Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays
Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel
2006-01-01
Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921
SPLICEFINDER – A Fast and Easy Screening Method for Active Protein Trans-Splicing Positions
Eppmann, Simone; Busche, Alena; Dikovskaya, Dina; Dötsch, Volker; Mootz, Henning D.
2013-01-01
Split intein enabled protein trans-splicing (PTS) is a powerful method for the ligation of two protein fragments, thereby paving the way for various protein modification or protein function control applications. PTS activity is strongly influenced by the amino acids directly flanking the splice junctions. However, to date no reliable prediction can be made whether or not a split intein is active in a particular foreign extein context. Here we describe SPLICEFINDER, a PCR-based method, allowing fast and easy screening for active split intein insertions in any target protein. Furthermore we demonstrate the applicability of SPLICEFINDER for segmental isotopic labeling as well as for the generation of multi-domain and enzymatically active proteins. PMID:24023792
Gatto, Alberto; Torroja-Fungairiño, Carlos; Mazzarotto, Francesco; Cook, Stuart A; Barton, Paul J R; Sánchez-Cabo, Fátima; Lara-Pezzi, Enrique
2014-04-01
Alternative splicing is the main mechanism governing protein diversity. The recent developments in RNA-Seq technology have enabled the study of the global impact and regulation of this biological process. However, the lack of standardized protocols constitutes a major bottleneck in the analysis of alternative splicing. This is particularly important for the identification of exon-exon junctions, which is a critical step in any analysis workflow. Here we performed a systematic benchmarking of alignment tools to dissect the impact of design and method on the mapping, detection and quantification of splice junctions from multi-exon reads. Accordingly, we devised a novel pipeline based on TopHat2 combined with a splice junction detection algorithm, which we have named FineSplice. FineSplice allows effective elimination of spurious junction hits arising from artefactual alignments, achieving up to 99% precision in both real and simulated data sets and yielding superior F1 scores under most tested conditions. The proposed strategy conjugates an efficient mapping solution with a semi-supervised anomaly detection scheme to filter out false positives and allows reliable estimation of expressed junctions from the alignment output. Ultimately this provides more accurate information to identify meaningful splicing patterns. FineSplice is freely available at https://sourceforge.net/p/finesplice/.
PASTA: splice junction identification from RNA-Sequencing data
2013-01-01
Background Next generation transcriptome sequencing (RNA-Seq) is emerging as a powerful experimental tool for the study of alternative splicing and its regulation, but requires ad-hoc analysis methods and tools. PASTA (Patterned Alignments for Splicing and Transcriptome Analysis) is a splice junction detection algorithm specifically designed for RNA-Seq data, relying on a highly accurate alignment strategy and on a combination of heuristic and statistical methods to identify exon-intron junctions with high accuracy. Results Comparisons against TopHat and other splice junction prediction software on real and simulated datasets show that PASTA exhibits high specificity and sensitivity, especially at lower coverage levels. Moreover, PASTA is highly configurable and flexible, and can therefore be applied in a wide range of analysis scenarios: it is able to handle both single-end and paired-end reads, it does not rely on the presence of canonical splicing signals, and it uses organism-specific regression models to accurately identify junctions. Conclusions PASTA is a highly efficient and sensitive tool to identify splicing junctions from RNA-Seq data. Compared to similar programs, it has the ability to identify a higher number of real splicing junctions, and provides highly annotated output files containing detailed information about their location and characteristics. Accurate junction data in turn facilitates the reconstruction of the splicing isoforms and the analysis of their expression levels, which will be performed by the remaining modules of the PASTA pipeline, still under development. Use of PASTA can therefore enable the large-scale investigation of transcription and alternative splicing. PMID:23557086
Mechanism of protein splicing of the Pyrococcus abyssi lon protease intein
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Brien, Kevin M.; Schufreider, Ann K.; McGill, Melissa A.
2010-12-17
Research highlights: {yields} The Pyrococcus abyssi lon protease intein promotes efficient protein splicing. {yields} Inteins with mutations that interfere with individual steps of splicing do not promote unproductive side reactions. {yields} The intein splices with Lys in place of the highly conserved penultimate His. {yields} The intein is flanked by a Gly-rich region at its C terminus that may increase the efficiency of the third step of splicing, Asn cyclization coupled to peptide bond cleavage. -- Abstract: Protein splicing is a post-translational process by which an intervening polypeptide, the intein, excises itself from the flanking polypeptides, the exteins, coupled tomore » ligation of the exteins. The lon protease of Pyrococcus abyssi (Pab) is interrupted by an intein. When over-expressed as a fusion protein in Escherichia coli, the Pab lon protease intein can promote efficient protein splicing. Mutations that block individual steps of splicing generally do not lead to unproductive side reactions, suggesting that the intein tightly coordinates the splicing process. The intein can splice, although it has Lys in place of the highly conserved penultimate His, and mutants of the intein in the C-terminal region lead to the accumulation of stable branched-ester intermediate.« less
2013-01-01
Background The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. Results We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Conclusions Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools. PMID:24209455
Sturgill, David; Malone, John H; Sun, Xia; Smith, Harold E; Rabinow, Leonard; Samson, Marie-Laure; Oliver, Brian
2013-11-09
The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools.
PathwaySplice: An R package for unbiased pathway analysis of alternative splicing in RNA-Seq data.
Yan, Aimin; Ban, Yuguang; Gao, Zhen; Chen, Xi; Wang, Lily
2018-04-24
Pathway analysis of alternative splicing would be biased without accounting for the different number of exons or junctions associated with each gene, because genes with higher number of exons or junctions are more likely to be included in the "significant" gene list in alternative splicing. We present PathwaySplice, an R package that (1) Performs pathway analysis that explicitly adjusts for the number of exons or junctions associated with each gene; (2) Visualizes selection bias due to different number of exons or junctions for each gene and formally tests for presence of bias using logistic regression; (3) Supports gene sets based on the Gene Ontology terms, as well as more broadly defined gene sets (e.g. MSigDB) or user defined gene sets; (4) Identifies the significant genes driving pathway significance and (5) Organizes significant pathways with an enrichment map, where pathways with large number of overlapping genes are grouped together in a network graph. https://bioconductor.org/packages/release/bioc/html/PathwaySplice.html. lily.wangg@gmail.com, xi.steven.chen@gmail.com.
Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays.
Johnson, Jason M; Castle, John; Garrett-Engele, Philip; Kan, Zhengyan; Loerch, Patrick M; Armour, Christopher D; Santos, Ralph; Schadt, Eric E; Stoughton, Roland; Shoemaker, Daniel D
2003-12-19
Alternative pre-messenger RNA (pre-mRNA) splicing plays important roles in development, physiology, and disease, and more than half of human genes are alternatively spliced. To understand the biological roles and regulation of alternative splicing across different tissues and stages of development, systematic methods are needed. Here, we demonstrate the use of microarrays to monitor splicing at every exon-exon junction in more than 10,000 multi-exon human genes in 52 tissues and cell lines. These genome-wide data provide experimental evidence and tissue distributions for thousands of known and novel alternative splicing events. Adding to previous studies, the results indicate that at least 74% of human multi-exon genes are alternatively spliced.
Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai
2012-02-15
RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
TopHat: discovering splice junctions with RNA-Seq
Trapnell, Cole; Pachter, Lior; Salzberg, Steven L.
2009-01-01
Motivation: A new protocol for sequencing the messenger RNA in a cell, known as RNA-Seq, generates millions of short sequence fragments in a single run. These fragments, or ‘reads’, can be used to measure levels of gene expression and to identify novel splice variants of genes. However, current software for aligning RNA-Seq data to a genome relies on known splice junctions and cannot identify novel ones. TopHat is an efficient read-mapping algorithm designed to align reads from an RNA-Seq experiment to a reference genome without relying on known splice sites. Results: We mapped the RNA-Seq reads from a recent mammalian RNA-Seq experiment and recovered more than 72% of the splice junctions reported by the annotation-based software from that study, along with nearly 20 000 previously unreported junctions. The TopHat pipeline is much faster than previous systems, mapping nearly 2.2 million reads per CPU hour, which is sufficient to process an entire RNA-Seq experiment in less than a day on a standard desktop computer. We describe several challenges unique to ab initio splice site discovery from RNA-Seq reads that will require further algorithm development. Availability: TopHat is free, open-source software available from http://tophat.cbcb.umd.edu Contact: cole@cs.umd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19289445
Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A. C.; Ning, Zemin; Slagboom, P. Eline; Ye, Kai
2012-01-01
Motivation: RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon–exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. Results: We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ∼ 137 000 and 173 000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. Availability: The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion Contact: y.zhang@lumc.nl; k.ye@lumc.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22219203
Mo, Fan; Hong, Xu; Gao, Feng; Du, Lin; Wang, Jun; Omenn, Gilbert S; Lin, Biaoyang
2008-12-16
Alternative splicing is an important gene regulation mechanism. It is estimated that about 74% of multi-exon human genes have alternative splicing. High throughput tandem (MS/MS) mass spectrometry provides valuable information for rapidly identifying potentially novel alternatively-spliced protein products from experimental datasets. However, the ability to identify alternative splicing events through tandem mass spectrometry depends on the database against which the spectra are searched. We wrote scripts in perl, Bioperl, mysql and Ensembl API and built a theoretical exon-exon junction protein database to account for all possible combinations of exons for a gene while keeping the frame of translation (i.e., keeping only in-phase exon-exon combinations) from the Ensembl Core Database. Using our liver cancer MS/MS dataset, we identified a total of 488 non-redundant peptides that represent putative exon skipping events. Our exon-exon junction database provides the scientific community with an efficient means to identify novel alternatively spliced (exon skipping) protein isoforms using mass spectrometry data. This database will be useful in annotating genome structures using rapidly accumulating proteomics data.
Splicing regulation and dysregulation of cholinergic genes expressed at the neuromuscular junction.
Ohno, Kinji; Rahman, Mohammad Alinoor; Nazim, Mohammad; Nasrin, Farhana; Lin, Yingni; Takeda, Jun-Ichi; Masuda, Akio
2017-08-01
We humans have evolved by acquiring diversity of alternative RNA metabolisms including alternative means of splicing and transcribing non-coding genes, and not by acquiring new coding genes. Tissue-specific and developmental stage-specific alternative RNA splicing is achieved by tightly regulated spatiotemporal regulation of expressions and activations of RNA-binding proteins that recognize their cognate splicing cis-elements on nascent RNA transcripts. Genes expressed at the neuromuscular junction are also alternatively spliced. In addition, germline mutations provoke aberrant splicing by compromising binding of RNA-binding proteins, and cause congenital myasthenic syndromes (CMS). We present physiological splicing mechanisms of genes for agrin (AGRN), acetylcholinesterase (ACHE), MuSK (MUSK), acetylcholine receptor (AChR) α1 subunit (CHRNA1), and collagen Q (COLQ) in human, and their aberration in diseases. Splicing isoforms of AChE T , AChE H , and AChE R are generated by hnRNP H/F. Skipping of MUSK exon 10 makes a Wnt-insensitive MuSK isoform, which is unique to human. Skipping of exon 10 is achieved by coordinated binding of hnRNP C, YB-1, and hnRNP L to exon 10. Exon P3A of CHRNA1 is alternatively included to generate a non-functional AChR α1 subunit in human. Molecular dissection of splicing mutations in patients with CMS reveals that exon P3A is alternatively skipped by hnRNP H, polypyrimidine tract-binding protein 1, and hnRNP L. Similarly, analysis of an exonic mutation in COLQ exon 16 in a CMS patient discloses that constitutive splicing of exon 16 requires binding of serine arginine-rich splicing factor 1. Intronic and exonic splicing mutations in CMS enable us to dissect molecular mechanisms underlying alternative and constitutive splicing of genes expressed at the neuromuscular junction. This is an article for the special issue XVth International Symposium on Cholinergic Mechanisms. © 2017 International Society for Neurochemistry.
Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons
Gelfman, Sahar; Burstein, David; Penn, Osnat; Savchenko, Anna; Amit, Maayan; Schwartz, Schraga; Pupko, Tal; Ast, Gil
2012-01-01
Exon–intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon–intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstructed the ancestral motifs of both 3′ and 5′ splice sites, as also the ancestral length of exons and introns. Our analyses suggest that vertebrate introns increased in length from the shortest ancestral introns to the longest primate introns. An evolutionary analysis of splice sites revealed that weak splice sites act as a restrictive force keeping introns short. In contrast, strong splice sites allow recognition of exons flanked by long introns. Reconstruction of the ancestral state suggests these phenomena were not prevalent in the vertebrate ancestor, but appeared during vertebrate evolution. By calculating evolutionary rate shifts in exons, we identified cis-acting regulatory sequences that became fixed during the transition from early vertebrates to mammals. Experimental validations performed on a selection of these hexamers confirmed their regulatory function. We additionally revealed many features of exons that can discriminate alternative from constitutive exons. These features were integrated into a machine-learning approach to predict whether an exon is alternative. Our algorithm obtains very high predictive power (AUC of 0.91), and using these predictions we have identified and successfully validated novel alternatively spliced exons. Overall, we provide novel insights regarding the evolutionary constraints acting upon exons and their recognition by the splicing machinery. PMID:21974994
Yeoh, Lee M.; Goodman, Christopher D.; Hall, Nathan E.; van Dooren, Giel G.; McFadden, Geoffrey I.; Ralph, Stuart A.
2015-01-01
Single genes are often subject to alternative splicing, which generates alternative mature mRNAs. This phenomenon is widespread in animals, and observed in over 90% of human genes. Recent data suggest it may also be common in Apicomplexa. These parasites have small genomes, and economy of DNA is evolutionarily favoured in this phylum. We investigated the mechanism of alternative splicing in Toxoplasma gondii, and have identified and localized TgSR3, a homologue of ASF/SF2 (alternative-splicing factor/splicing factor 2, a serine-arginine–rich, or SR protein) to a subnuclear compartment. In addition, we conditionally overexpressed this protein, which was deleterious to growth. qRT-PCR was used to confirm perturbation of splicing in a known alternatively-spliced gene. We performed high-throughput RNA-seq to determine the extent of splicing modulated by this protein. Current RNA-seq algorithms are poorly suited to compact parasite genomes, and hence we complemented existing tools by writing a new program, GeneGuillotine, that addresses this deficiency by segregating overlapping reads into distinct genes. In order to identify the extent of alternative splicing, we released another program, JunctionJuror, that detects changes in intron junctions. Using this program, we identified about 2000 genes that were constitutively alternatively spliced in T. gondii. Overexpressing the splice regulator TgSR3 perturbed alternative splicing in over 1000 genes. PMID:25870410
Barik, Sailen
2008-01-01
The significance of the intron-exon structure of genes is a mystery. As eukaryotic proteins are made up of modular functional domains, each exon was suspected to encode some form of module; however, the definition of a module remained vague. Comparison of pre-mRNA splice junctions with the three-dimensional architecture of its protein product from different eukaryotes revealed that the junctions were far less likely to occur inside the α-helices and β-strands of proteins than within the more flexible linker regions (‘turns’ and ‘loops’) connecting them. The splice junctions were equally distributed in the different types of linkers and throughout the linker sequence, although a slight preference for the central region of the linker was observed. The avoidance of the α-helix and the β-strand by splice junctions suggests the existence of a selection pressure against their disruption, perhaps underscoring the investment made by nature in building these intricate secondary structures. A corollary is that the helix and the strand are the smallest integral architectural units of a protein and represent the minimal modules in the evolution of protein structure. These results should find use in comparative genomics, designing of cloning strategies, and in the mutual verification of genome sequences with protein structures. PMID:15381847
Barik, Sailen
2004-09-01
The significance of the intron-exon structure of genes is a mystery. As eukaryotic proteins are made up of modular functional domains, each exon was suspected to encode some form of module; however, the definition of a module remained vague. Comparison of pre-mRNA splice junctions with the three-dimensional architecture of its protein product from different eukaryotes revealed that the junctions were far less likely to occur inside the alpha-helices and beta-strands of proteins than within the more flexible linker regions ('turns' and 'loops') connecting them. The splice junctions were equally distributed in the different types of linkers and throughout the linker sequence, although a slight preference for the central region of the linker was observed. The avoidance of the alpha-helix and the beta-strand by splice junctions suggests the existence of a selection pressure against their disruption, perhaps underscoring the investment made by nature in building these intricate secondary structures. A corollary is that the helix and the strand are the smallest integral architectural units of a protein and represent the minimal modules in the evolution of protein structure. These results should find use in comparative genomics, designing of cloning strategies, and in the mutual verification of genome sequences with protein structures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun
1996-08-01
The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less
ABMapper: a suffix array-based tool for multi-location searching and splice-junction mapping.
Lou, Shao-Ke; Ni, Bing; Lo, Leung-Yau; Tsui, Stephen Kwok-Wing; Chan, Ting-Fung; Leung, Kwong-Sak
2011-02-01
Sequencing reads generated by RNA-sequencing (RNA-seq) must first be mapped back to the genome through alignment before they can be further analyzed. Current fast and memory-saving short-read mappers could give us a quick view of the transcriptome. However, they are neither designed for reads that span across splice junctions nor for repetitive reads, which can be mapped to multiple locations in the genome (multi-reads). Here, we describe a new software package: ABMapper, which is specifically designed for exploring all putative locations of reads that are mapped to splice junctions or repetitive in nature. The software is freely available at: http://abmapper.sourceforge.net/. The software is written in C++ and PERL. It runs on all major platforms and operating systems including Windows, Mac OS X and LINUX.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, S.I.; Wirth, D.F.
1988-06-01
The 5' ends of Leishmania mRNAs contain an identical 35-nucleotide sequence termed the spliced leader (SL) or 5' mini-exon. The SL sequence is at the 5' end of an 85-nucleotide primary transcript that contains a consensus eucaryotic 5' intron-exon splice junction immediately 3' to the SL. The SL is added to protein-coding genes immediately 3' to a consensus eucaryotic 3' intron-exon splice junction. The authors' previous work demonstrated possible intermediates in discontinuous mRNA processing that contain the 50 nucleotides of the SL primary transcript 3' to the SL, the SL intron sequence (SLIS). These RNAs have a 5' terminus atmore » the splice junction of the SL and the SLIS. The authors examined a Leishmania nuclear extract for these RNAs in ribonucleoprotein (RNP) particles. Density centrifugation analysis showed that the SL RNA is predominately in RNP complexes at 60S, while the SLIS-containing RNAs are in complexes at 40S. They also demonstrated that the SLIS can be released from polyadenylated RNA by incubation with a HeLa cell extract containing debranching enzymatic activity. These data suggested that Leishmania enriettii mRNAs are assembled by bimolecular or trans splicing as has been recently demonstrated for Trypanosoma brucei. Furthermore, they determined the partial sequence of the Leishmania U2 equivalent RNA and demonstrated that it cosediments with the SL RNA at 60S in a nuclear extract. These RNP particles may be analogous to so-called spliceosomes that have been demonstrated in other systems.« less
Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine
2014-12-12
Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.
Spliced RNA of woodchuck hepatitis virus.
Ogston, C W; Razman, D G
1992-07-01
Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.
Alternative splicing regulated by butyrate in bovine epithelial cells.
Wu, Sitao; Li, Congjun; Huang, Wen; Li, Weizhong; Li, Robert W
2012-01-01
As a signaling molecule and an inhibitor of histone deacetylases (HDACs), butyrate exerts its impact on a broad range of biological processes, such as apoptosis and cell proliferation, in addition to its critical role in energy metabolism in ruminants. This study examined the effect of butyrate on alternative splicing in bovine epithelial cells using RNA-seq technology. Junction reads account for 11.28 and 12.32% of total mapped reads between the butyrate-treated (BT) and control (CT) groups. 201,326 potential splicing junctions detected were supported by ≥ 3 junction reads. Approximately 94% of these junctions conformed to the consensus sequence (GT/AG) while ~3% were GC/AG junctions. No AT/AC junctions were observed. A total of 2,834 exon skipping events, supported by a minimum of 3 junction reads, were detected. At least 7 genes, their mRNA expression significantly affected by butyrate, also had exon skipping events differentially regulated by butyrate. Furthermore, COL5A3, which was induced 310-fold by butyrate (FDR <0.001) at the gene level, had a significantly higher number of junction reads mapped to Exon#8 (Donor) and Exon#11 (Acceptor) in BT. This event had the potential to result in the formation of a COL5A3 mRNA isoform with 2 of the 69 exons missing. In addition, 216 differentially expressed transcript isoforms regulated by butyrate were detected. For example, Isoform 1 of ORC1 was strongly repressed by butyrate while Isoform 2 remained unchanged. Butyrate physically binds to and inhibits all zinc-dependent HDACs except HDAC6 and HDAC10. Our results provided evidence that butyrate also regulated deacetylase activities of classical HDACs via its transcriptional control. Moreover, thirteen gene fusion events differentially affected by butyrate were identified. Our results provided a snapshot into complex transcriptome dynamics regulated by butyrate, which will facilitate our understanding of the biological effects of butyrate and other HDAC inhibitors.
Is an observed non-co-linear RNA product spliced in trans, in cis or just in vitro?
Yu, Chun-Ying; Liu, Hsiao-Jung; Hung, Li-Yuan; Kuo, Hung-Chih; Chuang, Trees-Juen
2014-01-01
Global transcriptome investigations often result in the detection of an enormous number of transcripts composed of non-co-linear sequence fragments. Such ‘aberrant’ transcript products may arise from post-transcriptional events or genetic rearrangements, or may otherwise be false positives (sequencing/alignment errors or in vitro artifacts). Moreover, post-transcriptionally non-co-linear (‘PtNcl’) transcripts can arise from trans-splicing or back-splicing in cis (to generate so-called ‘circular RNA’). Here, we collected previously-predicted human non-co-linear RNA candidates, and designed a validation procedure integrating in silico filters with multiple experimental validation steps to examine their authenticity. We showed that >50% of the tested candidates were in vitro artifacts, even though some had been previously validated by RT-PCR. After excluding the possibility of genetic rearrangements, we distinguished between trans-spliced and circular RNAs, and confirmed that these two splicing forms can share the same non-co-linear junction. Importantly, the experimentally-confirmed PtNcl RNA events and their corresponding PtNcl splicing types (i.e. trans-splicing, circular RNA, or both sharing the same junction) were all expressed in rhesus macaque, and some were even expressed in mouse. Our study thus describes an essential procedure for confirming PtNcl transcripts, and provides further insight into the evolutionary role of PtNcl RNA events, opening up this important, but understudied, class of post-transcriptional events for comprehensive characterization. PMID:25053845
Circular RNA biogenesis can proceed through an exon-containing lariat precursor.
Barrett, Steven P; Wang, Peter L; Salzman, Julia
2015-06-09
Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical 'backsplicing' event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in Schizosaccharomyces pombe is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure.
Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions
Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun
2017-01-01
Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093
Snaptron: querying splicing patterns across tens of thousands of RNA-seq samples
Wilks, Christopher; Gaddipati, Phani; Nellore, Abhinav
2018-01-01
Abstract Motivation As more and larger genomics studies appear, there is a growing need for comprehensive and queryable cross-study summaries. These enable researchers to leverage vast datasets that would otherwise be difficult to obtain. Results Snaptron is a search engine for summarized RNA sequencing data with a query planner that leverages R-tree, B-tree and inverted indexing strategies to rapidly execute queries over 146 million exon-exon splice junctions from over 70 000 human RNA-seq samples. Queries can be tailored by constraining which junctions and samples to consider. Snaptron can score junctions according to tissue specificity or other criteria, and can score samples according to the relative frequency of different splicing patterns. We describe the software and outline biological questions that can be explored with Snaptron queries. Availability and implementation Documentation is at http://snaptron.cs.jhu.edu. Source code is at https://github.com/ChristopherWilks/snaptron and https://github.com/ChristopherWilks/snaptron-experiments with a CC BY-NC 4.0 license. Contact chris.wilks@jhu.edu or langmea@cs.jhu.edu Supplementary information Supplementary data are available at Bioinformatics online. PMID:28968689
Snaptron: querying splicing patterns across tens of thousands of RNA-seq samples.
Wilks, Christopher; Gaddipati, Phani; Nellore, Abhinav; Langmead, Ben
2018-01-01
As more and larger genomics studies appear, there is a growing need for comprehensive and queryable cross-study summaries. These enable researchers to leverage vast datasets that would otherwise be difficult to obtain. Snaptron is a search engine for summarized RNA sequencing data with a query planner that leverages R-tree, B-tree and inverted indexing strategies to rapidly execute queries over 146 million exon-exon splice junctions from over 70 000 human RNA-seq samples. Queries can be tailored by constraining which junctions and samples to consider. Snaptron can score junctions according to tissue specificity or other criteria, and can score samples according to the relative frequency of different splicing patterns. We describe the software and outline biological questions that can be explored with Snaptron queries. Documentation is at http://snaptron.cs.jhu.edu. Source code is at https://github.com/ChristopherWilks/snaptron and https://github.com/ChristopherWilks/snaptron-experiments with a CC BY-NC 4.0 license. chris.wilks@jhu.edu or langmea@cs.jhu.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Martínez-Montiel, Nancy; Rosas-Murrieta, Nora Hilda; Martínez-Montiel, Mónica; Gaspariano-Cholula, Mayra Patricia; Martínez-Contreras, Rebeca D
2016-01-01
In eukaryotes, genes are frequently interrupted with noncoding sequences named introns. Alternative splicing is a nuclear mechanism by which these introns are removed and flanking coding regions named exons are joined together to generate a message that will be translated in the cytoplasm. This mechanism is catalyzed by a complex machinery known as the spliceosome, which is conformed by more than 300 proteins and ribonucleoproteins that activate and regulate the precision of gene expression when assembled. It has been proposed that several genetic diseases are related to defects in the splicing process, including cancer. For this reason, natural products that show the ability to regulate splicing have attracted enormous attention due to its potential use for cancer treatment. Some microbial metabolites have shown the ability to inhibit gene splicing and the molecular mechanism responsible for this inhibition is being studied for future applications. Here, we summarize the main types of natural products that have been characterized as splicing inhibitors, the recent advances regarding molecular and cellular effects related to these molecules, and the applications reported so far in cancer therapeutics.
Rogan, P K; Schneider, T D
1995-01-01
Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.
Mayr, B; Reifinger, M; Alton, K; Schaffner, G
1998-06-01
Twenty feline neoplasms were sequenced in the region from exons 5 to 8 for the presence of tumour suppressor gene p53 mutations. In a spindle cell sarcoma of the bladder, a missense mutation (codon 164 AAG-->GAG, lysine-->glutamic acid) in exon 5 was detected. In a pleomorphic sarcoma, a 23 bp deletion involving the splicing junction between intron 5 and exon 6 was observed. In a fibrosarcoma, a 6 bp deletion of p53 covering 2 bp of exon 7 and 4 bp of intron 7, including the splicing junction, was found. The study demonstrates three new p53 mutations in different types of sarcomas in cats.
Sun, Xiaoyong; Wang, Lin; Ding, Jiechao; Wang, Yanru; Wang, Jiansheng; Zhang, Xiaoyang; Che, Yulei; Liu, Ziwei; Zhang, Xinran; Ye, Jiazhen; Wang, Jie; Sablok, Gaurav; Deng, Zhiping; Zhao, Hongwei
2016-10-01
A new regulatory class of small endogenous RNAs called circular RNAs (circRNAs) has been described as miRNA sponges in animals. Using 16 Arabidopsis thaliana RNA-Seq data sets, we identified 803 circRNAs in RNase R-/non-RNase R-treated samples. The results revealed the following features: Canonical and noncanonical splicing can generate circRNAs; chloroplasts are a hotspot for circRNA generation; furthermore, limited complementary sequences exist not only in introns, but also in the sequences flanking splice sites. The latter finding suggests that multiple combinations between complementary sequences may facilitate the formation of the circular structure. Our results contribute to a better understanding of this novel class of plant circRNAs. © 2016 Federation of European Biochemical Societies.
Sharma, Neeraj; Sosnay, Patrick R.; Ramalho, Anabela S.; Douville, Christopher; Franca, Arianna; Gottschalk, Laura B.; Park, Jeenah; Lee, Melissa; Vecchio-Pagan, Briana; Raraigh, Karen S.; Amaral, Margarida D.; Karchin, Rachel; Cutting, Garry R.
2015-01-01
Assessment of the functional consequences of variants near splice sites is a major challenge in the diagnostic laboratory. To address this issue, we created expression minigenes (EMGs) to determine the RNA and protein products generated by splice site variants (n = 10) implicated in cystic fibrosis (CF). Experimental results were compared with the splicing predictions of eight in silico tools. EMGs containing the full-length Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) coding sequence and flanking intron sequences generated wild-type transcript and fully processed protein in Human Embryonic Kidney (HEK293) and CF bronchial epithelial (CFBE41o-) cells. Quantification of variant induced aberrant mRNA isoforms was concordant using fragment analysis and pyrosequencing. The splicing patterns of c.1585−1G>A and c.2657+5G>A were comparable to those reported in primary cells from individuals bearing these variants. Bioinformatics predictions were consistent with experimental results for 9/10 variants (MES), 8/10 variants (NNSplice), and 7/10 variants (SSAT and Sroogle). Programs that estimate the consequences of mis-splicing predicted 11/16 (HSF and ASSEDA) and 10/16 (Fsplice and SplicePort) experimentally observed mRNA isoforms. EMGs provide a robust experimental approach for clinical interpretation of splice site variants and refinement of in silico tools. PMID:25066652
USDA-ARS?s Scientific Manuscript database
RNA splicing is crucial to the production of mature messenger RNAs (mRNA). The protein Arginine/Serine-rich 45 (SR45) acts as an RNA splicing activator and initiates the spliceosome assembly. It is also a peripheral component of the exon-exon junction complex, which assures the quality and availabil...
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M
2003-01-01
Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.
Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M
2003-01-01
Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing. PMID:14519201
Circular RNA biogenesis can proceed through an exon-containing lariat precursor
Barrett, Steven P; Wang, Peter L; Salzman, Julia
2015-01-01
Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical ‘backsplicing’ event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in Schizosaccharomyces pombe is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure. DOI: http://dx.doi.org/10.7554/eLife.07540.001 PMID:26057830
Perispeckles are major assembly sites for the exon junction core complex
Daguenet, Elisabeth; Baguet, Aurélie; Degot, Sébastien; Schmidt, Ute; Alpy, Fabien; Wendling, Corinne; Spiegelhalter, Coralie; Kessler, Pascal; Rio, Marie-Christine; Le Hir, Hervé; Bertrand, Edouard; Tomasetto, Catherine
2012-01-01
The exon junction complex (EJC) is loaded onto mRNAs as a consequence of splicing and regulates multiple posttranscriptional events. MLN51, Magoh, Y14, and eIF4A3 form a highly stable EJC core, but where this tetrameric complex is assembled in the cell remains unclear. Here we show that EJC factors are enriched in domains that we term perispeckles and are visible as doughnuts around nuclear speckles. Fluorescence resonance energy transfer analyses and EJC assembly mutants show that perispeckles do not store free subunits, but instead are enriched for assembled cores. At the ultrastructural level, perispeckles are distinct from interchromatin granule clusters that may function as storage sites for splicing factors and intermingle with perichromatin fibrils, where nascent RNAs and active RNA Pol II are present. These results support a model in which perispeckles are major assembly sites for the tetrameric EJC core. This subnuclear territory thus represents an intermediate region important for mRNA maturation, between transcription sites and splicing factor reservoirs and assembly sites. PMID:22419818
Sadek, Jouliana
2016-01-01
ABSTRACT During lytic herpes simplex virus (HSV) infections, the virion host shutoff (Vhs) (UL41) endoribonuclease degrades many cellular and viral mRNAs. In uninfected cells, spliced mRNAs emerge into the cytoplasm bound by exon junction complexes (EJCs) and are translated several times more efficiently than unspliced mRNAs that have the same sequence but lack EJCs. Notably, most cellular mRNAs are spliced, whereas most HSV mRNAs are not. To examine the effect of splicing on gene expression during HSV infection, cells were transfected with plasmids harboring an unspliced renilla luciferase (RLuc) reporter mRNA or RLuc constructs with introns near the 5′ or 3′ end of the gene. After splicing of intron-containing transcripts, all three RLuc mRNAs had the same primary sequence. Upon infection in the presence of actinomycin D, spliced mRNAs were much less sensitive to degradation by copies of Vhs from infecting virions than were unspliced mRNAs. During productive infections (in the absence of drugs), RLuc was expressed at substantially higher levels from spliced than from unspliced mRNAs. Interestingly, the stimulatory effect of splicing on RLuc expression was significantly greater in infected than in uninfected cells. The translational stimulatory effect of an intron during HSV-1 infections could be replicated by artificially tethering various EJC components to an unspliced RLuc transcript. Thus, the splicing history of an mRNA, and the consequent presence or absence of EJCs, affects its level of translation and sensitivity to Vhs cleavage during lytic HSV infections. IMPORTANCE Most mammalian mRNAs are spliced. In contrast, of the more than 80 mRNAs harbored by herpes simplex virus 1 (HSV-1), only 5 are spliced. In addition, synthesis of the immediate early protein ICP27 causes partial inhibition of pre-mRNA splicing, with the resultant accumulation of both spliced and unspliced versions of some mRNAs in the cytoplasm. A common perception is that HSV-1 infection necessarily inhibits the expression of spliced mRNAs. In contrast, this study demonstrates two instances in which pre-mRNA splicing actually enhances the synthesis of proteins from mRNAs during HSV-1 infections. Specifically, splicing stabilized an mRNA against degradation by copies of the Vhs endoribonuclease from infecting virions and greatly enhanced the amount of protein synthesized from spliced mRNAs at late times after infection. The data suggest that splicing, and the resultant presence of exon junction complexes on an mRNA, may play an important role in gene expression during HSV-1 infections. PMID:27681125
iCLIP Predicts the Dual Splicing Effects of TIA-RNA Interactions
Briese, Michael; Zarnack, Kathi; Luscombe, Nicholas M.; Rot, Gregor; Zupan, Blaž; Curk, Tomaž; Ule, Jernej
2010-01-01
The regulation of alternative splicing involves interactions between RNA-binding proteins and pre-mRNA positions close to the splice sites. T-cell intracellular antigen 1 (TIA1) and TIA1-like 1 (TIAL1) locally enhance exon inclusion by recruiting U1 snRNP to 5′ splice sites. However, effects of TIA proteins on splicing of distal exons have not yet been explored. We used UV-crosslinking and immunoprecipitation (iCLIP) to find that TIA1 and TIAL1 bind at the same positions on human RNAs. Binding downstream of 5′ splice sites was used to predict the effects of TIA proteins in enhancing inclusion of proximal exons and silencing inclusion of distal exons. The predictions were validated in an unbiased manner using splice-junction microarrays, RT-PCR, and minigene constructs, which showed that TIA proteins maintain splicing fidelity and regulate alternative splicing by binding exclusively downstream of 5′ splice sites. Surprisingly, TIA binding at 5′ splice sites silenced distal cassette and variable-length exons without binding in proximity to the regulated alternative 3′ splice sites. Using transcriptome-wide high-resolution mapping of TIA-RNA interactions we evaluated the distal splicing effects of TIA proteins. These data are consistent with a model where TIA proteins shorten the time available for definition of an alternative exon by enhancing recognition of the preceding 5′ splice site. Thus, our findings indicate that changes in splicing kinetics could mediate the distal regulation of alternative splicing. PMID:21048981
Alternative Splicing of STAT3 Is Affected by RNA Editing.
Goldberg, Lior; Abutbul-Amitai, Mor; Paret, Gideon; Nevo-Caspi, Yael
2017-05-01
A-to-I RNA editing, carried out by adenosine deaminase acting on RNA (ADAR) enzymes, is an epigenetic phenomenon of posttranscriptional modifications on pre-mRNA. RNA editing in intronic sequences may influence alternative splicing of flanking exons. We have previously shown that conditions that induce editing result in elevated expression of signal transducer and activator of transcription 3 (STAT3), preferentially the alternatively-spliced STAT3β isoform. Mechanisms regulating alternative splicing of STAT3 have not been elucidated. STAT3 undergoes A-to-I RNA editing in an intron residing in proximity to the alternatively spliced exon. We hypothesized that RNA editing plays a role in regulating alternative splicing toward STAT3β. In this study we extend our observation connecting RNA editing to the preferential induction of STAT3β expression. We study the involvement of ADAR1 in STAT3 editing and reveal the connection between editing and alternative splicing of STAT3. Deferoaxamine treatment caused the induction in STAT3 RNA editing and STAT3β expression. Silencing ADAR1 caused a decrease in STAT3 editing and expression with a preferential decrease in STAT3β. Cells transfected with a mutated minigene showed preferential splicing toward the STAT3β transcript. Editing in the STAT3 intron is performed by ADAR1 and affects STAT3 alternative splicing. These results suggest that RNA editing is one of the molecular mechanisms regulating the expression of STAT3β.
Kramer, Marianne C.; Liang, Dongming; Tatomer, Deirdre C.; Gold, Beth; March, Zachary M.; Cherry, Sara; Wilusz, Jeremy E.
2015-01-01
Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3′ end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine–arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. PMID:26450910
Gene organization and alternative splicing of human prohormone convertase PC8.
Goodge, K A; Thomas, R J; Martin, T J; Gillespie, M T
1998-01-01
The mammalian Ca2+-dependent serine protease prohormone convertase PC8 is expressed ubiquitously, being transcribed as 3.5, 4.3 and 6.0 kb mRNA isoforms in various tissues. To determine the origin of these various mRNA isoforms we report the characterization of the human PC8 gene, which has been previously localized to chromosome 11q23-24. Consisting of 16 exons, the human PC8 gene spans approx. 27 kb. A comparison of the position of intron-exon junctions of the human PC8 gene with the gene structures of previously reported prohormone convertase genes demonstrated a divergence of the human PC8 from the highly conserved nature of the gene organization of this enzyme family. The nucleotide sequence of the 5'-flanking region of the human PC8 is reported and possesses putative promoter elements characteristic of a GC-rich promoter. Further supporting the potential role of a GC-rich promoter element, multiple transcriptional initiation sites within a 200 bp region were demonstrated. We propose that the various mRNA isoforms of PC8 result from the inclusion of intronic sequences within transcripts. PMID:9820811
Argyropoulos, G; Brown, A M; Willi, S M; Zhu, J; He, Y; Reitman, M; Gevao, S M; Spruill, I; Garvey, W T
1998-01-01
Human uncoupling protein 3 (UCP3) is a mitochondrial transmembrane carrier that uncouples oxidative ATP phosphorylation. With the capacity to participate in thermogenesis and energy balance, UCP3 is an important obesity candidate gene. A missense polymorphism in exon 3 (V102I) was identified in an obese and diabetic proband. A mutation introducing a stop codon in exon 4 (R143X) and a terminal polymorphism in the splice donor junction of exon 6 were also identified in a compound heterozygote that was morbidly obese and diabetic. Allele frequencies of the exon 3 and exon 6 splice junction polymorphisms were determined and found to be similar in Gullah-speaking African Americans and the Mende tribe of Sierra Leone, but absent in Caucasians. Moreover, in exon 6-splice donor heterozygotes, basal fat oxidation rates were reduced by 50%, and the respiratory quotient was markedly increased compared with wild-type individuals, implicating a role for UCP3 in metabolic fuel partitioning. PMID:9769326
SplicingTypesAnno: annotating and quantifying alternative splicing events for RNA-Seq data.
Sun, Xiaoyong; Zuo, Fenghua; Ru, Yuanbin; Guo, Jiqiang; Yan, Xiaoyan; Sablok, Gaurav
2015-04-01
Alternative splicing plays a key role in the regulation of the central dogma. Four major types of alternative splicing have been classified as intron retention, exon skipping, alternative 5 splice sites or alternative donor sites, and alternative 3 splice sites or alternative acceptor sites. A few algorithms have been developed to detect splice junctions from RNA-Seq reads. However, there are few tools targeting at the major alternative splicing types at the exon/intron level. This type of analysis may reveal subtle, yet important events of alternative splicing, and thus help gain deeper understanding of the mechanism of alternative splicing. This paper describes a user-friendly R package, extracting, annotating and analyzing alternative splicing types for sequence alignment files from RNA-Seq. SplicingTypesAnno can: (1) provide annotation for major alternative splicing at exon/intron level. By comparing the annotation from GTF/GFF file, it identifies the novel alternative splicing sites; (2) offer a convenient two-level analysis: genome-scale annotation for users with high performance computing environment, and gene-scale annotation for users with personal computers; (3) generate a user-friendly web report and additional BED files for IGV visualization. SplicingTypesAnno is a user-friendly R package for extracting, annotating and analyzing alternative splicing types at exon/intron level for sequence alignment files from RNA-Seq. It is publically available at https://sourceforge.net/projects/splicingtypes/files/ or http://genome.sdau.edu.cn/research/software/SplicingTypesAnno.html. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Systematic Analysis of Splice-Site-Creating Mutations in Cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jayasinghe, Reyka G.; Cao, Song; Gao, Qingsong
For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs) across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared tomore » missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Finally, our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases.« less
Systematic Analysis of Splice-Site-Creating Mutations in Cancer.
Jayasinghe, Reyka G; Cao, Song; Gao, Qingsong; Wendl, Michael C; Vo, Nam Sy; Reynolds, Sheila M; Zhao, Yanyan; Climente-González, Héctor; Chai, Shengjie; Wang, Fang; Varghese, Rajees; Huang, Mo; Liang, Wen-Wei; Wyczalkowski, Matthew A; Sengupta, Sohini; Li, Zhi; Payne, Samuel H; Fenyö, David; Miner, Jeffrey H; Walter, Matthew J; Vincent, Benjamin; Eyras, Eduardo; Chen, Ken; Shmulevich, Ilya; Chen, Feng; Ding, Li
2018-04-03
For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs) across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared to missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Systematic Analysis of Splice-Site-Creating Mutations in Cancer
Jayasinghe, Reyka G.; Cao, Song; Gao, Qingsong; ...
2018-04-05
For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs) across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared tomore » missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Finally, our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases.« less
Reflections on protein splicing: structures, functions and mechanisms
Anraku, Yasuhiro; Satow, Yoshinori
2009-01-01
Twenty years ago, evidence that one gene produces two enzymes via protein splicing emerged from structural and expression studies of the VMA1 gene in Saccharomyces cerevisiae. VMA1 consists of a single open reading frame and contains two independent genetic information for Vma1p (a catalytic 70-kDa subunit of the vacuolar H+-ATPase) and VDE (a 50-kDa DNA endonuclease) as an in-frame spliced insert in the gene. Protein splicing is a posttranslational cellular process, in which an intervening polypeptide termed as the VMA1 intein is self-catalytically excised out from a nascent 120-kDa VMA1 precursor and two flanking polypeptides of the N- and C-exteins are ligated to produce the mature Vma1p. Subsequent studies have demonstrated that protein splicing is not unique to the VMA1 precursor and there are many operons in nature, which implement genetic information editing at protein level. To elucidate its structure-directed chemical mechanisms, a series of biochemical and crystal structural studies has been carried out with the use of various VMA1 recombinants. This article summarizes a VDE-mediated self-catalytic mechanism for protein splicing that is triggered and terminated solely via thiazolidine intermediates with tetrahedral configurations formed within the splicing sites where proton ingress and egress are driven by balanced protonation and deprotonation. PMID:19907126
Garcia-Garcia, Elisa; Little, Jamie C; Kalderon, Daniel
2017-08-01
Hedgehog (Hh) regulates the Cubitus interruptus (Ci) transcription factor in Drosophila melanogaster by activating full-length Ci-155 and blocking processing to the Ci-75 repressor. However, the interplay between the regulation of Ci-155 levels and activity, as well as processing-independent mechanisms that affect Ci-155 levels, have not been explored extensively. Here, we identified Mago Nashi (Mago) and Y14 core Exon Junction Complex (EJC) proteins, as well as the Srp54 splicing factor, as modifiers of Hh pathway activity under sensitized conditions. Mago inhibition reduced Hh pathway activity by altering the splicing pattern of ci to reduce Ci-155 levels. Srp54 inhibition also affected pathway activity by reducing ci RNA levels but additionally altered Ci-155 levels and activity independently of ci splicing. Further tests using ci transgenes and ci mutations confirmed evidence from studying the effects of Mago and Srp54 that relatively small changes in the level of Ci-155 primary translation product alter Hh pathway activity under a variety of sensitized conditions. We additionally used ci transgenes lacking intron sequences or the presumed translation initiation codon for an alternatively spliced ci RNA to provide further evidence that Mago acts principally by modulating the levels of the major ci RNA encoding Ci-155, and to show that ci introns are necessary to support the production of sufficient Ci-155 for robust Hh signaling and may also be important mediators of regulatory inputs. Copyright © 2017 by the Genetics Society of America.
RNA structure in splicing: An evolutionary perspective.
Lin, Chien-Ling; Taggart, Allison J; Fairbrother, William G
2016-09-01
Pre-mRNA splicing is a key post-transcriptional regulation process in which introns are excised and exons are ligated together. A novel class of structured intron was recently discovered in fish. Simple expansions of complementary AC and GT dimers at opposite boundaries of an intron were found to form a bridging structure, thereby enforcing correct splice site pairing across the intron. In some fish introns, the RNA structures are strong enough to bypass the need of regulatory protein factors for splicing. Here, we discuss the prevalence and potential functions of highly structured introns. In humans, structured introns usually arise through the co-occurrence of C and G-rich repeats at intron boundaries. We explore the potentially instructive example of the HLA receptor genes. In HLA pre-mRNA, structured introns flank the exons that encode the highly polymorphic β sheet cleft, making the processing of the transcript robust to variants that disrupt splicing factor binding. While selective forces that have shaped HLA receptor are fairly atypical, numerous other highly polymorphic genes that encode receptors contain structured introns. Finally, we discuss how the elevated mutation rate associated with the simple repeats that often compose structured intron can make structured introns themselves rapidly evolving elements.
Horiuchi, Keiko; Perez-Cerezales, Serafín; Papasaikas, Panagiotis; Ramos-Ibeas, Priscila; López-Cardona, Angela Patricia; Laguna-Barraza, Ricardo; Fonseca Balvís, Noelia; Pericuesta, Eva; Fernández-González, Raul; Planells, Benjamín; Viera, Alberto; Suja, Jose Angel; Ross, Pablo Juan; Alén, Francisco; Orio, Laura; Rodriguez de Fonseca, Fernando; Pintado, Belén; Valcárcel, Juan; Gutiérrez-Adán, Alfonso
2018-04-03
The U2AF35-like ZRSR1 has been implicated in the recognition of 3' splice site during spliceosome assembly, but ZRSR1 knockout mice do not show abnormal phenotypes. To analyze ZRSR1 function and its precise role in RNA splicing, we generated ZRSR1 mutant mice containing truncating mutations within its RNA-recognition motif. Homozygous mutant mice exhibited severe defects in erythrocytes, muscle stretch, and spermatogenesis, along with germ cell sloughing and apoptosis, ultimately leading to azoospermia and male sterility. Testis RNA sequencing (RNA-seq) analyses revealed increased intron retention of both U2- and U12-type introns, including U12-type intron events in genes with key functions in spermatogenesis and spermatid development. Affected U2 introns were commonly found flanking U12 introns, suggesting functional cross-talk between the two spliceosomes. The splicing and tissue defects observed in mutant mice attributed to ZRSR1 loss of function suggest a physiological role for this factor in U12 intron splicing. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Pang, Chi Nam Ignatius; Tay, Aidan P; Aya, Carlos; Twine, Natalie A; Harkness, Linda; Hart-Smith, Gene; Chia, Samantha Z; Chen, Zhiliang; Deshpande, Nandan P; Kaakoush, Nadeem O; Mitchell, Hazel M; Kassem, Moustapha; Wilkins, Marc R
2014-01-03
Direct links between proteomic and genomic/transcriptomic data are not frequently made, partly because of lack of appropriate bioinformatics tools. To help address this, we have developed the PG Nexus pipeline. The PG Nexus allows users to covisualize peptides in the context of genomes or genomic contigs, along with RNA-seq reads. This is done in the Integrated Genome Viewer (IGV). A Results Analyzer reports the precise base position where LC-MS/MS-derived peptides cover genes or gene isoforms, on the chromosomes or contigs where this occurs. In prokaryotes, the PG Nexus pipeline facilitates the validation of genes, where annotation or gene prediction is available, or the discovery of genes using a "virtual protein"-based unbiased approach. We illustrate this with a comprehensive proteogenomics analysis of two strains of Campylobacter concisus . For higher eukaryotes, the PG Nexus facilitates gene validation and supports the identification of mRNA splice junction boundaries and splice variants that are protein-coding. This is illustrated with an analysis of splice junctions covered by human phosphopeptides, and other examples of relevance to the Chromosome-Centric Human Proteome Project. The PG Nexus is open-source and available from https://github.com/IntersectAustralia/ap11_Samifier. It has been integrated into Galaxy and made available in the Galaxy tool shed.
Kramer, Marianne C; Liang, Dongming; Tatomer, Deirdre C; Gold, Beth; March, Zachary M; Cherry, Sara; Wilusz, Jeremy E
2015-10-15
Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼ 400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3' end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine-arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. © 2015 Kramer et al.; Published by Cold Spring Harbor Laboratory Press.
Mochida, Ganeshwaran H.; Ganesh, Vijay S.; Felie, Jillian M.; Gleason, Danielle; Hill, R. Sean; Clapham, Katie Rose; Rakiec, Daniel; Tan, Wen-Hann; Akawi, Nadia; Al-Saffar, Muna; Partlow, Jennifer N.; Tinschert, Sigrid; Barkovich, A. James; Ali, Bassam; Al-Gazali, Lihadh; Walsh, Christopher A.
2010-01-01
The tight junction, or zonula occludens, is a specialized cell-cell junction that regulates epithelial and endothelial permeability, and it is an essential component of the blood-brain barrier in the cerebrovascular endothelium. In addition to functioning as a diffusion barrier, tight junctions are also involved in signal transduction. In this study, we identified a homozygous mutation in the tight-junction protein gene JAM3 in a large consanguineous family from the United Arab Emirates. Some members of this family had a rare autosomal-recessive syndrome characterized by severe hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Their clinical presentation overlaps with some reported cases of pseudo-TORCH syndrome as well as with cases involving mutations in occludin, another component of the tight-junction complex. However, massive intracranial hemorrhage distinguishes these patients from others. Homozygosity mapping identified the disease locus in this family on chromosome 11q25 with a maximum multipoint LOD score of 6.15. Sequence analysis of genes in the candidate interval uncovered a mutation in the canonical splice-donor site of intron 5 of JAM3. RT-PCR analysis of a patient lymphoblast cell line confirmed abnormal splicing, leading to a frameshift mutation with early termination. JAM3 is known to be present in vascular endothelium, although its roles in cerebral vasculature have not been implicated. Our results suggest that JAM3 is essential for maintaining the integrity of the cerebrovascular endothelium as well as for normal lens development in humans. PMID:21109224
Splicing of designer exons informs a biophysical model for exon definition
Arias, Mauricio A.; Chasin, Lawrence A.
2015-01-01
Pre-mRNA molecules in humans contain mostly short internal exons flanked by longer introns. To explain the removal of such introns, exon recognition instead of intron recognition has been proposed. We studied this exon definition using designer exons (DEs) made up of three prototype modules of our own design: an exonic splicing enhancer (ESE), an exonic splicing silencer (ESS), and a Reference Sequence (R) predicted to be neither. Each DE was examined as the central exon in a three-exon minigene. DEs made of R modules showed a sharp size dependence, with exons shorter than 14 nt and longer than 174 nt splicing poorly. Changing the strengths of the splice sites improved longer exon splicing but worsened shorter exon splicing, effectively displacing the curve to the right. For the ESE we found, unexpectedly, that its enhancement efficiency was independent of its position within the exon. For the ESS we found a step-wise positional increase in its effects; it was most effective at the 3′ end of the exon. To apply these results quantitatively, we developed a biophysical model for exon definition of internal exons undergoing cotranscriptional splicing. This model features commitment to inclusion before the downstream exon is synthesized and competition between skipping and inclusion fates afterward. Collision of both exon ends to form an exon definition complex was incorporated to account for the effect of size; ESE/ESS effects were modeled on the basis of stabilization/destabilization. This model accurately predicted the outcome of independent experiments on more complex DEs that combined ESEs and ESSs. PMID:25492963
TSVdb: a web-tool for TCGA splicing variants analysis.
Sun, Wenjie; Duan, Ting; Ye, Panmeng; Chen, Kelie; Zhang, Guanling; Lai, Maode; Zhang, Honghe
2018-05-29
Collaborative projects such as The Cancer Genome Atlas (TCGA) have generated various -omics and clinical data on cancer. Many computational tools have been developed to facilitate the study of the molecular characterization of tumors using data from the TCGA. Alternative splicing of a gene produces splicing variants, and accumulating evidence has revealed its essential role in cancer-related processes, implying the urgent need to discover tumor-specific isoforms and uncover their potential functions in tumorigenesis. We developed TSVdb, a web-based tool, to explore alternative splicing based on TCGA samples with 30 clinical variables from 33 tumors. TSVdb has an integrated and well-proportioned interface for visualization of the clinical data, gene expression, usage of exons/junctions and splicing patterns. Researchers can interpret the isoform expression variations between or across clinical subgroups and estimate the relationships between isoforms and patient prognosis. TSVdb is available at http://www.tsvdb.com , and the source code is available at https://github.com/wenjie1991/TSVdb . TSVdb will inspire oncologists and accelerate isoform-level advances in cancer research.
Seth, Puneet; Yeowell, Heather N
2010-04-01
Scleroderma (systemic sclerosis [SSc]) is a complex connective tissue disorder characterized by hardening and thickening of the skin. One hallmark of scleroderma is excessive accumulation of collagen accompanied by increased levels of pyridinoline collagen crosslinks derived from hydroxylysine residues in the collagen telopeptide domains. Lysyl hydroxylase 2 (LH2), an important alternatively spliced enzyme in collagen biosynthesis, acts as a collagen telopeptide hydroxylase. Changes in the pattern of LH2 alternative splicing, favoring increased inclusion of the alternatively spliced LH2 exon 13A, thereby increasing the levels of the long transcript of LH2 (LH2[long]), are linked to scleroderma disease. This study was undertaken to examine the role played by RNA binding protein Fox-2 in regulating exon 13A inclusion, which leads to the generation of scleroderma-associated LH2(long) messenger RNA (mRNA). Phylogenetic sequence analysis of introns flanking exon 13A was performed. A tetracycline-inducible system in T-Rex 293 cells was used to induce Fox-2 protein, and endogenous LH2(long) mRNA was determined by reverse transcriptase-polymerase chain reaction. An LH2 minigene was designed, validated, and used in Fox-2 overexpression and mutagenesis experiments. Knockdown of Fox-2 was performed in mouse embryonic fibroblasts and in fibroblasts from SSc patients. Overexpression of Fox-2 enhanced the inclusion of exon 13A and increased the generation of LH2(long) mRNA, whereas knockdown of Fox-2 decreased LH2(long) transcripts. Mutational analysis of an LH2 minigene demonstrated that 2 of the 4 Fox binding motifs flanking LH2 exon 13A are required for inclusion of exon 13A. In early passage fibroblasts derived from patients with scleroderma, the knockdown of Fox-2 protein significantly decreased the endogenous levels of LH2(long) mRNA. Our findings indicate that Fox-2 plays an integral role in the regulation of LH2 splicing. Knockdown of Fox-2 and other methods to decrease the levels of fibrosis-associated LH2(long) mRNA in primary scleroderma cells may suggest a novel approach to strategies directed against scleroderma.
Stricker, Stefan H; Steenpass, Laura; Pauler, Florian M; Santoro, Federica; Latos, Paulina A; Huang, Ru; Koerner, Martha V; Sloane, Mathew A; Warczok, Katarzyna E; Barlow, Denise P
2008-01-01
The Airn macro ncRNA is the master regulator of imprinted expression in the Igf2r imprinted gene cluster where it silences three flanking genes in cis. Airn transcription shows unusual features normally viewed as promoter specific, such as impaired post-transcriptional processing and a macro size. The Airn transcript is 108 kb long, predominantly unspliced and nuclear localized, with only a minority being variably spliced and exported. Here, we show by deletion of the Airn ncRNA promoter and replacement with a constitutive strong or weak promoter that splicing suppression and termination, as well as silencing activity, are maintained by strong Airn expression from an exogenous promoter. This indicates that all functional regions are located within the Airn transcript. DNA methylation of the maternal imprint control element (ICE) restricts Airn expression to the paternal allele and we also show that a strong active promoter is required to maintain the unmethylated state of the paternal ICE. Thus, Airn expression not only induces silencing of flanking mRNA genes but also protects the paternal copy of the ICE from de novo methylation. PMID:19008856
A Comprehensive Analysis of Alternative Splicing in Paleopolyploid Maize.
Mei, Wenbin; Liu, Sanzhen; Schnable, James C; Yeh, Cheng-Ting; Springer, Nathan M; Schnable, Patrick S; Barbazuk, William B
2017-01-01
Identifying and characterizing alternative splicing (AS) enables our understanding of the biological role of transcript isoform diversity. This study describes the use of publicly available RNA-Seq data to identify and characterize the global diversity of AS isoforms in maize using the inbred lines B73 and Mo17, and a related species, sorghum. Identification and characterization of AS within maize tissues revealed that genes expressed in seed exhibit the largest differential AS relative to other tissues examined. Additionally, differences in AS between the two genotypes B73 and Mo17 are greatest within genes expressed in seed. We demonstrate that changes in the level of alternatively spliced transcripts (intron retention and exon skipping) do not solely reflect differences in total transcript abundance, and we present evidence that intron retention may act to fine-tune gene expression across seed development stages. Furthermore, we have identified temperature sensitive AS in maize and demonstrate that drought-induced changes in AS involve distinct sets of genes in reproductive and vegetative tissues. Examining our identified AS isoforms within B73 × Mo17 recombinant inbred lines (RILs) identified splicing QTL (sQTL). The 43.3% of cis- sQTL regulated junctions are actually identified as alternatively spliced junctions in our analysis, while 10 Mb windows on each side of 48.2% of trans -sQTLs overlap with splicing related genes. Using sorghum as an out-group enabled direct examination of loss or conservation of AS between homeologous genes representing the two subgenomes of maize. We identify several instances where AS isoforms that are conserved between one maize homeolog and its sorghum ortholog are absent from the second maize homeolog, suggesting that these AS isoforms may have been lost after the maize whole genome duplication event. This comprehensive analysis provides new insights into the complexity of AS in maize.
Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M
2017-01-01
Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.
A SMN-Dependent U12 Splicing Event Essential for Motor Circuit Function
Lotti, Francesco; Imlach, Wendy L.; Saieva, Luciano; Beck, Erin S.; Hao, Le T.; Li, Darrick K.; Jiao, Wei; Mentis, George Z.; Beattie, Christine E.; McCabe, Brian D.; Pellizzoni, Livio
2012-01-01
SUMMARY Spinal muscular atrophy (SMA) is a motor neuron disease caused by deficiency of the ubiquitous survival motor neuron (SMN) protein. To define the mechanisms of selective neuronal dysfunction in SMA, we investigated the role of SMN-dependent U12 splicing events in the regulation of motor circuit activity. We show that SMN deficiency perturbs splicing and decreases the expression of a subset of U12 intron-containing genes in mammalian cells and Drosophila larvae. Analysis of these SMN target genes identifies Stasimon as a novel protein required for motor circuit function. Restoration of Stasimon expression in the motor circuit corrects defects in neuromuscular junction transmission and muscle growth in Drosophila SMN mutants and aberrant motor neuron development in SMN-deficient zebrafish. These findings directly link defective splicing of critical neuronal genes induced by SMN deficiency to motor circuit dysfunction, establishing a molecular framework for the selective pathology of SMA. PMID:23063131
Jin, Lirong; Li, Guanglin; Yu, Dazhao; Huang, Wei; Cheng, Chao; Liao, Shengjie; Wu, Qijia; Zhang, Yi
2017-02-06
Alternative splicing (AS) regulation is extensive and shapes the functional complexity of higher organisms. However, the contribution of alternative splicing to fungal biology is not well studied. This study provides sequences of the transcriptomes of the plant wilt pathogen Verticillium dahliae, using two different strains and multiple methods for cDNA library preparations. We identified alternatively spliced mRNA isoforms in over a half of the multi-exonic fungal genes. Over one-thousand isoforms involve TopHat novel splice junction; multiple types of combinatory alternative splicing patterns were identified. We showed that one Verticillium gene could use four different 5' splice sites and two different 3' donor sites to produce up to five mature mRNAs, representing one of the most sophisticated alternative splicing model in eukaryotes other than animals. Hundreds of novel intron types involving a pair of new splice sites were identified in the V. dahliae genome. All the types of AS events were validated by using RT-PCR. Functional enrichment analysis showed that AS genes are involved in most known biological functions and enriched in ATP biosynthesis, sexual/asexual reproduction, morphogenesis, signal transduction etc., predicting that the AS regulation modulates mRNA isoform output and shapes the V. dahliae proteome plasticity of the pathogen in response to the environmental and developmental changes. These findings demonstrate the comprehensive alternative splicing mechanisms in a fungal plant pathogen, which argues the importance of this fungus in developing complicate genome regulation strategies in eukaryotes.
Flytzanis, Nicholas C.; Balsamo, Michele; Condeelis, John S.; Oktay, Maja H.; Burge, Christopher B.; Gertler, Frank B.
2011-01-01
Epithelial-mesenchymal transition (EMT), a mechanism important for embryonic development, plays a critical role during malignant transformation. While much is known about transcriptional regulation of EMT, alternative splicing of several genes has also been correlated with EMT progression, but the extent of splicing changes and their contributions to the morphological conversion accompanying EMT have not been investigated comprehensively. Using an established cell culture model and RNA–Seq analyses, we determined an alternative splicing signature for EMT. Genes encoding key drivers of EMT–dependent changes in cell phenotype, such as actin cytoskeleton remodeling, regulation of cell–cell junction formation, and regulation of cell migration, were enriched among EMT–associated alternatively splicing events. Our analysis suggested that most EMT–associated alternative splicing events are regulated by one or more members of the RBFOX, MBNL, CELF, hnRNP, or ESRP classes of splicing factors. The EMT alternative splicing signature was confirmed in human breast cancer cell lines, which could be classified into basal and luminal subtypes based exclusively on their EMT–associated splicing pattern. Expression of EMT–associated alternative mRNA transcripts was also observed in primary breast cancer samples, indicating that EMT–dependent splicing changes occur commonly in human tumors. The functional significance of EMT–associated alternative splicing was tested by expression of the epithelial-specific splicing factor ESRP1 or by depletion of RBFOX2 in mesenchymal cells, both of which elicited significant changes in cell morphology and motility towards an epithelial phenotype, suggesting that splicing regulation alone can drive critical aspects of EMT–associated phenotypic changes. The molecular description obtained here may aid in the development of new diagnostic and prognostic markers for analysis of breast cancer progression. PMID:21876675
Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo
2013-11-01
Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC 3 (NM_003786.3:c.1783-1G>A), KLHDC 1 (NM_172193.1:c.568-2A>G), HOOK 1 (NM_015888.4:c.1662-1G>A), SMAD 9 (NM_001127217.2:c.1004-1C>T), and DNAH 9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC 3, HOOK 1. In ABCC 3 and HOOK 1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK 1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4-6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis.
Tang, Rongying; Prosser, Debra O.; Love, Donald R.
2016-01-01
The increasing diagnostic use of gene sequencing has led to an expanding dataset of novel variants that lie within consensus splice junctions. The challenge for diagnostic laboratories is the evaluation of these variants in order to determine if they affect splicing or are merely benign. A common evaluation strategy is to use in silico analysis, and it is here that a number of programmes are available online; however, currently, there are no consensus guidelines on the selection of programmes or protocols to interpret the prediction results. Using a collection of 222 pathogenic mutations and 50 benign polymorphisms, we evaluated the sensitivity and specificity of four in silico programmes in predicting the effect of each variant on splicing. The programmes comprised Human Splice Finder (HSF), Max Entropy Scan (MES), NNSplice, and ASSP. The MES and ASSP programmes gave the highest performance based on Receiver Operator Curve analysis, with an optimal cut-off of score reduction of 10%. The study also showed that the sensitivity of prediction is affected by the level of conservation of individual positions, with in silico predictions for variants at positions −4 and +7 within consensus splice sites being largely uninformative. PMID:27313609
Global regulation of alternative RNA splicing by the SR-rich protein RBM39.
Mai, Sanyue; Qu, Xiuhua; Li, Ping; Ma, Qingjun; Cao, Cheng; Liu, Xuan
2016-08-01
RBM39 is a serine/arginine-rich RNA-binding protein that is highly homologous to the splicing factor U2AF65. However, the role of RBM39 in alternative splicing is poorly understood. In this study, RBM39-mediated global alternative splicing was investigated using RNA-Seq and genome-wide RBM39-RNA interactions were mapped via cross-linking and immunoprecipitation coupled with deep sequencing (CLIP-Seq) in wild-type and RBM39-knockdown MCF-7 cells. RBM39 was involved in the up- or down-regulation of the transcript levels of various genes. Hundreds of alternative splicing events regulated by endogenous RBM39 were identified. The majority of these events were cassette exons. Genes containing RBM39-regulated alternative exons were found to be linked to G2/M transition, cellular response to DNA damage, adherens junctions and endocytosis. CLIP-Seq analysis showed that the binding site of RBM39 was mainly in proximity to 5' and 3' splicing sites. Considerable RBM39 binding to mRNAs encoding proteins involved in translation was observed. Of particular importance, ~20% of the alternative splicing events that were significantly regulated by RBM39 were similarly regulated by U2AF65. RBM39 is extensively involved in alternative splicing of RNA and helps regulate transcript levels. RBM39 may modulate alternative splicing similarly to U2AF65 by either directly binding to RNA or recruiting other splicing factors, such as U2AF65. The current study offers a genome-wide view of RBM39's regulatory function in alternative splicing. RBM39 may play important roles in multiple cellular processes by regulating both alternative splicing of RNA molecules and transcript levels. Copyright © 2016 Elsevier B.V. All rights reserved.
Regulation of alternative splicing at the single-cell level.
