Sample records for flatband voltage shift

  1. Anomalous positive flatband voltage shifts in metal gate stacks containing rare-earth oxide capping layers

    NASA Astrophysics Data System (ADS)

    Caraveo-Frescas, J. A.; Hedhili, M. N.; Wang, H.; Schwingenschlögl, U.; Alshareef, H. N.

    2012-03-01

    It is shown that the well-known negative flatband voltage (VFB) shift, induced by rare-earth oxide capping in metal gate stacks, can be completely reversed in the absence of the silicon overlayer. Using TaN metal gates and Gd2O3-doped dielectric, we measure a ˜350 mV negative shift with the Si overlayer present and a ˜110 mV positive shift with the Si overlayer removed. This effect is correlated to a positive change in the average electrostatic potential at the TaN/dielectric interface which originates from an interfacial dipole. The dipole is created by the replacement of interfacial oxygen atoms in the HfO2 lattice with nitrogen atoms from TaN.

  2. Interface charge trapping induced flatband voltage shift during plasma-enhanced atomic layer deposition in through silicon via

    NASA Astrophysics Data System (ADS)

    Li, Yunlong; Suhard, Samuel; Van Huylenbroeck, Stefaan; Meersschaut, Johan; Van Besien, Els; Stucchi, Michele; Croes, Kristof; Beyer, Gerald; Beyne, Eric

    2017-12-01

    A Through Silicon Via (TSV) is a key component for 3D integrated circuit stacking technology, and the diameter of a TSV keeps scaling down to reduce the footprint in silicon. The TSV aspect ratio, defined as the TSV depth/diameter, tends to increase consequently. Starting from the aspect ratio of 10, to improve the TSV sidewall coverage and reduce the process thermal budget, the TSV dielectric liner deposition process has evolved from sub-atmospheric chemical vapour deposition to plasma-enhanced atomic layer deposition (PE-ALD). However, with this change, a strong negative shift in the flatband voltage is observed in the capacitance-voltage characteristic of the vertical metal-oxide-semiconductor (MOS) parasitic capacitor formed between the TSV copper metal and the p-Si substrate. And, no shift is present in planar MOS capacitors manufactured with the same PE-ALD oxide. By comparing the integration process of these two MOS capacitor structures, and by using Elastic Recoil Detection to study the elemental composition of our films, it is found that the origin of the negative flatband voltage shift is the positive charge trapping at the Si/SiO2 interface, due to the positive PE-ALD reactants confined to the narrow cavity of high aspect ratio TSVs. This interface charge trapping effect can be effectively mitigated by high temperature annealing. However, this is limited in the real process due to the high thermal budget. Further investigation on liner oxide process optimization is needed.

  3. Electrical behaviour of fully solution processed HfO2 (MOS) in presence of different light illumination

    NASA Astrophysics Data System (ADS)

    Mondal, Sandip

    2018-04-01

    This experiment demonstrates the electrical behaviors of fully solution processed HfO2(MOS) in presence of different optical illumination. The capacitance voltage measurement was performed at frequency of 100 kHz with a DC gate sweep voltage of ±5V (with additional AC voltage of 100mV) in presence of deep UV (wavelength of 365nm with power of 25W) as well as white light (20W). It is found that there is a large shift in flatband voltage of 120mV due presence of white light during the CV measurement. However there is negligible change in flatband voltage (30mV) has been observed due to illumination of deep UV light.

  4. Organic memory capacitor device fabricated with Ag nanoparticles.

    PubMed

    Kim, Yo-Han; Jung, Sung Mok; Hu, Quanli; Kim, Yong-Sang; Yoon, Tae-Sik; Lee, Hyun Ho

    2011-07-01

    In this study, it is demonstrated that an organic memory structure using pentacene and citrate-stabilized silver nanoparticles (Ag NPs) as charge storage elements on dielectric SiO2 layer and silicon substrate. The Ag NPs were synthesized by thermal reduction method of silver trifluoroacetate with oleic acid. The synthesized Ag NPs were analyzed with high resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED) for their crystalline structure. The capacitance versus voltage (C-V) curves obtained for the Ag NPs embedded capacitor exhibited flat-band voltage shifts, which demonstrated the presence of charge storages. The citrate-capping of the Ag NPs was confirmed by ultraviolet-visible (UV-VIS) and Fourier transformed infrared (FTIR) spectroscopy. With voltage sweeping of +/-7 V, a hysteresis loop having flatband voltage shift of 7.1 V was obtained. The hysteresis loop showed a counter-clockwise direction. In addition, electrical performance test for charge storage showed more than 10,000 second charge retention time. The device with Ag NPs can be applied to an organic memory device for flexible electronics.

  5. Effect of Al-diffusion-induced positive flatband voltage shift on the electrical characteristics of Al-incorporated high-k metal-oxide-semiconductor field-effective transistor

    NASA Astrophysics Data System (ADS)

    Wang, Wenwu; Akiyama, Koji; Mizubayashi, Wataru; Nabatame, Toshihide; Ota, Hiroyuki; Toriumi, Akira

    2009-03-01

    We systematically studied what effect Al diffusion from high-k dielectrics had on the flatband voltage (Vfb) of Al-incorporated high-k gate stacks. An anomalous positive shift fin Vfb with the decreasing equivalent oxide thickness (EOT) of high-k gate stacks is reported. As the SiO2 interfacial layer is aggressively thinned in Al-incorporated HfxAl1-xOy gate stacks with a metal-gate electrode, the Vfb first lies on the well known linear Vfb-EOT plot and deviates toward the positive-voltage direction (Vfb roll-up), followed by shifting toward negative voltage (Vfb roll-off). We demonstrated that the Vfb roll-up behavior remarkably decreases the threshold voltage (Vth) of p-type metal-oxide-semiconductor field-effect transistors (p-MOSFETs), and does not cause severe degradation in the characteristics of hole mobility. The Vfb roll-up behavior, which is independent of gate materials but strongly dependent on high-k dielectrics, was ascribed to variations in fixed charges near the SiO2/Si interface, which are caused by Al diffusion from HfxAl1-xOy through SiO2 to the SiO2/Si interface. These results indicate that anomalous positive shift in Vfb, i.e., Vfb roll-up, should be taken into consideration in quantitatively adjusting Vfb in thin EOT regions and that it could be used to further tune Vth in p-MOSFETs.

  6. Instability of phosphorous doped SiO2 in 4H-SiC MOS capacitors at high temperatures

    NASA Astrophysics Data System (ADS)

    Idris, M. I.; Weng, M. H.; Chan, H.-K.; Murphy, A. E.; Clark, D. T.; Young, R. A. R.; Ramsay, E. P.; Wright, N. G.; Horsfall, A. B.

    2016-12-01

    In this paper, the effect of inclusion of phosphorous (at a concentration below 1%) on the high temperature characteristics (up to 300 °C) of the SiO2/SiC interface is investigated. Capacitance-voltage measurements taken for a range of frequencies have been utilized to extract parameters including flatband voltage, threshold voltage, effective oxide charge, and interface state density. The variation of these parameters with temperature has been investigated for bias sweeps in opposing directions and a comparison made between phosphorous doped and as-grown oxides. At room temperature, the effective oxide charge for SiO2 may be reduced by the phosphorous termination of dangling bonds at the interface. However, at high temperatures, the effective charge in the phosphorous doped oxide remains unstable and effects such as flatband voltage shift and threshold voltage shift dominate the characteristics. The instability in these characteristics was found to result from the trapped charges in the oxide (±1012 cm-3) or near interface traps at the interface of the gate oxide and the semiconductor (1012-1013 cm-2 eV-1). Hence, the performance enhancements observed for phosphorous doped oxides are not realised in devices operated at elevated temperatures.

  7. Investigation of the flatband voltage (V(FB)) shift of Al2O3 on N2 plasma treated Si substrate.

    PubMed

    Kim, Hyungchul; Lee, Jaesang; Jeon, Heeyoung; Park, Jingyu; Jeon, Hyeongtag

    2013-09-01

    The relationships between the physical and electrical characteristics of films treated with N2 plasma followed by forming gas annealing (FGA) were investigated. The Si substrates were treated with various radio frequency (RF) power levels under a N2 ambient. Al2O3 films were then deposited on Si substrates via remote plasma atomic-layer deposition. The plasma characteristics, such as the radical and ion density, were investigated using optical emission spectroscopy. Through X-ray photoelectron spectroscopy, the chemical-bonding configurations of the samples treated with N2 plasma and FGA were examined. The quantity of Si-N bonds increased as the RF power was increased, and Si--O--N bonds were generated after FGA. The flatband voltage (VFB) was shifted in the negative direction with increasing RF power, but the VFB values of the samples after FGA shifted in the positive direction due to the formation of Si--O--N bonds. N2 plasma treatment with various RF power levels slightly increased the leakage current due to the generation of defect sites.

  8. Threshold voltage control in TmSiO/HfO2 high-k/metal gate MOSFETs

    NASA Astrophysics Data System (ADS)

    Dentoni Litta, E.; Hellström, P.-E.; Östling, M.

    2015-06-01

    High-k interfacial layers have been proposed as a way to extend the scalability of Hf-based high-k/metal gate CMOS technology, which is currently limited by strong degradations in threshold voltage control, channel mobility and device reliability when the chemical oxide (SiOx) interfacial layer is scaled below 0.4 nm. We have previously demonstrated that thulium silicate (TmSiO) is a promising candidate as a high-k interfacial layer, providing competitive advantages in terms of EOT scalability and channel mobility. In this work, the effect of the TmSiO interfacial layer on threshold voltage control is evaluated, showing that the TmSiO/HfO2 dielectric stack is compatible with threshold voltage control techniques commonly used with SiOx/HfO2 stacks. Specifically, we show that the flatband voltage can be set in the range -1 V to +0.5 V by the choice of gate metal and that the effective workfunction of the stack is properly controlled by the metal workfunction in a gate-last process flow. Compatibility with a gate-first approach is also demonstrated, showing that integration of La2O3 and Al2O3 capping layers can induce a flatband voltage shift of at least 150 mV. Finally, the effect of the annealing conditions on flatband voltage is investigated, finding that the duration of the final forming gas anneal can be used as a further process knob to tune the threshold voltage. The evaluation performed on MOS capacitors is confirmed by the fabrication of TmSiO/HfO2/TiN MOSFETs achieving near-symmetric threshold voltages at sub-nm EOT.

  9. Origin of flatband voltage shift and unusual minority carrier generation in thermally grown GeO2/Ge metal-oxide-semiconductor devices

    NASA Astrophysics Data System (ADS)

    Hosoi, Takuji; Kutsuki, Katsuhiro; Okamoto, Gaku; Saito, Marina; Shimura, Takayoshi; Watanabe, Heiji

    2009-05-01

    Improvement in electrical properties of thermally grown GeO2/Ge metal-oxide-semiconductor (MOS) capacitors, such as significantly reduced flatband voltage (VFB) shift, small hysteresis, and minimized minority carrier response in capacitance-voltage (C-V) characteristics, has been demonstrated by in situ low temperature vacuum annealing prior to gate electrode deposition. Thermal desorption analysis has revealed that not only water but also hydrocarbons are easily infiltrated into GeO2 layers during air exposure and desorbed at around 300 °C, indicating that organic molecules within GeO2/Ge MOS structures are possible origins of electrical defects. The inversion capacitance, indicative of minority carrier generation, increases with air exposure time for Au/GeO2/Ge MOS capacitors, while maintaining an interface state density (Dit) of about a few 1011 cm-2 eV-1. Unusual increase in inversion capacitance was found to be suppressed by Al2O3 capping (Au/Al2O3/GeO2/Ge structures). This suggests that electrical defects induced outside the Au electrode by infiltrated molecules may enhance the minority carrier generation, and thus acting as a minority carrier source just like MOS field-effect transistors.

  10. A study of charged particles/radiation damage to VLSI device materials

    NASA Technical Reports Server (NTRS)

    Okyere, John G.

    1987-01-01

    Future spacecraft systems such as the manned space station will be subjected to low-dose long term radiation particles. Most electronic systems are affected by such particles. There is therefore a great need to understand device physics and failure mechanisms affected by radiation and to design circuits that would be less susceptible to radiation. Using 2 MeV electron radiation and bias temperature aging, it was found that MOS capacitors that were prepositively biased have lower flatband voltage shift and lesser increase in density of surface state charge than those that were not prepositively biased. In addition, it was shown that there is continued recovery of flatband voltage and density of state charge in irradiated capacitors during both room temperature anneal and 137 degree anneal. When nMOS transistors were subjected to 1 MeV proton radiation, charge pumping and current versus voltage measurements indicated that transconductance degradation, threshold voltage shifts and changes in interface states density may be the primary cause of nMOS transistor failure after radiation. Simulation studies using SPICE were performed on CMOS SRAM cells of various transistor sizes. It is shown that transistor sizing affects the noise margins of CMOS SRAM cells, and that as the beta ratio of the transistors of the CMOS SRAM cell decreases, the effective noise margin of the SRAM cell increases. Some suggestions were made in connection with the design of CMOS SRAMS that are hardened against single event upsets.

  11. Nanocrystals embedded in hafnium dioxide-based dielectrics as charge storage nodes of nano-floating gate memory

    NASA Astrophysics Data System (ADS)

    Lee, Pui Fai

    2007-12-01

    Nanocrystals (NC) embedded in dielectrics have attracted a great deal of attention recently because they can potentially be applied in nonvolatile, high-speed, high-density and low-power memory devices. This device benefits from a relatively low operating voltage, high endurance, fast write-erase speeds and better immunity to soft errors. The nanocrystal materials suitable for such an application can be either metals or semiconductors. Recent studies have shown that high-k dielectrics, instead of SiO2 , for the tunneling layer in nanocrystal floating gate memory can improve the trade-off between data retention and program efficiency due to the unique band alignment of high-k dielectrics in the programming and retention modes. In this project, HfAlO has been selected as the high- k dielectric for the nanocrystal floating gate memory structure. The trilayer structure (HfAlO/Ge-NC/HfAlO) on Si was fabricated by PLD. Results revealed that relatively low substrate temperature and growth rate are favourable for the formation of smaller-size Ge nanocrystals. Effects of size/density of the Ge nanocrystal, the tunneling and control oxide layer thicknesses and the oxygen partial pressure during their growth on the charge storage and charge retention characteristics have also been studied. The island structure of the Ge nanocrystal suggests that the growth is based on the Volmer-Webber mode. The self-organized Ge nanocrystals so formed were uniform in size (5--20 nm diameter) and distribution with a density approaching 1012--1013cm-2. Flat-band voltage shift (DeltaVFB) of about 3.6 V and good retention property have been achieved. By varying aggregation distance, sputtering gas pressure and ionization power of the nanocluster source, nanoclusters of Ge with different sizes can be formed. The memory effect of the trilayer structure so formed with 10 nm Ge nanoclusters are manifested by the counter-clockwise hysteresis loop in the C-V curves and a maximum flat-band voltage shift of 5.0 V has been achieved. For comparison purposes, metal nanocrystals have also been investigated by utilizing both of the physical deposition methods as mentioned above. Silver (Ag) nanocrystals with size of 10--40 nm have been embedded in HfAlO matrix in the trilayer capacitor structure and a flat-band voltage shift of 2.0 V has been achieved.

  12. Organic memory device with self-assembly monolayered aptamer conjugated nanoparticles

    NASA Astrophysics Data System (ADS)

    Oh, Sewook; Kim, Minkeun; Kim, Yejin; Jung, Hunsang; Yoon, Tae-Sik; Choi, Young-Jin; Jung Kang, Chi; Moon, Myeong-Ju; Jeong, Yong-Yeon; Park, In-Kyu; Ho Lee, Hyun

    2013-08-01

    An organic memory structure using monolayered aptamer conjugated gold nanoparticles (Au NPs) as charge storage nodes was demonstrated. Metal-pentacene-insulator-semiconductor device was adopted for the non-volatile memory effect through self assembly monolayer of A10-aptamer conjugated Au NPs, which was formed on functionalized insulator surface with prostate-specific membrane antigen protein. The capacitance versus voltage (C-V) curves obtained for the monolayered Au NPs capacitor exhibited substantial flat-band voltage shift (ΔVFB) or memory window of 3.76 V under (+/-)7 V voltage sweep. The memory device format can be potentially expanded to a highly specific capacitive sensor for the aptamer-specific biomolecule detection.

  13. Temperature dependence of frequency response characteristics in organic field-effect transistors

    NASA Astrophysics Data System (ADS)

    Lu, Xubing; Minari, Takeo; Liu, Chuan; Kumatani, Akichika; Liu, J.-M.; Tsukagoshi, Kazuhito

    2012-04-01

    The frequency response characteristics of semiconductor devices play an essential role in the high-speed operation of electronic devices. We investigated the temperature dependence of dynamic characteristics in pentacene-based organic field-effect transistors and metal-insulator-semiconductor capacitors. As the temperature decreased, the capacitance-voltage characteristics showed large frequency dispersion and a negative shift in the flat-band voltage at high frequencies. The cutoff frequency shows Arrhenius-type temperature dependence with different activation energy values for various gate voltages. These phenomena demonstrate the effects of charge trapping on the frequency response characteristics, since decreased mobility prevents a fast charge response for alternating current signals at low temperatures.

  14. On the Relationship Between Schottky Barrier Capacitance and Mixer Performance at Cryogenic Temperatures

    NASA Technical Reports Server (NTRS)

    Romanofsky, Robert R.

    1996-01-01

    The flat-band voltage is the Schottky junction voltage required to shrink the depletion width to zero. At cryogenic temperatures, mixer diodes are generally biased and/or pumped beyond the flat-band condition to minimize conversion loss and noise figure. This occurs despite the presumed sharp increase in junction capacitance near flat-band, which should instead limit mixer performance. Past moderate forward bias, the diode C-V relationship is difficult to measure. A simple analytic expression for C(V) is usually used to model and predict mixer performance. This letter provides experimental data on C(V) at 77 K based on a microwave measurement and modeling technique. Data is also provided on the conversion loss of a singly balanced mixer optimized for 77 K operation. The connection between junction capacitance, flat-band potential, and conversion loss is examined. It is shown that the analytic expression greatly overestimates the junction capacitance that occurs as flat-band is approached.

  15. Universal Correlation between Flatband Voltage and Electron Mobility in TiN/HfSiON Devices with MgO or La2O3 Incorporation and Stack Variation

    NASA Astrophysics Data System (ADS)

    Mise, Nobuyuki; Kadoshima, Masaru; Morooka, Tetsu; Eimori, Takahisa; Nara, Yasuo; Ohji, Yuzuru

    2008-10-01

    We investigated the controversial effective workfunction and electron mobility of TiN/HfSiON devices by intentionally adding MgO or La2O3 into HfSiON and by changing the material on TiN or the TiN thickness. As a result, we found a close relationship between the electron mobility at low effective field and the flatband voltage. This relationship is explained on the basis of the fixed charge in HfSiON and its neutralization. The intrinsic workfunction of TiN/HfSiON without charge is determined to be 4.3 eV from the flatband voltage when the electron mobility at low effective field is the highest.

  16. New method for the extraction of bulk channel mobility and flat-band voltage in junctionless transistors

    NASA Astrophysics Data System (ADS)

    Jeon, Dae-Young; Park, So Jeong; Mouis, Mireille; Barraud, Sylvain; Kim, Gyu-Tae; Ghibaudo, Gérard

    2013-11-01

    A new and simple method for the extraction of electrical parameters in junctionless transistors (JLTs) is presented. The bulk channel mobility (μbulk) and flat-band voltage (Vfb) were successfully extracted from the new method, based on a linear dependence between the inverse of transconductance squared (1/gm2) vs gate voltage in the partially depleted operation regime (Vth < Vg < Vfb). The validity of the new method is also proved by 2D numerical simulation and newly defined Maserjian's-like function for gm of JLT devices.

  17. Titanium-tungsten nanocrystals embedded in a SiO(2)/Al(2)O(3) gate dielectric stack for low-voltage operation in non-volatile memory.

    PubMed

    Yang, Shiqian; Wang, Qin; Zhang, Manhong; Long, Shibing; Liu, Jing; Liu, Ming

    2010-06-18

    Titanium-tungsten nanocrystals (NCs) were fabricated by a self-assembly rapid thermal annealing (RTA) process. Well isolated Ti(0.46)W(0.54) NCs were embedded in the gate dielectric stack of SiO(2)/Al(2)O(3). A metal-oxide-semiconductor (MOS) capacitor was fabricated to investigate its application in a non-volatile memory (NVM) device. It demonstrated a large memory window of 6.2 V in terms of flat-band voltage (V(FB)) shift under a dual-directional sweeping gate voltage of - 10 to 10 V. A 1.1 V V(FB) shift under a low dual-directional sweeping gate voltage of - 4 to 4 V was also observed. The retention characteristic of this MOS capacitor was demonstrated by a 0.5 V memory window after 10(4) s of elapsed time at room temperature. The endurance characteristic was demonstrated by a program/erase cycling test.

  18. Synthesis and electron storage characteristics of isolated silver nanodots on/embedded in Al 2O 3 gate dielectric

    NASA Astrophysics Data System (ADS)

    Wang, Q.; Song, Z. T.; Liu, W. L.; Lin, C. L.; Wang, T. H.

    2004-05-01

    Monolayer-isolated silver (Ag) nanodots with the average diameter down to 7 nm are synthesized on Al 2O 3/Si substrate by vacuum electron-beam evaporation followed by annealing at 400 °C in N 2 ambient. Metal-insulator-silicon (MIS) structures with Ag nanodots embedded in Al 2O 3 gate dielectric are fabricated. Clear electron storage effect with the flatband voltage shift of 1.3 eV is observed through capacitance-conductance and conductance-voltage measurements. Our results demonstrate the feasibility of applying Ag nanodots for nanocrystal floating-gate memory devices.

  19. Capacitance-voltage measurement in memory devices using ferroelectric polymer

    NASA Astrophysics Data System (ADS)

    Nguyen, Chien A.; Lee, Pooi See

    2006-01-01

    Application of thin polymer film as storing mean for non-volatile memory devices is investigated. Capacitance-voltage (C-V) measurement of metal-ferroelectric-metal device using ferroelectric copolymer P(VDF-TrFE) as dielectric layer shows stable 'butter-fly' curve. The two peaks in C-V measurement corresponding to the largest capacitance are coincidental at the coercive voltages that give rise to zero polarization in the polarization hysteresis measurement. By comparing data of C-V and P-E measurement, a correlation between two types of hysteresis is established in which it reveals simultaneous electrical processes occurring inside the device. These processes are caused by the response of irreversible and reversible polarization to the applied electric field that can be used to present a memory window. The memory effect of ferroelectric copolymer is further demonstrated for fabricating polymeric non-volatile memory devices using metal-ferroelectric-insulator-semiconductor structure (MFIS). By applying different sweeping voltages at the gate, bidirectional flat-band voltage shift is observed in the ferroelectric capacitor. The asymmetrical shift after negative sweeping is resulted from charge accumulation at the surface of Si substrate caused by the dipole direction in the polymer layer. The effect is reversed for positive voltage sweeping.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, H. X.; Zhang, T.; Wang, R. X.

    A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfO{sub x} film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfO{sub x} matrix. Pt/Ni-NCs embedded HfO{sub x}/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 10{sup 12} electrons/cm{sup 2}, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 10{sup 4} cycles and excellent retention performance of 10{sup 5} s, fulfilling themore » requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.« less

  1. Charge storage and tunneling mechanism of Ni nanocrystals embedded HfOx film

    NASA Astrophysics Data System (ADS)

    Zhu, H. X.; Zhang, T.; Wang, R. X.; Zhang, Y. Y.; Li, L. T.; Qiu, X. Y.

    2016-05-01

    A nano-floating gate memory structure based on Ni nanocrystals (NCs) embedded HfOx film is deposited by means of radio-frequency magnetron sputtering. Microstructure investigations reveal that self-organized Ni-NCs with diameters of 4-8 nm are well dispersed in amorphous HfOx matrix. Pt/Ni-NCs embedded HfOx/Si/Ag capacitor structures exhibit voltage-dependent capacitance-voltage hysteresis, and a maximum flat-band voltage shift of 1.5 V, corresponding to a charge storage density of 6.0 × 1012 electrons/cm2, is achieved. These capacitor memory cells exhibit good endurance characteristic up to 4 × 104 cycles and excellent retention performance of 105 s, fulfilling the requirements of next generation non-volatile memory devices. Schottky tunneling is proven to be responsible for electrons tunneling in these capacitors.

  2. Electrical hysteresis in p-GaN metal-oxide-semiconductor capacitor with atomic-layer-deposited Al2O3 as gate dielectric

    NASA Astrophysics Data System (ADS)

    Zhang, Kexiong; Liao, Meiyong; Imura, Masataka; Nabatame, Toshihide; Ohi, Akihiko; Sumiya, Masatomo; Koide, Yasuo; Sang, Liwen

    2016-12-01

    The electrical hysteresis in current-voltage (I-V) and capacitance-voltage characteristics was observed in an atomic-layer-deposited Al2O3/p-GaN metal-oxide-semiconductor capacitor (PMOSCAP). The absolute minimum leakage currents of the PMOSCAP for forward and backward I-V scans occurred not at 0 V but at -4.4 and +4.4 V, respectively. A negative flat-band voltage shift of 5.5 V was acquired with a capacitance step from +4.4 to +6.1 V during the forward scan. Mg surface accumulation on p-GaN was demonstrated to induce an Mg-Ga-Al-O oxidized layer with a trap density on the order of 1013 cm-2. The electrical hysteresis is attributed to the hole trapping and detrapping process in the traps of the Mg-Ga-Al-O layer via the Poole-Frenkel mechanism.

  3. Subthreshold characteristics of pentacene field-effect transistors influenced by grain boundaries

    NASA Astrophysics Data System (ADS)

    Park, Jaehoon; Jeong, Ye-Sul; Park, Kun-Sik; Do, Lee-Mi; Bae, Jin-Hyuk; Sun Choi, Jong; Pearson, Christopher; Petty, Michael

    2012-05-01

    Grain boundaries in polycrystalline pentacene films significantly affect the electrical characteristics of pentacene field-effect transistors (FETs). Upon reversal of the gate voltage sweep direction, pentacene FETs exhibited hysteretic behaviours in the subthreshold region, which was more pronounced for the FET having smaller pentacene grains. No shift in the flat-band voltage of the metal-insulator-semiconductor capacitor elucidates that the observed hysteresis was mainly caused by the influence of localized trap states existing at pentacene grain boundaries. From the results of continuous on/off switching operation of the pentacene FETs, hole depletion during the off period is found to be limited by pentacene grain boundaries. It is suggested that the polycrystalline nature of a pentacene film plays an important role on the dynamic characteristics of pentacene FETs.

  4. Kinetics of Ta ions penetration into porous low-k dielectrics under bias-temperature stress

    NASA Astrophysics Data System (ADS)

    He, Ming; Ou, Ya; Wang, Pei-I.; Lu, Toh-Ming

    2010-05-01

    It is known that Ta, a popular diffusion barrier material, can itself penetrate into low-k dielectrics under bias-temperature stress. In this work, we derived a model which directly correlates the diffusivity of Ta ions to the rate of flatband voltage shift (FBS) of the Ta/methyl silsesquixane (MSQ)/Si capacitors. From our experimentally measured constant FBS rate, the Ta diffusivity and activation energy were determined. It appears that an increase in the porosity of MSQ film enhances the Ta diffusivity but does not affect the associated activation energy. This suggests the Ta ion diffusion is mainly through interconnected pore surfaces.

  5. Effect of gamma-ray irradiation on the surface states of MOS tunnel junctions

    NASA Technical Reports Server (NTRS)

    Ma, T. P.; Barker, R. C.

    1974-01-01

    Gamma-ray irradiation with doses up to 8 megarad produces no significant change on either the C(V) or the G(V) characteristics of MOS tunnel junctions with intermediate oxide thicknesses (40-60 A), whereas the expected flat-band shift toward negative electrode voltages occurs in control thick oxide capacitors. A simple tunneling model would explain the results if the radiation-generated hole traps are assumed to lie below the valence band of the silicon. The experiments also suggest that the observed radiation-generated interface states in conventional MOS devices are not due to the radiation damage of the silicon surface.

  6. Carrier transport in flexible organic bistable devices of ZnO nanoparticles embedded in an insulating poly(methyl methacrylate) polymer layer.