Faigenbloom, Lior; Rubinstein, Nimrod D; Kloog, Yoel; Mayrose, Itay; Pupko, Tal; Stein, Reuven
2015-12-28
Alternative splicing is a key cellular mechanism for generating distinct isoforms, whose relative abundances regulate critical cellular processes. It is therefore essential that inclusion levels of alternative exons be tightly regulated. However, how the precision of inclusion levels among individual cells is governed is poorly understood. Using single-cell gene expression, we show that the precision of inclusion levels of alternative exons is determined by the degree of evolutionary conservation at their flanking intronic regions. Moreover, the inclusion levels of alternative exons, as well as the expression levels of the transcripts harboring them, also contribute to this precision. We further show that alternative exons whose inclusion levels are considerably changed during stem cell differentiation are also subject to this regulation. Our results imply that alternative splicing is coordinately regulated to achieve accuracy in relative isoform abundances and that such accuracy may be important in determining cell fate. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.
Hua, Yimin; Vickers, Timothy A.; Okunola, Hazeem L.; Bennett, C. Frank; Krainer, Adrian R.
2008-01-01
survival of motor neuron 2, centromeric (SMN2) is a gene that modifies the severity of spinal muscular atrophy (SMA), a motor-neuron disease that is the leading genetic cause of infant mortality. Increasing inclusion of SMN2 exon 7, which is predominantly skipped, holds promise to treat or possibly cure SMA; one practical strategy is the disruption of splicing silencers that impair exon 7 recognition. By using an antisense oligonucleotide (ASO)-tiling method, we systematically screened the proximal intronic regions flanking exon 7 and identified two intronic splicing silencers (ISSs): one in intron 6 and a recently described one in intron 7. We analyzed the intron 7 ISS by mutagenesis, coupled with splicing assays, RNA-affinity chromatography, and protein overexpression, and found two tandem hnRNP A1/A2 motifs within the ISS that are responsible for its inhibitory character. Mutations in these two motifs, or ASOs that block them, promote very efficient exon 7 inclusion. We screened 31 ASOs in this region and selected two optimal ones to test in human SMN2 transgenic mice. Both ASOs strongly increased hSMN2 exon 7 inclusion in the liver and kidney of the transgenic animals. Our results show that the high-resolution ASO-tiling approach can identify cis-elements that modulate splicing positively or negatively. Most importantly, our results highlight the therapeutic potential of some of these ASOs in the context of SMA. PMID:18371932
Wongpalee, Somsakul Pop; Vashisht, Ajay; Sharma, Shalini; Chui, Darryl; Wohlschlegel, James A; Black, Douglas L
2016-01-01
Polypyrimidine-tract binding protein PTBP1 can repress splicing during the exon definition phase of spliceosome assembly, but the assembly steps leading to an exon definition complex (EDC) and how PTBP1 might modulate them are not clear. We found that PTBP1 binding in the flanking introns allowed normal U2AF and U1 snRNP binding to the target exon splice sites but blocked U2 snRNP assembly in HeLa nuclear extract. Characterizing a purified PTBP1-repressed complex, as well as an active early complex and the final EDC by SILAC-MS, we identified extensive PTBP1-modulated changes in exon RNP composition. The active early complex formed in the absence of PTBP1 proceeded to assemble an EDC with the eviction of hnRNP proteins, the late recruitment of SR proteins, and binding of the U2 snRNP. These results demonstrate that during early stages of splicing, exon RNP complexes are highly dynamic with many proteins failing to bind during PTBP1 arrest. DOI: http://dx.doi.org/10.7554/eLife.19743.001 PMID:27882870
Non-exomic and synonymous variants in ABCA4 are an important cause of Stargardt disease
Braun, Terry A.; Mullins, Robert F.; Wagner, Alex H.; Andorf, Jeaneen L.; Johnston, Rebecca M.; Bakall, Benjamin B.; Deluca, Adam P.; Fishman, Gerald A.; Lam, Byron L.; Weleber, Richard G.; Cideciyan, Artur V.; Jacobson, Samuel G.; Sheffield, Val C.; Tucker, Budd A.; Stone, Edwin M.
2013-01-01
Mutations in ABCA4 cause Stargardt disease and other blinding autosomal recessive retinal disorders. However, sequencing of the complete coding sequence in patients with clinical features of Stargardt disease sometimes fails to detect one or both mutations. For example, among 208 individuals with clear clinical evidence of ABCA4 disease ascertained at a single institution, 28 had only one disease-causing allele identified in the exons and splice junctions of the primary retinal transcript of the gene. Haplotype analysis of these 28 probands revealed 3 haplotypes shared among ten families, suggesting that 18 of the 28 missing alleles were rare enough to be present only once in the cohort. We hypothesized that mutations near rare alternate splice junctions in ABCA4 might cause disease by increasing the probability of mis-splicing at these sites. Next-generation sequencing of RNA extracted from human donor eyes revealed more than a dozen alternate exons that are occasionally incorporated into the ABCA4 transcript in normal human retina. We sequenced the genomic DNA containing 15 of these minor exons in the 28 one-allele subjects and observed five instances of two different variations in the splice signals of exon 36.1 that were not present in normal individuals (P < 10−6). Analysis of RNA obtained from the keratinocytes of patients with these mutations revealed the predicted alternate transcript. This study illustrates the utility of RNA sequence analysis of human donor tissue and patient-derived cell lines to identify mutations that would be undetectable by exome sequencing. PMID:23918662
Increased complexity of circRNA expression during species evolution.
Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li
2017-08-03
Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.
Milewich, L; Mendonca, B B; Arnhold, I; Wallace, A M; Donaldson, M D; Wilson, J D; Russell, D W
1995-11-01
Steroid 5 alpha-reductase 2 deficiency has been identified in two adult women from unrelated families, one a homozygote and the other a compound heterozygote. The homozygote carries the G183S mutation and is the sister of an affected male; the compound heterozygote (R246W/splice junction abnormality) is married to a heterozygote (splice junction abnormality) and is the mother of two compound heterozygotes and two homozygotes. The fact that these two women are the mothers of seven children and appear to be endocrinologically normal confirms the previous deduction that this disorder is not manifest in women. Concentrations of plasma 5 alpha-dihydroprogesterone were normal in these two women during the luteal phase; this finding implies that circulating 5 alpha-dihydroprogesterone in women is derived principally from the steroid 5 alpha-reductase 1 isoenzyme and leaves unresolved the question of whether 5 alpha-dihydroprogesterone plays a physiological role in women.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doerk, T.; Wulbrand, U.; Tuemmler, B.
1993-03-01
Single cases of the four novel splice site mutations 1525[minus]1 G [r arrow] A (intron 9), 3601[minus]2 A [r arrow] G (intron 18), 3850[minus]3 T [r arrow] G (intron 19), and 4374+1 G [r arrow] T (intron 23) were detected in the CFTR gene of cystic fibrosis patients of Indo-Iranian, Turkish, Polish, and Germany descent. The nucleotide substitutions at the +1, [minus]1, and [minus]2 positions all destroy splice sites and lead to severe disease alleles associated with features typical of gastrointestinal and pulmonary cystic fibrosis disease. The 3850[minus]3 T-to-G change was discovered in a very mildly affected 33-year-old [Delta]F508 compoundmore » heterozygote, suggesting that the T-to-G transversion at the less conserved [minus]3 position of the acceptor splice site may retain some wildtype function. 13 refs., 1 fig., 2 tabs.« less
Lee, Sook-Kyung; Hu, Jan C.-C.; Lee, Kyung-Eun; Simmer, James P.; Kim, Jung-Wook
2009-01-01
The dentin sialophosphoprotein (DSPP) gene on chromosome 4q21.3 encodes the major noncollagenous protein in tooth dentin. DSPP mutations are the principal cause of dentin dysplasia type II, dentinogenesis imperfecta type II, and dentinogenesis imperfecta type III. We have identified a DSPP splice junction mutation (IVS2-6T>G) in a family with dentin dysplasia type II. The primary dentition is discolored brown with severe attrition. The mildly discolored permanent dentition has thistle-shaped pulp chambers, pulp stones, and eventual pulp obliteration. The mutation is in the sixth nucleotide from the end of intron 2, perfectly segregates with the disease phenotype, and is absent in 200 normal control chromosomes. An in vitro splicing assay shows that pre-mRNA splicing of the mutant allele generates wild-type mRNA and mRNA lacking exon 3 in approximately equal amounts. Skipping exon 3 might interfere with signal peptide cleavage, causing endoplasmic reticulum stress, and also reduce DSPP secretion, leading to haploinsufficiency. PMID:19026876
Mootz, Henning D; Blum, Elyse S; Tyszkiewicz, Amy B; Muir, Tom W
2003-09-03
Protein splicing is a naturally occurring process in which an intervening intein domain excises itself out of a precursor polypeptide in an autocatalytic fashion with concomitant linkage of the two flanking extein sequences by a native peptide bond. We have recently reported an engineered split VMA intein whose splicing activity in trans between two polypeptides can be triggered by the small molecule rapamycin. In this report, we show that this conditional protein splicing (CPS) system can be used in mammalian cells. Two model constructs harboring maltose-binding protein (MBP) and a His-tag as exteins were expressed from a constitutive promoter after transient transfection. The splicing product MBP-His was detected by Western blotting and immunoprecipitation in cells treated with rapamycin or a nontoxic analogue thereof. No background splicing in the absence of the small-molecule inducer was observed over a 24-h time course. Product formation could be detected within 10 min of addition of rapamycin, indicating the advantage of the posttranslational nature of CPS for quick responses. The level of protein splicing was dose dependent and could be competitively attenuated with the small molecule ascomycin. In related studies, the geometric flexibility of the CPS components was investigated with a series of purified proteins. The FKBP and FRB domains, which are dimerized by rapamycin and thereby induce the reconstitution of the split intein, were fused to the extein sequences of the split intein halves. CPS was still triggered by rapamycin when FKBP and FRB occupied one or both of the extein positions. This finding suggests yet further applications of CPS in the area of proteomics. In summary, CPS holds great promise to become a powerful new tool to control protein structure and function in vitro and in living cells.
An UPF3-based nonsense-mediated decay in Paramecium.
Contreras, Julia; Begley, Victoria; Macias, Sandra; Villalobo, Eduardo
2014-12-01
Nonsense-mediated decay recognises mRNAs containing premature termination codons. One of its components, UPF3, is a molecular link bridging through its binding to the exon junction complex nonsense-mediated decay and splicing. In protists UPF3 has not been identified yet. We report that Paramecium tetraurelia bears an UPF3 gene and that it has a role in nonsense-mediated decay. Interestingly, the identified UPF3 has not conserved the essential amino acids required to bind the exon junction complex. Though, our data indicates that this ciliate bears genes coding for core proteins of the exon junction complex. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
NASA Astrophysics Data System (ADS)
Pollastro, Pasquale; Rampone, Salvatore
The aim of this work is to describe a cleaning procedure of GenBank data, producing material to train and to assess the prediction accuracy of computational approaches for gene characterization. A procedure (GenBank2HS3D) has been defined, producing a dataset (HS3D - Homo Sapiens Splice Sites Dataset) of Homo Sapiens Splice regions extracted from GenBank (Rel.123 at this time). It selects, from the complete GenBank Primate Division, entries of Human Nuclear DNA according with several assessed criteria; then it extracts exons and introns from these entries (actually 4523 + 3802). Donor and acceptor sites are then extracted as windows of 140 nucleotides around each splice site (3799 + 3799). After discarding windows not including canonical GT-AG junctions (65 + 74), including insufficient data (not enough material for a 140 nucleotide window) (686 + 589), including not AGCT bases (29 + 30), and redundant (218 + 226), the remaining windows (2796 + 2880) are reported in the dataset. Finally, windows of false splice sites are selected by searching canonical GT-AG pairs in not splicing positions (271 937 + 332 296). The false sites in a range +/- 60 from a true splice site are marked as proximal. HS3D, release 1.2 at this time, is available at the Web server of the University of Sannio: http://www.sci.unisannio.it/docenti/rampone/.
TSUNAMI: an antisense method to phenocopy splicing-associated diseases in animals
Sahashi, Kentaro; Hua, Yimin; Ling, Karen K.Y.; Hung, Gene; Rigo, Frank; Horev, Guy; Katsuno, Masahisa; Sobue, Gen; Ko, Chien-Ping; Bennett, C. Frank; Krainer, Adrian R.
2012-01-01
Antisense oligonucleotides (ASOs) are versatile molecules that can be designed to specifically alter splicing patterns of target pre-mRNAs. Here we exploit this feature to phenocopy a genetic disease. Spinal muscular atrophy (SMA) is a motor neuron disease caused by loss-of-function mutations in the SMN1 gene. The related SMN2 gene expresses suboptimal levels of functional SMN protein due to alternative splicing that skips exon 7; correcting this defect—e.g., with ASOs—is a promising therapeutic approach. We describe the use of ASOs that exacerbate SMN2 missplicing and phenocopy SMA in a dose-dependent manner when administered to transgenic Smn−/− mice. Intracerebroventricular ASO injection in neonatal mice recapitulates SMA-like progressive motor dysfunction, growth impairment, and shortened life span, with α-motor neuron loss and abnormal neuromuscular junctions. These SMA-like phenotypes are prevented by a therapeutic ASO that restores correct SMN2 splicing. We uncovered starvation-induced splicing changes, particularly in SMN2, which likely accelerate disease progression. These results constitute proof of principle that ASOs designed to cause sustained splicing defects can be used to induce pathogenesis and rapidly and accurately model splicing-associated diseases in animals. This approach allows the dissection of pathogenesis mechanisms, including spatial and temporal features of disease onset and progression, as well as testing of candidate therapeutics. PMID:22895255
Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo
2013-01-01
Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC3 (NM_003786.3:c.1783-1G>A), KLHDC1 (NM_172193.1:c.568-2A>G), HOOK1 (NM_015888.4:c.1662-1G>A), SMAD9 (NM_001127217.2:c.1004-1C>T), and DNAH9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC3, HOOK1. In ABCC3 and HOOK1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4–6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis. PMID:24498620
Zhu, Yezi; Sharp, Adam; Anderson, Courtney M; Silberstein, John L; Taylor, Maritza; Lu, Changxue; Zhao, Pei; De Marzo, Angelo M; Antonarakis, Emmanuel S; Wang, Mindy; Wu, Xingyong; Luo, Yuling; Su, Nan; Nava Rodrigues, Daniel; Figueiredo, Ines; Welti, Jonathan; Park, Emily; Ma, Xiao-Jun; Coleman, Ilsa; Morrissey, Colm; Plymate, Stephen R; Nelson, Peter S; de Bono, Johann S; Luo, Jun
2018-05-01
Androgen receptor splice variant 7 (AR-V7) has been implicated in resistance to abiraterone and enzalutamide treatment in men with metastatic castration-resistant prostate cancer (mCRPC). Tissue- or cell-based in situ detection of AR-V7, however, has been limited by lack of specificity. To address current limitations in precision measurement of AR-V7 by developing a novel junction-specific AR-V7 RNA in situ hybridization (RISH) assay compatible with automated quantification. We designed a RISH method to visualize single splice junctions in cells and tissue. Using the validated assay for junction-specific detection of the full-length AR (AR-FL) and AR-V7, we generated quantitative data, blinded to clinical data, for 63 prostate tumor biopsies. We evaluated clinical correlates of AR-FL/AR-V7 measurements, including association with prostate-specific antigen progression-free survival (PSA-PFS) and clinical and radiographic progression-free survival (PFS), in a subset of patients starting treatment with abiraterone or enzalutamide following biopsy. Quantitative AR-FL/AR-V7 data were generated from 56 of the 63 (88.9%) biopsy specimens examined, of which 44 were mCRPC biopsies. Positive AR-V7 signals were detected in 34.1% (15/44) mCRPC specimens, all of which also co-expressed AR-FL. The median AR-V7/AR-FL ratio was 11.9% (range 2.7-30.3%). Positive detection of AR-V7 was correlated with indicators of high disease burden at baseline. Among the 25 CRPC biopsies collected before treatment with abiraterone or enzalutamide, positive AR-V7 detection, but not higher AR-FL, was significantly associated with shorter PSA-PFS (hazard ratio 2.789, 95% confidence interval 1.12-6.95; p=0.0081). We report for the first time a RISH method for highly specific and quantifiable detection of splice junctions, allowing further characterization of AR-V7 and its clinical significance. Higher AR-V7 levels detected and quantified using a novel method were associated with poorer response to abiraterone or enzalutamide in prostate cancer. Copyright © 2017 European Association of Urology. Published by Elsevier B.V. All rights reserved.
Yoshihisa, Tohru; Yunoki-Esaki, Kaori; Ohshima, Chie; Tanaka, Nobuyuki; Endo, Toshiya
2003-08-01
Pre-tRNA splicing has been believed to occur in the nucleus. In yeast, the tRNA splicing endonuclease that cleaves the exon-intron junctions of pre-tRNAs consists of Sen54p, Sen2p, Sen34p, and Sen15p and was thought to be an integral membrane protein of the inner nuclear envelope. Here we show that the majority of Sen2p, Sen54p, and the endonuclease activity are not localized in the nucleus, but on the mitochondrial surface. The endonuclease is peripherally associated with the cytosolic surface of the outer mitochondrial membrane. A Sen54p derivative artificially fixed on the mitochondria as an integral membrane protein can functionally replace the authentic Sen54p, whereas mutant proteins defective in mitochondrial localization are not fully active. sen2 mutant cells accumulate unspliced pre-tRNAs in the cytosol under the restrictive conditions, and this export of the pre-tRNAs partly depends on Los1p, yeast exportin-t. It is difficult to explain these results from the view of tRNA splicing in the nucleus. We rather propose a new possibility that tRNA splicing occurs on the mitochondrial surface in yeast.
A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.
Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R
2001-01-01
Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.
Chuang, Trees-Juen; Yang, Min-Yu; Lin, Chuang-Chieh; Hsieh, Ping-Hung; Hung, Li-Yuan
2015-02-05
Crop plants such as rice, maize and sorghum play economically-important roles as main sources of food, fuel, and animal feed. However, current genome annotations of crop plants still suffer false-positive predictions; a more comprehensive registry of alternative splicing (AS) events is also in demand. Comparative genomics of crop plants is largely unexplored. We performed a large-scale comparative analysis (ExonFinder) of the expressed sequence tag (EST) library from nine grass plants against three crop genomes (rice, maize, and sorghum) and identified 2,879 previously-unannotated exons (i.e., novel exons) in the three crops. We validated 81% of the tested exons by RT-PCR-sequencing, supporting the effectiveness of our in silico strategy. Evolutionary analysis reveals that the novel exons, comparing with their flanking annotated ones, are generally under weaker selection pressure at the protein level, but under stronger pressure at the RNA level, suggesting that most of the novel exons also represent novel alternatively spliced variants (ASVs). However, we also observed the consistency of evolutionary rates between certain novel exons and their flanking exons, which provided further evidence of their co-occurrence in the transcripts, suggesting that previously-annotated isoforms might be subject to erroneous predictions. Our validation showed that 54% of the tested genes expressed the newly-identified isoforms that contained the novel exons, rather than the previously-annotated isoforms that excluded them. The consistent results were steadily observed across cultivated (Oryza sativa and O. glaberrima) and wild (O. rufipogon and O. nivara) rice species, asserting the necessity of our curation of the crop genome annotations. Our comparative analyses also inferred the common ancestral transcriptome of grass plants and gain- and loss-of-ASV events. We have reannotated the rice, maize, and sorghum genomes, and showed that evolutionary rates might serve as an indicator for determining whether the identified exons were alternatively spliced. This study not only presents an effective in silico strategy for the improvement of plant annotations, but also provides further insights into the role of AS events in the evolution and domestication of crop plants. ExonFinder and the novel exons/ASVs identified are publicly accessible at http://exonfinder.sourceforge.net/ .
Intragenic motifs regulate the transcriptional complexity of Pkhd1/PKHD1
Boddu, Ravindra; Yang, Chaozhe; O’Connor, Amber K.; Hendrickson, Robert Curtis; Boone, Braden; Cui, Xiangqin; Garcia-Gonzalez, Miguel; Igarashi, Peter; Onuchic, Luiz F.; Germino, Gregory G.
2014-01-01
Autosomal recessive polycystic kidney disease (ARPKD) results from mutations in the human PKHD1 gene. Both this gene, and its mouse ortholog, Pkhd1, are primarily expressed in renal and biliary ductal structures. The mouse protein product, fibrocystin/polyductin complex (FPC), is a 445-kDa protein encoded by a 67-exon transcript that spans >500 kb of genomic DNA. In the current study, we observed multiple alternatively spliced Pkhd1 transcripts that varied in size and exon composition in embryonic mouse kidney, liver, and placenta samples, as well as among adult mouse pancreas, brain, heart, lung, testes, liver, and kidney. Using reverse transcription PCR and RNASeq, we identified 22 novel Pkhd1 kidney transcripts with unique exon junctions. Various mechanisms of alternative splicing were observed, including exon skipping, use of alternate acceptor/donor splice sites, and inclusion of novel exons. Bioinformatic analyses identified, and exon-trapping minigene experiments validated, consensus binding sites for serine/arginine-rich proteins that modulate alternative splicing. Using site-directed mutagenesis, we examined the functional importance of selected splice enhancers. In addition, we demonstrated that many of the novel transcripts were polysome bound, thus likely translated. Finally, we determined that the human PKHD1 R760H missense variant alters a splice enhancer motif that disrupts exon splicing in vitro and is predicted to truncate the protein. Taken together, these data provide evidence of the complex transcriptional regulation of Pkhd1/PKHD1 and identified motifs that regulate its splicing. Our studies indicate that Pkhd1/PKHD1 transcription is modulated, in part by intragenic factors, suggesting that aberrant PKHD1 splicing represents an unappreciated pathogenic mechanism in ARPKD. PMID:24984783
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajenova, Olga, E-mail: o.bazhenova@spbu.ru; Department of Genetics and Biotechnology, St. Petersburg State University, St. Petersburg 199034; Department of Surgery and Biomedical Sciences, Creighton University, Omaha, NE 68178
2014-06-10
Oncomarkers play important roles in the detection and management of human malignancies. Carcinoembryonic antigen (CEA, CEACAM5) and epithelial cadherin (E-cadherin) are considered as independent tumor markers in monitoring metastatic colorectal cancer. They are both expressed by cancer cells and can be detected in the blood serum. We investigated the effect of CEA production by MIP101 colorectal carcinoma cell lines on E-cadherin adherens junction (AJ) protein complexes. No direct interaction between E-cadherin and CEA was detected; however, the functional relationships between E-cadherin and its AJ partners: α-, β- and p120 catenins were impaired. We discovered a novel interaction between CEA andmore » beta-catenin protein in the CEA producing cells. It is shown in the current study that CEA overexpression alters the splicing of p120 catenin and triggers the release of soluble E-cadherin. The influence of CEA production by colorectal cancer cells on the function of E-cadherin junction complexes may explain the link between the elevated levels of CEA and the increase in soluble E-cadherin during the progression of colorectal cancer. - Highlights: • Elevated level of CEA increases the release of soluble E-cadherin during the progression of colorectal cancer. • CEA over-expression alters the binding preferences between E-cadherin and its partners: α-, β- and p120 catenins in adherens junction complexes. • CEA produced by colorectal cancer cells interacts with beta-catenin protein. • CEA over-expression triggers the increase in nuclear beta-catenin. • CEA over-expression alters the splicing of p120 catenin protein.« less
The splicing of tiny introns of Paramecium is controlled by MAGO.
Contreras, Julia; Begley, Victoria; Marsella, Laura; Villalobo, Eduardo
2018-07-15
The exon junction complex (EJC) is a key element of the splicing machinery. The EJC core is composed of eIF4A3, MAGO, Y14 and MLN51. Few accessory proteins, such as CWC22 or UPF3, bind transiently to the EJC. The EJC has been implicated in the control of the splicing of long introns. To ascertain whether the EJC controls the splicing of short introns, we used Paramecium tetraurelia as a model organism, since it has thousands of very tiny introns. To elucidate whether EJC affects intron splicing in P. tetraurelia, we searched for EJC protein-coding genes, and silenced those genes coding for eIF4A3, MAGO and CWC22. We found that P. tetraurelia likely assembles an active EJC with only three of the core proteins, since MLN51 is lacking. Silencing of eIF4A3 or CWC22 genes, but not that of MAGO, caused lethality. Silencing of the MAGO gene caused either an increase, decrease, or no change in intron retention levels of some intron-containing mRNAs used as reporters. We suggest that a fine-tuning expression of EJC genes is required for steady intron removal in P. tetraurelia. Taking into consideration our results and those published by others, we conclude that the EJC controls splicing independently of the intron size. Copyright © 2018 Elsevier B.V. All rights reserved.
Zhang, Chi; Dower, Ken; Zhang, Baohong; Martinez, Robert V; Lin, Lih-Ling; Zhao, Shanrong
2018-05-16
Obese ZSF1 rats exhibit spontaneous time-dependent diabetic nephropathy and are considered to be a highly relevant animal model of progressive human diabetic kidney disease. We previously identified gene expression changes between disease and control animals across six time points from 12 to 41 weeks. In this study, the same data were analysed at the isoform and exon levels to reveal additional disease mechanisms that may be governed by alternative splicing. Our analyses identified alternative splicing patterns in genes that may be implicated in disease pathogenesis (such as Shc1, Serpinc1, Epb4.1l5, and Il-33), which would have been overlooked in standard gene-level analysis. The alternatively spliced genes were enriched in pathways related to cell adhesion, cell-cell interactions/junctions, and cytoskeleton signalling, whereas the differentially expressed genes were enriched in pathways related to immune response, G protein-coupled receptor, and cAMP signalling. Our findings indicate that additional mechanistic insights can be gained from exon- and isoform-level data analyses over standard gene-level analysis. Considering alternative splicing is poorly conserved between rodents and humans, it is noted that this work is not translational, but the point holds true that additional insights can be gained from alternative splicing analysis of RNA-seq data.
2. South elevation with bases of two massive brick chimneys ...
2. South elevation with bases of two massive brick chimneys flanking structure at southwest and southeast corners. - Charlestown Navy Yard, Incinerator, Midway along northern boundary of Charlestown Navy Yard, on Little Mystic Channel, near junction of Eighteenth Street & Second Avenue, Boston, Suffolk County, MA
Dynamics differentiate between active and inactive inteins
Cronin, Melissa; Coolbaugh, Michael J; Nellis, David; Zhu, Jianwei; Wood, David W.; Nussinov, Ruth; Ma, Buyong
2014-01-01
The balance between stability and dynamics for active enzymes can be somewhat quantified by studies of intein splicing and cleaving reactions. Inteins catalyze the ligation of flanking host exteins while excising themselves. The potential for applications led to engineering of a mini-intein splicing domain, where the homing endonuclease domain of the Mycobacterium tuberculosis RecA (Mtu recA) intein was removed. The remaining domains were linked by several short peptides, but splicing activity in all was substantially lower than the full-length intein. Native splicing activity was restored in some cases by a V67L mutation. Using computations and experiments, we examine the impact of this mutation on the stability and conformational dynamics of the mini-intein splicing domain. Molecular dynamics simulations were used to delineate the factors that determine the active state, including the V67L mini-intein mutant, and peptide linker. We found that (1) the V67L mutation lowers the global fluctuations in all modeled mini-inteins, stabilizing the mini-intein constructs; (2) the connecting linker length affects intein dynamics; and (3) the flexibilities of the linker and intein core are higher in the active structure. We have observed that the interaction of the linker region and a turn region around residues 35-41 provides the pathway for the allostery interaction. Our experiments reveal that intein catalysis is characterized by non-linear Arrhenius plot, confirming the significant contribution of protein conformational dynamics to intein function. We conclude that while the V67L mutation stabilizes the global structure, cooperative dynamics of all intein regions appear more important for intein function than high stability. Our studies suggest that effectively quenching the conformational dynamics of an intein through engineered allosteric interactions could deactivate intein splicing or cleaving. PMID:25087201
Tan, Wei; Dean, Michael; Law, Amanda J.
2010-01-01
ErbB4 is a growth factor receptor tyrosine kinase essential for neurodevelopment. Genetic variation in ErbB4 is associated with schizophrenia and risk-associated polymorphisms predict overexpression of ErbB4 CYT-1 isoforms in the brain in the disorder. The molecular mechanism of association is unclear because the polymorphisms flank exon 3 of the gene and reside 700 kb distal to the CYT-1 defining exon. We hypothesized that the polymorphisms are indirectly associated with ErbB4 CYT-1 via splicing of exon 3 on the CYT-1 background. We report via cloning and sequencing of adult and fetal human brain cDNA libraries the identification of novel splice isoforms of ErbB4, whereby exon 3 is skipped (del.3). ErbB4 del.3 transcripts exist as CYT-2 isoforms and are predicted to produce truncated proteins. Furthermore, our data refine the structure of the human ErbB4 gene, clarify that juxtamembrane (JM) splice variants of ErbB4, JM-a and JM-b respectively, are characterized by the replacement of a 75 nucleotide (nt) sequence with a 45-nt insertion, and demonstrate that there are four alternative exons in the gene. Our analyses reveal that novel splice variants of ErbB4 exist in the developing and adult human brain and, given the failure to identify ErbB4 del.3 CYT-1 transcripts, suggest that the association of risk polymorphisms in the ErbB4 gene with CYT-1 transcript levels is not mediated via an exon 3 splicing event. PMID:20886074
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.
Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F
1984-01-01
The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019
Pianigiani, Giulia; Licastro, Danilo; Fortugno, Paola; Castiglia, Daniele; Petrovic, Ivana; Pagani, Franco
2018-06-12
MicroRNAs are found throughout the genome and are processed by the microprocessor complex (MPC) from longer precursors. Some precursor miRNAs overlap intron:exon junctions. These Splice site Overlapping microRNAs (SO-miRNAs) are mostly located in coding genes. It has been intimated, in the rarer examples of SO-miRNAs in non-coding RNAs, that the competition between the spliceosome and the MPC modulates alternative splicing. However, the effect of this overlap on coding transcripts is unknown. Unexpectedly, we show that neither Drosha silencing nor SF3b1 silencing changed the inclusion ratio of SO-miRNA exons. Two SO-miRNAs, located in genes that code for basal membrane proteins, are known to inhibit proliferation in primary keratinocytes. These SO-miRNAs were upregulated during differentiation and the host mRNAs were downregulated, but again there was no change in inclusion ratio of the SO-miRNA exons. Interestingly, Drosha silencing increased nascent RNA density, on chromatin, downstream of SO-miRNA exons. Overall our data suggest a novel mechanism for regulating gene expression in which MPC-dependent cleavage of SO-miRNA exons could cause premature transcriptional termination of coding genes rather than affecting alternative splicing. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Nishi, Morihiro; Matsumoto, Kazumasa; Fujita, Tetsuo; Iwamura, Masatsugu
2016-11-01
To evaluate the efficacy of laparoscopic pyeloplasty (LPP) for lower functioning kidney, we investigated the outcome of this procedure for patients with ureteropelvic junction obstruction with decreased renal function, defined as less than 20% split renal function. Between October 1998 and June 2015, we performed transperitoneal dismembered LPP in 224 patients. Among them, 15 patients with less than 20% split renal function were included in this study. Patient characteristics, perioperative split renal functions, complications, and surgical outcomes were retrospectively investigated. Fourteen of 15 patients had preoperative symptoms, including flank pain in 13 patients and gross hematuria in 1 patient. Preoperative 99mTc-mercaptoacetyltriglycine (MAG3) renogram revealed no response to diuretic injection and median split renal function was 16.5%. Median operative time and blood loss were 170 minutes and 20 mL, respectively. There were no complications during the perioperative period. Postoperative MAG3 renogram at 6 and 12 months after the operation revealed significantly increased split renal function (median: 23.8% and 23.7%, p = 0.001 and 0.008, respectively) and response to diuretic injection in all patients. Preoperative symptoms disappeared and no recurrence was seen during the follow-up period for all patients except for one who experienced flank pain again 4 months after the surgery. He subsequently underwent open pyeloplasty, and flank pain disappeared soon after. LPP for patients with low split renal function and flank pain significantly improved symptoms and split renal functions. Although the long-term clinical effects of LPP are unknown, we recommend performing LPP before considering nephrectomy for patients with lower functioning kidney.
Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N
2003-09-01
Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.
1994-12-31
Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less
A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches
Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael
2012-01-01
Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521
Exon definition as a potential negative force against intron losses in evolution.
Niu, Deng-Ke
2008-11-13
Previous studies have indicated that the wide variation in intron density (the number of introns per gene) among different eukaryotes largely reflects varying degrees of intron loss during evolution. The most popular model, which suggests that organisms lose introns through a mechanism in which reverse-transcribed cDNA recombines with the genomic DNA, concerns only one mutational force. Using exons as the units of splicing-site recognition, exon definition constrains the length of exons. An intron-loss event results in fusion of flanking exons and thus a larger exon. The large size of the newborn exon may cause splicing errors, i.e., exon skipping, if the splicing of pre-mRNAs is initiated by exon definition. By contrast, if the splicing of pre-mRNAs is initiated by intron definition, intron loss does not matter. Exon definition may thus be a selective force against intron loss. An organism with a high frequency of exon definition is expected to experience a low rate of intron loss throughout evolution and have a high density of spliceosomal introns. The majority of spliceosomal introns in vertebrates may be maintained during evolution not because of potential functions, but because of their splicing mechanism (i.e., exon definition). Further research is required to determine whether exon definition is a negative force in maintaining the high intron density of vertebrates. This article was reviewed by Dr. Scott W. Roy (nominated by Dr. John Logsdon), Dr.Eugene V. Koonin, and Dr. Igor B. Rogozin (nominated by Dr. Mikhail Gelfand). For the full reviews,please go to the Reviewers' comments section.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-07-13
... monitoring plans; (2) a request for waivers of certain Integrated Licensing Process (ILP) regulations...Hydro Group Ltd., mounted on completely submerged gravity foundations; (2) two 250-meter service cables connected at a subsea junction box or spliced to a 0.5-kilometer subsea transmission cable, connecting to a...
van Gool, Alain J.; Hajibagheri, Nasser M.A.; Stasiak, Andrzej; West, Stephen C.
1999-01-01
Genetic recombination can lead to the formation of intermediates in which DNA molecules are linked by Holliday junctions. Movement of a junction along DNA, by a process known as branch migration, leads to heteroduplex formation, whereas resolution of a junction completes the recombination process. Holliday junctions can be resolved in either of two ways, yielding products in which there has, or has not, been an exchange of flanking markers. The ratio of these products is thought to be determined by the frequency with which the two isomeric forms (conformers) of the Holliday junction are cleaved. Recent studies with enzymes that process Holliday junctions in Escherichia coli, the RuvABC proteins, however, indicate that protein binding causes the junction to adopt an open square-planar configuration. Within such a structure, DNA isomerization can have little role in determining the orientation of resolution. To determine the role that junction-specific protein assembly has in determining resolution bias, a defined in vitro system was developed in which we were able to direct the assembly of the RuvABC resolvasome. We found that the bias toward resolution in one orientation or the other was determined simply by the way in which the Ruv proteins were positioned on the junction. Additionally, we provide evidence that supports current models on RuvABC action in which Holliday junction resolution occurs as the resolvasome promotes branch migration. PMID:10421637
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaler, S.G.; Gahl, W.A.
1994-09-01
Menkes disease is an X linked recessive disorder of copper metabolism produced by abnormalities in a gene that encodes a copper transporting ATPase. The clinical spectrum of Menkes disease includes a range of neurological severity from the classical type to the occipital horn syndrome (OHS) in which slightly subnormal intelligence or signs of autonomic dysfunction are the only neurologic abnormalities. We previously documented a distinctive, less severe Menkes phenotype associated with a +3 intronic splice donor mutation at the 3{prime} end of the gene in which exon skipping occurred but some normally spliced message was also detectable. We now reportmore » a similar splicing mutation in a patient with a typical OHS phenotype an A to G transition at the 2 exonic position of a splice donor site in the middle of the Menkes coding sequence. Some normally sized transcripts are evident by RT-PCR of lymphoblast mRNA from this individual, as well as 2 truncated fragments generated by exon skipping and activation of a cryptic splice acceptor site, respectively. The predicted effect of the mutation on the gene product involves a serine to glycine substitution in a noncritical region of the Menkes ATPase from the patient`s normally sized message, and premature termination due to translational frameshift in both truncated transcripts. The mutation eliminates a Dde 1 restriction site in the gene which provided a method to rapidly screen other family members, and revealed that the patient`s mother is a non-carrier. The mutational base change was not present in 25 normal X chromosomes studied. Preliminary analysis of the Menkes locus in 5 other Menkes disease families indicates aberrant mRNA splicing in 2. Our findings confirm allelism at the Menkes locus, indicate that splice mutations are relatively common mutational event in Menkes disease, and suggest that splice mutations in which some normal splicing is preserved may underlie milder Menkes disease variants, including OHS.« less
Gromadzka, Agnieszka M.; Steckelberg, Anna-Lena; Singh, Kusum K.; Hofmann, Kay; Gehring, Niels H.
2016-01-01
The export of messenger RNAs (mRNAs) is the final of several nuclear posttranscriptional steps of gene expression. The formation of export-competent mRNPs involves the recruitment of export factors that are assumed to facilitate transport of the mature mRNAs. Using in vitro splicing assays, we show that a core set of export factors, including ALYREF, UAP56 and DDX39, readily associate with the spliced RNAs in an EJC (exon junction complex)- and cap-dependent manner. In order to elucidate how ALYREF and other export adaptors mediate mRNA export, we conducted a computational analysis and discovered four short, conserved, linear motifs present in RNA-binding proteins. We show that mutation in one of the new motifs (WxHD) in an unstructured region of ALYREF reduced RNA binding and abolished the interaction with eIF4A3 and CBP80. Additionally, the mutation impaired proper localization to nuclear speckles and export of a spliced reporter mRNA. Our results reveal important details of the orchestrated recruitment of export factors during the formation of export competent mRNPs. PMID:26773052
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-11
... supplied by OpenHydro Group Ltd., mounted on completely submerged gravity foundations; (2) two 250-meter service cables connected at a subsea junction box or spliced to a 0.5-kilometer subsea transmission cable... building; (4) a 140-meter long buried cable from the control building to the grid; and (5) appurtenant...
Application of hidden Markov models to biological data mining: a case study
NASA Astrophysics Data System (ADS)
Yin, Michael M.; Wang, Jason T.
2000-04-01
In this paper we present an example of biological data mining: the detection of splicing junction acceptors in eukaryotic genes. Identification or prediction of transcribed sequences from within genomic DNA has been a major rate-limiting step in the pursuit of genes. Programs currently available are far from being powerful enough to elucidate the gene structure completely. Here we develop a hidden Markov model (HMM) to represent the degeneracy features of splicing junction acceptor sites in eukaryotic genes. The HMM system is fully trained using an expectation maximization (EM) algorithm and the system performance is evaluated using the 10-way cross- validation method. Experimental results show that our HMM system can correctly classify more than 94% of the candidate sequences (including true and false acceptor sites) into right categories. About 90% of the true acceptor sites and 96% of the false acceptor sites in the test data are classified correctly. These results are very promising considering that only the local information in DNA is used. The proposed model will be a very important component of an effective and accurate gene structure detection system currently being developed in our lab.
Gandhi, Manish J; Pendergrass, Thomas W; Cummings, Carrie C; Ihara, Kenji; Blau, C Anthony; Drachman, Jonathan G
2005-10-01
An 11-year-old girl, presenting with fatigue and bruising, was found to be profoundly pancytopenic. Bone marrow exam and clinical evaluation were consistent with aplastic anemia. Family members were studied as potential stem cell donors, revealing that both younger siblings displayed significant thrombocytopenia, whereas both parents had normal blood counts. We evaluated this pedigree to understand the unusually late presentation of congenital amegakaryocytic thrombocytopenia (CAMT). The coding region and the intron/exon junctions of MPL were sequenced from each family member. Vectors representing each of the mutations were constructed and tested for the ability to support growth of Baf3/Mpl(mutant) cells. All three siblings had elevated thrombopoietin levels. Analysis of genomic DNA demonstrated that each parent had mutations/polymorphisms in a single MPL allele and that each child was a compound heterozygote, having inherited both abnormal alleles. The maternal allele encoded a mutation of the donor splice-junction at the exon-3/intron-3 boundary. A mini-gene construct encoding normal vs mutant versions of the intron-3 donor-site demonstrated that physiologic splicing was significantly reduced in the mutant construct. Mutations that incompletely eliminate Mpl expression/function may result in delayed diagnosis of CAMT and confusion with aplastic anemia.
New Splice Site Acceptor Mutation in AIRE Gene in Autoimmune Polyendocrine Syndrome Type 1
Mora, Mireia; Hanzu, Felicia A.; Pradas-Juni, Marta; Aranda, Gloria B.; Halperin, Irene; Puig-Domingo, Manuel; Aguiló, Sira; Fernández-Rebollo, Eduardo
2014-01-01
Autoimmune polyglandular syndrome type 1 (APS-1, OMIM 240300) is a rare autosomal recessive disorder, characterized by the presence of at least two of three major diseases: hypoparathyroidism, Addison’s disease, and chronic mucocutaneous candidiasis. We aim to identify the molecular defects and investigate the clinical and mutational characteristics in an index case and other members of a consanguineous family. We identified a novel homozygous mutation in the splice site acceptor (SSA) of intron 5 (c.653-1G>A) in two siblings with different clinical outcomes of APS-1. Coding DNA sequencing revealed that this AIRE mutation potentially compromised the recognition of the constitutive SSA of intron 5, splicing upstream onto a nearby cryptic SSA in intron 5. Surprisingly, the use of an alternative SSA entails the uncovering of a cryptic donor splice site in exon 5. This new transcript generates a truncated protein (p.A214fs67X) containing the first 213 amino acids and followed by 68 aberrant amino acids. The mutation affects the proper splicing, not only at the acceptor but also at the donor splice site, highlighting the complexity of recognizing suitable splicing sites and the importance of sequencing the intron-exon junctions for a more precise molecular diagnosis and correct genetic counseling. As both siblings were carrying the same mutation but exhibited a different APS-1 onset, and one of the brothers was not clinically diagnosed, our finding highlights the possibility to suspect mutations in the AIRE gene in cases of childhood chronic candidiasis and/or hypoparathyroidism otherwise unexplained, especially when the phenotype is associated with other autoimmune diseases. PMID:24988226
Shear zone junctions: Of zippers and freeways
NASA Astrophysics Data System (ADS)
Passchier, Cees W.; Platt, John P.
2017-02-01
Ductile shear zones are commonly treated as straight high-strain domains with uniform shear sense and characteristic curved foliation trails, bounded by non-deforming wall rock. Many shear zones, however, are branched, and if movement on such branches is contemporaneous, the resulting shape can be complicated and lead to unusual shear sense arrangement and foliation geometries in the wall rock. For Y-shaped shear zone triple junctions with three joining branches and transport direction at a high angle to the branchline, only eight basic types of junction are thought to be stable and to produce significant displacement. The simplest type, called freeway junctions, have similar shear sense in all three branches. The other types show joining or separating behaviour of shear zone branches similar to the action of a zipper. Such junctions may have shear zone branches that join to form a single branch (closing zipper junction), or a single shear zone that splits to form two branches, (opening zipper junction). All categories of shear zone junctions show characteristic foliation patterns and deflection of markers in the wall rock. Closing zipper junctions are unusual, since they form a non-active zone with opposite deflection of foliations in the wall rock known as an extraction fault or wake. Shear zipper junctions can form domains of overprinting shear sense along their flanks. A small and large field example are given from NE Spain and Eastern Anatolia. The geometry of more complex, 3D shear zone junctions with slip parallel and oblique to the branchline is briefly discussed.
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi; Shi, Yu
2016-02-01
The granulin/epithelin precursor (GEP) encodes a glycoprotein precursor which exhibits pleiotropic tissue growth factor activity with multiple functions. Here, GEP was isolated and its role in the shell biomineralization process of the pearl oyster Pinctada fucata was investigated. Three forms of GEP mRNA were isolated from the pearl oyster (designated PfGEP-1, PfGEP-2 and PfGEP-3). Genomic DNA flanking the splicing region of the PfGEP variants was sequenced and it was found that PfGEP-2 splices out Exon 4, whereas PfGEP-3 splices out Exon 3 compared to PfGEP-1. PfGEP-1 (1505 amino acids) consists of 18 granulin domains, whereas PfGEP-2 (1459 amino acids) and PfGEP-3 (1471 amino acids) consist of 17.5 granulin domains, respectively. Analyses of PfGEP-1 and PfGEP-3 mRNA showed differential patterns in the tissues and developmental stages. Western blotting results showed that the three splice variants can translate to proteins in HEK293T cells. A knockdown experiment using PfGEP dsRNA showed decreased PfGEP-1/PfGEP-3 and PfMSX mRNA, and irregular crystallization of the nacreous layer using scanning electron microscopy. In luciferase assays, co-transfection of PfGEP-1 could activate as well as repress luciferase expression of the reporter plasmid driven by the PfMSX promoter, whereas PfGEP-3 stimulated the expression, elucidating the molecular mechanisms involved in the correlation between PfGEP and PfMSX. These results suggested that GEP variants might function differently during the biomineralization process, which provides new knowledge on the mechanism regulating nacre formation.
Pipathsouk, Anne; Belotserkovskii, Boris P; Hanawalt, Philip C
2017-02-01
Non-canonical DNA structures can obstruct transcription. This transcription blockage could have various biological consequences, including genomic instability and gratuitous transcription-coupled repair. Among potential structures causing transcription blockage are Holliday junctions (HJs), which can be generated as intermediates in homologous recombination or during processing of stalled replication forks. Of particular interest is the double Holliday junction (DHJ), which contains two HJs. Topological considerations impose the constraint that the total number of helical turns in the DNA duplexes between the junctions cannot be altered as long as the flanking DNA duplexes are intact. Thus, the DHJ structure should strongly resist transient unwinding during transcription; consequently, it is predicted to cause significantly stronger blockage than single HJ structures. The patterns of transcription blockage obtained for RNA polymerase II transcription in HeLa cell nuclear extracts were in accordance with this prediction. However, we did not detect transcription blockage with purified T7 phage RNA polymerase; we discuss a possible explanation for this difference. In general, our findings implicate naturally occurring Holliday junctions in transcription arrest. Copyright © 2016 Elsevier B.V. All rights reserved.
Villate, Olatz; Ibarluzea, Nekane; Fraile-Bethencourt, Eugenia; Valenzuela, Alberto; Velasco, Eladio A; Grozeva, Detelina; Raymond, F L; Botella, María P; Tejada, María-Isabel
2018-01-01
Mutations in CHD7 have been shown to be a major cause of CHARGE syndrome, which presents many symptoms and features common to other syndromes making its diagnosis difficult. Next generation sequencing (NGS) of a panel of intellectual disability related genes was performed in an adult patient without molecular diagnosis. A splice donor variant in CHD7 (c.5665 + 1G > T) was identified. To study its potential pathogenicity, exons and flanking intronic sequences were amplified from patient DNA and cloned into the pSAD ® splicing vector. HeLa cells were transfected with this construct and a wild-type minigene and functional analysis were performed. The construct with the c.5665 + 1G > T variant produced an aberrant transcript with an insert of 63 nucleotides of intron 28 creating a premature termination codon (TAG) 25 nucleotides downstream. This would lead to the insertion of 8 new amino acids and therefore a truncated 1896 amino acid protein. As a result of this, the patient was diagnosed with CHARGE syndrome. Functional analyses underline their usefulness for studying the pathogenicity of variants found by NGS and therefore its application to accurately diagnose patients.
Cancer-Associated Perturbations in Alternative Pre-messenger RNA Splicing.
Shkreta, Lulzim; Bell, Brendan; Revil, Timothée; Venables, Julian P; Prinos, Panagiotis; Elela, Sherif Abou; Chabot, Benoit
2013-01-01
For most of our 25,000 genes, the removal of introns by pre-messenger RNA (pre-mRNA) splicing represents an essential step toward the production of functional messenger RNAs (mRNAs). Alternative splicing of a single pre-mRNA results in the production of different mRNAs. Although complex organisms use alternative splicing to expand protein function and phenotypic diversity, patterns of alternative splicing are often altered in cancer cells. Alternative splicing contributes to tumorigenesis by producing splice isoforms that can stimulate cell proliferation and cell migration or induce resistance to apoptosis and anticancer agents. Cancer-specific changes in splicing profiles can occur through mutations that are affecting splice sites and splicing control elements, and also by alterations in the expression of proteins that control splicing decisions. Recent progress in global approaches that interrogate splicing diversity should help to obtain specific splicing signatures for cancer types. The development of innovative approaches for annotating and reprogramming splicing events will more fully establish the essential contribution of alternative splicing to the biology of cancer and will hopefully provide novel targets and anticancer strategies. Metazoan genes are usually made up of several exons interrupted by introns. The introns are removed from the pre-mRNA by RNA splicing. In conjunction with other maturation steps, such as capping and polyadenylation, the spliced mRNA is then transported to the cytoplasm to be translated into a functional protein. The basic mechanism of splicing requires accurate recognition of each extremity of each intron by the spliceosome. Introns are identified by the binding of U1 snRNP to the 5' splice site and the U2AF65/U2AF35 complex to the 3' splice site. Following these interactions, other proteins and snRNPs are recruited to generate the complete spliceosomal complex needed to excise the intron. While many introns are constitutively removed by the spliceosome, other splice junctions are not used systematically, generating the phenomenon of alternative splicing. Alternative splicing is therefore the process by which a single species of pre-mRNA can be matured to produce different mRNA molecules (Fig. 1). Depending on the number and types of alternative splicing events, a pre-mRNA can generate from two to several thousands different mRNAs leading to the production of a corresponding number of proteins. It is now believed that the expression of at least 70 % of human genes is subjected to alternative splicing, implying an enormous contribution to proteomic diversity, and by extension, to the development and the evolution of complex animals. Defects in splicing have been associated with human diseases (Caceres and Kornblihtt, Trends Genet 18(4):186-93, 2002, Cartegni et al., Nat Rev Genet 3(4):285-98, 2002, Pagani and Baralle, Nat Rev Genet 5(5):389-96, 2004), including cancer (Brinkman, Clin Biochem 37(7):584-94, 2004, Venables, Bioessays 28(4):378-86, 2006, Srebrow and Kornblihtt, J Cell Sci 119(Pt 13):2635-2641, 2006, Revil et al., Bull Cancer 93(9):909-919, 2006, Venables, Transworld Res Network, 2006, Pajares et al., Lancet Oncol 8(4):349-57, 2007, Skotheim and Nees, Int J Biochem Cell Biol 39:1432-1449, 2007). Numerous studies have now confirmed the existence of specific differences in the alternative splicing profiles between normal and cancer tissues. Although there are a few cases where specific mutations are the primary cause for these changes, global alterations in alternative splicing in cancer cells may be primarily derived from changes in the expression of RNA-binding proteins that control splice site selection. Overall, these cancer-specific differences in alternative splicing offer an immense potential to improve the diagnosis and the prognosis of cancer. This review will focus on the functional impact of cancer-associated alternative splicing variants, the molecular determinants that alter the splicing decisions in cancer cells, and future therapeutic strategies.
Gromadzka, Agnieszka M; Steckelberg, Anna-Lena; Singh, Kusum K; Hofmann, Kay; Gehring, Niels H
2016-03-18
The export of messenger RNAs (mRNAs) is the final of several nuclear posttranscriptional steps of gene expression. The formation of export-competent mRNPs involves the recruitment of export factors that are assumed to facilitate transport of the mature mRNAs. Using in vitro splicing assays, we show that a core set of export factors, including ALYREF, UAP56 and DDX39, readily associate with the spliced RNAs in an EJC (exon junction complex)- and cap-dependent manner. In order to elucidate how ALYREF and other export adaptors mediate mRNA export, we conducted a computational analysis and discovered four short, conserved, linear motifs present in RNA-binding proteins. We show that mutation in one of the new motifs (WxHD) in an unstructured region of ALYREF reduced RNA binding and abolished the interaction with eIF4A3 and CBP80. Additionally, the mutation impaired proper localization to nuclear speckles and export of a spliced reporter mRNA. Our results reveal important details of the orchestrated recruitment of export factors during the formation of export competent mRNPs. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T
1992-03-24
P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solera, J.; Magallon, M.; Martin-Villar, J.
1992-02-01
DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less
Wire Crimp Termination Verification Using Ultrasonic Inspection
NASA Technical Reports Server (NTRS)
Perey, Daniel F.; Cramer, K. Elliott; Yost, William T.
2007-01-01
The development of a new ultrasonic measurement technique to quantitatively assess wire crimp terminations is discussed. The amplitude change of a compressional ultrasonic wave propagating through the junction of a crimp termination and wire is shown to correlate with the results of a destructive pull test, which is a standard for assessing crimp wire junction quality. Various crimp junction pathologies such as undercrimping, missing wire strands, incomplete wire insertion, partial insulation removal, and incorrect wire gauge are ultrasonically tested, and their results are correlated with pull tests. Results show that the nondestructive ultrasonic measurement technique consistently (as evidenced with destructive testing) predicts good crimps when ultrasonic transmission is above a certain threshold amplitude level. A physics-based model, solved by finite element analysis, describes the compressional ultrasonic wave propagation through the junction during the crimping process. This model is in agreement within 6% of the ultrasonic measurements. A prototype instrument for applying this technique while wire crimps are installed is also presented. The instrument is based on a two-jaw type crimp tool suitable for butt-splice type connections. Finally, an approach for application to multipin indenter type crimps will be discussed.
RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application.
D'Antonio, Mattia; D'Onorio De Meo, Paolo; Pallocca, Matteo; Picardi, Ernesto; D'Erchia, Anna Maria; Calogero, Raffaele A; Castrignanò, Tiziana; Pesole, Graziano
2015-01-01
The study of RNA has been dramatically improved by the introduction of Next Generation Sequencing platforms allowing massive and cheap sequencing of selected RNA fractions, also providing information on strand orientation (RNA-Seq). The complexity of transcriptomes and of their regulative pathways make RNA-Seq one of most complex field of NGS applications, addressing several aspects of the expression process (e.g. identification and quantification of expressed genes and transcripts, alternative splicing and polyadenylation, fusion genes and trans-splicing, post-transcriptional events, etc.). In order to provide researchers with an effective and friendly resource for analyzing RNA-Seq data, we present here RAP (RNA-Seq Analysis Pipeline), a cloud computing web application implementing a complete but modular analysis workflow. This pipeline integrates both state-of-the-art bioinformatics tools for RNA-Seq analysis and in-house developed scripts to offer to the user a comprehensive strategy for data analysis. RAP is able to perform quality checks (adopting FastQC and NGS QC Toolkit), identify and quantify expressed genes and transcripts (with Tophat, Cufflinks and HTSeq), detect alternative splicing events (using SpliceTrap) and chimeric transcripts (with ChimeraScan). This pipeline is also able to identify splicing junctions and constitutive or alternative polyadenylation sites (implementing custom analysis modules) and call for statistically significant differences in genes and transcripts expression, splicing pattern and polyadenylation site usage (using Cuffdiff2 and DESeq). Through a user friendly web interface, the RAP workflow can be suitably customized by the user and it is automatically executed on our cloud computing environment. This strategy allows to access to bioinformatics tools and computational resources without specific bioinformatics and IT skills. RAP provides a set of tabular and graphical results that can be helpful to browse, filter and export analyzed data, according to the user needs.
Free energy landscapes of RNA/RNA complexes: with applications to snRNA complexes in spliceosomes.
Cao, Song; Chen, Shi-Jie
2006-03-17
We develop a statistical mechanical model for RNA/RNA complexes with both intramolecular and intermolecular interactions. As an application of the model, we compute the free energy landscapes, which give the full distribution for all the possible conformations, for U4/U6 and U2/U6 in major spliceosome and U4atac/U6atac and U12/U6atac in minor spliceosome. Different snRNA experiments found contrasting structures, our free energy landscape theory shows why these structures emerge and how they compete with each other. For yeast U2/U6, the model predicts that the two distinct experimental structures, the four-helix junction structure and the helix Ib-containing structure, can actually coexist and specifically compete with each other. In addition, the energy landscapes suggest possible mechanisms for the conformational switches in splicing. For instance, our calculation shows that coaxial stacking is essential for stabilizing the four-helix junction in yeast U2/U6. Therefore, inhibition of the coaxial stacking possibly by protein-binding may activate the conformational switch from the four-helix junction to the helix Ib-containing structure. Moreover, the change of the energy landscape shape gives information about the conformational changes. We find multiple (native-like and misfolded) intermediates formed through base-pairing rearrangements in snRNA complexes. For example, the unfolding of the U2/U6 undergoes a transition to a misfolded state which is functional, while in the unfolding of U12/U6atac, the functional helix Ib is found to be the last one to unfold and is thus the most stable structural component. Furthermore, the energy landscape gives the stabilities of all the possible (functional) intermediates and such information is directly related to splicing efficiency.
Lemoine, E; Merceron, D; Sallantin, J; Nguifo, E M
1999-01-01
This paper describes a new approach to problem solving by splitting up problem component parts between software and hardware. Our main idea arises from the combination of two previously published works. The first one proposed a conceptual environment of concept modelling in which the machine and the human expert interact. The second one reported an algorithm based on reconfigurable hardware system which outperforms any kind of previously published genetic data base scanning hardware or algorithms. Here we show how efficient the interaction between the machine and the expert is when the concept modelling is based on reconfigurable hardware system. Their cooperation is thus achieved with an real time interaction speed. The designed system has been partially applied to the recognition of primate splice junctions sites in genetic sequences.
Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta
2012-01-01
Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917
Ramsden, Richard; Arms, Luther; Davis, Trisha N; Muller, Eric G D
2011-06-27
Inteins are proteins that catalyze their own removal from within larger precursor proteins. In the process they splice the flanking protein sequences, termed the N-and C-terminal exteins. Large inteins frequently have a homing endonuclease that is involved in maintaining the intein in the host. Splicing and nuclease activity are independent and distinct domains in the folded structure. We show here that other biochemical activities can be incorporated into an intein in place of the endonuclease without affecting splicing and that these activities can provide genetic selection for the intein. We have coupled such a genetically marked intein with GFP as the N-terminal extein to create a cassette to introduce GFP within the interior of a targeted protein. The Pch PRP8 mini-intein of Penicillium chrysogenum was modified to include: 1) aminoglycoside phosphotransferase; 2) imidazoleglycerol-phosphate dehydratase, His5 from S. pombe ; 3) hygromycin B phosphotransferase; and 4) the transcriptional activator LexA-VP16. The proteins were inserted at the site of the lost endonuclease. When expressed in E. coli, all of the modified inteins spliced at high efficiency. Splicing efficiency was also greater than 96% when expressed from a plasmid in S. cerevisiae. In addition the inteins conferred either G418 or hygromycin resistance, or histidine or leucine prototropy, depending on the inserted marker and the yeast genetic background. DNA encoding the marked inteins coupled to GFP as the N-terminal extein was PCR amplified with ends homologous to an internal site in the yeast calmodulin gene CMD1. The DNA was transformed into yeast and integrants obtained by direct selection for the intein's marker. The His5-marked intein yielded a fully functional calmodulin that was tagged with GFP within its central linker. Inteins continue to show their flexibility as tools in molecular biology. The Pch PRP8 intein can successfully tolerate a variety of genetic markers and still retain high splicing efficiency. We have shown that a genetically marked intein can be used to insert GFP in one-step within a target protein in vivo.
Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan
2018-01-01
CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.
Identifying single bases in a DNA oligomer with electron tunnelling.
Huang, Shuo; He, Jin; Chang, Shuai; Zhang, Peiming; Liang, Feng; Li, Shengqin; Tuchband, Michael; Fuhrmann, Alexander; Ros, Robert; Lindsay, Stuart
2010-12-01
It has been proposed that single molecules of DNA could be sequenced by measuring the physical properties of the bases as they pass through a nanopore. Theoretical calculations suggest that electron tunnelling can identify bases in single-stranded DNA without enzymatic processing, and it was recently experimentally shown that tunnelling can sense individual nucleotides and nucleosides. Here, we report that tunnelling electrodes functionalized with recognition reagents can identify a single base flanked by other bases in short DNA oligomers. The residence time of a single base in a recognition junction is on the order of a second, but pulling the DNA through the junction with a force of tens of piconewtons would yield reading speeds of tens of bases per second.
Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H
2009-11-01
Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
Schultz, Kris Ann; Harris, Anne; Messinger, Yoav; Sencer, Susan; Baldinger, Shari; Dehner, Louis P.; Hill, D. Ashley
2015-01-01
Germline DICER1 mutations have been described in individuals with pleuropulmonary blastoma (PPB), ovarian Sertoli-Leydig cell tumor (SLCT), sarcomas, multinodular goiter, thyroid carcinoma, cystic nephroma and other neoplastic conditions. Early results from the International Ovarian and Testicular Stromal Tumor Registry show germline DICER1 mutations in 48% of girls and women with SLCT. In this report, a young woman presented with ovarian undifferentiated sarcoma. Four years later, she presented with SLCT. She was successfully treated for both malignancies. Sequence results showed a germline intronic mutation in DICER1. This mutation results in an exact duplication of the six bases at the splice site at the intron 23 and exon 24 junction. Predicted improper splicing leads to inclusion of 10 bases of intronic sequence, frameshift and premature truncation of the protein disrupting the RNase IIIb domain. A second individual with SLCT was found to have an identical germline mutation. In each of the ovarian tumors, an additional somatic mutation in the RNase IIIb domain of DICER1 was found. In rare patients, germline intronic mutations in DICER1 that are predicted to cause incorrect splicing can also contribute to the pathogenesis of SLCT. PMID:26289771
Transcriptional diversity during lineage commitment of human blood progenitors.
Chen, Lu; Kostadima, Myrto; Martens, Joost H A; Canu, Giovanni; Garcia, Sara P; Turro, Ernest; Downes, Kate; Macaulay, Iain C; Bielczyk-Maczynska, Ewa; Coe, Sophia; Farrow, Samantha; Poudel, Pawan; Burden, Frances; Jansen, Sjoert B G; Astle, William J; Attwood, Antony; Bariana, Tadbir; de Bono, Bernard; Breschi, Alessandra; Chambers, John C; Consortium, Bridge; Choudry, Fizzah A; Clarke, Laura; Coupland, Paul; van der Ent, Martijn; Erber, Wendy N; Jansen, Joop H; Favier, Rémi; Fenech, Matthew E; Foad, Nicola; Freson, Kathleen; van Geet, Chris; Gomez, Keith; Guigo, Roderic; Hampshire, Daniel; Kelly, Anne M; Kerstens, Hindrik H D; Kooner, Jaspal S; Laffan, Michael; Lentaigne, Claire; Labalette, Charlotte; Martin, Tiphaine; Meacham, Stuart; Mumford, Andrew; Nürnberg, Sylvia; Palumbo, Emilio; van der Reijden, Bert A; Richardson, David; Sammut, Stephen J; Slodkowicz, Greg; Tamuri, Asif U; Vasquez, Louella; Voss, Katrin; Watt, Stephen; Westbury, Sarah; Flicek, Paul; Loos, Remco; Goldman, Nick; Bertone, Paul; Read, Randy J; Richardson, Sylvia; Cvejic, Ana; Soranzo, Nicole; Ouwehand, Willem H; Stunnenberg, Hendrik G; Frontini, Mattia; Rendon, Augusto
2014-09-26
Blood cells derive from hematopoietic stem cells through stepwise fating events. To characterize gene expression programs driving lineage choice, we sequenced RNA from eight primary human hematopoietic progenitor populations representing the major myeloid commitment stages and the main lymphoid stage. We identified extensive cell type-specific expression changes: 6711 genes and 10,724 transcripts, enriched in non-protein-coding elements at early stages of differentiation. In addition, we found 7881 novel splice junctions and 2301 differentially used alternative splicing events, enriched in genes involved in regulatory processes. We demonstrated experimentally cell-specific isoform usage, identifying nuclear factor I/B (NFIB) as a regulator of megakaryocyte maturation-the platelet precursor. Our data highlight the complexity of fating events in closely related progenitor populations, the understanding of which is essential for the advancement of transplantation and regenerative medicine. Copyright © 2014, American Association for the Advancement of Science.
Mapping RNA-seq Reads with STAR
Dobin, Alexander; Gingeras, Thomas R.
2015-01-01
Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, signal visualization, and so forth. In this unit we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is Open Source software that can be run on Unix, Linux or Mac OS X systems. PMID:26334920
Mapping RNA-seq Reads with STAR.
Dobin, Alexander; Gingeras, Thomas R
2015-09-03
Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates, providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, and signal visualization. In this unit, we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is open source software that can be run on Unix, Linux, or Mac OS X systems. Copyright © 2015 John Wiley & Sons, Inc.
Multicystic dysplastic kidneys suggesting hydronephrosis during Tc-DTPA imaging
DOE Office of Scientific and Technical Information (OSTI.GOV)
Siddiqui, A.R.; Cohen, M.; Mitchell, M.E.
1982-10-01
Tc-99m DTPA renal scans on two infants with flank masses were interpreted as consistent with hydronephrosis and obstruction of the uretopelvic junction because of delayed accumulation of the radiotracer in the initially photon-deficient regions. However, both these patients were found to have multicystic dysplastic kidney. It appears that for proper diagnosis more attention should be paid to the location of the functioning cortex rather than to the delayed images.
Filichkin, Sergei A.; Hamilton, Michael; Dharmawardhana, Palitha D.; Singh, Sunil K.; Sullivan, Christopher; Ben-Hur, Asa; Reddy, Anireddy S. N.; Jaiswal, Pankaj
2018-01-01
Abiotic stresses affect plant physiology, development, growth, and alter pre-mRNA splicing. Western poplar is a model woody tree and a potential bioenergy feedstock. To investigate the extent of stress-regulated alternative splicing (AS), we conducted an in-depth survey of leaf, root, and stem xylem transcriptomes under drought, salt, or temperature stress. Analysis of approximately one billion of genome-aligned RNA-Seq reads from tissue- or stress-specific libraries revealed over fifteen millions of novel splice junctions. Transcript models supported by both RNA-Seq and single molecule isoform sequencing (Iso-Seq) data revealed a broad array of novel stress- and/or tissue-specific isoforms. Analysis of Iso-Seq data also resulted in the discovery of 15,087 novel transcribed regions of which 164 show AS. Our findings demonstrate that abiotic stresses profoundly perturb transcript isoform profiles and trigger widespread intron retention (IR) events. Stress treatments often increased or decreased retention of specific introns – a phenomenon described here as differential intron retention (DIR). Many differentially retained introns were regulated in a stress- and/or tissue-specific manner. A subset of transcripts harboring super stress-responsive DIR events showed persisting fluctuations in the degree of IR across all treatments and tissue types. To investigate coordinated dynamics of intron-containing transcripts in the study we quantified absolute copy number of isoforms of two conserved transcription factors (TFs) using Droplet Digital PCR. This case study suggests that stress treatments can be associated with coordinated switches in relative ratios between fully spliced and intron-retaining isoforms and may play a role in adjusting transcriptome to abiotic stresses. PMID:29483921
Li, Fang; Vensko, Steven P.; Belikoff, Esther J.; Scott, Maxwell J.
2013-01-01
Transformer (TRA) promotes female development in several dipteran species including the Australian sheep blowfly Lucilia cuprina, the Mediterranean fruit fly, housefly and Drosophila melanogaster. tra transcripts are sex-specifically spliced such that only the female form encodes full length functional protein. The presence of six predicted TRA/TRA2 binding sites in the sex-specific female intron of the L. cuprina gene suggested that tra splicing is auto-regulated as in medfly and housefly. With the aim of identifying conserved motifs that may play a role in tra sex-specific splicing, here we have isolated and characterized the tra gene from three additional blowfly species, L. sericata, Cochliomyia hominivorax and C. macellaria. The blowfly adult male and female transcripts differ in the choice of splice donor site in the first intron, with males using a site downstream of the site used in females. The tra genes all contain a single TRA/TRA2 site in the male exon and a cluster of four to five sites in the male intron. However, overall the sex-specific intron sequences are poorly conserved in closely related blowflies. The most conserved regions are around the exon/intron junctions, the 3′ end of the intron and near the cluster of TRA/TRA2 sites. We propose a model for sex specific regulation of tra splicing that incorporates the conserved features identified in this study. In L. sericata embryos, the male tra transcript was first detected at around the time of cellular blastoderm formation. RNAi experiments showed that tra is required for female development in L. sericata and C. macellaria. The isolation of the tra gene from the New World screwworm fly C. hominivorax, a major livestock pest, will facilitate the development of a “male-only” strain for genetic control programs. PMID:23409170
RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application
2015-01-01
Background The study of RNA has been dramatically improved by the introduction of Next Generation Sequencing platforms allowing massive and cheap sequencing of selected RNA fractions, also providing information on strand orientation (RNA-Seq). The complexity of transcriptomes and of their regulative pathways make RNA-Seq one of most complex field of NGS applications, addressing several aspects of the expression process (e.g. identification and quantification of expressed genes and transcripts, alternative splicing and polyadenylation, fusion genes and trans-splicing, post-transcriptional events, etc.). Moreover, the huge volume of data generated by NGS platforms introduces unprecedented computational and technological challenges to efficiently analyze and store sequence data and results. Methods In order to provide researchers with an effective and friendly resource for analyzing RNA-Seq data, we present here RAP (RNA-Seq Analysis Pipeline), a cloud computing web application implementing a complete but modular analysis workflow. This pipeline integrates both state-of-the-art bioinformatics tools for RNA-Seq analysis and in-house developed scripts to offer to the user a comprehensive strategy for data analysis. RAP is able to perform quality checks (adopting FastQC and NGS QC Toolkit), identify and quantify expressed genes and transcripts (with Tophat, Cufflinks and HTSeq), detect alternative splicing events (using SpliceTrap) and chimeric transcripts (with ChimeraScan). This pipeline is also able to identify splicing junctions and constitutive or alternative polyadenylation sites (implementing custom analysis modules) and call for statistically significant differences in genes and transcripts expression, splicing pattern and polyadenylation site usage (using Cuffdiff2 and DESeq). Results Through a user friendly web interface, the RAP workflow can be suitably customized by the user and it is automatically executed on our cloud computing environment. This strategy allows to access to bioinformatics tools and computational resources without specific bioinformatics and IT skills. RAP provides a set of tabular and graphical results that can be helpful to browse, filter and export analyzed data, according to the user needs. PMID:26046471
The developmental transcriptome of Drosophila melanogaster
DOE Office of Scientific and Technical Information (OSTI.GOV)
University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.
Drosophila melanogaster is one of the most well studied genetic model organisms; nonetheless, its genome still contains unannotated coding and non-coding genes, transcripts, exons and RNA editing sites. Full discovery and annotation are pre-requisites for understanding how the regulation of transcription, splicing and RNA editing directs the development of this complex organism. Here we used RNA-Seq, tiling microarrays and cDNA sequencing to explore the transcriptome in 30 distinct developmental stages. We identified 111,195 new elements, including thousands of genes, coding and non-coding transcripts, exons, splicing and editing events, and inferred protein isoforms that previously eluded discovery using established experimental, predictionmore » and conservation-based approaches. These data substantially expand the number of known transcribed elements in the Drosophila genome and provide a high-resolution view of transcriptome dynamics throughout development. Drosophila melanogaster is an important non-mammalian model system that has had a critical role in basic biological discoveries, such as identifying chromosomes as the carriers of genetic information and uncovering the role of genes in development. Because it shares a substantial genic content with humans, Drosophila is increasingly used as a translational model for human development, homeostasis and disease. High-quality maps are needed for all functional genomic elements. Previous studies demonstrated that a rich collection of genes is deployed during the life cycle of the fly. Although expression profiling using microarrays has revealed the expression of, 13,000 annotated genes, it is difficult to map splice junctions and individual base modifications generated by RNA editing using such approaches. Single-base resolution is essential to define precisely the elements that comprise the Drosophila transcriptome. Estimates of the number of transcript isoforms are less accurate than estimates of the number of genes. Whereas, 20% of Drosophila genes are annotated as encoding alternatively spliced premRNAs, splice-junction microarray experiments indicate that this number is at least 40% (ref. 7). Determining the diversity of mRNAs generated by alternative promoters, alternative splicing and RNA editing will substantially increase the inferred protein repertoire. Non-coding RNA genes (ncRNAs) including short interfering RNAs (siRNAs) and microRNAS (miRNAs) (reviewed in ref. 10), and longer ncRNAs such as bxd (ref. 11) and rox (ref. 12), have important roles in gene regulation, whereas others such as small nucleolar RNAs (snoRNAs)and small nuclear RNAs (snRNAs) are important components of macromolecular machines such as the ribosome and spliceosome. The transcription and processing of these ncRNAs must also be fully documented and mapped. As part of the modENCODE project to annotate the functional elements of the D. melanogaster and Caenorhabditis elegans genomes, we used RNA-Seq and tiling microarrays to sample the Drosophila transcriptome at unprecedented depth throughout development from early embryo to ageing male and female adults. We report on a high-resolution view of the discovery, structure and dynamic expression of the D. melanogaster transcriptome.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suchi, Mariko; Mizuno, Haruo; Tsuboi, Takashi
Uridine monophosphate (UMP) synthase is a bifunctional enzyme catalyzing the last two steps of de novo pyrimidine biosynthesis, orotate phosphoribosyltransferase (OPRT) and orotidine-5{prime}-monophosphate decarboxylase (ODC). Loss of either enzymatic activity results in hereditary orotic aciduria, a rare autosomal recessive disorder characterized by retarded growth, anemia, and excessive urinary excretion of orotic acid. We have isolated the UMP synthase chromosomal gene from a {lambda}EMBL-3 human genomic library and report a single-copy gene spanning {approximately}15 kb. The UMP synthase genomic structure encodes six exons ranging in size from 115 bp to 672 bp, and all splicing junctions adhere to the canonical GT/AGmore » rule. Cognate promoter elements implicated in glucocorticoid- and cAMP-mediated regulation as well as in liver-, myeloid-, and lymphocyte-specific expression are located within the 5{prime} flanking sequence. Molecular investigation of UMP synthase deficiency in a Japanese orotic aciduria patient revealed mutations R96G (A- to-G transition; nt 286) and G429R (G-to-C transversion; nt 1285) in one allele and V109G (T-to-G transversion; nt 326) in the other allele. Expression of human UMP synthase cDNAs containing these mutations in pyrimidine auxotrophic Escherichia coli and in recombinant baculovirus-infected Sf21 cells demonstrates impaired activity presumably associated with the urinary orotic acid substrate accumulations observed in vivo. We further establish the identity of two polymorphisms, G213A ({nu} = .26) and 440 Gpoly ({nu} = .27) located in exons 3 and 6, respectively, which did not significantly compromise either OPRT or ODC function. 76 refs., 5 figs., 7 tabs.« less
Parra-Unda, Ricardo; Vaca-Paniagua, Felipe; Jiménez, Lucia; Landa, Abraham
2012-01-01
Cytosolic Cu,Zn superoxide dismutase (Cu,Zn-SOD) catalyzes the dismutation of superoxide (O(2)(-)) to oxygen and hydrogen peroxide (H(2)O(2)) and plays an important role in the establishment and survival of helminthes in their hosts. In this work, we describe the Taenia solium Cu,Zn-SOD gene (TsCu,Zn-SOD) and a Taenia crassiceps (TcCu,Zn-SOD) cDNA. TsCu,Zn-SOD gene that spans 2.841 kb, and has three exons and two introns; the splicing junctions follow the GT-AG rule. Analysis in silico of the gene revealed that the 5'-flanking region has three putative TATA and CCAAT boxes, and transcription factor binding sites for NF1 and AP1. The transcription start site was a C, located at 22 nucleotides upstream of the translation start codon (ATG). Southern blot analysis showed that TcCu,Zn-SOD and TsCu,Zn-SOD genes are encoded by a single copy. The deduced amino acid sequences of TsCu,Zn-SOD gene and TcCu,Zn-SOD cDNA reveal 98.47% of identity, and the characteristic motives, including the catalytic site and β-barrel structure of the Cu,Zn-SOD. Proteomic and immunohistochemical analysis indicated that Cu,Zn-SOD does not have isoforms, is distributed throughout the bladder wall and is concentrated in the tegument of T. solium and T. crassiceps cysticerci. Expression analysis revealed that TcCu,Zn-SOD mRNA and protein expression levels do not change in cysticerci, even upon exposure to O(2)(-) (0-3.8 nmol/min) and H(2)O(2) (0-2mM), suggesting that this gene is constitutively expressed in these parasites. Published by Elsevier Inc.
Zeng, Weihong; Liu, Xinmei; Liu, Zhicui; Zheng, Ying; Yu, Tiantian; Fu, Shaliu; Li, Xiao; Zhang, Jing; Zhang, Siming; Ma, Xiaoling; Liu, Xiao-Rui; Qin, Xiaoli; Khanniche, Asma; Zhang, Yan; Tian, Fuju; Lin, Yi
2018-01-01
Decidual CD8 + (dCD8) T cells have been proposed to play important roles in immune protection against the invading pathogens and in tolerance toward the growing semi-allogeneic fetus during early pregnancy. However, their phenotypic and functional characteristics remain poorly defined. Here, we performed the first analysis of the transcriptional and alternative splicing (AS) signatures for human first-trimester dCD8 T cells using high-throughput mRNA sequencing. Our data revealed that dCD8 T cells have distinct transcriptional and AS landscapes when compared with their autologous peripheral blood CD8 + (pCD8) T counterparts. Furthermore, human dCD8 T cells were observed to contain CD8-Treg and effector-memory T-cell subsets, and display enhanced functionality in terms of degranulation and cytokine production on a per-cell basis. Additionally, we have identified the novel splice junctions that use a high ratio of the non-canonical splicing motif GC-AG and found that AS is not a major contributor to the gene expression-level changes between paired pCD8 and dCD8 T cells. Together, our findings not only provide a comprehensive framework of the transcriptional and AS landscapes but also reveal the functional feature of human dCD8 T cells, which are of great importance in understanding the biology of these cells and the physiology of human healthy pregnancy.
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
An RNAi-enhanced Logic Circuit for Cancer Specific Detection and Destruction
2010-07-01
Bcl-2 family: mBax (Mus musculus), hBax ( Homo sapiens ), and its mutant hBax-S184A [4]. A plasmid containing the tested gene was transfected into HEK...the far-red fluorescent protein mKate to express the Gata3 mStaple. Intron- feature sequences – donor site, branch point, poly- pyrimidine tract, and...intron-exon junction. Among the donor and acceptor sequences found in literature our intron features were chosen according SplicePort [5], an
2011-01-01
Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer cell lines. Conclusions Deep transcriptional sequencing and analysis with targeted and spliced alignment methods can effectively identify TIC events across the genome in individual tissues. Prostate and reference samples exhibit a wide range of TIC events, involving more genes than estimated previously using ESTs. Tissue specificity of TIC events is correlated with expression patterns of the upstream gene. Some TIC events, such as MSMB-NCOA4, may play functional roles in cancer. PMID:21261984
Khurana, Simran; Chakraborty, Sharmistha; Zhao, Xuan; Liu, Yu; Guan, Dongyin; Lam, Minh; Huang, Wei; Yang, Sichun; Kao, Hung-Ying
2012-01-01
α-Actinins (ACTNs) are a family of proteins cross-linking actin filaments that maintain cytoskeletal organization and cell motility. Recently, it has also become clear that ACTN4 can function in the nucleus. In this report, we found that ACTN4 (full length) and its spliced isoform ACTN4 (Iso) possess an unusual LXXLL nuclear receptor interacting motif. Both ACTN4 (full length) and ACTN4 (Iso) potentiate basal transcription activity and directly interact with estrogen receptor α, although ACTN4 (Iso) binds ERα more strongly. We have also found that both ACTN4 (full length) and ACTN4 (Iso) interact with the ligand-independent and the ligand-dependent activation domains of estrogen receptor α. Although ACTN4 (Iso) interacts efficiently with transcriptional co-activators such as p300/CBP-associated factor (PCAF) and steroid receptor co-activator 1 (SRC-1), the full length ACTN4 protein either does not or does so weakly. More importantly, the flanking sequences of the LXXLL motif are important not only for interacting with nuclear receptors but also for the association with co-activators. Taken together, we have identified a novel extended LXXLL motif that is critical for interactions with both receptors and co-activators. This motif functions more efficiently in a spliced isoform of ACTN4 than it does in the full-length protein. PMID:22908231
Waluk, Dominik P; Zur, Gila; Kaufmann, Ronnie; Welle, Monika M; Jagannathan, Vidhya; Drögemüller, Cord; Müller, Eliane J; Leeb, Tosso; Galichet, Arnaud
2016-09-08
X-linked hypohidrotic ectodermal dysplasia (XLHED) caused by variants in the EDA gene represents the most common ectodermal dysplasia in humans. We investigated three male mixed-breed dogs with an ectodermal dysplasia phenotype characterized by marked hypotrichosis and multifocal complete alopecia, almost complete absence of sweat and sebaceous glands, and altered dentition with missing and abnormally shaped teeth. Analysis of SNP chip genotypes and whole genome sequence data from the three affected dogs revealed that the affected dogs shared the same haplotype on a large segment of the X-chromosome, including the EDA gene. Unexpectedly, the whole genome sequence data did not reveal any nonsynonymous EDA variant in the affected dogs. We therefore performed an RNA-seq experiment on skin biopsies to search for changes in the transcriptome. This analysis revealed that the EDA transcript in the affected dogs lacked 103 nucleotides encoded by exon 2. We speculate that this exon skipping is caused by a genetic variant located in one of the large introns flanking this exon, which was missed by whole genome sequencing with the illumina short read technology. The altered EDA transcript splicing most likely causes the observed ectodermal dysplasia in the affected dogs. These dogs thus offer an excellent opportunity to gain insights into the complex splicing processes required for expression of the EDA gene, and other genes with large introns. Copyright © 2016 Waluk et al.
Yu, Yi; Panhuysen, Carolien; Kranzler, Henry R; Hesselbrock, Victor; Rounsaville, Bruce; Weiss, Roger; Brady, Kathleen; Farrer, Lindsay A; Gelernter, Joel
2006-07-15
We report here a study considering association of alleles and haplotypes at the DOPA decarboxylase (DDC) locus with the DSM-IV diagnosis of nicotine dependence (ND) or a quantitative measure for ND using the Fagerstrom Test for Nicotine Dependence (FTND). We genotyped 18 single nucleotide polymorphisms (SNPs) spanning a region of approximately 210 kb that includes DDC and the genes immediately flanking DDC in 1,590 individuals from 621 families of African-American (AA) or European-American (EA) ancestry. Evidence of association (family-based tests) was observed with several SNPs for both traits (0.0002
Meurs, Kathryn M; Lahmers, Sunshine; Keene, Bruce W; White, Stephen N; Oyama, Mark A; Mauceli, Evan; Lindblad-Toh, Kerstin
2012-08-01
Familial dilated cardiomyopathy is a primary myocardial disease that can result in the development of congestive heart failure and sudden cardiac death. Spontaneous animal models of familial dilated cardiomyopathy exist and the Doberman pinscher dog is one of the most commonly reported canine breeds. The objective of this study was to evaluate familial dilated cardiomyopathy in the Doberman pinscher dog using a genome-wide association study for a genetic alteration(s) associated with the development of this disease in this canine model. Genome-wide association analysis identified an area of statistical significance on canine chromosome 14 (p(raw) = 9.999e-05 corrected for genome-wide significance), fine-mapping of additional SNPs flanking this region localized a signal to 23,774,190-23,781,919 (p = 0.001) and DNA sequencing identified a 16-base pair deletion in the 5' donor splice site of intron 10 of the pyruvate dehydrogenase kinase 4 gene in affected dogs (p < 0.0001). Electron microscopy of myocardium from affected dogs demonstrated disorganization of the Z line, mild to moderate T tubule and sarcoplasmic reticulum dilation, marked pleomorphic mitochondrial alterations with megamitochondria, scattered mitochondria with whorling and vacuolization and mild aggregates of lipofuscin granules. In conclusion, we report the identification of a splice site deletion in the PDK4 gene that is associated with the development of familial dilated cardiomyopathy in the Doberman pinscher dog.
Krajewski, Wojciech; Wojciechowska, Joanna; Dembowski, Janusz; Zdrojowy, Romuald; Szydełko, Tomasz
2017-08-01
Ureteropelvic junction obstruction (UPJO) causes a reduction in the urine flow from the renal pelvis into the ureter. Untreated UPJO may cause hydronephrosis, chronic infection or urolithiasis and will often result in progressive deterioration of renal function. Most cases of UPJO are congenital; however, the disease can be clinically silent until adulthood. Other causes, both intrinsic and extrinsic, are acquired and include urolithiasis, post-operative/inflammatory/ischemic stricture, fibroepithelial polyps, adhesions and malignancy. In the past, the most frequent symptom of UPJO in neonates and infants was a palpable flank mass. Nowadays, thanks to the widespread use of maternal and prenatal ultrasound examinations, asymptomatic hydronephrosis is diagnosed very early. In adults and older children symptoms may include intermittent abdominal or flank pain, nausea, vomiting and hematuria. In addition to high specificity and sensitivity in detecting UPJO, modern technologically advanced equipment such as ultrasound, magnetic resonance imaging and computed tomography provides a lot of information about the function of the affected kidney and the anatomy of the surrounding tissues. Treatment options for UPJO include a wide spectrum of approaches, from active surveillance or minimally invasive endourologic techniques to open, laparoscopic or robotic pyeloplasty. The main goal of therapy is to relieve symptoms and maintain or improve renal function, but it is difficult to define treatment success after UPJO therapy.
Santo, Evan E; Paik, Jihye
2018-06-17
The rapid development of CRISPR technology is revolutionizing molecular approaches to the dissection of complex biological phenomena. Here we describe an alternative generally applicable implementation of the CRISPR-Cas9 system that allows for selective knockdown of extremely homologous genes. This strategy employs the lentiviral delivery of paired sgRNAs and nickase Cas9 (Cas9D10A) to achieve targeted deletion of splice junctions. This general strategy offers several advantages over standard single-guide exon-targeting CRISPR-Cas9 such as greatly reduced off-target effects, more restricted genomic editing, routine disruption of target gene mRNA expression and the ability to differentiate between closely related genes. Here we demonstrate the utility of this strategy by achieving selective knockdown of the highly homologous human genes FOXO3A and suspected pseudogene FOXO3B. We find the spJCRISPR strategy to efficiently and selectively disrupt FOXO3A and FOXO3B mRNA and protein expression; thus revealing that the human FOXO3B locus encodes a bona fide human gene. Unlike FOXO3A, we find the FOXO3B protein to be cytosolically localized in both the presence and absence of active Akt. The ability to selectively target and efficiently disrupt the expression of the closely-related FOXO3A and FOXO3B genes demonstrates the efficacy of the spJCRISPR approach. Copyright © 2018. Published by Elsevier B.V.
Thieme, Frank; Marillonnet, Sylvestre
2014-01-01
Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.
Livingstone, Mark; Folkman, Lukas; Yang, Yuedong; Zhang, Ping; Mort, Matthew; Cooper, David N; Liu, Yunlong; Stantic, Bela; Zhou, Yaoqi
2017-10-01
Synonymous single-nucleotide variants (SNVs), although they do not alter the encoded protein sequences, have been implicated in many genetic diseases. Experimental studies indicate that synonymous SNVs can lead to changes in the secondary and tertiary structures of DNA and RNA, thereby affecting translational efficiency, cotranslational protein folding as well as the binding of DNA-/RNA-binding proteins. However, the importance of these various features in disease phenotypes is not clearly understood. Here, we have built a support vector machine (SVM) model (termed DDIG-SN) as a means to discriminate disease-causing synonymous variants. The model was trained and evaluated on nearly 900 disease-causing variants. The method achieves robust performance with the area under the receiver operating characteristic curve of 0.84 and 0.85 for protein-stratified 10-fold cross-validation and independent testing, respectively. We were able to show that the disease-causing effects in the immediate proximity to exon-intron junctions (1-3 bp) are driven by the loss of splicing motif strength, whereas the gain of splicing motif strength is the primary cause in regions further away from the splice site (4-69 bp). The method is available as a part of the DDIG server at http://sparks-lab.org/ddig. © 2017 Wiley Periodicals, Inc.
Ma, Nina S; Malloy, Peter J; Pitukcheewanont, Pisit; Dreimane, Daina; Geffner, Mitchell E; Feldman, David
2009-10-01
To study the vitamin D receptor (VDR) gene in a young girl with severe rickets and clinical features of hereditary vitamin D resistant rickets, including hypocalcemia, hypophosphatemia, partial alopecia, and elevated serum levels of 1,25-dihydroxyvitamin D. We amplified and sequenced DNA samples from blood from the patient, her mother, and the patient's two siblings. We also amplified and sequenced the VDR cDNA from RNA isolated from the patient's blood. DNA sequence analyses of the VDR gene showed that the patient was homozygous for a novel guanine to thymine substitution in the 5'-splice site in the exon 8-intron J junction. Analysis of the VDR cDNA using reverse transcriptase-polymerase chain reaction showed that exons 7 and 9 were fused, and that exon 8 was skipped. The mother was heterozygous for the mutation and the two siblings were unaffected. A novel splice site mutation was identified in the VDR gene that caused exon 8 to be skipped. The mutation deleted amino acids 303-341 in the VDR ligand-binding domain, which is expected to render the VDR non-functional. Nevertheless, successful outpatient treatment was achieved with frequent high doses of oral calcium.
Willemse, Hermia; Theodoratos, Angelo; Smith, Paul N; Dulhunty, Angela F
2016-02-01
The skeletal muscle ryanodine receptor Ca(2+) release channel (RyR1), essential for excitation-contraction (EC) coupling, demonstrates a known developmentally regulated alternative splicing in the ASI region. We now find unexpectedly that the expression of the splice variants is closely related to fiber type in adult human lower limb muscles. We examined the distribution of myosin heavy chain isoforms and ASI splice variants in gluteus minimus, gluteus medius and vastus medialis from patients aged 45 to 85 years. There was a strong positive correlation between ASI(+)RyR1 and the percentage of type 2 fibers in the muscles (r = 0.725), and a correspondingly strong negative correlation between the percentages of ASI(+)RyR1 and percentage of type 1 fibers. When the type 2 fiber data were separated into type 2X and type 2A, the correlation with ASI(+)RyR1 was stronger in type 2X fibers (r = 0.781) than in type 2A fibers (r = 0.461). There was no significant correlation between age and either fiber-type composition or ASI(+)RyR1/ASI(-)RyR1 ratio. The results suggest that the reduced expression of ASI(-)RyR1 during development may reflect a reduction in type 1 fibers during development. Preferential expression of ASI(-) RyR1, having a higher gain of in Ca(2+) release during EC coupling than ASI(+)RyR1, may compensate for the reduced terminal cisternae volume, fewer junctional contacts and reduced charge movement in type 1 fibers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
W Vallen Graham; A Magis; K Bailey
2011-12-31
Myosin light-chain kinase-dependent tight junction regulation is a critical event in inflammatory cytokine-induced increases in epithelial paracellular permeability. MLCK is expressed in human intestinal epithelium as two isoforms, long MLCK1 and long MLCK2, and MLCK1 is specifically localized to the tight junction, where it regulates paracellular permeability. The sole difference between these long MLCK splice variants is the presence of an immunoglobulin-like cell-adhesion molecule domain, IgCAM3, in MLCK1. To gain insight into the structure of the IgCAM3 domain, the IgCAM3 domain of MLCK1 has been expressed, purified and crystallized. Preliminary X-ray diffraction data were collected to 2.0 {angstrom} resolution andmore » were consistent with the primitive trigonal space group P2{sub 1}2{sub 1}2{sub 1}.« less
Risky business: Microhomology-mediated end joining.
Sinha, Supriya; Villarreal, Diana; Shim, Eun Yong; Lee, Sang Eun
2016-06-01
Prevalence of microhomology (MH) at the breakpoint junctions in somatic and germ-line chromosomal rearrangements and in the programmed immune receptor rearrangements from cells deficient in classical end joining reveals an enigmatic process called MH-mediated end joining (MMEJ). MMEJ repairs DNA double strand breaks (DSBs) by annealing flanking MH and deleting genetic information at the repair junctions from yeast to humans. Being genetically distinct from canonical DNA DSB pathways, MMEJ is involved with the fusions of eroded/uncapped telomeres as well as with the assembly of chromosome fragments in chromothripsis. In this review article, we will discuss an up-to-date model representing the MMEJ process and the mechanism by which cells regulate MMEJ to limit repair-associated mutagenesis. We will also describe the possible therapeutic gains resulting from the inhibition of MMEJ in recombination deficient cancers. Lastly, we will embark on two contentious issues associated with MMEJ such as the significance of MH at the repair junction to be the hallmark of MMEJ and the relationship of MMEJ to other mechanistically related DSB repair pathways. Copyright © 2015 Elsevier B.V. All rights reserved.
Simulation-based comprehensive benchmarking of RNA-seq aligners
Baruzzo, Giacomo; Hayer, Katharina E; Kim, Eun Ji; Di Camillo, Barbara; FitzGerald, Garret A; Grant, Gregory R
2018-01-01
Alignment is the first step in most RNA-seq analysis pipelines, and the accuracy of downstream analyses depends heavily on it. Unlike most steps in the pipeline, alignment is particularly amenable to benchmarking with simulated data. We performed a comprehensive benchmarking of 14 common splice-aware aligners for base, read, and exon junction-level accuracy and compared default with optimized parameters. We found that performance varied by genome complexity, and accuracy and popularity were poorly correlated. The most widely cited tool underperforms for most metrics, particularly when using default settings. PMID:27941783
Concurrent and Accurate Short Read Mapping on Multicore Processors.
Martínez, Héctor; Tárraga, Joaquín; Medina, Ignacio; Barrachina, Sergio; Castillo, Maribel; Dopazo, Joaquín; Quintana-Ortí, Enrique S
2015-01-01
We introduce a parallel aligner with a work-flow organization for fast and accurate mapping of RNA sequences on servers equipped with multicore processors. Our software, HPG Aligner SA (HPG Aligner SA is an open-source application. The software is available at http://www.opencb.org, exploits a suffix array to rapidly map a large fraction of the RNA fragments (reads), as well as leverages the accuracy of the Smith-Waterman algorithm to deal with conflictive reads. The aligner is enhanced with a careful strategy to detect splice junctions based on an adaptive division of RNA reads into small segments (or seeds), which are then mapped onto a number of candidate alignment locations, providing crucial information for the successful alignment of the complete reads. The experimental results on a platform with Intel multicore technology report the parallel performance of HPG Aligner SA, on RNA reads of 100-400 nucleotides, which excels in execution time/sensitivity to state-of-the-art aligners such as TopHat 2+Bowtie 2, MapSplice, and STAR.
Human heavy chain disease protein WIS: implications for the organization of immunoglobulin genes.
Franklin, E C; Prelli, F; Frangione, B
1979-01-01
Protein WIS is a human gamma3 heavy (H) chain disease immunoglobulin variant whose amino acid sequence is most readily interpreted by postulating that three residues of the amino terminus are followed by a deletion of most of the variable (VH) domain, which ends at the variable-constant (VC) joining region. Then there is a stretch of eight residues, three of which are unusual, while the other five have striking homology to the VC junction sequence. This is followed by a second deletion, which ends at the beginning of the quadruplicated hinge region. These findings are consistent with mutations resulting in deletions of most of the gene coding for the V region and CH1 domain followed by splicing at the VC joining region and at the hinge. These structural features fit well the notion of genetic discontinuity between V and C genes and also suggest similar mechanisms of excision and splicing in the interdomain regions of the C gene of the heavy chain. PMID:106391
Sun, Lan; Irudayaraj, Joseph
2009-01-01
We demonstrate a surface enhanced Raman spectroscopy (SERS) based array platform to monitor gene expression in cancer cells in a multiplex and quantitative format without amplification steps. A strategy comprising of DNA/RNA hybridization, S1 nuclease digestion, and alkaline hydrolysis was adopted to obtain DNA targets specific to two splice junction variants Δ(9, 10) and Δ(5) of the breast cancer susceptibility gene 1 (BRCA1) from MCF-7 and MDA-MB-231 breast cancer cell lines. These two targets were identified simultaneously and their absolute quantities were estimated by a SERS strategy utilizing the inherent plasmon-phonon Raman mode of gold nanoparticle probes as a self-referencing standard to correct for variability in surface enhancement. Results were then validated by reverse transcription PCR (RT-PCR). Our proposed methodology could be expanded to a higher level of multiplexing for quantitative gene expression analysis of any gene without any amplification steps. PMID:19780515
Riffo-Campos, Ángela L; Gimeno-Valiente, Francisco; Rodríguez, Fernanda M; Cervantes, Andrés; López-Rodas, Gerardo; Franco, Luis; Castillo, Josefa
2018-04-17
Mutation-driven activation of KRAS is crucial to cancer development. The human gene yields four mRNA splicing isoforms, 4A and 4B being translated to protein. Their different properties and oncogenic potential have been studied, but the mechanisms deciding the ratio 4A/4B are not known. To address this issue, the expression of the four KRAS isoforms was determined in 9 human colorectal cancer cell lines. HCT116 and SW48 were further selected because they present the highest difference in the ratio 4A/4B (twice as much in HCT116 than in SW48). Chromatin structure was analysed at the exon 4A, characteristic of isoform 4A, at its intronic borders and at the two flanking exons. The low nucleosome occupancy at exon 4A in both cell lines may result in a fast transcriptional rate, which would explain the general lower abundance of isoform 4A, also found in cells and tissues by other authors, but due to its similarity between both cell lines, chromatin structure does not influence alternative splicing. DNA methylation downstream exon 4A significantly differs in HCT116 and SW48 cells, but the CCCTC-binding factor, which affects the processivity of RNA polymerase and the alternative splicing, does not bind the differentially methylated sequences. Quantitative epigenetic analysis at mononucleosomal level revealed significant differences between both cell lines in H3K4me3, H3K27me3, H3K36me3, H3K9ac, H3K27ac and H4K20me1, and the inhibition of some histone-modifying enzymes alters the ratio 4A/4B. It can be concluded that the epigenetic modification of histones has an influence on the selection of isoforms 4A and 4B.
Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M
2015-03-15
Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Ajiro, Masahiko
2015-01-01
ABSTRACT Transcripts of human papillomavirus 16 (HPV16) E6 and E7 oncogenes undergo alternative RNA splicing to produce multiple splice isoforms. However, the importance of these splice isoforms is poorly understood. Here we report a critical role of E6^E7, a novel isoform containing the 41 N-terminal amino acid (aa) residues of E6 and the 38 C-terminal aa residues of E7, in the regulation of E6 and E7 stability. Through mass spectrometric analysis, we identified that HSP90 and GRP78, which are frequently upregulated in cervical cancer tissues, are two E6^E7-interacting proteins responsible for the stability and function of E6^E7, E6, and E7. Although GRP78 and HSP90 do not bind each other, GRP78, but not HSP90, interacts with E6 and E7. E6^E7 protein, in addition to self-binding, interacts with E6 and E7 in the presence of GRP78 and HSP90, leading to the stabilization of E6 and E7 by prolonging the half-life of each protein. Knocking down E6^E7 expression in HPV16-positive CaSki cells by a splice junction-specific small interfering RNA (siRNA) destabilizes E6 and E7 and prevents cell growth. The same is true for the cells with a GRP78 knockdown or in the presence of an HSP90 inhibitor. Moreover, mapping and alignment analyses for splicing elements in 36 alpha-HPVs (α-HPVs) suggest the possible expression of E6^E7 mostly by other oncogenic or possibly oncogenic α-HPVs (HPV18, -30, -31, -39, -42, -45, -56, -59, -70, and -73). HPV18 E6^E7 is detectable in HPV18-positive HeLa cells and HPV18-infected raft tissues. All together, our data indicate that viral E6^E7 and cellular GRP78 or HSP90 might be novel targets for cervical cancer therapy. PMID:25691589
Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E
2001-08-01
Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.
GH-releasing hormone receptor gene: a novel splice-disrupting mutation and study of founder effects.
Marui, Suemi; Trarbach, Ericka B; Boguszewski, Margaret C S; França, Marcela M; Jorge, Alexander A L; Inoue, Hiroshi; Nishi, Mirian Y; de Lacerda Filho, Luiz; Aguiar-Oliveira, Manuel H; Mendonca, Berenice B; Arnhold, Ivo J P
2012-01-01
Mutations in GH-releasing hormone receptor gene (GHRHR) are emerging as the most common cause of autosomal recessive isolated GH deficiency (IGHD). To search for GHRHR mutations in patients with familial or sporadic IGHD and to investigate founder effects in recurring mutations. The coding region of GHRHR was entirely amplified and sequenced from DNA of 18 patients with IGHD (16 unrelated) with topic posterior pituitary lobe on MRI. Haplotypes containing promoter SNPs and microsatellites flanking GHRHR were analyzed in patients with c.57+1G>A (IVS1+1G>A) mutation of our previously published kindred and also a Brazilian patient and 2 previously reported Japanese sisters with c.1146G>A (p.E382E) mutation. A novel homozygous intronic GHRHR c.752-1G>A (IVS7-1G>A) mutation, predicting loss of the constitutive splice acceptor site, was identified in two siblings with IGHD. A compound heterozygous c.[57+1G>A];[1146G>A] and a heterozygous c.527C>T (p.A176V) were found in two sporadic cases. Haplotype analysis provided evidence for a founder effect for the c.57+1G>A mutation and independent recurrence for the c.1146G>A mutation. We report a novel splice-disrupting mutation in GHRHR in 2 siblings and provide evidence that all c.57+1G>A (IVS1+1G>A) mutant chromosomes have the same haplotype ancestor, indicating the occurrence of a founder effect in Brazilian patients with IGHD. Copyright © 2012 S. Karger AG, Basel.
Liu, Zhong-Yu; Yu, Jiu-Yang; Huang, Xing-Yao; Fan, Hang; Li, Xiao-Feng; Deng, Yong-Qiang; Ji, Xue; Cheng, Meng-Li; Ye, Qing; Zhao, Hui; Han, Jian-Feng; An, Xiao-Ping; Jiang, Tao; Zhang, Bo; Tong, Yi-Gang; Qin, Cheng-Feng
2017-11-01
Zika virus (ZIKV) has caused significant outbreaks and epidemics in the Americas recently, raising global concern due to its ability to cause microcephaly and other neurological complications. A stable and efficient infectious clone of ZIKV is urgently needed. However, the instability and toxicity of flavivirus cDNA clones in Escherichia coli hosts has hindered the development of ZIKV infectious clones. Here, using a novel self-splicing ribozyme-based strategy, we generated a stable infectious cDNA clone of a contemporary ZIKV strain imported from Venezuela to China in 2016. The constructed clone contained a modified version of the group II self-splicing intron P.li.LSUI2 near the junction between the E and NS1 genes, which were removed from the RNA transcripts by an easy-to-establish in vitro splicing reaction. Transfection of the spliced RNAs into BHK-21 cells led to the production of infectious progeny virus that resembled the parental virus. Finally, potential cis -acting RNA elements in ZIKV genomic RNA were identified based on this novel reverse genetics system, and the critical role of 5'-SLA promoter and 5'-3' cyclization sequences were characterized by a combination of different assays. Our results provide another stable and reliable reverse genetics system for ZIKV that will help study ZIKV infection and pathogenesis, and the novel self-splicing intron-based strategy could be further expanded for the construction of infectious clones from other emerging and reemerging flaviviruses. IMPORTANCE The ongoing Zika virus (ZIKV) outbreaks have drawn global concern due to the unexpected causal link to fetus microcephaly and other severe neurological complications. The infectious cDNA clones of ZIKV are critical for the research community to study the virus, understand the disease, and inform vaccine design and antiviral screening. A panel of existing technologies have been utilized to develop ZIKV infectious clones. Here, we successfully generated a stable infectious clone of a 2016 ZIKV strain using a novel self-splicing ribozyme-based technology that abolished the potential toxicity of ZIKV cDNA clones to the E. coli host. Moreover, two crucial cis -acting replication elements (5'-SLA and 5'-CS) of ZIKV were first identified using this novel reverse genetics system. This novel self-splicing ribozyme-based reverse genetics platform will be widely utilized in future ZIKV studies and provide insight for the development of infectious clones of other emerging viruses. Copyright © 2017 American Society for Microbiology.
Liu, Zhong-Yu; Yu, Jiu-Yang; Huang, Xing-Yao; Fan, Hang; Li, Xiao-Feng; Deng, Yong-Qiang; Ji, Xue; Cheng, Meng-Li; Ye, Qing; Zhao, Hui; Han, Jian-Feng; An, Xiao-Ping; Jiang, Tao; Zhang, Bo; Tong, Yi-Gang
2017-01-01
ABSTRACT Zika virus (ZIKV) has caused significant outbreaks and epidemics in the Americas recently, raising global concern due to its ability to cause microcephaly and other neurological complications. A stable and efficient infectious clone of ZIKV is urgently needed. However, the instability and toxicity of flavivirus cDNA clones in Escherichia coli hosts has hindered the development of ZIKV infectious clones. Here, using a novel self-splicing ribozyme-based strategy, we generated a stable infectious cDNA clone of a contemporary ZIKV strain imported from Venezuela to China in 2016. The constructed clone contained a modified version of the group II self-splicing intron P.li.LSUI2 near the junction between the E and NS1 genes, which were removed from the RNA transcripts by an easy-to-establish in vitro splicing reaction. Transfection of the spliced RNAs into BHK-21 cells led to the production of infectious progeny virus that resembled the parental virus. Finally, potential cis-acting RNA elements in ZIKV genomic RNA were identified based on this novel reverse genetics system, and the critical role of 5′-SLA promoter and 5′-3′ cyclization sequences were characterized by a combination of different assays. Our results provide another stable and reliable reverse genetics system for ZIKV that will help study ZIKV infection and pathogenesis, and the novel self-splicing intron-based strategy could be further expanded for the construction of infectious clones from other emerging and reemerging flaviviruses. IMPORTANCE The ongoing Zika virus (ZIKV) outbreaks have drawn global concern due to the unexpected causal link to fetus microcephaly and other severe neurological complications. The infectious cDNA clones of ZIKV are critical for the research community to study the virus, understand the disease, and inform vaccine design and antiviral screening. A panel of existing technologies have been utilized to develop ZIKV infectious clones. Here, we successfully generated a stable infectious clone of a 2016 ZIKV strain using a novel self-splicing ribozyme-based technology that abolished the potential toxicity of ZIKV cDNA clones to the E. coli host. Moreover, two crucial cis-acting replication elements (5′-SLA and 5′-CS) of ZIKV were first identified using this novel reverse genetics system. This novel self-splicing ribozyme-based reverse genetics platform will be widely utilized in future ZIKV studies and provide insight for the development of infectious clones of other emerging viruses. PMID:28814522
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Chiancone, Francesco; Fedelini, Maurizio; Pucci, Luigi; Meccariello, Clemente; Fedelini, Paolo
2017-01-01
ABSTRACT Purpose To describe and analyze our experience with Anderson-Hynes transperitoneal laparoscopic pyeloplasty (LP) in the treatment of recurrent ureteropelvic junction obstruction (UPJO). Materials and methods 38 consecutive patients who underwent transperitoneal laparoscopic redo-pyeloplasty between January 2007 and January 2015 at our department were included in the analysis. 36 patients were previously treated with dismembered pyeloplasty and 2 patients underwent a retrograde endopyelotomy. All patients were symptomatic and all patients had a T1/2>20 minutes at pre-operative DTPA (diethylene-triamine-pentaacetate) renal scan. All data were collected in a prospectively maintained database and retrospectively analyzed. Intraoperative and postoperative complications have been reported according to the Satava and the Clavien-Dindo system. Treatment success was evaluated by a 12 month-postoperative renal scan. Total success was defined as T1/2≤10 minutes while relative success was defined as T1/2between 10 to 20 minutes. Post-operative hydronephrosis and flank pain were also evaluated. Results Mean operating time was 103.16±30 minutes. The mean blood loss was 122.37±73.25mL. The mean postoperative hospital stay was 4.47±0.86 days. No intraoperative complications occurred. 6 out of 38 patients (15.8%) experienced postoperative complications. The success rate was 97.4% for flank pain and 97.4% for hydronephrosis. Post-operative renal scan showed radiological failure in one out of 38 (2.6%) patients, relative success in 2 out of 38 (5.3%) patients and total success in 35 out of 38 (92.1%) of patients. Conclusion Laparoscopic redo-pyeloplasty is a feasible procedure for the treatment of recurrent ureteropelvic junction obstruction (UPJO), with a low rate of post-operative complications and a high success rate in high laparoscopic volume centers. PMID:28191792
Single Molecule Spectroscopy of Amino Acids and Peptides by Recognition Tunneling
Zhao, Yanan; Ashcroft, Brian; Zhang, Peiming; Liu, Hao; Sen, Suman; Song, Weisi; Im, JongOne; Gyarfas, Brett; Manna, Saikat; Biswas, Sovan; Borges, Chad; Lindsay, Stuart
2014-01-01
The human proteome has millions of protein variants due to alternative RNA splicing and post-translational modifications, and variants that are related to diseases are frequently present in minute concentrations. For DNA and RNA, low concentrations can be amplified using the polymerase chain reaction, but there is no such reaction for proteins. Therefore, the development of single molecule protein sequencing is a critical step in the search for protein biomarkers. Here we show that single amino acids can be identified by trapping the molecules between two electrodes that are coated with a layer of recognition molecules and measuring the electron tunneling current across the junction. A given molecule can bind in more than one way in the junction, and we therefore use a machine-learning algorithm to distinguish between the sets of electronic ‘fingerprints’ associated with each binding motif. With this recognition tunneling technique, we are able to identify D, L enantiomers, a methylated amino acid, isobaric isomers, and short peptides. The results suggest that direct electronic sequencing of single proteins could be possible by sequentially measuring the products of processive exopeptidase digestion, or by using a molecular motor to pull proteins through a tunnel junction integrated with a nanopore. PMID:24705512
Diverse growth hormone receptor gene mutations in Laron syndrome.
Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U
1993-01-01
To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849
Harun, Fatimah; Jalaludin, Muhammad Yazid; Lim, Chor Yin; Ng, Khoon Leong
2014-01-01
The c.2268dup mutation in thyroid peroxidase (TPO) gene was reported to be a founder mutation in Taiwanese patients with dyshormonogenetic congenital hypothyroidism (CH). The functional impact of the mutation is not well documented. In this study, homozygous c.2268dup mutation was detected in two Malaysian-Chinese sisters with goitrous CH. Normal and alternatively spliced TPO mRNA transcripts were present in thyroid tissues of the two sisters. The abnormal transcript contained 34 nucleotides originating from intron 12. The c.2268dup is predicted to generate a premature termination codon (PTC) at position 757 (p.Glu757X). Instead of restoring the normal reading frame, the alternatively spliced transcript has led to another stop codon at position 740 (p.Asp739ValfsX740). The two PTCs are located at 116 and 201 nucleotides upstream of the exons 13/14 junction fulfilling the requirement for a nonsense-mediated mRNA decay (NMD). Quantitative RT-PCR revealed an abundance of unidentified transcripts believed to be associated with the NMD. TPO enzyme activity was not detected in both patients, even though a faint TPO band of about 80 kD was present. In conclusion, the c.2268dup mutation leads to the formation of normal and alternatively spliced TPO mRNA transcripts with a consequential loss of TPO enzymatic activity in Malaysian-Chinese patients with goitrous CH. PMID:24745015
Rail-RNA: scalable analysis of RNA-seq splicing and coverage.
Nellore, Abhinav; Collado-Torres, Leonardo; Jaffe, Andrew E; Alquicira-Hernández, José; Wilks, Christopher; Pritt, Jacob; Morton, James; Leek, Jeffrey T; Langmead, Ben
2017-12-15
RNA sequencing (RNA-seq) experiments now span hundreds to thousands of samples. Current spliced alignment software is designed to analyze each sample separately. Consequently, no information is gained from analyzing multiple samples together, and it requires extra work to obtain analysis products that incorporate data from across samples. We describe Rail-RNA, a cloud-enabled spliced aligner that analyzes many samples at once. Rail-RNA eliminates redundant work across samples, making it more efficient as samples are added. For many samples, Rail-RNA is more accurate than annotation-assisted aligners. We use Rail-RNA to align 667 RNA-seq samples from the GEUVADIS project on Amazon Web Services in under 16 h for US$0.91 per sample. Rail-RNA outputs alignments in SAM/BAM format; but it also outputs (i) base-level coverage bigWigs for each sample; (ii) coverage bigWigs encoding normalized mean and median coverages at each base across samples analyzed; and (iii) exon-exon splice junctions and indels (features) in columnar formats that juxtapose coverages in samples in which a given feature is found. Supplementary outputs are ready for use with downstream packages for reproducible statistical analysis. We use Rail-RNA to identify expressed regions in the GEUVADIS samples and show that both annotated and unannotated (novel) expressed regions exhibit consistent patterns of variation across populations and with respect to known confounding variables. Rail-RNA is open-source software available at http://rail.bio. anellore@gmail.com or langmea@cs.jhu.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Nadimi, Maryam; Beaudet, Denis; Forget, Lise; Hijri, Mohamed; Lang, B Franz
2012-09-01
Gigaspora rosea is a member of the arbuscular mycorrhizal fungi (AMF; Glomeromycota) and a distant relative of Glomus species that are beneficial to plant growth. To allow for a better understanding of Glomeromycota, we have sequenced the mitochondrial DNA of G. rosea. A comparison with Glomus mitochondrial genomes reveals that Glomeromycota undergo insertion and loss of mitochondrial plasmid-related sequences and exhibit considerable variation in introns. The gene order between the two species is almost completely reshuffled. Furthermore, Gigaspora has fragmented cox1 and rns genes, and an unorthodox initiator tRNA that is tailored to decoding frequent UUG initiation codons. For the fragmented cox1 gene, we provide evidence that its RNA is joined via group I-mediated trans-splicing, whereas rns RNA remains in pieces. According to our model, the two cox1 precursor RNA pieces are brought together by flanking cox1 exon sequences that form a group I intron structure, potentially in conjunction with the nad5 intron 3 sequence. Finally, we present analyses that address the controversial phylogenetic association of Glomeromycota within fungi. According to our results, Glomeromycota are not a separate group of paraphyletic zygomycetes but branch together with Mortierellales, potentially also Harpellales.
Ousterout, David G; Kabadi, Ami M; Thakore, Pratiksha I; Perez-Pinera, Pablo; Brown, Matthew T; Majoros, William H; Reddy, Timothy E; Gersbach, Charles A
2015-01-01
Duchenne muscular dystrophy (DMD) is caused by genetic mutations that result in the absence of dystrophin protein expression. Oligonucleotide-induced exon skipping can restore the dystrophin reading frame and protein production. However, this requires continuous drug administration and may not generate complete skipping of the targeted exon. In this study, we apply genome editing with zinc finger nucleases (ZFNs) to permanently remove essential splicing sequences in exon 51 of the dystrophin gene and thereby exclude exon 51 from the resulting dystrophin transcript. This approach can restore the dystrophin reading frame in ~13% of DMD patient mutations. Transfection of two ZFNs targeted to sites flanking the exon 51 splice acceptor into DMD patient myoblasts led to deletion of this genomic sequence. A clonal population was isolated with this deletion and following differentiation we confirmed loss of exon 51 from the dystrophin mRNA transcript and restoration of dystrophin protein expression. Furthermore, transplantation of corrected cells into immunodeficient mice resulted in human dystrophin expression localized to the sarcolemmal membrane. Finally, we quantified ZFN toxicity in human cells and mutagenesis at predicted off-target sites. This study demonstrates a powerful method to restore the dystrophin reading frame and protein expression by permanently deleting exons. PMID:25492562
Vigentini, Ileana; De Lorenzis, Gabriella; Picozzi, Claudia; Imazio, Serena; Merico, Annamaria; Galafassi, Silvia; Piškur, Jure; Foschino, Roberto
2012-06-15
In enology, "Brett" character refers to the wine spoilage caused by the yeast Dekkera/Brettanomyces bruxellensis and its production of volatile phenolic off-flavours. However, the spoilage potential of this yeast is strain-dependent. Therefore, a rapid and reliable recognition at the strain level is a key point to avoid serious economic losses. The present work provides an operative tool to assess the genetic intraspecific variation in this species through the use of introns as molecular targets. Firstly, the available partial D./B. bruxellensis genome sequence was investigated in order to build primers annealing to introns 5' splice site sequence (ISS). This analysis allowed the detection of a non-random vocabulary flanking the site and, exploiting this feature, the creation of specific probes for strain discrimination. Secondly, the separation of the intron splice site PCR fragments was obtained throughout the set up of a capillary electrophoresis protocol, giving a 94% repeatability threshold in our experimental conditions. The comparison of results obtained with ISS-PCR/CE versus the ones performed by mtDNA RFLP revealed that the former protocol is more discriminating and allowed a reliable identification at strain level. Actually sixty D./B. bruxellensis isolates were recognised as unique strains, showing a level of similarity below 79% and confirming the high genetic polymorphism existing within the species. Two main clusters were grouped at similarity levels of about 46% and 47%, respectively, showing a poor correlation with the geographic area of isolation. Moreover, from the evolutionary point of view, the proposed technique could determine the frequency of the genome rearrangements that can occur in D./B. bruxellesis populations. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Quartau, R.; Omira, R.; Ramalho, I.; Baptista, M. A.; Mitchell, N. C.
2015-12-01
The Azores archipelago is a set of nine volcanic islands in the middle of the North Atlantic, close to the triple junction between the North American, Eurasian and African plates. Due to their location, the islands are seismic and volcanically active, which makes them especially vulnerable to these types of hazards that could eventually trigger flank collapses, capable of generating destructive tsunamis. However, solid evidence of large-scale flank collapses has only been found recently in Pico Island (Costa et al., 2014; Quartau et al., 2015). This study investigates for the first time the tsunami effects of a flank collapse of the northeastern subaerial slope of Pico Island that occurred more than 70 ka ago. We first reconstructed the pre-event sub-aerial morphology of the island, and then numerically model the flank failure involving an estimated volume of ~8 km3, its flow toward and under the sea of ~14 km, and the subsequent tsunami generation and propagation. The modelling suggests that the collapse of Pico created a mega-tsunami that significantly impacted the coast of adjacent São Jorge Island only after 7 minutes after generation, with wave run-up reaching a maximum of 50 m at some coastlines. Most of the tsunami energy became trapped in the semi-enclosed basin between Pico and São Jorge Islands, with only relatively little energy escaping to neighboring islands. Acknowledgments The author wishes to acknowledge the European Union's Seventh Framework Programme (FP7/2007-2013) under grant agreement n° 603839 (Project ASTARTE - Assessment, Strategy and Risk Reduction for Tsunamis in Europe)" for its major contribution for the success of this study. Publication supported by project FCT UID/GEO/50019/2013 - Instituto Dom Luiz. The author also acknowledges Fundação Luso-Americana para o Desenvolvimento for supporting the participation in the meeting.
Temporal and spatial expression of Drosophila DLGS97 during neural development.
Albornoz, Valeria; Mendoza-Topaz, Carolina; Oliva, Carlos; Tello, Judith; Olguín, Patricio; Sierralta, Jimena
2008-07-01
The products of the Drosophila discs-large (dlg) gene are members of the MAGUK family of proteins, a group of proteins involved in localization, transport and recycling of receptors and channels in cell junctions, including the synapse. In vertebrates, four genes with multiple splice variants homologous to dlg are described. dlg originates two main proteins, DLGA, similar to the vertebrate neuronal protein PSD95, and DLGS97, similar to the vertebrate neuronal and epithelial protein SAP97. DLGA is expressed in epithelia, neural tissue and muscle. DLGS97 is expressed in neural tissue and muscle but not in epithelia. The distinctive difference between them is the presence in DLGS97 of an L27 domain. The differential expression between these variants makes the study of DLGS97 of key relevance to understand the in vivo role of synaptic MAGUKs in neurons. Here we present the temporal and spatial expression pattern of DLGS97 during embryonic and larval nervous system development, during eye development and in adult brain. Our results show that DLGS97 is expressed zygotically, in neurons in the embryo, larvae and adult, and is absent at all stages in glial cells. During eye development DLGS97 starts to be expressed in photoreceptor cells at early stages of differentiation and localizes basal to the basolateral junctions. In the brain, DLGS97 is expressed in the mushroom bodies and optic lobes at larval and adult stages; and in the antennal lobe in the adult stage. In addition we show that both, dlgS97 and dlgA transcripts, express during development multiple splice variants with differences in the use of exons in two sites.
A Method For The Verification Of Wire Crimp Compression Using Ultrasonic Inspection
NASA Technical Reports Server (NTRS)
Cramer, K. E.; Perey, Daniel F.; Yost, William t.
2010-01-01
The development of a new ultrasonic measurement technique to assess quantitatively wire crimp terminations is discussed. The amplitude change of a compressional ultrasonic wave propagating at right angles to the wire axis and through the junction of a crimp termination is shown to correlate with the results of a destructive pull test, which is a standard for assessing crimp wire junction quality. To demonstrate the technique, the case of incomplete compression of crimped connections is ultrasonically tested, and the results are correlated with pull tests. Results show that the nondestructive ultrasonic measurement technique consistently predicts good crimps when the ultrasonic transmission is above a certain threshold amplitude level. A quantitative measure of the quality of the crimped connection based on the ultrasonic energy transmitted is shown to respond accurately to crimp quality. A wave propagation model, solved by finite element analysis, describes the compressional ultrasonic wave propagation through the junction during the crimping process. This model is in agreement within 6% of the ultrasonic measurements. A prototype instrument for applying this technique while wire crimps are installed is also presented. The instrument is based on a two-jaw type crimp tool suitable for butt-splice type connections. A comparison of the results of two different instruments is presented and shows reproducibility between instruments within a 95% confidence bound.
Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.
1990-01-01
Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764
RtcB is the RNA ligase component of an Escherichia coli RNA repair operon.
Tanaka, Naoko; Shuman, Stewart
2011-03-11
RNA 2',3'-cyclic phosphate ends play important roles in RNA metabolism as substrates for RNA ligases during tRNA restriction-repair and tRNA splicing. Diverse bacteria from multiple phyla encode a two-component RNA repair cassette, comprising Pnkp (polynucleotide kinase-phosphatase-ligase) and Hen1 (RNA 3'-terminal ribose 2'-O-methyltransferase), that heals and then seals broken tRNAs with 2',3'-cyclic phosphate and 5'-OH ends. The Pnkp-Hen1 repair operon is absent in the majority of bacterial species, thereby raising the prospect that other RNA repair systems might be extant. A candidate component is RNA 3'-phosphate cyclase, a widely distributed enzyme that transforms RNA 3'-monophosphate termini into 2',3'-cyclic phosphates but cannot seal the ends it produces. Escherichia coli RNA cyclase (RtcA) is encoded in a σ(54)-regulated operon with RtcB, a protein of unknown function. Taking a cue from Pnkp-Hen1, we purified E. coli RtcB and tested it for RNA ligase activity. We report that RtcB per se seals broken tRNA-like stem-loop structures with 2',3'-cyclic phosphate and 5'-OH ends to form a splice junction with a 2'-OH, 3',5'-phosphodiester. We speculate that: (i) RtcB might afford bacteria a means to recover from stress-induced RNA damage; and (ii) RtcB homologs might catalyze tRNA repair or splicing reactions in archaea and eukarya.
A zebrafish sox9 gene required for cartilage morphogenesis.
Yan, Yi-Lin; Miller, Craig T; Nissen, Robert M; Singer, Amy; Liu, Dong; Kirn, Anette; Draper, Bruce; Willoughby, John; Morcos, Paul A; Amsterdam, Adam; Chung, Bon-Chu; Westerfield, Monte; Haffter, Pascal; Hopkins, Nancy; Kimmel, Charles; Postlethwait, John H; Nissen, Robert
2002-11-01
The molecular genetic mechanisms of cartilage construction are incompletely understood. Zebrafish embryos homozygous for jellyfish (jef) mutations show craniofacial defects and lack cartilage elements of the neurocranium, pharyngeal arches, and pectoral girdle similar to humans with campomelic dysplasia. We show that two alleles of jef contain mutations in sox9a, one of two zebrafish orthologs of the human transcription factor SOX9. A mutation induced by ethyl nitrosourea changed a conserved nucleotide at a splice junction and severely reduced splicing of sox9a transcript. A retrovirus insertion into sox9a disrupted its DNA-binding domain. Inhibiting splicing of the sox9a transcript in wild-type embryos with splice site-directed morpholino antisense oligonucleotides produced a phenotype like jef mutant larvae, and caused sox9a transcript to accumulate in the nucleus; this accumulation can serve as an assay for the efficacy of a morpholino independent of phenotype. RNase-protection assays showed that in morpholino-injected animals, the percent of splicing inhibition decreased from 80% at 28 hours post fertilization to 45% by 4 days. Homozygous mutant embryos had greatly reduced quantities of col2a1 message, the major collagen of cartilage. Analysis of dlx2 expression showed that neural crest specification and migration was normal in jef (sox9a) embryos. Confocal images of living embryos stained with BODIPY-ceramide revealed at single-cell resolution the formation of precartilage condensations in mutant embryos. Besides the lack of overt cartilage differentiation, pharyngeal arch condensations in jef (sox9a) mutants lacked three specific morphogenetic behaviors: the stacking of chondrocytes into orderly arrays, the individuation of pharyngeal cartilage organs and the proper shaping of individual cartilages. Despite the severe reduction of cartilages, analysis of titin expression showed normal muscle patterning in jef (sox9a) mutants. Likewise, calcein labeling revealed that early bone formation was largely unaffected in jef (sox9a) mutants. These studies show that jef (sox9a) is essential for both morphogenesis of condensations and overt cartilage differentiation.
Fibroepithelial ureteral polyps presenting as ureteropelvic obstruction
Cusano, Antonio; Abarzua-Cabezas, Fernando; Kesler, Stuart
2014-01-01
A 57-year-old woman presented with bilateral abdominal pain and flank discomfort. Imaging studies, consisting of CT scan, diethylene triamine pentaacetic acid renal scan with Lasix and a retrograde pyelogram, indicated an obstruction at the uteropelvic junction (UPJ), possibly due to fibroepithelial polyps within the ureter. A robotic pyeloplasty revealed a ureteral diverticulum and a thin, still-attached fibroepithelial polyp of approximately 2 cm in length. The patient tolerated the procedure well and was discharged one day postpyeloplasty with no reported complications. This rare clinical scenario should be considered when formulating a diagnosis for a UPJ obstruction. PMID:24759168
Kohmoto, Tomohiro; Okamoto, Nana; Naruto, Takuya; Murata, Chie; Ouchi, Yuya; Fujita, Naoko; Inagaki, Hidehito; Satomura, Shigeko; Okamoto, Nobuhiko; Saito, Masako; Masuda, Kiyoshi; Kurahashi, Hiroki; Imoto, Issei
2017-01-01
Complex genomic rearrangements (CGRs) consisting of interstitial triplications in conjunction with uniparental isodisomy (isoUPD) have rarely been reported in patients with multiple congenital anomalies (MCA)/intellectual disability (ID). One-ended DNA break repair coupled with microhomology-mediated break-induced replication (MMBIR) has been recently proposed as a possible mechanism giving rise to interstitial copy number gains and distal isoUPD, although only a few cases providing supportive evidence in human congenital diseases with MCA have been documented. Here, we report on the chromosomal microarray (CMA)-based identification of the first known case with concurrent interstitial duplication at 1q42.12-q42.2 and triplication at 1q42.2-q43 followed by isoUPD for the remainder of chromosome 1q (at 1q43-qter). In distal 1q duplication/triplication overlapping with 1q42.12-q43, variable clinical features have been reported, and our 25-year-old patient with MCA/ID presented with some of these frequently described features. Further analyses including the precise mapping of breakpoint junctions within the CGR in a sequence level suggested that the CGR found in association with isoUPD in our case is a triplication with flanking duplications, characterized as a triplication with a particularly long duplication-inverted triplication-duplication (DUP-TRP/INV-DUP) structure. Because microhomology was observed in both junctions between the triplicated region and the flanking duplicated regions, our case provides supportive evidence for recently proposed replication-based mechanisms, such as MMBIR, underlying the formation of CGRs + isoUPD implicated in chromosomal disorders. To the best of our knowledge, this is the first case of CGRs + isoUPD observed in 1q and having DUP-TRP/INV-DUP structure with a long proximal duplication, which supports MMBIR-based model for genomic rearrangements. Molecular cytogenetic analyses using CMA containing single-nucleotide polymorphism probes with further analyses of the breakpoint junctions are recommended in cases suspected of having complex chromosomal abnormalities based on discrepancies between clinical and conventional cytogenetic findings.
An Organismal CNV Mutator Phenotype Restricted to Early Human Development.
Liu, Pengfei; Yuan, Bo; Carvalho, Claudia M B; Wuster, Arthur; Walter, Klaudia; Zhang, Ling; Gambin, Tomasz; Chong, Zechen; Campbell, Ian M; Coban Akdemir, Zeynep; Gelowani, Violet; Writzl, Karin; Bacino, Carlos A; Lindsay, Sarah J; Withers, Marjorie; Gonzaga-Jauregui, Claudia; Wiszniewska, Joanna; Scull, Jennifer; Stankiewicz, Paweł; Jhangiani, Shalini N; Muzny, Donna M; Zhang, Feng; Chen, Ken; Gibbs, Richard A; Rautenstrauss, Bernd; Cheung, Sau Wai; Smith, Janice; Breman, Amy; Shaw, Chad A; Patel, Ankita; Hurles, Matthew E; Lupski, James R
2017-02-23
De novo copy number variants (dnCNVs) arising at multiple loci in a personal genome have usually been considered to reflect cancer somatic genomic instabilities. We describe a multiple dnCNV (MdnCNV) phenomenon in which individuals with genomic disorders carry five to ten constitutional dnCNVs. These CNVs originate from independent formation incidences, are predominantly tandem duplications or complex gains, exhibit breakpoint junction features reminiscent of replicative repair, and show increased de novo point mutations flanking the rearrangement junctions. The active CNV mutation shower appears to be restricted to a transient perizygotic period. We propose that a defect in the CNV formation process is responsible for the "CNV-mutator state," and this state is dampened after early embryogenesis. The constitutional MdnCNV phenomenon resembles chromosomal instability in various cancers. Investigations of this phenomenon may provide unique access to understanding genomic disorders, structural variant mutagenesis, human evolution, and cancer biology. Copyright © 2017 Elsevier Inc. All rights reserved.
Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.
Ponce, M R; Quesada, V; Micol, J L
1998-05-01
An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.
Genetics, structure, and prevalence of FP967 (CDC Triffid) T-DNA in flax.
Young, Lester; Hammerlindl, Joseph; Babic, Vivijan; McLeod, Jamille; Sharpe, Andrew; Matsalla, Chad; Bekkaoui, Faouzi; Marquess, Leigh; Booker, Helen M
2015-01-01
The detection of T-DNA from a genetically modified flaxseed line (FP967, formally CDC Triffid) in a shipment of Canadian flaxseed exported to Europe resulted in a large decrease in the amount of flax planted in Canada. The Canadian flaxseed industry undertook major changes to ensure the removal of FP967 from the supply chain. This study aimed to resolve the genetics and structure of the FP967 transfer DNA (T-DNA). The FP967 T-DNA is thought to be inserted in at single genomic locus. The junction between the T-DNA and genomic DNA consisted of two inverted Right Borders with no Left Border (LB) flanking genomic DNA sequences recovered. This information was used to develop an event-specific quantitative PCR (qPCR) assay. This assay and an existing assay specific to the T-DNA construct were used to determine the genetics and prevalence of the FP967 T-DNA. These data supported the hypothesis that the T-DNA is present at a single location in the genome. The FP967 T-DNA is present at a low level (between 0.01 and 0.1%) in breeder seed lots from 2009 and 2010. None of the 11,000 and 16,000 lines selected for advancement through the Flax Breeding Program in 2010 and 2011, respectively, tested positive for the FP967 T-DNA, however. Most of the FP967 T-DNA sequence was resolved via PCR cloning and next generation sequencing. A 3,720 bp duplication of an internal portion of the T-DNA (including a Right Border) was discovered between the flanking genomic DNA and the LB. An event-specific assay, SAT2-LB, was developed for the junction between this repeat and the LB.