    PubMed

    Son, Dong-Ick; Park, Dong-Hee; Choi, Won Kook; Cho, Sung-Hwan; Kim, Won-Tae; Kim, Tae Whan

    2009-05-13

    The bistable effects of ZnO nanoparticles embedded in an insulating poly(methyl methacrylate) (PMMA) polymer single layer by using flexible polyethylene terephthalate (PET) substrates were investigated. Transmission electron microscopy (TEM) images revealed that ZnO nanoparticles were formed inside the PMMA polymer layer. Current-voltage (I-V) measurement on the Al/ZnO nanoparticles embedded in an insulating PMMA polymer layer/ITO/PET structures at 300 K showed a nonvolatile electrical bistability behavior with a flat-band voltage shift due to the existence of the ZnO nanoparticles, indicative of trapping, storing, and emission of charges in the electronic states of the ZnO nanoparticles. The carrier transport mechanism of the bistable behavior for the fabricated organic bistable device (OBD) structures is described on the basis of the I-V results by analyzing the effect of space charge.

  7. Atomic layer deposition of insulating nitride interfacial layers for germanium metal oxide semiconductor field effect transistors with high-κ oxide/tungsten nitride gate stacks

    NASA Astrophysics Data System (ADS)

    Kim, Kyoung H.; Gordon, Roy G.; Ritenour, Andrew; Antoniadis, Dimitri A.

    2007-05-01

    Atomic layer deposition (ALD) was used to deposit passivating interfacial nitride layers between Ge and high-κ oxides. High-κ oxides on Ge surfaces passivated by ultrathin (1-2nm) ALD Hf3N4 or AlN layers exhibited well-behaved C-V characteristics with an equivalent oxide thickness as low as 0.8nm, no significant flatband voltage shifts, and midgap density of interface states values of 2×1012cm-1eV-1. Functional n-channel and p-channel Ge field effect transistors with nitride interlayer/high-κ oxide/metal gate stacks are demonstrated.

  8. Capacitance-voltage analysis of electrical properties for WSe2 field effect transistors with high-k encapsulation layer

    NASA Astrophysics Data System (ADS)

    Ko, Seung-Pil; Shin, Jong Mok; Jang, Ho Kyun; You, Min Youl; Jin, Jun-Eon; Choi, Miri; Cho, Jiung; Kim, Gyu-Tae

    2018-02-01

    Doping effects in devices based on two-dimensional (2D) materials have been widely studied. However, detailed analysis and the mechanism of the doping effect caused by encapsulation layers has not been sufficiently explored. In this work, we present experimental studies on the n-doping effect in WSe2 field effect transistors (FETs) with a high-k encapsulation layer (Al2O3) grown by atomic layer deposition. In addition, we demonstrate the mechanism and origin of the doping effect. After encapsulation of the Al2O3 layer, the threshold voltage of the WSe2 FET negatively shifted with the increase of the on-current. The capacitance-voltage measurements of the metal insulator semiconductor (MIS) structure proved the presence of the positive fixed charges within the Al2O3 layer. The flat-band voltage of the MIS structure of Au/Al2O3/SiO2/Si was shifted toward the negative direction on account of the positive fixed charges in the Al2O3 layer. Our results clearly revealed that the fixed charges in the Al2O3 encapsulation layer modulated the Fermi energy level via the field effect. Moreover, these results possibly provide fundamental ideas and guidelines to design 2D materials FETs with high-performance and reliability.

  9. Mechanism of formation of the response of a hydrogen gas sensor based on a silicon MOS diode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gaman, V. I.; Balyuba, V. I.; Gritsyk, V. Yu.

    2008-03-15

    Experimental data on the dependence of the flat-band voltage and relaxation time for the capacitance of the space-charge region in an MOS diode (Pd-SiO{sub 2}-n-Si) on the hydrogen concentration in a hydrogen/air gaseous mixture are discussed. It is assumed that variation in the flat-band voltage U{sub fb} in an MOS structure with the thickness d = 369 nm subjected to a hydrogen/air gaseous mixture can be accounted for by the formation of dipoles in the Pd-SiO{sub 2} gap due to polarization of hydrogen atoms (H{sub a}). An analytical expression describing the dependence of variation in the flat-band voltage {Delta}U{sub fb}more » on the hydrogen concentration n{sub H{sub 2}} was derived. In MOS structures with d {<=} 4 nm (or MOS diodes), the value of {Delta}U{sub fb} is mainly controlled by passivation of the centers responsible for the presence of the surface acceptor-type centers at the SiO{sub 2}-n-Si interface by hydrogen atoms. Analytical expressions describing the dependences of {Delta}U{sub fb} and the capacitance relaxation time in the space-charge region on n{sub H{sub 2}} are derived. The values of the density of adsorption centers and the adsorption heat for hydrogen atoms at the Pd-SiO{sub 2} and SiO{sub 2}-n-Si interfaces are found.« less

  10. Mechanism of formation of the response of a hydrogen gas sensor based on a silicon MOS diode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gaman, V. I.; Balyuba, V. I.; Gritsyk, V. Yu.

    2008-03-15

    Experimental data on the dependence of the flat-band voltage and relaxation time for the capacitance of the space-charge region in an MOS diode (Pd-SiO{sub 2}-n-Si) on the hydrogen concentration in a hydrogen/air gaseous mixture are discussed. It is assumed that variation in the flat-band voltage U{sub fb} in an MOS structure with the thickness d = 369 nm subjected to a hydrogen/air gaseous mixture can be accounted for by the formation of dipoles in the Pd-SiO{sub 2} gap due to polarization of hydrogen atoms (H{sub a}). An analytical expression describing the dependence of variation in the flat-band voltage {delta}U{sub fb}more » on the hydrogen concentration n{sub H2} was derived. In MOS structures with d {<=} 4 nm (or MOS diodes), the value of {delta}U{sub fb} is mainly controlled by passivation of the centers responsible for the presence of the surface acceptor-type centers at the SiO{sub 2}-n-Si interface by hydrogen atoms. Analytical expressions describing the dependences of {delta}U{sub fb} and the capacitance relaxation time in the space-charge region on n{sub H2} are derived. The values of the density of adsorption centers and the adsorption heat for hydrogen atoms at the Pd-SiO{sub 2} and SiO{sub 2}-n-Si interfaces are found.« less

  11. Flat-Band Slow Light in a Photonic Crystal Slab Waveguide by Vertical Geometry Adjustment and Selective Infiltration of Optofluidics

    NASA Astrophysics Data System (ADS)

    Mansouri-Birjandi, Mohammad Ali; Janfaza, Morteza; Tavousi, Alireza

    2017-11-01

    In this paper, a photonic crystal slab waveguide (PhCSW) for slow light applications is presented. To obtain widest possible flat-bands of slow light regions—regions with large group index ( n g), and very low group velocity dispersion (GVD)—two core parameters of PhCSW structure are investigated. The design procedure is based on vertical shifting of the first row of the air holes adjacent to the waveguide center and concurrent selective optofluidic infiltration of the second row. The criteria of < n_g > ± 10% variations is used for ease of definition and comparison of flat-band regions. By applying various geometry optimizations for the first row, our results suggest that a waveguide core of W 1.09 would provide a reasonable wide flat-band. Furthermore, infiltration of optofluidics in the second row alongside with geometry adjustments of the first row result in flexible control of 10 < n g < 32 and provide flat-band regions with large bandwidth (10 nm < Δ λ < 21.5 nm). Also, negligible GVD as low as β 2 = 10-24 (s2/m) is achieved. Numerical simulations are calculated by means of the three-dimensional plane wave expansion method.

  12. Effect of Embedded Pd Microstructures on the Flat-Band-Voltage Operation of Room Temperature ZnO-Based Liquid Petroleum Gas Sensors

    PubMed Central

    Ali, Ghusoon M.; Thompson, Cody V.; Jasim, Ali K.; Abdulbaqi, Isam M.; Moore, James C.

    2013-01-01

    Three methods were used to fabricate ZnO-based room temperature liquid petroleum gas (LPG) sensors having interdigitated metal-semiconductor-metal (MSM) structures. Specifically, devices with Pd Schottky contacts were fabricated with: (1) un-doped ZnO active layers; (2) Pd-doped ZnO active layers; and (3) un-doped ZnO layers on top of Pd microstructure arrays. All ZnO films were grown on p-type Si(111) substrates by the sol-gel method. For devices incorporating a microstructure array, Pd islands were first grown on the substrate by thermal evaporation using a 100 μm mesh shadow mask. We have estimated the sensitivity of the sensors for applied voltage from –5 to 5 V in air ambient, as well as with exposure to LPG in concentrations from 500 to 3,500 ppm at room temperature (300 K). The current-voltage characteristics were studied and parameters such as leakage current, barrier height, reach-through voltage, and flat-band voltage were extracted. We include contributions due to the barrier height dependence on the electric field and tunneling through the barrier for the studied MSM devices. The Pd-enhanced devices demonstrated a maximum gas response at flat-band voltages. The study also revealed that active layers consisting of Pd microstructure embedded ZnO films resulted in devices exhibiting greater gas-response as compared to those using Pd-doped ZnO thin films or un-doped active layers.

  13. The Co-60 gamma-ray irradiation effects on the Al/HfSiO4/p-Si/Al MOS capacitors

    NASA Astrophysics Data System (ADS)

    Lok, R.; Kaya, S.; Karacali, H.; Yilmaz, E.

    2017-12-01

    In this work, the initial interface trap density (Nit) to examine device compability for microelectronics and then the Co-60 gamma irradiation responses of Al/HfSiO4/p-Si/Al (MOS) capacitors were investigated in various dose ranges up to 70 Gy. Pre-irradiation response of the devices was evaluated from high frequency (HF) and low frequency (LF) capacitance method and the Nit was calculated as 9.91 × 1011 cm-2 which shows that the HfSiO4/p-Si interface quality is convenient for microelectronics applications. The irradiation responses of the devices were carried out from flat-band and mid-gap voltage shifts obtained from stretch of capacitance characteristics prior to and after irradiation. The results show that the flat band voltages very slightly shifted to positive voltage values demonstrating the enhancement of negative charge trapping in device structure. The sensitivity of the Al/HfSiO4/p-Si/Al MOS capacitors was found to be 4.41 mV/Gy for 300 nm-thick HfSiO4 gate dielectrics. This value approximately 6.5 times smaller compared to the same thickness conventional SiO2 based MOS devices. Therefore, HfSiO4 exhibits crucial irradiation tolerance in gamma irradiation environment. Consequently, HfSiO4 dielectrics may have significant usage for microelectronic technology as a radiation hard material where radiation field exists such as in space applications.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurishima, Kazunori, E-mail: ce41034@meiji.ac.jp; Nabatame, Toshihide, E-mail: NABATAME.Toshihide@nims.go.jp; Shimizu, Maki

    To investigate the influence of ionic/covalent interface of Al{sub 2}O{sub 3}/SiO{sub 2} gate insulator on the electrical properties of thin-film transistors (TFTs) with ionic Ga-In-Zn-O (GIZO) semiconducting channel layers, Al{sub 2}O{sub 3} layers of different thickness were introduced between SiO{sub 2} and GIZO using plasma-enhanced atomic layer deposition. The GIZO layers were obtained by DC magnetron sputtering using a GIZO target (Ga:In:Zn = 1:1:1 mol. %). The GIZO TFTs with an Al{sub 2}O{sub 3}/SiO{sub 2} gate insulator exhibited positive threshold voltage (V{sub th}) shift (about 1.1 V), V{sub th} hysteresis suppression (0.23 V), and electron mobility degradation (about 13%) compared with thosemore » of a GIZO TFT with SiO{sub 2} gate insulator by the influence of ionic/ionic and ionic/covalent interface at Al{sub 2}O{sub 3}/GIZO and Al{sub 2}O{sub 3}/SiO{sub 2}, respectively. To clarify the origin of the positive V{sub th} shift, the authors estimated the shifts of flatband voltage (0.4 V) due to the dipole and the fixed charge (−1.1 × 10{sup 11}/cm{sup 2}) at Al{sub 2}O{sub 3}/SiO{sub 2} interface, from capacitance–voltage data for Pt/Al{sub 2}O{sub 3}/SiO{sub 2}/p-Si capacitors. Based on these experimental data, the authors found that the positive V{sub th} shift (1.1 V) could be divided into three components: the dipole (−0.4 V) and fixed charge (0.15 V) at the SiO{sub 2}/Al{sub 2}O{sub 3} interface, and the fixed charge (1.35 V) at the Al{sub 2}O{sub 3}/GIZO interface. Finally, it is noted that heterointerface of SiO{sub 2}/Al{sub 2}O{sub 3}/GIZO stacks is important not only to recognize mechanism of V{sub th} shift but also to design future TFTs with high-k dielectrics and low operating voltage.« less

  15. Fabrication of Total-Dose-Radiation-Hardened (TDRH) SOI wafer with embedded silicon nanoclusters

    NASA Astrophysics Data System (ADS)

    Wu, Aimin; Wang, Xi; Wei, Xing; Chen, Jing; Chen, Ming; Zhang, Zhengxuan

    2009-05-01

    Si ion-implantation and post annealing of silicon wafers prior to wafer bonding were used to radiation-harden the thermal oxide layer of Silicon on Insulator structures. After grinding and polishing, Total-Dose-Radiation-Hardened SOI (TDRH-SOI) wafers with several-micron-thick device layers were prepared. Electrical characterization before and after X-ray irradiation showed that the flatband voltage shift induced by irradiation was reduced by this preprocessing. Photoluminescence Spectroscopy (PL), Transmission Electron Microscopy (TEM) and X-ray photoelectron spectroscopy (XPS) results indicated that the improvement of the total dose response of the TDRH-SOI wafer was associated with formation of Si nanoclusters in the implanted oxide layer, suggesting that these were the likely candidates for electron and proton trapping centers that reduce the positive charge buildup effect in the buried oxide.

  16. Evaluation of GeO desorption behavior in the metalGeO(2)Ge structure and its improvement of the electrical characteristics.

    PubMed

    Oniki, Yusuke; Koumo, Hideo; Iwazaki, Yoshitaka; Ueno, Tomo

    2010-06-15

    The relation between germanium monoxide (GeO) desorption and either improvement or deterioration in electrical characteristics of metalGeO(2)Ge capacitors fabricated by thermal oxidation has been investigated. In the metalGeO(2)Ge stack, two processes of GeO desorption at different sites and at different temperatures were observed by thermal desorption spectroscopy measurements. The electrical characteristics of as-oxidized metalGeO(2)Ge capacitors shows a large flat-band voltage shift and minority carrier generation due to the GeO desorption from the GeO(2)Ge interface during oxidation of Ge substrates. On the other hand, the electrical properties were drastically improved by a postmetallization annealing at low temperature resulting in a metal catalyzed GeO desorption from the top interface.

  17. Effects of post-deposition annealing on sputtered SiO2/4H-SiC metal-oxide-semiconductor

    NASA Astrophysics Data System (ADS)

    Lee, Suhyeong; Kim, Young Seok; Kang, Hong Jeon; Kim, Hyunwoo; Ha, Min-Woo; Kim, Hyeong Joon

    2018-01-01

    Reactive sputtering followed by N2, NH3, O2, and NO post-deposition annealing (PDA) of SiO2 on 4H-SiC was investigated in this study. The results of ellipsometry, an etching test, and X-ray photoemission spectroscopy showed that N2 and NH3 PDA nitrified the SiO2. Devices using N2 and NH3 PDA exhibited a high gate leakage current and low breakdown field due to oxygen vacancies and incomplete oxynitride. SiO2/4H-SiC MOS capacitors were also fabricated and their electrical characteristics measured. The average breakdown fields of the devices using N2, NH3, O2, and NO PDA were 0.12, 0.17, 4.71 and 2.63 MV/cm, respectively. The shifts in the flat-band voltage after O2 and NO PDA were 0.95 and -2.56 V, respectively, compared with the theoretical value. The extracted effective oxide charge was -4.11 × 1011 cm-2 for O2 PDA and 1.11 × 1012 cm-2 for NO PDA. NO PDA for 2 h at 1200 °C shifted the capacitance-voltage curve in the negative direction. The oxygen containing PDA showed better electrical properties than non-oxygen PDA. The sputtering method described can be applied to 4H-SiC MOS fabrication.

  18. Evaluation of GeO desorption behavior in the metal∕GeO2∕Ge structure and its improvement of the electrical characteristics

    PubMed Central

    Oniki, Yusuke; Koumo, Hideo; Iwazaki, Yoshitaka; Ueno, Tomo

    2010-01-01

    The relation between germanium monoxide (GeO) desorption and either improvement or deterioration in electrical characteristics of metal∕GeO2∕Ge capacitors fabricated by thermal oxidation has been investigated. In the metal∕GeO2∕Ge stack, two processes of GeO desorption at different sites and at different temperatures were observed by thermal desorption spectroscopy measurements. The electrical characteristics of as-oxidized metal∕GeO2∕Ge capacitors shows a large flat-band voltage shift and minority carrier generation due to the GeO desorption from the GeO2∕Ge interface during oxidation of Ge substrates. On the other hand, the electrical properties were drastically improved by a postmetallization annealing at low temperature resulting in a metal catalyzed GeO desorption from the top interface. PMID:20644659

  19. Combinatorial study of Ni-Ti-Pt ternary metal gate electrodes on HfO{sub 2} for the advanced gate stack

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, K.-S.; Green, M. L.; Suehle, J.

    2006-10-02

    The authors have fabricated combinatorial Ni-Ti-Pt ternary metal gate thin film libraries on HfO{sub 2} using magnetron co-sputtering to investigate flatband voltage shift ({delta}V{sub fb}), work function ({phi}{sub m}), and leakage current density (J{sub L}) variations. A more negative {delta}V{sub fb} is observed close to the Ti-rich corner than at the Ni- and Pt-rich corners, implying smaller {phi}{sub m} near the Ti-rich corners and higher {phi}{sub m} near the Ni- and Pt-rich corners. In addition, measured J{sub L} values can be explained consistently with the observed {phi}{sub m} variations. Combinatorial methodologies prove to be useful in surveying the large compositionalmore » space of ternary alloy metal gate electrode systems.« less

  20. Mobile patient monitoring based on impedance-loaded SAW-sensors.

    PubMed

    Karilainen, Anna; Finnberg, Thomas; Uelzen, Thorsten; Dembowski, Klaus; Müller, Jörg

    2004-11-01

    A remotely requestable, passive, short-range sensor network for measuring small voltages is presented. The sensor system is able to simultaneously monitor six small voltages in millivolt-range, and it can be used for Holter-electrocardiogram (ECG) and other biopotential monitoring, or in industrial applications. The sensors are based on a surface acoustic wave (SAW) delay line with voltage-dependent, impedance loading on a reflector interdigital transducer (IDT). The load circuit impedance is varied by the capacitance of the voltage-controlled varactor. High resolution is achieved by developing a MOS-capacitor with a thin oxide, low flat-band voltage, and zero-voltage capacitance in the space-charge region, as well as a high-Q-microcoil by thick metal electroplating. Simultaneous monitoring of multiple potentials is realized by time-division-multiplexing of different sensor signals.

  1. Computer Aided Design of Integrated Circuit Fabrication Processes for VLSI Devices

    DTIC Science & Technology

    1981-07-01

    observed in the growth kinetics on N -type and P -type samples whether (100)- or (111)-oriented. Fig. 5 (100) and 6 (111) show the oxidation rate obtained...9, and 10 show Vfb vs. xox for (100), (111), N -type and P -type samples. The values of@MS obtained in the different cases are shown in Fig. 11, where...voltage vs. oxide thickness for (100) N -type wafers oxidized at 1000 0C and fast pulled from 02 ambient. FLATBAND VOLTAGE vs OXIDE THICKNESS -0.2 (100), P

  2. Effect of surface fields on the dynamic resistance of planar HgCdTe mid-wavelength infrared photodiodes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Kai; Wang, Xi; Zhang, Peng

    2015-05-28

    This work investigates the effect of surface fields on the dynamic resistance of a planar HgCdTe mid-wavelength infrared photodiode from both theoretical and experimental aspects, considering a gated n-on-p diode with the surface potential of its p-region modulated. Theoretical models of the surface leakage current are developed, where the surface tunnelling current in the case of accumulation is expressed by modifying the formulation of bulk tunnelling currents, and the surface channel current for strong inversion is simulated with a transmission line method. Experimental data from the fabricated devices show a flat-band voltage of V{sub FB}=−5.7 V by capacitance-voltage measurement, and thenmore » the physical parameters for bulk properties are determined from the resistance-voltage characteristics of the diode working at a flat-band gate voltage. With proper values of the modeling parameters such as surface trap density and channel electron mobility, the theoretical R{sub 0}A product and corresponding dark current calculated from the proposed model as functions of the gate voltage V{sub g} demonstrate good consistency with the measured values. The R{sub 0}A product remarkably degenerates when V{sub g} is far below or above V{sub FB} because of the surface tunnelling current or channel current, respectively; and it attains the maximum value of 5.7×10{sup 7} Ω · cm{sup 2} around the transition between surface depletion and weak inversion when V{sub g}≈−4 V, which might result from reduced generation-recombination current.« less

  3. Flash Memory Featuring Low-Voltage Operation by Crystalline ZrTiO4 Charge-Trapping Layer

    NASA Astrophysics Data System (ADS)

    Shen, Yung-Shao; Chen, Kuen-Yi; Chen, Po-Chun; Chen, Teng-Chuan; Wu, Yung-Hsien

    2017-03-01

    Crystalline ZrTiO4 (ZTO) in orthorhombic phase with different plasma treatments was explored as the charge-trapping layer for low-voltage operation flash memory. For ZTO without any plasma treatment, even with a high k value of 45.2, it almost cannot store charges due the oxygen vacancies-induced shallow-level traps that make charges easy to tunnel back to Si substrate. With CF4 plasma treatment, charge storage is still not improved even though incorporated F atoms could introduce additional traps since the F atoms disappear during the subsequent thermal annealing. On the contrary, nevertheless the k value degrades to 40.8, N2O plasma-treated ZTO shows promising performance in terms of 5-V hysteresis memory window by ±7-V sweeping voltage, 2.8-V flatband voltage shift by programming at +7 V for 100 μs, negligible memory window degradation with 105 program/erase cycles and 81.8% charge retention after 104 sec at 125 °C. These desirable characteristics are ascribed not only to passivation of oxygen vacancies-related shallow-level traps but to introduction of a large amount of deep-level bulk charge traps which have been proven by confirming thermally excited process as the charge loss mechanism and identifying traps located at energy level beneath ZTO conduction band by 0.84 eV~1.03 eV.

  4. Flash Memory Featuring Low-Voltage Operation by Crystalline ZrTiO4 Charge-Trapping Layer.

    PubMed

    Shen, Yung-Shao; Chen, Kuen-Yi; Chen, Po-Chun; Chen, Teng-Chuan; Wu, Yung-Hsien

    2017-03-08

    Crystalline ZrTiO 4 (ZTO) in orthorhombic phase with different plasma treatments was explored as the charge-trapping layer for low-voltage operation flash memory. For ZTO without any plasma treatment, even with a high k value of 45.2, it almost cannot store charges due the oxygen vacancies-induced shallow-level traps that make charges easy to tunnel back to Si substrate. With CF 4 plasma treatment, charge storage is still not improved even though incorporated F atoms could introduce additional traps since the F atoms disappear during the subsequent thermal annealing. On the contrary, nevertheless the k value degrades to 40.8, N 2 O plasma-treated ZTO shows promising performance in terms of 5-V hysteresis memory window by ±7-V sweeping voltage, 2.8-V flatband voltage shift by programming at +7 V for 100 μs, negligible memory window degradation with 10 5 program/erase cycles and 81.8% charge retention after 10 4  sec at 125 °C. These desirable characteristics are ascribed not only to passivation of oxygen vacancies-related shallow-level traps but to introduction of a large amount of deep-level bulk charge traps which have been proven by confirming thermally excited process as the charge loss mechanism and identifying traps located at energy level beneath ZTO conduction band by 0.84 eV~1.03 eV.

  5. Characteristics of Reduced Graphene Oxide Quantum Dots for a Flexible Memory Thin Film Transistor.

    PubMed

    Kim, Yo-Han; Lee, Eun Yeol; Lee, Hyun Ho; Seo, Tae Seok

    2017-05-17

    Reduced graphene oxide quantum dot (rGOQD) devices in formats of capacitor and thin film transistor (TFT) were demonstrated and examined as the first trial to achieve nonambipolar channel property. In addition, through a gold nanoparticle (Au NP) layer embedded between the rGOQD active channel and dielectric layer, memory capacitor and TFT performances were realized by capacitance-voltage (C-V) hysteresis and gate program, erase, and reprogram biases. First, capacitor structure of the rGOQD memory device was constructed to examine memory charging effect featured in hysteretic C-V behavior with a 30 nm dielectric layer of cross-linked poly(vinyl alcohol). For the intervening Au NP charging layer, self-assembled monolayer (SAM) formation of the Au NP was executed to utilize electrostatic interaction by a dip-coating process under ambient environments with a conformal fabrication uniformity. Second, the rGOQD memory TFT device was also constructed in the same format of the Au NPs SAMs on a flexible substrate. Characteristics of the rGOQD TFT output showed novel saturation curves unlike typical graphene-based TFTs. However, The rGOQD TFT device reveals relatively low on/off ratio of 10 1 and mobility of 5.005 cm 2 /V·s. For the memory capacitor, the flat-band voltage shift (ΔV FB ) was measured as 3.74 V for ±10 V sweep, and for the memory TFT, the threshold voltage shift (ΔV th ) by the Au NP charging was detected as 7.84 V. In summary, it was concluded that the rGOQD memory device could accomplish an ideal graphene-based memory performance, which could have provided a wide memory window and saturated output characteristics.

  6. Model for thickness dependence of radiation charging in MOS structures

    NASA Technical Reports Server (NTRS)

    Viswanathan, C. R.; Maserjian, J.

    1976-01-01

    The model considers charge buildup in MOS structures due to hole trapping in the oxide and the creation of sheet charge at the silicon interface. The contribution of hole trapping causes the flatband voltage to increase with thickness in a manner in which square and cube dependences are limiting cases. Experimental measurements on samples covering a 200 - 1000 A range of oxide thickness are consistent with the model, using independently obtained values of hole-trapping parameters. An important finding of our experimental results is that a negative interface charge contribution due to surface states created during irradiation compensates most of the positive charge in the oxide at flatband. The tendency of the surface states to 'track' the positive charge buildup in the oxide, for all thicknesses, applies both in creation during irradiation and in annihilation during annealing. An explanation is proposed based on the common defect origin of hole traps and potential surface states.

  7. Fabrication and Properties of a Metal-Insulator - Type Oxygen Sensor Using Lanthanum Trifluoride as the Sole Dielectric.

    NASA Astrophysics Data System (ADS)

    Mattingly, William Brashear, III

    1995-01-01

    Oxygen sensors were fabricated using a metal-insulator -semiconductor construction where the sole 'insulator' is a thin film of LaF_3, an ionic conductor. The typical oxide or nitride layers were eliminated producing a simple Pt/LaF_3/Si design. LaF_3 films, 200-300nm thick, were directly deposited on n-type Si(111) using a high temperature effusion cell in an ultra high vacuum MBE chamber. The film morphology could be controlled from polycrystalline to near single crystal epitaxy. Epitaxial films exhibited a single relaxed variant with the LaF _3 c-axis normal to the silicon surface and the in-plane LaF_3(10^ -10) parallel to Si(110). Polycrystalline films also showed a high degree of LaF_3 c-axis normal texture. Films doped with strontium were also produced. Polycrystalline films were more robust and fabricated into MIS (metal-insulator-semiconductor) capacitors. Capacitance voltage tests of the devices demonstrate nearly ideal MIS capacitor behavior. The flatband voltages were typically within 300mV of the calculated value. Bias challenge tests developed in the lab showed less than 70mV flatband voltage shift. The dielectric constant of undoped LaF_3 films measured close to 14. Doped films, rm Sr_{x}La_ {1-x}F_3 x =.06, showed a dielectric constant of 275, at 100kHz. Oxygen partial pressure tests were performed with mixtures of dry nitrogen and dry oxygen. Oxygen partial pressures were varied between 2.5 times 10^{-4} and 1.0 atmosphere. The steady state data are consistent with a Pt/LaF _3 interface adsorption mechanism, where the work function of the platinum gate metal is modulated. The mechanism is not a half-cell Nernst-type response. Langmiur isotherm fitted data indicate the response range for undoped devices is 0.3 V. Signal drift was less than 5 mV/day. The metal free-surface reactions and the dipole species at the Pt/LaF_3 interface are yet to be determined. Device kinetic studies show the time required for full equilibration after a step in oxygen partial pressure is 24 hours at 90^circC. Initial response kinetics to downward steps in oxygen show the activation energy of the process is 0.54 eV.

  8. Nonvolatile memory characteristics of organic thin film transistors using poly(2-hydroxyethyl methacrylate)-based polymer multilayer dielectric

    NASA Astrophysics Data System (ADS)

    Chen, Ying-Chih; Su, Yan-Kuin; Yu, Hsin-Chieh; Huang, Chun-Yuan; Huang, Tsung-Syun

    2011-10-01

    A wide hysteresis width characteristic (memory window) was observed in the organic thin film transistors (OTFTs) using poly(2-hydroxyethyl methacrylate) (PHEMA)-based polymer multilayers. In this study, a strong memory effect was also found in the pentacene-based OTFTs and the electric characteristics were improved by introducing PHEMA/poly(methyl methacrylate) (PMMA)/PHEMA trilayer to replace the conventional PHEMA monolayer or PMMA/PHEMA and PHEMA/PMMA bilayer as the dielectric layers of OTFTs. The memory effect was originated from the electron trapping and slow polarization of the dielectrics. The hydroxyl (-OH) groups inside the polymer dielectric were the main charge storage sites of the electrons. This charge-storage phenomenon could lead to a wide flat-band voltage shift (memory window, △VFB = 22 V) which is essential for the OTFTs' memory-related applications. Moreover, the fabricated transistors also exhibited significant switchable channel current due to the charge-storage and slow charge relaxation.

  9. Electrical characterization of ALD HfO2 high-k dielectrics on ( 2 ¯ 01) β-Ga2O3

    NASA Astrophysics Data System (ADS)

    Shahin, David I.; Tadjer, Marko J.; Wheeler, Virginia D.; Koehler, Andrew D.; Anderson, Travis J.; Eddy, Charles R.; Christou, Aris

    2018-01-01

    The electrical quality of HfO2 dielectrics grown by thermal atomic layer deposition at 175 °C on n-type ( 2 ¯ 01) β-Ga2O3 has been studied through capacitance- and current-voltage measurements on metal-oxide-semiconductor capacitors. These capacitors exhibited excellent electrical characteristics, including dual-sweep capacitance-voltage curves with low hysteresis and stretch-out and a frequency-stable dielectric constant of k˜14 when measured between 10 kHz and 1 MHz. The C-V curves exhibited a uniform and repeatable +1.05 V shift relative to the ideal case when swept from 3.5 to -5 V, yielding positively measured flatband (+2.15 V) and threshold (+1.05 V) voltages that may be useful for normally off n-channel Ga2O3 devices. Using the Terman method, an average interface trap density of 1.3 × 1011 cm-2.eV-1 was obtained between 0.2 and 0.6 eV below the conduction band edge. The forward bias current-voltage characteristic was successfully fitted to the Fowler-Nordheim tunneling model at a field strength of 5 MV/cm, allowing an extraction of a 1.3 eV conduction band offset between HfO2 and Ga2O3, which matches the value previously determined from x-ray photoelectron spectroscopy. However, a temperature dependence in the leakage current was observed. These results suggest that HfO2 is an appealing dielectric for Ga2O3 device applications.

  10. Hysteresis in Lanthanide Aluminum Oxides Observed by Fast Pulse CV Measurement

    PubMed Central

    Zhao, Chun; Zhao, Ce Zhou; Lu, Qifeng; Yan, Xiaoyi; Taylor, Stephen; Chalker, Paul R.

    2014-01-01

    Oxide materials with large dielectric constants (so-called high-k dielectrics) have attracted much attention due to their potential use as gate dielectrics in Metal Oxide Semiconductor Field Effect Transistors (MOSFETs). A novel characterization (pulse capacitance-voltage) method was proposed in detail. The pulse capacitance-voltage technique was employed to characterize oxide traps of high-k dielectrics based on the Metal Oxide Semiconductor (MOS) capacitor structure. The variation of flat-band voltages of the MOS structure was observed and discussed accordingly. Some interesting trapping/detrapping results related to the lanthanide aluminum oxide traps were identified for possible application in Flash memory technology. After understanding the trapping/detrapping mechanism of the high-k oxides, a solid foundation was prepared for further exploration into charge-trapping non-volatile memory in the future. PMID:28788225

  11. Interfacial Cation-Defect Charge Dipoles in Stacked TiO2/Al2O3 Gate Dielectrics.

    PubMed

    Zhang, Liangliang; Janotti, Anderson; Meng, Andrew C; Tang, Kechao; Van de Walle, Chris G; McIntyre, Paul C

    2018-02-14

    Layered atomic-layer-deposited and forming-gas-annealed TiO 2 /Al 2 O 3 dielectric stacks, with the Al 2 O 3 layer interposed between the TiO 2 and a p-type germanium substrate, are found to exhibit a significant interface charge dipole that causes a ∼-0.2 V shift of the flat-band voltage and suppresses the leakage current density for gate injection of electrons. These effects can be eliminated by the formation of a trilayer dielectric stack, consistent with the cancellation of one TiO 2 /Al 2 O 3 interface dipole by the addition of another dipole of opposite sign. Density functional theory calculations indicate that the observed interface-dependent properties of TiO 2 /Al 2 O 3 dielectric stacks are consistent in sign and magnitude with the predicted behavior of Al Ti and Ti Al point-defect dipoles produced by local intermixing of the Al 2 O 3 /TiO 2 layers across the interface. Evidence for such intermixing is found in both electrical and physical characterization of the gate stacks.

  12. Initial results from a cryogenic proton irradiation of a p-channel CCD

    NASA Astrophysics Data System (ADS)

    Gow, J. P. D.; Wood, D.; Burt, D.; Hall, D. J.; Dryer, B.; Holland, A. D.; Murray, N. J.

    2015-08-01

    The displacement damage hardness that can be achieved using p-channel charge coupled devices (CCD) was originally demonstrated in 1997 and since then a number of other studies have demonstrated an improved tolerance to radiationinduced CTI when compared to n-channel CCDs. A number of recent studies have also shown that the temperature history of the device after the irradiation impacts the performance of the detector, linked to the mobility of defects at different temperatures. This study describes the initial results from an e2v technologies p-channel CCD204 irradiated at 153 K with a 10 MeV equivalent proton fluences of 1.24×109 and 1.24×1011 protons.cm-2. The number of defects identified using trap pumping, dark current and cosmetic quality immediately after irradiation and over a period of 150 hours after the irradiation with the device held at 153 K and then after different periods of time at room temperature are described. The device also exhibited a flatband voltage shift of around 30 mV per krad, determined by the reduction in full well capacity.

  13. Postirradiation behavior of p-channel charge-coupled devices irradiated at 153 K

    NASA Astrophysics Data System (ADS)

    Gow, Jason P. D.; Wood, Daniel; Murray, Neil J.; Burt, David; Hall, David J.; Dryer, Ben; Holland, Andrew D.

    2016-04-01

    The displacement damage hardness that can be achieved using p-channel charge-coupled devices (CCD) was originally demonstrated in 1997, and since then a number of other studies have demonstrated an improved tolerance to radiation-induced charge transfer inefficiency when compared to n-channel CCDs. A number of recent studies have also shown that the temperature history of the device after the irradiation impacts the performance of the detector, linked to the mobility of defects at different temperatures. The initial results from an e2v technologies p-channel CCD204 irradiated at 153 K with 10-MeV equivalent proton fluences of 1.24×109 and 1.24×1011 protons cm-2 is described. The dark current, cosmetic quality, and the number of defects identified using trap pumping immediately were monitored after the irradiation for a period of 150 h with the device held at 153 K and then after different periods of time at room temperature. The device also exhibited a flatband voltage shift of around 30 mV/krad, determined by the reduction in full well capacity.

  14. Oxygen vacancy defect engineering using atomic layer deposited HfAlOx in multi-layered gate stack

    NASA Astrophysics Data System (ADS)

    Bhuyian, M. N.; Sengupta, R.; Vurikiti, P.; Misra, D.

    2016-05-01

    This work evaluates the defects in high quality atomic layer deposited (ALD) HfAlOx with extremely low Al (<3% Al/(Al + Hf)) incorporation in the Hf based high-k dielectrics. The defect activation energy estimated by the high temperature current voltage measurement shows that the charged oxygen vacancies, V+/V2+, are the primary source of defects in these dielectrics. When Al is added in HfO2, the V+ type defects with a defect activation energy of Ea ˜ 0.2 eV modify to V2+ type to Ea ˜ 0.1 eV with reference to the Si conduction band. When devices were stressed in the gate injection mode for 1000 s, more V+ type defects are generated and Ea reverts back to ˜0.2 eV. Since Al has a less number of valence electrons than do Hf, the change in the co-ordination number due to Al incorporation seems to contribute to the defect level modifications. Additionally, the stress induced leakage current behavior observed at 20 °C and at 125 °C demonstrates that the addition of Al in HfO2 contributed to suppressed trap generation process. This further supports the defect engineering model as reduced flat-band voltage shifts were observed at 20 °C and at 125 °C.

  15. Penicillin biosensor based on a capacitive field-effect structure functionalized with a dendrimer/carbon nanotube multilayer.

    PubMed

    Siqueira, José R; Abouzar, Maryam H; Poghossian, Arshak; Zucolotto, Valtencir; Oliveira, Osvaldo N; Schöning, Michael J

    2009-10-15

    Silicon-based sensors incorporating biomolecules are advantageous for processing and possible biological recognition in a small, reliable and rugged manufactured device. In this study, we report on the functionalization of field-effect (bio-)chemical sensors with layer-by-layer (LbL) films containing single-walled carbon nanotubes (SWNTs) and polyamidoamine (PAMAM) dendrimers. A capacitive electrolyte-insulator-semiconductor (EIS) structure modified with carbon nanotubes (EIS-NT) was built, which could be used as a penicillin biosensor. From atomic force microscopy (AFM) and field-emission scanning electron microscopy (FESEM) images, the LbL films were shown to be highly porous due to interpenetration of SWNTs into the dendrimer layers. Capacitance-voltage (C/V) measurements pointed to a high pH sensitivity of ca. 55 mV/pH for the EIS-NT structures. The biosensing ability towards penicillin of an EIS-NT-penicillinase biosensor was also observed as the flat-band voltage shifted to lower potentials at different penicillin concentrations. A dynamic response of penicillin concentrations, ranging from 5.0 microM to 25 mM, was evaluated for an EIS-NT with the penicillinase enzyme immobilized onto the surfaces, via constant-capacitance (ConCap) measurements, achieving a sensitivity of ca. 116 mV/decade. The presence of the nanostructured PAMAM/SWNT LbL film led to sensors with higher sensitivity and better performance.

  16. Investigation of microstructural and electrical properties of composition dependent co-sputtered Hf1-x Ta x O2 thin films

    NASA Astrophysics Data System (ADS)

    Das, K. C.; Tripathy, N.; Ghosh, S. P.; Mohanta, S. K.; Nakamura, A.; Kar, J. P.

    2017-11-01

    Tantalum doped HfO2 gate dielectric thin films were deposited on silicon substrates using RF reactive co-sputtering by varying RF power of Ta target from 15 W to 90 W. The morphological, compositional and electrical properties of Hf1-x Ta x O2 films were systematically investigated. The Ta content was found to be increased up to 21% for a Ta target power of 90 W. The evolution of monoclinic phase of Hf1-x Ta x O2 was seen from XRD study upto RF power of 60 W and afterwards, the amorphous like behaviour is appeared. The featureless smooth surface with the decrease in granular morphology has been observed from FESEM micrographs of the doped films at higher RF powers of Ta. The flatband voltage is found to be shifted towards negative voltage in the capacitance-voltage plot, which was attributed to the enhancement in positive oxide charge density with rise in RF power. The interface charge density has a minimum value of 7.85  ×  1011 eV-1 cm-2 for the film deposited at Ta RF power of 75 W. The Hf1-x Ta x O2 films deposited at Ta target RF power of 90 W has shown lower leakage current. The high on/off ratio of the current during the set process in Hf1-x Ta x O2 based memristors is found suitable for bipolar resistive switching memory device applications.

  17. Effect of interfacial SiO2- y layer and defect in HfO2- x film on flat-band voltage of HfO2- x /SiO2- y stacks for backside-illuminated CMOS image sensors

    NASA Astrophysics Data System (ADS)

    Na, Heedo; Lee, Jimin; Jeong, Juyoung; Kim, Taeho; Sohn, Hyunchul

    2018-03-01

    In this study, the effect of oxygen gas fraction during deposition of a hafnium oxide (HfO2- x ) film and the influence of the quality of the SiO2- y interlayer on the nature of flat-band voltage ( V fb) in TiN/HfO/SiO2- y /p-Si structures were investigated. X-ray photoemission spectroscopy analysis showed that the non-lattice oxygen peak, indicating an existing oxygen vacancy, increased as the oxygen gas fraction decreased during sputtering. From C- V and J- E analyses, the V fb behavior was significantly affected by the characteristics of the SiO2- y interlayer and the non-lattice oxygen fraction in the HfO2- x films. The HfO2- x /native SiO2- y stack presented a V fb of - 1.01 V for HfO2- x films with an oxygen gas fraction of 5% during sputtering. Additionally, the V fb of the HfO2- x /native SiO2- y stack could be controlled from - 1.01 to - 0.56 V by changing the deposition conditions of the HfO2- x film with the native SiO2- y interlayer. The findings of this study can be useful to fabricate charge-accumulating layers for backside-illuminated image sensor devices.

  18. A Monte Carlo model of hot electron trapping and detrapping in SiO2

    NASA Astrophysics Data System (ADS)

    Kamocsai, R. L.; Porod, W.

    1991-02-01

    High-field stressing and oxide degradation of SiO2 are studied using a microscopic model of electron heating and charge trapping and detrapping. Hot electrons lead to a charge buildup in the oxide according to the dynamic trapping-detrapping model by Nissan-Cohen and co-workers [Y. Nissan-Cohen, J. Shappir, D. Frohman-Bentchkowsky, J. Appl. Phys. 58, 2252 (1985)]. Detrapping events are modeled as trap-to-band impact ionization processes initiated by high energy conduction electrons. The detailed electronic distribution function obtained from Monte Carlo transport simulations is utilized for the determination of the detrapping rates. We apply our microscopic model to the calculation of the flat-band voltage shift in silicon dioxide as a function of the electric field, and we show that our model is able to reproduce the experimental results. We also compare these results to the predictions of the empirical trapping-detrapping model which assumes a heuristic detrapping cross section. Our microscopic theory accounts for the nonlocal nature of impact ionization which leads to a dark space close to the injecting cathode, which is unaccounted for in the empirical model.

  19. Silicon Photoelectrode Thermodynamics and Hydrogen Evolution Kinetics Measured by Intensity-Modulated High-Frequency Resistivity Impedance Spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Nicholas C.; Carroll, Gerard M.; Pekarek, Ryan T.

    Here, we present an impedance technique based on light intensity-modulated high-frequency resistivity (IMHFR) that provides a new way to elucidate both the thermodynamics and kinetics in complex semiconductor photoelectrodes. We apply IMHFR to probe electrode interfacial energetics on oxide-modified semiconductor surfaces frequently used to improve the stability and efficiency of photoelectrochemical water splitting systems. Combined with current density-voltage measurements, the technique quantifies the overpotential for proton reduction relative to its thermodynamic potential in Si photocathodes coated with three oxides (SiO x, TiO 2, and Al 2O 3) and a Pt catalyst. In pH 7 electrolyte, the flatband potentials of TiOmore » 2- and Al 2O 3-coated Si electrodes are negative relative to samples with native SiO x, indicating that SiO x is a better protective layer against oxidative electrochemical corrosion than ALD-deposited crystalline TiO 2 or Al 2O 3. Adding a Pt catalyst to SiO x/Si minimizes proton reduction overpotential losses but at the expense of a reduction in available energy characterized by a more negative flatband potential relative to catalyst-free SiO x/Si.« less

  20. Silicon Photoelectrode Thermodynamics and Hydrogen Evolution Kinetics Measured by Intensity-Modulated High-Frequency Resistivity Impedance Spectroscopy

    DOE PAGES

    Anderson, Nicholas C.; Carroll, Gerard M.; Pekarek, Ryan T.; ...

    2017-10-05

    Here, we present an impedance technique based on light intensity-modulated high-frequency resistivity (IMHFR) that provides a new way to elucidate both the thermodynamics and kinetics in complex semiconductor photoelectrodes. We apply IMHFR to probe electrode interfacial energetics on oxide-modified semiconductor surfaces frequently used to improve the stability and efficiency of photoelectrochemical water splitting systems. Combined with current density-voltage measurements, the technique quantifies the overpotential for proton reduction relative to its thermodynamic potential in Si photocathodes coated with three oxides (SiO x, TiO 2, and Al 2O 3) and a Pt catalyst. In pH 7 electrolyte, the flatband potentials of TiOmore » 2- and Al 2O 3-coated Si electrodes are negative relative to samples with native SiO x, indicating that SiO x is a better protective layer against oxidative electrochemical corrosion than ALD-deposited crystalline TiO 2 or Al 2O 3. Adding a Pt catalyst to SiO x/Si minimizes proton reduction overpotential losses but at the expense of a reduction in available energy characterized by a more negative flatband potential relative to catalyst-free SiO x/Si.« less

  1. Electrical and optical properties of diketopyrrolopyrrole-based copolymer interfaces in thin film devices.

    PubMed

    Adil, Danish; Kanimozhi, Catherine; Ukah, Ndubuisi; Paudel, Keshab; Patil, Satish; Guha, Suchi

    2011-05-01

    Two donor-acceptor diketopyrrolopyrrole (DPP)-based copolymers (PDPP-BBT and TDPP-BBT) have been synthesized for their application in organic devices such as metal-insulator semiconductor (MIS) diodes and field-effect transistors (FETs). The semiconductor-dielectric interface was characterized by capacitance-voltage and conductance-voltage methods. These measurements yield an interface trap density of 4.2 × 10(12) eV⁻¹ cm⁻² in TDPP-BBT and 3.5 × 10¹² eV⁻¹ cm⁻² in PDPP-BBT at the flat-band voltage. The FETs based on these spincoated DPP copolymers display p-channel behavior with hole mobilities of the order 10⁻³ cm²/(Vs). Light scattering studies from PDPP-BBT FETs show almost no change in the Raman spectrum after the devices are allowed to operate at a gate voltage, indicating that the FETs suffer minimal damage due to the metal-polymer contact or the application of an electric field. As a comparison Raman intensity profile from the channel-Au contact layer in pentacene FETs are presented, which show a distinct change before and after biasing.

  2. Nonequilibrium transport in the pseudospin-1 Dirac-Weyl system

    NASA Astrophysics Data System (ADS)

    Wang, Cheng-Zhen; Xu, Hong-Ya; Huang, Liang; Lai, Ying-Cheng

    2017-09-01

    Recently, solid state materials hosting pseudospin-1 quasiparticles have attracted a great deal of attention. In these materials, the energy band contains a pair of Dirac cones and a flatband through the connecting point of the cones. As the "caging" of carriers with a zero group velocity, the flatband itself has zero conductivity. However, in a nonequilibrium situation where a constant electric field is suddenly switched on, the flatband can enhance the resulting current in both the linear and nonlinear response regimes through distinct physical mechanisms. Using the (2 +1 )-dimensional pseudospin-1 Dirac-Weyl system as a concrete setting, we demonstrate that, in the weak field regime, the interband current is about twice larger than that for pseudospin-1/2 system due to the interplay between the flatband and the negative band, with the scaling behavior determined by the Kubo formula. In the strong field regime, the intraband current is √{2 } times larger than that in the pseudospin-1/2 system, due to the additional contribution from particles residing in the flatband. In this case, the current and field follow the scaling law associated with Landau-Zener tunneling. These results provide a better understanding of the role of the flatband in nonequilibrium transport and are experimentally testable using electronic or photonic systems.

  3. Electrical properties of HfO2 high- k thin-film MOS capacitors for advanced CMOS technology

    NASA Astrophysics Data System (ADS)

    Khairnar, A. G.; Patil, L. S.; Salunke, R. S.; Mahajan, A. M.

    2015-11-01

    We deposited the hafnium dioxide (HfO2) thin films on p-Si (100) substrates. The thin films were deposited with deposition time variations, viz 2, 4, 7 and 20 min using RF-sputtering technique. The thickness and refractive index of the films were measured using spectroscopic ellipsometer. The thicknesses of the films were measured to be 13.7, 21.9, 35.38 and 92.2 nm and refractive indices of 1.90, 1.93, 1.99 and 1.99, respectively, of the films deposited for 2, 4, 7 and 20 min deposition time. The crystal structures of the deposited HfO2 thin films were determined using XRD spectra and showed the monoclinic structure, confirmed with the ICDD card no 34-0104. Aluminum metallization was carried to form the Al/HfO2/ p-Si MOS structures by using thermal evaporation system with electrode area of 12.56 × 10-4 cm2. Capacitance voltage and current voltage measurements were taken to know electrical behavior of these fabricated MOS structures. The electrical parameters such as dielectric constant, flat-band shift and interface trap density determined through CV measurement were 7.99, 0.11 V and 6.94 × 1011 eV-1 cm-2, respectively. The low leakage current density was obtained from IV measurement of fabricated MOS structure at 1.5 V is 4.85 × 10-10 Acm-2. Aforesaid properties explored the suitability of the fabricated HfO2 high- k-based MOS capacitors for advanced CMOS technology.

  4. Oxygen vacancy defect engineering using atomic layer deposited HfAlO{sub x} in multi-layered gate stack

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhuyian, M. N., E-mail: mnb3@njit.edu; Misra, D.; Sengupta, R.

    2016-05-02

    This work evaluates the defects in high quality atomic layer deposited (ALD) HfAlO{sub x} with extremely low Al (<3% Al/(Al + Hf)) incorporation in the Hf based high-k dielectrics. The defect activation energy estimated by the high temperature current voltage measurement shows that the charged oxygen vacancies, V{sup +}/V{sup 2+}, are the primary source of defects in these dielectrics. When Al is added in HfO{sub 2}, the V{sup +} type defects with a defect activation energy of E{sub a} ∼ 0.2 eV modify to V{sup 2+} type to E{sub a} ∼ 0.1 eV with reference to the Si conduction band. When devices were stressedmore » in the gate injection mode for 1000 s, more V{sup +} type defects are generated and E{sub a} reverts back to ∼0.2 eV. Since Al has a less number of valence electrons than do Hf, the change in the co-ordination number due to Al incorporation seems to contribute to the defect level modifications. Additionally, the stress induced leakage current behavior observed at 20 °C and at 125 °C demonstrates that the addition of Al in HfO{sub 2} contributed to suppressed trap generation process. This further supports the defect engineering model as reduced flat-band voltage shifts were observed at 20 °C and at 125 °C.« less

  5. Evaluation of the density of the charge trapped in organic ferroelectric capacitors based on the Mott-Schottky model

    NASA Astrophysics Data System (ADS)

    Kim, Won-Ho; Kwon, Jin-Hyuk; Park, Gyeong-Tae; Kim, Jae-Hyun; Bae, Jin-Hyuk; Zhang, Xue; Park, Jaehoon

    2014-09-01

    Organic ferroelectric capacitors were fabricated using pentacene and poly(vinylidene fluoride-trifluoroethylene) (PVDF-TrFE) as an organic semiconductor and a ferroelectric material, respectively. A paraelectric poly(vinyl cinnamate) layer was adopted as an interlayer between the PVDF-TrFE layer and the bottom electrode. The paraelectric interlayer induced a depolarization field opposite to the direction of the polarization formed in the ferroelectric PVDF-TrFE insulator, thereby suppressing spontaneous polarization. As a result, the Mott-Schottky model could be used to evaluate, from the extracted flat-band voltages, the density of the charge trapped in the organic ferroelectric capacitors.

  6. Al203 thin films on Silicon and Germanium substrates for CMOS and flash memory applications

    NASA Astrophysics Data System (ADS)

    Gopalan, Sundararaman; Dutta, Shibesh; Ramesh, Sivaramakrishnan; Prathapan, Ragesh; Sreehari G., S.

    2017-07-01

    As scaling of device dimensions has continued, it has become necessary to replace traditional SiO2 with high dielectric constant materials in the conventional CMOS devices. In addition, use of metal gate electrodes and Germanium substrates may have to be used in order to address leakage and mobility issues. Al2O3 is one of the potential candidates both for CMOS and as a blocking dielectric for Flash memory applications owing to its low leakage. In this study, the effects of sputtering conditions and post-deposition annealing conditions on the electrical and reliability characteristics of MOS capacitors using Al2O3 films on Si and Ge substrates with Aluminium gate electrodes have been presented. It was observed that higher sputtering power resulted in larger flat-band voltage (Vfb) shifts, more hysteresis, higher interface state density (Dit) and a poorer reliability. Wit was also found that while a short duration high temperature annealing improves film characteristics, a long duration anneal even at 800C was found to be detrimental to MOS characteristics. Finally, the electronic conduction mechanism in Al2O3 films was also studied. It was observed that the conduction mechanism varied depending on the annealing condition, thickness of film and electric field.

  7. Perspective: Photonic flatbands

    NASA Astrophysics Data System (ADS)

    Leykam, Daniel; Flach, Sergej

    2018-07-01

    Flatbands are receiving increasing theoretical and experimental attention in the field of photonics, in particular in the field of photonic lattices. Flatband photonic lattices consist of arrays of coupled waveguides or resonators where the peculiar lattice geometry results in at least one completely flat or dispersionless band in its photonic band structure. Although bearing a strong resemblance to structural slow light, this independent research direction is instead inspired by analogies with "frustrated" condensed matter systems. In this Perspective, we critically analyze the research carried out to date, discuss how this exotic physics may lead to novel photonic device applications, and chart promising future directions in theory and experiment.

  8. Flat-Band Potential of a Semiconductor: Using the Mott-Schottky Equation

    ERIC Educational Resources Information Center

    Gelderman, K.; L. Lee; Donne, S. W.

    2007-01-01

    An experiment is suitable for fourth-year undergraduate and graduate students in which the nature of the semiconductor materials through determination of flat-band potential using the Mott-Schottky equation is explored. The experiment confirms the soundness of the technique.

  9. Wigner Transport Simulation of Resonant Tunneling Diodes with Auxiliary Quantum Wells

    NASA Astrophysics Data System (ADS)

    Lee, Joon-Ho; Shin, Mincheol; Byun, Seok-Joo; Kim, Wangki

    2018-03-01

    Resonant-tunneling diodes (RTDs) with auxiliary quantum wells ( e.g., emitter prewell, subwell, and collector postwell) are studied using a Wigner transport equation (WTE) discretized by a thirdorder upwind differential scheme. A flat-band potential profile is used for the WTE simulation. Our calculations revealed functions of the auxiliary wells as follows: The prewell increases the current density ( J) and the peak voltage ( V p ) while decreasing the peak-to-valley current ratio (PVCR), and the postwell decreases J while increasing the PVCR. The subwell affects J and PVCR, but its main effect is to decrease V p . When multiple auxiliary wells are used, each auxiliary well contributes independently to the transport without producing side effects.

  10. Passivation of oxide traps and interface states in GaAs metal-oxide-semiconductor capacitor by LaTaON passivation layer and fluorine incorporation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, L. N.; Choi, H. W.; Lai, P. T., E-mail: laip@eee.hku.hk

    2015-11-23

    GaAs metal-oxide-semiconductor capacitor with TaYON/LaTaON gate-oxide stack and fluorine-plasma treatment is fabricated and compared with its counterparts without the LaTaON passivation interlayer or the fluorine treatment. Experimental results show that the sample exhibits better characteristics: low interface-state density (8 × 10{sup 11 }cm{sup −2}/eV), small flatband voltage (0.69 V), good capacitance-voltage behavior, small frequency dispersion, and small gate leakage current (6.35 × 10{sup −6} A/cm{sup 2} at V{sub fb} + 1 V). These should be attributed to the suppressed growth of unstable Ga and As oxides on the GaAs surface during gate-oxide annealing by the LaTaON interlayer and fluorine incorporation, and the passivating effects of fluorine atoms on the acceptor-likemore » interface and near-interface traps.« less

  11. In situ current-voltage characterization of swift heavy ion irradiated Au/n-GaAs Schottky diode at low temperature

    NASA Astrophysics Data System (ADS)

    Singh, R.; Arora, S. K.; Singh, J. P.; Kanjilal, D.

    A Au/n-GaAs(100) Schottky diode was irradiated at 80 K by a 180 MeV Ag-107(14+) ion beam. In situ current-voltage (I--V) characterization of the diode was performed at various irradiation fluences ranging from 1x10(10) to 1x10(13) ions cm(-2) . The semiconductor was heavily doped (carrier concentration=1x10(18) cm(-3)), hence thermionic field emission was assumed to be the dominant current transport mechanism in the diode. Systematic variations in various parameters of the Schottky diode like characteristic energy E-0 , ideality factor n , reverse saturation current I-S , flatband barrier height Phi(bf) and reverse leakage current I-R have been observed with respect to the irradiation fluence. The nuclear and electronic energy losses of the swift heavy ion affect the interface state density at the metal-semiconductor interface resulting in observed variations in Schottky diode parameters.