Kück, Ulrich; Choquet, Yves; Schneider, Michel; Dron, Michel; Bennoun, Pierre
1987-01-01
The two homologous genes for the P700 chlorophyll a-apoproteins (ps1A1 and ps1A2) are encoded by the plastom in the green alga Chlamydomonas reinhardii. The structure and organization of the two genes were determined by comparison with the homologous genes from maize using data from heterologous hybridizations as well as from DNA and RNA sequencing. While the ps1A2 (736 codons) gene shows a continuous gene organization, the ps1A1 (754 codons) gene possesses some unusual features. The discontinuous gene is split into three separate exons which are scattered around the circular chloroplast genome. Exon 1 (86 bp) is separated by ∼50 kb from exon 2 (198 bp), which is located ∼ 90 kb apart from exon 3 (1984 bp). All exons are flanked by intronic sequences of group II. Transcription analysis reveals that the ps1A2 gene hybridizes with a 2.8-kb transcript, while all exon regions of the ps1A1 gene are homologous to a mature mRNA of 2.7 kb. From our data we conclude that the three distantly separated exonic sequences of the ps1A1 gene constitute a functional gene which probably operates by a trans-splicing mechanism. ImagesFig. 3.Fig. 5.Fig. 6. PMID:16453785
An indicator gene to demonstrate intracellular transposition of defective retroviruses.
Heidmann, T; Heidmann, O; Nicolas, J F
1988-01-01
An indicator gene for detection and quantitation of RNA-mediated transposition was constructed (neoRT). It was inserted into a Moloney murine leukemia provirus (Mo-MLV) deleted for the envelope gene to test for intracellular transposition of defective retroviruses [Mo-MLV(neo)RT]. NeoRT contains the selectable neo gene (which confers resistance to the drug G418), inactivated by a polyadenylylation sequence inserted between the neo promotor and coding sequence. The polyadenylylation sequence is flanked (on the antisense strand of the DNA) by a donor and an acceptor splice site so as to be removed upon passage of the provirus through an RNA intermediate. 3T3 cells transfected with the defective Mo-MLV(neo)RT provirus are sensitive to G418. After trans-complementation with Mo-MLV, viral transcripts confer resistance to G418 upon infection of test cells. In the resistant cells, the polyadenylylation sequence has been removed, as a result in most cases of precise splicing of the intronic domain. Retrotransposition of the defective Mo-MLV(neo)RT provirus was demonstrated by submitting transfected G418-sensitive clones to selection. Between 1 and 10 G418-resistant clones were obtained per 10(7) cells. Several possess additional copies, with evidence for precise removal of the intronic domain. By using target test cells in coculture experiments, extracellular intermediates of retrotransposition could not be detected. Images PMID:2832848
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.
Evaluation of the arrestin gene in patients with retinitis pigmentosa or an allied disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeStefano, D.J.; Berson, E.L.; Dryja, T.P.
1994-09-01
Arrestin, also called 48K protein or S-antigen, plays a role in deactivating rhodopsin, the photosensitive, seven-helix, G-protein receptor found in rod photoreceptors. In Drosophila, null mutations in arrestin genes cause a light-dependent photoreceptor degeneration. It is possible that a comparable photoreceptor degeneration in humans is caused by defects in the rod arrestin gene. In order to evaluate this possibility, we are characterizing the human arrestin locus on chromosome 2q. We screened a genomic library (5 million plaques) using an arrestin cDNA clone. Sixty-eight hybridizing clones were identified; portions of 7 clones were sequenced to determine the intron sequence flanking themore » exons. We are using SSCP analysis and direct genomic sequencing to screen the entire coding region, splice donor and acceptor sites, and the promoter region of the arrestin gene in 188 patients with autosomal dominant and 104 patients with autosomal recessive retinitis pigmentosa. We have already obtained flanking intron sequences necessary for SSCP analysis for 13 of 16 exons. So far, we have identified 4 silent base changes at codons 67 (TGC-to-TGT), 107 (CTG-to-CTC), 163 (GCC-to-GCT), and 288 (CTG-to-TGT), all with allele frequencies at 1% or less. Several other variant bands detected by SSCP analysis are currently being sequenced.« less
A novel DSPP mutation causes dentinogenesis imperfecta type II in a large Mongolian family
2010-01-01
Background Several studies have shown that the clinical phenotypes of dentinogenesis imperfecta type II (DGI-II) may be caused by mutations in dentin sialophosphoprotein (DSPP). However, no previous studies have documented the clinical phenotype and genetic basis of DGI-II in a Mongolian family from China. Methods We identified a large five-generation Mongolian family from China with DGI-II, comprising 64 living family members of whom 22 were affected. Linkage analysis of five polymorphic markers flanking DSPP gene was used to genotype the families and to construct the haplotypes of these families. All five DSPP exons including the intron-exon boundaries were PCR-amplified and sequenced in 48 members of this large family. Results All affected individuals showed discoloration and severe attrition of their teeth, with obliterated pulp chambers and without progressive high frequency hearing loss or skeletal abnormalities. No recombination was found at five polymorphic markers flanking DSPP in the family. Direct DNA sequencing identified a novel A→G transition mutation adjacent to the donor splicing site within intron 3 in all affected individuals but not in the unaffected family members and 50 unrelated Mongolian individuals. Conclusion This study identified a novel mutation (IVS3+3A→G) in DSPP, which caused DGI-II in a large Mongolian family. This expands the spectrum of mutations leading to DGI-II. PMID:20146806
Li, Hongying; Zhang, Kaihui; Xu, Qun; Ma, Lixia; Lv, Xin; Sun, Ruopeng
2015-03-01
Alkaptonuria (AKU) is an autosomal recessive disorder of tyrosine metabolism, which is caused by a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) with subsequent accumulation of homogentisic acid. Presently, more than 100 HGD mutations have been identified as the cause of the inborn error of metabolism across different populations worldwide. However, the HGD mutation is very rarely reported in Asia, especially China. In this study, we present mutational analyses of HGD gene in one Chinese Han child with AKU, which had been identified by gas chromatography-mass spectrometry detection of organic acids in urine samples. PCR and DNA sequencing of the entire coding region as well as exon-intron boundaries of HGD have been performed. Two novel mutations were identified in the HGD gene in this AKU case, a frameshift mutation of c.115delG in exon 3 and the splicing mutation of IVS5+3 A>C, a donor splice site of the exon 5 and exon-intron junction. The identification of these mutations in this study further expands the spectrum of known HGD gene mutations and contributes to prenatal molecular diagnosis of AKU.
Ruggles, Kelly V; Tang, Zuojian; Wang, Xuya; Grover, Himanshu; Askenazi, Manor; Teubl, Jennifer; Cao, Song; McLellan, Michael D; Clauser, Karl R; Tabb, David L; Mertins, Philipp; Slebos, Robbert; Erdmann-Gilmore, Petra; Li, Shunqiang; Gunawardena, Harsha P; Xie, Ling; Liu, Tao; Zhou, Jian-Ying; Sun, Shisheng; Hoadley, Katherine A; Perou, Charles M; Chen, Xian; Davies, Sherri R; Maher, Christopher A; Kinsinger, Christopher R; Rodland, Karen D; Zhang, Hui; Zhang, Zhen; Ding, Li; Townsend, R Reid; Rodriguez, Henry; Chan, Daniel; Smith, Richard D; Liebler, Daniel C; Carr, Steven A; Payne, Samuel; Ellis, Matthew J; Fenyő, David
2016-03-01
Improvements in mass spectrometry (MS)-based peptide sequencing provide a new opportunity to determine whether polymorphisms, mutations, and splice variants identified in cancer cells are translated. Herein, we apply a proteogenomic data integration tool (QUILTS) to illustrate protein variant discovery using whole genome, whole transcriptome, and global proteome datasets generated from a pair of luminal and basal-like breast-cancer-patient-derived xenografts (PDX). The sensitivity of proteogenomic analysis for singe nucleotide variant (SNV) expression and novel splice junction (NSJ) detection was probed using multiple MS/MS sample process replicates defined here as an independent tandem MS experiment using identical sample material. Despite analysis of over 30 sample process replicates, only about 10% of SNVs (somatic and germline) detected by both DNA and RNA sequencing were observed as peptides. An even smaller proportion of peptides corresponding to NSJ observed by RNA sequencing were detected (<0.1%). Peptides mapping to DNA-detected SNVs without a detectable mRNA transcript were also observed, suggesting that transcriptome coverage was incomplete (∼80%). In contrast to germline variants, somatic variants were less likely to be detected at the peptide level in the basal-like tumor than in the luminal tumor, raising the possibility of differential translation or protein degradation effects. In conclusion, this large-scale proteogenomic integration allowed us to determine the degree to which mutations are translated and identify gaps in sequence coverage, thereby benchmarking current technology and progress toward whole cancer proteome and transcriptome analysis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Huge maternal hydronephrosis: a rare complication in pregnancy.
Peng, Hsiu-Huei; Wang, Chin-Jung; Yen, Chih-Feng; Chou, Chien-Chung; Lee, Chyi-Long
2003-06-10
A huge maternal hydronephrosis is uncommon in pregnancy and might be mistaken as a pelvic mass. A 21-year-old primigravida was noted at 25th week of gestation to have a visible bulging mass on her left flank. The mass was originally mistaken as a large ovarian cyst but later proved to be a huge hydronephrosis. Retrograde insertion of ureteroscope and a ureteric stent failed, so we performed repeated ultrasound-guided needle aspiration to decompress the huge hydronephrosis, which enabled the patient to proceed to a successful term vaginal delivery. Nephrectomy was performed after delivery and proved the diagnosis of congenital ureteropelvic junction obstruction.
Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.
Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui
2018-05-01
The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.
Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S
2000-01-01
Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667
Peter, Angela K; Miller, Gaynor; Capote, Joana; DiFranco, Marino; Solares-Pérez, Alhondra; Wang, Emily L; Heighway, Jim; Coral-Vázquez, Ramón M; Vergara, Julio; Crosbie-Watson, Rachelle H
2017-06-06
Sarcospan (SSPN) is a transmembrane protein that interacts with the sarcoglycans (SGs) to form a tight subcomplex within the dystrophin-glycoprotein complex that spans the sarcolemma and interacts with laminin in the extracellular matrix. Overexpression of SSPN ameliorates Duchenne muscular dystrophy in murine models. Standard cloning approaches were used to identify nanospan, and nanospan-specific polyclonal antibodies were generated and validated. Biochemical isolation of skeletal muscle membranes and two-photon laser scanning microscopy were used to analyze nanospan localization in muscle from multiple murine models. Duchenne muscular dystrophy biopsies were analyzed by immunoblot analysis of protein lysates as well as indirect immunofluorescence analysis of muscle cryosections. Nanospan is an alternatively spliced isoform of sarcospan. While SSPN has four transmembrane domains and is a core component of the sarcolemmal dystrophin-glycoprotein complex, nanospan is a type II transmembrane protein that does not associate with the dystrophin-glycoprotein complex. We demonstrate that nanospan is enriched in the sarcoplasmic reticulum (SR) fractions and is not present in the T-tubules. SR fractions contain membranes from three distinct structural regions: a region flanking the T-tubules (triadic SR), a SR region across the Z-line (ZSR), and a longitudinal SR region across the M-line (LSR). Analysis of isolated murine muscles reveals that nanospan is mostly associated with the ZSR and triadic SR, and only minimally with the LSR. Furthermore, nanospan is absent from the SR of δ-SG-null (Sgcd -/- ) skeletal muscle, a murine model for limb girdle muscular dystrophy 2F. Analysis of skeletal muscle biopsies from Duchenne muscular dystrophy patients reveals that nanospan is preferentially expressed in type I (slow) fibers in both control and Duchenne samples. Furthermore, nanospan is significantly reduced in Duchenne biopsies. Alternative splicing of proteins from the SG-SSPN complex produces δ-SG3, microspan, and nanospan that localize to the ZSR and the triadic SR, where they may play a role in regulating resting calcium levels as supported by previous studies (Estrada et al., Biochem Biophys Res Commun 340:865-71, 2006). Thus, alternative splicing of SSPN mRNA generates three protein isoforms (SSPN, microspan, and nanospan) that differ in the number of transmembrane domains affecting subcellular membrane association into distinct protein complexes.
Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors
Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael
2012-01-01
Purpose The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer (PCa) tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in PCa cells. The junction of theTMPRSS2 and ERG derived portions of the fusion mRNA constitutes a cancer specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low toxicity treatment for PCa. Experimental Design We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (Type III or Type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of PCa cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. Results The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Conclusions Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with PCa. PMID:23052253
Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors.
Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael
2012-12-15
The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in prostate cancer cells. The junction of theTMPRSS2- and ERG-derived portions of the fusion mRNA constitutes a cancer-specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low-toxicity treatment for prostate cancer. We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (type III or type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of prostate cancer cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with prostate cancer. ©2012 AACR.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, P.Y.; Ernst, A.R.; Sly, W.S.
1994-04-01
To date, three different structural gene mutations have been identified in patients with carbonic anhydrase II deficiency (osteopetrosis with renal tubular acidosis and cerebral calcification). These include a missense mutation (H107Y) in two families, a splice junction mutation in intron 5 in one of these families, and a splice junction mutation in intron 2 for which many Arabic patients are homozygous. The authors report here a novel mutation for which carbonic anhydrase II-deficient patients from seven unrelated Hispanic families were found to be homozygous. The proband was a 2 1/2-year-old Hispanic girl of Puerto Rican ancestry who was unique clinically,more » in that she had no evidence of renal tubular acidosis, even though she did have osteopetrosis, developmental delay, and cerebral calcification. She proved to be homozygous for a single-base deletion in the coding region of exon 7 that produces a frameshift that changes the next 12 amino acids before leading to chain termination and that also introduces a new MaeIII restriction site. The 27-kD truncated enzyme produced when the mutant cDNA was expressed in COS cells was enzymatically inactive, present mainly in insoluble aggregates, and detectable immunologically at only 5% the level of the 29-kD normal carbonic anhydrase II expressed from the wild-type cDNA. Metabolic labeling revealed that this 27-kD mutant protein has an accelerated rate of degradation. Six subsequent Hispanic patients of Caribbean ancestry, all of whom had osteopetrosis and renal tubular acidosis but who varied widely in clinical severity, were found to be homozygous for the same mutation. These findings identify a novel mutation common to Hispanic patients from the Caribbean islands and provide a ready means for PCR-based diagnosis of the [open quotes]Hispanic mutation.[close quotes] The basis for their phenotypic variability is not yet clear. 15 refs., 5 figs., 1 tab.« less
NASA Technical Reports Server (NTRS)
Breault, D. T.; Lichtler, A. C.; Rowe, D. W.
1997-01-01
Collagen reporter gene constructs have be used to identify cell-specific sequences needed for transcriptional activation. The elements required for endogenous levels of COL1A1 expression, however, have not been elucidated. The human COL1A1 minigene is expressed at high levels and likely harbors sequence elements required for endogenous levels of activity. Using stably transfected osteoblastic Py1a cells, we studied a series of constructs (pOBColCAT) designed to characterize further the elements required for high level of expression. pOBColCAT, which contains the COL1A1 first intron, was expressed at 50-100-fold higher levels than ColCAT 3.6, which lacks the first intron. This difference is best explained by improved mRNA processing rather than a transcriptional effect. Furthermore, variation in activity observed with the intron deletion constructs is best explained by altered mRNA splicing. Two major regions of the human COL1A1 minigene, the 3'-flanking sequences and the minigene body, were introduced into pOBColCAT to assess both transcriptional enhancing activity and the effect on mRNA stability. Analysis of the minigene body, which includes the first five exons and introns fused with the terminal six introns and exons, revealed an orientation-independent 5-fold increase in CAT activity. In contrast the 3'-flanking sequences gave rise to a modest 61% increase in CAT activity. Neither region increased the mRNA half-life of the parent construct, suggesting that CAT-specific mRNA instability elements may serve as dominant negative regulators of stability. This study suggests that other sites within the body of the COL1A1 minigene are important for high expression, e.g. during periods of rapid extracellular matrix production.
Vaghi, Valentina; Polacchini, Alessio; Baj, Gabriele; Pinheiro, Vera L M; Vicario, Annalisa; Tongiorgi, Enrico
2014-10-03
The neurotrophin brain-derived neurotrophic factor (BDNF) is a key regulator of neuronal development and plasticity. BDNF is a major pharmaceutical target in neurodevelopmental and psychiatric disorders. However, pharmacological modulation of this neurotrophin is challenging because BDNF is generated by multiple, alternatively spliced transcripts with different 5'- and 3'UTRs. Each BDNF mRNA variant is transcribed independently, but translation regulation is unknown. To evaluate the translatability of BDNF transcripts, we developed an in vitro luciferase assay in human neuroblastoma cells. In unstimulated cells, each BDNF 5'- and 3'UTR determined a different basal translation level of the luciferase reporter gene. However, constructs with either a 5'UTR or a 3'UTR alone showed poor translation modulation by BDNF, KCl, dihydroxyphenylglycine, AMPA, NMDA, dopamine, acetylcholine, norepinephrine, or serotonin. Constructs consisting of the luciferase reporter gene flanked by the 5'UTR of one of the most abundant BDNF transcripts in the brain (exons 1, 2c, 4, and 6) and the long 3'UTR responded selectively to stimulation with the different receptor agonists, and only transcripts 2c and 6 were increased by the antidepressants desipramine and mirtazapine. We propose that BDNF mRNA variants represent "a quantitative code" for regulated expression of the protein. Thus, to discriminate the efficacy of drugs in stimulating BDNF synthesis, it is appropriate to use variant-specific in vitro screening tests. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Cardiac-Sparing Whole Lung IMRT in Children With Lung Metastasis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kalapurakal, John A., E-mail: j-kalapurakal@northwestern.edu; Zhang, Yunkai; Kepka, Alan
Purpose: To demonstrate the dosimetric advantages of cardiac-sparing (CS) intensity modulated radiation therapy (IMRT) in children undergoing whole lung irradiation (WLI). Methods and Materials: Chest CT scans of 22 children who underwent simulation with 3-dimensional (n=10) or 4-dimensional (n=12) techniques were used for this study. Treatment planning was performed using standard anteroposterior-posteroanterior (S-RT) technique and CS-IMRT. Left and right flank fields were added to WLI fields to determine whether CS-IMRT offered any added protection to normal tissues at the junction between these fields. The radiation dose to the lung PTV, cardiac structures, liver, and thyroid were analyzed and compared. Results:more » CS-IMRT had 4 significant advantages over S-RT: (1) superior cardiac protection (2) superior 4-dimensional lung planning target volume coverage, (3) superior dose uniformity in the lungs with fewer hot spots, and (4) significantly lower dose to the heart when flank RT is administered after WLI. Conclusions: The use of CS-IMRT and 4-dimensional treatment planning has the potential to improve tumor control rates and reduce cardiac toxicity in children receiving WLI.« less
Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran
2018-01-10
Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.
Lin, Xiaoyan; Ruiz, Janelle; Bajraktari, Ilda; Ohman, Rachel; Banerjee, Soojay; Gribble, Katherine; Kaufman, Joshua D.; Wingfield, Paul T.; Griggs, Robert C.; Fischbeck, Kenneth H.; Mankodi, Ami
2014-01-01
The core of skeletal muscle Z-discs consists of actin filaments from adjacent sarcomeres that are cross-linked by α-actinin homodimers. Z-disc-associated, alternatively spliced, PDZ motif-containing protein (ZASP)/Cypher interacts with α-actinin, myotilin, and other Z-disc proteins via the PDZ domain. However, these interactions are not sufficient to maintain the Z-disc structure. We show that ZASP directly interacts with skeletal actin filaments. The actin-binding domain is between the modular PDZ and LIM domains. This ZASP region is alternatively spliced so that each isoform has unique actin-binding domains. All ZASP isoforms contain the exon 6-encoded ZASP-like motif that is mutated in zaspopathy, a myofibrillar myopathy (MFM), whereas the exon 8–11 junction-encoded peptide is exclusive to the postnatal long ZASP isoform (ZASP-LΔex10). MFM is characterized by disruption of skeletal muscle Z-discs and accumulation of myofibrillar degradation products. Wild-type and mutant ZASP interact with α-actin, α-actinin, and myotilin. Expression of mutant, but not wild-type, ZASP leads to Z-disc disruption and F-actin accumulation in mouse skeletal muscle, as in MFM. Mutations in the actin-binding domain of ZASP-LΔex10, but not other isoforms, cause disruption of the actin cytoskeleton in muscle cells. These isoform-specific mutation effects highlight the essential role of the ZASP-LΔex10 isoform in F-actin organization. Our results show that MFM-associated ZASP mutations in the actin-binding domain have deleterious effects on the core structure of the Z-discs in skeletal muscle. PMID:24668811
Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, L.A.
1994-05-06
We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gladwin, A.J.; Dixon, J.; Loftus, S.K.
Heparan sulfate-N-deacetylase/N-sulfotransferase (HSST) catalyzes both the N-deacetylation and the N-sulfation of heparan sulfate. Previous studies have resulted in the isolation of the human HSST gene from within the Treacher Collins syndrome locus (TCOF1) critical region on 5q. In the present study, the genomic organization of the HSST gene has been elucidated, and the 14 exons identified have been tested for TCOF1-specific mutations. As a result of these studies, mutations within the coding sequence and adjacent splice junctions of HSST can be excluded from a causative role in the pathogenesis of Treacher Collins syndrome. 13 refs., 1 fig., 2 tabs.
Sanyoura, May; Woudstra, Cédric; Halaby, George; Baz, Patrick; Senée, Valérie; Guillausseau, Pierre-Jean; Zalloua, Pierre; Julier, Cécile
2014-01-01
Insulin-dependent juvenile-onset diabetes may occur in the context of rare syndromic presentations suggesting monogenic inheritance rather than common multifactorial autoimmune type 1 diabetes. Here, we report the case of a Lebanese patient diagnosed with juvenile-onset insulin-dependent diabetes presenting ketoacidosis, early-onset retinopathy with optic atrophy, hearing loss, diabetes insipidus, epilepsy, and normal weight and stature, who later developed insulin resistance. Despite similarities with Wolfram syndrome, we excluded the WFS1 gene as responsible for this disease. Using combined linkage and candidate gene study, we selected ALMS1, responsible for Alström syndrome, as a candidate gene. We identified a novel splice mutation in intron 18 located 3 bp before the intron–exon junction (IVS18-3T>G), resulting in exon 19 skipping and consequent frameshift generating a truncated protein (V3958fs3964X). The clinical presentation of the patient significantly differed from typical Alström syndrome by the absence of truncal obesity and short stature, and by the presence of ketoacidotic insulin-dependent diabetes, optic atrophy and diabetes insipidus. Our observation broadens the clinical spectrum of Alström syndrome and suggests that ALMS1 mutations may be considered in patients who initially present with an acute onset of insulin-dependent diabetes. PMID:23652376
Serang, Oliver
2014-01-01
Exact Bayesian inference can sometimes be performed efficiently for special cases where a function has commutative and associative symmetry of its inputs (called "causal independence"). For this reason, it is desirable to exploit such symmetry on big data sets. Here we present a method to exploit a general form of this symmetry on probabilistic adder nodes by transforming those probabilistic adder nodes into a probabilistic convolution tree with which dynamic programming computes exact probabilities. A substantial speedup is demonstrated using an illustration example that can arise when identifying splice forms with bottom-up mass spectrometry-based proteomics. On this example, even state-of-the-art exact inference algorithms require a runtime more than exponential in the number of splice forms considered. By using the probabilistic convolution tree, we reduce the runtime to O(k log(k)2) and the space to O(k log(k)) where k is the number of variables joined by an additive or cardinal operator. This approach, which can also be used with junction tree inference, is applicable to graphs with arbitrary dependency on counting variables or cardinalities and can be used on diverse problems and fields like forward error correcting codes, elemental decomposition, and spectral demixing. The approach also trivially generalizes to multiple dimensions.
Serang, Oliver
2014-01-01
Exact Bayesian inference can sometimes be performed efficiently for special cases where a function has commutative and associative symmetry of its inputs (called “causal independence”). For this reason, it is desirable to exploit such symmetry on big data sets. Here we present a method to exploit a general form of this symmetry on probabilistic adder nodes by transforming those probabilistic adder nodes into a probabilistic convolution tree with which dynamic programming computes exact probabilities. A substantial speedup is demonstrated using an illustration example that can arise when identifying splice forms with bottom-up mass spectrometry-based proteomics. On this example, even state-of-the-art exact inference algorithms require a runtime more than exponential in the number of splice forms considered. By using the probabilistic convolution tree, we reduce the runtime to and the space to where is the number of variables joined by an additive or cardinal operator. This approach, which can also be used with junction tree inference, is applicable to graphs with arbitrary dependency on counting variables or cardinalities and can be used on diverse problems and fields like forward error correcting codes, elemental decomposition, and spectral demixing. The approach also trivially generalizes to multiple dimensions. PMID:24626234
Boullot, Floriane; Castrec, Justine; Bidault, Adeline; Dantas, Natanael; Payton, Laura; Perrigault, Mickael; Tran, Damien; Amzil, Zouher; Boudry, Pierre; Soudant, Philippe; Hégaret, Hélène; Fabioux, Caroline
2017-01-01
Paralytic shellfish toxins (PST) bind to voltage-gated sodium channels (Nav) and block conduction of action potential in excitable cells. This study aimed to (i) characterize Nav sequences in Crassostrea gigas and (ii) investigate a putative relation between Nav and PST-bioaccumulation in oysters. The phylogenetic analysis highlighted two types of Nav in C. gigas: a Nav1 (CgNav1) and a Nav2 (CgNav2) with sequence properties of sodium-selective and sodium/calcium-selective channels, respectively. Three alternative splice transcripts of CgNav1 named A, B and C, were characterized. The expression of CgNav1, analyzed by in situ hybridization, is specific to nervous cells and to structures corresponding to neuromuscular junctions. Real-time PCR analyses showed a strong expression of CgNav1A in the striated muscle while CgNav1B is mainly expressed in visceral ganglia. CgNav1C expression is ubiquitous. The PST binding site (domain II) of CgNav1 variants possess an amino acid Q that could potentially confer a partial saxitoxin (STX)-resistance to the channel. The CgNav1 genotype or alternative splicing would not be the key point determining PST bioaccumulation level in oysters. PMID:28106838
Revealing the transcriptomic complexity of switchgrass by PacBio long-read sequencing.
Zuo, Chunman; Blow, Matthew; Sreedasyam, Avinash; Kuo, Rita C; Ramamoorthy, Govindarajan Kunde; Torres-Jerez, Ivone; Li, Guifen; Wang, Mei; Dilworth, David; Barry, Kerrie; Udvardi, Michael; Schmutz, Jeremy; Tang, Yuhong; Xu, Ying
2018-01-01
Switchgrass ( Panicum virgatum L.) is an important bioenergy crop widely used for lignocellulosic research. While extensive transcriptomic analyses have been conducted on this species using short read-based sequencing techniques, very little has been reliably derived regarding alternatively spliced (AS) transcripts. We present an analysis of transcriptomes of six switchgrass tissue types pooled together, sequenced using Pacific Biosciences (PacBio) single-molecular long-read technology. Our analysis identified 105,419 unique transcripts covering 43,570 known genes and 8795 previously unknown genes. 45,168 are novel transcripts of known genes. A total of 60,096 AS transcripts are identified, 45,628 being novel. We have also predicted 1549 transcripts of genes involved in cell wall construction and remodeling, 639 being novel transcripts of known cell wall genes. Most of the predicted transcripts are validated against Illumina-based short reads. Specifically, 96% of the splice junction sites in all the unique transcripts are validated by at least five Illumina reads. Comparisons between genes derived from our identified transcripts and the current genome annotation revealed that among the gene set predicted by both analyses, 16,640 have different exon-intron structures. Overall, substantial amount of new information is derived from the PacBio RNA data regarding both the transcriptome and the genome of switchgrass.
Tabaczewski, P; Shirwan, H; Lewis, K; Stroynowski, I
1994-01-01
Class Ib Qa-2 molecules are expressed in tissue culture cells as approximately 40-kDa membrane-bound, glycophosphatidylinositol-linked antigens and as approximately 39-kDa soluble polypeptides. Recently, alternative splicing events which delete exon 5 from a portion of Qa-2 transcripts were demonstrated to give rise to truncated secreted Qa-2 molecules in transfected cell lines. To determine whether this mechanism operates in vivo and to find out whether Qa-2 can be detected in soluble form in circulation, murine blood samples were analyzed. Critical to these experiments was preparation of an anti-peptide antiserum against an epitope encoded by a junction of exon 4 and exon 6. We find that supernatants of splenocytes cultured in vitro as well as serum or plasma contain two forms of soluble Qa-2 molecules. One form corresponds to a secreted molecule translated from transcripts from which exon 5 has been deleted; the other is derived from membrane-bound antigens or their precursors. The levels of both soluble forms of Qa-2 are inducible upon stimulation of the immune system, suggesting an immunoregulatory role for these molecules or for the mechanism leading to the reduction of cell-associated Qa-2 antigens in vivo. Images PMID:8127900
Hirono, Moritoshi; Ogawa, Yasuhiro; Misono, Kaori; Zollinger, Daniel R; Trimmer, James S; Rasband, Matthew N; Misonou, Hiroaki
2015-05-06
In myelinated axons, K(+) channels are clustered in distinct membrane domains to regulate action potentials (APs). At nodes of Ranvier, Kv7 channels are expressed with Na(+) channels, whereas Kv1 channels flank nodes at juxtaparanodes. Regulation of axonal APs by K(+) channels would be particularly important in fast-spiking projection neurons such as cerebellar Purkinje cells. Here, we show that BK/Slo1 channels are clustered at the paranodal junctions of myelinated Purkinje cell axons of rat and mouse. The paranodal junction is formed by a set of cell-adhesion molecules, including Caspr, between the node and juxtaparanodes in which it separates nodal from internodal membrane domains. Remarkably, only Purkinje cell axons have detectable paranodal BK channels, whose clustering requires the formation of the paranodal junction via Caspr. Thus, BK channels occupy this unique domain in Purkinje cell axons along with the other K(+) channel complexes at nodes and juxtaparanodes. To investigate the physiological role of novel paranodal BK channels, we examined the effect of BK channel blockers on antidromic AP conduction. We found that local application of blockers to the axon resulted in a significant increase in antidromic AP failure at frequencies above 100 Hz. We also found that Ni(2+) elicited a similar effect on APs, indicating the involvement of Ni(2+)-sensitive Ca(2+) channels. Furthermore, axonal application of BK channel blockers decreased the inhibitory synaptic response in the deep cerebellar nuclei. Thus, paranodal BK channels uniquely support high-fidelity firing of APs in myelinated Purkinje cell axons, thereby underpinning the output of the cerebellar cortex. Copyright © 2015 the authors 0270-6474/15/357082-13$15.00/0.
Soreq, Lilach; Guffanti, Alessandro; Salomonis, Nathan; Simchovitz, Alon; Israel, Zvi; Bergman, Hagai; Soreq, Hermona
2014-01-01
The continuously prolonged human lifespan is accompanied by increase in neurodegenerative diseases incidence, calling for the development of inexpensive blood-based diagnostics. Analyzing blood cell transcripts by RNA-Seq is a robust means to identify novel biomarkers that rapidly becomes a commonplace. However, there is lack of tools to discover novel exons, junctions and splicing events and to precisely and sensitively assess differential splicing through RNA-Seq data analysis and across RNA-Seq platforms. Here, we present a new and comprehensive computational workflow for whole-transcriptome RNA-Seq analysis, using an updated version of the software AltAnalyze, to identify both known and novel high-confidence alternative splicing events, and to integrate them with both protein-domains and microRNA binding annotations. We applied the novel workflow on RNA-Seq data from Parkinson's disease (PD) patients' leukocytes pre- and post- Deep Brain Stimulation (DBS) treatment and compared to healthy controls. Disease-mediated changes included decreased usage of alternative promoters and N-termini, 5′-end variations and mutually-exclusive exons. The PD regulated FUS and HNRNP A/B included prion-like domains regulated regions. We also present here a workflow to identify and analyze long non-coding RNAs (lncRNAs) via RNA-Seq data. We identified reduced lncRNA expression and selective PD-induced changes in 13 of over 6,000 detected leukocyte lncRNAs, four of which were inversely altered post-DBS. These included the U1 spliceosomal lncRNA and RP11-462G22.1, each entailing sequence complementarity to numerous microRNAs. Analysis of RNA-Seq from PD and unaffected controls brains revealed over 7,000 brain-expressed lncRNAs, of which 3,495 were co-expressed in the leukocytes including U1, which showed both leukocyte and brain increases. Furthermore, qRT-PCR validations confirmed these co-increases in PD leukocytes and two brain regions, the amygdala and substantia-nigra, compared to controls. This novel workflow allows deep multi-level inspection of RNA-Seq datasets and provides a comprehensive new resource for understanding disease transcriptome modifications in PD and other neurodegenerative diseases. PMID:24651478
Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
Björk, Petra; Persson, Jan-Olov
2015-01-01
Eukaryotic gene expression requires the ordered association of numerous factors with precursor messenger RNAs (premRNAs)/messenger RNAs (mRNAs) to achieve efficiency and regulation. Here, we use the Balbiani ring (BR) genes to demonstrate the temporal and spatial association of the exon junction complex (EJC) core with gene-specific endogenous premRNAs and mRNAs. The EJC core components bind cotranscriptionally to BR premRNAs during or very rapidly after splicing. The EJC core does not recruit the nonsense-mediated decay mediaters UPF2 and UPF3 until the BR messenger RNA protein complexes (mRNPs) enter the interchromatin. Even though several known adapters for the export factor NXF1 become part of BR mRNPs already at the gene, NXF1 binds to BR mRNPs only in the interchromatin. In steady state, a subset of the BR mRNPs in the interchromatin binds NXF1, UPF2, and UPF3. This binding appears to occur stochastically, and the efficiency approximately equals synthesis and export of the BR mRNPs. Our data provide unique in vivo information on how export competent eukaryotic mRNPs are formed. PMID:26459599
Retroperitoneal and transperitoneal robot-assisted pyeloplasty in adults: techniques and results.
Cestari, Andrea; Buffi, Nicolò Maria; Lista, Giuliana; Sangalli, Mattia; Scapaticci, Emanuele; Fabbri, Fabio; Lazzeri, Massimo; Rigatti, Patrizio; Guazzoni, Giorgio
2010-11-01
The surgical management of ureteropelvic junction obstruction (UPJO) has dramatically evolved over the past 20 yr due to the development of new technology. Our aim was to report the feasibility and efficacy of robot-assisted pyeloplasty (RAP) performed by either the retroperitoneal or the transperitoneal approach. A stage 2 investigative study was conducted including development (stage 2a) and exploration (stage 2b) of transperitoneal and retroperitoneal RAP performed in 55 patients at an urban tertiary university department of urology. Retroperitoneal RAP was performed with the patient in full flank position using a 12-mm Hasson-style optical port at the tip of the 12th rib, plus two operative 8-mm robotic trocars and an assistant 5-mm port. The stenotic ureteropelvic junction was excised, the ureter was spatulated, and a dismembered pyeloplasty was performed in all cases. Transperitoneal RAP was performed with the patients in the 60° flank position. The optical port is in the umbilical area, plus two 8-mm operative robotic ports and one 5-mm assistant port. The pyeloplasty technique is similar to the retroperitoneoscopic approach. In both groups, the stent can be positioned in an anterograde or retrograde fashion. Success consisted of no evidence of obstruction on computed tomography urography or mercaptoacetyltriglycine-3 diuretic renal scan, no postoperative symptoms, and no further treatment. Thirty-six patients underwent retroperitoneoscopic RAP and 19 transperitoneal RAP for UPJO. All the procedures were completed with robotic assistance. The overall objective success (measured by diuretic renal scan and/or imaging techniques) was 96% with two cases of recurrence (both in the retroperitoneal group). The main limitation was the short follow-up, although all patients reached at least a 6-mo follow-up. RAP performed either retroperitoneally or transperitoneally was revealed as a feasible and reproducible surgical option for the treatment of UPJO, offering a subjective optimal plasty reconfiguration at short follow-up. Copyright © 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved.
Shozu, M; Zhao, Y; Bulun, S E; Simpson, E R
1998-04-01
The expression of aromatase is regulated in a tissue-specific fashion through alternative use of multiple promoter-specific first exons. To date, eight different first exons have been reported in human aromatase, namely I.1., I.2, I.3. I.4, I.5, PII, 2a, and 1f. Recently, we have found a new putative exon I in a RACE-generated library of THP-1 cells and have conducted studies to characterize this new exon I. We confirmed that the constructs containing -1552/+17 or less flanking sequence of this exon function as a promoter in THP-1 cells, JEG-3 cells and osteoblast-like cells obtained from a human fetus. Results of transfection assays using a series of deletion constructs and mutation constructs indicate that a 1-bp mismatch of the consensus TATA-like box (TTTAAT) and the consensus sequence of the initiator site, which is located 45 bp downstream of the putative TATA box, were functioning cooperatively as a core promoter. The putative transcription site was confirmed by the results of RT-PCR southern blot analysis. We examined the regulation and the expression of this exon, I.6, in several human cells and tissues by RT-PCR Southern blot analysis. THP-1 cells (mononuclear leukemic origin) and JEG-3 cells (choriocarcinoma origin) expressed exon I.6 in serum-free media. The level of expression was increased by serum and phorbol myristyl acetate (PMA) in both cell lines. Adipose stromal cells also expressed exon I.6 in the presence of PMA. In fetal osteoblasts, the expression of exon I.6 was increased most effectively by serum and less so by dexamethasone (DEX) + IL-1beta and DEX + IL-11, whereas induction by serum was suppressed by the addition of DEX. The level of expression was low in granulosa cells in culture and did not change with forskolin. On the other hand, dibutyryl cAMP suppressed PMA-stimulated expression of exon I.6 in THP-1 cells and adipose stromal cells. This result supports the hypothesis that the expression of exon I.6 is regulated mainly via an AP-1 binding site that is found upstream of the initiator site of the promoter region. Expression of exon I.6-specific transcripts was examined in several human tissues. Testis and bone obtained from normal adults expressed exon I.6. Testicular tumor and hepatic carcinoma expressed high levels of exon I.6, whereas granulosa cell tumor did not. Fetal liver and bone also showed a significant level of exon I.6 expression, but not so much as testicular tumor and hepatic tumor. Several splicing variants of exon I.6 were detected especially in THP-1 and JEG-3 cells, and to a lesser extent in primary cultures and tissue samples. These variants were identified as an unspliced form, a form spliced at the end of exon I.4, a form spliced at the end of exon I.3 (truncated) and a form spliced 220 bp downstream of the 3' end of exon I.6. The last variant revealed a new splicing site. Because most of the splicing variants contain the sequence specific for exon I.3, RT-PCR specific for exon I.3 can coamplify these splicing variants of exon I.6 transcripts. These results suggests that it is necessary to examine the expression of I.6 in tissues that are known to express exon I.3 such as breast adipose tissue, in which promoter usage of exon I of the aromatase gene switches from exon I.4 to I.3 in the course of malignant transformation.
Length Variation in Mitochondrial DNA of the Minnow Cyprinella Spiloptera
Broughton, R. E.; Dowling, T. E.
1994-01-01
Length differences in animal mitochondrial DNA (mtDNA) are common, frequently due to variation in copy number of direct tandem duplications. While such duplications appear to form without great difficulty in some taxonomic groups, they appear to be relatively short-lived, as typical duplication products are geographically restricted within species and infrequently shared among species. To better understand such length variation, we have studied a tandem and direct duplication of approximately 260 bp in the control region of the cyprinid fish, Cyprinella spiloptera. Restriction site analysis of 38 individuals was used to characterize population structure and the distribution of variation in repeat copy number. This revealed two length variants, including individuals with two or three copies of the repeat, and little geographic structure among populations. No standard length (single copy) genomes were found and heteroplasmy, a common feature of length variation in other taxa, was absent. Nucleotide sequence of tandem duplications and flanking regions localized duplication junctions in the phenylalanine tRNA and near the origin of replication. The locations of these junctions and the stability of folded repeat copies support the hypothesized importance of secondary structures in models of duplication formation. PMID:8001785
ViennaNGS: A toolbox for building efficient next- generation sequencing analysis pipelines
Wolfinger, Michael T.; Fallmann, Jörg; Eggenhofer, Florian; Amman, Fabian
2015-01-01
Recent achievements in next-generation sequencing (NGS) technologies lead to a high demand for reuseable software components to easily compile customized analysis workflows for big genomics data. We present ViennaNGS, an integrated collection of Perl modules focused on building efficient pipelines for NGS data processing. It comes with functionality for extracting and converting features from common NGS file formats, computation and evaluation of read mapping statistics, as well as normalization of RNA abundance. Moreover, ViennaNGS provides software components for identification and characterization of splice junctions from RNA-seq data, parsing and condensing sequence motif data, automated construction of Assembly and Track Hubs for the UCSC genome browser, as well as wrapper routines for a set of commonly used NGS command line tools. PMID:26236465
Absence of integrin alpha 7 causes a novel form of muscular dystrophy.
Mayer, U; Saher, G; Fässler, R; Bornemann, A; Echtermeyer, F; von der Mark, H; Miosge, N; Pöschl, E; von der Mark, K
1997-11-01
Integrin alpha 7 beta 1 is a specific cellular receptor for the basement membrane protein laminin-1 (refs 1,2), as well as for the laminin isoforms -2 and -4 (ref. 3). The alpha 7 subunit is expressed mainly in skeletal and cardiac muscle and has been suggested to be involved in differentiation and migration processes during myogenesis. Three cytoplasmic and two extracellular splice variants that have been described are developmentally regulated and expressed in different sites in the muscle. In adult muscle, the alpha 7A and alpha 7B subunits are concentrated in myotendinous junctions but can also be detected in neuromuscular junctions and along the sarcolemmal membrane. To study the potential involvement of alpha 7 integrin, during myogenesis and its role in muscle integrity and function, we generated a null allele of the alpha 7 gene (Itga7) in the germline of mice by homologous recombination in embryonic stem (ES) cells. Surprisingly, mice homozygous for the mutation are viable and fertile, indicating that the alpha 7 beta 1 integrin is not essential for myogenesis. However, histological analysis of skeletal muscle revealed typical symptoms of a progressive muscular dystrophy starting soon after birth, but with a distinct variability in different muscle types. The observed histopathological changes strongly indicate an impairment of function of the myotendinous junctions. These findings demonstrate that alpha 7 beta 1 integrin represents an indispensable linkage between the muscle fibre and the extracellular matrix that is independent of the dystrophin-dystroglycan complex-mediated interaction of the cytoskeleton with the muscle basement membrane.
Xiong, Jie; Gao, Shan; Dui, Wen; Yang, Wentao; Chen, Xiao; Taverna, Sean D; Pearlman, Ronald E; Ashlock, Wendy; Miao, Wei; Liu, Yifan
2016-12-01
The ciliate protozoan Tetrahymena thermophila contains two types of structurally and functionally differentiated nuclei: the transcriptionally active somatic macronucleus (MAC) and the transcriptionally silent germ-line micronucleus (MIC). Here, we demonstrate that MAC features well-positioned nucleosomes downstream of transcription start sites and flanking splice sites. Transcription-associated trans-determinants promote nucleosome positioning in MAC. By contrast, nucleosomes in MIC are dramatically delocalized. Nucleosome occupancy in MAC and MIC are nonetheless highly correlated with each other, as well as with in vitro reconstitution and predictions based upon DNA sequence features, revealing unexpectedly strong contributions from cis-determinants. In particular, well-positioned nucleosomes are often matched with GC content oscillations. As many nucleosomes are coordinately accommodated by both cis- and trans-determinants, we propose that their distribution is shaped by the impact of these nucleosomes on the mutational and transcriptional landscape, and driven by evolutionary selection. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
ACTG: novel peptide mapping onto gene models.
Choi, Seunghyuk; Kim, Hyunwoo; Paek, Eunok
2017-04-15
In many proteogenomic applications, mapping peptide sequences onto genome sequences can be very useful, because it allows us to understand origins of the gene products. Existing software tools either take the genomic position of a peptide start site as an input or assume that the peptide sequence exactly matches the coding sequence of a given gene model. In case of novel peptides resulting from genomic variations, especially structural variations such as alternative splicing, these existing tools cannot be directly applied unless users supply information about the variant, either its genomic position or its transcription model. Mapping potentially novel peptides to genome sequences, while allowing certain genomic variations, requires introducing novel gene models when aligning peptide sequences to gene structures. We have developed a new tool called ACTG (Amino aCids To Genome), which maps peptides to genome, assuming all possible single exon skipping, junction variation allowing three edit distances from the original splice sites, exon extension and frame shift. In addition, it can also consider SNVs (single nucleotide variations) during mapping phase if a user provides the VCF (variant call format) file as an input. Available at http://prix.hanyang.ac.kr/ACTG/search.jsp . eunokpaek@hanyang.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Evolution of Rubisco activase gene in plants.
Nagarajan, Ragupathi; Gill, Kulvinder S
2018-01-01
Rubisco activase of plants evolved in a stepwise manner without losing its function to adapt to the major evolutionary events including endosymbiosis and land colonization. Rubisco activase is an essential enzyme for photosynthesis, which removes inhibitory sugar phosphates from the active sites of Rubisco, a process necessary for Rubisco activation and carbon fixation. The gene probably evolved in cyanobacteria as different species differ for its presence. However, the gene is present in all other plant species. At least a single gene copy was maintained throughout plant evolution; but various genome and gene duplication events, which occurred during plant evolution, increased its copy number in some species. The exons and exon-intron junctions of present day higher plant's Rca, which is conserved in most species seem to have evolved in charophytes. A unique tandem duplication of Rca gene occurred in a common grass ancestor, and the two genes evolved differently for gene structure, sequence, and expression pattern. At the protein level, starting with a primitive form in cyanobacteria, RCA of chlorophytes evolved by integrating chloroplast transit peptide (cTP), and N-terminal domains to the ATPase, Rubisco recognition and C-terminal domains. The redox regulated C-terminal extension (CTE) and the associated alternate splicing mechanism, which splices the RCA-α and RCA-β isoforms were probably gained from another gene in charophytes, conserved in most species except the members of Solanaceae family.
Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.
2016-01-01
The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruggles, Kelly V.; Tang, Zuojian; Wang, Xuya
Improvements in mass spectrometry (MS)-based peptide sequencing provide a new opportunity to determine whether polymorphisms, mutations and splice variants identified in cancer cells are translated. Herein we therefore describe a proteogenomic data integration tool (QUILTS) and illustrate its application to whole genome, transcriptome and global MS peptide sequence datasets generated from a pair of luminal and basal-like breast cancer patient derived xenografts (PDX). The sensitivity of proteogenomic analysis for singe nucleotide variant (SNV) expression and novel splice junction (NSJ) detection was probed using multiple MS/MS process replicates. Despite over thirty sample replicates, only about 10% of all SNV (somatic andmore » germline) were detected by both DNA and RNA sequencing were observed as peptides. An even smaller proportion of peptides corresponding to NSJ observed by RNA sequencing were detected (<0.1%). Peptides mapping to DNA-detected SNV without a detectable mRNA transcript were also observed demonstrating the transcriptome coverage was also incomplete (~80%). In contrast to germ-line variants, somatic variants were less likely to be detected at the peptide level in the basal-like tumor than the luminal tumor raising the possibility of differential translation or protein degradation effects. In conclusion, the QUILTS program integrates DNA, RNA and peptide sequencing to assess the degree to which somatic mutations are translated and therefore biologically active. By identifying gaps in sequence coverage QUILTS benchmarks current technology and assesses progress towards whole cancer proteome and transcriptome analysis.« less
Mömke, Stefanie; Kerkmann, Andrea; Wöhlke, Anne; Ostmeier, Miriam; Hewicker-Trautwein, Marion; Ganter, Martin; Kijas, James; Distl, Ottmar
2011-01-01
Junctional epidermolysis bullosa (JEB) is a hereditary mechanobullous skin disease in humans and animals. A Herlitz type JEB was identified in German Black Headed Mutton (BHM) sheep and affected lambs were reproduced in a breeding trial. Affected lambs showed skin and mucous membranes blistering and all affected lambs died within the first weeks of life. The pedigree data were consistent with a monogenic autosomal recessive inheritance. Immunofluorescence showed a reduced expression of laminin 5 protein which consists of 3 subunits encoded by the genes LAMA3, LAMB3 and LAMC2. We screened these genes for polymorphisms. Linkage and genome-wide association analyses identified LAMC2 as the most likely candidate for HJEB. A two base pair deletion within exon 18 of the LAMC2 gene (FM872310:c.2746delCA) causes a frameshift mutation resulting in a premature stop codon (p.A928*) 13 triplets downstream of this mutation and in addition, introduces an alternative splicing of exon 18 LAMC2. This deletion showed a perfect co-segregation with HJEB in all 740 analysed BHM sheep. Identification of the LAMC2 deletion means an animal model for HJEB is now available to develop therapeutic approaches of relevance to the human form of this disease. PMID:21573221
MutPred Splice: machine learning-based prediction of exonic variants that disrupt splicing
2014-01-01
We have developed a novel machine-learning approach, MutPred Splice, for the identification of coding region substitutions that disrupt pre-mRNA splicing. Applying MutPred Splice to human disease-causing exonic mutations suggests that 16% of mutations causing inherited disease and 10 to 14% of somatic mutations in cancer may disrupt pre-mRNA splicing. For inherited disease, the main mechanism responsible for the splicing defect is splice site loss, whereas for cancer the predominant mechanism of splicing disruption is predicted to be exon skipping via loss of exonic splicing enhancers or gain of exonic splicing silencer elements. MutPred Splice is available at http://mutdb.org/mutpredsplice. PMID:24451234
Diverse alternative back-splicing and alternative splicing landscape of circular RNAs
Zhang, Xiao-Ou; Dong, Rui; Zhang, Yang; Zhang, Jia-Lin; Luo, Zheng; Zhang, Jun; Chen, Ling-Ling; Yang, Li
2016-01-01
Circular RNAs (circRNAs) derived from back-spliced exons have been widely identified as being co-expressed with their linear counterparts. A single gene locus can produce multiple circRNAs through alternative back-splice site selection and/or alternative splice site selection; however, a detailed map of alternative back-splicing/splicing in circRNAs is lacking. Here, with the upgraded CIRCexplorer2 pipeline, we systematically annotated different types of alternative back-splicing and alternative splicing events in circRNAs from various cell lines. Compared with their linear cognate RNAs, circRNAs exhibited distinct patterns of alternative back-splicing and alternative splicing. Alternative back-splice site selection was correlated with the competition of putative RNA pairs across introns that bracket alternative back-splice sites. In addition, all four basic types of alternative splicing that have been identified in the (linear) mRNA process were found within circRNAs, and many exons were predominantly spliced in circRNAs. Unexpectedly, thousands of previously unannotated exons were detected in circRNAs from the examined cell lines. Although these novel exons had similar splice site strength, they were much less conserved than known exons in sequences. Finally, both alternative back-splicing and circRNA-predominant alternative splicing were highly diverse among the examined cell lines. All of the identified alternative back-splicing and alternative splicing in circRNAs are available in the CIRCpedia database (http://www.picb.ac.cn/rnomics/circpedia). Collectively, the annotation of alternative back-splicing and alternative splicing in circRNAs provides a valuable resource for depicting the complexity of circRNA biogenesis and for studying the potential functions of circRNAs in different cells. PMID:27365365
Dwarfism with joint laxity in Friesian horses is associated with a splice site mutation in B4GALT7.
Leegwater, Peter A; Vos-Loohuis, Manon; Ducro, Bart J; Boegheim, Iris J; van Steenbeek, Frank G; Nijman, Isaac J; Monroe, Glen R; Bastiaansen, John W M; Dibbits, Bert W; van de Goor, Leanne H; Hellinga, Ids; Back, Willem; Schurink, Anouk
2016-10-28
Inbreeding and population bottlenecks in the ancestry of Friesian horses has led to health issues such as dwarfism. The limbs of dwarfs are short and the ribs are protruding inwards at the costochondral junction, while the head and back appear normal. A striking feature of the condition is the flexor tendon laxity that leads to hyperextension of the fetlock joints. The growth plates of dwarfs display disorganized and thickened chondrocyte columns. The aim of this study was to identify the gene defect that causes the recessively inherited trait in Friesian horses to understand the disease process at the molecular level. We have localized the genetic cause of the dwarfism phenotype by a genome wide approach to a 3 Mb region on the p-arm of equine chromosome 14. The DNA of two dwarfs and one control Friesian horse was sequenced completely and we identified the missense mutation ECA14:g.4535550C > T that cosegregated with the phenotype in all Friesians analyzed. The mutation leads to the amino acid substitution p.(Arg17Lys) of xylosylprotein beta 1,4-galactosyltransferase 7 encoded by B4GALT7. The protein is one of the enzymes that synthesize the tetrasaccharide linker between protein and glycosaminoglycan moieties of proteoglycans of the extracellular matrix. The mutation not only affects a conserved arginine codon but also the last nucleotide of the first exon of the gene and we show that it impedes splicing of the primary transcript in cultured fibroblasts from a heterozygous horse. As a result, the level of B4GALT7 mRNA in fibroblasts from a dwarf is only 2 % compared to normal levels. Mutations in B4GALT7 in humans are associated with Ehlers-Danlos syndrome progeroid type 1 and Larsen of Reunion Island syndrome. Growth retardation and ligamentous laxity are common manifestations of these syndromes. We suggest that the identified mutation of equine B4GALT7 leads to the typical dwarfism phenotype in Friesian horses due to deficient splicing of transcripts of the gene. The mutated gene implicates the extracellular matrix in the regular organization of chrondrocyte columns of the growth plate. Conservation of individual amino acids may not be necessary at the protein level but instead may reflect underlying conservation of nucleotide sequence that are required for efficient splicing.
Splicing-factor alterations in cancers
Anczuków, Olga; Krainer, Adrian R.
2016-01-01
Tumor-associated alterations in RNA splicing result either from mutations in splicing-regulatory elements or changes in components of the splicing machinery. This review summarizes our current understanding of the role of splicing-factor alterations in human cancers. We describe splicing-factor alterations detected in human tumors and the resulting changes in splicing, highlighting cell-type-specific similarities and differences. We review the mechanisms of splicing-factor regulation in normal and cancer cells. Finally, we summarize recent efforts to develop novel cancer therapies, based on targeting either the oncogenic splicing events or their upstream splicing regulators. PMID:27530828
Splicing-related genes are alternatively spliced upon changes in ambient temperatures in plants
Bucher, Johan; Lammers, Michiel; Busscher-Lange, Jacqueline; Bonnema, Guusje; Rodenburg, Nicole; Proveniers, Marcel C. G.; Angenent, Gerco C.
2017-01-01
Plants adjust their development and architecture to small variations in ambient temperature. In a time in which temperatures are rising world-wide, the mechanism by which plants are able to sense temperature fluctuations and adapt to it, is becoming of special interest. By performing RNA-sequencing on two Arabidopsis accession and one Brassica species exposed to temperature alterations, we showed that alternative splicing is an important mechanism in ambient temperature sensing and adaptation. We found that amongst the differentially alternatively spliced genes, splicing related genes are enriched, suggesting that the splicing machinery itself is targeted for alternative splicing when temperature changes. Moreover, we showed that many different components of the splicing machinery are targeted for ambient temperature regulated alternative splicing. Mutant analysis of a splicing related gene that was differentially spliced in two of the genotypes showed an altered flowering time response to different temperatures. We propose a two-step mechanism where temperature directly influences alternative splicing of the splicing machinery genes, followed by a second step where the altered splicing machinery affects splicing of downstream genes involved in the adaptation to altered temperatures. PMID:28257507
Modelling reveals kinetic advantages of co-transcriptional splicing.
Aitken, Stuart; Alexander, Ross D; Beggs, Jean D
2011-10-01
Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-transcriptional second step splicing. Model comparison is used to assess the alternative representations of reactions. Modelling also indicates the functional coupling of transcription and splicing, because both the rate of initiation of transcription and the probability that step one of splicing occurs co-transcriptionally are reduced, when the second step of splicing is abolished in a mutant reporter.
Precise Maps of RNA Polymerase Reveal How Promoters Direct Initiation and Pausing
Kwak, Hojoong; Fuda, Nicholas J.; Core, Leighton J.; Lis, John T.
2014-01-01
Transcription regulation occurs frequently through promoter-associated pausing of RNA polymerase II (Pol II). We developed a Precision nuclear Run-On and sequencing assay (PRO-seq) to map the genome-wide distribution of transcriptionally-engaged Pol II at base-pair resolution. Pol II accumulates immediately downstream of promoters, at intron-exon junctions that are efficiently used for splicing, and over 3' poly-adenylation sites. Focused analyses of promoters reveal that pausing is not fixed relative to initiation sites nor is it specified directly by the position of a particular core promoter element or the first nucleosome. Core promoter elements function beyond initiation, and when optimally positioned they act collectively to dictate the position and strength of pausing. We test this ‘Complex Interaction’ model with insertional mutagenesis of the Drosophila Hsp70 core promoter. PMID:23430654
Aberrant alternative splicing is another hallmark of cancer.
Ladomery, Michael
2013-01-01
The vast majority of human genes are alternatively spliced. Not surprisingly, aberrant alternative splicing is increasingly linked to cancer. Splice isoforms often encode proteins that have distinct and even antagonistic properties. The abnormal expression of splice factors and splice factor kinases in cancer changes the alternative splicing of critically important pre-mRNAs. Aberrant alternative splicing should be added to the growing list of cancer hallmarks.
A novel protein factor is required for use of distal alternative 5' splice sites in vitro.
Harper, J E; Manley, J L
1991-01-01
Adenovirus E1A pre-mRNA was used as a model to examine alternative 5' splice site selection during in vitro splicing reactions. Strong preference for the downstream 13S 5' splice site over the upstream 12S or 9S 5' splice sites was observed. However, the 12S 5' splice site was used efficiently when a mutant pre-mRNA lacking the 13S 5' splice site was processed, and 12S splicing from this substrate was not reduced by 13S splicing from a separate pre-mRNA, demonstrating that 13S splicing reduced 12S 5' splice site selection through a bona fide cis-competition. DEAE-cellulose chromatography of nuclear extract yielded two fractions with different splicing activities. The bound fraction contained all components required for efficient splicing of simple substrates but was unable to utilize alternative 5' splice sites. In contrast, the flow-through fraction, which by itself was inactive, contained an activity required for alternative splicing and was shown to stimulate 12S and 9S splicing, while reducing 13S splicing, when added to reactions carried out by the bound fraction. Furthermore, the activity, which we have called distal splicing factor (DSF), enhanced utilization of an upstream 5' splice site on a simian virus 40 early pre-mRNA, suggesting that the factor acts in a position-dependent, substrate-independent fashion. Several lines of evidence are presented suggesting that DSF is a non-small nuclear ribonucleoprotein protein. Finally, we describe a functional interaction between DSF and ASF, a protein that enhances use of downstream 5' splice sites. Images PMID:1658620
Targeting RNA Splicing for Disease Therapy
Havens, Mallory A.; Duelli, Dominik M.
2013-01-01
Splicing of pre-messenger RNA into mature messenger RNA is an essential step for expression of most genes in higher eukaryotes. Defects in this process typically affect cellular function and can have pathological consequences. Many human genetic diseases are caused by mutations that cause splicing defects. Furthermore, a number of diseases are associated with splicing defects that are not attributed to overt mutations. Targeting splicing directly to correct disease-associated aberrant splicing is a logical approach to therapy. Splicing is a favorable intervention point for disease therapeutics, because it is an early step in gene expression and does not alter the genome. Significant advances have been made in the development of approaches to manipulate splicing for therapy. Splicing can be manipulated with a number of tools including antisense oligonucleotides, modified small nuclear RNAs (snRNAs), trans-splicing, and small molecule compounds, all of which have been used to increase specific alternatively spliced isoforms or to correct aberrant gene expression resulting from gene mutations that alter splicing. Here we describe clinically relevant splicing defects in disease states, the current tools used to target and alter splicing, specific mutations and diseases that are being targeted using splice-modulating approaches, and emerging therapeutics. PMID:23512601
Targeting RNA splicing for disease therapy.
Havens, Mallory A; Duelli, Dominik M; Hastings, Michelle L
2013-01-01
Splicing of pre-messenger RNA into mature messenger RNA is an essential step for the expression of most genes in higher eukaryotes. Defects in this process typically affect cellular function and can have pathological consequences. Many human genetic diseases are caused by mutations that cause splicing defects. Furthermore, a number of diseases are associated with splicing defects that are not attributed to overt mutations. Targeting splicing directly to correct disease-associated aberrant splicing is a logical approach to therapy. Splicing is a favorable intervention point for disease therapeutics, because it is an early step in gene expression and does not alter the genome. Significant advances have been made in the development of approaches to manipulate splicing for therapy. Splicing can be manipulated with a number of tools including antisense oligonucleotides, modified small nuclear RNAs (snRNAs), trans-splicing, and small molecule compounds, all of which have been used to increase specific alternatively spliced isoforms or to correct aberrant gene expression resulting from gene mutations that alter splicing. Here we describe clinically relevant splicing defects in disease states, the current tools used to target and alter splicing, specific mutations and diseases that are being targeted using splice-modulating approaches, and emerging therapeutics. Copyright © 2013 John Wiley & Sons, Ltd.
Cossins, Judith; Liu, Wei Wei; Belaya, Katsiaryna; Maxwell, Susan; Oldridge, Michael; Lester, Tracy; Robb, Stephanie; Beeson, David
2012-09-01
Congenital myasthenic syndromes (CMS) are a group of inherited diseases that affect synaptic transmission at the neuromuscular junction and result in fatiguable muscle weakness. A subgroup of CMS patients have a recessively inherited limb-girdle pattern of weakness caused by mutations in DOK7. DOK7 encodes DOK7, an adaptor protein that is expressed in the skeletal muscle and heart and that is essential for the development and maintenance of the neuromuscular junction. We have screened the DOK7 gene for mutations by polymerase chain reaction amplification and bi-directional sequencing of exonic and promoter regions and performed acetylcholine receptor (AChR) clustering assays and used exon trapping to determine the pathogenicity of detected variants. Approximately 18% of genetically diagnosed CMSs in the UK have mutations in DOK7, with mutations in this gene identified in more than 60 kinships to date. Thirty-four different pathogenic mutations were identified as well as 27 variants likely to be non-pathogenic. An exon 7 frameshift duplication c.1124_1127dupTGCC is commonly found in at least one allele. We analyse the effect of the common frameshift c.1124_1127dupTGCC and show that 10/11 suspected missense mutations have a deleterious effect on AChR clustering. We identify for the first time homozygous or compound heterozygous mutations that are localized 5' to exon 7. In addition, three silent variants in the N-terminal half of DOK7 are predicted to alter the splicing of the DOK7 RNA transcript. The DOK7 gene is highly polymorphic, and within these many variants, we define a spectrum of mutations that can underlie DOK7 CMS that will inform in managing this disorder.
[Deregulation of pre-messenger RNA splicing and rare diseases].
de la Grange, Pierre
2016-12-01
Most of protein-coding human genes are subjected to alternative pre-mRNA splicing. This mechanism is highly regulated to precisely modulate detection of specific splice sites. This regulation is under control of the spliceosome and several splicing factors are also required to modulate the alternative usage of splice sites. Splicing factors and spliceosome components recognize splicing signals and regulatory sequences of the pre-mRNAs. These splicing sequences make splicing susceptible to polymorphisms and mutations. Examples of associations between human rare diseases and defects in pre-messenger RNA splicing are accumulating. Although many alterations are caused by mutations in splicing sequence (i.e., cis acting mutations), recent studies described the disruptive impact of mutations within spliceosome components or splicing factors (i.e., trans acting mutations). Following growing of knowledge regarding splicing regulation, several approaches have been developed to compensate for the effect of deleterious mutations and to restore sufficient amounts of functional protein. © 2016 médecine/sciences – Inserm.
Ge, H; Noble, J; Colgan, J; Manley, J L
1990-01-01
We have studied splicing of the polyoma virus early region pre-mRNA in vitro. This RNA is alternatively spliced in vivo to produce mRNA encoding the large, middle-sized (MTAg), and small (StAg) tumor antigens. Our primary interest was to learn how the 48-nucleotide StAg intron is excised, because the length of this intron is significantly less than the apparent minimum established for mammalian introns. Although the products of all three splices are detected in vitro, characterization of the pathway and sequence requirements of StAg splicing suggests that splicing factors interact with the precursor RNA in an unexpected way to catalyze removal of this intron. Specifically, StAg splicing uses either of two lariat branch points, one of which is located only 4 nucleotides from the 3' splice site. Furthermore, the StAg splice absolutely requires that the alternative MTAg 3' splice site, located 14 nucleotides downstream of the StAg 3' splice site, be intact. Insertion mutations that increase or decrease the quality of the MTAg pyrimidine stretch enhance or repress StAg as well as MTAg splicing, and a single-base change in the MTAg AG splice acceptor totally blocks both splices. These results demonstrate the ability of two 3' splice sites to cooperate with each other to bring about removal of a single intron. Images PMID:2159146
“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta
Hansen, Geneviève; Chilton, Mary-Dell
1996-01-01
We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167
Witkind, I.J.
1954-01-01
formation (Permian) to the Salt Wash member of the Morrison formation (Jurassic), The dominant structural element of the area is the Monument upwarp, a arge asymmetrical anticline whose northern end is near the junction of the Green and Colorado Rivers in Utah, and whose southern end disappears near Kayenta, Ariz. Asymmetrical anticlines with steeply dipping east flanks and gently dipping west flanks are superimposed on the upwarp. These subsidiary structures trend north. The uranium ore bodies are localized in conglomeratic sandstone of the Upper Triassic Shinarump conglomerate that fills channels scoured in the underlying Lower and Middle (?) Triassic Moenkopi formation. These channels range from relatively narrow and shallow ones 15 feet wide and 10 feet deep to much broader and deeper ones 2,300 feet wide and 70 feet deep. Two types of channels can be distinguished-r-a short-type less than 2 miles Iong 5 and a long-type traceable for distances greater than 2 miles Plant matter in the form of trees, branches,'and twigs was deposited with Shinarump sediments in the channels. It is suggested that when the Shinarump conglomerate was invaded by mineralizing solutions the uranium ore was deposited primarily in localities formerly occupied by the plant material. Further, it is suggested that the short channels are more likely to have ore accumulations than long channels.