  12. In-line charge-trapping characterization of dielectrics for sub-0.5-um CMOS technologies

    NASA Astrophysics Data System (ADS)

    Roy, Pradip K.; Chacon, Carlos M.; Ma, Yi; Horner, Gregory

    1997-09-01

    The advent of ultra-large and giga-scale-integration (ULSI/GSI) has placed considerable emphasis on the development of new gate oxides and interlevel dielectrics capable of meeting strict performance and reliability requirements. The costs and demands associated with ULSI fabrication have in turn fueled the need for cost-effective, rapid and accurate in-line characterization techniques for evaluating dielectric quality. The use of non-contact surface photovoltage characterization techniques provides cost-effective rapid feedback on dielectric quality, reducing costs through the reutilization of control wafers and the elimination of processing time. This technology has been applied to characterize most of the relevant C-V parameters, including flatband voltage (Vfb), density of interface traps (Dit), mobile charge density (Qm), oxide thickness (Tox), oxide resistivity (pox) and total charge (Qtot) for gate and interlevel (ILO) oxides. A novel method of measuring tunneling voltage by this technique on various gate oxides is discussed. For ILO, PECVD and high density plasma dielectrics, surface voltage maps are also presented. Measurements of near-surface silicon quality are described, including minority carrier generation lifetime, and examples of their application in diagnosing manufacturing problems.

  13. Electrical Characterization of Semiconductor and Dielectric Materials with a Non-Damaging FastGateTM Probe

    NASA Astrophysics Data System (ADS)

    Robert, Hillard; William, Howland; Bryan, Snyder

    2002-03-01

    Determination of the electrical properties of semiconductor materials and dielectrics is highly desirable since these correlate best to final device performance. The properties of SiO2 and high k dielectrics such as Equivalent Oxide Thickness(EOT), Interface Trap Density(Dit), Oxide Effective Charge(Neff), Flatband Voltage Hysteresis(Delta Vfb), Threshold Voltage(VT) and, bulk properties such as carrier density profile and channel dose are all important parameters that require monitoring during front end processing. Conventional methods for determining these parameters involve the manufacturing of polysilicon or metal gate MOS capacitors and subsequent measurements of capacitance-voltage(CV) and/or current-voltage(IV). These conventional techniques are time consuming and can introduce changes to the materials being monitored. Also, equivalent circuit effects resulting from excessive leakage current, series resistance and stray inductance can introduce large errors in the measured results. In this paper, a new method is discussed that provides rapid determination of these critical parameters and is robust against equivalent circuit errors. This technique uses a small diameter(30 micron), elastically deformed probe to form a gate for MOSCAP CV and IV and can be used to measure either monitor wafers or test areas within scribe lines on product wafers. It allows for measurements of dielectrics thinner than 10 Angstroms. A detailed description and applications such as high k dielectrics, will be presented.

  14. Determination of pseudogap state density and carrier mobility in rf sputtered amorphous silicon. Quarterly technical progress report, January-March 31, 1980

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paul, W

    1980-06-01

    The effect of a variety of plasma cleaning procedures on the level of bulk and interfacial contaminants in the films is analyzed by secondary ion mass spectrometry. Bulk levels of 0 have been reduced considerably by N/sub 2/ plasma cleaning, but no reproducible reductions in interfacial contamination have been achieved. A method is described of determining the gap state density N(epsilon) of a-Si:H from field effect, in which no assumptions are made about the form of the band bending in the semiconductor. The problem is reduced to three successive integrals over an assumed N(epsilon) by change of variable from distancemore » to applied voltage and the best fit to the experimental data is obtained by iteration of the assumed state density. The method is shown to be no less rigorous and considerably more economical than the recent analysis of Goodman, Fritzsche and Ozaki. In addition, an experimental means of determining the flat-band voltage to within 5% of the maximum gate voltage V/sub g/ used is demonstrated, by finding the value of V/sub g/ for which (kT/e)dlog I/sub SD//dV/sub g/ is independent of temperature.« less

  15. Optical, electrical, and photovoltaic properties of PbS thin films by anionic and cationic dopants

    NASA Astrophysics Data System (ADS)

    Cheraghizade, Mohsen; Jamali-Sheini, Farid; Yousefi, Ramin

    2017-06-01

    Lead sulfide (PbS) thin films were deposited by CVD method to examine the effects of anionic and cationic dopants on optical and electrical properties for photovoltaic applications. XRD diffractograms verified the formation of cubic phase of multicrystalline PbS thin films. FESEM images showed surface morphologies in nano-dimensions (rods and flowers). UV-Vis-NIR spectrum revealed absorbance in the visible and NIR regions for all samples, in which dopants decreased the intensity of absorbance. Se as an anionic dopant for PbS thin films increased electrical resistance, acceptor concentrations, and crystallite defects, and decreased flat-band voltage and depletion width. Finally, photovoltaic measurements indicated that Zn-doped PbS thin film, as a photovoltaic cell, exhibited higher conversion efficiency and external quantum efficiency (EQE).

  16. Symmetry Breaking in Photonic Crystals: On-Demand Dispersion from Flatband to Dirac Cones

    NASA Astrophysics Data System (ADS)

    Nguyen, H. S.; Dubois, F.; Deschamps, T.; Cueff, S.; Pardon, A.; Leclercq, J.-L.; Seassal, C.; Letartre, X.; Viktorovitch, P.

    2018-02-01

    We demonstrate that symmetry breaking opens a new degree of freedom to tailor energy-momentum dispersion in photonic crystals. Using a general theoretical framework in two illustrative practical structures, we show that breaking symmetry enables an on-demand tuning of the local density of states of the same photonic band from zero (Dirac cone dispersion) to infinity (flatband dispersion), as well as any constant density over an adjustable spectral range. As a proof of concept, we demonstrate experimentally the transformation of the very same photonic band from a conventional quadratic shape to a Dirac dispersion, a flatband dispersion, and a multivalley one. This transition is achieved by finely tuning the vertical symmetry breaking of the photonic structures. Our results provide an unprecedented degree of freedom for optical dispersion engineering in planar integrated photonic devices.

  17. Symmetry Breaking in Photonic Crystals: On-Demand Dispersion from Flatband to Dirac Cones.

    PubMed

    Nguyen, H S; Dubois, F; Deschamps, T; Cueff, S; Pardon, A; Leclercq, J-L; Seassal, C; Letartre, X; Viktorovitch, P

    2018-02-09

    We demonstrate that symmetry breaking opens a new degree of freedom to tailor energy-momentum dispersion in photonic crystals. Using a general theoretical framework in two illustrative practical structures, we show that breaking symmetry enables an on-demand tuning of the local density of states of the same photonic band from zero (Dirac cone dispersion) to infinity (flatband dispersion), as well as any constant density over an adjustable spectral range. As a proof of concept, we demonstrate experimentally the transformation of the very same photonic band from a conventional quadratic shape to a Dirac dispersion, a flatband dispersion, and a multivalley one. This transition is achieved by finely tuning the vertical symmetry breaking of the photonic structures. Our results provide an unprecedented degree of freedom for optical dispersion engineering in planar integrated photonic devices.

  18. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    NASA Astrophysics Data System (ADS)

    Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.

    2015-08-01

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.

  19. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patel, N.; Department of Electrical and Computer Engineering, MSC01 1100, University of New Mexico, Albuquerque, New Mexico 87131-0001; Branch, D. W.

    2015-08-15

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO{sub 3}) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5more » μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less

  20. Comparative study of 0° X-cut and Y+36°-cut lithium niobate high-voltage sensing

    DOE PAGES

    Patel, N.; Branch, D. W.; Schamiloglu, E.; ...

    2015-08-11

    A comparison study between Y+36° and 0° X-cut lithium niobate (LiNbO 3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y+36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses tomore » both crystals, the voltage-induced shift scaled linearly with voltage. For the Y+36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y+36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y+36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. Furthermore, when the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less

  1. Optical, electrochemical and hydrophilic properties of Y2O3 doped TiO2 nanocomposite films.

    PubMed

    Zhang, Xiangchao; Yang, Huaming; Tang, Aidong

    2008-12-25

    The 5% Y2O3 doped TiO2 nanocomposite film (YTF) deposited on ITO glass substrate has been synthesized by the sol-gel dip-coating method. The as-synthesized samples were characterized using X-ray diffraction (XRD), atomic force microscopy (AFM), scanning electron microscope (SEM), X-ray photoelectron spectroscopy (XPS), voltage-current (V-I), electrochemical impedance spectroscopy (EIS) and ultraviolet-visible (UV-vis) analysis technologies. The crystalline structure, surface morphology and surface chemical composition of YTF sample have been primarily investigated. The results demonstrate that YTF is anatase crystalline phase with thickness of 480 nm and consists of spherical shape particles with a grain size of about 15.8 nm. The binding energy appears as a chemical shift, and relatively more Y and Ti species are present on the surface, indicating that active surfaces of the nanocomposite film have been enhanced with more oxygen vacancies Vö due to doping Y2O3 to TiO2. The absorption edge of YTF has a red shift, and the optical properties of YTF in visible light region have been obviously improved. The water contact angle is about 8 degrees after daylight lamp irradiation 60 min. An equivalent circuit model provided a reliable description for the electrochemical systems. Based on the Mott-Schottky equation, the donor concentration (ND) for YTF is 1.05 x 10(20) cm(-3), which enhances 1 order of magnitude than that for pure TiO2 film (TF), the flat-band potential (V(fb)) and the space charge layer (d(sc)) obviously decreased. With the incorporation of Y2O3 into TiO2, the optical, electrochemical and photoinduced hydrophilic properties of YTF in visible light region have obviously improved, indicating that YTF shows promising applications in solar energy conversion, self-cleaning and other potential fields.

  2. Analysis of Schottky Barrier Parameters and Current Transport Properties of V/p-Type GaN Schottky Junction at Low Temperatures

    NASA Astrophysics Data System (ADS)

    Asha, B.; Harsha, Cirandur Sri; Padma, R.; Rajagopal Reddy, V.

    2018-05-01

    The electrical characteristics of a V/p-GaN Schottky junction have been investigated by current-voltage (I-V) and capacitance-voltage (C-V) characteristics under the assumption of the thermionic emission (TE) theory in the temperature range of 120-280 K with steps of 40 K. The zero-bias barrier height (ΦB0), ideality factor (n), flat-band barrier height (ΦBF) and series resistance (R S) values were evaluated and were found to be strongly temperature dependent. The results revealed that the ΦB0 values increase, whereas n, ΦFB and R S values decrease, with increasing temperature. Using the conventional Richardson plot, the mean barrier height (0.39 eV) and Richardson constant (8.10 × 10-10 Acm-2 K-2) were attained. The barrier height inhomogeneities were demonstrated by assuming a Gaussian distribution function. The interface state density (N SS) values were found to decrease with increasing temperature. The reverse leakage current mechanism of the V/p-GaN Schottky junction was found to be governed by Poole-Frenkel emission at all temperatures.

  3. From Discrete Breathers to Many Body Localization and Flatbands

    NASA Astrophysics Data System (ADS)

    Flach, Sergej

    Discrete breathers (DB) and intrinsic localized modes (ILM) are synonymic dynamical states on nonlinear lattices - periodic in time and localized in space, and widely observed in many applications. I will discuss the connections between DBs and many-body localization (MBL) and the properties of DBs on flatband networks. A dense quantized gas of strongly excited DBs can lead to a MBL phase in a variety of different lattice models. Its classical counterpart corresponds to a 'nonergodic metal' in the MBL language, or to a nonGibbsean selftrapped state in the language of nonlinear dynamics. Flatband networks are lattices with small amplitude waves exhibiting macroscopic degeneracy in their band structure due to local symmetries, destructive interference, compact localized eigenstates and horizontal flat bands. DBs can preserve the compactness of localization in the presence of nonlinearity with properly tuned internal phase relationships, making them promising tools for control of the phase coherence of waves. Also at New Zealand Institute of Advanced Study, Massey University, Auckland, New Zealand.

  4. Mode shift of the voltage sensors in Shaker K+ channels is caused by energetic coupling to the pore domain

    PubMed Central

    Haddad, Georges A.

    2011-01-01

    The voltage sensors of voltage-gated ion channels undergo a conformational change upon depolarization of the membrane that leads to pore opening. This conformational change can be measured as gating currents and is thought to be transferred to the pore domain via an annealing of the covalent link between voltage sensor and pore (S4-S5 linker) and the C terminus of the pore domain (S6). Upon prolonged depolarizations, the voltage dependence of the charge movement shifts to more hyperpolarized potentials. This mode shift had been linked to C-type inactivation but has recently been suggested to be caused by a relaxation of the voltage sensor itself. In this study, we identified two ShakerIR mutations in the S4-S5 linker (I384N) and S6 (F484G) that, when mutated, completely uncouple voltage sensor movement from pore opening. Using these mutants, we show that the pore transfers energy onto the voltage sensor and that uncoupling the pore from the voltage sensor leads the voltage sensors to be activated at more negative potentials. This uncoupling also eliminates the mode shift occurring during prolonged depolarizations, indicating that the pore influences entry into the mode shift. Using voltage-clamp fluorometry, we identified that the slow conformational change of the S4 previously correlated with the mode shift disappears when uncoupling the pore. The effects can be explained by a mechanical load that is imposed upon the voltage sensors by the pore domain and allosterically modulates its conformation. Mode shift is caused by the stabilization of the open state but leads to a conformational change in the voltage sensor. PMID:21518834

  5. Impact of process parameters on the structural and electrical properties of metal/PZT/Al2O3/silicon gate stack for non-volatile memory applications

    NASA Astrophysics Data System (ADS)

    Singh, Prashant; Jha, Rajesh Kumar; Singh, Rajat Kumar; Singh, B. R.

    2018-02-01

    In this paper, we present the structural and electrical properties of the Al2O3 buffer layer on non-volatile memory behavior using Metal/PZT/Al2O3/Silicon structures. Metal/PZT/Silicon and Metal/Al2O3/Silicon structures were also fabricated and characterized to obtain capacitance and leakage current parameters. Lead zirconate titanate (PZT::35:65) and Al2O3 films were deposited by sputtering on the silicon substrate. Memory window, PUND, endurance, breakdown voltage, effective charges, flat-band voltage and leakage current density parameters were measured and the effects of process parameters on the structural and electrical characteristics were investigated. X-ray data show dominant (110) tetragonal phase of the PZT film, which crystallizes at 500 °C. The sputtered Al2O3 film annealed at different temperatures show dominant (312) orientation and amorphous nature at 425 °C. Multiple angle laser ellipsometric analysis reveals the temperature dependence of PZT film refractive index and extinction coefficient. Electrical characterization shows the maximum memory window of 3.9 V and breakdown voltage of 25 V for the Metal/Ferroelectric/Silicon (MFeS) structures annealed at 500 °C. With 10 nm Al2O3 layer in the Metal/Ferroelectric/Insulator/Silicon (MFeIS) structure, the memory window and breakdown voltage was improved to 7.21 and 35 V, respectively. Such structures show high endurance with no significant reduction polarization charge for upto 2.2 × 109 iteration cycles.

  6. High capacitance density MIS capacitor using Si nanowires by MACE and ALD alumina dielectric

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leontis, I.; Nassiopoulou, A. G., E-mail: A.Nassiopoulou@inn.demokritos.gr; Botzakaki, M. A.

    2016-06-28

    High capacitance density three-dimensional (3D) metal-insulator-semiconductor (MIS) capacitors using Si nanowires (SiNWs) by metal-assisted chemical etching and atomic-layer-deposited alumina dielectric film were fabricated and electrically characterized. A chemical treatment was used to remove structural defects from the nanowire surface, in order to reduce the density of interface traps at the Al{sub 2}O{sub 3}/SiNW interface. SiNWs with two different lengths, namely, 1.3 μm and 2.4 μm, were studied. A four-fold capacitance density increase compared to a planar reference capacitor was achieved with the 1.3 μm SiNWs. In the case of the 2.4 μm SiNWs this increase was ×7, reaching a value of 4.1 μF/cm{sup 2}. Capacitance-voltagemore » (C-V) measurements revealed that, following a two-cycle chemical treatment, frequency dispersion at accumulation regime and flat-band voltage shift disappeared in the case of the 1.3 μm SiNWs, which is indicative of effective removal of structural defects at the SiNW surface. In the case of the 2.4 μm SiNWs, frequency dispersion at accumulation persisted even after the two-step chemical treatment. This is attributed to a porous Si layer at the SiNW tops, which is not effectively removed by the chemical treatment. The electrical losses of MIS capacitors in both cases of SiNW lengths were studied and will be discussed.« less

  7. Frequency stabilization in nonlinear MEMS and NEMS oscillators

    DOEpatents

    Lopez, Omar Daniel; Antonio, Dario

    2014-09-16

    An illustrative system includes an amplifier operably connected to a phase shifter. The amplifier is configured to amplify a voltage from an oscillator. The phase shifter is operably connected to a driving amplitude control, wherein the phase shifter is configured to phase shift the amplified voltage and is configured to set an amplitude of the phase shifted voltage. The oscillator is operably connected to the driving amplitude control. The phase shifted voltage drives the oscillator. The oscillator is at an internal resonance condition, based at least on the amplitude of the phase shifted voltage, that stabilizes frequency oscillations in the oscillator.

  8. Process dependency of radiation hardness of rapid thermal reoxidized nitrided gate oxides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weishin Lu; Kuanchin Lin; Jenngwo Hwu

    The radiation hardness of MOS capacitors with various reoxidized nitrided oxide (RNO) structures is studied by changing the durations of rapid thermal processes during sample preparation and by applying irradiation-then-anneal (ITA) treatments on samples after preparation. It is found that the initial flatband voltage and midgap interface trap density of MOS capacitors exhibit turnaround'' dependency on the total time of nitridation and reoxidation processes. For samples with nitrided oxide (NO) structures, the radiation-induced variations of above parameters are also turnaround''-dependent on nitridation time. However, when the reoxidation process is performed, the radiation hardness for all samples will be gradually improvedmore » with increasing reoxidation time no matter what the nitridation time is. The most radiation-hard process for RNO structures is suggested. Finally, it is found that when ITA treatments are applied on samples after preparation, their radiation hardness is much improved.« less

  9. Depolarization of the conductance-voltage relationship in the NaV1.5 mutant, E1784K, is due to altered fast inactivation

    PubMed Central

    Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.

    2017-01-01

    E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267

  10. Depolarization of the conductance-voltage relationship in the NaV1.5 mutant, E1784K, is due to altered fast inactivation.

    PubMed

    Peters, Colin H; Yu, Alec; Zhu, Wandi; Silva, Jonathan R; Ruben, Peter C

    2017-01-01

    E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.

  11. Flat-band superconductivity in strained Dirac materials

    NASA Astrophysics Data System (ADS)

    Kauppila, V. J.; Aikebaier, F.; Heikkilä, T. T.

    2016-06-01

    We consider superconducting properties of a two-dimensional Dirac material such as graphene under strain that produces a flat-band spectrum in the normal state. We show that in the superconducting state, such a model results in a highly increased critical temperature compared to the case without the strain, inhomogeneous order parameter with two-peak shaped local density of states and yet a large and almost uniform and isotropic supercurrent. This model could be realized in strained graphene or ultracold atom systems and could be responsible for unusually strong superconductivity observed in some graphite interfaces and certain IV-VI semiconductor heterostructures.

  12. Electrical characteristics and thermal stability of n+ polycrystalline- Si/ZrO2/SiO2/Si metal-oxide-semiconductor capacitors

    NASA Astrophysics Data System (ADS)

    Lim, Kwan-Yong; Park, Dae-Gyu; Cho, Heung-Jae; Kim, Joong-Jung; Yang, Jun-Mo; Ii, Choi-Sang; Yeo, In-Seok; Park, Jin Won

    2002-01-01

    We have investigated the thermal stability of n+ polycrystalline-Si(poly-Si)/ZrO2(50-140 Å)/SiO2(7 Å)/p-Si metal-oxide-semiconductor (MOS) capacitors via electrical and material characterization. The ZrO2 gate dielectric was prepared by atomic layer chemical vapor deposition using ZrCl4 and H2O vapor. Capacitance-voltage hysteresis as small as ˜12 mV with the flatband voltage of -0.5 V and the interface trap density of ˜5×1010cm-2 eV-1 were attained with activation anneal at 750 °C. A high level of gate leakage current was observed at the activation temperatures over 750 °C and attributed to the interfacial reaction of poly-Si and ZrO2 during the poly-Si deposition and the following high temperature anneal. Because of this, the ZrO2 gate dielectric is incompatible with the conventional poly-Si gate process. In the MOS capacitors having a smaller active area (<50×50 μm2), fortunately, the electrical degradation by further severe silicidation does not occur up to an 800 °C anneal in N2 for 30 min.

  13. The properties of the extraordinary mode and surface plasmon modes in the three-dimensional magnetized plasma photonic crystals based on the magneto-optical Voigt effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hai-Feng, E-mail: hanlor@163.com, E-mail: lsb@nuaa.edu.cn; Nanjing Artillery Academy, Nanjing 211132; Liu, Shao-Bin, E-mail: hanlor@163.com, E-mail: lsb@nuaa.edu.cn

    2014-06-15

    In this paper, the properties of the extraordinary mode and surface plasmon modes in the three-dimensional (3D) magnetized plasma photonic crystals (MPPCs) with face-centered-cubic lattices that are composed of the core tellurium (Te) spheres with surrounded by the homogeneous magnetized plasma shells inserted in the air, are theoretically investigated in detail by the plane wave expansion method, as the magneto-optical Voigt effects of magnetized plasma are considered (the incidence electromagnetic wave vector is perpendicular to the external magnetic field at any time). The optical switching or wavelength division multiplexer can be realized by the proposed 3D MPPCs. Our analyses demonstratemore » that the complete photonic band gaps (PBGs) and two flatbands regions for the extraordinary mode can be observed obviously. PBGs can be tuned by the radius of core Te sphere, the plasma density and the external magnetic field. The flatbands regions are determined by the existence of surface plasmon modes. Numerical simulations also show that if the thickness of magnetized plasma shell is larger than a threshold value, the band structures of the extraordinary mode will be similar to those obtained from the same structure containing the pure magnetized plasma spheres. In this case, the band structures also will not be affected by the inserted core spheres. It is also provided that the upper edges of two flatbands regions will not depend on the topology of lattice. However, the frequencies of lower edges of two flatbands regions will be convergent to the different constants for different lattices, as the thickness of magnetized plasma shell is close to zero.« less

  14. Threshold-Voltage-Shift Compensation and Suppression Method Using Hydrogenated Amorphous Silicon Thin-Film Transistors for Large Active Matrix Organic Light-Emitting Diode Displays

    NASA Astrophysics Data System (ADS)

    Oh, Kyonghwan; Kwon, Oh-Kyong

    2012-03-01

    A threshold-voltage-shift compensation and suppression method for active matrix organic light-emitting diode (AMOLED) displays fabricated using a hydrogenated amorphous silicon thin-film transistor (TFT) backplane is proposed. The proposed method compensates for the threshold voltage variation of TFTs due to different threshold voltage shifts during emission time and extends the lifetime of the AMOLED panel. Measurement results show that the error range of emission current is from -1.1 to +1.7% when the threshold voltage of TFTs varies from 1.2 to 3.0 V.

  15. Response of pMOS dosemeters on gamma-ray irradiation during its re-use.

    PubMed

    Pejovic, Milic M; Pejovic, Momcilo M; Jaksic, Aleksandar B

    2013-08-01

    Response of pMOS dosemeters during two successive irradiations with gamma-ray irradiation to a dose of 35 Gy and annealing at room and elevated temperature has been studied. The response was followed on the basis of threshold voltage shift, determined from transfer characteristics, as a function of absorbed dose or annealing time. It was shown that the threshold voltage shifts during first and second irradiation for the gate bias during irradiation of 5 and 2.5 V insignificantly differ although complete fading was not achieved after the first cycle of annealing. In order to analyse the defects formed in oxide and at the interface during irradiation and annealing, which are responsible for threshold voltage shift, midgap and charge-pumping techniques were used. It was shown that during first irradiation and annealing a dominant influence to threshold voltage shift is made by fixed oxide traps, while at the beginning of the second annealing cycle, threshold voltage shift is a consequence of both fixed oxide traps and slow switching traps.

  16. Novel Approach to Evaluation of Charging on Semiconductor Surface by Noncontact, Electrode-Free Capacitance/Voltage Measurement

    NASA Astrophysics Data System (ADS)

    Hirae, Sadao; Kohno, Motohiro; Okada, Hiroshi; Matsubara, Hideaki; Nakatani, Ikuyoshi; Kusuda, Tatsufumi; Sakai, Takamasa

    1994-04-01

    This paper describes a novel approach to the quantitative characterization of semiconductor surface charging caused by plasma exposures and ion implantations. The problems in conventional evaluation of charging are also discussed. Following the discussions above, the necessity of unified criteria is suggested for efficient development of systems or processes without charging damage. Hence, the charging saturation voltage between a top oxide surface and substrate, V s, and the charging density per unit area per second, ρ0, should be taken as criteria of charging behavior, which effectively represent the charging characteristics of both processes. The unified criteria can be obtained from the exposure time dependence of a net charging density on the thick field oxide. In order to determine V s and ρ0, the analysis using the C-V curve measured in a noncontact method with the metal-air-insulator-semiconductor (MAIS) technique is employed. The total space-charge density in oxide and its centroid can be determined at the same time by analyzing the flat-band voltage (V fb) of the MAIS capacitor as a function of the air gap. The net charge density can be obtained by analyzing the difference between the total space-charge density in oxide before and after charging. Finally, it is shown that charge damage of the large area metal-oxide-semiconductor (MOS) capacitor can be estimated from both V s and ρ0 which are obtained from results for a thick field oxide implanted with As+ and exposed to oxygen plasma.

  17. Role of AlGaN/GaN interface traps on negative threshold voltage shift in AlGaN/GaN HEMT

    NASA Astrophysics Data System (ADS)

    Malik, Amit; Sharma, Chandan; Laishram, Robert; Bag, Rajesh Kumar; Rawal, Dipendra Singh; Vinayak, Seema; Sharma, Rajesh Kumar

    2018-04-01

    This article reports negative shift in the threshold-voltage in AlGaN/GaN high electron mobility transistor (HEMT) with application of reverse gate bias stress. The device is biased in strong pinch-off and low drain to source voltage condition for a fixed time duration (reverse gate bias stress), followed by measurement of transfer characteristics. Negative threshold voltage shift after application of reverse gate bias stress indicates the presence of more carriers in channel as compared to the unstressed condition. We propose the presence of AlGaN/GaN interface states to be the reason of negative threshold voltage shift, and developed a process to electrically characterize AlGaN/GaN interface states. We verified the results with Technology Computer Aided Design (TCAD) ATLAS simulation and got a good match with experimental measurements.

  18. Low voltage to high voltage level shifter and related methods

    NASA Technical Reports Server (NTRS)

    Mentze, Erik J. (Inventor); Buck, Kevin M. (Inventor); Hess, Herbert L. (Inventor); Cox, David F. (Inventor)

    2006-01-01

    A shifter circuit comprises a high and low voltage buffer stages and an output buffer stage. The high voltage buffer stage comprises multiple transistors arranged in a transistor stack having a plurality of intermediate nodes connecting individual transistors along the stack. The transistor stack is connected between a voltage level being shifted to and an input voltage. An inverter of this stage comprises multiple inputs and an output. Inverter inputs are connected to a respective intermediate node of the transistor stack. The low voltage buffer stage has an input connected to the input voltage and an output, and is operably connected to the high voltage buffer stage. The low voltage buffer stage is connected between a voltage level being shifted away from and a lower voltage. The output buffer stage is driven by the outputs of the high voltage buffer stage inverter and the low voltage buffer stage.

  19. Novel Electronic Structures of Ru-pnictides RuPn (Pn = P, As, Sb)

    NASA Astrophysics Data System (ADS)

    Goto, H.; Toriyama, T.; Konishi, T.; Ohta, Y.

    Density-functional-theory-based electronic structure calculations are made to consider the novel electronic states of Ru-pnictides RuP and RuAs where the intriguing phase transitions and superconductivity under doping of Rh have been reported. We find that there appear nearly degenerate flat bands just at the Fermi level in the high-temperature metallic phase of RuP and RuAs; the flat-band states come mainly from the 4dxy orbitals of Ru ions and the Rh doping shifts the Fermi level just above the flat bands. The splitting of the flat bands caused by their electronic instability may then be responsible for the observed phase transition to the nonmagnetic insulating phase at low temperatures. We also find that the band structure calculated for RuSb resembles that of the doped RuP and RuAs, which is consistent with experiment where superconductivity occurs in RuSb without Rh doping.

  20. Defect States Emerging from a Non-Hermitian Flatband of Photonic Zero Modes

    NASA Astrophysics Data System (ADS)

    Qi, Bingkun; Zhang, Lingxuan; Ge, Li

    2018-03-01

    We show the existence of a flatband consisting of photonic zero modes in a gain and loss modulated lattice system as a result of the underlying non-Hermitian particle-hole symmetry. This general finding explains the previous observation in parity-time symmetric systems where non-Hermitian particle-hole symmetry is hidden. We further discuss the defect states in these systems, whose emergence can be viewed as an unconventional alignment of a pseudospin under the influence of a complex-valued pseudomagnetic field. These defect states also behave as a chain with two types of links, one rigid in a unit cell and one soft between unit cells, as the defect states become increasingly localized with the gain and loss strength.

  1. Voltage-sensing domain mode shift is coupled to the activation gate by the N-terminal tail of hERG channels.

    PubMed

    Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P

    2012-09-01

    Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.

  2. Symmetry conditions of a nodal superconductor for generating robust flat-band Andreev bound states at its dirty surface

    NASA Astrophysics Data System (ADS)

    Ikegaya, Satoshi; Kobayashi, Shingo; Asano, Yasuhiro

    2018-05-01

    We discuss the symmetry property of a nodal superconductor that hosts robust flat-band zero-energy states at its surface under potential disorder. Such robust zero-energy states are known to induce the anomalous proximity effect in a dirty normal metal attached to a superconductor. A recent study has shown that a topological index NZES describes the number of zero-energy states at the dirty surface of a p -wave superconductor. We generalize the theory to clarify the conditions required for a superconductor that enables NZES≠0 . Our results show that NZES≠0 is realized in a topological material that belongs to either the BDI or CII class. We also present two realistic Hamiltonians that result in NZES≠0 .

  3. Simulation of Dual-Electrode Capacitively Coupled Plasma Discharges

    NASA Astrophysics Data System (ADS)

    Lu, Yijia; Ji, Linhong; Cheng, Jia

    2016-12-01

    Dual-electrode capacitively coupled plasma discharges are investigated here to lower the non-uniformity of plasma density. The dual-electrode structure proposed by Jung splits the electrode region and increases the flexibility of fine tuning non-uniformity. Different RF voltages, frequencies, phase-shifts and electrode areas are simulated and the influences are discussed. RF voltage and electrode area have a non-monotonic effect on non-uniformity, while frequency has a monotonic effect. Phase-shift has a cyclical influence on non-uniformity. A special combination of 224 V voltage and 11% area ratio with 10 MHz lowers the non-uniformity of the original set (200 V voltage and 0% area ratio with 10 MHz) by 46.5%. The position of the plasma density peak at the probe line has been tracked and properly tuning the phase-shift can obtain the same trace as tuning frequency or voltage. supported by National Natural Science Foundation of China (No. 51405261)

  4. Simulative and experimental investigation on stator winding turn and unbalanced supply voltage fault diagnosis in induction motors using Artificial Neural Networks.

    PubMed

    Lashkari, Negin; Poshtan, Javad; Azgomi, Hamid Fekri

    2015-11-01

    The three-phase shift between line current and phase voltage of induction motors can be used as an efficient fault indicator to detect and locate inter-turn stator short-circuit (ITSC) fault. However, unbalanced supply voltage is one of the contributing factors that inevitably affect stator currents and therefore the three-phase shift. Thus, it is necessary to propose a method that is able to identify whether the unbalance of three currents is caused by ITSC or supply voltage fault. This paper presents a feedforward multilayer-perceptron Neural Network (NN) trained by back propagation, based on monitoring negative sequence voltage and the three-phase shift. The data which are required for training and test NN are generated using simulated model of stator. The experimental results are presented to verify the superior accuracy of the proposed method. Copyright © 2015. Published by Elsevier Ltd.

  5. Electrical characterization of 4H-SiC metal-oxide-semiconductor structure with Al2O3 stacking layers as dielectric

    NASA Astrophysics Data System (ADS)

    Chang, P. K.; Hwu, J. G.

    2018-02-01

    Interface defects and oxide bulk traps conventionally play important roles in the electrical performance of SiC MOS device. Introducing the Al2O3 stack grown by repeated anodization of Al films can notably lower the leakage current in comparison to the SiO2 structure, and enhance the minority carrier response at low frequency when the number of Al2O3 layers increase. In addition, the interface quality is not deteriorated by the stacking of Al2O3 layers because the stacked Al2O3 structure grown by anodization possesses good uniformity. In this work, the capacitance equivalent thickness (CET) of stacking Al2O3 will be up to 19.5 nm and the oxidation process can be carried out at room temperature. For the Al2O3 gate stack with CET 19.5 nm on n-SiC substrate, the leakage current at 2 V is 2.76 × 10-10 A/cm2, the interface trap density at the flatband voltage is 3.01 × 1011 eV-1 cm-2, and the effective breakdown field is 11.8 MV/cm. Frequency dispersion and breakdown characteristics may thus be improved as a result of the reduction in trap density. The Al2O3 stacking layers are capable of maintaining the leakage current as low as possible even after constant voltage stress test, which will further ameliorate reliability characteristics.

  6. Application of the superposition principle to solar-cell analysis

    NASA Technical Reports Server (NTRS)

    Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.

    1979-01-01

    The superposition principle of differential-equation theory - which applies if and only if the relevant boundary-value problems are linear - is used to derive the widely used shifting approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. Analytical methods are presented to treat cases where shifting is not strictly valid. Well-defined conditions necessary for superposition to apply are established. For high injection in the base region, the method of analysis accurately yields the dependence of the open-circuit voltage on the short-circuit current (or the illumination level).

  7. Topological magnons in a one-dimensional itinerant flatband ferromagnet

    NASA Astrophysics Data System (ADS)

    Su, Xiao-Fei; Gu, Zhao-Long; Dong, Zhao-Yang; Li, Jian-Xin

    2018-06-01

    Different from previous scenarios that topological magnons emerge in local spin models, we propose an alternative that itinerant electron magnets can host topological magnons. A one-dimensional Tasaki model with a flatband is considered as the prototype. This model can be viewed as a quarter-filled periodic Anderson model with impurities located in between and hybridizing with the nearest-neighbor conducting electrons, together with a Hubbard repulsion for these electrons. By increasing the Hubbard interaction, the gap between the acoustic and optical magnons closes and reopens while the Berry phase of the acoustic band changes from 0 to π , leading to the occurrence of a topological transition. After this transition, there always exist in-gap edge magnonic modes, which is consistent with the bulk-edge correspondence. The Hubbard interaction-driven transition reveals a new mechanism to realize nontrivial magnon bands.

  8. Investigation of Defect Distributions in SiO2/AlGaN/GaN High-Electron-Mobility Transistors by Using Capacitance-Voltage Measurement with Resonant Optical Excitation

    NASA Astrophysics Data System (ADS)

    Kim, Tae-Soo; Lim, Seung-Young; Park, Yong-Keun; Jung, Gunwoo; Song, Jung-Hoon; Cha, Ho-Young; Han, Sang-Woo

    2018-06-01

    We investigated the distributions and the energy levels of defects in SiO2/AlGaN/GaN highelectron-mobility transistors (HEMTs) by using frequency-dependent ( F- D) capacitance-voltage ( C- V) measurements with resonant optical excitation. A Schottky barrier (SB) and a metal-oxidesemiconductor (MOS) HEMT were prepared to compare the effects of defects in their respective layers. We also investigated the effects of those layers on the threshold voltage ( V th ). A drastic voltage shift in the C- V curve at higher frequencies was caused by the large number of defect levels in the SiO2/GaN interface. A significant shift in V th with additional light illumination was observed due to a charging of the defect states in the SiO2/GaN interface. The voltage shifts were attributed to the detrapping of defect states at the SiO2/GaN interface.

  9. Diffuse fibrosis leads to a decrease in unipolar voltage: Validation in a swine model of premature ventricular contraction-induced cardiomyopathy.

    PubMed

    Tanaka, Yasuaki; Rahmutula, Dolkun; Duggirala, Srikant; Nazer, Babak; Fang, Qizhi; Olgin, Jeffrey; Sievers, Richard; Gerstenfeld, Edward P

    2016-02-01

    Frequent premature ventricular contractions (PVCs) may lead to dilated cardiomyopathy. A leftward shift in the unipolar voltage distribution in patients with cardiomyopathy has also been described and attributed to increased fibrosis. We established a swine model of PVC-induced cardiomyopathy and assessed (1) whether an increase in left ventricular fibrosis occurs and (2) whether increased fibrosis leads to a leftward shift in the unipolar voltage distribution. Ten swine underwent implantation of ventricular pacemakers; 6 programmed to deliver a 50% PVC burden and 4 controls without pacing. Voltage maps were acquired at baseline and after 14 weeks of ventricular bigeminy. In the PVC group, left ventricular ejection fraction decreased from 67% ± 7% to 44% ± 15% (P < .05) with no change in controls (71% ± 6% to 73% ± 4%; P = .56). The fifth percentile of the bipolar and unipolar voltage distribution at baseline was 1.63 and 5.36 mV, respectively. In the control group, after 14 weeks of pacing there was no significant change in % bipolar voltage <1.5 mV (pre 1.2% vs post 2.2%; P = .34) or % unipolar voltage <5.5 mV (pre 4.0% vs post 3.5%; P = .20). In the PVC group, there was a significant increase in % unipolar voltage <5.5 mV (5.4% vs 12.6%; P < .01), with a leftward shift in the unipolar voltage distribution. Histologically, % fibrosis was increased in the PVC group (control 1.8% ± 1.3% vs PVC 3.4% ± 2.6%; P < .01). PVC-induced cardiomyopathy in swine leads to an increase in interstitial fibrosis and a leftward shift in the unipolar voltage distribution. These findings are consistent with findings in humans with PVC-induced cardiomyopathy. Copyright © 2016 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  10. Stabilization of the Activated hERG Channel Voltage Sensor by Depolarization Involves the S4-S5 Linker.

    PubMed

    Thouta, Samrat; Hull, Christina M; Shi, Yu Patrick; Sergeev, Valentine; Young, James; Cheng, Yen M; Claydon, Thomas W

    2017-01-24

    Slow deactivation of hERG channels is critical for preventing cardiac arrhythmia yet the mechanistic basis for the slow gating transition is unclear. Here, we characterized the temporal sequence of events leading to voltage sensor stabilization upon membrane depolarization. Progressive increase in step depolarization duration slowed voltage-sensor return in a biphasic manner (τ fast = 34 ms, τ slow  = 2.5 s). The faster phase of voltage-sensor return slowing correlated with the kinetics of pore opening. The slower component occurred over durations that exceeded channel activation and was consistent with voltage sensor relaxation. The S4-S5 linker mutation, G546L, impeded the faster phase of voltage sensor stabilization without attenuating the slower phase, suggesting that the S4-S5 linker is important for communications between the pore gate and the voltage sensor during deactivation. These data also demonstrate that the mechanisms of pore gate-opening-induced and relaxation-induced voltage-sensor stabilization are separable. Deletion of the distal N-terminus (Δ2-135) accelerated off-gating current, but did not influence the relative contribution of either mechanism of stabilization of the voltage sensor. Lastly, we characterized mode-shift behavior in hERG channels, which results from stabilization of activated channel states. The apparent mode-shift depended greatly on recording conditions. By measuring slow activation and deactivation at steady state we found the "true" mode-shift to be ∼15 mV. Interestingly, the "true" mode-shift of gating currents was ∼40 mV, much greater than that of the pore gate. This demonstrates that voltage sensor return is less energetically favorable upon repolarization than pore gate closure. We interpret this to indicate that stabilization of the activated voltage sensor limits the return of hERG channels to rest. The data suggest that this stabilization occurs as a result of reconfiguration of the pore gate upon opening by a mechanism that is influenced by the S4-S5 linker, and by a separable voltage-sensor intrinsic relaxation mechanism. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  11. Unassisted HI photoelectrolysis using n-WSe 2 solar absorbers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McKone, James R.; Potash, Rebecca A.; DiSalvo, Francis J.

    Molybdenum and tungsten diselenide are among the most robust and efficient semiconductor materials for photoelectrochemistry, but they have seen limited use for integrated solar energy storage systems. Herein, we report that n-type WSe 2 photoelectrodes can facilitate unassisted aqueous HI electrolysis to H 2(g) and HI 3(aq) when placed in contact with a platinum counter electrode and illuminated by simulated sunlight. Even in strongly acidic electrolyte, the photoelectrodes are robust and operate very near their maximum power point. We have rationalized this behavior by characterizing the n-WSe 2|HI/HI 3 half cell, the Pt|HI/H 2||HI 3/HI|Pt full cell, and the n-WSemore » 2 band-edge positions. Importantly, specific interactions between the n-WSe 2 surface and aqueous iodide significantly shift the semiconductor’s flatband potential and allow for unassisted HI electrolysis. These findings exemplify the important role of interfacial chemical reactivity in influencing the energetics of semiconductor-liquid junctions and the resulting device performance.« less

  12. Unassisted HI photoelectrolysis using n-WSe2 solar absorbers.

    PubMed

    McKone, James R; Potash, Rebecca A; DiSalvo, Francis J; Abruña, Héctor D

    2015-06-07

    Molybdenum and tungsten diselenide are among the most robust and efficient semiconductor materials for photoelectrochemistry, but they have seen limited use for integrated solar energy storage systems. Herein, we report that n-type WSe2 photoelectrodes can facilitate unassisted aqueous HI electrolysis to H2(g) and HI3(aq) when placed in contact with a platinum counter electrode and illuminated by simulated sunlight. Even in strongly acidic electrolyte, the photoelectrodes are robust and operate very near their maximum power point. We have rationalized this behavior by characterizing the n-WSe2|HI/HI3 half cell, the Pt|HI/H2||HI3/HI|Pt full cell, and the n-WSe2 band-edge positions. Importantly, specific interactions between the n-WSe2 surface and aqueous iodide significantly shift the semiconductor's flatband potential and allow for unassisted HI electrolysis. These findings exemplify the important role of interfacial chemical reactivity in influencing the energetics of semiconductor-liquid junctions and the resulting device performance.

  13. Energy-band engineering for tunable memory characteristics through controlled doping of reduced graphene oxide.

    PubMed

    Han, Su-Ting; Zhou, Ye; Yang, Qing Dan; Zhou, Li; Huang, Long-Biao; Yan, Yan; Lee, Chun-Sing; Roy, Vellaisamy A L

    2014-02-25

    Tunable memory characteristics are used in multioperational mode circuits where memory cells with various functionalities are needed in one combined device. It is always a challenge to obtain control over threshold voltage for multimode operation. On this regard, we use a strategy of shifting the work function of reduced graphene oxide (rGO) in a controlled manner through doping gold chloride (AuCl3) and obtained a gradient increase of rGO work function. By inserting doped rGO as floating gate, a controlled threshold voltage (Vth) shift has been achieved in both p- and n-type low voltage flexible memory devices with large memory window (up to 4 times for p-type and 8 times for n-type memory devices) in comparison with pristine rGO floating gate memory devices. By proper energy band engineering, we demonstrated a flexible floating gate memory device with larger memory window and controlled threshold voltage shifts.

  14. Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

    PubMed

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

    2018-03-01

    Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

  15. Improved interface and electrical properties of atomic layer deposited Al2O3/4H-SiC

    NASA Astrophysics Data System (ADS)

    Suvanam, Sethu Saveda; Usman, Muhammed; Martin, David; Yazdi, Milad. G.; Linnarsson, Margareta; Tempez, Agnès; Götelid, Mats; Hallén, Anders

    2018-03-01

    In this paper we demonstrate a process optimization of atomic layer deposited Al2O3 on 4H-SiC resulting in an improved interface and electrical properties. For this purpose the samples have been treated with two pre deposition surface cleaning processes, namely CP1 and CP2. The former is a typical surface cleaning procedure used in SiC processing while the latter have an additional weak RCA1 cleaning step. In addition to the cleaning and deposition, the effects of post dielectric annealing (PDA) at various temperatures in N2O ambient have been investigated. Analyses by scanning electron microscopy show the presence of structural defects on the Al2O3 surface after annealing at 500 and 800 °C. These defects disappear after annealing at 1100 °C, possibly due to densification of the Al2O3 film. Interface analyses have been performed using X-ray photoelectron spectroscopy (XPS) and time-of-flight medium energy ion scattering (ToF MEIS). Both these measurements show the formation of an interfacial SiOx (0 < x < 2) layer for both the CP1 and CP2, displaying an increased thickness for higher temperatures. Furthermore, the quality of the sub-oxide interfacial layer was found to depend on the pre deposition cleaning. In conclusion, an improved interface with better electrical properties is shown for the CP2 sample annealed at 1100 °C, resulting in lower oxide charges, strongly reduced flatband voltage and leakage current, as well as higher breakdown voltage.

  16. Interface investigation of solution processed high- κ ZrO2/Si MOS structure by DLTS

    NASA Astrophysics Data System (ADS)

    Kumar, Arvind; Mondal, Sandip; Rao, Ksr Koteswara

    The interfacial region is dominating due to the continuous downscaling and integration of high- k oxides in CMOS applications. The accurate characterization of high- k oxides/semiconductor interface has the significant importance towards its usage in memory and thin film devices. The interface traps at the high - k /semiconductor interface can be quantified by deep level transient spectroscopy (DLTS) with better accuracy in contrast to capacitance-voltage (CV) and conductance technique. We report the fabrication of high- k ZrO2 films on p-Si substrate by a simple and inexpensive sol-gel spin-coating technique. Further, the ZrO2/Si interface is characterized through DLTS. The flat-band voltage (VFB) and the density of slow interface states (oxide trapped charges) extracted from CV characteristics are 0.37 V and 2x10- 11 C/cm2, respectively. The activation energy, interface state density and capture cross-section quantified by DLTS are EV + 0.42 eV, 3.4x1011 eV- 1 cm- 2 and 5.8x10- 18 cm2, respectively. The high quality ZrO2 films own high dielectric constant 15 with low leakage current density might be an appropriate insulating layer in future electronic application. The low value of interface state density and capture cross-section are the indication of high quality interface and the defect present at the interface may not affect the device performance to a great extent. The DLTS study provides a broad understanding about the traps present at the interface of spin-coated ZrO2/Si.

  17. Gate tunneling current and quantum capacitance in metal-oxide-semiconductor devices with graphene gate electrodes

    NASA Astrophysics Data System (ADS)

    An, Yanbin; Shekhawat, Aniruddh; Behnam, Ashkan; Pop, Eric; Ural, Ant

    2016-11-01

    Metal-oxide-semiconductor (MOS) devices with graphene as the metal gate electrode, silicon dioxide with thicknesses ranging from 5 to 20 nm as the dielectric, and p-type silicon as the semiconductor are fabricated and characterized. It is found that Fowler-Nordheim (F-N) tunneling dominates the gate tunneling current in these devices for oxide thicknesses of 10 nm and larger, whereas for devices with 5 nm oxide, direct tunneling starts to play a role in determining the total gate current. Furthermore, the temperature dependences of the F-N tunneling current for the 10 nm devices are characterized in the temperature range 77-300 K. The F-N coefficients and the effective tunneling barrier height are extracted as a function of temperature. It is found that the effective barrier height decreases with increasing temperature, which is in agreement with the results previously reported for conventional MOS devices with polysilicon or metal gate electrodes. In addition, high frequency capacitance-voltage measurements of these MOS devices are performed, which depict a local capacitance minimum under accumulation for thin oxides. By analyzing the data using numerical calculations based on the modified density of states of graphene in the presence of charged impurities, it is shown that this local minimum is due to the contribution of the quantum capacitance of graphene. Finally, the workfunction of the graphene gate electrode is extracted by determining the flat-band voltage as a function of oxide thickness. These results show that graphene is a promising candidate as the gate electrode in metal-oxide-semiconductor devices.

  18. Local anesthetics disrupt energetic coupling between the voltage-sensing segments of a sodium channel.

    PubMed

    Muroi, Yukiko; Chanda, Baron

    2009-01-01

    Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.

  19. Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins.

    PubMed

    Zeimpekis, I; Sun, K; Hu, C; Ditshego, N M J; Thomas, O; de Planque, M R R; Chong, H M H; Morgan, H; Ashburn, P

    2016-04-22

    We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH(-1) is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH(-1) measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.

  20. Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins

    NASA Astrophysics Data System (ADS)

    Zeimpekis, I.; Sun, K.; Hu, C.; Ditshego, N. M. J.; Thomas, O.; de Planque, M. R. R.; Chong, H. M. H.; Morgan, H.; Ashburn, P.

    2016-04-01

    We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH-1 is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH-1 measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.

  1. Biosensing in a microelectrofluidic system using optical whispering-gallery mode spectroscopy

    PubMed Central

    Huang, Lei; Guo, Zhixiong

    2011-01-01

    Label-free detection of biomolecules using an optical whispering-gallery mode sensor in a microelectrofluidic channel is simulated. Negatively charged bovine serum albumin is considered as the model protein analyte. The analyte transport in aqueous solution is controlled by an externally applied electrical field. The finite element method is employed for solving the equations of the charged species transport, the Poisson equation of electric potential, the equations of conservation of momentum and energy, and the Helmholtz equations of electromagnetic waves. The adsorption process of the protein molecules on the microsensor head surface is monitored by the resonance frequency shifts. Frequency shift caused by temperature variation due to Joule heating is analyzed and found to be negligible. The induced shifts behave in a manner similar to Langmuir-like adsorption kinetics; but the time constant increases due to the presence of the external electrical field. A correlation of the frequency shift, the analyte feed concentration in the solution, and the applied voltage gradient is obtained, in which an excellent linear relationship between the frequency shift and the analyte concentration is revealed. The applied voltage gradient enhances significantly the analyte concentration in the vicinity of the sensor surface; thus, the sensor sensitivity which has a power function of the voltage gradient with exponent 2.85 in the controlled voltage range. Simulated detection of extremely low protein concentration to the pico-molar level is carried out. PMID:22662041

  2. Impacts of Annealing Conditions on the Flat Band Voltage of Alternate La2O3/Al2O3 Multilayer Stack Structures.

    PubMed

    Feng, Xing-Yao; Liu, Hong-Xia; Wang, Xing; Zhao, Lu; Fei, Chen-Xi; Liu, He-Lei

    2016-12-01

    The mechanism of flat band voltage (VFB) shift for alternate La2O3/Al2O3 multilayer stack structures in different annealing condition is investigated. The samples were prepared for alternate multilayer structures, which were annealed in different conditions. The capacitance-voltage (C-V) measuring results indicate that the VFB of samples shift negatively for thinner bottom Al2O3 layer, increasing annealing temperature or longer annealing duration. Simultaneously, the diffusion of high-k material to interfaces in different multilayer structures and annealing conditions is observed by X-ray photoelectron spectroscopy (XPS). Based on the dipole theory, a correlation between the diffusion effect of La towards bottom Al2O3/Si interface and VFB shift is found. Without changing the dielectric constant k of films, VFB shift can be manipulated by controlling the single-layer cycles and annealing conditions of alternate high-k multilayer stack.

  3. A CMOS matrix for extracting MOSFET parameters before and after irradiation

    NASA Technical Reports Server (NTRS)

    Blaes, B. R.; Buehler, M. G.; Lin, Y.-S.; Hicks, K. A.

    1988-01-01

    An addressable matrix of 16 n- and 16 p-MOSFETs was designed to extract the dc MOSFET parameters for all dc gate bias conditions before and after irradiation. The matrix contains four sets of MOSFETs, each with four different geometries that can be biased independently. Thus the worst-case bias scenarios can be determined. The MOSFET matrix was fabricated at a silicon foundry using a radiation-soft CMOS p-well LOCOS process. Co-60 irradiation results for the n-MOSFETs showed a threshold-voltage shift of -3 mV/krad(Si), whereas the p-MOSFETs showed a shift of 21 mV/krad(Si). The worst-case threshold-voltage shift occurred for the n-MOSFETs, with a gate bias of 5 V during the anneal. For the p-MOSFETs, biasing did not affect the shift in the threshold voltage. A parasitic MOSFET dominated the leakage of the n-MOSFET biased with 5 V on the gate during irradiation. Co-60 test results for other parameters are also presented.

  4. Investigation of ultrahigh sensitivity in GaInAsP nanolaser biosensor

    NASA Astrophysics Data System (ADS)

    Saijo, Yoshito; Watanabe, Takumi; Hasegawa, Yu; Nishijima, Yoshiaki; Baba, Toshihiko

    2018-02-01

    We have developed GaInAsP semiconductor photonic crystal nanolaser biosensor and demonstrated the detection of ultralow-concentration (fM to aM) proteins and deoxyribonucleic acids (DNAs) adsorbed on the device surface. In general, this type of photonic sensors exploiting optical resonance has been considered to detect the refractive index of biomolecules via the wavelength shift. However, this principle cannot explain the detection of such ultralowconcentration. Therefore, we investigated another candidate principle, i.e., ion sensitivity. We consider such a process that 1) the electric charge of biomolecules changes the nanolaser's surface charge, 2) the Schottky barrier near the semiconductor surface is increased or decreased, 3) the distribution of photopumped carriers is modified by the barrier, 4) the refractive index of the semiconductor is changed by the carrier effects, and 5) the laser wavelength shifts. To confirm this process, we electrochemically measured the zeta and flatband potentials when charged electrolyte polymers were adsorbed in water. We clearly observed that these potentials temporally behaved consistently with that of the laser wavelength, which suggests that polymers significantly acted on the Schottky barrier. The same behaviors were also observed for the adsorption of 1 fM DNA. We consider that a limited number of charged DNA changed the surface functional group of the entire device surface. Such charge effects will be the key that achieves the ultrahigh sensitivity in the nanolaser biosensor.

  5. Active-Matrix Organic Light Emission Diode Pixel Circuit for Suppressing and Compensating for the Threshold Voltage Degradation of Hydrogenated Amorphous Silicon Thin Film Transistors

    NASA Astrophysics Data System (ADS)

    Shin, Hee-Sun; Lee, Won-Kyu; Park, Sang-Guen; Kuk, Seung-Hee; Han, Min-Koo

    2009-03-01

    A new hydrogenated amorphous silicon (a-Si:H) thin film transistor (TFT) pixel circuit for active-matrix organic light emission diodes (AM-OLEDs), which significantly compensates the OLED current degradation by memorizing the threshold voltage of driving TFT and suppresses the threshold voltage shift of a-Si:H TFTs by negative bias annealing, is proposed and fabricated. During the first half of each frame, the driving TFT of the proposed pixel circuit supplies current to the OLED, which is determined by modified data voltage in the compensation scheme. The proposed pixel circuit was able to compensate the threshold voltage shift of the driving TFT as well as the OLED. During the remaining half of each frame, the proposed pixel circuit induces the recovery of the threshold voltage degradation of a-Si:H TFTs owing to the negative bias annealing. The experimental results show that the proposed pixel circuit was able to successfully compensate for the OLED current degradation and suppress the threshold voltage degradation of the driving TFT.

  6. Quantum Transport and Non-Hermiticity on Flat-Band Lattices

    NASA Astrophysics Data System (ADS)

    Park, Hee Chul; Ryu, Jung-Wan; Myoung, Nojoon

    2018-04-01

    We investigate quantum transport in a flat-band lattice induced in a twisted cross-stitch lattice with Hermitian or non-Hermitian potentials, with a combination of parity and time-reversal symmetry invariant. In the given system, the transmission probability demonstrates a resonant behavior on the real part of the energy bands. Both of the potentials break the parity symmetry, which lifts the degeneracy of the flat and dispersive bands. In addition, non-Hermiticity conserving PT-symmetry induces a transition between the unbroken and broken PT-symmetric phases through exceptional points in momentum space. Characteristics of non-Hermitian and Hermitian bandgaps are distinguishable: The non-Hermitian bandgap is induced by separation toward complex energy, while the Hermitian bandgap is caused by the expelling of available states into real energy. Deviation of the two bandgaps follows as a function of the quartic power of the induced potential. It is notable that non-Hermiticity plays an important role in the mechanism of generating a bandgap distinguishable from a Hermitian bandgap.

  7. Method, memory media and apparatus for detection of grid disconnect

    DOEpatents

    Ye, Zhihong [Clifton Park, NY; Du, Pengwei [Troy, NY

    2008-09-23

    A phase shift procedure for detecting a disconnect of a power grid from a feeder that is connected to a load and a distributed generator. The phase shift procedure compares a current phase shift of the output voltage of the distributed generator with a predetermined threshold and if greater, a command is issued for a disconnect of the distributed generator from the feeder. To extend the range of detection, the phase shift procedure is used when a power mismatch between the distributed generator and the load exceeds a threshold and either or both of an under/over frequency procedure and an under/over voltage procedure is used when any power mismatch does not exceed the threshold.