Identification of genes from the Treacher Collins candidate region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dixon, M.; Dixon, J.; Edwards, S.
Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less
Hainaut, Pierre
2014-01-01
Germline TP53 mutations predispose to multiple cancers defining Li-Fraumeni/Li-Fraumeni-like syndrome (LFS/LFL), a disease with large individual disparities in cancer profiles and age of onset. G-quadruplexes (G4s) are secondary structural motifs occurring in guanine tracks, with regulatory effects on DNA and RNA. We analyzed 85 polymorphisms within or near five predicted G4s in TP53 in search of modifiers of penetrance of LFS/LFL in Brazilian cancer families with (n = 35) or without (n = 110) TP53 mutations. Statistical analyses stratified on family structure showed that cancer tended to occur ~15 years later in mutation carriers who also carried the variant alleles of two polymorphisms within predicted G4-forming regions, rs17878362 (TP53 PIN3, 16 bp duplication in intron 3; P = 0.082) and rs17880560 (6 bp duplication in 3′ flanking region; P = 0.067). Haplotype analysis showed that this inverse association was driven by the polymorphic status of the remaining wild-type (WT) haplotype in mutation carriers: in carriers with a WT haplotype containing at least one variant allele of rs17878362 or rs17880560, cancer occurred ~15 years later than in carriers with other WT haplotypes (P = 0.019). No effect on age of cancer onset was observed in subjects without a TP53 mutation. The G4 in intron 3 has been shown to regulate alternative p53 messenger RNA splicing, whereas the biological roles of predicted G4s in the 3′ flanking region remain to be elucidated. In conclusion, this study demonstrates that G4 polymorphisms in haplotypes of the WT TP53 allele have an impact on LFS/LFL penetrance in germline TP53 mutation carriers. PMID:24336192
Aberrant RNA splicing in cancer; expression changes and driver mutations of splicing factor genes.
Sveen, A; Kilpinen, S; Ruusulehto, A; Lothe, R A; Skotheim, R I
2016-05-12
Alternative splicing is a widespread process contributing to structural transcript variation and proteome diversity. In cancer, the splicing process is commonly disrupted, resulting in both functional and non-functional end-products. Cancer-specific splicing events are known to contribute to disease progression; however, the dysregulated splicing patterns found on a genome-wide scale have until recently been less well-studied. In this review, we provide an overview of aberrant RNA splicing and its regulation in cancer. We then focus on the executors of the splicing process. Based on a comprehensive catalog of splicing factor encoding genes and analyses of available gene expression and somatic mutation data, we identify cancer-associated patterns of dysregulation. Splicing factor genes are shown to be significantly differentially expressed between cancer and corresponding normal samples, and to have reduced inter-individual expression variation in cancer. Furthermore, we identify enrichment of predicted cancer-critical genes among the splicing factors. In addition to previously described oncogenic splicing factor genes, we propose 24 novel cancer-critical splicing factors predicted from somatic mutations.
The power of fission: yeast as a tool for understanding complex splicing.
Fair, Benjamin Jung; Pleiss, Jeffrey A
2017-06-01
Pre-mRNA splicing is an essential component of eukaryotic gene expression. Many metazoans, including humans, regulate alternative splicing patterns to generate expansions of their proteome from a limited number of genes. Importantly, a considerable fraction of human disease causing mutations manifest themselves through altering the sequences that shape the splicing patterns of genes. Thus, understanding the mechanistic bases of this complex pathway will be an essential component of combating these diseases. Dating almost to the initial discovery of splicing, researchers have taken advantage of the genetic tractability of budding yeast to identify the components and decipher the mechanisms of splicing. However, budding yeast lacks the complex splicing machinery and alternative splicing patterns most relevant to humans. More recently, many researchers have turned their efforts to study the fission yeast, Schizosaccharomyces pombe, which has retained many features of complex splicing, including degenerate splice site sequences, the usage of exonic splicing enhancers, and SR proteins. Here, we review recent work using fission yeast genetics to examine pre-mRNA splicing, highlighting its promise for modeling the complex splicing seen in higher eukaryotes.
Matsumoto, Jun; Dewar, Ken; Wasserscheid, Jessica; Wiley, Graham B; Macmil, Simone L; Roe, Bruce A; Zeller, Robert W; Satou, Yutaka; Hastings, Kenneth E M
2010-05-01
Pre-mRNA 5' spliced-leader (SL) trans-splicing occurs in some metazoan groups but not in others. Genome-wide characterization of the trans-spliced mRNA subpopulation has not yet been reported for any metazoan. We carried out a high-throughput analysis of the SL trans-spliced mRNA population of the ascidian tunicate Ciona intestinalis by 454 Life Sciences (Roche) pyrosequencing of SL-PCR-amplified random-primed reverse transcripts of tailbud embryo RNA. We obtained approximately 250,000 high-quality reads corresponding to 8790 genes, approximately 58% of the Ciona total gene number. The great depth of this data revealed new aspects of trans-splicing, including the existence of a significant class of "infrequently trans-spliced" genes, accounting for approximately 28% of represented genes, that generate largely non-trans-spliced mRNAs, but also produce trans-spliced mRNAs, in part through alternative promoter use. Thus, the conventional qualitative dichotomy of trans-spliced versus non-trans-spliced genes should be supplanted by a more accurate quantitative view recognizing frequently and infrequently trans-spliced gene categories. Our data include reads representing approximately 80% of Ciona frequently trans-spliced genes. Our analysis also revealed significant use of closely spaced alternative trans-splice acceptor sites which further underscores the mechanistic similarity of cis- and trans-splicing and indicates that the prevalence of +/-3-nt alternative splicing events at tandem acceptor sites, NAGNAG, is driven by spliceosomal mechanisms, and not nonsense-mediated decay, or selection at the protein level. The breadth of gene representation data enabled us to find new correlations between trans-splicing status and gene function, namely the overrepresentation in the frequently trans-spliced gene class of genes associated with plasma/endomembrane system, Ca(2+) homeostasis, and actin cytoskeleton.
The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture.
Pai, Athma A; Henriques, Telmo; McCue, Kayla; Burkholder, Adam; Adelman, Karen; Burge, Christopher B
2017-12-27
Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning ('intron definition') or exon-spanning ('exon definition') pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila , using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60-70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly low variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing.
Genetics of alternative splicing evolution during sunflower domestication.
Smith, Chris C R; Tittes, Silas; Mendieta, J Paul; Collier-Zans, Erin; Rowe, Heather C; Rieseberg, Loren H; Kane, Nolan C
2018-06-11
Alternative splicing enables organisms to produce the diversity of proteins necessary for multicellular life by using relatively few protein-coding genes. Although differences in splicing have been identified among divergent taxa, the shorter-term evolution of splicing is understudied. The origins of novel splice forms, and the contributions of alternative splicing to major evolutionary transitions, are largely unknown. This study used transcriptomes of wild and domesticated sunflowers to examine splice differentiation and regulation during domestication. We identified substantial splicing divergence between wild and domesticated sunflowers, mainly in the form of intron retention. Transcripts with divergent splicing were enriched for seed-development functions, suggesting that artificial selection impacted splicing patterns. Mapping of quantitative trait loci (QTLs) associated with 144 differential splicing cases revealed primarily trans -acting variation affecting splicing patterns. A large proportion of identified QTLs contain known spliceosome proteins and are associated with splicing variation in multiple genes. Examining a broader set of wild and domesticated sunflower genotypes revealed that most differential splicing patterns in domesticated sunflowers likely arose from standing variation in wild Helianthus annuus and gained frequency during the domestication process. However, several domesticate-associated splicing patterns appear to be introgressed from other Helianthus species. These results suggest that sunflower domestication involved selection on pleiotropic regulatory alleles. More generally, our findings indicate that substantial differences in isoform abundances arose rapidly during a recent evolutionary transition and appear to contribute to adaptation and population divergence.
Luo, Su-shan; Xi, Jian-ying; Cai, Shuang; Zhao, Chong-bo; Lu, Jia-hong; Zhu, Wen-hua; Lin, Jie; Qiao, Kai; Wang, Yin; Ye, Zhu-rong
2014-01-01
Danon disease is an Xlinked dominant lysosomal glycogen storage disorder characterized by cardiomyopathy, skeletal myopathy, and mental retardation. This study described two Chinese cases of Danon disease in order to broaden the phenotypic and genetic spectrum. Clinical data were collected and LAMP2 mutations were analyzed. Patient A had fluctuating limb weakness during 6 months follow-up and was diagnosed with drug-induced myopathy due to anti-hepatitis B therapy with lamivudine. However, the first muscle biopsy with large cytoplasmic vacuoles confused the diagnosis and led to the second biopsy that allowed for the final diagnosis. Patient B had severe cardiac disturbances leading to sudden death. Molecularly, patient A harbored a synonymous mutation adjacent to the exon 6-intron 6 junction; mRNA analysis provided evidence that totally abolished the donor site and caused skipping of exon 6. Patient B harbored a frame-shift deletion mutation in exon 3 (c.396delA) leading to a truncated protein. To our knowledge, this is the first report of Danon disease caused by a synonymous exon mutation that affected mRNA splicing, which indicates that a synonymous substitution may not be silent when it is in the exon sequences close to the splice sites. It is also the first description of Danon disease clinically presenting as druginduced myopathy at onset; the pathological changes might be the key point for making a differential diagnosis. *These two authors contributed equally to this work.
Loss of ERLIN2 function leads to juvenile primary lateral sclerosis.
Al-Saif, Amr; Bohlega, Saeed; Al-Mohanna, Futwan
2012-10-01
Primary lateral sclerosis (PLS) is a motor neuron disorder that exclusively affects upper motor neurons leading to their degeneration. Mutations in the ALS2 gene encoding the protein Alsin have been described previously in the juvenile form of the disease. In this study, we identify mutation of the ERLIN2 gene in juvenile PLS patients and describe an in vitro model for loss of ERLIN2 function. Single nucleotide polymorphism arrays were used for homozygosity mapping. DNA sequencing of candidate genes was used to detect the underlying mutation. Level of ERLIN2 mRNA was measured by quantitative real time polymerase chain reaction. Knocking down ERLIN2 in NSC34 cells was accomplished by short-hairpin RNA interference. We identified a splice junction mutation in the ERLIN2 gene-a component of the endoplasmic reticulum (ER) lipid rafts-that resulted in abnormal splicing of ERLIN2 transcript and nonsense-mediated decay of ERLIN2 mRNA. Knocking down ERLIN2 in NSC34 cells suppressed their growth in culture. Recently, we found that mutation of SIGMAR1, a component of ER lipid rafts, leads to juvenile amyotrophic lateral sclerosis. The identification of mutation in another component of the ER lipid rafts in juvenile PLS patients emphasizes their role in motor neuron function. Furthermore, the discovered effect of ERLIN2 loss on cell growth may advance understanding of the mechanism behind motor neuron degeneration in PLS. Copyright © 2012 American Neurological Association.
Ryan, Michael C; Cleland, James; Kim, RyangGuk; Wong, Wing Chung; Weinstein, John N
2012-09-15
SpliceSeq is a resource for RNA-Seq data that provides a clear view of alternative splicing and identifies potential functional changes that result from splice variation. It displays intuitive visualizations and prioritized lists of results that highlight splicing events and their biological consequences. SpliceSeq unambiguously aligns reads to gene splice graphs, facilitating accurate analysis of large, complex transcript variants that cannot be adequately represented in other formats. SpliceSeq is freely available at http://bioinformatics.mdanderson.org/main/SpliceSeq:Overview. The application is a Java program that can be launched via a browser or installed locally. Local installation requires MySQL and Bowtie. mryan@insilico.us.com Supplementary data are available at Bioinformatics online.
Collins, Richard A; Stajich, Jason E; Field, Deborah J; Olive, Joan E; DeAbreu, Diane M
2015-05-01
When we expressed a small (0.9 kb) nonprotein-coding transcript derived from the mitochondrial VS plasmid in the nucleus of Neurospora we found that it was efficiently spliced at one or more of eight 5' splice sites and ten 3' splice sites, which are present apparently by chance in the sequence. Further experimental and bioinformatic analyses of other mitochondrial plasmids, random sequences, and natural nuclear genes in Neurospora and other fungi indicate that fungal spliceosomes recognize a wide range of 5' splice site and branchpoint sequences and predict introns to be present at high frequency in random sequence. In contrast, analysis of intronless fungal nuclear genes indicates that branchpoint, 5' splice site and 3' splice site consensus sequences are underrepresented compared with random sequences. This underrepresentation of splicing signals is sufficient to deplete the nuclear genome of splice sites at locations that do not comprise biologically relevant introns. Thus, the splicing machinery can recognize a wide range of splicing signal sequences, but splicing still occurs with great accuracy, not because the splicing machinery distinguishes correct from incorrect introns, but because incorrect introns are substantially depleted from the genome. © 2015 Collins et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Jyotsana, Nidhi; Heuser, Michael
2018-02-01
Mutations in genes associated with splicing have been found in hematologic malignancies, but also in solid cancers. Aberrant cancer specific RNA splicing either results from mutations or misexpression of the spliceosome genes directly, or from mutations in splice sites of oncogenes or tumor suppressors. Areas covered: In this review, we present molecular targets of aberrant splicing in various malignancies, information on existing and emerging therapeutics against such targets, and strategies for future drug development. Expert opinion: Alternative splicing is an important mechanism that controls gene expression, and hence pharmacologic and genetic control of aberrant alternative RNA splicing has been proposed as a potential therapy in cancer. To identify and validate aberrant RNA splicing patterns as therapeutic targets we need to (1) characterize the most common genetic aberrations of the spliceosome and of splice sites, (2) understand the dysregulated downstream pathways and (3) exploit in-vivo disease models of aberrant splicing. Antisense oligonucleotides show promising activity, but will benefit from improved delivery tools. Inhibitors of mutated splicing factors require improved specificity, as alternative and aberrant splicing are often intertwined like two sides of the same coin. In summary, targeting aberrant splicing is an early but emerging field in cancer treatment.
Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes
Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia
2013-01-01
DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893
30 CFR 57.12088 - Splicing trailing cables.
Code of Federal Regulations, 2014 CFR
2014-07-01
... cable reel or other power feed cable payout-retrieval system. However, a temporary splice may be made to... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Splicing trailing cables. 57.12088 Section 57... Underground Only § 57.12088 Splicing trailing cables. No splice, except a vulcanized splice or its equivalent...
30 CFR 57.12088 - Splicing trailing cables.
Code of Federal Regulations, 2011 CFR
2011-07-01
... cable reel or other power feed cable payout-retrieval system. However, a temporary splice may be made to... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Splicing trailing cables. 57.12088 Section 57... Underground Only § 57.12088 Splicing trailing cables. No splice, except a vulcanized splice or its equivalent...
30 CFR 57.12088 - Splicing trailing cables.
Code of Federal Regulations, 2013 CFR
2013-07-01
... cable reel or other power feed cable payout-retrieval system. However, a temporary splice may be made to... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Splicing trailing cables. 57.12088 Section 57... Underground Only § 57.12088 Splicing trailing cables. No splice, except a vulcanized splice or its equivalent...
30 CFR 57.12088 - Splicing trailing cables.
Code of Federal Regulations, 2012 CFR
2012-07-01
... cable reel or other power feed cable payout-retrieval system. However, a temporary splice may be made to... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Splicing trailing cables. 57.12088 Section 57... Underground Only § 57.12088 Splicing trailing cables. No splice, except a vulcanized splice or its equivalent...
The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture
Pai, Athma A; Henriques, Telmo; McCue, Kayla; Burkholder, Adam; Adelman, Karen
2017-01-01
Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning (‘intron definition’) or exon-spanning (‘exon definition’) pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila, using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60–70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly low variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing. PMID:29280736
The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture
Pai, Athma A.; Henriques, Telmo; McCue, Kayla; ...
2017-12-27
Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning (‘intron definition’) or exon-spanning (‘exon definition’) pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila, using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60–70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly lowmore » variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing.« less
The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pai, Athma A.; Henriques, Telmo; McCue, Kayla
Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning (‘intron definition’) or exon-spanning (‘exon definition’) pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila, using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60–70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly lowmore » variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing.« less
Ryan, Michael C.; Cleland, James; Kim, RyangGuk; Wong, Wing Chung; Weinstein, John N.
2012-01-01
Summary: SpliceSeq is a resource for RNA-Seq data that provides a clear view of alternative splicing and identifies potential functional changes that result from splice variation. It displays intuitive visualizations and prioritized lists of results that highlight splicing events and their biological consequences. SpliceSeq unambiguously aligns reads to gene splice graphs, facilitating accurate analysis of large, complex transcript variants that cannot be adequately represented in other formats. Availability and implementation: SpliceSeq is freely available at http://bioinformatics.mdanderson.org/main/SpliceSeq:Overview. The application is a Java program that can be launched via a browser or installed locally. Local installation requires MySQL and Bowtie. Contact: mryan@insilico.us.com Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:22820202
IRAS: High-Throughput Identification of Novel Alternative Splicing Regulators.
Zheng, S
2016-01-01
Alternative splicing is a fundamental regulatory process of gene expression. Defects in alternative splicing can lead to various diseases, and modification of disease-causing splicing events presents great therapeutic promise. Splicing outcome is commonly affected by extracellular stimuli and signaling cascades that converge on RNA-binding splicing regulators. These trans-acting factors recognize cis-elements in pre-mRNA transcripts to affect spliceosome assembly and splice site choices. Identification of these splicing regulators and/or upstream modulators has been difficult and traditionally done by piecemeal. High-throughput screening strategies to find multiple regulators of exon splicing have great potential to accelerate the discovery process, but typically confront low sensitivity and low specificity of screening assays. Here we describe a unique screening strategy, IRAS (identifying regulators of alternative splicing), using a pair of dual-output minigene reporters to allow for sensitive detection of exon splicing changes. Each dual-output reporter produces green fluorescent protein (GFP) and red fluorescent protein (RFP) fluorescent signals to assay the two spliced isoforms exclusively. The two complementary minigene reporters alter GFP/RFP output ratios in the opposite direction in response to splicing change. Applying IRAS in cell-based high-throughput screens allows sensitive and specific identification of splicing regulators and modulators for any alternative exons of interest. In comparison to previous high-throughput screening methods, IRAS substantially enhances the specificity of the screening assay. This strategy significantly eliminates false positives without sacrificing sensitive identification of true regulators of splicing. © 2016 Elsevier Inc. All rights reserved.
Niu, Zhi-Tao; Liu, Wei; Xue, Qing-Yun; Ding, Xiao-Yu
2014-01-01
The orchid family Orchidaceae is one of the largest angiosperm families, including many species of important economic value. While chloroplast genomes are very informative for systematics and species identification, there is very limited information available on chloroplast genomes in the Orchidaceae. Here, we report the complete chloroplast genomes of the medicinal plant Dendrobium officinale and the ornamental orchid Cypripedium macranthos, demonstrating their gene content and order and potential RNA editing sites. The chloroplast genomes of the above two species and five known photosynthetic orchids showed similarities in structure as well as gene order and content, but differences in the organization of the inverted repeat/small single-copy junction and ndh genes. The organization of the inverted repeat/small single-copy junctions in the chloroplast genomes of these orchids was classified into four types; we propose that inverted repeats flanking the small single-copy region underwent expansion or contraction among Orchidaceae. The AT-rich regions of the ycf1 gene in orchids could be linked to the recombination of inverted repeat/small single-copy junctions. Relative species in orchids displayed similar patterns of variation in ndh gene contents. Furthermore, fifteen highly divergent protein-coding genes were identified, which are useful for phylogenetic analyses in orchids. To test the efficiency of these genes serving as markers in phylogenetic analyses, coding regions of four genes (accD, ccsA, matK, and ycf1) were used as a case study to construct phylogenetic trees in the subfamily Epidendroideae. High support was obtained for placement of previously unlocated subtribes Collabiinae and Dendrobiinae in the subfamily Epidendroideae. Our findings expand understanding of the diversity of orchid chloroplast genomes and provide a reference for study of the molecular systematics of this family. PMID:24911363
Luo, Jing; Hou, Bei-Wei; Niu, Zhi-Tao; Liu, Wei; Xue, Qing-Yun; Ding, Xiao-Yu
2014-01-01
The orchid family Orchidaceae is one of the largest angiosperm families, including many species of important economic value. While chloroplast genomes are very informative for systematics and species identification, there is very limited information available on chloroplast genomes in the Orchidaceae. Here, we report the complete chloroplast genomes of the medicinal plant Dendrobium officinale and the ornamental orchid Cypripedium macranthos, demonstrating their gene content and order and potential RNA editing sites. The chloroplast genomes of the above two species and five known photosynthetic orchids showed similarities in structure as well as gene order and content, but differences in the organization of the inverted repeat/small single-copy junction and ndh genes. The organization of the inverted repeat/small single-copy junctions in the chloroplast genomes of these orchids was classified into four types; we propose that inverted repeats flanking the small single-copy region underwent expansion or contraction among Orchidaceae. The AT-rich regions of the ycf1 gene in orchids could be linked to the recombination of inverted repeat/small single-copy junctions. Relative species in orchids displayed similar patterns of variation in ndh gene contents. Furthermore, fifteen highly divergent protein-coding genes were identified, which are useful for phylogenetic analyses in orchids. To test the efficiency of these genes serving as markers in phylogenetic analyses, coding regions of four genes (accD, ccsA, matK, and ycf1) were used as a case study to construct phylogenetic trees in the subfamily Epidendroideae. High support was obtained for placement of previously unlocated subtribes Collabiinae and Dendrobiinae in the subfamily Epidendroideae. Our findings expand understanding of the diversity of orchid chloroplast genomes and provide a reference for study of the molecular systematics of this family.
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
Regulation of alternative mRNA splicing: old players and new perspectives.
Dvinge, Heidi
2018-06-01
Nearly all human multi-exon genes are subject to alternative splicing in one or more cell types. The splicing machinery, therefore, has to select between multiple splice sites in a context-dependent manner, relying on sequence features in cis and trans-acting splicing regulators that either promote or repress splice site recognition and spliceosome assembly. However, the functional coupling between multiple gene regulatory layers signifies that splicing can also be modulated by transcriptional or epigenetic characteristics. Other, less obvious, aspects of alternative splicing have come to light in recent years, often involving core components of the spliceosome previously thought to perform a basal rather than a regulatory role in splicing. Together this paints a highly dynamic picture of splicing regulation, where the final splice site choice is governed by the entire transcriptional environment of a gene and its cellular context. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Splicing predictions reliably classify different types of alternative splicing
Busch, Anke; Hertel, Klemens J.
2015-01-01
Alternative splicing is a key player in the creation of complex mammalian transcriptomes and its misregulation is associated with many human diseases. Multiple mRNA isoforms are generated from most human genes, a process mediated by the interplay of various RNA signature elements and trans-acting factors that guide spliceosomal assembly and intron removal. Here, we introduce a splicing predictor that evaluates hundreds of RNA features simultaneously to successfully differentiate between exons that are constitutively spliced, exons that undergo alternative 5′ or 3′ splice-site selection, and alternative cassette-type exons. Surprisingly, the splicing predictor did not feature strong discriminatory contributions from binding sites for known splicing regulators. Rather, the ability of an exon to be involved in one or multiple types of alternative splicing is dictated by its immediate sequence context, mainly driven by the identity of the exon's splice sites, the conservation around them, and its exon/intron architecture. Thus, the splicing behavior of human exons can be reliably predicted based on basic RNA sequence elements. PMID:25805853
Methods for Characterization of Alternative RNA Splicing.
Harvey, Samuel E; Cheng, Chonghui
2016-01-01
Quantification of alternative splicing to detect the abundance of differentially spliced isoforms of a gene in total RNA can be accomplished via RT-PCR using both quantitative real-time and semi-quantitative PCR methods. These methods require careful PCR primer design to ensure specific detection of particular splice isoforms. We also describe analysis of alternative splicing using a splicing "minigene" in mammalian cell tissue culture to facilitate investigation of the regulation of alternative splicing of a particular exon of interest.
Liang, Yang; Tebaldi, Toma; Rejeski, Kai; Joshi, Poorval; Stefani, Giovanni; Taylor, Ashley; Song, Yuanbin; Vasic, Radovan; Maziarz, Jamie; Balasubramanian, Kunthavai; Ardasheva, Anastasia; Ding, Alicia; Quattrone, Alessandro; Halene, Stephanie
2018-06-01
Recurrent mutations in the splicing factor SRSF2 are associated with poor clinical outcomes in myelodysplastic syndromes (MDS). Their high frequency suggests these mutations drive oncogenesis, yet the molecular explanation for this process is unclear. SRSF2 mutations could directly affect pre-mRNA splicing of a vital gene product; alternatively, a whole network of gene products could be affected. Here we determine how SRSF2 mutations globally affect RNA binding and splicing in vivo using HITS-CLIP. Remarkably, the majority of differential binding events do not translate into alternative splicing of exons with SRSF2 P95H binding sites. Alternative splice alterations appear to be dominated by indirect effects. Importantly, SRSF2 P95H targets are enriched in RNA processing and splicing genes, including several members of the hnRNP and SR families of proteins, suggesting a "splicing-cascade" phenotype wherein mutation of a single splicing factor leads to widespread modifications in multiple RNA processing and splicing proteins. We show that splice alteration of HNRNPA2B1, a splicing factor differentially bound and spliced by SRSF2 P95H , impairs hematopoietic differentiation in vivo. Our data suggests a model whereby the recurrent mutations in splicing factors set off a cascade of gene regulatory events that together affect hematopoiesis and drive cancer.
Mutation testing in Treacher Collins Syndrome.
Ellis, P E; Dawson, M; Dixon, M J
2002-12-01
To report on a study where 97 subjects were screened for mutations in the Treacher Collins syndrome (TCS) gene TCOF1. Ninety-seven subjects with a clinical diagnosis of TCS were screened for potential mutations in TCOF1, by means of single strand conformation polymorphism (SSCP) analysis. In those subjects where potential mutations were detected, sequence analysis was performed to determine the site and type of mutation present. Thirty-six TCS-specific mutations are reported including 27 deletions, six point mutations, two splice junction mutations, and one insertion/deletion. This brings the total number of mutations reported to date to 105. The importance of detection of these mutations is mainly in postnatal diagnosis and genetic counselling. Knowledge of the family specific mutation may also be used in prenatal diagnosis to confirm whether the foetus is affected or not, and give the parents the choice of whether to continue with the pregnancy.
Discovery of selective ATP-competitive eIF4A3 inhibitors.
Ito, Masahiro; Iwatani, Misa; Kamada, Yusuke; Sogabe, Satoshi; Nakao, Shoichi; Tanaka, Toshio; Kawamoto, Tomohiro; Aparicio, Samuel; Nakanishi, Atsushi; Imaeda, Yasuhiro
2017-04-01
Eukaryotic initiation factor 4A3 (eIF4A3), an ATP-dependent RNA helicase, is a core component of exon junction complex (EJC). EJC has a variety of roles in RNA metabolism such as translation, surveillance, and localization of spliced RNA. It is worthwhile to identify selective eIF4A3 inhibitors with a view to investigating the functions of eIF4A3 and EJC further to clarify the roles of the ATPase and helicase activities in cells. Our chemical optimization of hit compound 2 culminated in the discovery of ATP-competitive eIF4A3 inhibitor 18 with submicromolar ATPase inhibitory activity and excellent selectivity over other helicases. Hence, compound 18 could be a valuable chemical probe to elucidate the detailed functions of eIF4A3 and EJC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Medical Sequencing at the extremes of Human Body Mass
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahituv, Nadav; Kavaslar, Nihan; Schackwitz, Wendy
2006-09-01
Body weight is a quantitative trait with significantheritability in humans. To identify potential genetic contributors tothis phenotype, we resequenced the coding exons and splice junctions of58 genes in 379 obese and 378 lean individuals. Our 96Mb survey included21 genes associated with monogenic forms of obesity in humans or mice, aswell as 37 genes that function in body weight-related pathways. We foundthat the monogenic obesity-associated gene group was enriched for rarenonsynonymous variants unique to the obese (n=46) versus lean (n=26)populations. Computational analysis further predicted a significantlygreater fraction of deleterious variants within the obese cohort.Consistent with the complex inheritance of body weight,more » we did notobserve obvious familial segregation in the majority of the 28 availablekindreds. Taken together, these data suggest that multiple rare alleleswith variable penetrance contribute to obesity in the population andprovide a deep medical sequencing based approach to detectthem.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Funkenstein, B.; Leary, S.L.; Stein, J.C.
1988-03-01
The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of themore » Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.« less
Structural Chemistry of Human RNA Methyltransferases.
Schapira, Matthieu
2016-03-18
RNA methyltransferases (RNMTs) play important roles in RNA stability, splicing, and epigenetic mechanisms. They constitute a promising target class that is underexplored by the medicinal chemistry community. Information of relevance to drug design can be extracted from the rich structural coverage of human RNMTs. In this work, the structural chemistry of this protein family is analyzed in depth. Unlike most methyltransferases, RNMTs generally feature a substrate-binding site that is largely open on the cofactor-binding pocket, favoring the design of bisubstrate inhibitors. Substrate purine or pyrimidines are often sandwiched between hydrophobic walls that can accommodate planar ring systems. When the substrate base is laying on a shallow surface, a 5' flanking base is sometimes anchored in a druggable cavity. The cofactor-binding site is structurally more diverse than in protein methyltransferases and more druggable in SPOUT than in Rossman-fold enzymes. Finally, conformational plasticity observed both at the substrate and cofactor binding sites may be a challenge for structure-based drug design. The landscape drawn here may inform ongoing efforts toward the discovery of the first human RNMT inhibitors.
Wang, Yue; Xu, Tingting; He, Weiyi; Shen, Xiujing; Zhao, Qian; Bai, Jianlin; You, Minsheng
2018-01-01
Long non-coding RNAs (lncRNAs) are of particular interest because of their contributions to many biological processes. Here, we present the genome-wide identification and characterization of putative lncRNAs in a global insect pest, Plutella xylostella. A total of 8096 lncRNAs were identified and classified into three groups. The average length of exons in lncRNAs was longer than that in coding genes and the GC content was lower than that in mRNAs. Most lncRNAs were flanked by canonical splice sites, similar to mRNAs. Expression profiling identified 114 differentially expressed lncRNAs during the DBM development and found that majority were temporally specific. While the biological functions of lncRNAs remain uncharacterized, many are microRNA precursors or competing endogenous RNAs involved in micro-RNA regulatory pathways. This work provides a valuable resource for further studies on molecular bases for development of DBM and lay the foundation for discovery of lncRNA functions in P. xylostella. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhu, Junyong; Chen, Zuhua; Yong, Lei
2018-02-01
The majority of genes are alternatively spliced and growing evidence suggests that alternative splicing is modified in cancer and is associated with cancer progression. Systematic analysis of alternative splicing signature in ovarian cancer is lacking and greatly needed. We profiled genome-wide alternative splicing events in 408 ovarian serous cystadenocarcinoma (OV) patients in TCGA. Seven types of alternative splicing events were curated and prognostic analyses were performed with predictive models and splicing network built for OV patients. Among 48,049 mRNA splicing events in 10,582 genes, we detected 2,611 alternative splicing events in 2,036 genes which were significant associated with overall survival of OV patients. Exon skip events were the most powerful prognostic factors among the seven types. The area under the curve of the receiver-operator characteristic curve for prognostic predictor, which was built with top significant alternative splicing events, was 0.937 at 2,000 days of overall survival, indicating powerful efficiency in distinguishing patient outcome. Interestingly, splicing correlation network suggested obvious trends in the role of splicing factors in OV. In summary, we built powerful prognostic predictors for OV patients and uncovered interesting splicing networks which could be underlying mechanisms. Copyright © 2017 Elsevier Inc. All rights reserved.
Schizophyllum commune has an extensive and functional alternative splicing repertoire
Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.; Wösten, Han A. B.; Abeel, Thomas; Reinders, Marcel J. T.
2016-01-01
Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regions (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically. PMID:27659065
Widespread Use of Non-productive Alternative Splice Sites in Saccharomyces cerevisiae
Kawashima, Tadashi; Douglass, Stephen; Gabunilas, Jason; Pellegrini, Matteo; Chanfreau, Guillaume F.
2014-01-01
Saccharomyces cerevisiae has been used as a model system to investigate the mechanisms of pre-mRNA splicing but only a few examples of alternative splice site usage have been described in this organism. Using RNA-Seq analysis of nonsense-mediated mRNA decay (NMD) mutant strains, we show that many S. cerevisiae intron-containing genes exhibit usage of alternative splice sites, but many transcripts generated by splicing at these sites are non-functional because they introduce premature termination codons, leading to degradation by NMD. Analysis of splicing mutants combined with NMD inactivation revealed the role of specific splicing factors in governing the use of these alternative splice sites and identified novel functions for Prp17p in enhancing the use of branchpoint-proximal upstream 3′ splice sites and for Prp18p in suppressing the usage of a non-canonical AUG 3′-splice site in GCR1. The use of non-productive alternative splice sites can be increased in stress conditions in a promoter-dependent manner, contributing to the down-regulation of genes during stress. These results show that alternative splicing is frequent in S. cerevisiae but masked by RNA degradation and that the use of alternative splice sites in this organism is mostly aimed at controlling transcript levels rather than increasing proteome diversity. PMID:24722551
Schizophyllum commune has an extensive and functional alternative splicing repertoire
Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.; ...
2016-09-23
Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regionsmore » (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Finally, taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically.« less
SplicePlot: a utility for visualizing splicing quantitative trait loci.
Wu, Eric; Nance, Tracy; Montgomery, Stephen B
2014-04-01
RNA sequencing has provided unprecedented resolution of alternative splicing and splicing quantitative trait loci (sQTL). However, there are few tools available for visualizing the genotype-dependent effects of splicing at a population level. SplicePlot is a simple command line utility that produces intuitive visualization of sQTLs and their effects. SplicePlot takes mapped RNA sequencing reads in BAM format and genotype data in VCF format as input and outputs publication-quality Sashimi plots, hive plots and structure plots, enabling better investigation and understanding of the role of genetics on alternative splicing and transcript structure. Source code and detailed documentation are available at http://montgomerylab.stanford.edu/spliceplot/index.html under Resources and at Github. SplicePlot is implemented in Python and is supported on Linux and Mac OS. A VirtualBox virtual machine running Ubuntu with SplicePlot already installed is also available.
Evolutionary Insights into RNA trans-Splicing in Vertebrates
Lei, Quan; Li, Cong; Zuo, Zhixiang; Huang, Chunhua; Cheng, Hanhua; Zhou, Rongjia
2016-01-01
Pre-RNA splicing is an essential step in generating mature mRNA. RNA trans-splicing combines two separate pre-mRNA molecules to form a chimeric non-co-linear RNA, which may exert a function distinct from its original molecules. Trans-spliced RNAs may encode novel proteins or serve as noncoding or regulatory RNAs. These novel RNAs not only increase the complexity of the proteome but also provide new regulatory mechanisms for gene expression. An increasing amount of evidence indicates that trans-splicing occurs frequently in both physiological and pathological processes. In addition, mRNA reprogramming based on trans-splicing has been successfully applied in RNA-based therapies for human genetic diseases. Nevertheless, clarifying the extent and evolution of trans-splicing in vertebrates and developing detection methods for trans-splicing remain challenging. In this review, we summarize previous research, highlight recent advances in trans-splicing, and discuss possible splicing mechanisms and functions from an evolutionary viewpoint. PMID:26966239
Function of alternative splicing
Kelemen, Olga; Convertini, Paolo; Zhang, Zhaiyi; Wen, Yuan; Shen, Manli; Falaleeva, Marina; Stamm, Stefan
2017-01-01
Almost all polymerase II transcripts undergo alternative pre-mRNA splicing. Here, we review the functions of alternative splicing events that have been experimentally determined. The overall function of alternative splicing is to increase the diversity of mRNAs expressed from the genome. Alternative splicing changes proteins encoded by mRNAs, which has profound functional effects. Experimental analysis of these protein isoforms showed that alternative splicing regulates binding between proteins, between proteins and nucleic acids as well as between proteins and membranes. Alternative splicing regulates the localization of proteins, their enzymatic properties and their interaction with ligands. In most cases, changes caused by individual splicing isoforms are small. However, cells typically coordinate numerous changes in ‘splicing programs’, which can have strong effects on cell proliferation, cell survival and properties of the nervous system. Due to its widespread usage and molecular versatility, alternative splicing emerges as a central element in gene regulation that interferes with almost every biological function analyzed. PMID:22909801
Genetic therapies for RNA mis-splicing diseases.
Hammond, Suzan M; Wood, Matthew J A
2011-05-01
RNA mis-splicing diseases account for up to 15% of all inherited diseases, ranging from neurological to myogenic and metabolic disorders. With greatly increased genomic sequencing being performed for individual patients, the number of known mutations affecting splicing has risen to 50-60% of all disease-causing mutations. During the past 10years, genetic therapy directed toward correction of RNA mis-splicing in disease has progressed from theoretical work in cultured cells to promising clinical trials. In this review, we discuss the use of antisense oligonucleotides to modify splicing as well as the principles and latest work in bifunctional RNA, trans-splicing and modification of U1 and U7 snRNA to target splice sites. The success of clinical trials for modifying splicing to treat Duchenne muscular dystrophy opens the door for the use of splicing modification for most of the mis-splicing diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.
Mutual interdependence of splicing and transcription elongation.
Brzyżek, Grzegorz; Świeżewski, Szymon
2015-01-01
Transcription and splicing are intrinsically linked, as splicing needs a pre-mRNA substrate to commence. The more nuanced view is that the rate of transcription contributes to splicing regulation. On the other hand there is accumulating evidence that splicing has an active role in controlling transcription elongation by DNA-dependent RNA polymerase II (RNAP II). We briefly review those mechanisms and propose a unifying model where splicing controls transcription elongation to provide an optimal timing for successive rounds of splicing.
Movassat, Maliheh; Crabb, Tara L; Busch, Anke; Yao, Chengguo; Reynolds, Derrick J; Shi, Yongsheng; Hertel, Klemens J
2016-07-02
Alternative polyadenylation has been implicated as an important regulator of gene expression. In some cases, alternative polyadenylation is known to couple with alternative splicing to influence last intron removal. However, it is unknown whether alternative polyadenylation events influence alternative splicing decisions at upstream exons. Knockdown of the polyadenylation factors CFIm25 or CstF64 in HeLa cells was used as an approach in identifying alternative polyadenylation and alternative splicing events on a genome-wide scale. Although hundreds of alternative splicing events were found to be differentially spliced in the knockdown of CstF64, genes associated with alternative polyadenylation did not exhibit an increased incidence of alternative splicing. These results demonstrate that the coupling between alternative polyadenylation and alternative splicing is usually limited to defining the last exon. The striking influence of CstF64 knockdown on alternative splicing can be explained through its effects on UTR selection of known splicing regulators such as hnRNP A2/B1, thereby indirectly influencing splice site selection. We conclude that changes in the expression of the polyadenylation factor CstF64 influences alternative splicing through indirect effects.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.
Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regionsmore » (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Finally, taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically.« less
Ni, Julie Z.; Grate, Leslie; Donohue, John Paul; Preston, Christine; Nobida, Naomi; O’Brien, Georgeann; Shiue, Lily; Clark, Tyson A.; Blume, John E.; Ares, Manuel
2007-01-01
Many alternative splicing events create RNAs with premature stop codons, suggesting that alternative splicing coupled with nonsense-mediated decay (AS-NMD) may regulate gene expression post-transcriptionally. We tested this idea in mice by blocking NMD and measuring changes in isoform representation using splicing-sensitive microarrays. We found a striking class of highly conserved stop codon-containing exons whose inclusion renders the transcript sensitive to NMD. A genomic search for additional examples identified >50 such exons in genes with a variety of functions. These exons are unusually frequent in genes that encode splicing activators and are unexpectedly enriched in the so-called “ultraconserved” elements in the mammalian lineage. Further analysis show that NMD of mRNAs for splicing activators such as SR proteins is triggered by splicing activation events, whereas NMD of the mRNAs for negatively acting hnRNP proteins is triggered by splicing repression, a polarity consistent with widespread homeostatic control of splicing regulator gene expression. We suggest that the extreme genomic conservation surrounding these regulatory splicing events within splicing factor genes demonstrates the evolutionary importance of maintaining tightly tuned homeostasis of RNA-binding protein levels in the vertebrate cell. PMID:17369403
Understanding splicing regulation through RNA splicing maps
Witten, Joshua T.; Ule, Jernej
2011-01-01
Alternative splicing is a highly regulated process that greatly increases the proteome diversity and plays an important role in cellular differentiation and disease. Interactions between RNA-binding proteins (RBPs) and pre-mRNA are the principle regulator of splicing decisions. Findings from recent genome-wide studies of protein–RNA interactions have been combined with assays of the global effects of RBPs on splicing to create RNA splicing maps. These maps integrate information from all pre-mRNAs regulated by single RBPs to identify the global positioning principles guiding splicing regulation. Recent studies using this approach have identified a set of positional principles that are shared between diverse RBPs. Here, we discuss how insights from RNA splicing maps of different RBPs inform the mechanistic models of splicing regulation. PMID:21232811
Pre-mRNA mis-splicing of sarcomeric genes in heart failure.
Zhu, Chaoqun; Chen, Zhilong; Guo, Wei
2017-08-01
Pre-mRNA splicing is an important biological process that allows production of multiple proteins from a single gene in the genome, and mainly contributes to protein diversity in eukaryotic organisms. Alternative splicing is commonly governed by RNA binding proteins to meet the ever-changing demands of the cell. However, the mis-splicing may lead to human diseases. In the heart of human, mis-regulation of alternative splicing has been associated with heart failure. In this short review, we focus on alternative splicing of sarcomeric genes and review mis-splicing related heart failure with relatively well studied Sarcomeric genes and splicing mechanisms with identified regulatory factors. The perspective of alternative splicing based therapeutic strategies in heart failure has also been discussed. Copyright © 2016 Elsevier B.V. All rights reserved.
Alternative splicing in cancers: From aberrant regulation to new therapeutics.
Song, Xiaowei; Zeng, Zhenyu; Wei, Huanhuan; Wang, Zefeng
2018-03-01
Alternative splicing is one of the most common mechanisms for gene regulation in humans, and plays a vital role to increase the complexity of functional proteins. In this article, we seek to provide a general review on the relationships between alternative splicing and tumorigenesis. We briefly introduce the basic rules for regulation of alternative splicing, and discuss recent advances on dynamic regulation of alternative splicing in cancers by highlighting the roles of a variety of RNA splicing factors in tumorigenesis. We further discuss several important questions regarding the splicing of long noncoding RNAs and back-splicing of circular RNAs in cancers. Finally, we discuss the current technologies that can be used to manipulate alternative splicing and serve as potential cancer treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Coordinated tissue-specific regulation of adjacent alternative 3′ splice sites in C. elegans
Ragle, James Matthew; Katzman, Sol; Akers, Taylor F.; Barberan-Soler, Sergio; Zahler, Alan M.
2015-01-01
Adjacent alternative 3′ splice sites, those separated by ≤18 nucleotides, provide a unique problem in the study of alternative splicing regulation; there is overlap of the cis-elements that define the adjacent sites. Identification of the intron's 3′ end depends upon sequence elements that define the branchpoint, polypyrimidine tract, and terminal AG dinucleotide. Starting with RNA-seq data from germline-enriched and somatic cell-enriched Caenorhabditis elegans samples, we identify hundreds of introns with adjacent alternative 3′ splice sites. We identify 203 events that undergo tissue-specific alternative splicing. For these, the regulation is monodirectional, with somatic cells preferring to splice at the distal 3′ splice site (furthest from the 5′ end of the intron) and germline cells showing a distinct shift toward usage of the adjacent proximal 3′ splice site (closer to the 5′ end of the intron). Splicing patterns in somatic cells follow C. elegans consensus rules of 3′ splice site definition; a short stretch of pyrimidines preceding an AG dinucleotide. Splicing in germline cells occurs at proximal 3′ splice sites that lack a preceding polypyrimidine tract, and in three instances the germline-specific site lacks the AG dinucleotide. We provide evidence that use of germline-specific proximal 3′ splice sites is conserved across Caenorhabditis species. We propose that there are differences between germline and somatic cells in the way that the basal splicing machinery functions to determine the intron terminus. PMID:25922281
Can the HIV-1 splicing machinery be targeted for drug discovery?
Dlamini, Zodwa; Hull, Rodney
2017-01-01
HIV-1 is able to express multiple protein types and isoforms from a single 9 kb mRNA transcript. These proteins are also expressed at particular stages of viral development, and this is achieved through the control of alternative splicing and the export of these transcripts from the nucleus. The nuclear export is controlled by the HIV protein Rev being required to transport incompletely spliced and partially spliced mRNA from the nucleus where they are normally retained. This implies a close relationship between the control of alternate splicing and the nuclear export of mRNA in the control of HIV-1 viral proliferation. This review discusses both the processes. The specificity and regulation of splicing in HIV-1 is controlled by the use of specific splice sites as well as exonic splicing enhancer and exonic splicing silencer sequences. The use of these silencer and enhancer sequences is dependent on the serine arginine family of proteins as well as the heterogeneous nuclear ribonucleoprotein family of proteins that bind to these sequences and increase or decrease splicing. Since alternative splicing is such a critical factor in viral development, it presents itself as a promising drug target. This review aims to discuss the inhibition of splicing, which would stall viral development, as an anti-HIV therapeutic strategy. In this review, the most recent knowledge of splicing in human immunodeficiency viral development and the latest therapeutic strategies targeting human immunodeficiency viral splicing are discussed. PMID:28331370
Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang; Li, Jinghong
2017-08-01
RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5'-ASO could block RNA splicing by inhibiting the first step, while 3'-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs.
Competition between pre-mRNAs for the splicing machinery drives global regulation of splicing
Munding, Elizabeth M.; Shiue, Lily; Katzman, Sol; Donohue, John Paul; Ares, Manuel
2013-01-01
Summary During meiosis in yeast, global splicing efficiency increases and then decreases. Here we provide evidence that splicing improves due to reduced competition for the splicing machinery. The timing of this regulation corresponds to repression and reactivation of ribosomal protein genes (RPGs) during meiosis. In vegetative cells RPG repression by rapamycin treatment also increases splicing efficiency. Down-regulation of the RPG-dedicated transcription factor gene IFH1 genetically suppresses two spliceosome mutations prp11-1 and prp4-1, and globally restores splicing efficiency in prp4-1 cells. We conclude that the splicing apparatus is limiting and pre-mRNAs compete. Splicing efficiency of a pre-mRNA therefore depends not just on its own concentration and affinity for limiting splicing factor(s) but also on those of competing pre-mRNAs. Competition between RNAs for limiting RNA processing factors appears to be a general condition in eukaryotic cells important for function of a variety of post-transcriptional control mechanisms including miRNA repression, polyadenylation and splicing. PMID:23891561
SpliceDisease database: linking RNA splicing and disease.
Wang, Juan; Zhang, Jie; Li, Kaibo; Zhao, Wei; Cui, Qinghua
2012-01-01
RNA splicing is an important aspect of gene regulation in many organisms. Splicing of RNA is regulated by complicated mechanisms involving numerous RNA-binding proteins and the intricate network of interactions among them. Mutations in cis-acting splicing elements or its regulatory proteins have been shown to be involved in human diseases. Defects in pre-mRNA splicing process have emerged as a common disease-causing mechanism. Therefore, a database integrating RNA splicing and disease associations would be helpful for understanding not only the RNA splicing but also its contribution to disease. In SpliceDisease database, we manually curated 2337 splicing mutation disease entries involving 303 genes and 370 diseases, which have been supported experimentally in 898 publications. The SpliceDisease database provides information including the change of the nucleotide in the sequence, the location of the mutation on the gene, the reference Pubmed ID and detailed description for the relationship among gene mutations, splicing defects and diseases. We standardized the names of the diseases and genes and provided links for these genes to NCBI and UCSC genome browser for further annotation and genomic sequences. For the location of the mutation, we give direct links of the entry to the respective position/region in the genome browser. The users can freely browse, search and download the data in SpliceDisease at http://cmbi.bjmu.edu.cn/sdisease.
Katz, R A; Kotler, M; Skalka, A M
1988-01-01
The full-length retroviral RNA transcript serves as (i) mRNA for the gag and pol gene products, (ii) genomic RNA that is assembled into progeny virions, and (iii) a pre-mRNA for spliced subgenomic mRNAs. Therefore, a balance of spliced and unspliced RNA is required to generate the appropriate levels of protein and RNA products for virion production. We have introduced an insertion mutation near the avian sarcoma virus env splice acceptor site that results in a significant increase in splicing to form functional env mRNA. The mutant virus is replication defective, but phenotypic revertant viruses that have acquired second-site mutations near the splice acceptor site can be isolated readily. Detailed analysis of one of these viruses revealed that a single nucleotide change at -20 from the splice acceptor site, within the original mutagenic insert, was sufficient to restore viral growth and significantly decrease splicing efficiency compared with the original mutant and wild-type viruses. Thus, minor sequence alterations near the env splice acceptor site can produce major changes in the balance of spliced and unspliced RNAs. Our results suggest a mechanism of control in which splicing is modulated by cis-acting sequences at the env splice acceptor site. Furthermore, this retroviral system provides a powerful genetic method for selection and analysis of mutations that affect splicing control. Images PMID:2839694
Jakšić, Ana Marija; Schlötterer, Christian
2016-09-01
Alternative splicing is the highly regulated process of variation in the removal of introns from premessenger-RNA transcripts. The consequences of alternative splicing on the phenotype are well documented, but the impact of the environment on alternative splicing is not yet clear. We studied variation in alternative splicing among four different temperatures, 13, 18, 23, and 29°, in two Drosophila melanogaster genotypes. We show plasticity of alternative splicing with up to 10% of the expressed genes being differentially spliced between the most extreme temperatures for a given genotype. Comparing the two genotypes at different temperatures, we found <1% of the genes being differentially spliced at 18°. At extreme temperatures, however, we detected substantial differences in alternative splicing-with almost 10% of the genes having differential splicing between the genotypes: a magnitude similar to between species differences. Genes with differential alternative splicing between genotypes frequently exhibit dominant inheritance. Remarkably, the pattern of surplus of differences in alternative splicing at extreme temperatures resembled the pattern seen for gene expression intensity. Since different sets of genes were involved for the two phenotypes, we propose that purifying selection results in the reduction of differences at benign temperatures. Relaxed purifying selection at temperature extremes, on the other hand, may cause the divergence in gene expression and alternative splicing between the two strains in rarely encountered environments. Copyright © 2016 by the Genetics Society of America.
Alternative splicing and trans-splicing events revealed by analysis of the Bombyx mori transcriptome
Shao, Wei; Zhao, Qiong-Yi; Wang, Xiu-Ye; Xu, Xin-Yan; Tang, Qing; Li, Muwang; Li, Xuan; Xu, Yong-Zhen
2012-01-01
Alternative splicing and trans-splicing events have not been systematically studied in the silkworm Bombyx mori. Here, the silkworm transcriptome was analyzed by RNA-seq. We identified 320 novel genes, modified 1140 gene models, and found thousands of alternative splicing and 58 trans-splicing events. Studies of three SR proteins show that both their alternative splicing patterns and mRNA products are conserved from insect to human, and one isoform of Srsf6 with a retained intron is expressed sex-specifically in silkworm gonads. Trans-splicing of mod(mdg4) in silkworm was experimentally confirmed. We identified integrations from a common 5′-gene with 46 newly identified alternative 3′-exons that are located on both DNA strands over a 500-kb region. Other trans-splicing events in B. mori were predicted by bioinformatic analysis, in which 12 events were confirmed by RT-PCR, six events were further validated by chimeric SNPs, and two events were confirmed by allele-specific RT-PCR in F1 hybrids from distinct silkworm lines of JS and L10, indicating that trans-splicing is more widespread in insects than previously thought. Analysis of the B. mori transcriptome by RNA-seq provides valuable information of regulatory alternative splicing events. The conservation of splicing events across species and newly identified trans-splicing events suggest that B. mori is a good model for future studies. PMID:22627775
Hereditary cancer genes are highly susceptible to splicing mutations
Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.
2018-01-01
Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604
Optimal fusion offset in splicing photonic crystal fibers
NASA Astrophysics Data System (ADS)
Jin, Wa; Bi, Weihong; Fu, Guangwei
2013-08-01
Heat transfer is very complicate in fusion splicing process of photonic crystal fibers (PCFs) due to different structures and sizes of air hole, which requires different fusion splicing power and offsets of heat source. Based on the heat transfer characteristics, this paper focus on the optimal splicing offset splicing the single mode fiber and PCFs with a CO2 laser irradiation. The theory and experiments both show that the research results can effectively calculate the optimal fusion splicing offset and guide the practical splicing between PCFs and SMFs.
Heart failure-associated changes in RNA splicing of sarcomere genes.
Kong, Sek Won; Hu, Yong Wu; Ho, Joshua W K; Ikeda, Sadakatsu; Polster, Sean; John, Ranjit; Hall, Jennifer L; Bisping, Egbert; Pieske, Burkert; dos Remedios, Cristobal G; Pu, William T
2010-04-01
Alternative mRNA splicing is an important mechanism for regulation of gene expression. Altered mRNA splicing occurs in association with several types of cancer, and a small number of disease-associated changes in splicing have been reported in heart disease. However, genome-wide approaches have not been used to study splicing changes in heart disease. We hypothesized that mRNA splicing is different in diseased hearts compared with control hearts. We used the Affymetrix Exon array to globally evaluate mRNA splicing in left ventricular myocardial RNA from controls (n=15) and patients with ischemic cardiomyopathy (n=15). We observed a broad and significant decrease in mRNA splicing efficiency in heart failure, which affected some introns to a greater extent than others. The profile of mRNA splicing separately clustered ischemic cardiomyopathy and control samples, suggesting distinct changes in mRNA splicing between groups. Reverse transcription-polymerase chain reaction validated 9 previously unreported alternative splicing events. Furthermore, we demonstrated that splicing of 4 key sarcomere genes, cardiac troponin T (TNNT2), cardiac troponin I (TNNI3), myosin heavy chain 7 (MYH7), and filamin C, gamma (FLNC), was significantly altered in ischemic cardiomyopathy and in dilated cardiomyopathy and aortic stenosis. In aortic stenosis samples, these differences preceded the onset of heart failure. Remarkably, the ratio of minor to major splice variants of TNNT2, MYH7, and FLNC classified independent test samples as control or disease with >98% accuracy. Our data indicate that mRNA splicing is broadly altered in human heart disease and that patterns of aberrant RNA splicing accurately assign samples to control or disease classes.
A mutational analysis of U12-dependent splice site dinucleotides
DIETRICH, ROSEMARY C.; FULLER, JOHN D.; PADGETT, RICHARD A.
2005-01-01
Introns spliced by the U12-dependent minor spliceosome are divided into two classes based on their splice site dinucleotides. The /AU-AC/ class accounts for about one-third of U12-dependent introns in humans, while the /GU-AG/ class accounts for the other two-thirds. We have investigated the in vivo and in vitro splicing phenotypes of mutations in these dinucleotide sequences. A 5′ A residue can splice to any 3′ residue, although C is preferred. A 5′ G residue can splice to 3′ G or U residues with a preference for G. Little or no splicing was observed to 3′ A or C residues. A 5′ U or C residue is highly deleterious for U12-dependent splicing, although some combinations, notably 5′ U to 3′ U produced detectable spliced products. The dependence of 3′ splice site activity on the identity of the 5′ residue provides evidence for communication between the first and last nucleotides of the intron. Most mutants in the second position of the 5′ splice site and the next to last position of the 3′ splice site were defective for splicing. Double mutants of these residues showed no evidence of communication between these nucleotides. Varying the distance between the branch site and the 3′ splice site dinucleotide in the /GU-AG/ class showed that a somewhat larger range of distances was functional than for the /AU-AC/ class. The optimum branch site to 3′ splice site distance of 11–12 nucleotides appears to be the same for both classes. PMID:16043500
Integrative Analysis of Many RNA-Seq Datasets to Study Alternative Splicing
Li, Wenyuan; Dai, Chao; Kang, Shuli; Zhou, Xianghong Jasmine
2014-01-01
Alternative splicing is an important gene regulatory mechanism that dramatically increases the complexity of the proteome. However, how alternative splicing is regulated and how transcription and splicing are coordinated are still poorly understood, and functions of transcript isoforms have been studied only in a few limited cases. Nowadays, RNA-seq technology provides an exceptional opportunity to study alternative splicing on genome-wide scales and in an unbiased manner. With the rapid accumulation of data in public repositories, new challenges arise from the urgent need to effectively integrate many different RNA-seq datasets for study alterative splicing. This paper discusses a set of advanced computational methods that can integrate and analyze many RNA-seq datasets to systematically identify splicing modules, unravel the coupling of transcription and splicing, and predict the functions of splicing isoforms on a genome-wide scale. PMID:24583115
Small Molecule Modulators of Pre-mRNA Splicing in Cancer Therapy.
Salton, Maayan; Misteli, Tom
2016-01-01
Pre-mRNA splicing is a fundamental process in mammalian gene expression and alternative RNA splicing plays a considerable role in generating protein diversity. RNA splicing events are also key to the pathology of numerous diseases, particularly cancers. Some tumors are molecularly addicted to specific RNA splicing isoforms making interference with pre-mRNA processing a viable therapeutic strategy. Several RNA splicing modulators have recently been characterized, some showing promise in preclinical studies. While the targets of most splicing modulators are constitutive RNA processing components, possibly leading to undesirable side effects, selectivity for individual splicing events has been observed. Given the high prevalence of splicing defects in cancer, small molecule modulators of RNA processing represent a potentially promising novel therapeutic strategy in cancer treatment. Here, we review their reported effects, mechanisms, and limitations. Published by Elsevier Ltd.
Interplay between estrogen receptor and AKT in Estradiol-induced alternative splicing
2013-01-01
Background Alternative splicing is critical for generating complex proteomes in response to extracellular signals. Nuclear receptors including estrogen receptor alpha (ERα) and their ligands promote alternative splicing. The endogenous targets of ERα:estradiol (E2)-mediated alternative splicing and the influence of extracellular kinases that phosphorylate ERα on E2-induced splicing are unknown. Methods MCF-7 and its anti-estrogen derivatives were used for the majority of the assays. CD44 mini gene was used to measure the effect of E2 and AKT on alternative splicing. ExonHit array analysis was performed to identify E2 and AKT-regulated endogenous alternatively spliced apoptosis-related genes. Quantitative reverse transcription polymerase chain reaction was performed to verify alternative splicing. ERα binding to alternatively spliced genes was verified by chromatin immunoprecipitation assay. Bromodeoxyuridine incorporation-ELISA and Annexin V labeling assays were done to measure cell proliferation and apoptosis, respectively. Results We identified the targets of E2-induced alternative splicing and deconstructed some of the mechanisms surrounding E2-induced splicing by combining splice array with ERα cistrome and gene expression array. E2-induced alternatively spliced genes fall into at least two subgroups: coupled to E2-regulated transcription and ERα binding to the gene without an effect on rate of transcription. Further, AKT, which phosphorylates both ERα and splicing factors, influenced ERα:E2 dependent splicing in a gene-specific manner. Genes that are alternatively spliced include FAS/CD95, FGFR2, and AXIN-1. E2 increased the expression of FGFR2 C1 isoform but reduced C3 isoform at mRNA level. E2-induced alternative splicing of FAS and FGFR2 in MCF-7 cells correlated with resistance to FAS activation-induced apoptosis and response to keratinocyte growth factor (KGF), respectively. Resistance of MCF-7 breast cancer cells to the anti-estrogen tamoxifen was associated with ERα-dependent overexpression of FGFR2, whereas resistance to fulvestrant was associated with ERα-dependent isoform switching, which correlated with altered response to KGF. Conclusion E2 may partly alter cellular proteome through alternative splicing uncoupled to its effects on transcription initiation and aberration in E2-induced alternative splicing events may influence response to anti-estrogens. PMID:23758675
Widespread alternative and aberrant splicing revealed by lariat sequencing
Stepankiw, Nicholas; Raghavan, Madhura; Fogarty, Elizabeth A.; Grimson, Andrew; Pleiss, Jeffrey A.
2015-01-01
Alternative splicing is an important and ancient feature of eukaryotic gene structure, the existence of which has likely facilitated eukaryotic proteome expansions. Here, we have used intron lariat sequencing to generate a comprehensive profile of splicing events in Schizosaccharomyces pombe, amongst the simplest organisms that possess mammalian-like splice site degeneracy. We reveal an unprecedented level of alternative splicing, including alternative splice site selection for over half of all annotated introns, hundreds of novel exon-skipping events, and thousands of novel introns. Moreover, the frequency of these events is far higher than previous estimates, with alternative splice sites on average activated at ∼3% the rate of canonical sites. Although a subset of alternative sites are conserved in related species, implying functional potential, the majority are not detectably conserved. Interestingly, the rate of aberrant splicing is inversely related to expression level, with lowly expressed genes more prone to erroneous splicing. Although we validate many events with RNAseq, the proportion of alternative splicing discovered with lariat sequencing is far greater, a difference we attribute to preferential decay of aberrantly spliced transcripts. Together, these data suggest the spliceosome possesses far lower fidelity than previously appreciated, highlighting the potential contributions of alternative splicing in generating novel gene structures. PMID:26261211
2014-01-01
Background The circadian clock enables living organisms to anticipate recurring daily and seasonal fluctuations in their growth habitats and synchronize their biology to the environmental cycle. The plant circadian clock consists of multiple transcription-translation feedback loops that are entrained by environmental signals, such as light and temperature. In recent years, alternative splicing emerges as an important molecular mechanism that modulates the clock function in plants. Several clock genes are known to undergo alternative splicing in response to changes in environmental conditions, suggesting that the clock function is intimately associated with environmental responses via the alternative splicing of the clock genes. However, the alternative splicing events of the clock genes have not been studied at the molecular level. Results We systematically examined whether major clock genes undergo alternative splicing under various environmental conditions in Arabidopsis. We also investigated the fates of the RNA splice variants of the clock genes. It was found that the clock genes, including EARLY FLOWERING 3 (ELF3) and ZEITLUPE (ZTL) that have not been studied in terms of alternative splicing, undergo extensive alternative splicing through diverse modes of splicing events, such as intron retention, exon skipping, and selection of alternative 5′ splice site. Their alternative splicing patterns were differentially influenced by changes in photoperiod, temperature extremes, and salt stress. Notably, the RNA splice variants of TIMING OF CAB EXPRESSION 1 (TOC1) and ELF3 were degraded through the nonsense-mediated decay (NMD) pathway, whereas those of other clock genes were insensitive to NMD. Conclusion Taken together, our observations demonstrate that the major clock genes examined undergo extensive alternative splicing under various environmental conditions, suggesting that alternative splicing is a molecular scheme that underlies the linkage between the clock and environmental stress adaptation in plants. It is also envisioned that alternative splicing of the clock genes plays more complex roles than previously expected. PMID:24885185
30 CFR 7.405 - Critical characteristics.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Cable Splice Kits § 7.405 Critical characteristics. (a) A sample from each production run, batch, or lot of manufactured electric cable, signaling cable, or splice made from a splice kit shall be flame... cable or splice and a sample of the cable or splice kit assembly shall be visually inspected or tested...
30 CFR 7.405 - Critical characteristics.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Cable Splice Kits § 7.405 Critical characteristics. (a) A sample from each production run, batch, or lot of manufactured electric cable, signaling cable, or splice made from a splice kit shall be flame... cable or splice and a sample of the cable or splice kit assembly shall be visually inspected or tested...
ERIC Educational Resources Information Center
Kilmer, Donald C.
Designed for the student interested in a vocation in electrical work, this guide, fourth in a set of four, includes three units: Unit X--Splicing Wires, covering thirteen lessons (removing insulation, pigtail splice, Western Union splice, tap splice, extension cord splice, connecting wires to a terminal screw, underwriter's knot, three-wire ground…
NASA Astrophysics Data System (ADS)
Zhang, Chunxi; Zhang, Zuchen; Song, Jingming; Wu, Chunxiao; Song, Ningfang
2015-03-01
A splicing parameter optimization method to increase the tensile strength of splicing joint between photonic crystal fiber (PCF) and conventional fiber is demonstrated. Based on the splicing recipes provided by splicer or fiber manufacturers, the optimal values of some major splicing parameters are obtained in sequence, and a conspicuous improvement in the mechanical strength of splicing joints between PCFs and conventional fibers is validated through experiments.
Regulation of Alternative Splicing in Vivo by Overexpression of Antagonistic Splicing Factors
NASA Astrophysics Data System (ADS)
Caceres, Javier F.; Stamm, Stefan; Helfman, David M.; Krainer, Adrian R.
1994-09-01
The opposing effects of SF2/ASF and heterogeneous nuclear ribonucleoprotein (hnRNP) A1 influence alternative splicing in vitro. SF2/ASF or hnRNP A1 complementary DNAs were transiently overexpressed in HeLa cells, and the effect on alternative splicing of several cotransfected reporter genes was measured. Increased expression of SF2/ASF activated proximal 5' splice sites, promoted inclusion of a neuron-specific exon, and prevented abnormal exon skipping. Increased expression of hnRNP A1 activated distal 5' splice sites. Therefore, variations in the intracellular levels of antagonistic splicing factors influence different modes of alternative splicing in vivo and may be a natural mechanism for tissue-specific or developmental regulation of gene expression.
NASA Astrophysics Data System (ADS)
Song, Ningfang; Wu, Chunxiao; Luo, Wenyong; Zhang, Zuchen; Li, Wei
2016-12-01
High strength fusion splicing hollow core photonic crystal fiber (HC-PCF) and single-mode fiber (SMF) requires sufficient energy, which results in collapse of the air holes inside HC-PCF. Usually the additional splice loss induced by the collapse of air holes is too large. By large offset reheating, the collapse length of HC-PCF is reduced, thus the additional splice loss induced by collapse is effectively suppressed. This method guarantees high-strength fusion splicing between the two types of fiber with a low splice loss. The strength of the splice compares favorably with the strength of HC-PCF itself. This method greatly improves the reliability of splices between HC-PCFs and SMFs.
Mutations of RNA splicing factors in hematological malignancies.
Shukla, Girish C; Singh, Jagjit
2017-11-28
Systematic large-scale cancer genomic studies have produced numerous significant findings. These studies have not only revealed new cancer-promoting genes, but they also have identified cancer-promoting functions of previously known "housekeeping" genes. These studies have identified numerous mutations in genes which play a fundamental role in nuclear precursor mRNA splicing. Somatic mutations and copy number variation in many of the splicing factors which participate in the formation of multiple spliceosomal complexes appear to play a role in many cancers and in particular in myelodysplastic syndromes (MDS). Mutated proteins seem to interfere with the recognition of the authentic splice sites (SS) leading to utilization of suboptimal alternative splicing sites generating aberrantly spliced mRNA isoforms. This short review is focusing on the function of the splice factors involved in the formation of splicing complexes and potential mechanisms which affect usage of the authentic splice site recognition. Copyright © 2017 Elsevier B.V. All rights reserved.
Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert
2011-01-01
The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331
Regulation of alternative splicing in Drosophila by 56 RNA binding proteins
Brooks, Angela N.; Duff, Michael O.; May, Gemma; ...
2015-08-20
Alternative splicing is regulated by RNA binding proteins (RBPs) that recognize pre-mRNA sequence elements and activate or repress adjacent exons. Here, we used RNA interference and RNA-seq to identify splicing events regulated by 56 Drosophila proteins, some previously unknown to regulate splicing. Nearly all proteins affected alternative first exons, suggesting that RBPs play important roles in first exon choice. Half of the splicing events were regulated by multiple proteins, demonstrating extensive combinatorial regulation. We observed that SR and hnRNP proteins tend to act coordinately with each other, not antagonistically. We also identified a cross-regulatory network where splicing regulators affected themore » splicing of pre-mRNAs encoding other splicing regulators. In conclusion, this large-scale study substantially enhances our understanding of recent models of splicing regulation and provides a resource of thousands of exons that are regulated by 56 diverse RBPs.« less
The Human Splicing Factor ASF/SF2 can Specifically Recognize Pre-mRNA 5' Splice Sites
NASA Astrophysics Data System (ADS)
Zuo, Ping; Manley, James L.
1994-04-01
ASF/SF2 is a human protein previously shown to function in in vitro pre-mRNA splicing as an essential factor necessary for all splices and also as an alternative splicing factor, capable of switching selection of 5' splice sites. To begin to study the protein's mechanism of action, we have investigated the RNA binding properties of purified recombinant ASF/SF2. Using UV crosslinking and gel shift assays, we demonstrate that the RNA binding region of ASF/SF2 can interact with RNA in a sequence-specific manner, recognizing the 5' splice site in each of two different pre-mRNAs. Point mutations in the 5' splice site consensus can reduce binding by as much as a factor of 100, with the largest effects observed in competition assays. These findings support a model in which ASF/SF2 aids in the recognition of pre-mRNA 5' splice sites.
RNA splicing during terminal erythropoiesis.
Conboy, John G
2017-05-01
Erythroid progenitors must accurately and efficiently splice thousands of pre-mRNAs as the cells undergo extensive changes in gene expression and cellular remodeling during terminal erythropoiesis. Alternative splicing choices are governed by interactions between RNA binding proteins and cis-regulatory binding motifs in the RNA. This review will focus on recent studies that define the genome-wide scope of splicing in erythroblasts and discuss what is known about its regulation. RNA-seq analysis of highly purified erythroblast populations has revealed an extensive program of alternative splicing of both exons and introns. During normal erythropoiesis, stage-specific splicing transitions alter the structure and abundance of protein isoforms required for optimized red cell production. Mutation or deficiency of splicing regulators underlies hematopoietic disease in myelopdysplasia syndrome patients via disrupting the splicing program. Erythroid progenitors execute an elaborate alternative splicing program that modulates gene expression posttranscriptionally, ultimately regulating the structure and function of the proteome in a differentiation stage-specific manner during terminal erythropoiesis. This program helps drive differentiation and ensure synthesis of the proper protein isoforms required to produce mechanically stable red cells. Mutation or deficiency of key splicing regulatory proteins disrupts the splicing program to cause disease.
Nanoplasmonic probes of RNA folding and assembly during pre-mRNA splicing
NASA Astrophysics Data System (ADS)
Nguyen, Anh H.; Lee, Jong Uk; Sim, Sang Jun
2016-02-01
RNA splicing plays important roles in transcriptome and proteome diversity. Herein, we describe the use of a nanoplasmonic system that unveils RNA folding and assembly during pre-mRNA splicing wherein the quantification of mRNA splice variants is not taken into account. With a couple of SERS-probes and plasmonic probes binding at the boundary sites of exon-2/intron-2 and intron-2/exon-3 of the pre-mature RNA of the β-globin gene, the splicing process brings the probes into the plasmonic bands. For plasmonic probes, a plasmon shift increase of ~29 nm, corresponding to intron removal and exon-2 and exon-3 connection to form the mRNA molecule, is measured by plasmonic coupling. The increased scattering intensity and surface-enhanced Raman scattering (SERS) fingerprinting reveal the clear dynamics of pre-mRNA splicing. Moreover, a time-resolved experiment of individual RNA molecules exhibited a successful splicing and an inhibited splicing event by 33 μM biflavonoid isoginkgetin, a general inhibitor of RNA splicing. The results suggest that the RNA splicing is successfully monitored with the nanoplasmonic system. Thus, this platform can be useful for studying RNA nanotechnology, biomolecular folding, alternative splicing, and maturation of microRNA.
Berkers, Celia R.; de Jong, Annemieke; Schuurman, Karianne G.; Linnemann, Carsten; Meiring, Hugo D.; Janssen, Lennert; Neefjes, Jacques J.; Schumacher, Ton N. M.; Rodenko, Boris
2015-01-01
Peptide splicing, in which two distant parts of a protein are excised and then ligated to form a novel peptide, can generate unique MHC class I–restricted responses. Because these peptides are not genetically encoded and the rules behind proteasomal splicing are unknown, it is difficult to predict these spliced Ags. In the current study, small libraries of short peptides were used to identify amino acid sequences that affect the efficiency of this transpeptidation process. We observed that splicing does not occur at random, neither in terms of the amino acid sequences nor through random splicing of peptides from different sources. In contrast, splicing followed distinct rules that we deduced and validated both in vitro and in cells. Peptide ligation was quantified using a model peptide and demonstrated to occur with up to 30% ligation efficiency in vitro, provided that optimal structural requirements for ligation were met by both ligating partners. In addition, many splicing products could be formed from a single protein. Our splicing rules will facilitate prediction and detection of new spliced Ags to expand the peptidome presented by MHC class I Ags. PMID:26401003
Prognostic alternative mRNA splicing signature in non-small cell lung cancer.
Li, Yuan; Sun, Nan; Lu, Zhiliang; Sun, Shouguo; Huang, Jianbing; Chen, Zhaoli; He, Jie
2017-05-01
Alternative splicing provides a major mechanism to generate protein diversity. Increasing evidence suggests a link of dysregulation of splicing associated with cancer. Genome-wide alternative splicing profiling in lung cancer remains largely unstudied. We generated alternative splicing profiles in 491 lung adenocarcinoma (LUAD) and 471 lung squamous cell carcinoma (LUSC) patients in TCGA using RNA-seq data, prognostic models and splicing networks were built by integrated bioinformatics analysis. A total of 3691 and 2403 alternative splicing events were significantly associated with patient survival in LUAD and LUSC, respectively, including EGFR, CD44, PIK3C3, RRAS2, MAPKAP1 and FGFR2. The area under the curve of the receiver-operator characteristic curve for prognostic predictor in NSCLC was 0.817 at 2000 days of overall survival which were also over 0.8 in LUAD and LUSC, separately. Interestingly, splicing correlation networks uncovered opposite roles of splicing factors in LUAD and LUSC. We created prognostic predictors based on alternative splicing events with high performances for risk stratification in NSCLC patients and uncovered interesting splicing networks in LUAD and LUSC which could be underlying mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.
A saga of cancer epigenetics: linking epigenetics to alternative splicing.
Narayanan, Sathiya Pandi; Singh, Smriti; Shukla, Sanjeev
2017-03-07
The discovery of an increasing number of alternative splicing events in the human genome highlighted that ∼94% of genes generate alternatively spliced transcripts that may produce different protein isoforms with diverse functions. It is now well known that several diseases are a direct and indirect consequence of aberrant splicing events in humans. In addition to the conventional mode of alternative splicing regulation by ' cis ' RNA-binding sites and ' trans' RNA-binding proteins, recent literature provides enormous evidence for epigenetic regulation of alternative splicing. The epigenetic modifications may regulate alternative splicing by either influencing the transcription elongation rate of RNA polymerase II or by recruiting a specific splicing regulator via different chromatin adaptors. The epigenetic alterations and aberrant alternative splicing are known to be associated with various diseases individually, but this review discusses/highlights the latest literature on the role of epigenetic alterations in the regulation of alternative splicing and thereby cancer progression. This review also points out the need for further studies to understand the interplay between epigenetic modifications and aberrant alternative splicing in cancer progression. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila
Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang
2015-01-01
Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5′ intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5′ intron finds the 3′ introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5′ intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing. PMID:25838544
Philippe, Lucas; Pandarakalam, George C; Fasimoye, Rotimi; Harrison, Neale; Connolly, Bernadette; Pettitt, Jonathan; Müller, Berndt
2017-08-21
Spliced leader (SL) trans-splicing is a critical element of gene expression in a number of eukaryotic groups. This process is arguably best understood in nematodes, where biochemical and molecular studies in Caenorhabditis elegans and Ascaris suum have identified key steps and factors involved. Despite this, the precise details of SL trans-splicing have yet to be elucidated. In part, this is because the systematic identification of the molecules involved has not previously been possible due to the lack of a specific phenotype associated with defects in this process. We present here a novel GFP-based reporter assay that can monitor SL1 trans-splicing in living C. elegans. Using this assay, we have identified mutants in sna-1 that are defective in SL trans-splicing, and demonstrate that reducing function of SNA-1, SNA-2 and SUT-1, proteins that associate with SL1 RNA and related SmY RNAs, impairs SL trans-splicing. We further demonstrate that the Sm proteins and pICln, SMN and Gemin5, which are involved in small nuclear ribonucleoprotein assembly, have an important role in SL trans-splicing. Taken together these results provide the first in vivo evidence for proteins involved in SL trans-splicing, and indicate that continuous replacement of SL ribonucleoproteins consumed during trans-splicing reactions is essential for effective trans-splicing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
SASD: the Synthetic Alternative Splicing Database for identifying novel isoform from proteomics
2013-01-01
Background Alternative splicing is an important and widespread mechanism for generating protein diversity and regulating protein expression. High-throughput identification and analysis of alternative splicing in the protein level has more advantages than in the mRNA level. The combination of alternative splicing database and tandem mass spectrometry provides a powerful technique for identification, analysis and characterization of potential novel alternative splicing protein isoforms from proteomics. Therefore, based on the peptidomic database of human protein isoforms for proteomics experiments, our objective is to design a new alternative splicing database to 1) provide more coverage of genes, transcripts and alternative splicing, 2) exclusively focus on the alternative splicing, and 3) perform context-specific alternative splicing analysis. Results We used a three-step pipeline to create a synthetic alternative splicing database (SASD) to identify novel alternative splicing isoforms and interpret them at the context of pathway, disease, drug and organ specificity or custom gene set with maximum coverage and exclusive focus on alternative splicing. First, we extracted information on gene structures of all genes in the Ensembl Genes 71 database and incorporated the Integrated Pathway Analysis Database. Then, we compiled artificial splicing transcripts. Lastly, we translated the artificial transcripts into alternative splicing peptides. The SASD is a comprehensive database containing 56,630 genes (Ensembl gene IDs), 95,260 transcripts (Ensembl transcript IDs), and 11,919,779 Alternative Splicing peptides, and also covering about 1,956 pathways, 6,704 diseases, 5,615 drugs, and 52 organs. The database has a web-based user interface that allows users to search, display and download a single gene/transcript/protein, custom gene set, pathway, disease, drug, organ related alternative splicing. Moreover, the quality of the database was validated with comparison to other known databases and two case studies: 1) in liver cancer and 2) in breast cancer. Conclusions The SASD provides the scientific community with an efficient means to identify, analyze, and characterize novel Exon Skipping and Intron Retention protein isoforms from mass spectrometry and interpret them at the context of pathway, disease, drug and organ specificity or custom gene set with maximum coverage and exclusive focus on alternative splicing. PMID:24267658
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doug Blankenship
Archive of ArcGIS data from the West Flank FORGE site located in Coso, California. Archive contains the following eight shapefiles: Polygon of the 3D geologic model (WestFlank3DGeologicModelExtent) Polylines of the traces 3D modeled faults (WestFlank3DModeledFaultTraces) Polylines of the fault traces from Duffield and Bacon, 1980 (WestFlankFaultsfromDuffieldandBacon) Polygon of the West Flank FORGE site (WestFlankFORGEsite) Polylines of the traces of the geologic cross-sections (cross-sections in a separate archive in the GDR) (WestFlankGeologicCrossSections) Polylines of the traces of the seismic reflection profiles through and adjacent to the West Flank site (seismic reflection profiles in a separate archive in the GDR) (WestFlankSiesmicReflectionProfiles) Pointsmore » of the well collars in and around the West Flank site (WestFlankWellCollars) Polylines of the surface expression of the West Flank well paths (WestFlankWellPaths)« less
A study of alternative splicing in the pig
2010-01-01
Background Since at least half of the genes in mammalian genomes are subjected to alternative splicing, alternative pre-mRNA splicing plays an important contribution to the complexity of the mammalian proteome. Expressed sequence tags (ESTs) provide evidence of a great number of possible alternative isoforms. With the EST resource for the domestic pig now containing more than one million porcine ESTs, it is possible to identify alternative splice forms of the individual transcripts in this species from the EST data with some confidence. Results The pig EST data generated by the Sino-Danish Pig Genome project has been assembled with publicly available ESTs and made available in the PigEST database. Using the Distiller package 2,515 EST clusters with candidate alternative isoforms were identified in the EST data with high confidence. In agreement with general observations in human and mouse, we find putative splice variants in about 30% of the contigs with more than 50 ESTs. Based on the criteria that a minimum of two EST sequences confirmed each splice event, a list of 100 genes with the most distinct tissue-specific alternative splice events was generated from the list of candidates. To confirm the tissue specificity of the splice events, 10 genes with functional annotation were randomly selected from which 16 individual splice events were chosen for experimental verification by quantitative PCR (qPCR). Six genes were shown to have tissue specific alternatively spliced transcripts with expression patterns matching those of the EST data. The remaining four genes had tissue-restricted expression of alternative spliced transcripts. Five out of the 16 splice events that were experimentally verified were found to be putative pig specific. Conclusions In accordance with human and rodent studies we estimate that approximately 30% of the porcine genes undergo alternative splicing. We found a good correlation between EST predicted tissue-specificity and experimentally validated splice events in different porcine tissue. This study indicates that a cluster size of around 50 ESTs is optimal for in silico detection of alternative splicing. Although based on a limited number of splice events, the study supports the notion that alternative splicing could have an important impact on species differentiation since 31% of the splice events studied appears to be species specific. PMID:20444244
Adamia, Sophia; Haibe-Kains, Benjamin; Pilarski, Patrick M; Bar-Natan, Michal; Pevzner, Samuel; Avet-Loiseau, Herve; Lode, Laurence; Verselis, Sigitas; Fox, Edward A; Burke, John; Galinsky, Ilene; Dagogo-Jack, Ibiayi; Wadleigh, Martha; Steensma, David P; Motyckova, Gabriela; Deangelo, Daniel J; Quackenbush, John; Stone, Richard; Griffin, James D
2014-03-01
Despite new treatments, acute myeloid leukemia (AML) remains an incurable disease. More effective drug design requires an expanded view of the molecular complexity that underlies AML. Alternative splicing of RNA is used by normal cells to generate protein diversity. Growing evidence indicates that aberrant splicing of genes plays a key role in cancer. We investigated genome-wide splicing abnormalities in AML and based on these abnormalities, we aimed to identify novel potential biomarkers and therapeutic targets. We used genome-wide alternative splicing screening to investigate alternative splicing abnormalities in two independent AML patient cohorts [Dana-Farber Cancer Institute (DFCI) (Boston, MA) and University Hospital de Nantes (UHN) (Nantes, France)] and normal donors. Selected splicing events were confirmed through cloning and sequencing analysis, and than validated in 193 patients with AML. Our results show that approximately 29% of expressed genes genome-wide were differentially and recurrently spliced in patients with AML compared with normal donors bone marrow CD34(+) cells. Results were reproducible in two independent AML cohorts. In both cohorts, annotation analyses indicated similar proportions of differentially spliced genes encoding several oncogenes, tumor suppressor proteins, splicing factors, and heterogeneous-nuclear-ribonucleoproteins, proteins involved in apoptosis, cell proliferation, and spliceosome assembly. Our findings are consistent with reports for other malignances and indicate that AML-specific aberrations in splicing mechanisms are a hallmark of AML pathogenesis. Overall, our results suggest that aberrant splicing is a common characteristic for AML. Our findings also suggest that splice variant transcripts that are the result of splicing aberrations create novel disease markers and provide potential targets for small molecules or antibody therapeutics for this disease. ©2013 AACR
Long-read sequencing of nascent RNA reveals coupling among RNA processing events.
Herzel, Lydia; Straube, Korinna; Neugebauer, Karla M
2018-06-14
Pre-mRNA splicing is accomplished by the spliceosome, a megadalton complex that assembles de novo on each intron. Because spliceosome assembly and catalysis occur cotranscriptionally, we hypothesized that introns are removed in the order of their transcription in genomes dominated by constitutive splicing. Remarkably little is known about splicing order and the regulatory potential of nascent transcript remodeling by splicing, due to the limitations of existing methods that focus on analysis of mature splicing products (mRNAs) rather than substrates and intermediates. Here, we overcome this obstacle through long-read RNA sequencing of nascent, multi-intron transcripts in the fission yeast Schizosaccharomyces pombe Most multi-intron transcripts were fully spliced, consistent with rapid cotranscriptional splicing. However, an unexpectedly high proportion of transcripts were either fully spliced or fully unspliced, suggesting that splicing of any given intron is dependent on the splicing status of other introns in the transcript. Supporting this, mild inhibition of splicing by a temperature-sensitive mutation in prp2 , the homolog of vertebrate U2AF65, increased the frequency of fully unspliced transcripts. Importantly, fully unspliced transcripts displayed transcriptional read-through at the polyA site and were degraded cotranscriptionally by the nuclear exosome. Finally, we show that cellular mRNA levels were reduced in genes with a high number of unspliced nascent transcripts during caffeine treatment, showing regulatory significance of cotranscriptional splicing. Therefore, overall splicing of individual nascent transcripts, 3' end formation, and mRNA half-life depend on the splicing status of neighboring introns, suggesting crosstalk among spliceosomes and the polyA cleavage machinery during transcription elongation. © 2018 Herzel et al.; Published by Cold Spring Harbor Laboratory Press.
Pellagatti, Andrea; Armstrong, Richard N; Steeples, Violetta; Sharma, Eshita; Repapi, Emmanouela; Singh, Shalini; Sanchi, Andrea; Radujkovic, Aleksandar; Horn, Patrick; Dolatshad, Hamid; Roy, Swagata; Broxholme, John; Lockstone, Helen; Taylor, Stephen; Giagounidis, Aristoteles; Vyas, Paresh; Schuh, Anna; Hamblin, Angela; Papaemmanuil, Elli; Killick, Sally; Malcovati, Luca; Hennrich, Marco L; Gavin, Anne-Claude; Ho, Anthony D; Luft, Thomas; Hellström-Lindberg, Eva; Cazzola, Mario; Smith, Christopher W J; Smith, Stephen; Boultwood, Jacqueline
2018-06-21
SF3B1, SRSF2 and U2AF1 are the most frequently mutated splicing factor genes in the myelodysplastic syndromes (MDS). We have performed a comprehensive and systematic analysis to determine the impact of these commonly mutated splicing factors on pre-mRNA splicing in the bone marrow stem/progenitor cells and in the erythroid and myeloid precursors in splicing factor mutant MDS. Using RNA-seq, we determined the aberrantly spliced genes and dysregulated pathways in CD34 + cells of 84 MDS patients. Splicing factor mutations result in different alterations in splicing and largely affect different genes, but these converge in common dysregulated pathways and cellular processes, focused on RNA splicing, protein synthesis and mitochondrial dysfunction, suggesting common mechanisms of action in MDS. Many of these dysregulated pathways and cellular processes can be linked to the known disease pathophysiology associated with splicing factor mutations in MDS, whilst several others have not been previously associated with MDS, such as sirtuin signaling. We identified aberrantly spliced events associated with clinical variables, and isoforms which independently predict survival in MDS and implicate dysregulation of focal adhesion and extracellular exosomes as drivers of poor survival. Aberrantly spliced genes and dysregulated pathways were identified in the MDS-affected lineages in splicing factor mutant MDS. Functional studies demonstrated that knockdown of the mitosis regulators SEPT2 and AKAP8, aberrantly spliced target genes of SF3B1 and SRSF2 mutations respectively, led to impaired erythroid cell growth and differentiation. This study illuminates the impact of the common spliceosome mutations on the MDS phenotype and provides novel insights into disease pathophysiology. Copyright © 2018 American Society of Hematology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Conrad, R.; Thomas, J.; Spieth, J.
In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, Sl1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. The authors demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5[prime] splice site into the 5[prime] untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of amore » vit-5 intron, including the 3[prime] splice site, were inserted into the 5[prime] untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. They termed the region of a trans-spliced mRNA precursor between the 5[prime] end and the first 3[prime] splice site an 'outrun'. The results suggest that if a transcript begins with intronlike sequence followed by a 3[prime] splice site, this alone may constitute an outrun and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing.« less
CRISPR-based screening of genomic island excision events in bacteria.
Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe
2015-06-30
Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.
Defective control of pre–messenger RNA splicing in human disease
Shkreta, Lulzim
2016-01-01
Examples of associations between human disease and defects in pre–messenger RNA splicing/alternative splicing are accumulating. Although many alterations are caused by mutations in splicing signals or regulatory sequence elements, recent studies have noted the disruptive impact of mutated generic spliceosome components and splicing regulatory proteins. This review highlights recent progress in our understanding of how the altered splicing function of RNA-binding proteins contributes to myelodysplastic syndromes, cancer, and neuropathologies. PMID:26728853
Manananggal - a novel viewer for alternative splicing events.
Barann, Matthias; Zimmer, Ralf; Birzele, Fabian
2017-02-21
Alternative splicing is an important cellular mechanism that can be analyzed by RNA sequencing. However, identification of splicing events in an automated fashion is error-prone. Thus, further validation is required to select reliable instances of alternative splicing events (ASEs). There are only few tools specifically designed for interactive inspection of ASEs and available visualization approaches can be significantly improved. Here, we present Manananggal, an application specifically designed for the identification of splicing events in next generation sequencing data. Manananggal includes a web application for visual inspection and a command line tool that allows for ASE detection. We compare the sashimi plots available in the IGV Viewer, the DEXSeq splicing plots and SpliceSeq to the Manananggal interface and discuss the advantages and drawbacks of these tools. We show that sashimi plots (such as those used by the IGV Viewer and SpliceSeq) offer a practical solution for simple ASEs, but also indicate short-comings for highly complex genes. Manananggal is an interactive web application that offers functions specifically tailored to the identification of alternative splicing events that other tools are lacking. The ability to select a subset of isoforms allows an easier interpretation of complex alternative splicing events. In contrast to SpliceSeq and the DEXSeq splicing plot, Manananggal does not obscure the gene structure by showing full transcript models that makes it easier to determine which isoforms are expressed and which are not.
Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D
2014-01-01
The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841
30 CFR 75.810 - High-voltage trailing cables; splices.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage trailing cables; splices. 75.810... § 75.810 High-voltage trailing cables; splices. [Statutory Provisions] In the case of high-voltage cables used as trailing cables, temporary splices shall not be used and all permanent splices shall be...
30 CFR 57.12088 - Splicing trailing cables.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Splicing trailing cables. 57.12088 Section 57... Underground Only § 57.12088 Splicing trailing cables. No splice, except a vulcanized splice or its equivalent, shall be made in a trailing cable within 25 feet of the machine unless the machine is equipped with a...
Venables, Julian P.; Brosseau, Jean-Philippe; Gadea, Gilles; Klinck, Roscoe; Prinos, Panagiotis; Beaulieu, Jean-François; Lapointe, Elvy; Durand, Mathieu; Thibault, Philippe; Tremblay, Karine; Rousset, François; Tazi, Jamal; Abou Elela, Sherif
2013-01-01
Alternative splicing provides a critical and flexible layer of regulation intervening in many biological processes to regulate the diversity of proteins and impact cell phenotype. To identify alternative splicing differences that distinguish epithelial from mesenchymal tissues, we have investigated hundreds of cassette exons using a high-throughput reverse transcription-PCR (RT-PCR) platform. Extensive changes in splicing were noted between epithelial and mesenchymal tissues in both human colon and ovarian tissues, with many changes from mostly one splice variant to predominantly the other. Remarkably, many of the splicing differences that distinguish normal mesenchymal from normal epithelial tissues matched those that differentiate normal ovarian tissues from ovarian cancer. Furthermore, because splicing profiling could classify cancer cell lines according to their epithelial/mesenchymal characteristics, we used these cancer cell lines to identify regulators for these specific splicing signatures. By knocking down 78 potential splicing factors in five cell lines, we provide an extensive view of the complex regulatory landscape associated with the epithelial and mesenchymal states, thus revealing that RBFOX2 is an important driver of mesenchymal tissue-specific splicing. PMID:23149937
Alternative Splicing as a Target for Cancer Treatment.
Martinez-Montiel, Nancy; Rosas-Murrieta, Nora Hilda; Anaya Ruiz, Maricruz; Monjaraz-Guzman, Eduardo; Martinez-Contreras, Rebeca
2018-02-11
Alternative splicing is a key mechanism determinant for gene expression in metazoan. During alternative splicing, non-coding sequences are removed to generate different mature messenger RNAs due to a combination of sequence elements and cellular factors that contribute to splicing regulation. A different combination of splicing sites, exonic or intronic sequences, mutually exclusive exons or retained introns could be selected during alternative splicing to generate different mature mRNAs that could in turn produce distinct protein products. Alternative splicing is the main source of protein diversity responsible for 90% of human gene expression, and it has recently become a hallmark for cancer with a full potential as a prognostic and therapeutic tool. Currently, more than 15,000 alternative splicing events have been associated to different aspects of cancer biology, including cell proliferation and invasion, apoptosis resistance and susceptibility to different chemotherapeutic drugs. Here, we present well established and newly discovered splicing events that occur in different cancer-related genes, their modification by several approaches and the current status of key tools developed to target alternative splicing with diagnostic and therapeutic purposes.
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
Alternative Splicing in Neurogenesis and Brain Development.
Su, Chun-Hao; D, Dhananjaya; Tarn, Woan-Yuh
2018-01-01
Alternative splicing of precursor mRNA is an important mechanism that increases transcriptomic and proteomic diversity and also post-transcriptionally regulates mRNA levels. Alternative splicing occurs at high frequency in brain tissues and contributes to every step of nervous system development, including cell-fate decisions, neuronal migration, axon guidance, and synaptogenesis. Genetic manipulation and RNA sequencing have provided insights into the molecular mechanisms underlying the effects of alternative splicing in stem cell self-renewal and neuronal fate specification. Timely expression and perhaps post-translational modification of neuron-specific splicing regulators play important roles in neuronal development. Alternative splicing of many key transcription regulators or epigenetic factors reprograms the transcriptome and hence contributes to stem cell fate determination. During neuronal differentiation, alternative splicing also modulates signaling activity, centriolar dynamics, and metabolic pathways. Moreover, alternative splicing impacts cortical lamination and neuronal development and function. In this review, we focus on recent progress toward understanding the contributions of alternative splicing to neurogenesis and brain development, which has shed light on how splicing defects may cause brain disorders and diseases.
Kristensen, Jesper T; Houmann, Andreas; Liu, Xiaomin; Turchinovich, Dmitry
2008-06-23
We report on highly reproducible low-loss fusion splicing of polarization-maintaining single-mode fibers (PM-SMFs) and hollow-core photonic crystal fibers (HC-PCFs). The PM-SMF-to-HC-PCF splices are characterized by the loss of 0.62 +/- 0.24 dB, and polarization extinction ratio of 19 +/- 0.68 dB. The reciprocal HC-PCF-to-PM-SMF splice loss is found to be 2.19 +/- 0.33 dB, which is caused by the mode evolution in HC-PCF. The return loss in both cases was measured to be -14 dB. We show that a splice defect is caused by the HC-PCF cleave defect, and the lossy splice can be predicted at an early stage of the splicing process. We also demonstrate that the higher splice loss compromises the PM properties of the splice. Our splicing technique was successfully applied to the realization of a low-loss, environmentally stable monolithic PM fiber laser pulse compressor, enabling direct end-of-the-fiber femtosecond pulse delivery.
Rajkumar, Sankaranarayanan; Vasavada, Abhay R.; Praveen, Mamidipudi R.; Ananthan, Rajendran; Reddy, Geereddy B.; Tripathi, Harsha; Ganatra, Darshini A.; Arora, Anshul I.; Patel, Alpesh R.
2013-01-01
Purpose. To explore different molecular factors impairing the activities of superoxide dismutase (SOD) isoforms in senile cataractous lenses. Methods. Enzyme activity of SOD isoforms, levels of their corresponding cofactors copper (Cu), manganese (Mn), zinc (Zn), and expression of mRNA transcripts and proteins were determined in the lenses of human subjects with and without cataract. DNA from lens epithelium (LE) and peripheral blood was isolated. Polymerase chain reaction–single strand conformation polymorphism (PCR-SSCP) followed by sequencing was carried out to screen somatic mutations. The impact of intronic insertion/deletion (INDEL) variations on the splicing process and on the resultant transcript was evaluated. Genotyping of IVS4+42delG polymorphism of SOD1 gene was done by PCR–restriction fragment length polymorphism (RFLP). Results. A significant decrease in Cu/Zn- and Mn-SOD activity (P < 0.001) and in Cu/Zn-SOD transcript (P < 0.001) and its protein (P < 0.05) were found in cataractous lenses. No significant change in the level of copper (P = 0.36) and an increase in the level of manganese (P = 0.01) and zinc (P = 0.02) were observed in cataractous lenses. A significant positive correlation between the level of Cu/Zn-SOD activity and the levels of Cu (P = 0.003) and Zn (P = 0.005) was found in the cataractous lenses. DNA sequencing revealed three intronic INDEL variations in exon4 of SOD1 gene. Splice-junction analysis showed the potential of IVS4+42delG in creating a new cryptic acceptor site. If it is involved in alternate splicing, it could result in generation of SOD1 mRNA transcripts lacking exon4 region. Transcript analysis revealed the presence of complete SOD1 mRNA transcripts. Genotyping revealed the presence of IVS4+42delG polymorphism in all subjects. Conclusions. The decrease in the activity of SOD1 isoform in cataractous lenses was associated with the decreased level of mRNA transcripts and their protein expression and was not associated with either modulation in the level of enzyme cofactors or with INDEL variations. PMID:23970468
Language study on Spliced Semigraph using Folding techniques
NASA Astrophysics Data System (ADS)
Thiagarajan, K.; Padmashree, J.
2018-04-01
In this paper, we proposed algorithm to identify cut vertices and cut edges for n-Cut Spliced Semigraph and splicing the n-Cut Spliced Semigraph using cut vertices else cut edges or combination of cut vertex and cut edge and applying sequence of folding to the spliced semigraph to obtain the semigraph quadruple η(S)=(2, 1, 1, 1). We observed that the splicing and folding using both cut vertices and cut edges is applicable only for n-Cut Spliced Semigraph where n > 2. Also, we transformed the spliced semigraph into tree structure and studied the language for the semigraph with n+2 vertices and n+1 semivertices using Depth First Edge Sequence algorithm and obtain the language structure with sequence of alphabet ‘a’ and ‘b’.
The combinatorial control of alternative splicing in C. elegans
2017-01-01
Normal development requires the right splice variants to be made in the right tissues at the right time. The core splicing machinery is engaged in all splicing events, but which precise splice variant is made requires the choice between alternative splice sites—for this to occur, a set of splicing factors (SFs) must recognize and bind to short RNA motifs in the pre-mRNA. In C. elegans, there is known to be extensive variation in splicing patterns across development, but little is known about the targets of each SF or how multiple SFs combine to regulate splicing. Here we combine RNA-seq with in vitro binding assays to study how 4 different C. elegans SFs, ASD-1, FOX-1, MEC-8, and EXC-7, regulate splicing. The 4 SFs chosen all have well-characterised biology and well-studied loss-of-function genetic alleles, and all contain RRM domains. Intriguingly, while the SFs we examined have varied roles in C. elegans development, they show an unexpectedly high overlap in their targets. We also find that binding sites for these SFs occur on the same pre-mRNAs more frequently than expected suggesting extensive combinatorial control of splicing. We confirm that regulation of splicing by multiple SFs is often combinatorial and show that this is functionally significant. We also find that SFs appear to combine to affect splicing in two modes—they either bind in close proximity within the same intron or they appear to bind to separate regions of the intron in a conserved order. Finally, we find that the genes whose splicing are regulated by multiple SFs are highly enriched for genes involved in the cytoskeleton and in ion channels that are key for neurotransmission. Together, this shows that specific classes of genes have complex combinatorial regulation of splicing and that this combinatorial regulation is critical for normal development to occur. PMID:29121637
The behavior of bonded doubler splices for composite sandwich panels
NASA Technical Reports Server (NTRS)
Zeller, T. A.; Weisahaar, T. A.
1980-01-01
The results of an investigation into the behavior of adhesively bonded doubler splices of two composite material sandwich panels are presented. The splices are studied from three approaches: analytical; numerical (finite elements); and experimental. Several parameters that characterize the splice are developed to determine their influence upon joint strength. These parameters are: doubler overlap length; core stiffness; laminate bending stiffness; the size of the gap between the spliced sandwich panels; and room and elevated temperatures. Similarities and contrasts between these splices and the physically similar single and double lap joints are discussed. The results of this investigation suggest several possible approaches to improving the strength of the sandwich splices.
Niimi, Hideki; Ogawa, Tomomi; Note, Rhougou; Hayashi, Shirou; Ueno, Tomohiro; Harada, Kenu; Uji, Yoshinori; Kitajima, Isao
2010-12-01
In recent years, genetic diagnostics of pathogenic splicing abnormalities are increasingly recognized as critically important in the clinical genetic diagnostics. It is reported that approximately 10% of pathogenic mutations causing human inherited diseases are splicing mutations. Nonetheless, it is still difficult to identify splicing abnormalities in routine genetic diagnostic settings. Here, we studied two different kinds of cases with splicing abnormalities. The first case is a protein S deficiency. Nucleotide analyses revealed that the proband had a previously reported G to C substitution in the invariant AG dinucleotide at the splicing acceptor site of intronl/exon2, which produces multiple splicing abnormalities resulting in protein S deficiency. The second case is an antithrombin (AT) deficiency. This proband had a previously reported G to A substitution, at nucleotide position 9788 in intron 4, 14 bp in front of exon 5, which created a de novo exon 5 splice site and resulted in AT deficiency. From a practical standpoint, we discussed the pitfalls, attentions, and screening approaches in genetic diagnostics of pathogenic splicing abnormalities. Due to the difficulty with full-length sequence analysis of introns, and the lack of RNA samples, splicing mutations may escape identification. Although current genetic testing remains to be improved, to screen for splicing abnormalities more efficiently, it is significant to use an appropriate combination of various approaches such as DNA and/or RNA samples, splicing mutation databases, bioinformatic tools to detect splice sites and cis-regulatory elements, and in vitro and/or in vivo experimentally methods as needed.
Wang, Xinye; Xu, Xindong; Lu, Xingyu; Zhang, Yuanbin; Pan, Weiqing
2015-01-01
Alternative splicing is a molecular process that contributes greatly to the diversification of proteome and to gene functions. Understanding the mechanisms of stage-specific alternative splicing can provide a better understanding of the development of eukaryotes and the functions of different genes. Schistosoma japonicum is an infectious blood-dwelling trematode with a complex lifecycle that causes the tropical disease schistosomiasis. In this study, we analyzed the transcriptome of Schistosoma japonicum to discover alternative splicing events in this parasite, by applying RNA-seq to cDNA library of adults and schistosomula. Results were validated by RT-PCR and sequencing. We found 11,623 alternative splicing events among 7,099 protein encoding genes and average proportion of alternative splicing events per gene was 42.14%. We showed that exon skip is the most common type of alternative splicing events as found in high eukaryotes, whereas intron retention is the least common alternative splicing type. According to intron boundary analysis, the parasite possesses same intron boundaries as other organisms, namely the classic “GT-AG” rule. And in alternative spliced introns or exons, this rule is less strict. And we have attempted to detect alternative splicing events in genes encoding proteins with signal peptides and transmembrane helices, suggesting that alternative splicing could change subcellular locations of specific gene products. Our results indicate that alternative splicing is prevalent in this parasitic worm, and that the worm is close to its hosts. The revealed secretome involved in alternative splicing implies new perspective into understanding interaction between the parasite and its host. PMID:26407301
Independence between pre-mRNA splicing and DNA methylation in an isogenic minigene resource.
Nanan, Kyster K; Ocheltree, Cody; Sturgill, David; Mandler, Mariana D; Prigge, Maria; Varma, Garima; Oberdoerffer, Shalini
2017-12-15
Actively transcribed genes adopt a unique chromatin environment with characteristic patterns of enrichment. Within gene bodies, H3K36me3 and cytosine DNA methylation are elevated at exons of spliced genes and have been implicated in the regulation of pre-mRNA splicing. H3K36me3 is further responsive to splicing, wherein splicing inhibition led to a redistribution and general reduction over gene bodies. In contrast, little is known of the mechanisms supporting elevated DNA methylation at actively spliced genic locations. Recent evidence associating the de novo DNA methyltransferase Dnmt3b with H3K36me3-rich chromatin raises the possibility that genic DNA methylation is influenced by splicing-associated H3K36me3. Here, we report the generation of an isogenic resource to test the direct impact of splicing on chromatin. A panel of minigenes of varying splicing potential were integrated into a single FRT site for inducible expression. Profiling of H3K36me3 confirmed the established relationship to splicing, wherein levels were directly correlated with splicing efficiency. In contrast, DNA methylation was equivalently detected across the minigene panel, irrespective of splicing and H3K36me3 status. In addition to revealing a degree of independence between genic H3K36me3 and DNA methylation, these findings highlight the generated minigene panel as a flexible platform for the query of splicing-dependent chromatin modifications. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bandyopadhyay, Anindya; Kopperud, Kristin; Anderson, Gavin
The genome of Potato yellow dwarf virus (PYDV; Nucleorhabdovirus type species) was determined to be 12,875 nucleotides (nt). The antigenome is organized into seven open reading frames (ORFs) ordered 3'-N-X-P-Y-M-G-L-5', which likely encode the nucleocapsid, phospho, movement, matrix, glyco and RNA-dependent RNA polymerase proteins, respectively, except for X, which is of unknown function. The ORFs are flanked by a 3' leader RNA of 149 nt and a 5' trailer RNA of 97 nt, and are separated by conserved intergenic junctions. Phylogenetic analyses indicated that PYDV is closely related to other leafhopper-transmitted rhabdoviruses. Functional protein assays were used to determine themore » subcellular localization of PYDV proteins. Surprisingly, the M protein was able to induce the intranuclear accumulation of the inner nuclear membrane in the absence of any other viral protein. Finally, bimolecular fluorescence complementation was used to generate the most comprehensive protein interaction map for a plant-adapted rhabdovirus to date.« less
j5 DNA assembly design automation.
Hillson, Nathan J
2014-01-01
Modern standardized methodologies, described in detail in the previous chapters of this book, have enabled the software-automated design of optimized DNA construction protocols. This chapter describes how to design (combinatorial) scar-less DNA assembly protocols using the web-based software j5. j5 assists biomedical and biotechnological researchers construct DNA by automating the design of optimized protocols for flanking homology sequence as well as type IIS endonuclease-mediated DNA assembly methodologies. Unlike any other software tool available today, j5 designs scar-less combinatorial DNA assembly protocols, performs a cost-benefit analysis to identify which portions of an assembly process would be less expensive to outsource to a DNA synthesis service provider, and designs hierarchical DNA assembly strategies to mitigate anticipated poor assembly junction sequence performance. Software integrated with j5 add significant value to the j5 design process through graphical user-interface enhancement and downstream liquid-handling robotic laboratory automation.
Plasmid-Encoded Transferable mecB-Mediated Methicillin Resistance in Staphylococcus aureus
van Alen, Sarah; Idelevich, Evgeny A.; Schleimer, Nina; Seggewiß, Jochen; Mellmann, Alexander; Kaspar, Ursula; Peters, Georg
2018-01-01
During cefoxitin-based nasal screening, phenotypically categorized methicillin-resistant Staphylococcus aureus (MRSA) was isolated and tested negative for the presence of the mecA and mecC genes as well as for the SCCmec-orfX junction region. The isolate was found to carry a mecB gene previously described for Macrococcus caseolyticus but not for staphylococcal species. The gene is flanked by β-lactam regulatory genes similar to mecR, mecI, and blaZ and is part of an 84.6-kb multidrug-resistance plasmid that harbors genes encoding additional resistances to aminoglycosides (aacA-aphD, aphA, and aadK) as well as macrolides (ermB) and tetracyclines (tetS). This further plasmidborne β-lactam resistance mechanism harbors the putative risk of acceleration or reacceleration of MRSA spread, resulting in broad ineffectiveness of β-lactams as a main therapeutic application against staphylococcal infections. PMID:29350135
Somatic mitochondrial mutation in gastric cancer.
Burgart, L. J.; Zheng, J.; Shu, Q.; Strickler, J. G.; Shibata, D.
1995-01-01
Likely hot spots for mutations are mitochondrial sequences as there is less repair and more damage by carcinogens compared with nuclear sequences. A somatic 50-bp mitochondrial D-loop deletion was detected in four gastric adenocarcinomas. The deletion included the CSB2 region and was flanked by 9-bp direct repeats. The deletion was more frequent in adenocarcinomas arising from the gastroesophageal junction (4/32, 12.5%) compared with more distal tumors (0/45). Topographical analysis revealed the absence of the deletion from normal tissues except in focal portions of smooth muscle in one case. In two cases, apparent mutant homoplasmy was present throughout two tumors, including their metastases. In the two other cases, the mutation was present in only minor focal portions ( < 5%) of their primary tumors. These findings document the presence of somatic mitochondrial alterations in gastric cancer, which may reflect the environmental and genetic influences operative during tumor progression. Images Figure 3 Figure 4 Figure 5 PMID:7573355
Survey of gene splicing algorithms based on reads.
Si, Xiuhua; Wang, Qian; Zhang, Lei; Wu, Ruo; Ma, Jiquan
2017-11-02
Gene splicing is the process of assembling a large number of unordered short sequence fragments to the original genome sequence as accurately as possible. Several popular splicing algorithms based on reads are reviewed in this article, including reference genome algorithms and de novo splicing algorithms (Greedy-extension, Overlap-Layout-Consensus graph, De Bruijn graph). We also discuss a new splicing method based on the MapReduce strategy and Hadoop. By comparing these algorithms, some conclusions are drawn and some suggestions on gene splicing research are made.
Preparation of cell-free splicing extracts from Saccharomyces cerevisiae.
Ares, Manuel
2013-10-01
Much of our understanding of the mechanism of splicing comes from the analysis of cell extracts able to carry out splicing complex formation and splicing reactions in vitro using exogenously added synthetic model pre-mRNA transcripts. This protocol describes the preparation of whole-cell extracts from the budding yeast Saccharomyces cerevisiae. These extracts can be used to dissect the biochemical steps of the splicing reaction and to determine the macromolecules, cofactors, and substrate features necessary for successful splicing.
The influence of Argonaute proteins on alternative RNA splicing.
Batsché, Eric; Ameyar-Zazoua, Maya
2015-01-01
Alternative splicing of precursor RNAs is an important process in multicellular species because it impacts several aspects of gene expression: from the increase of protein repertoire to the level of expression. A large body of evidences demonstrates that factors regulating chromatin and transcription impact the outcomes of alternative splicing. Argonaute (AGO) proteins were known to play key roles in the regulation of gene expression at the post-transcriptional level. More recently, their role in the nucleus of human somatic cells has emerged. Here, we will discuss some of the nuclear functions of AGO, with special emphasis on alternative splicing. The AGO-mediated modulation of alternative splicing is based on several properties of these proteins: their binding to transcripts on chromatin and their interactions with many proteins, especially histone tail-modifying enzymes, HP1γ and splicing factors. AGO proteins may favor a decrease in the RNA-polymerase II kinetics at actively transcribed genes leading to the modulation of alternative splicing decisions. They could also influence alternative splicing through their interaction with core components of the splicing machinery and several splicing factors. We will discuss the modes of AGO recruitment on chromatin at active genes. We suggest that long intragenic antisense transcripts (lincRNA) might be an important feature of genes containing splicing events regulated by AGO. © 2014 John Wiley & Sons, Ltd.
Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang
2017-01-01
RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5′-ASO could block RNA splicing by inhibiting the first step, while 3′-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs. PMID:28989608
Genomic overview of mRNA 5′-leader trans-splicing in the ascidian Ciona intestinalis
Satou, Yutaka; Hamaguchi, Makoto; Takeuchi, Keisuke; Hastings, Kenneth E. M.; Satoh, Nori
2006-01-01
Although spliced leader (SL) trans-splicing in the chordates was discovered in the tunicate Ciona intestinalis there has been no genomic overview analysis of the extent of trans-splicing or the make-up of the trans-spliced and non-trans-spliced gene populations of this model organism. Here we report such an analysis for Ciona based on the oligo-capping full-length cDNA approach. We randomly sampled 2078 5′-full-length ESTs representing 668 genes, or 4.2% of the entire genome. Our results indicate that Ciona contains a single major SL, which is efficiently trans-spliced to mRNAs transcribed from a specific set of genes representing ∼50% of the total number of expressed genes, and that individual trans-spliced mRNA species are, on average, 2–3-fold less abundant than non-trans-spliced mRNA species. Our results also identify a relationship between trans-splicing status and gene functional classification; ribosomal protein genes fall predominantly into the non-trans-spliced category. In addition, our data provide the first evidence for the occurrence of polycistronic transcription in Ciona. An interesting feature of the Ciona polycistronic transcription units is that the great majority entirely lack intercistronic sequences. PMID:16822859
Human Splicing Finder: an online bioinformatics tool to predict splicing signals.
Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe
2009-05-01
Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.
Human Splicing Finder: an online bioinformatics tool to predict splicing signals
Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe
2009-01-01
Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-β Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5′ and 3′ splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project. PMID:19339519
Kalyna, Maria; Lopato, Sergiy; Voronin, Viktor; Barta, Andrea
2006-01-01
Alternative splicing is an important mechanism for fine tuning of gene expression at the post-transcriptional level. SR proteins govern splice site selection and spliceosome assembly. The Arabidopsis genome encodes 19 SR proteins, several of which have no orthologues in metazoan. Three of the plant specific subfamilies are characterized by the presence of a relatively long alternatively spliced intron located in their first RNA recognition motif, which potentially results in an extremely truncated protein. In atRSZ33, a member of the RS2Z subfamily, this alternative splicing event was shown to be autoregulated. Here we show that atRSp31, a member of the RS subfamily, does not autoregulate alternative splicing of its similarily positioned intron. Interestingly, this alternative splicing event is regulated by atRSZ33. We demonstrate that the positions of these long introns and their capability for alternative splicing are conserved from green algae to flowering plants. Moreover, in particular alternative splicing events the splicing signals are embedded into highly conserved sequences. In different taxa, these conserved sequences occur in at least one gene within a subfamily. The evolutionary preservation of alternative splice forms together with highly conserved intron features argues for additional functions hidden in the genes of these plant-specific SR proteins. PMID:16936312
Evolution of Nova-Dependent Splicing Regulation in the Brain
Živin, Marko; Darnell, Robert B
2007-01-01
A large number of alternative exons are spliced with tissue-specific patterns, but little is known about how such patterns have evolved. Here, we study the conservation of the neuron-specific splicing factors Nova1 and Nova2 and of the alternatively spliced exons they regulate in mouse brain. Whereas Nova RNA binding domains are 94% identical across vertebrate species, Nova-dependent splicing silencer and enhancer elements (YCAY clusters) show much greater divergence, as less than 50% of mouse YCAY clusters are conserved at orthologous positions in the zebrafish genome. To study the relation between the evolution of tissue-specific splicing and YCAY clusters, we compared the brain-specific splicing of Nova-regulated exons in zebrafish, chicken, and mouse. The presence of YCAY clusters in lower vertebrates invariably predicted conservation of brain-specific splicing across species, whereas their absence in lower vertebrates correlated with a loss of alternative splicing. We hypothesize that evolution of Nova-regulated splicing in higher vertebrates proceeds mainly through changes in cis-acting elements, that tissue-specific splicing might in some cases evolve in a single step corresponding to evolution of a YCAY cluster, and that the conservation level of YCAY clusters relates to the functions encoded by the regulated RNAs. PMID:17937501
Alternative splicing and the evolution of phenotypic novelty.
Bush, Stephen J; Chen, Lu; Tovar-Corona, Jaime M; Urrutia, Araxi O
2017-02-05
Alternative splicing, a mechanism of post-transcriptional RNA processing whereby a single gene can encode multiple distinct transcripts, has been proposed to underlie morphological innovations in multicellular organisms. Genes with developmental functions are enriched for alternative splicing events, suggestive of a contribution of alternative splicing to developmental programmes. The role of alternative splicing as a source of transcript diversification has previously been compared to that of gene duplication, with the relationship between the two extensively explored. Alternative splicing is reduced following gene duplication with the retention of duplicate copies higher for genes which were alternatively spliced prior to duplication. Furthermore, and unlike the case for overall gene number, the proportion of alternatively spliced genes has also increased in line with the evolutionary diversification of cell types, suggesting alternative splicing may contribute to the complexity of developmental programmes. Together these observations suggest a prominent role for alternative splicing as a source of functional innovation. However, it is unknown whether the proliferation of alternative splicing events indeed reflects a functional expansion of the transcriptome or instead results from weaker selection acting on larger species, which tend to have a higher number of cell types and lower population sizes.This article is part of the themed issue 'Evo-devo in the genomics era, and the origins of morphological diversity'. © 2016 The Author(s).
Alternative splicing and the evolution of phenotypic novelty
Bush, Stephen J.; Chen, Lu; Tovar-Corona, Jaime M.
2017-01-01
Alternative splicing, a mechanism of post-transcriptional RNA processing whereby a single gene can encode multiple distinct transcripts, has been proposed to underlie morphological innovations in multicellular organisms. Genes with developmental functions are enriched for alternative splicing events, suggestive of a contribution of alternative splicing to developmental programmes. The role of alternative splicing as a source of transcript diversification has previously been compared to that of gene duplication, with the relationship between the two extensively explored. Alternative splicing is reduced following gene duplication with the retention of duplicate copies higher for genes which were alternatively spliced prior to duplication. Furthermore, and unlike the case for overall gene number, the proportion of alternatively spliced genes has also increased in line with the evolutionary diversification of cell types, suggesting alternative splicing may contribute to the complexity of developmental programmes. Together these observations suggest a prominent role for alternative splicing as a source of functional innovation. However, it is unknown whether the proliferation of alternative splicing events indeed reflects a functional expansion of the transcriptome or instead results from weaker selection acting on larger species, which tend to have a higher number of cell types and lower population sizes. This article is part of the themed issue ‘Evo-devo in the genomics era, and the origins of morphological diversity’. PMID:27994117
Kim, Yong-Eun; Park, Chungoo; Kim, Kyoon Eon; Kim, Kee K
2018-04-30
Alternative splicing is an essential process in eukaryotes, as it increases the complexity of gene expression by generating multiple proteins from a single pre-mRNA. However, information on the regulatory mechanisms for alternative splicing is lacking, because splicing occurs over a short period via the transient interactions of proteins within functional complexes of the spliceosome. Here, we investigated in detail the molecular mechanisms connecting alternative splicing with epigenetic mechanisms. We identified interactions between histone proteins and splicing factors such as Rbfox2, Rbfox3, and splicing factor proline and glutamine rich protein (SFPQ) by in vivo crosslinking and immunoprecipitation. Furthermore, we confirmed that splicing factors were bound to specific modified residues of histone proteins. Additionally, changes in histone methylation due to histone methyltransferase inhibitor treatment notably affected alternative splicing in selected genes. Therefore, we suggested that there may be crosstalk mechanisms connecting histone modifications and RNA-binding proteins that increase the local concentration of RNA-binding proteins in alternative exon loci of nucleosomes by binding specific modified histone proteins, leading to alternative splicing. This crosstalk mechanism may play a major role in epigenetic processes such as histone modification and the regulation of alternative splicing. Copyright © 2018 Elsevier Inc. All rights reserved.
Liu, H X; Goodall, G J; Kole, R; Filipowicz, W
1995-01-16
We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.
Pre-mRNA splicing in cancer: the relevance in oncogenesis, treatment and drug resistance.
Wojtuszkiewicz, Anna; Assaraf, Yehuda G; Maas, Marielle J P; Kaspers, Gertjan J L; Jansen, Gerrit; Cloos, Jacqueline
2015-05-01
Aberrant pre-mRNA splicing in cancer is emerging as an important determinant of oncogenesis, response to treatment and anticancer drug resistance. At the same time, the spliceosome has become a target for a novel class of pre-clinical chemotherapeutics with a potential future application in cancer treatment. Taken together, these findings offer novel opportunities for the enhancement of the efficacy of cancer therapy. This review presents a comprehensive overview of the molecular mechanisms involved in splicing and current developments regarding splicing aberrations in relation to several aspects of cancer formation and therapy. Identified mutations in the various components of the spliceosome and their implications for cancer prognosis are delineated. Moreover, the contribution of abnormal splicing patterns as well as deregulated splicing factors to chemoresistance is discussed, along with novel splicing-based therapeutic approaches. Significant progress has been made in deciphering the role of splicing factors in cancer including carcinogenesis and drug resistance. Splicing-based prognostic tools as well as therapeutic options hold great potential towards improvements in cancer therapy. However, gaining more in-depth molecular insight into the consequences of mutations in various components of the splicing machinery as well as of cellular effects of spliceosome inhibition is a prerequisite to establish the role of splicing in tumor progression and treatment options, respectively.
Mutation in Pyrroline-5-Carboxylate Reductase 1 Gene in Families with Cutis Laxa Type 2
Guernsey, Duane L.; Jiang, Haiyan; Evans, Susan C.; Ferguson, Meghan; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea L.; Provost, Sylvie; Bedard, Karen; Orr, Andrew; Dubé, Marie-Pierre; Ludman, Mark; Samuels, Mark E.
2009-01-01
Autosomal-recessive cutis laxa type 2 (ARCL2) is a multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin, joint laxity, and a general developmental delay. Cutis laxa includes a family of clinically overlapping conditions with confusing nomenclature, generally requiring molecular analyses for definitive diagnosis. Six genes are currently known to mutate to yield one of these related conditions. We ascertained a cohort of typical ARCL2 patients from a subpopulation isolate within eastern Canada. Homozygosity mapping with high-density SNP genotyping excluded all six known genes, and instead identified a single homozygous region near the telomere of chromosome 17, shared identically by state by all genotyped affected individuals from the families. A putative pathogenic variant was identified by direct DNA sequencing of genes within the region. The single nucleotide change leads to a missense mutation adjacent to a splice junction in the gene encoding pyrroline-5-carboxylate reductase 1 (PYCR1). Bioinformatic analysis predicted a pathogenic effect of the variant on splice donor site function. Skipping of the associated exon was confirmed in RNA from blood lymphocytes of affected homozygotes and heterozygous mutation carriers. Exon skipping leads to deletion of the reductase functional domain-coding region and an obligatory downstream frameshift. PYCR1 plays a critical role in proline biosynthesis. Pathogenicity of the genetic variant in PYCR1 is likely, given that a similar clinical phenotype has been documented for mutation carriers of another proline biosynthetic enzyme, pyrroline-5-carboxylate synthase. Our results support a significant role for proline in normal development. PMID:19576563
Zhang, Xu; Zhang, Wei
2016-06-01
Cytosine modification on DNA is variable among individuals, which could correlate with gene expression variation. The effect of cytosine modification on interindividual transcript isoform variation (TIV), however, remains unclear. In this study, we assessed the extent of cytosine modification-specific TIV in lymphoblastoid cell lines (LCLs) derived from unrelated individuals of European and African descent. Our study detected cytosine modification-specific TIVs for 17% of the analyzed genes at a 5% false discovery rate. Forty-five percent of the TIV-associated cytosine modifications correlated with the overall gene expression levels as well, with the corresponding CpG sites overrepresented in transcript initiation sites, transcription factor binding sites, and distinct histone modification peaks, suggesting that alternative isoform transcription underlies the TIVs. Our analysis also revealed 33% of the TIV-associated cytosine modifications that affected specific exons, with the corresponding CpG sites overrepresented in exon/intron junctions, splicing branching points, and transcript termination sites, implying that the TIVs are attributable to alternative splicing or transcription termination. Genetic and epigenetic regulation of TIV shared target preference but exerted independent effects on 61% of the common exon targets. Cytosine modification-specific TIVs detected from LCLs were differentially enriched in those detected from various tissues in The Cancer Genome Atlas, indicating their developmental dependency. Genes containing cytosine modification-specific TIVs were enriched in pathways of cancers and metabolic disorders. Our study demonstrated a prominent effect of cytosine modification variation on the transcript isoform spectrum over gross transcript abundance and revealed epigenetic contributions to diseases that were mediated through cytosine modification-specific TIV. Copyright © 2016 by the Genetics Society of America.
Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl; Schrijver, Iris
2011-01-01
Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites to identify mutations for individual patients. Although Sanger sequencing is the gold standard for mutation detection, screening methods supplemented with targeted sequencing can provide a cost-effective alternative. One such method, denaturing high-performance liquid chromatography, was developed for clinical mutation detection in SLC26A4. However, this method inherently cannot distinguish homozygous changes from wild-type sequences. High-resolution melting (HRM), on the other hand, can detect heterozygous and homozygous changes cost-effectively, without any post-PCR modifications. We developed a closed-tube HRM mutation detection method specific for SLC26A4 that can be used in the clinical diagnostic setting. Twenty-eight primer pairs were designed to cover all 21 SLC26A4 exons and splice junction sequences. Using the resulting amplicons, initial HRM analysis detected all 45 variants previously identified by sequencing. Subsequently, a 384-well plate format was designed for up to three patient samples per run. Blinded HRM testing on these plates of patient samples collected over 1 year in a clinical diagnostic laboratory accurately detected all variants identified by sequencing. In conclusion, HRM with targeted sequencing is a reliable, simple, and cost-effective method for SLC26A4 mutation screening and detection. PMID:21704276
Kusko, Rebecca L; Brothers, John F; Tedrow, John; Pandit, Kusum; Huleihel, Luai; Perdomo, Catalina; Liu, Gang; Juan-Guardela, Brenda; Kass, Daniel; Zhang, Sherry; Lenburg, Marc; Martinez, Fernando; Quackenbush, John; Sciurba, Frank; Limper, Andrew; Geraci, Mark; Yang, Ivana; Schwartz, David A; Beane, Jennifer; Spira, Avrum; Kaminski, Naftali
2016-10-15
Despite shared environmental exposures, idiopathic pulmonary fibrosis (IPF) and chronic obstructive pulmonary disease are usually studied in isolation, and the presence of shared molecular mechanisms is unknown. We applied an integrative genomic approach to identify convergent transcriptomic pathways in emphysema and IPF. We defined the transcriptional repertoire of chronic obstructive pulmonary disease, IPF, or normal histology lungs using RNA-seq (n = 87). Genes increased in both emphysema and IPF relative to control were enriched for the p53/hypoxia pathway, a finding confirmed in an independent cohort using both gene expression arrays and the nCounter Analysis System (n = 193). Immunohistochemistry confirmed overexpression of HIF1A, MDM2, and NFKBIB members of this pathway in tissues from patients with emphysema or IPF. Using reads aligned across splice junctions, we determined that alternative splicing of p53/hypoxia pathway-associated molecules NUMB and PDGFA occurred more frequently in IPF or emphysema compared with control and validated these findings by quantitative polymerase chain reaction and the nCounter Analysis System on an independent sample set (n = 193). Finally, by integrating parallel microRNA and mRNA-Seq data on the same samples, we identified MIR96 as a key novel regulatory hub in the p53/hypoxia gene-expression network and confirmed that modulation of MIR96 in vitro recapitulates the disease-associated gene-expression network. Our results suggest convergent transcriptional regulatory hubs in diseases as varied phenotypically as chronic obstructive pulmonary disease and IPF and suggest that these hubs may represent shared key responses of the lung to environmental stresses.
Recurrent chimeric RNAs enriched in human prostate cancer identified by deep sequencing
Kannan, Kalpana; Wang, Liguo; Wang, Jianghua; Ittmann, Michael M.; Li, Wei; Yen, Laising
2011-01-01
Transcription-induced chimeric RNAs, possessing sequences from different genes, are expected to increase the proteomic diversity through chimeric proteins or altered regulation. Despite their importance, few studies have focused on chimeric RNAs especially regarding their presence/roles in human cancers. By deep sequencing the transcriptome of 20 human prostate cancer and 10 matched benign prostate tissues, we obtained 1.3 billion sequence reads, which led to the identification of 2,369 chimeric RNA candidates. Chimeric RNAs occurred in significantly higher frequency in cancer than in matched benign samples. Experimental investigation of a selected 46 set led to the confirmation of 32 chimeric RNAs, of which 27 were highly recurrent and previously undescribed in prostate cancer. Importantly, a subset of these chimeras was present in prostate cancer cell lines, but not detectable in primary human prostate epithelium cells, implying their associations with cancer. These chimeras contain discernable 5′ and 3′ splice sites at the RNA junction, indicating that their formation is mediated by splicing. Their presence is also largely independent of the expression of parental genes, suggesting that other factors are involved in their production and regulation. One chimera, TMEM79-SMG5, is highly differentially expressed in human cancer samples and therefore a potential biomarker. The prevalence of chimeric RNAs may allow the limited number of human genes to encode a substantially larger number of RNAs and proteins, forming an additional layer of cellular complexity. Together, our results suggest that chimeric RNAs are widespread, and increased chimeric RNA events could represent a unique class of molecular alteration in cancer. PMID:21571633
Measurement of Resistance and Strength of Conductor Splices in the Mice Coupling Magnets
NASA Astrophysics Data System (ADS)
Xu, F. Y.; Pan, H.; Wu, H.; Lui, X. K.; Li, E.; Green, M. A.; Dietderich, D.; Higley, H. C.; Tam, D. G.; Trillaud, F.; Wang, Li
2010-04-01
The superconducting magnets for the Muon Ionization Cooling Experiment [1] (MICE) use a copper based Nb-Ti conductor with un-insulated dimensions of 0.95 by 1.60 mm. There may be as many as twelve splices in one MICE superconducting coupling coil. These splices are to be wound in the coil. The conductor splices produce Joule heating, which may cause the magnet to quench. A technique of making conductor splices was developed by ICST. Two types of 1-meter long of soldered lap-joints have been tested. Side-by-side splices and up-down one splices were studied theoretically and experimentally using two types of soft solder made of eutectic tin-lead solder and tin-silver solder. The resistances of the splices made by ICST were tested at LBNL at liquid helium temperatures over a range of magnetic fields up to 5 T. The breaking strength of 250 mm long splices was also measured at room temperature and liquid nitrogen temperature.