  8. A new low voltage level-shifted FVF current mirror with enhanced bandwidth and output resistance

    NASA Astrophysics Data System (ADS)

    Aggarwal, Bhawna; Gupta, Maneesha; Gupta, Anil Kumar; Sangal, Ankur

    2016-10-01

    This paper proposes a new high-performance level-shifted flipped voltage follower (LSFVF) based low-voltage current mirror (CM). The proposed CM utilises the low-supply voltage and low-input resistance characteristics of a flipped voltage follower (FVF) CM. In the proposed CM, level-shifting configuration is used to obtain a wide operating current range and resistive compensation technique is employed to increase the operating bandwidth. The peaking in frequency response is reduced by using an additional large MOSFET. Moreover, a very high output resistance (in GΩ range) along with low-current transfer error is achieved through super-cascode configuration for a wide current range (0-440 µA). Small signal analysis is carried out to show the improvements achieved at each step. The proposed CM is simulated by Mentor Graphics Eldospice in TSMC 0.18 µm CMOS, BSIM3 and Level 53 technology. In the proposed CM, a bandwidth of 6.1799 GHz, 1% settling time of 0.719 ns, input and output resistances of 21.43 Ω and 1.14 GΩ, respectively, are obtained with a single supply voltage of 1 V. The layout of the proposed CM has been designed and post-layout simulation results have been shown. The post-layout simulation results for Monte Carlo and temperature analysis have also been included to show the reliability of the CM against the variations in process parameters and temperature changes.

  9. Limitations of threshold voltage engineering of AlGaN/GaN heterostructures by dielectric interface charge density and manipulation by oxygen plasma surface treatments

    NASA Astrophysics Data System (ADS)

    Lükens, G.; Yacoub, H.; Kalisch, H.; Vescan, A.

    2016-05-01

    The interface charge density between the gate dielectric and an AlGaN/GaN heterostructure has a significant impact on the absolute value and stability of the threshold voltage Vth of metal-insulator-semiconductor (MIS) heterostructure field effect transistor. It is shown that a dry-etching step (as typically necessary for normally off devices engineered by gate-recessing) before the Al2O3 gate dielectric deposition introduces a high positive interface charge density. Its origin is most likely donor-type trap states shifting Vth to large negative values, which is detrimental for normally off devices. We investigate the influence of oxygen plasma annealing techniques of the dry-etched AlGaN/GaN surface by capacitance-voltage measurements and demonstrate that the positive interface charge density can be effectively compensated. Furthermore, only a low Vth hysteresis is observable making this approach suitable for threshold voltage engineering. Analysis of the electrostatics in the investigated MIS structures reveals that the maximum Vth shift to positive voltages achievable is fundamentally limited by the onset of accumulation of holes at the dielectric/barrier interface. In the case of the Al2O3/Al0.26Ga0.74N/GaN material system, this maximum threshold voltage shift is limited to 2.3 V.

  10. High-quality uniaxial In(x)Ga(1-x)N/GaN multiple quantum well (MQW) nanowires (NWs) on Si(111) grown by metal-organic chemical vapor deposition (MOCVD) and light-emitting diode (LED) fabrication.

    PubMed

    Ra, Yong-Ho; Navamathavan, R; Park, Ji-Hyeon; Lee, Cheul-Ro

    2013-03-01

    This article describes the growth and device characteristics of vertically aligned high-quality uniaxial p-GaN/InxGa1-xN/GaN multiple quantum wells (MQW)/n-GaN nanowires (NWs) on Si(111) substrates grown by metal-organic chemical vapor deposition (MOCVD) technique. The resultant nanowires (NWs), with a diameter of 200-250 nm, have an average length of 2 μm. The feasibility of growing high-quality NWs with well-controlled indium composition MQW structure is demonstrated. These resultant NWs grown on Si(111) substrates were utilized for fabricating vertical-type light-emitting diodes (LEDs). The steep and intense photoluminescence (PL) and cathodoluminescence (CL) spectra are observed, based on the strain-free NWs on Si(111) substrates. High-resolution transmission electron microscopy (HR-TEM) analysis revealed that the MQW NWs are grown along the c-plane with uniform thickness. The current-voltage (I-V) characteristics of these NWs exhibited typical p-n junction LEDs and showed a sharp onset voltage at 2.75 V in the forward bias. The output power is linearly increased with increasing current. The result indicates that the pulsed MOCVD technique is an effective method to grow uniaxial p-GaN/InxGa1-xN/GaN MQW/n-GaN NWs on Si(111), which is more advantageous than other growth techniques, such as molecular beam epitaxy. These results suggest the uniaxial NWs are promising to allow flat-band quantum structures, which can enhance the efficiency of LEDs.

  11. MOSFET and MOS capacitor responses to ionizing radiation

    NASA Technical Reports Server (NTRS)

    Benedetto, J. M.; Boesch, H. E., Jr.

    1984-01-01

    The ionizing radiation responses of metal oxide semiconductor (MOS) field-effect transistors (FETs) and MOS capacitors are compared. It is shown that the radiation-induced threshold voltage shift correlates closely with the shift in the MOS capacitor inversion voltage. The radiation-induced interface-state density of the MOSFETs and MOS capacitors was determined by several techniques. It is shown that the presence of 'slow' states can interfere with the interface-state measurements.

  12. SEMICONDUCTOR INTEGRATED CIRCUITS: A quasi-3-dimensional simulation method for a high-voltage level-shifting circuit structure

    NASA Astrophysics Data System (ADS)

    Jizhi, Liu; Xingbi, Chen

    2009-12-01

    A new quasi-three-dimensional (quasi-3D) numeric simulation method for a high-voltage level-shifting circuit structure is proposed. The performances of the 3D structure are analyzed by combining some 2D device structures; the 2D devices are in two planes perpendicular to each other and to the surface of the semiconductor. In comparison with Davinci, the full 3D device simulation tool, the quasi-3D simulation method can give results for the potential and current distribution of the 3D high-voltage level-shifting circuit structure with appropriate accuracy and the total CPU time for simulation is significantly reduced. The quasi-3D simulation technique can be used in many cases with advantages such as saving computing time, making no demands on the high-end computer terminals, and being easy to operate.

  13. The use of hydrogenous material for sensitizing pMOS dosimeters to neutrons

    NASA Astrophysics Data System (ADS)

    Kronenberg, S.; Brucker, G. J.

    1995-02-01

    This paper is concerned with the application of pMOS dosimeters to measuring neutron dose by the use of hydrogenous materials to convert incident neutron flux to recoil protons. These latter charged particles can generate electron-hole pairs, and consequently, charge trapping takes place at the MOS interfaces, and threshold voltage shifts are produced. The use of pMOS devices for measuring gamma doses has been described extensively in the literature. Clearly, if measurable voltage shifts could be generated in a MOS device by neutrons, then a radiation detection instrument containing two MOS devices, back to back, with hydrogenous shields, and one MOS dosimeter without a converter would allow 4/spl pi/ measurements of neutron and gamma doses to be made. The results obtained in this study indicate that paraffin or polyethylene will convert incident, 2.82 MeV neutrons to recoil protons, which subsequently cause measurable voltage shifts.

  14. Accurate evaluation of fast threshold voltage shift for SiC MOS devices under various gate bias stress conditions

    NASA Astrophysics Data System (ADS)

    Sometani, Mitsuru; Okamoto, Mitsuo; Hatakeyama, Tetsuo; Iwahashi, Yohei; Hayashi, Mariko; Okamoto, Dai; Yano, Hiroshi; Harada, Shinsuke; Yonezawa, Yoshiyuki; Okumura, Hajime

    2018-04-01

    We investigated methods of measuring the threshold voltage (V th) shift of 4H-silicon carbide (SiC) metal–oxide–semiconductor field-effect transistors (MOSFETs) under positive DC, negative DC, and AC gate bias stresses. A fast measurement method for V th shift under both positive and negative DC stresses revealed the existence of an extremely large V th shift in the short-stress-time region. We then examined the effect of fast V th shifts on drain current (I d) changes within a pulse under AC operation. The fast V th shifts were suppressed by nitridation. However, the I d change within one pulse occurred even in commercially available SiC MOSFETs. The correlation between I d changes within one pulse and V th shifts measured by a conventional method is weak. Thus, a fast and in situ measurement method is indispensable for the accurate evaluation of I d changes under AC operation.

  15. Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene.

    PubMed

    Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen

    2018-07-01

    Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. Graphical Abstract ᅟ.

  16. Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene

    NASA Astrophysics Data System (ADS)

    Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen

    2018-04-01

    Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. [Figure not available: see fulltext.

  17. Significance of the gate voltage-dependent mobility in the electrical characterization of organic field effect transistors

    NASA Astrophysics Data System (ADS)

    Kim, Jong Beom; Lee, Dong Ryeol

    2018-04-01

    We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.

  18. Threshold-Voltage Shifts in Organic Transistors Due to Self-Assembled Monolayers at the Dielectric: Evidence for Electronic Coupling and Dipolar Effects.

    PubMed

    Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen

    2015-10-21

    The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.

  19. Characterization, modeling and physical mechanisms of different surface treatment methods at room temperature on the oxide and interfacial quality of the SiO2 film using the spectroscopic scanning capacitance microscopy

    NASA Astrophysics Data System (ADS)

    Wong, Kin Mun

    In this article, a simple, low cost and combined surface treatment method [pre-oxidation immersion of the p-type silicon (Si) substrate in hydrogen peroxide (H2O2) and post oxidation ultra-violet (UV) irradiation of the silicon-dioxide (SiO2) film] at room temperature is investigated. The interface trap density at midgap [Dit(mg)] of the resulting SiO2 film (denoted as sample 1A) is quantified from the full width at half-maximum of the scanning capacitance microscopy (SCM) differential capacitance (dC/dV) characteristics by utilizing a previously validated theoretical model. The Dit(mg) of sample 1A is significantly lower than the sample without any surface treatments which indicates that it is a viable technique for improving the interfacial quality of the thicker SiO2 films prepared by wet oxidation. Moreover, the proposed combined surface treatment method may possibly complement the commonly used forming gas anneal process to further improve the interfacial quality of the SiO2 films. The positive shift of the flatband voltage due to the overall oxide charges (estimated from the probe tip dc bias at the peak dC/dV spectra) of sample 1A suggests the presence of negative oxide fixed charge density (Nf) in the oxide. In addition, an analytical formula is derived to approximate the difference of the Nf values between the oxide samples that are immersed in H2O2 and UV irradiated from their measured SCM dC/dV spectra. Conversely, some physical mechanisms are proposed that result in the ionization of the SiO- species (which are converted from the neutral SiOH groups that originate from the pre-oxidation immersion in H2O2 and ensuing wet oxidation) during the UV irradiation as well as the UV photo-injected electrons from the Si substrate (which did not interact with the SiOH groups). They constitute the source of mobile electrons which partially passivate the positively charged empty donor-like interface traps at the Si-SiO2 interface.

  20. Electro-optic and radiation damage performance of the CIS115, an imaging sensor for the JANUS optical camera onboard JUICE

    NASA Astrophysics Data System (ADS)

    Soman, M. R.; Allanwood, E. A. H.; Holland, A. D.; Stefanov, K.; Pratlong, J.; Leese, M.; Gow, J. P. D.; Smith, D. R.

    2016-08-01

    The Jupiter Icy Moon Explorer (JUICE) has been officially adopted as the next Large class mission by the European Space Agency, with a launch date of 2022. The science payload includes an optical camera, JANUS, which will perform imaging and mapping observations of Jupiter, its moons and icy rings. A 13 slot filter wheel will be used to provide spectral information in order for the JANUS experiment to study the geology and physical properties of Ganymede, Europa and Io, and to investigate processes and structures in the atmosphere of Jupiter. The sensor selected for JANUS is the back-thinned CIS115, a 3 MPixel CMOS Image Sensor from e2v technologies. The CIS115 has a 4-Transistor pixel design with a pinned photodiode to improve signal to noise performance by reducing dark current and allowing for reset level subtraction. The JUICE mission will consist of an 8 year cruise phase followed by a 3 year science phase in the Jovian system. Models of the radiation environment throughout the JUICE mission predict that the End of Life (EOL) non-ionising damage will be equivalent to 1010 protons cm-2 (10 MeV) and the EOL ionising dose will be 100 krad(Si), once the shielding from the spacecraft and instrument design is taken into account. An extensive radiation campaign is therefore being carried out to qualify and characterise the CIS115 for JANUS, as well as other space and terrestrial applications. Radiation testing to take the CIS115 to twice the ionising dose and displacement damage levels was completed in 2015 and the change in sensor performance has been characterised. Good sensor performance has been observed following irradiation and a summary of the key results from the campaign using gamma irradiation (ionising dose) will be presented here, including its soft X-ray detection capabilities, flat-band voltage shift and readout noise. In 2016, further radiation campaigns on flight-representative CIS115s will be undertaken and their results will be disseminated in future publications.

  1. Infant breathing rate counter based on variable resistor for pneumonia

    NASA Astrophysics Data System (ADS)

    Sakti, Novi Angga; Hardiyanto, Ardy Dwi; La Febry Andira R., C.; Camelya, Kesa; Widiyanti, Prihartini

    2016-03-01

    Pneumonia is one of the leading causes of death in new born baby in Indonesia. According to WHO in 2002, breathing rate is very important index to be the symptom of pneumonia. In the Community Health Center, the nurses count with a stopwatch for exactly one minute. Miscalculation in Community Health Center occurs because of long time concentration and focus on two object at once. This calculation errors can cause the baby who should be admitted to the hospital only be attended at home. Therefore, an accurate breathing rate counter at Community Health Center level is necessary. In this work, resistance change of variable resistor is made to be breathing rate counter. Resistance change in voltage divider can produce voltage change. If the variable resistance moves periodically, the voltage will change periodically too. The voltage change counted by software in the microcontroller. For the every mm shift at the variable resistor produce average 0.96 voltage change. The software can count the number of wave generated by shifting resistor.

  2. Nonlinear effects of hyperpolarizing shifts in activation of mutant Nav1.7 channels on resting membrane potential

    PubMed Central

    Estacion, Mark

    2017-01-01

    The Nav1.7 sodium channel is preferentially expressed within dorsal root ganglion (DRG) and sympathetic ganglion neurons. Gain-of-function mutations that cause the painful disorder inherited erythromelalgia (IEM) shift channel activation in a hyperpolarizing direction. When expressed within DRG neurons, these mutations produce a depolarization of resting membrane potential (RMP). The biophysical basis for the depolarized RMP has to date not been established. To explore the effect on RMP of the shift in activation associated with a prototypical IEM mutation (L858H), we used dynamic-clamp models that represent graded shifts that fractionate the effect of the mutation on activation voltage dependence. Dynamic-clamp recording from DRG neurons using a before-and-after protocol for each cell made it possible, even in the presence of cell-to-cell variation in starting RMP, to assess the effects of these graded mutant models. Our results demonstrate a nonlinear, progressively larger effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. The observed differences in RMP were predicted by the “late” current of each mutant model. Since the depolarization of RMP imposed by IEM mutant channels is known, in itself, to produce hyperexcitability of DRG neurons, the development of pharmacological agents that normalize or partially normalize activation voltage dependence of IEM mutant channels merits further study. NEW & NOTEWORTHY Inherited erythromelalgia (IEM), the first human pain disorder linked to a sodium channel, is widely regarded as a genetic model of neuropathic pain. IEM is produced by Nav1.7 mutations that hyperpolarize activation. These mutations produce a depolarization of resting membrane potential (RMP) in dorsal root ganglion neurons. Using dynamic clamp to explore the effect on RMP of the shift in activation, we demonstrate a nonlinear effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. PMID:28148645

  3. Electroluminescence from ZnCuInS/ZnS quantum dots/poly(9-vinylcarbazole) multilayer films with different thicknesses of quantum dot layer

    NASA Astrophysics Data System (ADS)

    Dong, Xiaofei; Xu, Jianping; Shi, Shaobo; Zhang, Xiaosong; Li, Lan; Yin, Shougen

    2017-05-01

    We report tunable electroluminescence (EL) from solution-processed ZnCuInS/ZnS (ZCIS/ZnS) quantum dots (QDs)/poly(9-vinlycarbazole) multilayer films. The EL spectra exhibit a red shift as the QD layer thickness increases. By analyzing the dependence of the applied voltage and the ZCIS/ZnS QD layer thickness on the EL spectra, the origin of the red shift is associated with the increased trap density of QDs that induces the injected electrons to be trapped in the deep donor level. The current conduction mechanism based on the current density-voltage curves at different voltage regions was discussed.

  4. Charge movement in gating-locked HCN channels reveals weak coupling of voltage sensors and gate.

    PubMed

    Ryu, Sujung; Yellen, Gary

    2012-11-01

    HCN (hyperpolarization-activated cyclic nucleotide gated) pacemaker channels have an architecture similar to that of voltage-gated K(+) channels, but they open with the opposite voltage dependence. HCN channels use essentially the same positively charged voltage sensors and intracellular activation gates as K(+) channels, but apparently these two components are coupled differently. In this study, we examine the energetics of coupling between the voltage sensor and the pore by using cysteine mutant channels for which low concentrations of Cd(2+) ions freeze the open-closed gating machinery but still allow the sensors to move. We were able to lock mutant channels either into open or into closed states by the application of Cd(2+) and measure the effect on voltage sensor movement. Cd(2+) did not immobilize the gating charge, as expected for strict coupling, but rather it produced shifts in the voltage dependence of voltage sensor charge movement, consistent with its effect of confining transitions to either closed or open states. From the magnitude of the Cd(2+)-induced shifts, we estimate that each voltage sensor produces a roughly three- to sevenfold effect on the open-closed equilibrium, corresponding to a coupling energy of ∼1.3-2 kT per sensor. Such coupling is not only opposite in sign to the coupling in K(+) channels, but also much weaker.

  5. Effects of acidic pH on voltage-gated ion channels in rat trigeminal mesencephalic nucleus neurons.

    PubMed

    Han, Jin-Eon; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung

    2017-03-01

    The effects of acidic pH on several voltage-dependent ion channels, such as voltage-dependent K + and Ca 2+ channels, and hyperpolarization-gated and cyclic nucleotide-activated cation (HCN) channels, were examined using a whole-cell patch clamp technique on mechanically isolated rat mesencephalic trigeminal nucleus neurons. The application of a pH 6.5 solution had no effect on the peak amplitude of voltage-dependent K + currents. A pH 6.0 solution slightly, but significantly inhibited the peak amplitude of voltage-dependent K + currents. The pH 6.0 also shifted both the current-voltage and conductance-voltage relationships to the depolarization range. The application of a pH 6.5 solution scarcely affected the peak amplitude of membrane currents mediated by HCN channels, which were profoundly inhibited by the general HCN channel blocker Cs + (1 mM). However, the pH 6.0 solution slightly, but significantly inhibited the peak amplitude of HCN-mediated currents. Although the pH 6.0 solution showed complex modulation of the current-voltage and conductance-voltage relationships, the midpoint voltages for the activation of HCN channels were not changed by acidic pH. On the other hand, voltage-dependent Ca 2+ channels were significantly inhibited by an acidic pH. The application of an acidic pH solution significantly shifted the current-voltage and conductance-voltage relationships to the depolarization range. The modulation of several voltage-dependent ion channels by an acidic pH might affect the excitability of mesencephalic trigeminal nucleus neurons, and thus physiological functions mediated by the mesencephalic trigeminal nucleus could be affected in acidic pH conditions.

  6. Three-dimensional vertical Si nanowire MOS capacitor model structure for the study of electrical versus geometrical Si nanowire characteristics

    NASA Astrophysics Data System (ADS)

    Hourdakis, E.; Casanova, A.; Larrieu, G.; Nassiopoulou, A. G.

    2018-05-01

    Three-dimensional (3D) Si surface nanostructuring is interesting towards increasing the capacitance density of a metal-oxidesemiconductor (MOS) capacitor, while keeping reduced footprint for miniaturization. Si nanowires (SiNWs) can be used in this respect. With the aim of understanding the electrical versus geometrical characteristics of such capacitors, we fabricated and studied a MOS capacitor with highly ordered arrays of vertical Si nanowires of different lengths and thermal silicon oxide dielectric, in comparison to similar flat MOS capacitors. The high homogeneity and ordering of the SiNWs allowed the determination of the single SiNW capacitance and intrinsic series resistance, as well as other electrical characteristics (density of interface states, flat-band voltage and leakage current) in relation to the geometrical characteristics of the SiNWs. The SiNW capacitors demonstrated increased capacitance density compared to the flat case, while maintaining a cutoff frequency above 1 MHz, much higher than in other reports in the literature. Finally, our model system has been shown to constitute an excellent platform for the study of SiNW capacitors with either grown or deposited dielectrics, as for example high-k dielectrics for further increasing the capacitance density. This will be the subject of future work.

  7. Studying tantalum-based high-κ dielectrics in terms of capacitance measurements

    NASA Astrophysics Data System (ADS)

    Stojanovska-Georgievska, L.

    2016-08-01

    The trend of rapid development of microelectronics towards nano-miniaturization dictates the inevitable introduction of dielectrics with high permittivity (high-κ dielectrics), as alternative material for replacing SiO2. Therefore, studying these materials in terms of their characteristics, especially in terms of reliability, is of great importance for proper design and manufacture of devices. In this paper, alteration of capacitance in different frequency regimes is used, in order to determine the overall behavior of the material. Samples investigated here are MOS structures containing nanoscale tantalum based dielectrics. Layers of pure Ta2O5, but also Hf and Ti doped tantalum pentoxide, i.e. Ta2O5:Hf and Ta2O5:Ti are studied here. All samples are considered as ultrathin oxide layers with thicknesses less than 15 nm, obtained by radio frequent sputtering on p-type silicon substrate. Measuring capacitive characteristics enables determination of several specific parameters of the structures. The obtained results for capacitance in accumulation, the thickness and time evolution of the interfacial SiO2 layer, values of flatband and threshold voltage, density of oxide charges, interfacial and border states, and reliability properties favor the possibilities for more intensive use of studied materials in new nanoelectronic technologies.

  8. Influence of white light illumination on the performance of a-IGZO thin film transistor under positive gate-bias stress

    NASA Astrophysics Data System (ADS)

    Tang, Lan-Feng; Yu, Guang; Lu, Hai; Wu, Chen-Fei; Qian, Hui-Min; Zhou, Dong; Zhang, Rong; Zheng, You-Dou; Huang, Xiao-Ming

    2015-08-01

    The influence of white light illumination on the stability of an amorphous InGaZnO thin film transistor is investigated in this work. Under prolonged positive gate bias stress, the device illuminated by white light exhibits smaller positive threshold voltage shift than the device stressed under dark. There are simultaneous degradations of field-effect mobility for both stressed devices, which follows a similar trend to that of the threshold voltage shift. The reduced threshold voltage shift under illumination is explained by a competition between bias-induced interface carrier trapping effect and photon-induced carrier detrapping effect. It is further found that white light illumination could even excite and release trapped carriers originally exiting at the device interface before positive gate bias stress, so that the threshold voltage could recover to an even lower value than that in an equilibrium state. The effect of photo-excitation of oxygen vacancies within the a-IGZO film is also discussed. Project supported by the State Key Program for Basic Research of China (Grant Nos. 2011CB301900 and 2011CB922100) and the Priority Academic Program Development of Jiangsu Higher Education Institutions, China.

  9. Absence of a charge diffusion pole at finite energies in an exactly solvable interacting flat-band model in d dimensions

    NASA Astrophysics Data System (ADS)

    Phillips, Philip W.; Setty, Chandan; Zhang, Shuyi

    2018-05-01

    Motivated by recent bounds for charge diffusion in critical matter, we investigate the following question: What sets the scale for the velocity for diffusing degrees of freedom in a scale-invariant system? To make our statements precise, we analyze the diffusion pole in an exactly solvable model for a Mott transition in the presence of a long-range interaction term. To achieve scale invariance, we limit our discussion to the flat-band regime. We find in this limit that the diffusion pole, which would normally obtain at finite energy, is pushed to zero energy, resulting in a vanishing of the diffusion constant. This occurs even in the presence of interactions in certain limits, indicating the robustness of this result to the inclusion of a scale in the problem. Consequently, scale invariance precludes any reasonable definition of the diffusion constant. Nonetheless, we do find that a scale can be defined, albeit irrelevant to diffusion, which is the product of the squared band velocity and the density of states.

  10. Reduced distribution of threshold voltage shift in double layer NiSi2 nanocrystals for nano-floating gate memory applications.

    PubMed

    Choi, Sungjin; Lee, Junhyuk; Kim, Donghyoun; Oh, Seulki; Song, Wangyu; Choi, Seonjun; Choi, Eunsuk; Lee, Seung-Beck

    2011-12-01

    We report on the fabrication and capacitance-voltage characteristics of double layer nickel-silicide nanocrystals with Si3N4 interlayer tunnel barrier for nano-floating gate memory applications. Compared with devices using SiO2 interlayer, the use of Si3N4 interlayer separation reduced the average size (4 nm) and distribution (+/- 2.5 nm) of NiSi2 nanocrystal (NC) charge traps by more than 50% and giving a two fold increase in NC density to 2.3 x 10(12) cm(-2). The increased density and reduced NC size distribution resulted in a significantly decrease in the distribution of the device C-V characteristics. For each program voltage, the distribution of the shift in the threshold voltage was reduced by more than 50% on average to less than 0.7 V demonstrating possible multi-level-cell operation.

  11. Understanding Mott-Schottky Measurements under Illumination in Organic Bulk Heterojunction Solar Cells

    NASA Astrophysics Data System (ADS)

    Zonno, Irene; Martinez-Otero, Alberto; Hebig, Jan-Christoph; Kirchartz, Thomas

    2017-03-01

    The Mott-Schottky analysis in the dark is a frequently used method to determine the doping concentration of semiconductors from capacitance-voltage measurements, even for such complex systems as polymer:fullerene blends used for organic solar cells. While the analysis of capacitance-voltage measurements in the dark is relatively well established, the analysis of data taken under illumination is currently not fully understood. Here, we present experiments and simulations to show which physical mechanisms affect the Mott-Schottky analysis under illumination. We show that the mobility of the blend has a major influence on the shape of the capacitance-voltage curve and can be obtained from data taken under reverse bias. In addition, we show that the apparent shift of the built-in voltage observed previously can be explained by a shift of the onset of space-charge-limited collection with illumination intensity.

  12. Graphene quantum dot (GQD)-induced photovoltaic and photoelectric memory elements in a pentacene/GQD field effect transistor as a probe of functional interface

    NASA Astrophysics Data System (ADS)

    Kim, Youngjun; Cho, Seongeun; Kim, Hyeran; Seo, Soonjoo; Lee, Hyun Uk; Lee, Jouhahn; Ko, Hyungduk; Chang, Mincheol; Park, Byoungnam

    2017-09-01

    Electric field-induced charge trapping and exciton dissociation were demonstrated at a penatcene/grapheme quantum dot (GQD) interface using a bottom contact bi-layer field effect transistor (FET) as an electrical nano-probe. Large threshold voltage shift in a pentacene/GQD FET in the dark arises from field-induced carrier trapping in the GQD layer or GQD-induced trap states at the pentacene/GQD interface. As the gate electric field increases, hysteresis characterized by the threshold voltage shift depending on the direction of the gate voltage scan becomes stronger due to carrier trapping associated with the presence of a GQD layer. Upon illumination, exciton dissociation and gate electric field-induced charge trapping simultaneously contribute to increase the threshold voltage window, which can potentially be exploited for photoelectric memory and/or photovoltaic devices through interface engineering.

  13. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains.

    PubMed

    Cheng, Lan; Sanguinetti, Michael C

    2009-05-01

    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  14. A thermalization energy analysis of the threshold voltage shift in amorphous indium gallium zinc oxide thin film transistors under positive gate bias stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niang, K. M.; Flewitt, A. J., E-mail: ajf@eng.cam.ac.uk; Barquinha, P. M. C.

    Thin film transistors (TFTs) employing an amorphous indium gallium zinc oxide (a-IGZO) channel layer exhibit a positive shift in the threshold voltage under the application of positive gate bias stress (PBS). The time and temperature dependence of the threshold voltage shift was measured and analysed using the thermalization energy concept. The peak energy barrier to defect conversion is extracted to be 0.75 eV and the attempt-to-escape frequency is extracted to be 10{sup 7} s{sup −1}. These values are in remarkable agreement with measurements in a-IGZO TFTs under negative gate bias illumination stress (NBIS) reported recently (Flewitt and Powell, J. Appl. Phys.more » 115, 134501 (2014)). This suggests that the same physical process is responsible for both PBS and NBIS, and supports the oxygen vacancy defect migration model that the authors have previously proposed.« less

  15. Strain-optic voltage monitor wherein strain causes a change in the optical absorption of a crystalline material

    DOEpatents

    Weiss, Jonathan D.

    1997-01-01

    A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field.

  16. Digitally controlled distributed phase shifter

    DOEpatents

    Hietala, V.M.; Kravitz, S.H.; Vawter, G.A.