MYCN controls an alternative RNA splicing program in high-risk metastatic neuroblastoma
Zhang, Shile; Wei, Jun S.; Li, Samuel Q.; Badgett, Tom C.; Song, Young K.; Agarwal, Saurabh; Coarfa, Cristian; Tolman, Catherine; Hurd, Laura; Liao, Hongling; He, Jianbin; Wen, Xinyu; Liu, Zhihui; Thiele, Carol J.; Westermann, Frank; Asgharzadeh, Shahab; Seeger, Robert C.; Maris, John M.; Auvil, Jamie M Guidry; Smith, Malcolm A; Kolaczyk, Eric D; Shohet, Jason; Khan, Javed
2016-01-01
The molecular mechanisms underlying the aggressive behavior of MYCN driven neuroblastoma (NBL) is under intense investigation; however, little is known about the impact of this family of transcription factors on the splicing program. Here we used high-throughput RNA sequencing to systematically study the expression of RNA isoforms in stage 4 MYCN-amplified NBL, an aggressive subtype of metastatic NBL. We show that MYCN-amplified NBL tumors display a distinct gene splicing pattern affecting multiple cancer hallmark functions. Six splicing factors displayed unique differential expression patterns in MYCN-amplified tumors and cell lines, and the binding motifs for some of these splicing factors are significantly enriched in differentially-spliced genes. Direct binding of MYCN to promoter regions of the splicing factors PTBP1 and HNRNPA1 detected by ChIP-seq demonstrates MYCN controls the splicing pattern by direct regulation of the expression of these key splicing factors. Furthermore, high expression of PTBP1 and HNRNPA1 was significantly associated with poor overall survival of stage4 NBL patients (p≤0.05). Knocking down PTBP1, HNRNPA1 and their downstream target PKM2, an isoform of pro-tumor-growth, result in repressed growth of NBL cells. Therefore, our study reveals a novel role of MYCN in controlling global splicing program through regulation of splicing factors in addition to its well-known role in the transcription program. These findings suggest a therapeutically potential to target the key splicing factors or gene isoforms in high-risk NBL with MYCN-amplification. PMID:26683771
Bowler, Elizabeth; Porazinski, Sean; Uzor, Simon; Thibault, Philippe; Durand, Mathieu; Lapointe, Elvy; Rouschop, Kasper M A; Hancock, John; Wilson, Ian; Ladomery, Michael
2018-04-02
Mounting evidence suggests that one of the ways that cells adapt to hypoxia is through alternative splicing. The aim of this study was firstly to examine the effect of hypoxia on the alternative splicing of cancer associated genes using the prostate cancer cell line PC3 as a model. Secondly, the effect of hypoxia on the expression of several regulators of splicing was examined. PC3 cells were grown in 1% oxygen in a hypoxic chamber for 48 h, RNA extracted and sent for high throughput PCR analysis at the RNomics platform at the University of Sherbrooke, Canada. Genes whose exon inclusion rate PSI (ψ) changed significantly were identified, and their altered exon inclusion rates verified by RT-PCR in three cell lines. The expression of splice factors and splice factor kinases in response to hypoxia was examined by qPCR and western blotting. The splice factor kinase CLK1 was inhibited with the benzothiazole TG003. In PC3 cells the exon inclusion rate PSI (ψ) was seen to change by > 25% in 12 cancer-associated genes; MBP, APAF1, PUF60, SYNE2, CDC42BPA, FGFR10P, BTN2A2, UTRN, RAP1GDS1, PTPN13, TTC23 and CASP9 (caspase 9). The expression of the splice factors SRSF1, SRSF2, SRSF3, SAM68, HuR, hnRNPA1, and of the splice factor kinases SRPK1 and CLK1 increased significantly in hypoxia. We also observed that the splice factor kinase CLK3, but not CLK2 and CLK4, was also induced in hypoxic DU145 prostate, HT29 colon and MCF7 breast cancer cell lines. Lastly, we show that the inhibition of CLK1 in PC3 cells with the benzothiazole TG003 increased expression of the anti-apoptotic isoform caspase 9b. Significant changes in alternative splicing of cancer associated genes occur in prostate cancer cells in hypoxic conditions. The expression of several splice factors and splice factor kinases increases during hypoxia, in particular the Cdc-like splice factor kinases CLK1 and CLK3. We suggest that in hypoxia the elevated expression of these regulators of splicing helps cells adapt through alternative splicing of key cancer-associated genes. We suggest that the CLK splice factor kinases could be targeted in cancers in which hypoxia contributes to resistance to therapy.
Boric acid reversibly inhibits the second step of pre-mRNA splicing.
Shomron, Noam; Ast, Gil
2003-09-25
Several approaches have been used to identify the factors involved in mRNA splicing. None of them, however, comprises a straightforward reversible method for inhibiting the second step of splicing using an external reagent other than a chelator. This investigation demonstrates that the addition of boric acid to an in vitro pre-mRNA splicing reaction causes a dose-dependent reversible inhibition effect on the second step of splicing. The mechanism of action does not involve chelation of several metal ions; hindrance of 3' splice-site; or binding to hSlu7. This study presents a novel method for specific reversible inhibition of the second step of pre-mRNA splicing.
Wang, Yiping; Bartelt, Hartmut; Brueckner, Sven; Kobelke, Jens; Rothhardt, Manfred; Mörl, Klaus; Ecke, Wolfgang; Willsch, Reinhardt
2008-05-12
A novel technique for splicing a small core Ge-doped photonic crystal fiber (PCF) was demonstrated using a commercial fusion splicer with default discharge parameters for the splicing of two standard single mode fibers (SMFs). Additional discharge parameter adjustments are not required to splice the PCF to several different SMFs. A low splice loss of 1.0 approximately 1.4 dB is achieved. Low or no light reflection is expected at the splice joint due to the complete fusion of the two fiber ends. The splice joint has a high bending strength and does not break when the bending radius is decreased to 4 mm.
NASA Astrophysics Data System (ADS)
Jin, Wa; Bi, Weihong; Fu, Guangwei
2014-09-01
Single mode fibers (SMFs) need more fusion energy than PCFs during a splicing process, and it is necessary to make some offsets of the center of heat source toward to the SMFs. Based on the study of characteristics of heat transfer of PCFs and SMFs during splicing process with CO2 laser as the heat source, this paper reports the first systematic analysis of the optimal splicing offset of splicing SMFs and PCFs in theory and experiments. The results show that fusion splicing offsets can be applied to control the air-hole collapse and realize the practical splicing process between PCFs and SMFs with low loss.
Identification of pathogenic gene mutations in LMNA and MYBPC3 that alter RNA splicing.
Ito, Kaoru; Patel, Parth N; Gorham, Joshua M; McDonough, Barbara; DePalma, Steven R; Adler, Emily E; Lam, Lien; MacRae, Calum A; Mohiuddin, Syed M; Fatkin, Diane; Seidman, Christine E; Seidman, J G
2017-07-18
Genetic variants that cause haploinsufficiency account for many autosomal dominant (AD) disorders. Gene-based diagnosis classifies variants that alter canonical splice signals as pathogenic, but due to imperfect understanding of RNA splice signals other variants that may create or eliminate splice sites are often clinically classified as variants of unknown significance (VUS). To improve recognition of pathogenic splice-altering variants in AD disorders, we used computational tools to prioritize VUS and developed a cell-based minigene splicing assay to confirm aberrant splicing. Using this two-step procedure we evaluated all rare variants in two AD cardiomyopathy genes, lamin A/C ( LMNA ) and myosin binding protein C ( MYBPC3 ). We demonstrate that 13 LMNA and 35 MYBPC3 variants identified in cardiomyopathy patients alter RNA splicing, representing a 50% increase in the numbers of established damaging splice variants in these genes. Over half of these variants are annotated as VUS by clinical diagnostic laboratories. Familial analyses of one variant, a synonymous LMNA VUS, demonstrated segregation with cardiomyopathy affection status and altered cardiac LMNA splicing. Application of this strategy should improve diagnostic accuracy and variant classification in other haploinsufficient AD disorders.
RNA Splicing: Regulation and Dysregulation in the Heart.
van den Hoogenhof, Maarten M G; Pinto, Yigal M; Creemers, Esther E
2016-02-05
RNA splicing represents a post-transcriptional mechanism to generate multiple functional RNAs or proteins from a single transcript. The evolution of RNA splicing is a prime example of the Darwinian function follows form concept. A mutation that leads to a new mRNA (form) that encodes for a new functional protein (function) is likely to be retained, and this way, the genome has gradually evolved to encode for genes with multiple isoforms, thereby creating an enormously diverse transcriptome. Advances in technologies to characterize RNA populations have led to a better understanding of RNA processing in health and disease. In the heart, alternative splicing is increasingly being recognized as an important layer of post-transcriptional gene regulation. Moreover, the recent identification of several cardiac splice factors, such as RNA-binding motif protein 20 and SF3B1, not only provided important insight into the mechanisms underlying alternative splicing but also revealed how these splicing factors impact functional properties of the heart. Here, we review our current knowledge of alternative splicing in the heart, with a particular focus on the major and minor spliceosome, the factors controlling RNA splicing, and the role of alternative splicing in cardiac development and disease. © 2016 American Heart Association, Inc.
SpliceRover: Interpretable Convolutional Neural: Networks for Improved Splice Site Prediction.
Zuallaert, Jasper; Godin, Fréderic; Kim, Mijung; Soete, Arne; Saeys, Yvan; De Neve, Wesley
2018-06-21
During the last decade, improvements in high-throughput sequencing have generated a wealth of genomic data. Functionally interpreting these sequences and finding the biological signals that are hallmarks of gene function and regulation is currently mostly done using automated genome annotation platforms, which mainly rely on integrated machine learning frameworks to identify different functional sites of interest, including splice sites. Splicing is an essential step in the gene regulation process, and the correct identification of splice sites is a major cornerstone in a genome annotation system. In this paper, we present SpliceRover, a predictive deep learning approach that outperforms the state-of-the-art in splice site prediction. SpliceRover uses convolutional neural networks (CNNs), which have been shown to obtain cutting edge performance on a wide variety of prediction tasks. We adapted this approach to deal with genomic sequence inputs, and show it consistently outperforms already existing approaches, with relative improvements in prediction effectiveness of up to 80.9% when measured in terms of false discovery rate. However, a major criticism of CNNs concerns their "black box" nature, as mechanisms to obtain insight into their reasoning processes are limited. To facilitate interpretability of the SpliceRover models, we introduce an approach to visualize the biologically relevant information learnt. We show that our visualization approach is able to recover features known to be important for splice site prediction (binding motifs around the splice site, presence of polypyrimidine tracts and branch points), as well as reveal new features (e.g., several types of exclusion patterns near splice sites). SpliceRover is available as a web service. The prediction tool and instructions can be found at http://bioit2.irc.ugent.be/splicerover/. Supplementary materials are available at Bioinformatics online.
U2AF1 mutations alter splice site recognition in hematological malignancies.
Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K
2015-01-01
Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.
Juan, Wen Chun; Roca, Xavier; Ong, S. Tiong
2014-01-01
Aberrant changes in the expression of the pro-apoptotic protein, BCL-2-like 11 (BIM), can result in either impaired or excessive apoptosis, which can contribute to tumorigenesis and degenerative disorders, respectively. Altering BIM pre-mRNA splicing is an attractive approach to modulate apoptosis because BIM activity is partly determined by the alternative splicing of exons 3 or 4, whereby exon 3-containing transcripts are not apoptotic. Here we identified several cis-acting elements and splicing factors involved in BIM alternative splicing, as a step to better understand the regulation of BIM expression. We analyzed a recently discovered 2,903-bp deletion polymorphism within BIM intron 2 that biased splicing towards exon 3, and which also impaired BIM-dependent apoptosis. We found that this region harbors multiple redundant cis-acting elements that repress exon 3 inclusion. Furthermore, we have isolated a 23-nt intronic splicing silencer at the 3′ end of the deletion that is important for excluding exon 3. We also show that PTBP1 and hnRNP C repress exon 3 inclusion, and that downregulation of PTBP1 inhibited BIM-mediated apoptosis. Collectively, these findings start building our understanding of the cis-acting elements and splicing factors that regulate BIM alternative splicing, and also suggest potential approaches to alter BIM splicing for therapeutic purposes. PMID:24743263
Juan, Wen Chun; Roca, Xavier; Ong, S Tiong
2014-01-01
Aberrant changes in the expression of the pro-apoptotic protein, BCL-2-like 11 (BIM), can result in either impaired or excessive apoptosis, which can contribute to tumorigenesis and degenerative disorders, respectively. Altering BIM pre-mRNA splicing is an attractive approach to modulate apoptosis because BIM activity is partly determined by the alternative splicing of exons 3 or 4, whereby exon 3-containing transcripts are not apoptotic. Here we identified several cis-acting elements and splicing factors involved in BIM alternative splicing, as a step to better understand the regulation of BIM expression. We analyzed a recently discovered 2,903-bp deletion polymorphism within BIM intron 2 that biased splicing towards exon 3, and which also impaired BIM-dependent apoptosis. We found that this region harbors multiple redundant cis-acting elements that repress exon 3 inclusion. Furthermore, we have isolated a 23-nt intronic splicing silencer at the 3' end of the deletion that is important for excluding exon 3. We also show that PTBP1 and hnRNP C repress exon 3 inclusion, and that downregulation of PTBP1 inhibited BIM-mediated apoptosis. Collectively, these findings start building our understanding of the cis-acting elements and splicing factors that regulate BIM alternative splicing, and also suggest potential approaches to alter BIM splicing for therapeutic purposes.
Functional domains of the human splicing factor ASF/SF2.
Zuo, P; Manley, J L
1993-01-01
The human splicing factor ASF/SF2 displays two predominant activities in in vitro splicing assays: (i) it is an essential factor apparently required for all splices and (ii) it is able to switch utilization of alternative 5' splice sites in a concentration-dependent manner. ASF/SF2 is the prototype of a family of proteins typified by the presence of one or two RNP-type RNA binding domains (RBDs) and a region highly enriched in repeating arginine-serine dipeptides (RS regions). Here we describe a functional analysis of ASF/SF2, which defines several regions essential for one, or both, of its two principal activities, and provides insights into how this type of protein functions in splicing. Two isoforms of the protein, which arise from alternative splicing, are by themselves inactive, but each can block the activity of ASF/SF2, thereby functioning as splicing repressors. Some, but not all, mutations in the RS region prevent ASF/SF2 from functioning as an essential splicing factor. However, the entire RS region can be deleted without reducing splice site switching activity, indicating that it is not absolutely required for interaction with other splicing factors. Experiments with deletion and substitution mutants reveal that the protein contains two related, but highly diverged, RBDs, and that both are essential for activity. Each RBD by itself retains the ability to bind RNA, although optimal binding requires both domains. Images PMID:8223481
The RNA Splicing Response to DNA Damage.
Shkreta, Lulzim; Chabot, Benoit
2015-10-29
The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging.
The RNA Splicing Response to DNA Damage
Shkreta, Lulzim; Chabot, Benoit
2015-01-01
The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging. PMID:26529031
Muscle-Specific Mis-Splicing and Heart Disease Exemplified by RBM20.
Rexiati, Maimaiti; Sun, Mingming; Guo, Wei
2018-01-05
Alternative splicing is an essential post-transcriptional process to generate multiple functional RNAs or proteins from a single transcript. Progress in RNA biology has led to a better understanding of muscle-specific RNA splicing in heart disease. The recent discovery of the muscle-specific splicing factor RNA-binding motif 20 (RBM20) not only provided great insights into the general alternative splicing mechanism but also demonstrated molecular mechanism of how this splicing factor is associated with dilated cardiomyopathy. Here, we review our current knowledge of muscle-specific splicing factors and heart disease, with an emphasis on RBM20 and its targets, RBM20-dependent alternative splicing mechanism, RBM20 disease origin in induced Pluripotent Stem Cells (iPSCs), and RBM20 mutations in dilated cardiomyopathy. In the end, we will discuss the multifunctional role of RBM20 and manipulation of RBM20 as a potential therapeutic target for heart disease.
Ajiro, Masahiko; Tang, Shuang; Doorbar, John; Zheng, Zhi-Ming
2016-10-15
Human papillomavirus 18 (HPV18) is the second most common oncogenic HPV type associated with cervical, anogenital, and oropharyngeal cancers. Like other oncogenic HPVs, HPV18 encodes two major (one early and one late) polycistronic pre-mRNAs that are regulated by alternative RNA splicing to produce a repertoire of viral transcripts for the expression of individual viral genes. However, RNA cis-regulatory elements and trans-acting factors contributing to HPV18 alternative RNA splicing remain unknown. In this study, an exonic splicing enhancer (ESE) in the nucleotide (nt) 3520 to 3550 region in the HPV18 genome was identified and characterized for promotion of HPV18 929^3434 splicing and E1^E4 production through interaction with SRSF3, a host oncogenic splicing factor differentially expressed in epithelial cells and keratinocytes. Introduction of point mutations in the SRSF3-binding site or knockdown of SRSF3 expression in cells reduces 929^3434 splicing and E1^E4 production but activates other, minor 929^3465 and 929^3506 splicing. Knockdown of SRSF3 expression also enhances the expression of E2 and L1 mRNAs. An exonic splicing silencer (ESS) in the HPV18 nt 612 to 639 region was identified as being inhibitory to the 233^416 splicing of HPV18 E6E7 pre-mRNAs via binding to hnRNP A1, a well-characterized, abundantly and ubiquitously expressed RNA-binding protein. Introduction of point mutations into the hnRNP A1-binding site or knockdown of hnRNP A1 expression promoted 233^416 splicing and reduced E6 expression. These data provide the first evidence that the alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host trans-acting splicing factors. Expression of HPV18 genes is regulated by alternative RNA splicing of viral polycistronic pre-mRNAs to produce a repertoire of viral early and late transcripts. RNA cis elements and trans-acting factors contributing to HPV18 alternative RNA splicing have been discovered in this study for the first time. The identified ESS at the E7 open reading frame (ORF) prevents HPV18 233^416 splicing in the E6 ORF through interaction with a host splicing factor, hnRNP A1, and regulates E6 and E7 expression of the early E6E7 polycistronic pre-mRNA. The identified ESE at the E1^E4 ORF promotes HPV18 929^3434 splicing of both viral early and late pre-mRNAs and E1^E4 production through interaction with SRSF3. This study provides important observations on how alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host splicing factors and offers potential therapeutic targets to overcome HPV-related cancer. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Ajiro, Masahiko; Tang, Shuang; Doorbar, John
2016-01-01
ABSTRACT Human papillomavirus 18 (HPV18) is the second most common oncogenic HPV type associated with cervical, anogenital, and oropharyngeal cancers. Like other oncogenic HPVs, HPV18 encodes two major (one early and one late) polycistronic pre-mRNAs that are regulated by alternative RNA splicing to produce a repertoire of viral transcripts for the expression of individual viral genes. However, RNA cis-regulatory elements and trans-acting factors contributing to HPV18 alternative RNA splicing remain unknown. In this study, an exonic splicing enhancer (ESE) in the nucleotide (nt) 3520 to 3550 region in the HPV18 genome was identified and characterized for promotion of HPV18 929^3434 splicing and E1^E4 production through interaction with SRSF3, a host oncogenic splicing factor differentially expressed in epithelial cells and keratinocytes. Introduction of point mutations in the SRSF3-binding site or knockdown of SRSF3 expression in cells reduces 929^3434 splicing and E1^E4 production but activates other, minor 929^3465 and 929^3506 splicing. Knockdown of SRSF3 expression also enhances the expression of E2 and L1 mRNAs. An exonic splicing silencer (ESS) in the HPV18 nt 612 to 639 region was identified as being inhibitory to the 233^416 splicing of HPV18 E6E7 pre-mRNAs via binding to hnRNP A1, a well-characterized, abundantly and ubiquitously expressed RNA-binding protein. Introduction of point mutations into the hnRNP A1-binding site or knockdown of hnRNP A1 expression promoted 233^416 splicing and reduced E6 expression. These data provide the first evidence that the alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host trans-acting splicing factors. IMPORTANCE Expression of HPV18 genes is regulated by alternative RNA splicing of viral polycistronic pre-mRNAs to produce a repertoire of viral early and late transcripts. RNA cis elements and trans-acting factors contributing to HPV18 alternative RNA splicing have been discovered in this study for the first time. The identified ESS at the E7 open reading frame (ORF) prevents HPV18 233^416 splicing in the E6 ORF through interaction with a host splicing factor, hnRNP A1, and regulates E6 and E7 expression of the early E6E7 polycistronic pre-mRNA. The identified ESE at the E1^E4 ORF promotes HPV18 929^3434 splicing of both viral early and late pre-mRNAs and E1^E4 production through interaction with SRSF3. This study provides important observations on how alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host splicing factors and offers potential therapeutic targets to overcome HPV-related cancer. PMID:27489271
SMITten by the Speed of Splicing.
Johnson, Tracy L; Ares, Manuel
2016-04-07
Splicing occurs co-transcriptionally, but relative rates of splicing and transcription that might reveal mechanisms of their coordinated control have remained mysterious. Now, Carrillo Oesterreich et al. show that the fastest introns are gone nearly as soon as the 3' splice site is transcribed and that introns have distinct splicing kinetics with respect to polymerase progression along the gene. Copyright © 2016 Elsevier Inc. All rights reserved.
Ryan, Michael C; Zeeberg, Barry R; Caplen, Natasha J; Cleland, James A; Kahn, Ari B; Liu, Hongfang; Weinstein, John N
2008-01-01
Background Over 60% of protein-coding genes in vertebrates express mRNAs that undergo alternative splicing. The resulting collection of transcript isoforms poses significant challenges for contemporary biological assays. For example, RT-PCR validation of gene expression microarray results may be unsuccessful if the two technologies target different splice variants. Effective use of sequence-based technologies requires knowledge of the specific splice variant(s) that are targeted. In addition, the critical roles of alternative splice forms in biological function and in disease suggest that assay results may be more informative if analyzed in the context of the targeted splice variant. Results A number of contemporary technologies are used for analyzing transcripts or proteins. To enable investigation of the impact of splice variation on the interpretation of data derived from those technologies, we have developed SpliceCenter. SpliceCenter is a suite of user-friendly, web-based applications that includes programs for analysis of RT-PCR primer/probe sets, effectors of RNAi, microarrays, and protein-targeting technologies. Both interactive and high-throughput implementations of the tools are provided. The interactive versions of SpliceCenter tools provide visualizations of a gene's alternative transcripts and probe target positions, enabling the user to identify which splice variants are or are not targeted. The high-throughput batch versions accept user query files and provide results in tabular form. When, for example, we used SpliceCenter's batch siRNA-Check to process the Cancer Genome Anatomy Project's large-scale shRNA library, we found that only 59% of the 50,766 shRNAs in the library target all known splice variants of the target gene, 32% target some but not all, and 9% do not target any currently annotated transcript. Conclusion SpliceCenter provides unique, user-friendly applications for assessing the impact of transcript variation on the design and interpretation of RT-PCR, RNAi, gene expression microarrays, antibody-based detection, and mass spectrometry proteomics. The tools are intended for use by bench biologists as well as bioinformaticists. PMID:18638396
MYCN controls an alternative RNA splicing program in high-risk metastatic neuroblastoma.
Zhang, Shile; Wei, Jun S; Li, Samuel Q; Badgett, Tom C; Song, Young K; Agarwal, Saurabh; Coarfa, Cristian; Tolman, Catherine; Hurd, Laura; Liao, Hongling; He, Jianbin; Wen, Xinyu; Liu, Zhihui; Thiele, Carol J; Westermann, Frank; Asgharzadeh, Shahab; Seeger, Robert C; Maris, John M; Guidry Auvil, Jamie M; Smith, Malcolm A; Kolaczyk, Eric D; Shohet, Jason; Khan, Javed
2016-02-28
The molecular mechanisms underlying the aggressive behavior of MYCN driven neuroblastoma (NBL) is under intense investigation; however, little is known about the impact of this family of transcription factors on the splicing program. Here we used high-throughput RNA sequencing to systematically study the expression of RNA isoforms in stage 4 MYCN-amplified NBL, an aggressive subtype of metastatic NBL. We show that MYCN-amplified NBL tumors display a distinct gene splicing pattern affecting multiple cancer hallmark functions. Six splicing factors displayed unique differential expression patterns in MYCN-amplified tumors and cell lines, and the binding motifs for some of these splicing factors are significantly enriched in differentially-spliced genes. Direct binding of MYCN to promoter regions of the splicing factors PTBP1 and HNRNPA1 detected by ChIP-seq demonstrates that MYCN controls the splicing pattern by direct regulation of the expression of these key splicing factors. Furthermore, high expression of PTBP1 and HNRNPA1 was significantly associated with poor overall survival of stage4 NBL patients (p ≤ 0.05). Knocking down PTBP1, HNRNPA1 and their downstream target PKM2, an isoform of pro-tumor-growth, result in repressed growth of NBL cells. Therefore, our study reveals a novel role of MYCN in controlling global splicing program through regulation of splicing factors in addition to its well-known role in the transcription program. These findings suggest a therapeutically potential to target the key splicing factors or gene isoforms in high-risk NBL with MYCN-amplification. Published by Elsevier Ireland Ltd.
Subgroup Specific Alternative Splicing in Medulloblastoma
Kloosterhof, Nanne K; Northcott, Paul A; Yu, Emily PY; Shih, David; Peacock, John; Grajkowska, Wieslawa; van Meter, Timothy; Eberhart, Charles G; Pfister, Stefan; Marra, Marco A; Weiss, William A; Scherer, Stephen W; Rutka, James T; French, Pim J; Taylor, Michael D
2014-01-01
Medulloblastoma is comprised of four distinct molecular variants: WNT, SHH, Group 3, and Group 4. We analyzed alternative splicing usage in 14 normal cerebellar samples and 103 medulloblastomas of known subgroup. Medulloblastoma samples have a statistically significant increase in alternative splicing as compared to normal fetal cerebella (2.3-times; P<6.47E-8). Splicing patterns are distinct and specific between molecular subgroups. Unsupervised hierarchical clustering of alternative splicing events accurately assigns medulloblastomas to their correct subgroup. Subgroup-specific splicing and alternative promoter usage was most prevalent in Group 3 (19.4%) and SHH (16.2%) medulloblastomas, while observed less frequently in WNT (3.2%), and Group 4 (9.3%) tumors. Functional annotation of alternatively spliced genes reveals over-representation of genes important for neuronal development. Alternative splicing events in medulloblastoma may be regulated in part by the correlative expression of antisense transcripts, suggesting a possible mechanism affecting subgroup specific alternative splicing. Our results identify additional candidate markers for medulloblastoma subgroup affiliation, further support the existence of distinct subgroups of the disease, and demonstrate an additional level of transcriptional heterogeneity between medulloblastoma subgroups. PMID:22358458
Alternative splicing of inner-ear-expressed genes.
Wang, Yanfei; Liu, Yueyue; Nie, Hongyun; Ma, Xin; Xu, Zhigang
2016-09-01
Alternative splicing plays a fundamental role in the development and physiological function of the inner ear. Inner-ear-specific gene splicing is necessary to establish the identity and maintain the function of the inner ear. For example, exon 68 of Cadherin 23 (Cdh23) gene is subject to inner-ear-specific alternative splicing, and as a result, Cdh23(+ 68) is only expressed in inner ear hair cells. Alternative splicing along the tonotopic axis of the cochlea contributes to frequency tuning, particularly in lower vertebrates, such as chickens and turtles. Differential splicing of Kcnma1, which encodes for the α subunit of the Ca(2+)-activated K(+) channel (BK channel), has been suggested to affect the channel gating properties and is important for frequency tuning. Consequently, deficits in alternative splicing have been shown to cause hearing loss, as we can observe in Bronx Waltzer (bv) mice and Sfswap mutant mice. Despite the advances in this field, the regulation of alternative splicing in the inner ear remains elusive. Further investigation is also needed to clarify the mechanism of hearing loss caused by alternative splicing deficits.
Tran, Trung T; Bollineni, Ravi C; Strozynski, Margarita; Koehler, Christian J; Thiede, Bernd
2017-07-07
Alternative splicing is a mechanism in eukaryotes by which different forms of mRNAs are generated from the same gene. Identification of alternative splice variants requires the identification of peptides specific for alternative splice forms. For this purpose, we generated a human database that contains only unique tryptic peptides specific for alternative splice forms from Swiss-Prot entries. Using this database allows an easy access to splice variant-specific peptide sequences that match to MS data. Furthermore, we combined this database without alternative splice variant-1-specific peptides with human Swiss-Prot. This combined database can be used as a general database for searching of LC-MS data. LC-MS data derived from in-solution digests of two different cell lines (LNCaP, HeLa) and phosphoproteomics studies were analyzed using these two databases. Several nonalternative splice variant-1-specific peptides were found in both cell lines, and some of them seemed to be cell-line-specific. Control and apoptotic phosphoproteomes from Jurkat T cells revealed several nonalternative splice variant-1-specific peptides, and some of them showed clear quantitative differences between the two states.
Baty, Florent; Klingbiel, Dirk; Zappa, Francesco; Brutsche, Martin
2015-12-01
Alternative splicing is an important component of tumorigenesis. Recent advent of exon array technology enables the detection of alternative splicing at a genome-wide scale. The analysis of high-throughput alternative splicing is not yet standard and methodological developments are still needed. We propose a novel statistical approach-Dually Constrained Correspondence Analysis-for the detection of splicing changes in exon array data. Using this methodology, we investigated the genome-wide alteration of alternative splicing in patients with non-small cell lung cancer treated by bevacizumab/erlotinib. Splicing candidates reveal a series of genes related to carcinogenesis (SFTPB), cell adhesion (STAB2, PCDH15, HABP2), tumor aggressiveness (ARNTL2), apoptosis, proliferation and differentiation (PDE4D, FLT3, IL1R2), cell invasion (ETV1), as well as tumor growth (OLFM4, FGF14), tumor necrosis (AFF3) or tumor suppression (TUSC3, CSMD1, RHOBTB2, SERPINB5), with indication of known alternative splicing in a majority of genes. DCCA facilitates the identification of putative biologically relevant alternative splicing events in high-throughput exon array data. Copyright © 2015 Elsevier Inc. All rights reserved.
Connecting the dots: chromatin and alternative splicing in EMT.
Warns, Jessica A; Davie, James R; Dhasarathy, Archana
2016-02-01
Nature has devised sophisticated cellular machinery to process mRNA transcripts produced by RNA Polymerase II, removing intronic regions and connecting exons together, to produce mature RNAs. This process, known as splicing, is very closely linked to transcription. Alternative splicing, or the ability to produce different combinations of exons that are spliced together from the same genomic template, is a fundamental means of regulating protein complexity. Similar to transcription, both constitutive and alternative splicing can be regulated by chromatin and its associated factors in response to various signal transduction pathways activated by external stimuli. This regulation can vary between different cell types, and interference with these pathways can lead to changes in splicing, often resulting in aberrant cellular states and disease. The epithelial to mesenchymal transition (EMT), which leads to cancer metastasis, is influenced by alternative splicing events of chromatin remodelers and epigenetic factors such as DNA methylation and non-coding RNAs. In this review, we will discuss the role of epigenetic factors including chromatin, chromatin remodelers, DNA methyltransferases, and microRNAs in the context of alternative splicing, and discuss their potential involvement in alternative splicing during the EMT process.
Meyer, Katja; Koester, Tino; Staiger, Dorothee
2015-01-01
Alternative pre-messenger RNA splicing in higher plants emerges as an important layer of regulation upon exposure to exogenous and endogenous cues. Accordingly, mutants defective in RNA-binding proteins predicted to function in the splicing process show severe phenotypic alterations. Among those are developmental defects, impaired responses to pathogen threat or abiotic stress factors, and misregulation of the circadian timing system. A suite of splicing factors has been identified in the model plant Arabidopsis thaliana. Here we summarize recent insights on how defects in these splicing factors impair plant performance. PMID:26213982
Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii.
Lin, Huawen; Zhang, Zhengyan; Iomini, Carlo; Dutcher, Susan K
2018-03-01
Intraflagellar transport moves proteins in and out of flagella/cilia and it is essential for the assembly of these organelles. Using whole-genome sequencing, we identified splice site mutations in two IFT genes, IFT81 ( fla9 ) and IFT121 ( ift121-2 ), which lead to flagellar assembly defects in the unicellular green alga Chlamydomonas reinhardtii The splicing defects in these ift mutants are partially corrected by mutations in two conserved spliceosome proteins, DGR14 and FRA10. We identified a dgr14 deletion mutant, which suppresses the 3' splice site mutation in IFT81 , and a frameshift mutant of FRA10 , which suppresses the 5' splice site mutation in IFT121 Surprisingly, we found dgr14-1 and fra10 mutations suppress both splice site mutations. We suggest these two proteins are involved in facilitating splice site recognition/interaction; in their absence some splice site mutations are tolerated. Nonsense mutations in SMG1 , which is involved in nonsense-mediated decay, lead to accumulation of aberrant transcripts and partial restoration of flagellar assembly in the ift mutants. The high density of introns and the conservation of noncore splicing factors, together with the ease of scoring the ift mutant phenotype, make Chlamydomonas an attractive organism to identify new proteins involved in splicing through suppressor screening. © 2018 The Authors.
Therapeutic targeting of RNA splicing in myelodysplasia.
Kim, Young Joon; Abdel-Wahab, Omar
2017-07-01
Genomic analysis of patients with myelodysplastic syndromes (MDS) has identified that mutations within genes encoding RNA splicing factors represent the most common class of genetic alterations in MDS. These mutations primarily affect SF3B1, SRSF2, U2AF1, and ZRSR2. Current data suggest that these mutations perturb RNA splicing catalysis in a manner distinct from loss of function but how exactly the global changes in RNA splicing imparted by these mutations result in MDS is not well delineated. At the same time, cells bearing mutations in RNA splicing factors are exquisitely dependent on the presence of the remaining wild-type (WT) allele to maintain residual normal splicing for cell survival. The high frequency of these mutations in MDS, combined with their mutual exclusivity and noteworthy dependence on the WT allele, make targeting RNA splicing attractive in MDS. To this end, two promising therapeutic approaches targeting RNA splicing are being tested clinically currently. These include molecules targeting core RNA splicing catalysis by interfering with the ability of the SF3b complex to interact with RNA, as well as molecules degrading the auxiliary RNA splicing factor RBM39. The preclinical and clinical evaluation of these compounds are discussed here in addition to their potential as therapies for spliceosomal mutant MDS. Copyright © 2017 Elsevier Inc. All rights reserved.
Mis-Spliced Lr34 Transcript Events in Winter Wheat.
Fang, Tilin; Carver, Brett F; Hunger, Robert M; Yan, Liuling
2017-01-01
Lr34 in wheat is a non-race-specific gene that confers resistance against multiple fungal pathogens. The resistant allele Lr34 and the susceptible allele Lr34s can be distinguished by three polymorphisms that cause alternation of deduced amino acid sequences of Lr34 at the protein level. In seedlings of a cultivar carrying the resistant Lr34r allele, only a portion (35%) of its transcripts was correctly spliced and the majority (65%) of its transcripts were incorrectly spliced due to multiple mis-splicing events. Lr34 mis-splicing events were also observed at adult plant age when this gene exerts its function. All of the mis-spliced Lr34r cDNA transcripts observed in this study resulted in a premature stop codon due to a shift of the open reading frame; hence, the mis-spliced Lr34r cDNAs were deduced to encode incomplete proteins. Even if a cultivar has a functional Lr34 gene, its transcripts might not completely splice in a correct pattern. These findings suggested that the partial resistance conferred by a quantitative gene might be due to mis-splicing events in its transcripts; hence, the resistance of the gene could be increased by eliminating or mutating regulators that cause mis-splicing events in wheat.
Dong, Qiongye; Wei, Lei; Zhang, Michael Q; Wang, Xiaowo
2018-06-24
Dysregulation of mRNA splicing has been observed in certain cellular senescence process. However, the common splicing alterations on the whole transcriptome shared by various types of senescence are poorly understood. In order to systematically identify senescence-associated transcriptomic changes in genome-wide scale, we collected RNA sequencing datasets of different human cell types with a variety of senescence-inducing methods from public databases and performed meta-analysis. First, we discovered that a group of RNA binding proteins were consistently down-regulated in diverse senescent samples and identified 406 senescence-associated common differential splicing events. Then, eight differentially expressed RNA binding proteins were predicted to regulate these senescence-associated splicing alterations through an enrichment analysis of their RNA binding information, including motif scanning and enhanced cross-linking immunoprecipitation data. In addition, we constructed the splicing regulatory modules that might contribute to senescence-associated biological processes. Finally, it was confirmed that knockdown of the predicted senescence-associated potential splicing regulators through shRNAs in HepG2 cell line could result in senescence-like splicing changes. Taken together, our work demonstrated a broad range of common changes in mRNA splicing switches and detected their central regulatory RNA binding proteins during senescence. These findings would help to better understand the coordinating splicing alterations in cellular senescence.
Sangermano, Riccardo; Khan, Mubeen; Cornelis, Stéphanie S; Richelle, Valerie; Albert, Silvia; Garanto, Alejandro; Elmelik, Duaa; Qamar, Raheel; Lugtenberg, Dorien; van den Born, L Ingeborgh; Collin, Rob W J; Cremers, Frans P M
2018-01-01
Stargardt disease is caused by variants in the ABCA4 gene, a significant part of which are noncanonical splice site (NCSS) variants. In case a gene of interest is not expressed in available somatic cells, small genomic fragments carrying potential disease-associated variants are tested for splice abnormalities using in vitro splice assays. We recently discovered that when using small minigenes lacking the proper genomic context, in vitro results do not correlate with splice defects observed in patient cells. We therefore devised a novel strategy in which a bacterial artificial chromosome was employed to generate midigenes, splice vectors of varying lengths (up to 11.7 kb) covering almost the entire ABCA4 gene. These midigenes were used to analyze the effect of all 44 reported and three novel NCSS variants on ABCA4 pre-mRNA splicing. Intriguingly, multi-exon skipping events were observed, as well as exon elongation and intron retention. The analysis of all reported NCSS variants in ABCA4 allowed us to reveal the nature of aberrant splicing events and to classify the severity of these mutations based on the residual fraction of wild-type mRNA. Our strategy to generate large overlapping splice vectors carrying multiple exons, creating a toolbox for robust and high-throughput analysis of splice variants, can be applied to all human genes. © 2018 Sangermano et al.; Published by Cold Spring Harbor Laboratory Press.
Fu, X Y; Colgan, J D; Manley, J L
1988-01-01
We have determined the effects of a number of mutations in the small-t antigen mRNA intron on the alternative splicing pattern of the simian virus 40 early transcript. Expansion of the distance separating the small-t pre-mRNA lariat branch point and the shared large T-small t 3' splice site from 18 to 29 nucleotides (nt) resulted in a relative enhancement of small-t splicing in vivo. This finding, coupled with the observation that large-T pre-RNA splicing in vitro was not affected by this expansion, suggests that small-t splicing is specifically constrained by a short branch point-3' splice site distance. Similarly, the distance separating the 5' splice site and branch point (48 nt) was found to be at or near a minimum for small-t splicing, because deletions in this region as small as 2 nt dramatically reduced the ratio of small-t to large-T mRNA that accumulated in transfected cells. Finally, a specific sequence within the small-t intron, encompassing the upstream branch sites used in large-T splicing, was found to be an important element in the cell-specific pattern of early alternative splicing. Substitutions within this region reduced the ratio of small-t to large-T mRNA produced in HeLa cells but had only minor effects in human 293 cells. Images PMID:2851720
The emerging role of alternative splicing in senescence and aging.
Deschênes, Mathieu; Chabot, Benoit
2017-10-01
Deregulation of precursor mRNA splicing is associated with many illnesses and has been linked to age-related chronic diseases. Here we review recent progress documenting how defects in the machinery that performs intron removal and controls splice site selection contribute to cellular senescence and organismal aging. We discuss the functional association linking p53, IGF-1, SIRT1, and ING-1 splice variants with senescence and aging, and review a selection of splicing defects occurring in accelerated aging (progeria), vascular aging, and Alzheimer's disease. Overall, it is becoming increasingly clear that changes in the activity of splicing factors and in the production of key splice variants can impact cellular senescence and the aging phenotype. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Leong, Ivone U.S.; Dryland, Philippa A.; Prosser, Debra O.; Lai, Stella W.-S.; Graham, Mandy; Stiles, Martin; Crawford, Jackie; Skinner, Jonathan R.; Love, Donald R.
2017-01-01
Background Approximately 75% of clinically definite long QT syndrome (LQTS) cases are caused by mutations in the KCNQ1, KCNH2 and SCN5A genes. Of these mutations, a small proportion (3.2-9.2%) are predicted to affect splicing. These mutations present a particular challenge in ascribing pathogenicity. Methods Here we report an analysis of the transcriptional consequences of two mutations, one in the KCNQ1 gene (c.781_782delinsTC) and one in the SCN5A gene (c.2437-5C>A), which are predicted to affect splicing. We isolated RNA from lymphocytes and used a directed PCR amplification strategy of cDNA to show mis-spliced transcripts in mutation-positive patients. Results The loss of an exon in each mis-spliced transcript had no deduced effect on the translational reading frame. The clinical phenotype corresponded closely with genotypic status in family members carrying the KCNQ1 splice variant, but not in family members with the SCN5A splice variant. These results are put in the context of a literature review, where only 20% of all splice variants reported in the KCNQ1, KCNH2 and SCN5A gene entries in the HGMDPro 2015.4 database have been evaluated using transcriptional assays. Conclusions Prediction programmes play a strong role in most diagnostic laboratories in classifying variants located at splice sites; however, transcriptional analysis should be considered critical to confirm mis-splicing. Critically, this study shows that genuine mis- splicing may not always imply clinical significance, and genotype/phenotype cosegregation remains important even when mis-splicing is confirmed. PMID:28725320
van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T
2015-01-01
A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049
Koike, Chihiro; Friday, Robert P.; Nakashima, Izumi; Luppi, Patrizia; Fung, John J.; Rao, Abdul S.; Starzl, Thomas E.; Trucco, Massimo
2010-01-01
Background α1,3-galactosyltransferase (α1,3GT) is an enzyme that produces carbohydrate chains termed αGal epitopes found in most mammals, although some species of higher primates, including human, are notable exceptions. The evolutionary origin of the lost α1,3GT enzyme activity is not yet known, although it has been suggested that the promoter activity of this gene in the ancestors of higher primates was inactivated. Methods We used 5′-or 3′-RACE, GenomeWalking, reverse transcriptase polymerase chain reaction (RT-PCR) and dual Luciferase reporter assay for identification of the full-length cDNA, which includes the transcription initiation site and the promoter region of porcine α1,3GT gene. Results The region around exon 1 is guanine and cytosine (GC)-rich (about 70%), comprising a CpG island spanning more than 1.5 kbp. The 5′-flanking region of exon 1 contains multiple transcription factor consensus motifs, including GC-box, SP1, AP2, and GATA-box sites, in the absence of TATA or CAAT-box sequences. The entire gene consists of three 5′ noncoding and six coding region exons spanning more than 52 kbp. Detailed analysis of α1,3GT transcripts revealed two major alternative splicing patterns in the 5′-untranslated region (5′-UTR) and evidence for minor splicing activity that occurs in a tissue-specific manner. Interspecies comparison of 5′-UTR shows minimal homology between porcine and murine sequences except for exon 2, which suggests that the regulatory regions differ among species. Conclusions These observations have important implications for experiments involving genetic manipulation of the α1,3GT gene in transgenic animals in terms of promoter utilization, and particularly in genetically engineering cells for the animal cloning technology by nuclear transfer. PMID:11087141
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Guo-Shun; Grabowski, G.A.
1992-10-01
Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-01-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA. PMID:8943327
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-12-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.
Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A
2002-02-01
The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.
Abascal, Federico; Ezkurdia, Iakes; Rodriguez-Rivas, Juan; Rodriguez, Jose Manuel; del Pozo, Angela; Vázquez, Jesús; Valencia, Alfonso; Tress, Michael L.
2015-01-01
Alternative splicing of messenger RNA can generate a wide variety of mature RNA transcripts, and these transcripts may produce protein isoforms with diverse cellular functions. While there is much supporting evidence for the expression of alternative transcripts, the same is not true for the alternatively spliced protein products. Large-scale mass spectroscopy experiments have identified evidence of alternative splicing at the protein level, but with conflicting results. Here we carried out a rigorous analysis of the peptide evidence from eight large-scale proteomics experiments to assess the scale of alternative splicing that is detectable by high-resolution mass spectroscopy. We find fewer splice events than would be expected: we identified peptides for almost 64% of human protein coding genes, but detected just 282 splice events. This data suggests that most genes have a single dominant isoform at the protein level. Many of the alternative isoforms that we could identify were only subtly different from the main splice isoform. Very few of the splice events identified at the protein level disrupted functional domains, in stark contrast to the two thirds of splice events annotated in the human genome that would lead to the loss or damage of functional domains. The most striking result was that more than 20% of the splice isoforms we identified were generated by substituting one homologous exon for another. This is significantly more than would be expected from the frequency of these events in the genome. These homologous exon substitution events were remarkably conserved—all the homologous exons we identified evolved over 460 million years ago—and eight of the fourteen tissue-specific splice isoforms we identified were generated from homologous exons. The combination of proteomics evidence, ancient origin and tissue-specific splicing indicates that isoforms generated from homologous exons may have important cellular roles. PMID:26061177
Pombert, Jean-François; Otis, Christian; Turmel, Monique; Lemieux, Claude
2013-01-01
Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI), we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V). This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl) at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI). Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF) occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the possible implications of this interesting observation for trans-splicing of group I introns. PMID:24386369
RNA splicing regulated by RBFOX1 is essential for cardiac function in zebrafish.
Frese, Karen S; Meder, Benjamin; Keller, Andreas; Just, Steffen; Haas, Jan; Vogel, Britta; Fischer, Simon; Backes, Christina; Matzas, Mark; Köhler, Doreen; Benes, Vladimir; Katus, Hugo A; Rottbauer, Wolfgang
2015-08-15
Alternative splicing is one of the major mechanisms through which the proteomic and functional diversity of eukaryotes is achieved. However, the complex nature of the splicing machinery, its associated splicing regulators and the functional implications of alternatively spliced transcripts are only poorly understood. Here, we investigated the functional role of the splicing regulator rbfox1 in vivo using the zebrafish as a model system. We found that loss of rbfox1 led to progressive cardiac contractile dysfunction and heart failure. By using deep-transcriptome sequencing and quantitative real-time PCR, we show that depletion of rbfox1 in zebrafish results in an altered isoform expression of several crucial target genes, such as actn3a and hug. This study underlines that tightly regulated splicing is necessary for unconstrained cardiac function and renders the splicing regulator rbfox1 an interesting target for investigation in human heart failure and cardiomyopathy. © 2015. Published by The Company of Biologists Ltd.
NASA Astrophysics Data System (ADS)
Choudhury, Rajarshi; Roy, Sreerupa Ghose; Tsai, Yihsuan S.; Tripathy, Ashutosh; Graves, Lee M.; Wang, Zefeng
2014-01-01
Alternative splicing of pre-messenger RNA (mRNA) is a critical stage of gene regulation in response to environmental stimuli. Here we show that DAZAP1, an RNA-binding protein involved in mammalian development and spermatogenesis, promotes inclusion of weak exons through specific recognition of diverse cis-elements. The carboxy-terminal proline-rich domain of DAZAP1 interacts with and neutralizes general splicing inhibitors, and is sufficient to activate splicing when recruited to pre-mRNA. This domain is phosphorylated by the MEK/Erk (extracellular signal-regulated protein kinase) pathway and this modification is essential for the splicing regulatory activity and the nuclear/cytoplasmic translocation of DAZAP1. Using mRNA-seq, we identify endogenous splicing events regulated by DAZAP1, many of which are involved in maintaining cell growth. Knockdown or over-expression of DAZAP1 causes a cell proliferation defect. Taken together, these studies reveal a molecular mechanism that integrates splicing control into MEK/Erk-regulated cell proliferation.
An alternative splicing program promotes adipose tissue thermogenesis
Vernia, Santiago; Edwards, Yvonne JK; Han, Myoung Sook; Cavanagh-Kyros, Julie; Barrett, Tamera; Kim, Jason K; Davis, Roger J
2016-01-01
Alternative pre-mRNA splicing expands the complexity of the transcriptome and controls isoform-specific gene expression. Whether alternative splicing contributes to metabolic regulation is largely unknown. Here we investigated the contribution of alternative splicing to the development of diet-induced obesity. We found that obesity-induced changes in adipocyte gene expression include alternative pre-mRNA splicing. Bioinformatics analysis associated part of this alternative splicing program with sequence specific NOVA splicing factors. This conclusion was confirmed by studies of mice with NOVA deficiency in adipocytes. Phenotypic analysis of the NOVA-deficient mice demonstrated increased adipose tissue thermogenesis and improved glycemia. We show that NOVA proteins mediate a splicing program that suppresses adipose tissue thermogenesis. Together, these data provide quantitative analysis of gene expression at exon-level resolution in obesity and identify a novel mechanism that contributes to the regulation of adipose tissue function and the maintenance of normal glycemia. DOI: http://dx.doi.org/10.7554/eLife.17672.001 PMID:27635635
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alvarez, Enrique, E-mail: ealvarez@cbm.uam.es; Castello, Alfredo; Carrasco, Luis
Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of proteasemore » fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.« less
Aberrant and alternative splicing in skeletal system disease.
Fan, Xin; Tang, Liling
2013-10-01
The main function of skeletal system is to support the body and help movement. A variety of factors can lead to skeletal system disease, including age, exercise, and of course genetic makeup and expression. Pre-mRNA splicing plays a crucial role in gene expression, by creating multiple protein variants with different biological functions. The recent studies show that several skeletal system diseases are related to pre-mRNA splicing. This review focuses on the relationship between pre-mRNA splicing and skeletal system disease. On the one hand, splice site mutation that leads to aberrant splicing often causes genetic skeletal system disease, like COL1A1, SEDL and LRP5. On the other hand, alternative splicing without genomic mutation may generate some marker protein isoforms, for example, FN, VEGF and CD44. Therefore, understanding the relationship between pre-mRNA splicing and skeletal system disease will aid in uncovering the mechanism of disease and contribute to the future development of gene therapy. © 2013 Elsevier B.V. All rights reserved.
Choudhury, Rajarshi; Roy, Sreerupa Ghose; Tsai, Yihsuan S.; Tripathy, Ashutosh; Graves, Lee M.; Wang, Zefeng
2014-01-01
Alternative splicing of pre-mRNA is a critical stage of gene regulation in response to environmental stimuli. Here we show that DAZAP1, an RNA binding protein involved in mammalian development and spermatogenesis, promotes inclusion of weak exons through specific recognition of diverse cis-elements. The C-terminal proline-rich domain of DAZAP1 interacts with and neutralizes general splicing inhibitors, and is sufficient to activate splicing when recruited to pre-mRNA. This domain is phosphorylated by the MEK/Erk pathway and this modification is essential for the splicing regulatory activity and the nuclear/cytoplasmic translocation of DAZAP1. Using mRNA-seq we identify endogenous splicing events regulated by DAZAP1, many of which are involved in maintaining cell growth. Knockdown or over-expression of DAZAP1 causes a cell proliferation defect. Taken together, these studies reveal a molecular mechanism that integrates splicing control into MEK/Erk regulated cell proliferation. PMID:24452013
COMMUNICATION: Alternative splicing and genomic stability
NASA Astrophysics Data System (ADS)
Cahill, Kevin
2004-06-01
Alternative splicing allows an organism to make different proteins in different cells at different times, all from the same gene. In a cell that uses alternative splicing, the total length of all the exons is much shorter than in a cell that encodes the same set of proteins without alternative splicing. This economical use of exons makes genes more stable during reproduction and development because a genome with a shorter exon length is more resistant to harmful mutations. Genomic stability may be the reason why higher vertebrates splice alternatively. For a broad class of alternatively spliced genes, a formula is given for the increase in their stability.
RNA splicing factors as oncoproteins and tumor suppressors
Dvinge, Heidi; Kim, Eunhee; Abdel-Wahab, Omar; Bradley, Robert K.
2016-01-01
Preface The recent genomic characterization of cancers has revealed recurrent somatic point mutations and copy number changes affecting genes encoding RNA splicing factors. Initial studies of these ‘spliceosomal mutations’ suggest that the proteins bearing these mutations exhibit altered splice site and/or exon recognition preferences relative to their wild-type counterparts, resulting in cancer-specific mis-splicing. Such changes in the splicing machinery may create novel vulnerabilities in cancer cells that can be therapeutically exploited using compounds that can influence the splicing process. Further studies to dissect the biochemical, genomic, and biological effects of spliceosomal mutations are critical for the development of cancer therapies targeted to these mutations. PMID:27282250
Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches
Chen, Mo; Manley, James L.
2010-01-01
Alternative splicing of mRNA precursors provides an important means of genetic control and is a crucial step in the expression of most genes. Alternative splicing markedly affects human development, and its misregulation underlies many human diseases. Although the mechanisms of alternative splicing have been studied extensively, until the past few years we had not begun to realize fully the diversity and complexity of alternative splicing regulation by an intricate protein–RNA network. Great progress has been made by studying individual transcripts and through genome-wide approaches, which together provide a better picture of the mechanistic regulation of alternative pre-mRNA splicing. PMID:19773805
Alcoholism and alternative splicing of candidate genes.
Sasabe, Toshikazu; Ishiura, Shoichi
2010-04-01
Gene expression studies have shown that expression patterns of several genes have changed during the development of alcoholism. Gene expression is regulated not only at the level of transcription but also through alternative splicing of pre-mRNA. In this review, we discuss some of the evidence suggesting that alternative splicing of candidate genes such as DRD2 (encoding dopamine D2 receptor) may form the basis of the mechanisms underlying the pathophysiology of alcoholism. These reports suggest that aberrant expression of splice variants affects alcohol sensitivities, and alcohol consumption also regulates alternative splicing. Thus, investigations of alternative splicing are essential for understanding the molecular events underlying the development of alcoholism.
Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A
2013-07-30
Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.
Ebstein, F.; Textoris-Taube, K.; Keller, C.; Golnik, R.; Vigneron, N.; Van den Eynde, B. J.; Schuler-Thurner, B.; Schadendorf, D.; Lorenz, F. K. M.; Uckert, W.; Urban, S.; Lehmann, A.; Albrecht-Koepke, N.; Janek, K.; Henklein, P.; Niewienda, A.; Kloetzel, P. M.; Mishto, M.
2016-01-01
Proteasome-catalyzed peptide splicing represents an additional catalytic activity of proteasomes contributing to the pool of MHC-class I-presented epitopes. We here biochemically and functionally characterized a new melanoma gp100 derived spliced epitope. We demonstrate that the gp100mel47–52/40–42 antigenic peptide is generated in vitro and in cellulo by a not yet described proteasomal condensation reaction. gp100mel47–52/40–42 generation is enhanced in the presence of the β5i/LMP7 proteasome-subunit and elicits a peptide-specific CD8+ T cell response. Importantly, we demonstrate that different gp100mel-derived spliced epitopes are generated and presented to CD8+ T cells with efficacies comparable to non-spliced canonical tumor epitopes and that gp100mel-derived spliced epitopes trigger activation of CD8+ T cells found in peripheral blood of half of the melanoma patients tested. Our data suggest that both transpeptidation and condensation reactions contribute to the frequent generation of spliced epitopes also in vivo and that their immune relevance may be comparable to non-spliced epitopes. PMID:27049119
Suh, E R; Waring, R B
1990-01-01
It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465
Landscape of the spliced leader trans-splicing mechanism in Schistosoma mansoni.
Boroni, Mariana; Sammeth, Michael; Gava, Sandra Grossi; Jorge, Natasha Andressa Nogueira; Macedo, Andréa Mara; Machado, Carlos Renato; Mourão, Marina Moraes; Franco, Glória Regina
2018-03-01
Spliced leader dependent trans-splicing (SLTS) has been described as an important RNA regulatory process that occurs in different organisms, including the trematode Schistosoma mansoni. We identified more than seven thousand putative SLTS sites in the parasite, comprising genes with a wide spectrum of functional classes, which underlines the SLTS as a ubiquitous mechanism in the parasite. Also, SLTS gene expression levels span several orders of magnitude, showing that SLTS frequency is not determined by the expression level of the target gene, but by the presence of particular gene features facilitating or hindering the trans-splicing mechanism. Our in-depth investigation of SLTS events demonstrates widespread alternative trans-splicing (ATS) acceptor sites occurring in different regions along the entire gene body, highlighting another important role of SLTS generating alternative RNA isoforms in the parasite, besides the polycistron resolution. Particularly for introns where SLTS directly competes for the same acceptor substrate with cis-splicing, we identified for the first time additional and important features that might determine the type of splicing. Our study substantially extends the current knowledge of RNA processing by SLTS in S. mansoni, and provide basis for future studies on the trans-splicing mechanism in other eukaryotes.
Connecting the dots: chromatin and alternative splicing in EMT
Warns, Jessica A.; Davie, James R.; Dhasarathy, Archana
2015-01-01
Nature has devised sophisticated cellular machinery to process mRNA transcripts produced by RNA Polymerase II, removing intronic regions and connecting exons together, to produce mature RNAs. This process, known as splicing, is very closely linked to transcription. Alternative splicing, or the ability to produce different combinations of exons that are spliced together from the same genomic template, is a fundamental means of regulating protein complexity. Similar to transcription, both constitutive and alternative splicing can be regulated by chromatin and its associated factors in response to various signal transduction pathways activated by external stimuli. This regulation can vary between different cell types, and interference with these pathways can lead to changes in splicing, often resulting in aberrant cellular states and disease. The epithelial to mesenchymal transition (EMT), which leads to cancer metastasis, is influenced by alternative splicing events of chromatin remodelers and epigenetic factors such as DNA methylation and non-coding RNAs. In this review, we will discuss the role of epigenetic factors including chromatin, chromatin remodelers, DNA methyltransferases and microRNAs in the context of alternative splicing, and discuss their potential involvement in alternative splicing during the EMT process. PMID:26291837
Analysis of splicing in vitro using extracts of Saccharomyces cerevisiae.
Ares, Manuel
2013-10-01
In vitro splicing studies are a powerful means of investigating the requirements and mechanisms of action of the many components of the splicing apparatus. The ability to add and subtract components, purify activities, and reconstitute activity, as well as to expose the apparatus to chemical probes of various types, allows a far more mechanistically detailed view of the process to emerge than is available from genetic or in vivo studies alone. Two kinds of activities are assayed during in vitro splicing. The first concerns the chemical conversion of the substrate pre-mRNA into splicing intermediates and products and is usually visualized using a labeled substrate followed by separation on a denaturing gel. The second concerns the assembly of noncovalent complexes between the substrate and the myriad components of the splicing apparatus. This is also visualized using a labeled substrate, but the separation of complexes is achieved using native gel electrophoresis or gradient sedimentation. In this protocol, we describe the splicing reaction and its preparation for analysis by denaturing gels and native splicing complex gels. We also provide conditions for depletion of ATP, a critical cofactor that is hydrolyzed during numerous key steps in spliceosome assembly and splicing progression.
Melangath, Geetha; Sen, Titash; Kumar, Rakesh; Bawa, Pushpinder; Srinivasan, Subha; Vijayraghavan, Usha
2017-01-01
Budding yeast spliceosomal factors ScSlu7 and ScPrp18 interact and mediate intron 3'ss choice during second step pre-mRNA splicing. The fission yeast genome with abundant multi-intronic transcripts, degenerate splice signals and SR proteins is an apt unicellular fungal model to deduce roles for core spliceosomal factors in alternative splice-site choice, intron retention and to study the cellular implications of regulated splicing. From our custom microarray data we deduce a stringent reproducible subset of S. pombe alternative events. We examined the role of factors SpSlu7 or SpPrp18 for these splice events and investigated the relationship to growth phase and stress. Wild-type log and stationary phase cells showed ats1+ exon 3 skipped and intron 3 retained transcripts. Interestingly the non-consensus 5'ss in ats1+ intron 3 caused SpSlu7 and SpPrp18 dependent intron retention. We validated the use of an alternative 5'ss in dtd1+ intron 1 and of an upstream alternative 3'ss in DUF3074 intron 1. The dtd1+ intron 1 non-canonical 5'ss yielded an alternative mRNA whose levels increased in stationary phase. Utilization of dtd1+ intron 1 sub-optimal 5' ss required functional SpPrp18 and SpSlu7 while compromise in SpSlu7 function alone hampered the selection of the DUF3074 intron 1 non canonical 3'ss. We analysed the relative abundance of these splice isoforms during mild thermal, oxidative and heavy metal stress and found stress-specific splice patterns for ats1+ and DUF3074 intron 1 some of which were SpSlu7 and SpPrp18 dependent. By studying ats1+ splice isoforms during compromised transcription elongation rates in wild-type, spslu7-2 and spprp18-5 mutant cells we found dynamic and intron context-specific effects in splice-site choice. Our work thus shows the combinatorial effects of splice site strength, core splicing factor functions and transcription elongation kinetics to dictate alternative splice patterns which in turn serve as an additional recourse of gene regulation in fission yeast.
Kumar, Rakesh; Bawa, Pushpinder; Srinivasan, Subha
2017-01-01
Budding yeast spliceosomal factors ScSlu7 and ScPrp18 interact and mediate intron 3’ss choice during second step pre-mRNA splicing. The fission yeast genome with abundant multi-intronic transcripts, degenerate splice signals and SR proteins is an apt unicellular fungal model to deduce roles for core spliceosomal factors in alternative splice-site choice, intron retention and to study the cellular implications of regulated splicing. From our custom microarray data we deduce a stringent reproducible subset of S. pombe alternative events. We examined the role of factors SpSlu7 or SpPrp18 for these splice events and investigated the relationship to growth phase and stress. Wild-type log and stationary phase cells showed ats1+ exon 3 skipped and intron 3 retained transcripts. Interestingly the non-consensus 5’ss in ats1+ intron 3 caused SpSlu7 and SpPrp18 dependent intron retention. We validated the use of an alternative 5’ss in dtd1+ intron 1 and of an upstream alternative 3’ss in DUF3074 intron 1. The dtd1+ intron 1 non-canonical 5’ss yielded an alternative mRNA whose levels increased in stationary phase. Utilization of dtd1+ intron 1 sub-optimal 5’ ss required functional SpPrp18 and SpSlu7 while compromise in SpSlu7 function alone hampered the selection of the DUF3074 intron 1 non canonical 3’ss. We analysed the relative abundance of these splice isoforms during mild thermal, oxidative and heavy metal stress and found stress-specific splice patterns for ats1+ and DUF3074 intron 1 some of which were SpSlu7 and SpPrp18 dependent. By studying ats1+ splice isoforms during compromised transcription elongation rates in wild-type, spslu7-2 and spprp18-5 mutant cells we found dynamic and intron context-specific effects in splice-site choice. Our work thus shows the combinatorial effects of splice site strength, core splicing factor functions and transcription elongation kinetics to dictate alternative splice patterns which in turn serve as an additional recourse of gene regulation in fission yeast. PMID:29236736
Walthour, C. S.; Schaeffer, S. W.
1994-01-01
The transformer locus (tra) produces an RNA processing protein that alternatively splices the doublesex pre-mRNA in the sex determination hierarchy of Drosophila melanogaster. Comparisons of the tra coding region among Drosophila species have revealed an unusually high degree of divergence in synonymous and nonsynonymous sites. In this study, we tested the hypothesis that the tra gene will be polymorphic in synonymous and nonsynonymous sites within species by investigating nucleotide sequence variation in eleven tra alleles within D. melanogaster. Of the 1063 nucleotides examined, two synonymous sites were polymorphic and no amino acid variation was detected. Three statistical tests were used to detect departures from an equilibrium neutral model. Two tests failed to reject a neutral model of molecular evolution because of low statisitical power associated with low levels of genetic variation (Tajima/Fu and Li). The Hudson, Kreitman, and Aguade test rejected a neutral model when the tra region was compared to the 5'-flanking region of alcohol dehydrogenase (Adh). The lack of variability in the tra gene is consistent with a recent selective sweep of a beneficial allele in or near the tra locus. PMID:8013913
Exaptation of Bornavirus-Like Nucleoprotein Elements in Afrotherians
Kobayashi, Yuki; Horie, Masayuki; Nakano, Ayumi; Murata, Koichi; Itou, Takuya; Suzuki, Yoshiyuki
2016-01-01
Endogenous bornavirus-like nucleoprotein elements (EBLNs), the nucleotide sequence elements derived from the nucleoprotein gene of ancient bornavirus-like viruses, have been identified in many animal genomes. Here we show evidence that EBLNs encode functional proteins in their host. Some afrotherian EBLNs were observed to have been maintained for more than 83.3 million years under negative selection. Splice variants were expressed from the genomic loci of EBLNs in elephant, and some were translated into proteins. The EBLN proteins appeared to be localized to the rough endoplasmic reticulum in African elephant cells, in contrast to the nuclear localization of bornavirus N. These observations suggest that afrotherian EBLNs have acquired a novel function in their host. Interestingly, genomic sequences of the first exon and its flanking regions in these EBLN loci were homologous to those of transmembrane protein 106B (TMEM106B). The upstream region of the first exon in the EBLN loci exhibited a promoter activity, suggesting that the ability of these EBLNs to be transcribed in the host cell was gained through capturing a partial duplicate of TMEM106B. In conclusion, our results strongly support for exaptation of EBLNs to encode host proteins in afrotherians. PMID:27518265
Yi, Jia; Shen, Hai-Feng; Qiu, Jin-Song; Huang, Ming-Feng; Zhang, Wen-Juan; Ding, Jian-Cheng; Zhu, Xiao-Yan; Zhou, Yu
2017-01-01
Abstract JMJD6, a jumonji C (Jmj C) domain-containing protein demethylase and hydroxylase, has been implicated in an array of biological processes. It has been shown that JMJD6 interacts with and hydroxylates multiple serine/arginine-rich (SR) proteins and SR related proteins, including U2AF65, all of which are known to function in alternative splicing regulation. However, whether JMJD6 is widely involved in alternative splicing and the molecular mechanism underlying JMJD6-regulated alternative splicing have remained incompletely understood. Here, by using RASL-Seq, we investigated the functional impact of RNA-dependent interaction between JMJD6 and U2AF65, revealing that JMJD6 and U2AF65 co-regulated a large number of alternative splicing events. We further demonstrated the JMJD6 function in alternative splicing in jmjd6 knockout mice. Mechanistically, we showed that the enzymatic activity of JMJD6 was required for a subset of JMJD6-regulated splicing, and JMJD6-mediated lysine hydroxylation of U2AF65 could account for, at least partially, their co-regulated alternative splicing events, suggesting both JMJD6 enzymatic activity-dependent and independent control of alternative splicing. These findings reveal an intimate link between JMJD6 and U2AF65 in alternative splicing regulation, which has important implications in development and disease processes. PMID:27899633
Homologous SV40 RNA trans-splicing
Eul, Joachim; Patzel, Volker
2013-01-01
Simian Virus 40 (SV40) is a polyomavirus found in both monkeys and humans, which causes cancer in some animal models. In humans, SV40 has been reported to be associated with cancers but causality has not been proven yet. The transforming activity of SV40 is mainly due to its 94-kD large T antigen, which binds to the retinoblastoma (pRb) and p53 tumor suppressor proteins, and thereby perturbs their functions. Here we describe a 100 kD super T antigen harboring a duplication of the pRB binding domain that was associated with unusual high cell transformation activity and that was generated by a novel mechanism involving homologous RNA trans-splicing of SV40 early transcripts in transformed rodent cells. Enhanced trans-splice activity was observed in clones carrying a single point mutation in the large T antigen 5′ donor splice site (ss). This mutation impaired cis-splicing in favor of an alternative trans-splice reaction via a cryptic 5′ss within a second cis-spliced SV40 pre-mRNA molecule and enabled detectable gene expression. Next to the cryptic 5′ss we identified additional trans-splice helper functions, including putative dimerization domains and a splice enhancer sequence. Our findings suggest RNA trans-splicing as a SV40-intrinsic mechanism that supports the diversification of viral RNA and phenotypes. PMID:24178438
Drosha Promotes Splicing of a Pre-microRNA-like Alternative Exon
Havens, Mallory A.; Reich, Ashley A.; Hastings, Michelle L.