    1993-08-17

    A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.

  17. Digitally controlled distributed phase shifter

    DOEpatents

    Hietala, Vincent M.; Kravitz, Stanley H.; Vawter, Gregory A.

    1993-01-01

    A digitally controlled distributed phase shifter is comprised of N phase shifters. Digital control is achieved by using N binary length-weighted electrodes located on the top surface of a waveguide. A control terminal is attached to each electrode thereby allowing the application of a control signal. The control signal is either one or two discrete bias voltages. The application of the discrete bias voltages changes the modal index of a portion of the waveguide that corresponds to a length of the electrode to which the bias voltage is applied, thereby causing the phase to change through the underlying portion of the waveguide. The digitally controlled distributed phase shift network has a total phase shift comprised of the sum of the individual phase shifters.

  18. Signal Amplification in Field Effect-Based Sandwich Enzyme-Linked Immunosensing by Tuned Buffer Concentration with Ionic Strength Adjuster.

    PubMed

    Kumar, Satyendra; Kumar, Narendra; Panda, Siddhartha

    2016-04-01

    Miniaturization of the sandwich enzyme-based immunosensor has several advantages but could result in lower signal strength due to lower enzyme loading. Hence, technologies for amplification of the signal are needed. Signal amplification in a field effect-based electrochemical immunosensor utilizing chip-based ELISA is presented in this work. First, the molarities of phosphate buffer saline (PBS) and concentrations of KCl as ionic strength adjuster were optimized to maximize the GOx glucose-based enzymatic reactions in a beaker for signal amplification measured by change in the voltage shift with an EIS device (using 20 μl of solution) and validated with a commercial pH meter (using 3 ml of solution). The PBS molarity of 100 μM with 25 mM KCl provided the maximum voltage shift. These optimized buffer conditions were further verified for GOx immobilized on silicon chips, and similar trends with decreased PBS molarity were obtained; however, the voltage shift values obtained on chip reaction were lower as compared to the reactions occurring in the beaker. The decreased voltage shift with immobilized enzyme on chip could be attributed to the increased Km (Michaelis-Menten constant) values in the immobilized GOx. Finally, a more than sixfold signal enhancement (from 8 to 47 mV) for the chip-based sandwich immunoassay was obtained by altering the PBS molarity from 10 to 100 μM with 25 mM KCl.

  19. Barbiturates Block Sodium and Potassium Conductance Increases in Voltage-Clamped Lobster Axons

    PubMed Central

    Blaustein, M. P.

    1968-01-01

    Sodium pentobarbital and sodium thiopental decrease both the peak initial (Na) and late steady-state (K) currents and reduce the maximum sodium and potassium conductance increases in voltage-clamped lobster giant axons. These barbiturates also slow the rate at which the sodium conductance turns on, and shift the normalized sodium conductance vs. voltage curves in the direction of depolarization along the voltage axis. Since pentobarbital (pKa = 8.0) blocks the action potential more effectively at pH 8.5 than at pH 6.7, the anionic form of the drug appears to be active. The data suggest that these drugs affect the axon membrane directly, rather than secondarily through effects on intermediary metabolism. It is suggested that penetration of the lipid layer of the membrane by the nonpolar portion of the barbiturate molecules may cause the decrease in membrane conductances, while electrostatic interactions involving the anionic group on the barbiturate, divalent cations, and "fixed charges" in the membrane could account for the slowing of the rate of sodium conductance turn-on and the shift of the normalized conductance curves along the voltage axis. PMID:5648829

  20. Modulation of spin dynamics via voltage control of spin-lattice coupling in multiferroics

    DOE PAGES

    Zhu, Mingmin; Zhou, Ziyao; Peng, Bin; ...

    2017-02-03

    Our work aims at magnonics manipulation by the magnetoelectric coupling effect and is motivated by the most recent progresses in both magnonics (spin dynamics) and multiferroics fields. Here, voltage control of magnonics, particularly the surface spin waves, is achieved in La 0.7Sr 0.3MnO 3/0.7Pb(Mg 1/3Nb 2/3)O 3-0.3PbTiO 3 multiferroic heterostructures. With the electron spin resonance method, a large 135 Oe shift of surface spin wave resonance (≈7 times greater than conventional voltage-induced ferromagnetic resonance shift of 20 Oe) is determined. A model of the spin-lattice coupling effect, i.e., varying exchange stiffness due to voltage-induced anisotropic lattice changes, has been establishedmore » to explain experiment results with good agreement. In addition, an “on” and “off” spin wave state switch near the critical angle upon applying a voltage is created. The modulation of spin dynamics by spin-lattice coupling effect provides a platform for realizing energy-efficient, tunable magnonics devices.« less

  1. A mathematical approach for evaluating nickel-hydrogen cells

    NASA Technical Reports Server (NTRS)

    Leibecki, H. F.

    1986-01-01

    A mathematical equation is presented which gives a quantitative relationship between time-voltage discharge curves, when a cell's ampere-hour capacity is determined at a constant discharge current. In particular the equation quantifies the initial exponential voltage decay; the rate of voltage decay; the overall voltage shift of the curve and the total capacity of the cell at the given discharge current. The results of 12 nickel-hydrogen boiler plate cells cycled to 80 percent depth-of-discharge (DOD) are discussed in association with these equations.

  2. Raman spectrum method for characterization of pull-in voltages of graphene capacitive shunt switches

    NASA Astrophysics Data System (ADS)

    Li, Peng; You, Zheng; Cui, Tianhong

    2012-12-01

    An approach using Raman spectrum method is reported to measure pull-in voltages of graphene capacitive shunt switches. When the bias excesses the pull-in voltage, the Raman spectrum's intensity largely decreases. Two factors that contribute to the intensity reduction are investigated. Moreover, by monitoring the frequency shift of G peak and 2D band, we are able to detect the pull-in voltage and measure the strain change in graphene beams during switching.

  3. Power Factor Controller

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Frank Nola invented the Power Factor Controller (PFC) at Marshall Space Flight Center more than a decade ago. Nola came up with a way to curb power wastage in AC induction motors. The PFC matches voltage with the motor's actual need by continuously sensing shifts between voltage and current. When it senses a light load it cuts the voltage to the minimum needed. Potential energy savings range from 8 to 65 percent.

  4. Benefit from NASA

    NASA Image and Video Library

    1997-01-01

    Frank Nola invented the Power Factor Controller (PFC) at Marshall Space Flight Center more than a decade ago. Nola came up with a way to curb power wastage in AC induction motors. The PFC matches voltage with the motor's actual need by continuously sensing shifts between voltage and current. When it senses a light load it cuts the voltage to the minimum needed. Potential energy savings range from 8 to 65 percent.

  5. Strain-optic voltage monitor wherein strain causes a change in the optical absorption of a crystalline material

    DOEpatents

    Weiss, J.D.

    1997-01-14

    A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field. 6 figs.

  6. Note: Rapid offset reduction of impedance bridges taking into account instrumental damping and phase shifting.

    PubMed

    van der Wel, C M; Kortschot, R J; Bakelaar, I A; Erné, B H; Kuipers, B W M

    2013-03-01

    The sensitivity of an imperfectly balanced impedance bridge is limited by the remaining offset voltage. Here, we present a procedure for offset reduction in impedance measurements using a lock-in amplifier, by applying a complex compensating voltage external to the bridge. This procedure takes into account instrumental damping and phase shifting, which generally occur at the high end of the operational frequency range. Measurements demonstrate that the output of the circuit rapidly converges to the instrumentally limited noise at any frequency.

  7. Basic corrections to predictions of solar cell performance required by nonlinearities

    NASA Technical Reports Server (NTRS)

    Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.

    1976-01-01

    The superposition principle is used to derive the approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. The derivation requires the linearity of the boundary value problems that underlie the electrical characteristics. The shifting approximation is invalid if considerable photocurrent and considerable dark current both occur within the junction space-charge region; it is invalid also if sizable series resistance is present or if high-injection concentrations of holes and electrons exist within the quasi-neutral regions.

  8. Unraveling the mechanism of ultraviolet-induced optical gating in Zn1-x Mg x O nanocrystal solid solution field effect transistors

    NASA Astrophysics Data System (ADS)

    Kim, Youngjun; Cho, Seongeun; Park, Byoungnam

    2018-03-01

    We report ultraviolet (UV)-induced optical gating in a Zn1-x Mg x O nanocrystal solid solution (NCSS) field effect transistor (FET) through a systematic study in which UV-induced charge transport properties are probed as a function of Mg composition. Change in the electrical properties of Zn1-x Mg x O NCSS associated with electronic traps is investigated by field effect-modulated current-voltage characteristic curves in the dark and under illumination. Under UV illumination, significant threshold voltage shift to a more negative value in an n-channel Zn1-x Mg x O NCSS FET is observed. Importantly, as the Mg composition increases, the effect of UV illumination on the threshold voltage shift is alleviated. We found that threshold voltage shift as a function of Mg composition in the dark and under illumination is due to difference in the deep trap density in the Zn1-x Mg x O NCSS. This is supported by Mg composition dependent photoluminescence intensity in the visible range and reduced FET mobility with Mg addition. The presence of the deep traps and the corresponding trap energy levels in the Zn1-x Mg x O NCSS are ensured by photoelectron spectroscopy in air.

  9. Comparison between Phase-Shift Full-Bridge Converters with Noncoupled and Coupled Current-Doubler Rectifier

    PubMed Central

    Tsai, Cheng-Tao; Tseng, Sheng-Yu

    2013-01-01

    This paper presents comparison between phase-shift full-bridge converters with noncoupled and coupled current-doubler rectifier. In high current capability and high step-down voltage conversion, a phase-shift full-bridge converter with a conventional current-doubler rectifier has the common limitations of extremely low duty ratio and high component stresses. To overcome these limitations, a phase-shift full-bridge converter with a noncoupled current-doubler rectifier (NCDR) or a coupled current-doubler rectifier (CCDR) is, respectively, proposed and implemented. In this study, performance analysis and efficiency obtained from a 500 W phase-shift full-bridge converter with two improved current-doubler rectifiers are presented and compared. From their prototypes, experimental results have verified that the phase-shift full-bridge converter with NCDR has optimal duty ratio, lower component stresses, and output current ripple. In component count and efficiency comparison, CCDR has fewer components and higher efficiency at full load condition. For small size and high efficiency requirements, CCDR is relatively suitable for high step-down voltage and high efficiency applications. PMID:24381521

  10. Comparison between phase-shift full-bridge converters with noncoupled and coupled current-doubler rectifier.

    PubMed

    Tsai, Cheng-Tao; Su, Jye-Chau; Tseng, Sheng-Yu

    2013-01-01

    This paper presents comparison between phase-shift full-bridge converters with noncoupled and coupled current-doubler rectifier. In high current capability and high step-down voltage conversion, a phase-shift full-bridge converter with a conventional current-doubler rectifier has the common limitations of extremely low duty ratio and high component stresses. To overcome these limitations, a phase-shift full-bridge converter with a noncoupled current-doubler rectifier (NCDR) or a coupled current-doubler rectifier (CCDR) is, respectively, proposed and implemented. In this study, performance analysis and efficiency obtained from a 500 W phase-shift full-bridge converter with two improved current-doubler rectifiers are presented and compared. From their prototypes, experimental results have verified that the phase-shift full-bridge converter with NCDR has optimal duty ratio, lower component stresses, and output current ripple. In component count and efficiency comparison, CCDR has fewer components and higher efficiency at full load condition. For small size and high efficiency requirements, CCDR is relatively suitable for high step-down voltage and high efficiency applications.

  11. Inhibitory effects of magnolol on voltage-gated Na+ and K+ channels of NG108-15 cells.

    PubMed

    Gong, Chi-Li; Wong, Kar-Lok; Cheng, Ka-Shun; Kuo, Chang-Shin; Chao, Chia-Chia; Tsai, Min-Fan; Leung, Yuk-Man

    2012-05-05

    Magnolol, a polyphenolic compound isolated from Houpu, a Chinese herb from the bark of Magnolia officinalis, has been reported to have in vitro and in vivo neuroprotective effects. In spite of these reported beneficial effects, studies on the direct impact of magnolol on neuronal ion channels have been scarce. Whether magnolol affects voltage-gated Na(+) channels (VGSC) and voltage-gated K(+) (Kv) channels is unknown. Using the whole-cell voltage-clamp method, we studied the effects of magnolol on voltage-gated ion channels in neuronal NG108-15 cells. Magnolol inhibited VGSC channels with mild state-dependence (IC(50) of 15 and 30 μM, at holding potentials of -70 and -100 mV, respectively). No frequency-dependence was observed in magnolol block. Magnolol caused a left-shift of 18 mV in the steady-state inactivation curve but did not affect the voltage-dependence of activation. Magnolol inhibited Kv channels with an IC(50) of 21 μM, and it caused a 20-mV left-shift in the steady-state inactivation curve without affecting the voltage-dependence of activation. In conclusion, magnolol is an inhibitor of both VGSC and Kv channels and these inhibitory effects may in part contribute to some of the reported neuroprotective effects of magnolol. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    PubMed

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  13. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    PubMed Central

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  14. Motor Starters

    NASA Technical Reports Server (NTRS)

    1986-01-01

    The power factor controller (PFC) was invented by a NASA engineer. It matches voltage with a motor's actual need by sensing shifts in the relationship between voltage and current flow. With the device, power can be trimmed as much as 65%. Intellinet adopted this technology and designed "soft start" and "load-responsive" control modes to start engines gradually and recycle voltage without reducing motor speed. Other features are lower motor heat and faster fault identification.

  15. A finite state machine read-out chip for integrated surface acoustic wave sensors

    NASA Astrophysics Data System (ADS)

    Rakshit, Sambarta; Iliadis, Agis A.

    2015-01-01

    A finite state machine based integrated sensor circuit suitable for the read-out module of a monolithically integrated SAW sensor on Si is reported. The primary sensor closed loop consists of a voltage controlled oscillator (VCO), a peak detecting comparator, a finite state machine (FSM), and a monolithically integrated SAW sensor device. The output of the system oscillates within a narrow voltage range that correlates with the SAW pass-band response. The period of oscillation is of the order of the SAW phase delay. We use timing information from the FSM to convert SAW phase delay to an on-chip 10 bit digital output operating on the principle of time to digital conversion (TDC). The control inputs of this digital conversion block are generated by a second finite state machine operating under a divided system clock. The average output varies with changes in SAW center frequency, thus tracking mass sensing events in real time. Based on measured VCO gain of 16 MHz/V our system will convert a 10 kHz SAW frequency shift to a corresponding mean voltage shift of 0.7 mV. A corresponding shift in phase delay is converted to a one or two bit shift in the TDC output code. The system can handle alternate SAW center frequencies and group delays simply by adjusting the VCO control and TDC delay control inputs. Because of frequency to voltage and phase to digital conversion, this topology does not require external frequency counter setups and is uniquely suitable for full monolithic integration of autonomous sensor systems and tags.

  16. Improvements in the bias illumination stability of amorphous InGaZnO thin-film transistors by using thermal treatments

    NASA Astrophysics Data System (ADS)

    Kim, Woo-Byung; Lee, Dong Keun; Ryu, Sang Ouk

    2014-07-01

    The a-IGZO deposited by using the rf sputtering method features a conductive or an insulator characteristic based on amount of oxygen. We demonstrated that a post-treatment affects the resistance patterns of particular-sized InGaZnO(IGZO) thin films in a-IGZO thin-film transistors (TFTs). Post-annealing shifted the driving voltage of a-IGZO TFT to positive or negative values, depending on the annealing temperatures. Post-annealing may introduce oxygen vacancies or desorbed oxygen in the IGZO thin film. The changed driving voltage of IGZO TFTs coincides with the shift of the resistance pattern of IGZO. The fabricated a-IGZO TFTs exhibited a field effect mobility of 6.2 cm2/Vs, an excellent subthreshold gate swing of 0.32 V/decade, and a high I on/off ratio of > 109. Under positive bias illumination stress (PBIS) and negative bias illumination stress (NBIS), after 3,600 seconds, the device threshold voltage shifted about 0.2 V and 0.3 V, respectively.

  17. Stability study of solution-processed zinc tin oxide thin-film transistors

    NASA Astrophysics Data System (ADS)

    Zhang, Xue; Ndabakuranye, Jean Pierre; Kim, Dong Wook; Choi, Jong Sun; Park, Jaehoon

    2015-11-01

    In this study, the environmental dependence of the electrical stability of solution-processed n-channel zinc tin oxide (ZTO) thin-film transistors (TFTs) is reported. Under a prolonged negative gate bias stress, a negative shift in threshold voltage occurs in atmospheric air, whereas a negligible positive shift in threshold voltage occurs under vacuum. In the positive bias-stress experiments, a positive shift in threshold voltage was invariably observed both in atmospheric air and under vacuum. In this study, the negative gate-bias-stress-induced instability in atmospheric air is explained through an internal potential in the ZTO semiconductor, which can be generated owing to the interplay between H2O molecules and majority carrier electrons at the surface of the ZTO film. The positive bias-stress-induced instability is ascribed to electron-trapping phenomenon in and around the TFT channel region, which can be further augmented in the presence of air O2 molecules. These results suggest that the interaction between majority carriers and air molecules will have crucial implications for a reliable operation of solution-processed ZTO TFTs. [Figure not available: see fulltext.

  18. Possibility of Flat-Band Ferromagnetism in Hole-Doped Pyrochlore Oxides Sn2 Nb2 O7 and Sn2 Ta2 O7

    NASA Astrophysics Data System (ADS)

    Hase, I.; Yanagisawa, T.; Aiura, Y.; Kawashima, K.

    2018-05-01

    Quantum mechanics tells us that the hopping integral between local orbitals makes the energy band dispersive. In a lattice with geometric frustration, however, dispersionless flat bands may appear due to quantum interference. Several models possessing flat bands have been proposed theoretically, and many attracting magnetic and electronic properties are predicted. However, despite many attempts to realize these models experimentally, compounds that are appropriately described by this model have not been found so far. Here we show that pyrochlore oxides Sn2 Nb2 O7 and Sn2Ta2O7 are such examples, by performing first-principles band calculation and several tight-binding analyses. Moreover, spin-polarized band calculation shows that the hole-doped systems Sn2 Nb2 O6 N and Sn2 Ta2 O6 N have complete spin polarization, and their magnetic moments are mostly carried by Sn-s and N-p orbitals, which are usually nonmagnetic. These compounds are not only candidates for ferromagnets without a magnetic element, but also will provide an experimental platform for a flat-band model which shows a wide range of physical properties.

  19. Palladium configuration dependence of hydrogen detection sensitivity based on graphene FET for breath analysis

    NASA Astrophysics Data System (ADS)

    Sakamoto, Yuri; Uemura, Kohei; Ikuta, Takashi; Maehashi, Kenzo

    2018-04-01

    We have succeeded in fabricating a hydrogen gas sensor based on palladium-modified graphene field-effect transistors (FETs). The negative-voltage shift in the transfer characteristics was observed with exposure to hydrogen gas, which was explained by the change in work function. The hydrogen concentration dependence of the voltage shift was investigated using graphene FETs with palladium deposited by three different evaporation processes. The results indicate that the hydrogen detection sensitivity of the palladium-modified graphene FETs is strongly dependent on the palladium configuration. Therefore, the palladium-modified graphene FET is a candidate for breath analysis.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rajachidambaram, Meena Suhanya; Pandey, Archana; Vilayur Ganapathy, Subramanian

    The role of back channel surface chemistry on amorphous zinc tin oxide (ZTO) bottom gate thin film transistors (TFT) have been characterized by positive bias-stress measurements and x-ray photoelectron spectroscopy. Positive bias-stress turn-on voltage shifts for ZTO-TFTs were significantly reduced by passivation of back channel surfaces with self-assembled monolayers of n-hexylphosphonic acid (n-HPA) when compared to ZTO-TFTs with no passivation. These results indicate that adsorption of molecular species on exposed back channel of ZTO-TFTs strongly influence observed turn-on voltage shifts, as opposed to charge injection into the dielectric or trapping due to oxygen vacancies.

  1. Photocurrent Suppression of Transparent Organic Thin Film Transistors

    NASA Astrophysics Data System (ADS)

    Chuang, Chiao-Shun; Tsai, Shu-Ting; Lin, Yung-Sheng; Chen, Fang-Chung; Shieh, Hang-Ping D.

    2007-12-01

    Organic thin-film transistors (OTFTs) with high transmittance and low photosensitivity have been demonstrated. By using titanium dioxide nanoparticles as the additives in the polymer gate insulators, the level of device photoresponse has been reduced. The device shows simultaneously a high transparence and a minimal threshold voltage shift under white light illumination. It is inferred that the localized energy levels deep in the energy gap of pentacene behave as the recombination centers, enhancing substantially the recombination process in the conducting channel of the OTFTs. Therefore, the electron trapping is relieved and the shift of threshold voltage is reduced upon illumination.

  2. Side-gate modulation effects on high-quality BN-Graphene-BN nanoribbon capacitors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yang; Chen, Xiaolong; Ye, Weiguang

    High-quality BN-Graphene-BN nanoribbon capacitors with double side-gates of graphene have been experimentally realized. The double side-gates can effectively modulate the electronic properties of graphene nanoribbon capacitors. By applying anti-symmetric side-gate voltages, we observed significant upward shifting and flattening of the V-shaped capacitance curve near the charge neutrality point. Symmetric side-gate voltages, however, only resulted in tilted upward shifting along the opposite direction of applied gate voltages. These modulation effects followed the behavior of graphene nanoribbons predicted theoretically for metallic side-gate modulation. The negative quantum capacitance phenomenon predicted by numerical simulations for graphene nanoribbons modulated by graphene side-gates was not observed,more » possibly due to the weakened interactions between the graphene nanoribbon and side-gate electrodes caused by the Ga{sup +} beam etching process.« less

  3. Investigation of AlGaN/GaN HEMTs degradation with gate pulse stressing at cryogenic temperature

    NASA Astrophysics Data System (ADS)

    Wang, Ning; Wang, Hui; Lin, Xinpeng; Qi, Yongle; Duan, Tianli; Jiang, Lingli; Iervolino, Elina; Cheng, Kai; Yu, Hongyu

    2017-09-01

    Degradation on DC characteristics of AlGaN/GaN high electron mobility transistors (HEMTs) after applying pulsed gate stress at cryogenic temperatures is presented in this paper. The nitrogen vacancy near to the AlGaN/GaN interface leads to threshold voltage of stress-free sample shifting positively at low temperature. The anomalous behavior of threshold voltage variation (decrease first and then increase) under gate stressing as compared to stress-free sample is observed when lowing temperature. This can be correlated with the pre-existing electron traps in SiNX layer or at SiNX/AlGaN interface which can be de-activated and the captured electrons inject back to channel with lowering temperature, which counterbalances the influence of nitrogen vacancy on threshold voltage shift.

  4. Driving Method for Compensating Reliability Problem of Hydrogenated Amorphous Silicon Thin Film Transistors and Image Sticking Phenomenon in Active Matrix Organic Light-Emitting Diode Displays

    NASA Astrophysics Data System (ADS)

    Shin, Min-Seok; Jo, Yun-Rae; Kwon, Oh-Kyong

    2011-03-01

    In this paper, we propose a driving method for compensating the electrical instability of hydrogenated amorphous silicon (a-Si:H) thin film transistors (TFTs) and the luminance degradation of organic light-emitting diode (OLED) devices for large active matrix OLED (AMOLED) displays. The proposed driving method senses the electrical characteristics of a-Si:H TFTs and OLEDs using current integrators and compensates them by an external compensation method. Threshold voltage shift is controlled a using negative bias voltage. After applying the proposed driving method, the measured error of the maximum emission current ranges from -1.23 to +1.59 least significant bit (LSB) of a 10-bit gray scale under the threshold voltage shift ranging from -0.16 to 0.17 V.

  5. Photoelectrochemical Properties and Behavior of α-SnWO4 Photoanodes Synthesized by Hydrothermal Conversion of WO3 Films.

    PubMed

    Zhu, Zhehao; Sarker, Pranab; Zhao, Chenqi; Zhou, Lite; Grimm, Ronald L; Huda, Muhammad N; Rao, Pratap M

    2017-01-18

    Metal oxides with moderate band gaps are desired for efficient production of hydrogen from sunlight and water via photoelectrochemical (PEC) water splitting. Here, we report an α-SnWO 4 photoanode synthesized by hydrothermal conversion of WO 3 films that achieves photon to current conversion at wavelengths up to 700 nm (1.78 eV). This photoanode is promising for overall PEC water-splitting because the flat-band potential and voltage of photocurrent onset are more negative than the potential of hydrogen evolution. Furthermore, the photoanode utilizes a large portion of the solar spectrum. However, the photocurrent density reaches only a small fraction of that which is theoretically possible. Density functional theory based thermodynamic and electronic structure calculations were performed to elucidate the nature and impact of defects in α-SnWO 4 prepared by this synthetic route, from which hole localization at Sn-at-W antisite defects was determined to be a likely cause for the poor photocurrent. Measurements further showed that the photocurrent decreases over time due to surface oxidation, which was suppressed by improving the kinetics of hole transfer at the semiconductor/electrolyte interface. Alternative synthetic methods and the addition of protective coatings and/or oxygen evolution catalysts are suggested to improve the PEC performance and stability of this promising α-SnWO 4 material.

  6. Ta-Pt Alloys as Gate Materials for Metal-Oxide-Semiconductor Field Effect Transistor Application

    NASA Astrophysics Data System (ADS)

    Huang, Chih-Feng; Tsui, Bing-Yue

    2009-03-01

    In this work we explore the thermal stability of sputter-deposited Ta-rich Ta-Pt alloys. The effects of group III and V impurities on their work function are also investigated. The Ta content ranges from 65 to 82 at. %. The main phase is σ Ta-Pt. The binding energies of core-level electrons of Ta and Pt are changed due to the intermixing of Ta and Pt, which is evidence that the work function of alloys is changed in metallic alloy systems. Binding energies are thermally stable up to 800 °C. Moreover, the incorporation of Pt in Ta film induces poor crystallization and a compound phase of Ta-Pt alloys. Transmission electron microscopy analysis confirmed the absence of a clear grain boundary in Ta-Pt alloys. The Ta and Pt depth profile shows uniformity in depth after 800 °C annealing for 30 min. The diffusion and distribution of impurities in the alloys were studied by secondary ion mass spectroscopy. Arsenic cannot diffuse in the alloys following annealing at 800 °C for 30 s. In contrast, boron can easily diffuse at 800 °C. The incorporation of impurities with a dosage of 5 ×1015 cm-2 in 60 nm Ta-Pt alloy by implantation did not significantly change the flat-band voltage following annealing at 800 °C.

  7. Bias voltage dependence of the electron spin depolarization in quantum wires in the quantum Hall regime detected by the resistively detected NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chida, K.; Yamauchi, Y.; Arakawa, T.

    2013-12-04

    We performed the resistively-detected nuclear magnetic resonance (RDNMR) to study the electron spin polarization in the non-equilibrium quantum Hall regime. By measuring the Knight shift, we derive source-drain bias voltage dependence of the electron spin polarization in quantum wires. The electron spin polarization shows minimum value around the threshold voltage of the dynamic nuclear polarization.

  8. Power Controller

    NASA Technical Reports Server (NTRS)

    1983-01-01

    The power factor controller (PFC) senses shifts in the relationship between voltage and current, and matches them with a motor's need. This prevents waste as motors do not need a high voltage when they are not operating at full load conditions. PFC is manufactured by Nordic Controls Company, among others, and has proved extremely cost effective.

  9. Voltage gating of mechanosensitive PIEZO channels.

    PubMed

    Moroni, Mirko; Servin-Vences, M Rocio; Fleischer, Raluca; Sánchez-Carranza, Oscar; Lewin, Gary R

    2018-03-15

    Mechanosensitive PIEZO ion channels are evolutionarily conserved proteins whose presence is critical for normal physiology in multicellular organisms. Here we show that, in addition to mechanical stimuli, PIEZO channels are also powerfully modulated by voltage and can even switch to a purely voltage-gated mode. Mutations that cause human diseases, such as xerocytosis, profoundly shift voltage sensitivity of PIEZO1 channels toward the resting membrane potential and strongly promote voltage gating. Voltage modulation may be explained by the presence of an inactivation gate in the pore, the opening of which is promoted by outward permeation. Older invertebrate (fly) and vertebrate (fish) PIEZO proteins are also voltage sensitive, but voltage gating is a much more prominent feature of these older channels. We propose that the voltage sensitivity of PIEZO channels is a deep property co-opted to add a regulatory mechanism for PIEZO activation in widely different cellular contexts.