2014-01-01
The ribonuclease III enzyme Drosha has a central role in the biogenesis of microRNA (miRNA) by binding and cleaving hairpin structures in primary RNA transcripts into precursor miRNAs (pre-miRNAs). Many miRNA genes are located within protein-coding host genes and cleaved by Drosha in a manner that is coincident with splicing of introns by the spliceosome. The close proximity of splicing and pre-miRNA biogenesis suggests a potential for co-regulation of miRNA and host gene expression, though this relationship is not completely understood. Here, we describe a cleavage-independent role for Drosha in the splicing of an exon that has a predicted hairpin structure resembling a Drosha substrate. We find that Drosha can cleave the alternatively spliced exon 5 of the eIF4H gene into a pre-miRNA both in vitro and in cells. However, the primary role of Drosha in eIF4H gene expression is to promote the splicing of exon 5. Drosha binds to the exon and enhances splicing in a manner that depends on RNA structure but not on cleavage by Drosha. We conclude that Drosha can function like a splicing enhancer and promote exon inclusion. Our results reveal a new mechanism of alternative splicing regulation involving a cleavage-independent role for Drosha in splicing. PMID:24786770
Pellagatti, Andrea; Boultwood, Jacqueline
2017-01-01
Splicing factor gene mutations are the most frequent mutations found in patients with the myeloid malignancy myelodysplastic syndrome (MDS), suggesting that spliceosomal dysfunction plays a major role in disease pathogenesis. The aberrantly spliced target genes and deregulated cellular pathways associated with the commonly mutated splicing factor genes in MDS (SF3B1, SRSF2 and U2AF1) are being identified, illuminating the molecular mechanisms underlying MDS. Emerging data from mouse modeling studies indicate that the presence of splicing factor gene mutations can lead to bone marrow hematopoietic stem/myeloid progenitor cell expansion, impaired hematopoiesis and dysplastic differentiation that are hallmarks of MDS. Importantly, recent evidence suggests that spliceosome inhibitors and splicing modulators may have therapeutic value in the treatment of splicing factor mutant myeloid malignancies. Copyright © 2016 Elsevier Ltd. All rights reserved.
Context-dependent control of alternative splicing by RNA-binding proteins
Fu, Xiang-Dong; Ares, Manuel
2015-01-01
Sequence-specific RNA-binding proteins (RBPs) bind to pre-mRNA to control alternative splicing, but it is not yet possible to read the ‘splicing code’ that dictates splicing regulation on the basis of genome sequence. Each alternative splicing event is controlled by multiple RBPs, the combined action of which creates a distribution of alternatively spliced products in a given cell type. As each cell type expresses a distinct array of RBPs, the interpretation of regulatory information on a given RNA target is exceedingly dependent on the cell type. RBPs also control each other’s functions at many levels, including by mutual modulation of their binding activities on specific regulatory RNA elements. In this Review, we describe some of the emerging rules that govern the highly context-dependent and combinatorial nature of alternative splicing regulation. PMID:25112293
Sensing and splicing applications of small core Ge-doped photonic crystal fibers
NASA Astrophysics Data System (ADS)
Wang, Yiping; Brueckner, Sven; Kobelke, Jens; Rothhardt, Manfred; Ecke, Wolfgang; Willsch, Reinhardt; Bartelt, Hartmut
2008-04-01
Sensor related properties of a small core (4.1μm) Ge-doped photonic crystal fiber (PCF) are being reported. Fiber Bragg gratings with 35% and almost 100 % reflectivity were written in the Ge-doped PCF before and after hydrogen loading, respectively, by use of a UV laser. A 5.6pm/°C temperature sensitivity of the FBG was observed. Additionally, a novel method is demonstrated to splice such PCF by use of a commercial fusion splicer with default splice parameters for standard single mode fibers (SMF). No parameter adjustments are required to splice the PCF to various SMFs and a low splice loss of 1.0 ~ 1.4dB can be achieved. No splice interface emerges at the splice joint, which is of advantage for the sensing applications of such a PCF.
NASA Astrophysics Data System (ADS)
Hsu, Justin Bo-Kai; Huang, Kai-Yao; Weng, Tzu-Ya; Huang, Chien-Hsun; Lee, Tzong-Yi
2014-01-01
Machinery of pre-mRNA splicing is carried out through the interaction of RNA sequence elements and a variety of RNA splicing-related proteins (SRPs) (e.g. spliceosome and splicing factors). Alternative splicing, which is an important post-transcriptional regulation in eukaryotes, gives rise to multiple mature mRNA isoforms, which encodes proteins with functional diversities. However, the regulation of RNA splicing is not yet fully elucidated, partly because SRPs have not yet been exhaustively identified and the experimental identification is labor-intensive. Therefore, we are motivated to design a new method for identifying SRPs with their functional roles in the regulation of RNA splicing. The experimentally verified SRPs were manually curated from research articles. According to the functional annotation of Splicing Related Gene Database, the collected SRPs were further categorized into four functional groups including small nuclear Ribonucleoprotein, Splicing Factor, Splicing Regulation Factor and Novel Spliceosome Protein. The composition of amino acid pairs indicates that there are remarkable differences among four functional groups of SRPs. Then, support vector machines (SVMs) were utilized to learn the predictive models for identifying SRPs as well as their functional roles. The cross-validation evaluation presents that the SVM models trained with significant amino acid pairs and functional domains could provide a better predictive performance. In addition, the independent testing demonstrates that the proposed method could accurately identify SRPs in mammals/plants as well as effectively distinguish between SRPs and RNA-binding proteins. This investigation provides a practical means to identifying potential SRPs and a perspective for exploring the regulation of RNA splicing.
Hsu, Justin Bo-Kai; Huang, Kai-Yao; Weng, Tzu-Ya; Huang, Chien-Hsun; Lee, Tzong-Yi
2014-01-01
Machinery of pre-mRNA splicing is carried out through the interaction of RNA sequence elements and a variety of RNA splicing-related proteins (SRPs) (e.g. spliceosome and splicing factors). Alternative splicing, which is an important post-transcriptional regulation in eukaryotes, gives rise to multiple mature mRNA isoforms, which encodes proteins with functional diversities. However, the regulation of RNA splicing is not yet fully elucidated, partly because SRPs have not yet been exhaustively identified and the experimental identification is labor-intensive. Therefore, we are motivated to design a new method for identifying SRPs with their functional roles in the regulation of RNA splicing. The experimentally verified SRPs were manually curated from research articles. According to the functional annotation of Splicing Related Gene Database, the collected SRPs were further categorized into four functional groups including small nuclear Ribonucleoprotein, Splicing Factor, Splicing Regulation Factor and Novel Spliceosome Protein. The composition of amino acid pairs indicates that there are remarkable differences among four functional groups of SRPs. Then, support vector machines (SVMs) were utilized to learn the predictive models for identifying SRPs as well as their functional roles. The cross-validation evaluation presents that the SVM models trained with significant amino acid pairs and functional domains could provide a better predictive performance. In addition, the independent testing demonstrates that the proposed method could accurately identify SRPs in mammals/plants as well as effectively distinguish between SRPs and RNA-binding proteins. This investigation provides a practical means to identifying potential SRPs and a perspective for exploring the regulation of RNA splicing.
Nakata, Daisuke; Nakao, Shoichi; Nakayama, Kazuhide; Araki, Shinsuke; Nakayama, Yusuke; Aparicio, Samuel; Hara, Takahito; Nakanishi, Atsushi
2017-01-29
Mounting evidence suggests that constitutively active androgen receptor (AR) splice variants, typified by AR-V7, are associated with poor prognosis and resistance to androgen deprivation therapy in prostate cancer patients. However, mechanisms governing the generation of AR splice variants are not fully understood. In this study, we aimed to investigate the dynamics of AR splice variant generation using the JDCaP prostate cancer model that expresses AR splice variants under androgen depletion. Microarray analysis of JDCaP xenografts before and after expression of AR splice variants suggested that dysregulation of RNA processing pathways is likely involved in AR splice variant generation. To explore factors contributing to generation of AR-V7 mRNA, we conducted a focused RNA interference screen in AR-V7-positive JDCaP-hr cells using an shRNA library targeting spliceosome-related genes. This screen identified DDX39B as a regulator of AR-V7 mRNA expression. Simultaneous knockdown of DDX39B and its paralog DDX39A drastically and selectively downregulated AR-V7 mRNA expression in multiple AR-V7-positive prostate cancer cell lines. DDX39B was upregulated in relapsed JDCaP xenografts expressing AR splice variants, suggesting its role in expression of AR splice variants. Taken together, our findings offer insight into the mechanisms of AR splice variant generation and identify DDX39 as a potential drug target for the treatment of AR splice variant-positive prostate cancer. Copyright © 2016 Elsevier Inc. All rights reserved.
Splendore, A; Silva, E O; Alonso, L G; Richieri-Costa, A; Alonso, N; Rosa, A; Carakushanky, G; Cavalcanti, D P; Brunoni, D; Passos-Bueno, M R
2000-10-01
Twenty-eight families with a clinical diagnosis of Treacher Collins syndrome were screened for mutations in the 25 coding exons of TCOF1 and their adjacent splice junctions through SSCP and direct sequencing. Pathogenic mutations were detected in 26 patients, yielding the highest detection rate reported so far for this disease (93%) and bringing the number of known disease-causing mutations from 35 to 51. This is the first report to describe clustering of pathogenic mutations. Thirteen novel polymorphic alterations were characterized, confirming previous reports that TCOF1 has an unusually high rate of single-nucleotide polymorphisms (SNPs) within its coding region. We suggest a possible different mechanism leading to TCS or genetic heterogeneity for this condition, as we identified two families with no apparent pathogenic mutation in the gene. Furthermore, our data confirm the absence of genotype-phenotype correlation and reinforce that the apparent anticipation often observed in TCS families is due to ascertainment bias. Copyright 2000 Wiley-Liss, Inc.
2014-01-01
Background A rare neuro-ichthyotic disorder characterized by ichthyosis, spastic quadriplegia and intellectual disability and caused by recessive mutations in ELOVL4, encoding elongase-4 protein has recently been described. The objective of the study was to search for sequence variants in the gene ELOVL4 in three affected individuals of a consanguineous Pakistani family exhibiting features of neuro-ichthyotic disorder. Methods Linkage in the family was searched by genotyping microsatellite markers linked to the gene ELOVL4, mapped at chromosome 6p14.1. Exons and splice junction sites of the gene ELOVL4 were polymerase chain reaction amplified and sequenced in an automated DNA sequencer. Results DNA sequence analysis revealed a novel homozygous nonsense mutation (c.78C > G; p.Tyr26*). Conclusions Our report further confirms the recently described ELOVL4-related neuro-ichthyosis and shows that the neurological phenotype can be absent in some individuals. PMID:24571530
Development of mRNA-specific RT-PCR for the detection of koi herpesvirus (KHV) replication stage.
Yuasa, Kei; Kurita, Jun; Kawana, Morihiko; Kiryu, Ikunari; Oseko, Norihisa; Sano, Motohiko
2012-08-13
An mRNA-specific reverse transcription (RT)-PCR primer set spanning the exon junction of a spliced putative terminase gene in the koi herpesvirus (KHV) was developed to detect the replicating stage of the virus. The proposed RT-PCR amplified a target gene from the RNA template, but not from a DNA template extracted from common carp brain (CCB) cells infected with KHV. In addition, the RT-PCR did not amplify the target gene of templates extracted from specific cell lines infected with either CyHV-1 or CyHV-2. RT-PCR detected mRNA from the scales of koi experimentally infected with KHV at 24 h post exposure (hpe). However, unlike conventional PCR, RT-PCR could not detect KHV DNA in fish at 0 hpe. The results indicate that the RT-PCR developed in this study is mRNA-specific and that the assay can detect the replicating stage of KHV from both fish and cultured cells infected with the virus.
Novel TGM5 mutations in acral peeling skin syndrome.
van der Velden, Jaap J A J; van Geel, Michel; Nellen, Ruud G L; Jonkman, Marcel F; McGrath, John A; Nanda, Arti; Sprecher, Eli; van Steensel, Maurice A M; McLean, W H Irwin; Cassidy, Andrew J
2015-04-01
Acral peeling skin syndrome (APSS, MIM #609796) is a rare autosomal recessive disorder characterized by superficial exfoliation and blistering of the volar and dorsal aspects of hands and feet. The level of separation is at the junction of the stratum granulosum and stratum corneum. APSS is caused by mutations in the TGM5 gene encoding transglutaminase-5, which is important for structural integrity of the outermost epidermal layers. The majority of patients originate from Europe and carry a p.(Gly113Cys) mutation in TGM5. In this study, we report both European and non-European families carrying other mutations in the TGM5 gene. In 5 patients, we found 3 novel mutations: c.1001+2_1001+3del, c.1171G>A and c.1498C>T. To confirm their pathogenicity, we performed functional analyses with a transglutaminase activity assay, determined alternative splicing by reverse-transcribed PCR analysis and used databases and in silico prediction tools. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Self-Organizing Hidden Markov Model Map (SOHMMM).
Ferles, Christos; Stafylopatis, Andreas
2013-12-01
A hybrid approach combining the Self-Organizing Map (SOM) and the Hidden Markov Model (HMM) is presented. The Self-Organizing Hidden Markov Model Map (SOHMMM) establishes a cross-section between the theoretic foundations and algorithmic realizations of its constituents. The respective architectures and learning methodologies are fused in an attempt to meet the increasing requirements imposed by the properties of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein chain molecules. The fusion and synergy of the SOM unsupervised training and the HMM dynamic programming algorithms bring forth a novel on-line gradient descent unsupervised learning algorithm, which is fully integrated into the SOHMMM. Since the SOHMMM carries out probabilistic sequence analysis with little or no prior knowledge, it can have a variety of applications in clustering, dimensionality reduction and visualization of large-scale sequence spaces, and also, in sequence discrimination, search and classification. Two series of experiments based on artificial sequence data and splice junction gene sequences demonstrate the SOHMMM's characteristics and capabilities. Copyright © 2013 Elsevier Ltd. All rights reserved.
Chapman, Jarrod A; Kirkness, Ewen F; Simakov, Oleg; Hampson, Steven E; Mitros, Therese; Weinmaier, Thomas; Rattei, Thomas; Balasubramanian, Prakash G; Borman, Jon; Busam, Dana; Disbennett, Kathryn; Pfannkoch, Cynthia; Sumin, Nadezhda; Sutton, Granger G; Viswanathan, Lakshmi Devi; Walenz, Brian; Goodstein, David M; Hellsten, Uffe; Kawashima, Takeshi; Prochnik, Simon E; Putnam, Nicholas H; Shu, Shengquiang; Blumberg, Bruce; Dana, Catherine E; Gee, Lydia; Kibler, Dennis F; Law, Lee; Lindgens, Dirk; Martinez, Daniel E; Peng, Jisong; Wigge, Philip A; Bertulat, Bianca; Guder, Corina; Nakamura, Yukio; Ozbek, Suat; Watanabe, Hiroshi; Khalturin, Konstantin; Hemmrich, Georg; Franke, André; Augustin, René; Fraune, Sebastian; Hayakawa, Eisuke; Hayakawa, Shiho; Hirose, Mamiko; Hwang, Jung Shan; Ikeo, Kazuho; Nishimiya-Fujisawa, Chiemi; Ogura, Atshushi; Takahashi, Toshio; Steinmetz, Patrick R H; Zhang, Xiaoming; Aufschnaiter, Roland; Eder, Marie-Kristin; Gorny, Anne-Kathrin; Salvenmoser, Willi; Heimberg, Alysha M; Wheeler, Benjamin M; Peterson, Kevin J; Böttger, Angelika; Tischler, Patrick; Wolf, Alexander; Gojobori, Takashi; Remington, Karin A; Strausberg, Robert L; Venter, J Craig; Technau, Ulrich; Hobmayer, Bert; Bosch, Thomas C G; Holstein, Thomas W; Fujisawa, Toshitaka; Bode, Hans R; David, Charles N; Rokhsar, Daniel S; Steele, Robert E
2010-03-25
The freshwater cnidarian Hydra was first described in 1702 and has been the object of study for 300 years. Experimental studies of Hydra between 1736 and 1744 culminated in the discovery of asexual reproduction of an animal by budding, the first description of regeneration in an animal, and successful transplantation of tissue between animals. Today, Hydra is an important model for studies of axial patterning, stem cell biology and regeneration. Here we report the genome of Hydra magnipapillata and compare it to the genomes of the anthozoan Nematostella vectensis and other animals. The Hydra genome has been shaped by bursts of transposable element expansion, horizontal gene transfer, trans-splicing, and simplification of gene structure and gene content that parallel simplification of the Hydra life cycle. We also report the sequence of the genome of a novel bacterium stably associated with H. magnipapillata. Comparisons of the Hydra genome to the genomes of other animals shed light on the evolution of epithelia, contractile tissues, developmentally regulated transcription factors, the Spemann-Mangold organizer, pluripotency genes and the neuromuscular junction.
Wang, Xiaohong; Zheng, Zhi-Ming
2016-01-01
Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map from each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in the genome structure, organization and gene expression among papillomaviruses. The focused methods are 5’- and 3’- rapid amplification of cDNA ends (RACE), which are the techniques commonly used in molecular biology to obtain the full length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281
Orientation-dependent fiber-optic accelerometer based on grating inscription over fiber cladding.
Rong, Qiangzhou; Qiao, Xueguang; Guo, Tuan; Bao, Weijia; Su, Dan; Yang, Hangzhou
2014-12-01
An orientation-sensitive fiber-optic accelerometer based on grating inscription over fiber cladding has been demonstrated. The sensor probe comprises a compact structure in which a short section of thin-core fiber (TCF) stub containing a "cladding" fiber Bragg grating (FBG) is spliced to another single-mode fiber (SMF) without any lateral offset. A femtosecond laser side-illumination technique was utilized to ensure that the grating inscription remains close to the core-cladding interface of the TCF. The core mode and the cladding mode of the TCF are coupled at the core-mismatch junction, and two well-defined resonances in reflection appear from the downstream FBG, in which the cladding resonance exhibits a strong polarization and bending dependence due to the asymmetrical distribution of the cladding FBG along the fiber cross section. Strong orientation dependence of the vibration (acceleration) measurement has been achieved by power detection of the cladding resonance. Meanwhile, the unwanted power fluctuations and temperature perturbations can be referenced out by monitoring the fundamental core resonance.
Cura, Vincent; Troffer-Charlier, Nathalie; Wurtz, Jean Marie; Bonnefond, Luc; Cavarelli, Jean
2014-09-01
Protein arginine methyltransferase 7 (PRMT7) is a type III arginine methyltransferase which has been implicated in several biological processes such as transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation and metastasis. PRMT7 is a unique but less characterized member of the family of PRMTs. The crystal structure of full-length PRMT7 from Mus musculus refined at 1.7 Å resolution is described. The PRMT7 structure is composed of two catalytic modules in tandem forming a pseudo-dimer and contains only one AdoHcy molecule bound to the N-terminal module. The high-resolution crystal structure presented here revealed several structural features showing that the second active site is frozen in an inactive state by a conserved zinc finger located at the junction between the two PRMT modules and by the collapse of two degenerated AdoMet-binding loops.
Africa's Megafans and Their Tectonic Setting
NASA Technical Reports Server (NTRS)
Wilkinson, M. J.; Burke, K.
2016-01-01
Megafans are a really extensive continental sediment bodies, fluvially derived, and fan-shaped in planform. Only those >80 km long were included in this study. Africa's megafans were mapped for purposes of both comprehensive geomorphic description and as a method of mapping by remote sensing large probable fluvial sediment bodies (we exclude sediment bodies deposited in well defined, modern floodplains and coastal deltas). Our criteria included a length dimension of >80 km and maximum width >40 km, partial cone morphology, and a radial drainage pattern. Visible and especially IR imagery were used to identify the features, combined with topographic SRTM data. We identified 99 megafans most of which are unstudied thus far. Their feeder rivers responsible for depositing megafan sediments rise on, and are consequent drainages oriented down the slopes of the swells that have dominated African landscapes since approximately 34 Ma (the high points in Africa's so-called basin-and-swell topography [1]). Most megafans (66%) have developed along these consequent rivers relatively near the swell cores, oriented radially away from the swells. The vast basins between the swells provide accommodation for megafan sediment wedges. Although clearly visible remotely, most megafans are inactive as a result of incision by the feeder river (which then no longer operates on the fan surface). Two tectonic settings control the location of Africa's megafans, 66% on swell flanks, and 33% related to rifts. (i) Swell flanks Most megafans are apexed relatively near the core of the parent swell, and are often clustered in groups: e.g., six on the west and north flanks of the Hoggar Swell (Algeria), seven on the north and south flanks of the Tibesti Swell (Libya-Chad borderlands), twelve on the west flank of the Ethiopian Swell, four on the east flank of the East African Swell (Kenya), Africa's largest, and eight around Angola's Bié Swell (western Zambia, northern Namibia). A cluster of possible fans lies on the western margin of the Congo Basin (Mayombe Swell), and on the coastal slopes of the Namibia Swell. Sheer size may have militated aginst the recognition of many megafans: the largest in the Sahara are the Teghahart (378 km, Hoggar Swell, Algeria), and the Wadi Albalata (340 km, Uweinat Swell, Egypt). In southern Africa the largest are the Cubango (320 km, Bié Swell, Angola/ Namibia), and the Limpopo (230 km, Mozambique). (ii) Rift zones (a) Steer's horns basins-wide depressions centered on rifts. The largest contiguous group (n=14) developed in a steer's-horns basin occupies the wide Muglad depression (200-350 km, South Sudan). Four rift-related megafans lie SE of Lake Chad (Chad). Nine megafans occupy the complex Anza Rift in Kenya/South Somalia. The Salamat megafan (Chad), is unusual because it oriented parallel with the linked Salamat, Doseo and Doba rift axes, and is consequently one of the longest in Africa (465 km). (b) Rift depressions sensu stricto. Most rifts are too narrow to provide a transverse dimension large enough to accommodate megafans. Although well-known, the Okavango Rift (NW Botswana, NE Namibia) is unique in Africa in hosting three megafans within identifiable faulted margins. The Nile megafan is Africa's largest (476 km) and comprises the vast Sudd wetland (South Sudan). An explanation for its remarkable size may be its location in a depression at the junction of two conducive tectonic zones, the East African Swell margin and the Muglad steer's-horns depression. Discharge of the River Nile, the largest in the region, has allowed the Nile megafan to outcompete neighboring megafans for space.
30 CFR 75.603 - Temporary splice of trailing cable.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Temporary splice of trailing cable. 75.603... SAFETY AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Trailing Cables § 75.603 Temporary splice of trailing cable. [Statutory Provision] One temporary splice may be made in any trailing cable...
30 CFR 75.604 - Permanent splicing of trailing cables.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Permanent splicing of trailing cables. 75.604... SAFETY AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Trailing Cables § 75.604 Permanent splicing of trailing cables. [Statutory Provisions] When permanent splices in trailing cables are made...
30 CFR 77.602 - Permanent splicing of trailing cables.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Permanent splicing of trailing cables. 77.602... COAL MINES Trailing Cables § 77.602 Permanent splicing of trailing cables. When permanent splices in trailing cables are made, they shall be: (a) Mechanically strong with adequate electrical conductivity; (b...
Controls on erosional retreat of the uplifted rift flanks at the Gulf of Suez and northern Red Sea
NASA Technical Reports Server (NTRS)
Steckler, Michael S.; Omar, Gomaa I.
1994-01-01
The Gulf of Suez and the Red Sea rigts are currently bordered by large asymmetric uplifts that are undergoing erosion. We find that the amount and timing of erosion vary systematically along the strike of the margin and have been controlled by variations in the perift stratigraphy. The perfit strata are compsoed of cliff-forming Eocene-Cretaceous carbonates overlaying the easily eroded Cretaceous-Cambrian 'Nubian' sandstone. This lithologic succession promotes scarp retreat of the sedimentary section, follwed by dissection of the underlying basement. The perift section thins from over 2000 m at the northern end of the rift to less htan 400 m at its junction with the Red Sea. Thus, at the northern part of the Gulf of Suez, the Nubian sandstone is minimally exposed, and the carbonates form a scarp at the rift border fault. Farther south, undercuttin of hte carbonates by erosion of the sandstion has resulted in scarp retreat. The escarpment cuts diagonally away from the border fault andis over 100 km inland from the border fault at the southernmost Gulf of Suez. The amount of retreat varies inversely with the sediment thickness. Exposure and erosion of basement are initiated by the retreate of the escarpment, and the depth of erosion, as indicated by fission track ages, increases with distance from the escarpment. These observations are explained by a model in which erosion along the Gulf of Suez is initiated as rift flank uplift becomes sufficiently large ot expose the friable sandstones. Undercutting the escarpment and exhumation of basement has been propagating northward and westward for at least 20 m.y. The average rate of scarp retreat has been 6 km/m.y. and the along-strike propagation of the erosion has been 12 km/m.y. The diachronous erosion of the rift flanks at the Gulf of Suez highlights the importance of distinguishing between the timing of uplift and of erosion. Both thermochronometric and stratigraphic data primarily indicate the timing of erosion, which may differ significantly form the timing of the uplift that initiates it. They must be interpreted carefully to avoid erroneous conclusions about rift tectonics.
Vaughn, J C; Mason, M T; Sper-Whitis, G L; Kuhlman, P; Palmer, J D
1995-11-01
We present phylogenetic evidence that a group I intron in an angiosperm mitochondrial gene arose recently by horizontal transfer from a fungal donor species. A 1,716-bp fragment of the mitochondrial coxI gene from the angiosperm Peperomia polybotrya was amplified via the polymerase chain reaction and sequenced. Comparison to other coxI genes revealed a 966-bp group I intron, which, based on homology with the related yeast coxI intron aI4, potentially encodes a 279-amino-acid site-specific DNA endonuclease. This intron, which is believed to function as a ribozyme during its own splicing, is not present in any of 19 coxI genes examined from other diverse vascular plant species. Phylogenetic analysis of intron origin was carried out using three different tree-generating algorithms, and on a variety of nucleotide and amino acid data sets from the intron and its flanking exon sequences. These analyses show that the Peperomia coxI gene intron and exon sequences are of fundamentally different evolutionary origin. The Peperomia intron is more closely related to several fungal mitochondrial introns, two of which are located at identical positions in coxI, than to identically located coxI introns from the land plant Marchantia and the green alga Prototheca. Conversely, the exon sequence of this gene is, as expected, most closely related to other angiosperm coxI genes. These results, together with evidence suggestive of co-conversion of exonic markers immediately flanking the intron insertion site, lead us to conclude that the Peperomia coxI intron probably arose by horizontal transfer from a fungal donor, using the double-strand-break repair pathway. The donor species may have been one of the symbiotic mycorrhizal fungi that live in close obligate association with most plants.
Doan, Ninh; Gettins, Peter G W
2007-10-01
Human alpha2M (alpha2-macroglobulin) and the complement components C3 and C4 are thiol ester-containing proteins that evolved from the same ancestral gene. The recent structure determination of human C3 has allowed a detailed prediction of the location of domains within human alpha2M to be made. We describe here the expression and characterization of three alpha(2)M domains predicted to be involved in the stabilization of the thiol ester in native alpha2M and in its activation upon bait region proteolysis. The three newly expressed domains are MG2 (macroglobulin domain 2), TED (thiol ester-containing domain) and CUB (complement protein subcomponents C1r/C1s, urchin embryonic growth factor and bone morphogenetic protein 1) domain. Together with the previously characterized RBD (receptor-binding domain), they represent approx. 42% of the alpha2M polypeptide. Their expression as folded domains strongly supports the predicted domain organization of alpha2M. An X-ray crystal structure of MG2 shows it to have a fibronectin type-3 fold analogous to MG1-MG8 of C3. TED is, as predicted, an alpha-helical domain. CUB is a spliced domain composed of two stretches of polypeptide that flank TED in the primary structure. In intact C3 TED interacts with RBD, where it is in direct contact with the thiol ester, and with MG2 and CUB on opposite, flanking sides. In contrast, these alpha2M domains, as isolated species, show negligible interaction with one another, suggesting that the native conformation of alpha2M, and the consequent thiol ester-stabilizing domain-domain interactions, result from additional restraints imposed by the physical linkage of these domains or by additional domains in the protein.
Doan, Ninh; Gettins, Peter G. W.
2007-01-01
Human α2M (α2-macroglobulin) and the complement components C3 and C4 are thiol ester-containing proteins that evolved from the same ancestral gene. The recent structure determination of human C3 has allowed a detailed prediction of the location of domains within human α2M to be made. We describe here the expression and characterization of three α2M domains predicted to be involved in the stabilization of the thiol ester in native α2M and in its activation upon bait region proteolysis. The three newly expressed domains are MG2 (macroglobulin domain 2), TED (thiol ester-containing domain) and CUB (complement protein subcomponents C1r/C1s, urchin embryonic growth factor and bone morphogenetic protein 1) domain. Together with the previously characterized RBD (receptor-binding domain), they represent approx. 42% of the α2M polypeptide. Their expression as folded domains strongly supports the predicted domain organization of α2M. An X-ray crystal structure of MG2 shows it to have a fibronectin type-3 fold analogous to MG1–MG8 of C3. TED is, as predicted, an α-helical domain. CUB is a spliced domain composed of two stretches of polypeptide that flank TED in the primary structure. In intact C3 TED interacts with RBD, where it is in direct contact with the thiol ester, and with MG2 and CUB on opposite, flanking sides. In contrast, these α2M domains, as isolated species, show negligible interaction with one another, suggesting that the native conformation of α2M, and the consequent thiol ester-stabilizing domain–domain interactions, result from additional restraints imposed by the physical linkage of these domains or by additional domains in the protein. PMID:17608619
The neurogenetics of alternative splicing
Vuong, Celine K.; Black, Douglas L.; Zheng, Sika
2016-01-01
Alternative precursor-mRNA splicing is a key mechanism for regulating gene expression in mammals and is controlled by specialized RNA-binding proteins. The misregulation of splicing is implicated in multiple neurological disorders. We describe recent mouse genetic studies of alternative splicing that reveal its critical role in both neuronal development and the function of mature neurons. We discuss the challenges in understanding the extensive genetic programmes controlled by proteins that regulate splicing, both during development and in the adult brain. PMID:27094079
NASA Astrophysics Data System (ADS)
Lawson, Christopher M.; Michael, Robert R., Jr.; Dressel, Earl M.; Harmony, David W.
1991-12-01
Optical time domain reflectometry (OTDR) measurements have been performed on polished polymethylmethacrylate (PMMA) plastic fiber splices. After the dominant splice reflection sources due to surface roughness, inexact index matching, and fiber core misalignment were eliminated, an intrinsic OTDR signature 3 - 8 dB above the Rayleigh backscatter floor remained with all tested fibers. This minimum splice reflectivity exhibits characteristics that are consistent with sub-surface polymer damage and can be used for detection of PMMA fiber splices.
Analysis of Alternative Pre-RNA Splicing in the Mouse Retina Using a Fluorescent Reporter.
Murphy, Daniel; Kolandaivelu, Saravanan; Ramamurthy, Visvanathan; Stoilov, Peter
2016-01-01
In vivo alternative splicing is controlled in a tissue and cell type specific manner. Often individual cellular components of complex tissues will express different splicing programs. Thus, when studying splicing in multicellular organisms it is critical to determine the exon inclusion levels in individual cells positioned in the context of their native tissue or organ. Here we describe how a fluorescent splicing reporter in combination with in vivo electroporation can be used to visualize alternative splicing in individual cells within mature tissues. In a test case we show how the splicing of a photoreceptor specific exon can be visualized within the mouse retina. The retina was chosen as an example of a complex tissue that is fragile and whose cells cannot be studied in culture. With minor modifications to the injection and electroporation procedure, the protocol we outline can be applied to other tissues and organs.
30 CFR 57.12013 - Splices and repairs of power cables.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Splices and repairs of power cables. 57.12013... Electricity Surface and Underground § 57.12013 Splices and repairs of power cables. Permanent splices and repairs made in power cables, including the ground conductor where provided, shall be— (a) Mechanically...
30 CFR 57.12013 - Splices and repairs of power cables.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Splices and repairs of power cables. 57.12013... Electricity Surface and Underground § 57.12013 Splices and repairs of power cables. Permanent splices and repairs made in power cables, including the ground conductor where provided, shall be— (a) Mechanically...
30 CFR 57.12013 - Splices and repairs of power cables.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Splices and repairs of power cables. 57.12013... Electricity Surface and Underground § 57.12013 Splices and repairs of power cables. Permanent splices and repairs made in power cables, including the ground conductor where provided, shall be— (a) Mechanically...
30 CFR 57.12013 - Splices and repairs of power cables.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Splices and repairs of power cables. 57.12013... Electricity Surface and Underground § 57.12013 Splices and repairs of power cables. Permanent splices and repairs made in power cables, including the ground conductor where provided, shall be— (a) Mechanically...
30 CFR 57.12013 - Splices and repairs of power cables.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Splices and repairs of power cables. 57.12013... Electricity Surface and Underground § 57.12013 Splices and repairs of power cables. Permanent splices and repairs made in power cables, including the ground conductor where provided, shall be— (a) Mechanically...
NASA Technical Reports Server (NTRS)
Chambers, G.
1966-01-01
Metal boot splices hard sheathed instrumentation cables used with high temperature strain gages and thermocouples. Silver brazing the conductors together, hermetically seals the splice. This boot is a highly reliable sealed splice which is equally effective at cryogenic temperatures, high temperatures, nuclear environments, and combinations of the above.
NASA Astrophysics Data System (ADS)
Silva, Pedro F.; Henry, Bernard; Marques, Fernando O.; Hildenbrand, Anthony; Lopes, Ana; Madureira, Pedro; Madeira, José; Nunes, João C.; Roxerová, Zuzana
2018-02-01
The morphology of volcanic oceanic islands results from the interplay between constructive and destructive processes, and tectonics. In this study, the analysis of the paleomagnetic directions obtained on well-dated volcanic rocks is used as a tool to assess tilting related to tectonics and large-scale volcano instability along the Pico-Faial linear volcanic ridge (Azores Triple Junction, Central-North Atlantic). For this purpose, 530 specimens from 46 lava flows and one dyke from Pico and Faial islands were submitted to thermal and alternating magnetic fields demagnetizations. Detailed rock magnetic analyses, including thermomagnetic analyses and classical high magnetic field experiments revealed titanomagnetites with different Ti-content as the primary magnetic carrier, capable of recording stable remanent magnetizations. In both islands, the paleomagnetic analysis yields a Characteristic Remanent Magnetization, which presents island mean direction with normal and reversed polarities in agreement with the islands location and the age of the studied lava flows, indicating a primary thermo-remanent magnetization. Field observations and paleomagnetic data show that lava flows were emplaced on pre-existing slopes and were later affected by significant tilting. In Faial Island, magmatic inflation and normal faults making up an island-scale graben, can be responsible for the tilting. In Pico Island, inflation related to magma intrusion during flow emplacement can be at the origin of the inferred tilting, whereas gradual downward movement of the SE flank by slumping processes appears mostly translational.
Evolution of a tissue-specific splicing network
Taliaferro, J. Matthew; Alvarez, Nehemiah; Green, Richard E.; Blanchette, Marco; Rio, Donald C.
2011-01-01
Alternative splicing of precursor mRNA (pre-mRNA) is a strategy employed by most eukaryotes to increase transcript and proteomic diversity. Many metazoan splicing factors are members of multigene families, with each member having different functions. How these highly related proteins evolve unique properties has been unclear. Here we characterize the evolution and function of a new Drosophila splicing factor, termed LS2 (Large Subunit 2), that arose from a gene duplication event of dU2AF50, the large subunit of the highly conserved heterodimeric general splicing factor U2AF (U2-associated factor). The quickly evolving LS2 gene has diverged from the splicing-promoting, ubiquitously expressed dU2AF50 such that it binds a markedly different RNA sequence, acts as a splicing repressor, and is preferentially expressed in testes. Target transcripts of LS2 are also enriched for performing testes-related functions. We therefore propose a path for the evolution of a new splicing factor in Drosophila that regulates specific pre-mRNAs and contributes to transcript diversity in a tissue-specific manner. PMID:21406555
Spliced-leader RNA trans splicing in a chordate, Oikopleura dioica, with a compact genome.
Ganot, Philippe; Kallesøe, Torben; Reinhardt, Richard; Chourrout, Daniel; Thompson, Eric M
2004-09-01
trans splicing of a spliced-leader RNA (SL RNA) to the 5' ends of mRNAs has been shown to have a limited and sporadic distribution among eukaryotes. Within metazoans, only nematodes are known to process polycistronic pre-mRNAs, produced from operon units of transcription, into mature monocistronic mRNAs via an SL RNA trans-splicing mechanism. Here we demonstrate that a chordate with a highly compact genome, Oikopleura dioica, now joins Caenorhabditis elegans in coupling trans splicing with processing of polycistronic transcipts. We identified a single SL RNA which associates with Sm proteins and has a trimethyl guanosine cap structure reminiscent of spliceosomal snRNPs. The same SL RNA, estimated to be trans-spliced to at least 25% of O. dioica mRNAs, is used for the processing of both isolated or first cistrons and downstream cistrons in a polycistronic precursor. Remarkably, intercistronic regions in O. dioica are far more reduced than those in either nematodes or kinetoplastids, implying minimal cis-regulatory elements for coupling of 3'-end formation and trans splicing. Copyright 2004 American Society for Microbiology
Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A
2016-06-01
Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3' end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. Copyright © 2016 Larson et al.
SAM68 is a physiological regulator of SMN2 splicing in spinal muscular atrophy
Pagliarini, Vittoria; Pelosi, Laura; Bustamante, Maria Blaire; Nobili, Annalisa; Berardinelli, Maria Grazia; D’Amelio, Marcello; Musarò, Antonio
2015-01-01
Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by loss of motor neurons in patients with null mutations in the SMN1 gene. The almost identical SMN2 gene is unable to compensate for this deficiency because of the skipping of exon 7 during pre–messenger RNA (mRNA) processing. Although several splicing factors can modulate SMN2 splicing in vitro, the physiological regulators of this disease-causing event are unknown. We found that knockout of the splicing factor SAM68 partially rescued body weight and viability of SMAΔ7 mice. Ablation of SAM68 function promoted SMN2 splicing and expression in SMAΔ7 mice, correlating with amelioration of SMA-related defects in motor neurons and skeletal muscles. Mechanistically, SAM68 binds to SMN2 pre-mRNA, favoring recruitment of the splicing repressor hnRNP A1 and interfering with that of U2AF65 at the 3′ splice site of exon 7. These findings identify SAM68 as the first physiological regulator of SMN2 splicing in an SMA mouse model. PMID:26438828
Beusch, Irene; Barraud, Pierre; Moursy, Ahmed; Cléry, Antoine; Allain, Frédéric Hai-Trieu
2017-01-01
HnRNP A1 regulates many alternative splicing events by the recognition of splicing silencer elements. Here, we provide the solution structures of its two RNA recognition motifs (RRMs) in complex with short RNA. In addition, we show by NMR that both RRMs of hnRNP A1 can bind simultaneously to a single bipartite motif of the human intronic splicing silencer ISS-N1, which controls survival of motor neuron exon 7 splicing. RRM2 binds to the upstream motif and RRM1 to the downstream motif. Combining the insights from the structure with in cell splicing assays we show that the architecture and organization of the two RRMs is essential to hnRNP A1 function. The disruption of the inter-RRM interaction or the loss of RNA binding capacity of either RRM impairs splicing repression by hnRNP A1. Furthermore, both binding sites within the ISS-N1 are important for splicing repression and their contributions are cumulative rather than synergistic. DOI: http://dx.doi.org/10.7554/eLife.25736.001 PMID:28650318
A Systems-Level Analysis Reveals Circadian Regulation of Splicing in Colorectal Cancer.
El-Athman, Rukeia; Fuhr, Luise; Relógio, Angela
2018-06-20
Accumulating evidence points to a significant role of the circadian clock in the regulation of splicing in various organisms, including mammals. Both dysregulated circadian rhythms and aberrant pre-mRNA splicing are frequently implicated in human disease, in particular in cancer. To investigate the role of the circadian clock in the regulation of splicing in a cancer progression context at the systems-level, we conducted a genome-wide analysis and compared the rhythmic transcriptional profiles of colon carcinoma cell lines SW480 and SW620, derived from primary and metastatic sites of the same patient, respectively. We identified spliceosome components and splicing factors with cell-specific circadian expression patterns including SRSF1, HNRNPLL, ESRP1, and RBM 8A, as well as altered alternative splicing events and circadian alternative splicing patterns of output genes (e.g., VEGFA, NCAM1, FGFR2, CD44) in our cellular model. Our data reveals a remarkable interplay between the circadian clock and pre-mRNA splicing with putative consequences in tumor progression and metastasis. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A.
2016-01-01
Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3ʹ end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. PMID:27172183
Singh, Smriti; Narayanan, Sathiya Pandi; Biswas, Kajal; Gupta, Amit; Ahuja, Neha; Yadav, Sandhya; Panday, Rajendra Kumar; Samaiya, Atul; Sharan, Shyam K.
2017-01-01
Aberrant alternative splicing and epigenetic changes are both associated with various cancers, but epigenetic regulation of alternative splicing in cancer is largely unknown. Here we report that the intragenic DNA methylation-mediated binding of Brother of Regulator of Imprinted Sites (BORIS) at the alternative exon of Pyruvate Kinase (PKM) is associated with cancer-specific splicing that promotes the Warburg effect and breast cancer progression. Interestingly, the inhibition of DNA methylation, BORIS depletion, or CRISPR/Cas9-mediated deletion of the BORIS binding site leads to a splicing switch from cancer-specific PKM2 to normal PKM1 isoform. This results in the reversal of the Warburg effect and the inhibition of breast cancer cell growth, which may serve as a useful approach to inhibit the growth of breast cancer cells. Importantly, our results show that in addition to PKM splicing, BORIS also regulates the alternative splicing of several genes in a DNA methylation-dependent manner. Our findings highlight the role of intragenic DNA methylation and DNA binding protein BORIS in cancer-specific splicing and its role in tumorigenesis. PMID:29073069
Aucouturier, Jean-Julien; Defreville, Boris
2009-04-01
This study uses an audio signal transformation, splicing, to create an experimental situation where human listeners judge the similarity of audio signals, which they cannot easily categorize. Splicing works by segmenting audio signals into 50-ms frames, then shuffling and concatenating these frames back in random order. Splicing a signal masks the identification of the categories that it normally elicits: For instance, human participants cannot easily identify the sound of cars in a spliced recording of a city street. This study compares human performance on both normal and spliced recordings of soundscapes and music. Splicing is found to degrade human similarity performance significantly less for soundscapes than for music: When two spliced soundscapes are judged similar to one another, the original recordings also tend to sound similar. This establishes that humans are capable of reconstructing consistent similarity relations between soundscapes without relying much on the identification of the natural categories associated with such signals, such as their constituent sound sources. This finding contradicts previous literature and points to new ways to conceptualize the different ways in which humans perceive soundscapes and music.
Alternative splicing of natriuretic peptide A and B receptor transcripts in the rat brain.
Francoeur, F; Gossard, F; Hamet, P; Tremblay, J
1995-12-01
1. In the present study we searched for variants of alternative splicing of guanylyl cyclase A and B mRNA in rats in vivo. 2. Guanylyl cyclase A2 and guanylyl cyclase B2 isoforms of guanylyl cyclase produced by alternative splicing leading to the deletion of exon 9 of both transcripts were quantified in several rat organs. 3. Only one alternative splicing was found in the regulatory domain, encoded by exons 8-15. 4. Quantification of the guanylyl cyclase B2 isoform in different rat organs and in cultured aortic smooth muscle cells showed that this alternative splicing was tissue-specific and occurred predominantly in the central nervous system where the alternatively spliced variant represented more than 50% of the guanylyl cyclase B mRNA. 5. The same alternative splicing existed for guanylyl cyclase A mRNA but at very low levels in the organs studied. 6. Alternative splicing of guanylyl cyclase B exon 9 in the brain may play an important role in signal transduction, since the expressed protein possesses a constitutionally active guanylyl cyclase acting independently of C-type natriuretic peptide regulation.
Lehmann, Kjong-Van; Kahles, André; Kandoth, Cyriac; Lee, William; Schultz, Nikolaus; Stegle, Oliver; Rätsch, Gunnar
2015-01-01
We present a genome-wide analysis of splicing patterns of 282 kidney renal clear cell carcinoma patients in which we integrate data from whole-exome sequencing of tumor and normal samples, RNA-seq and copy number variation. We proposed a scoring mechanism to compare splicing patterns in tumor samples to normal samples in order to rank and detect tumor-specific isoforms that have a potential for new biomarkers. We identified a subset of genes that show introns only observable in tumor but not in normal samples, ENCODE and GEUVADIS samples. In order to improve our understanding of the underlying genetic mechanisms of splicing variation we performed a large-scale association analysis to find links between somatic or germline variants with alternative splicing events. We identified 915 cis- and trans-splicing quantitative trait loci (sQTL) associated with changes in splicing patterns. Some of these sQTL have previously been associated with being susceptibility loci for cancer and other diseases. Our analysis also allowed us to identify the function of several COSMIC variants showing significant association with changes in alternative splicing. This demonstrates the potential significance of variants affecting alternative splicing events and yields insights into the mechanisms related to an array of disease phenotypes.
Douglass, Stephen; Galivanche, Anoop R.
2017-01-01
Abstract Despite its relatively streamlined genome, there are important examples of regulated RNA splicing in Saccharomyces cerevisiae, such as splicing of meiotic transcripts. Like other eukaryotes, S. cerevisiae undergoes a dramatic reprogramming of gene expression during meiosis, including regulated splicing of a number of crucial meiosis-specific RNAs. Splicing of a subset of these is dependent upon the splicing activator Mer1. Here we show a crucial role for the chromatin remodeler Swi/Snf in regulation of splicing of meiotic genes and find that the complex affects meiotic splicing in two ways. First, we show that Swi/Snf regulates nutrient-dependent downregulation of ribosomal protein encoding RNAs, leading to the redistribution of spliceosomes from this abundant class of intron-containing RNAs (the ribosomal protein genes) to Mer1-regulated transcripts. We also demonstrate that Mer1 expression is dependent on Snf2, its acetylation state and histone H3 lysine 9 acetylation at the MER1 locus. Hence, Snf2 exerts systems level control of meiotic gene expression through two temporally distinct mechanisms, demonstrating that it is a key regulator of meiotic splicing in S. cerevisiae. We also reveal an evolutionarily conserved mechanism whereby the cell redirects its energy from maintaining its translational capacity to the process of meiosis. PMID:28637241
Takeda, Jun-ichi; Suzuki, Yutaka; Nakao, Mitsuteru; Barrero, Roberto A.; Koyanagi, Kanako O.; Jin, Lihua; Motono, Chie; Hata, Hiroko; Isogai, Takao; Nagai, Keiichi; Otsuki, Tetsuji; Kuryshev, Vladimir; Shionyu, Masafumi; Yura, Kei; Go, Mitiko; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Wiemann, Stefan; Nomura, Nobuo; Sugano, Sumio; Gojobori, Takashi; Imanishi, Tadashi
2006-01-01
We report the first genome-wide identification and characterization of alternative splicing in human gene transcripts based on analysis of the full-length cDNAs. Applying both manual and computational analyses for 56 419 completely sequenced and precisely annotated full-length cDNAs selected for the H-Invitational human transcriptome annotation meetings, we identified 6877 alternative splicing genes with 18 297 different alternative splicing variants. A total of 37 670 exons were involved in these alternative splicing events. The encoded protein sequences were affected in 6005 of the 6877 genes. Notably, alternative splicing affected protein motifs in 3015 genes, subcellular localizations in 2982 genes and transmembrane domains in 1348 genes. We also identified interesting patterns of alternative splicing, in which two distinct genes seemed to be bridged, nested or having overlapping protein coding sequences (CDSs) of different reading frames (multiple CDS). In these cases, completely unrelated proteins are encoded by a single locus. Genome-wide annotations of alternative splicing, relying on full-length cDNAs, should lay firm groundwork for exploring in detail the diversification of protein function, which is mediated by the fast expanding universe of alternative splicing variants. PMID:16914452
iSS-PseDNC: identifying splicing sites using pseudo dinucleotide composition.
Chen, Wei; Feng, Peng-Mian; Lin, Hao; Chou, Kuo-Chen
2014-01-01
In eukaryotic genes, exons are generally interrupted by introns. Accurately removing introns and joining exons together are essential processes in eukaryotic gene expression. With the avalanche of genome sequences generated in the postgenomic age, it is highly desired to develop automated methods for rapid and effective detection of splice sites that play important roles in gene structure annotation and even in RNA splicing. Although a series of computational methods were proposed for splice site identification, most of them neglected the intrinsic local structural properties. In the present study, a predictor called "iSS-PseDNC" was developed for identifying splice sites. In the new predictor, the sequences were formulated by a novel feature-vector called "pseudo dinucleotide composition" (PseDNC) into which six DNA local structural properties were incorporated. It was observed by the rigorous cross-validation tests on two benchmark datasets that the overall success rates achieved by iSS-PseDNC in identifying splice donor site and splice acceptor site were 85.45% and 87.73%, respectively. It is anticipated that iSS-PseDNC may become a useful tool for identifying splice sites and that the six DNA local structural properties described in this paper may provide novel insights for in-depth investigations into the mechanism of RNA splicing.
Yeakley, J M; Hedjran, F; Morfin, J P; Merillat, N; Rosenfeld, M G; Emeson, R B
1993-01-01
The calcitonin/calcitonin gene-related peptide (CGRP) primary transcript is alternatively spliced in thyroid C cells and neurons, resulting in the tissue-specific production of calcitonin and CGRP mRNAs. Analyses of mutated calcitonin/CGRP transcription units in permanently transfected cell lines have indicated that alternative splicing is regulated by a differential capacity to utilize the calcitonin-specific splice acceptor. The analysis of an extensive series of mutations suggests that tissue-specific regulation of calcitonin mRNA production does not depend on the presence of a single, unique cis-active element but instead appears to be a consequence of suboptimal constitutive splicing signals. While only those mutations that altered constitutive splicing signals affected splice choices, the action of multiple regulatory sequences cannot be formally excluded. Further, we have identified a 13-nucleotide purine-rich element from a constitutive exon that, when placed in exon 4, entirely switches splice site usage in CGRP-producing cells. These data suggest that specific exon recruitment sequences, in combination with other constitutive elements, serve an important function in exon recognition. These results are consistent with the hypothesis that tissue-specific alternative splicing of the calcitonin/CGRP primary transcript is mediated by cell-specific differences in components of the constitutive splicing machinery. Images PMID:8413203
FOX-2 Dependent Splicing of Ataxin-2 Transcript Is Affected by Ataxin-1 Overexpression
Welzel, Franziska; Kaehler, Christian; Isau, Melanie; Hallen, Linda; Lehrach, Hans; Krobitsch, Sylvia
2012-01-01
Alternative splicing is a fundamental posttranscriptional mechanism for controlling gene expression, and splicing defects have been linked to various human disorders. The splicing factor FOX-2 is part of a main protein interaction hub in a network related to human inherited ataxias, however, its impact remains to be elucidated. Here, we focused on the reported interaction between FOX-2 and ataxin-1, the disease-causing protein in spinocerebellar ataxia type 1. In this line, we further evaluated this interaction by yeast-2-hybrid analyses and co-immunoprecipitation experiments in mammalian cells. Interestingly, we discovered that FOX-2 localization and splicing activity is affected in the presence of nuclear ataxin-1 inclusions. Moreover, we observed that FOX-2 directly interacts with ataxin-2, a protein modulating spinocerebellar ataxia type 1 pathogenesis. Finally, we provide evidence that splicing of pre-mRNA of ataxin-2 depends on FOX-2 activity, since reduction of FOX-2 levels led to increased skipping of exon 18 in ataxin-2 transcripts. Most striking, we observed that ataxin-1 overexpression has an effect on this splicing event as well. Thus, our results demonstrate that FOX-2 is involved in splicing of ataxin-2 transcripts and that this splicing event is altered by overexpression of ataxin-1. PMID:22666429
Diversification of the muscle proteome through alternative splicing.
Nakka, Kiran; Ghigna, Claudia; Gabellini, Davide; Dilworth, F Jeffrey
2018-03-06
Skeletal muscles express a highly specialized proteome that allows the metabolism of energy sources to mediate myofiber contraction. This muscle-specific proteome is partially derived through the muscle-specific transcription of a subset of genes. Surprisingly, RNA sequencing technologies have also revealed a significant role for muscle-specific alternative splicing in generating protein isoforms that give specialized function to the muscle proteome. In this review, we discuss the current knowledge with respect to the mechanisms that allow pre-mRNA transcripts to undergo muscle-specific alternative splicing while identifying some of the key trans-acting splicing factors essential to the process. The importance of specific splicing events to specialized muscle function is presented along with examples in which dysregulated splicing contributes to myopathies. Though there is now an appreciation that alternative splicing is a major contributor to proteome diversification, the emergence of improved "targeted" proteomic methodologies for detection of specific protein isoforms will soon allow us to better appreciate the extent to which alternative splicing modifies the activity of proteins (and their ability to interact with other proteins) in the skeletal muscle. In addition, we highlight a continued need to better explore the signaling pathways that contribute to the temporal control of trans-acting splicing factor activity to ensure specific protein isoforms are expressed in the proper cellular context. An understanding of the signal-dependent and signal-independent events driving muscle-specific alternative splicing has the potential to provide us with novel therapeutic strategies to treat different myopathies.
Majerciak, Vladimir; Lu, Mathew; Li, Xiaofan
2014-01-01
Kaposi sarcoma–associated herpesvirus (KSHV) ORF57 is a multifunctional post-transcriptional regulator essential for viral gene expression during KSHV lytic infection. ORF57 requires interactions with various cellular proteins for its function. Here, we identified serine/arginine-rich splicing factor 3 (SRSF3, formerly known as SRp20) as a cellular cofactor involved in ORF57-mediated splicing of KSHV K8β RNA. In the absence of ORF57, SRSF3 binds to a suboptimal K8β intron and inhibits K8β splicing. Knockdown of SRSF3 promotes K8β splicing, mimicking the effect of ORF57. The N-terminal half of ORF57 binds to the RNA recognition motif of SRSF3, which prevents SRSF3 from associating with the K8β intron RNA and therefore attenuates the suppressive effect of SRSF3 on K8β splicing. ORF57 also promotes splicing of heterologous non-KSHV transcripts that are negatively regulated by SRSF3, indicating that the effect of ORF57 on SRSF3 activity is independent of RNA target. SPEN proteins, previously identified as ORF57-interacting partners, suppress ORF57 splicing activity by displacing ORF57 from SRSF3–RNA complexes. In summary, we have identified modulation of SRSF3 activity as the molecular mechanism by which ORF57 promotes RNA splicing. PMID:25234929
Majerciak, Vladimir; Lu, Mathew; Li, Xiaofan; Zheng, Zhi-Ming
2014-11-01
Kaposi sarcoma-associated herpesvirus (KSHV) ORF57 is a multifunctional post-transcriptional regulator essential for viral gene expression during KSHV lytic infection. ORF57 requires interactions with various cellular proteins for its function. Here, we identified serine/arginine-rich splicing factor 3 (SRSF3, formerly known as SRp20) as a cellular cofactor involved in ORF57-mediated splicing of KSHV K8β RNA. In the absence of ORF57, SRSF3 binds to a suboptimal K8β intron and inhibits K8β splicing. Knockdown of SRSF3 promotes K8β splicing, mimicking the effect of ORF57. The N-terminal half of ORF57 binds to the RNA recognition motif of SRSF3, which prevents SRSF3 from associating with the K8β intron RNA and therefore attenuates the suppressive effect of SRSF3 on K8β splicing. ORF57 also promotes splicing of heterologous non-KSHV transcripts that are negatively regulated by SRSF3, indicating that the effect of ORF57 on SRSF3 activity is independent of RNA target. SPEN proteins, previously identified as ORF57-interacting partners, suppress ORF57 splicing activity by displacing ORF57 from SRSF3-RNA complexes. In summary, we have identified modulation of SRSF3 activity as the molecular mechanism by which ORF57 promotes RNA splicing. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Yi, Jia; Shen, Hai-Feng; Qiu, Jin-Song; Huang, Ming-Feng; Zhang, Wen-Juan; Ding, Jian-Cheng; Zhu, Xiao-Yan; Zhou, Yu; Fu, Xiang-Dong; Liu, Wen
2017-04-07
JMJD6, a jumonji C (Jmj C) domain-containing protein demethylase and hydroxylase, has been implicated in an array of biological processes. It has been shown that JMJD6 interacts with and hydroxylates multiple serine/arginine-rich (SR) proteins and SR related proteins, including U2AF65, all of which are known to function in alternative splicing regulation. However, whether JMJD6 is widely involved in alternative splicing and the molecular mechanism underlying JMJD6-regulated alternative splicing have remained incompletely understood. Here, by using RASL-Seq, we investigated the functional impact of RNA-dependent interaction between JMJD6 and U2AF65, revealing that JMJD6 and U2AF65 co-regulated a large number of alternative splicing events. We further demonstrated the JMJD6 function in alternative splicing in jmjd6 knockout mice. Mechanistically, we showed that the enzymatic activity of JMJD6 was required for a subset of JMJD6-regulated splicing, and JMJD6-mediated lysine hydroxylation of U2AF65 could account for, at least partially, their co-regulated alternative splicing events, suggesting both JMJD6 enzymatic activity-dependent and independent control of alternative splicing. These findings reveal an intimate link between JMJD6 and U2AF65 in alternative splicing regulation, which has important implications in development and disease processes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Factors influencing alternative splice site utilization in vivo.
Fu, X Y; Manley, J L
1987-01-01
To study factors that influence the choice of alternative pre-mRNA splicing pathways, we introduced plasmids expressing either wild-type or mutated simian virus 40 (SV40) early regions into tissue culture cells and then measured the quantities of small-t and large-T RNAs produced. One important element controlling splice site selection was found to be the size of the intron removed in the production of small-t mRNA; expansion of this intron (from 66 to 77 or more nucleotides) resulted in a substantial increase in the amount of small-t mRNA produced relative to large-T mRNA. This suggests that in the normal course of SV40 early pre-mRNA processing, large-T splicing is at a competitive advantage relative to small-t splicing because of the small size of the latter intron. Several additional features of the pre-mRNA that can influence splice site selection were also identified by analyzing the effects of mutations containing splice site duplications. These include the strengths of competing 5' splice sites and the relative positions of splice sites in the pre-mRNA. Finally, we showed that the ratio of small-t to large-T mRNA was 10 to 15-fold greater in human 293 cells than in HeLa cells or other mammalian cell types. These results suggest the existence of cell-specific trans-acting factors that can dramatically alter the pattern of splice site selection in a pre-mRNA. Images PMID:3029566
Iborra, Severine; Hirschfeld, Marc; Jaeger, Markus; Zur Hausen, Axel; Braicu, Iona; Sehouli, Jalid; Gitsch, Gerald; Stickeler, Elmar
2013-07-01
Alternative splicing represents an important nuclear mechanism in the posttranscriptional regulation of gene expression, which is frequently altered during tumorigenesis. Previously, we described marked changes in alternative splicing of the CD44 gene in ovarian and breast cancer as well as specific induction of distinct splicing factors during tumor development. The present study was focused on the expression profiles of different splicing factors, including classical serine-arginine (SR) proteins including ASF/SF2, hTra2β1, hTra2α, and Y-box-binding protein (YB-1) in physiological and malignant epithelial ovarian tissue to evaluate their expression pattern with regard to tumor development and disease progression. Expression levels of the different splicing factors were analyzed in physiological epithelial ovarian tissue samples, primary tumors, and metastatic samples of patients with a diagnosis of epithelial ovarian cancer using quantified reverse transcription polymerase chain reaction analysis. We examined more closely the splicing factor hTra2β1 using Western blot analysis and immunohistochemistry. The analysis revealed a marked and specific induction of ASF/SF2, SRp20, hTra2β1, and YB-1 in primary tumors as well as in their metastatic sites. However, in our patient cohort, no induction was seen for the other investigated splicing factors SRp55, SRp40, and hTra2α. Our results suggest a specific induction of distinct splicing factors in ovarian cancer tumorigenesis. The involvement of hTra2β1, YB-1, SRp20, and ASF/SF2 in exon recognition and alternative splicing may be important for gene regulation of alternatively spliced genes like CD44 with potential functional consequences in this tumor type leading to progression and metastasis.
Mechanisms and Regulation of Alternative Pre-mRNA Splicing
Lee, Yeon
2015-01-01
Precursor messenger RNA (pre-mRNA) splicing is a critical step in the posttranscriptional regulation of gene expression, providing significant expansion of the functional proteome of eukaryotic organisms with limited gene numbers. Split eukaryotic genes contain intervening sequences or introns disrupting protein-coding exons, and intron removal occurs by repeated assembly of a large and highly dynamic ribonucleoprotein complex termed the spliceosome, which is composed of five small nuclear ribonucleoprotein particles, U1, U2, U4/U6, and U5. Biochemical studies over the past 10 years have allowed the isolation as well as compositional, functional, and structural analysis of splicing complexes at distinct stages along the spliceosome cycle. The average human gene contains eight exons and seven introns, producing an average of three or more alternatively spliced mRNA isoforms. Recent high-throughput sequencing studies indicate that 100% of human genes produce at least two alternative mRNA isoforms. Mechanisms of alternative splicing include RNA–protein interactions of splicing factors with regulatory sites termed silencers or enhancers, RNA–RNA base-pairing interactions, or chromatin-based effects that can change or determine splicing patterns. Disease-causing mutations can often occur in splice sites near intron borders or in exonic or intronic RNA regulatory silencer or enhancer elements, as well as in genes that encode splicing factors. Together, these studies provide mechanistic insights into how spliceosome assembly, dynamics, and catalysis occur; how alternative splicing is regulated and evolves; and how splicing can be disrupted by cis- and trans-acting mutations leading to disease states. These findings make the spliceosome an attractive new target for small-molecule, antisense, and genome-editing therapeutic interventions. PMID:25784052
Comprehensive splicing functional analysis of DNA variants of the BRCA2 gene by hybrid minigenes
2012-01-01
Introduction The underlying pathogenic mechanism of a large fraction of DNA variants of disease-causing genes is the disruption of the splicing process. We aimed to investigate the effect on splicing of the BRCA2 variants c.8488-1G > A (exon 20) and c.9026_9030del (exon 23), as well as 41 BRCA2 variants reported in the Breast Cancer Information Core (BIC) mutation database. Methods DNA variants were analyzed with the splicing prediction programs NNSPLICE and Human Splicing Finder. Functional analyses of candidate variants were performed by lymphocyte RT-PCR and/or hybrid minigene assays. Forty-one BIC variants of exons 19, 20, 23 and 24 were bioinformatically selected and generated by PCR-mutagenesis of the wild type minigenes. Results Lymphocyte RT-PCR of c.8488-1G > A showed intron 19 retention and a 12-nucleotide deletion in exon 20, whereas c.9026_9030del did not show any splicing anomaly. Minigene analysis of c.8488-1G > A displayed the aforementioned aberrant isoforms but also exon 20 skipping. We further evaluated the splicing outcomes of 41 variants of four BRCA2 exons by minigene analysis. Eighteen variants presented splicing aberrations. Most variants (78.9%) disrupted the natural splice sites, whereas four altered putative enhancers/silencers and had a weak effect. Fluorescent RT-PCR of minigenes accurately detected 14 RNA isoforms generated by cryptic site usage, exon skipping and intron retention events. Fourteen variants showed total splicing disruptions and were predicted to truncate or eliminate essential domains of BRCA2. Conclusions A relevant proportion of BRCA2 variants are correlated with splicing disruptions, indicating that RNA analysis is a valuable tool to assess the pathogenicity of a particular DNA change. The minigene system is a straightforward and robust approach to detect variants with an impact on splicing and contributes to a better knowledge of this gene expression step. PMID:22632462
Disturbed expression of type 1 iodothyronine deiodinase splice variants in human renal cancer.
Piekielko-Witkowska, Agnieszka; Master, Adam; Wojcicka, Anna; Boguslawska, Joanna; Brozda, Izabela; Tanski, Zbigniew; Nauman, Alicja
2009-10-01
Alternative splicing, one of the sources of protein diversity, is often disturbed in cancer. Type 1 iodothyronine deiodinase (DIO1) catalyzes deiodination of thyroxine generating triiodothyronine, an important regulator of cell proliferation and differentiation. The expression of DIO1 is disturbed in different types of cancer. The aim of the study was to analyze the alternative splicing of DIO1 and its possible disturbance in renal cancer. Using real-time PCR, we analyzed 19 tissue samples (T) of renal cancer and 19 matched control samples (C) of the opposite pole of the kidney, not infiltrated by tumor, and 6 control samples (N) (nonneoplastic kidney abnormalities). Cloning of DIO1 mRNA isoforms revealed 11 different transcripts, among them 7 new splice variants, not previously reported. The expression of all variants of DIO1 was dramatically (>90%) and significantly (p < or = 0.0003) lowered in samples T compared to control samples C. The ratio of mRNA isoforms encoding DIO1 protein variants possessing or lacking the active center was lowered in samples T compared with control samples C, suggesting disturbed alternative splicing of DIO1. The expression of mRNA of splicing factors SF2/ASF (splicing factor-2/alternative-splicing factor) and hnRNPA1 (heterogeneous ribonucleoprotein A1), regulating 5'-splice site selection, was significantly but not proportionally lowered in samples T compared to samples C. The mRNA ratio of splicing factors SF2/ASF and hnRNPA1 correlated with the ratio of mRNA isoforms encoding DIO1 protein variants possessing or lacking the active center in controls C but not in samples T. Our results show that the expression and alternative splicing of DIO1 mRNA is disturbed in renal cancer, possibly due to changes in expression of splicing factors SF2/ASF and hnRNPA1.