  10. Frequency Invariability of (Pb,La)(Zr,Ti)O₃ Antiferroelectric Thick-Film Micro-Cantilevers.

    PubMed

    An, Kun; Jin, Xuechen; Meng, Jiang; Li, Xiao; Ren, Yifeng

    2018-05-13

    Micro-electromechanical systems comprising antiferroelectric layers can offer both actuation and transduction to integrated technologies. Micro-cantilevers based on the (Pb 0.97 La 0.02 )(Zr 0.95 Ti 0.05 )O₃ (PLZT) antiferroelectric thick film are fabricated by the micro-nano manufacturing process, to utilize the effect of phase transition induced strain and sharp phase switch of antiferroelectric materials. When micro-cantilevers made of antiferroelectric thick films were driven by sweep voltages, there were two resonant peaks corresponding to the natural frequency shift from 27.8 to 27.0 kHz, before and after phase transition. This is the compensation principle for the PLZT micro-cantilever to tune the natural frequency by the amplitude modulation of driving voltage, rather than of frequency modulation. Considering the natural frequency shift about 0.8 kHz and the frequency tuning ability about 156 Hz/V before the phase transition, this can compensate the frequency shift caused by increasing temperature by tuning only the amplitude of driving voltage, when the ultrasonic micro-transducer made of antiferroelectric thick films works for such a long period. Therefore, antiferroelectric thick films with hetero-structures incorporated into PLZT micro-cantilevers not only require a lower driving voltage (no more than 40 V) than rival bulk piezoelectric ceramics, but also exhibit better performance of frequency invariability, based on the amplitude modulation.

  11. Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

    PubMed

    Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

    2017-08-29

    Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

  12. Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

    PubMed Central

    Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-01-01

    A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff <5 msec). However, the signal was small (ΔF/F= 0.6%/200 mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

  13. A polarization-independent liquid crystal phase modulation using polymer-network liquid crystals in a 90° twisted cell

    NASA Astrophysics Data System (ADS)

    Lin, Yi-Hsin; Chen, Ming-Syuan; Lin, Wei-Chih; Tsou, Yu-Shih

    2012-07-01

    A polarization-independent liquid crystal phase modulation using polymer-network liquid crystals in a 90° twisted cell (T-PNLC) is demonstrated. T-PNLC consists of three layers. Liquid crystal (LC) directors in the two layers near glass substrates are orthogonal to each other and those two layers modulate two eigen-polarizations of an incident light. As a result, two eigen-polarizations of an incident light experience the same phase shift. In the middle layer, LC directors are perpendicular to the glass substrate and contribute no phase shift. The phase shift of T-PNLC is electrically tunable and polarization-independent. T-PNLC does not require any bias voltage for operation. The phase shift is 0.28 π rad for the voltage of 30 Vrms. By measuring and analyzing the optical phase shift of T-PNLC at the oblique incidence of transverse magnetic wave, the pretilt angle of LC directors and the effective thickness of three layers are obtained and discussed. The potential applications are spatial light modulators, laser beam steering, and micro-lens arrays.

  14. Xanthine derivatives without PDE effect stimulate voltage-activated chloride conductance of toad skin.

    PubMed

    Nagel, Wolfram; Katz, Uri

    2003-02-01

    The effect of xanthine derivatives on the voltage-activated Cl(-) conductance (G(Cl)) of amphibian skin was analyzed. 3-Isobutyl-1-methylxanthine (IBMX) and the recently synthesized xanthine derivatives 3,7-dimethyl-1-propyl xanthine (X-32) and 3,7-dimethyl-1-isobutyl xanthine (X-33), which lack inhibitory effects on phosphodiesterases in CHO and Calu-3 cells, increased voltage-activated G(Cl) without effect on baseline conductance at inactivating voltage. Half-maximal stimulation of G(Cl) occurred at 108 +/- 9 microM for X-32 and X-33 after apical or basolateral application. The stimulation of G(Cl), which occurs only in the presence of Cl(-) in the mucosal solution, is caused by a shift of the voltage sensitivity to lower clamp potentials and an increase of the maximally activated level. Furosemide reversed both the shift of sensitivity and the increase in magnitude. These patterns are fundamentally different from those seen after application of membrane-permeant, nonmetabolized analogs of cAMP, and they indicate that the xanthines stimulate G(Cl) directly. This notion is strengthened by the lack of influence on intracellular cAMP content, which is consistent with the observations in CHO and Calu-3 cells. We propose that the xanthine derivatives increase the voltage sensitivity of a regulative component in the conductive Cl(-) pathway across amphibian skin.

  15. Correlation of proton irradiation induced threshold voltage shifts to deep level traps in AlGaN/GaN heterostructures

    NASA Astrophysics Data System (ADS)

    Zhang, Z.; Cardwell, D.; Sasikumar, A.; Kyle, E. C. H.; Chen, J.; Zhang, E. X.; Fleetwood, D. M.; Schrimpf, R. D.; Speck, J. S.; Arehart, A. R.; Ringel, S. A.

    2016-04-01

    The impact of proton irradiation on the threshold voltage (VT) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of VT was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 1014 cm-2. Silvaco Atlas simulations of VT shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different VT dependences on proton irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed VT shifts. The proton irradiation induced VT shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.

  16. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    PubMed

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  17. Deflection amplifier for image dissectors

    NASA Technical Reports Server (NTRS)

    Salomon, P. M.

    1977-01-01

    Balanced symmetrical y-axis amplifier uses zener-diode level shifting to interface operational amplifiers to high voltage bipolar output stages. Nominal voltage transfer characteristic is 40 differential output volts per input volt; bandwidth, between -3-dB points, is approximately 8 kHz; loop gain is nominally 89 dB with closed loop gain of 26 dB.

  18. A Substrate Bias Effect on Recovery of the Threshold Voltage Shift of Amorphous Silicon Thin-Film Transistors

    NASA Astrophysics Data System (ADS)

    Han, Chang-Wook; Han, Min-Koo; Choi, Nack-Bong; Kim, Chang-Dong; Kim, Ki-Yong; Chung, In-Jae

    2007-07-01

    Hydrogenated amorphous silicon (a-Si:H) thin-film transistors (TFTs) were fabricated on a flexible stainless-steel (SS) substrate. The stability of the a-Si:H TFT is a key issue for active matrix organic light-emitting diodes (AMOLEDs). The drain current decreases because of the threshold voltage shift (Δ VTH) during OLED driving. A negative voltage at a floated gate can be induced by a negative substrate bias through a capacitor between the substrate and the gate electrode without additional circuits. The negative voltage biased at the SS substrate can recover Δ VTH and reduced drain current of the driving TFT. The VTH of the TFT increased by 2.3 V under a gate bias of +15 V and a drain bias of +15 V at 65 °C applied for 3,500 s. The VTH decreased by -2.3 V and the drain current recovered 97% of its initial value under a substrate bias of -23 V at 65 °C applied for 3,500 s.

  19. IGZO TFT-based circuit with tunable threshold voltage by laser annealing

    NASA Astrophysics Data System (ADS)

    Huang, Xiaoming; Yu, Guang; Wu, Chenfei

    2017-11-01

    In this work, a high-performance inverter based on amorphous indium-gallium-zinc oxide thin-film transistors (TFTs) has been fabricated, which consists of a driver TFT and a load TFT. The threshold voltage (Vth) of the load TFT can be tuned by applying an area-selective laser annealing. The transfer curve of the load TFT shows a parallel shift into the negative bias direction upon laser annealing. Based on x-ray photoelectron spectroscopy analyses, the negative Vth shift can be attributed to the increase of oxygen vacancy concentration within the device channel upon laser irradiation. Compared to the untreated inverter, the laser annealed inverter shows much improved switching characteristics, including a large output swing range which is close to full swing, as well as an enhanced output voltage gain. Furthermore, the dynamic performance of ring oscillator based on the laser-annealed inverter is improved.

  20. A polarization-independent liquid crystal phase modulation using polymer-network liquid crystal with orthogonal alignment layers

    NASA Astrophysics Data System (ADS)

    Chen, Ming-Syuan; Lin, Wei-Chih; Tsou, Yu-Shih; Lin, Yi-Hsin

    2012-10-01

    A polarization-independent liquid crystal (LC) phase modulation using polymer-network liquid crystals with orthogonal alignments layers (T-PNLC) is demonstrated. T-PNLC consists of three layers. LC directors in the two layers near glass substrates are orthogonal to each other. In the middle layer, LC directors are perpendicular to the glass substrate. The advantages of such T-PNLC include polarizer-free, larger phase shift (~0.4π rad) than the residual phase type (<0.05π rad), and low operating voltage (< 30Vrms). It does not require bias voltage for avoiding scattering because the refractive index of liquid crystals matches that of polymers. The phase shift of T-PNLC is affected by the cell gap and the curing voltages. The potential applications are laser beam steering, spatial light modulators and electrically tunable micro-lens arrays.

  1. Metal-oxide thin-film transistor-based pH sensor with a silver nanowire top gate electrode

    NASA Astrophysics Data System (ADS)

    Yoo, Tae-Hee; Sang, Byoung-In; Wang, Byung-Yong; Lim, Dae-Soon; Kang, Hyun Wook; Choi, Won Kook; Lee, Young Tack; Oh, Young-Jei; Hwang, Do Kyung

    2016-04-01

    Amorphous InGaZnO (IGZO) metal-oxide-semiconductor thin-film transistors (TFTs) are one of the most promising technologies to replace amorphous and polycrystalline Si TFTs. Recently, TFT-based sensing platforms have been gaining significant interests. Here, we report on IGZO transistor-based pH sensors in aqueous medium. In order to achieve stable operation in aqueous environment and enhance sensitivity, we used Al2O3 grown by using atomic layer deposition (ALD) and a porous Ag nanowire (NW) mesh as the top gate dielectric and electrode layers, respectively. Such devices with a Ag NW mesh at the top gate electrode rapidly respond to the pH of solutions by shifting the turn-on voltage. Furthermore, the output voltage signals induced by the voltage shifts can be directly extracted by implantation of a resistive load inverter.

  2. Outward stabilization of the voltage sensor in domain II but not domain I speeds inactivation of voltage-gated sodium channels.

    PubMed

    Sheets, Michael F; Chen, Tiehua; Hanck, Dorothy A

    2013-10-15

    To determine the roles of the individual S4 segments in domains I and II to activation and inactivation kinetics of sodium current (INa) in NaV1.5, we used a tethered biotin and avidin approach after a site-directed cysteine substitution was made in the second outermost Arg in each S4 (DI-R2C and DII-R2C). We first determined the fraction of gating charge contributed by the individual S4's to maximal gating current (Qmax), and found that the outermost Arg residue in each S4 contributed ∼19% to Qmax with minimal contributions by other arginines. Stabilization of the S4's in DI-R2C and DII-R2C was confirmed by measuring the expected reduction in Qmax. In DI-R2C, stabilization resulted in a decrease in peak INa of ∼45%, while its peak current-voltage (I-V) and voltage-dependent Na channel availability (SSI) curves were nearly unchanged from wild type (WT). In contrast, stabilization of the DII-R2C enhanced activation with a negative shift in the peak I-V relationship by -7 mV and a larger -17 mV shift in the voltage-dependent SSI curve. Furthermore, its INa decay time constants and time-to-peak INa became more rapid than WT. An explanation for these results is that the depolarized conformation of DII-S4, but not DI-S4, affects the receptor for the inactivation particle formed by the interdomain linker between DIII and IV. In addition, the leftward shifts of both activation and inactivation and the decrease in Gmax after stabilization of the DII-S4 support previous studies that showed β-scorpion toxins trap the voltage sensor of DII in an activated conformation.

  3. Probing surface states in PbS nanocrystal films using pentacene field effect transistors: controlling carrier concentration and charge transport in pentacene.

    PubMed

    Park, Byoungnam; Whitham, Kevin; Bian, Kaifu; Lim, Yee-Fun; Hanrath, Tobias

    2014-12-21

    We used a bilayer field effect transistor (FET) consisting of a thin PbS nanocrystals (NCs) film interfaced with vacuum-deposited pentacene to probe trap states in NCs. We interpret the observed threshold voltage shift in context of charge carrier trapping by PbS NCs and relate the magnitude of the threshold voltage shift to the number of trapped carriers. We explored a series of NC surface ligands to modify the interface between PbS NCs and pentacene and demonstrate the impact of interface chemistry on charge carrier density and the FET mobility in a pentacene FET.

  4. Toward Quantifying the Electrostatic Transduction Mechanism in Carbon Nanotube Biomolecular Sensors

    NASA Astrophysics Data System (ADS)

    Lerner, Mitchell; Kybert, Nicholas; Mendoza, Ryan; Dailey, Jennifer; Johnson, A. T. Charlie

    2013-03-01

    Despite the great promise of carbon nanotube field-effect transistors (CNT FETs) for applications in chemical and biochemical detection, a quantitative understanding of sensor responses is lacking. To explore the role of electrostatics in sensor transduction, experiments were conducted with a set of similar compounds designed to adsorb onto the CNT FET via a pyrene linker group and take on a set of known charge states under ambient conditions. Acidic and basic species were observed to induce threshold voltage shifts of opposite sign, consistent with gating of the CNT FET by local charges due to protonation or deprotonation of the pyrene compounds by interfacial water. The magnitude of the gate voltage shift was controlled by the distance between the charged group and the CNT. Additionally, functionalization with an uncharged pyrene compound showed a threshold shift ascribed to its molecular dipole moment. This work illustrates a method for producing CNT FETs with controlled values of the turnoff gate voltage, and more generally, these results will inform the development of quantitative models for the response of CNT FET chemical and biochemical sensors. As an example, the results of an experiment detecting biomarkers of Lyme disease will be discussed in the context of this model.

  5. Low-Temperature-Processed Zinc Oxide Thin-Film Transistors Fabricated by Plasma-Assisted Atomic Layer Deposition

    NASA Astrophysics Data System (ADS)

    Kawamura, Yumi; Tani, Mai; Hattori, Nozomu; Miyatake, Naomasa; Horita, Masahiro; Ishikawa, Yasuaki; Uraoka, Yukiharu

    2012-02-01

    We investigated zinc oxide (ZnO) thin films prepared by plasma assisted atomic layer deposition (PA-ALD), and thin-film transistors (TFTs) with the ALD ZnO channel layer for application to next-generation displays. We deposited the ZnO channel layer by PA-ALD at 100 or 300 °C, and fabricated TFTs. The transfer characteristic of the 300 °C-deposited ZnO TFT exhibited high mobility (5.7 cm2 V-1 s-1), although the threshold voltage largely shifted toward the negative (-16 V). Furthermore, we deposited Al2O3 thin film as a gate insulator by PA-ALD at 100 °C for the low-temperature TFT fabrication process. In the case of ZnO TFTs with the Al2O3 gate insulator, the shift of the threshold voltage improved (-0.1 V). This improvement of the negative shift seems to be due to the negative charges of the Al2O3 film deposited by PA-ALD. On the basis of the experimental results, we confirmed that the threshold voltage of ZnO TFTs is controlled by PA-ALD for the deposition of the gate insulator.

  6. The effect of electrostatic and gravity force on offset wire inside tube

    NASA Astrophysics Data System (ADS)

    Oh, S. H.; Hazineh, D.; Wang, C.

    2018-04-01

    In a straw-tube detector, a wire that is offset with respect to the tube axis experiences a Coulomb force when high voltage is applied between the anode wire and the tube. This force results in a shifting of the wire and straw, in addition to the gravitational sag, and is a function of the tube and wire radius, initial offset, high voltage, tension and length. The presence of such effects is well known, but the precise magnitude of the shift for the anode wires under conditions of detector operation have not been previously documented with measurable confidence. In this work, we provide the first systematic measurements for the wire shift in straw-tube detectors due to gravity and the electrostatic force using an x-ray scanner developed for the Mu2e experiment. The data are compared to the solutions of the differential equations governing the system, and we find a good match between the two. The solutions can predict the final wire and straw positions from the initial positions measured without the high voltage, and the final wire and straw positions can then be used as an input to the track reconstruction software to improve the track position resolution.

  7. High reliable and stable organic field-effect transistor nonvolatile memory with a poly(4-vinyl phenol) charge trapping layer based on a pn-heterojunction active layer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiang, Lanyi; Ying, Jun; Han, Jinhua

    2016-04-25

    In this letter, we demonstrate a high reliable and stable organic field-effect transistor (OFET) based nonvolatile memory (NVM) with a polymer poly(4-vinyl phenol) (PVP) as the charge trapping layer. In the unipolar OFETs, the inreversible shifts of the turn-on voltage (V{sub on}) and severe degradation of the memory window (ΔV{sub on}) at programming (P) and erasing (E) voltages, respectively, block their application in NVMs. The obstacle is overcome by using a pn-heterojunction as the active layer in the OFET memory, which supplied a holes and electrons accumulating channel at the supplied P and E voltages, respectively. Both holes and electronsmore » transferring from the channels to PVP layer and overwriting the trapped charges with an opposite polarity result in the reliable bidirectional shifts of V{sub on} at P and E voltages, respectively. The heterojunction OFET exhibits excellent nonvolatile memory characteristics, with a large ΔV{sub on} of 8.5 V, desired reading (R) voltage at 0 V, reliable P/R/E/R dynamic endurance over 100 cycles and a long retention time over 10 years.« less

  8. Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin.

    PubMed

    Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke

    2011-05-06

    Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

  9. Permeation and gating properties of the L-type calcium channel in mouse pancreatic beta cells

    PubMed Central

    1993-01-01

    Ba2+ currents through L-type Ca2+ channels were recorded from cell- attached patches on mouse pancreatic beta cells. In 10 mM Ba2+, single- channel currents were recorded at -70 mV, the beta cell resting membrane potential. This suggests that Ca2+ influx at negative membrane potentials may contribute to the resting intracellular Ca2+ concentration and thus to basal insulin release. Increasing external Ba2+ increased the single-channel current amplitude and shifted the current-voltage relation to more positive potentials. This voltage shift could be modeled by assuming that divalent cations both screen and bind to surface charges located at the channel mouth. The single- channel conductance was related to the bulk Ba2+ concentration by a Langmuir isotherm with a dissociation constant (Kd(gamma)) of 5.5 mM and a maximum single-channel conductance (gamma max) of 22 pS. A closer fit to the data was obtained when the barium concentration at the membrane surface was used (Kd(gamma) = 200 mM and gamma max = 47 pS), which suggests that saturation of the concentration-conductance curve may be due to saturation of the surface Ba2+ concentration. Increasing external Ba2+ also shifted the voltage dependence of ensemble currents to positive potentials, consistent with Ba2+ screening and binding to membrane surface charge associated with gating. Ensemble currents recorded with 10 mM Ca2+ activated at more positive potentials than in 10 mM Ba2+, suggesting that external Ca2+ binds more tightly to membrane surface charge associated with gating. The perforated-patch technique was used to record whole-cell currents flowing through L-type Ca2+ channels. Inward currents in 10 mM Ba2+ had a similar voltage dependence to those recorded at a physiological Ca2+ concentration (2.6 mM). BAY-K 8644 (1 microM) increased the amplitude of the ensemble and whole-cell currents but did not alter their voltage dependence. Our results suggest that the high divalent cation solutions usually used to record single L-type Ca2+ channel activity produce a positive shift in the voltage dependence of activation (approximately 32 mV in 100 mM Ba2+). PMID:7687645

  10. Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

    PubMed

    Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-07-15

    A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)<5ms). However, the signal was small (ΔF/F=0.4%/200mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator

    PubMed Central

    Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June

    2017-01-01

    Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition. PMID:29093633

  12. Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

    PubMed

    Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

    2017-10-01

    Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

  13. Limits on Arcminute-Scale Cosmic Microwave Background Anisotropy at 28.5 GHz

    NASA Technical Reports Server (NTRS)

    Holzapfel, W. L.; Carlstrom, J. E.; Grego, L.; Holder, G.; Joy, M.; Reese, E. D.

    2000-01-01

    We have used the Berkeley-Illinois-Maryland Association (BIMA) millimeter array outfitted with sensitive centimeter-wave receivers to search for cosmic microwave background (CMB) anisotropies on arcminute scales. The interferometer was placed in a compact configuration that produces high brightness sensitivity, while providing discrimination against point sources. Operating at a frequency of 28.5 GHz, the FWHM primary beam of the instrument is approximately 6'.6. We have made sensitive images of seven fields, four of which where chosen specifically to have low infrared dust contrast and to be free of bright radio sources. Additional observations with the Owens Valley Radio Observatory (OVRO) millimeter array were used to assist in the location and removal of radio point sources. Applying a Bayesian analysis to the raw visibility data, we place limits on CMB anisotropy flat-band power of Q(sub flat) = 5.6(sub -5.6)(exp 3.0) microK and Q(sub flat) < 14.1 microK at 68% and 95% confidence, respectively. The sensitivity of this experiment to flat-band power peaks at a multipole of I = 5470, which corresponds to an angular scale of approximately 2'. The most likely value of Q(sub flat) is similar to the level of the expected secondary anisotropies.

  14. A Bright and Fast Red Fluorescent Protein Voltage Indicator That Reports Neuronal Activity in Organotypic Brain Slices

    PubMed Central

    Abdelfattah, Ahmed S.; Farhi, Samouil L.; Zhao, Yongxin; Brinks, Daan; Zou, Peng; Ruangkittisakul, Araya; Platisa, Jelena; Pieribone, Vincent A.; Ballanyi, Klaus; Cohen, Adam E.

    2016-01-01

    Optical imaging of voltage indicators based on green fluorescent proteins (FPs) or archaerhodopsin has emerged as a powerful approach for detecting the activity of many individual neurons with high spatial and temporal resolution. Relative to green FP-based voltage indicators, a bright red-shifted FP-based voltage indicator has the intrinsic advantages of lower phototoxicity, lower autofluorescent background, and compatibility with blue-light-excitable channelrhodopsins. Here, we report a bright red fluorescent voltage indicator (fluorescent indicator for voltage imaging red; FlicR1) with properties that are comparable to the best available green indicators. To develop FlicR1, we used directed protein evolution and rational engineering to screen libraries of thousands of variants. FlicR1 faithfully reports single action potentials (∼3% ΔF/F) and tracks electrically driven voltage oscillations at 100 Hz in dissociated Sprague Dawley rat hippocampal neurons in single trial recordings. Furthermore, FlicR1 can be easily imaged with wide-field fluorescence microscopy. We demonstrate that FlicR1 can be used in conjunction with a blue-shifted channelrhodopsin for all-optical electrophysiology, although blue light photoactivation of the FlicR1 chromophore presents a challenge for applications that require spatially overlapping yellow and blue excitation. SIGNIFICANCE STATEMENT Fluorescent-protein-based voltage indicators enable imaging of the electrical activity of many genetically targeted neurons with high spatial and temporal resolution. Here, we describe the engineering of a bright red fluorescent protein-based voltage indicator designated as FlicR1 (fluorescent indicator for voltage imaging red). FlicR1 has sufficient speed and sensitivity to report single action potentials and voltage fluctuations at frequencies up to 100 Hz in single-trial recordings with wide-field microscopy. Because it is excitable with yellow light, FlicR1 can be used in conjunction with blue-light-activated optogenetic actuators. However, spatially distinct patterns of optogenetic activation and voltage imaging are required to avoid fluorescence artifacts due to photoactivation of the FlicR1 chromophore. PMID:26911693

  15. Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.

    PubMed

    Carvalho-de-Souza, Joao L; Bezanilla, Francisco

    2018-02-05

    Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018 Carvalho-de-Souza and Bezanilla.

  16. Multilevel cascade voltage source inverter with seperate DC sources

    DOEpatents

    Peng, Fang Zheng; Lai, Jih-Sheng

    1997-01-01

    A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.

  17. Multilevel cascade voltage source inverter with seperate DC sources

    DOEpatents

    Peng, Fang Zheng; Lai, Jih-Sheng

    2002-01-01

    A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.

  18. Multilevel cascade voltage source inverter with seperate DC sources

    DOEpatents

    Peng, Fang Zheng; Lai, Jih-Sheng

    2001-04-03

    A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations.

  19. Multilevel cascade voltage source inverter with separate DC sources

    DOEpatents

    Peng, F.Z.; Lai, J.S.

    1997-06-24

    A multilevel cascade voltage source inverter having separate DC sources is described herein. This inverter is applicable to high voltage, high power applications such as flexible AC transmission systems (FACTS) including static VAR generation (SVG), power line conditioning, series compensation, phase shifting and voltage balancing and fuel cell and photovoltaic utility interface systems. The M-level inverter consists of at least one phase wherein each phase has a plurality of full bridge inverters equipped with an independent DC source. This inverter develops a near sinusoidal approximation voltage waveform with only one switching per cycle as the number of levels, M, is increased. The inverter may have either single-phase or multi-phase embodiments connected in either wye or delta configurations. 15 figs.

  20. Paramagnetic defects and charge trapping behavior of ZrO2 films deposited on germanium by plasma-enhanced CVD

    NASA Astrophysics Data System (ADS)

    Mahata, C.; Bera, M. K.; Bose, P. K.; Maiti, C. K.

    2009-02-01

    Internal photoemission and magnetic resonance studies have been performed to investigate the charge trapping behavior and chemical nature of defects in ultrathin (~14 nm) high-k ZrO2 dielectric films deposited on p-Ge (1 0 0) substrates at low temperature (<200 °C) by plasma-enhanced chemical vapor deposition (PECVD) in a microwave (700 W, 2.45 GHz) plasma at a pressure of ~65 Pa. Both the band and defect-related electron states have been characterized using electron paramagnetic resonance, internal photoemission, capacitance-voltage and current-voltage measurements under UV illumination. Capacitance-voltage and photocurrent-voltage measurements were used to determine the centroid of oxide charge within the high-k gate stack. The observed shifts in photocurrent response of the Al/ZrO2/GeO2/p-Ge metal-insulator-semiconductor (MIS) capacitors indicate the location of the centroids to be within the ZrO2 dielectric near to the gate electrode. Moreover, the measured flat band voltage and photocurrent shifts also indicate a large density of traps in the dielectric. The impact of plasma nitridation on the interfacial quality of the oxides has been investigated. Different N sources, such as NO and NH3, have been used for nitrogen engineering. Oxynitride samples show a lower defect density and trapping over the non-nitrided samples. The charge trapping and detrapping properties of MIS capacitors under stressing in constant current and voltage modes have been investigated in detail.

  1. Perchlorate enhances transmission in skeletal muscle excitation- contraction coupling

    PubMed Central

    1993-01-01

    The effects of the anion perchlorate (present extracellularly at 8 mM) were studied on functional skeletal muscle fibers from Rana pipiens, voltage-clamped in a Vaseline gap chamber. Established methods were used to monitor intramembranous charge movement and flux of Ca release from the sarcoplasmic reticulum (SR) during pulse depolarization. Saponin permeabilization of the end portions of the fiber segment (Irving, M., J. Maylie, N. L. Sizto, and W. K. Chandler. 1987. Journal of General Physiology. 89:1-41) substantially reduced the amount of charge moving during conventional control pulses, thus minimizing a technical error that plagued our previous studies. Perchlorate prolonged the ON time course of charge movement, especially at low and intermediate voltages. The OFFs were also made slower, the time constant increasing twofold. The hump kinetic component was exaggerated by ClO4- or was made to appear in fibers that did not have it in reference conditions. ClO4- had essentially no kinetic ON effects at high voltages (> or = 10 mV). ClO4- changed the voltage distribution of mobile charge. In single Boltzmann fits, the midpoint potential V was shifted -20 mV and the steepness parameter K was reduced by 4.7 mV (or 1.78-fold), but the maximum charge was unchanged (n = 9). Total Ca content in the SR, estimated using the method of Schneider et al. (Schneider, M. F., B. J. Simon, and G. Szucs. 1987. Journal of Physiology. 392:167-192) for correcting for depletion, stayed constant over tens of minutes in reference conditions but decayed in ClO4- at an average rate of 0.3 mumol/liter myoplasmic water per s. ClO4- changed the kinetics of release flux, reducing the fractional inactivation of release after the peak. ClO4- shifted the voltage dependence of Ca release flux. In particular, the threshold voltage for Ca release was shifted by about -20 mV, and the activation of the steady component of release flux was shifted by > 20 mV in the negative direction. The shift of release activation was greater than that of mobile charge. Thus the threshold charge, defined as the minimum charge moved for eliciting a detectable Ca transient, was reduced from 6 nC/microF (0.55, n = 7) to 3.4 (0.53). The average of the paired differences was 2.8 (0.33, P < 0.01). The effects of ClO4- were then studied in fibers in modified functional situations. Depletion of Ca in the SR, achieved by high frequency pulsing in the presence of intracellular BAPTA and EGTA, simplified but did not eliminate the effects of ClO4-.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:8245817

  2. Investigation of iodine dopant amount effects on dye-sensitized hierarchically structured ZnO solar cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Yan-Zhen; Research Center of the Ministry of Education for High Gravity Engineering and Technology, Beijing University of Chemical Technology, Beijing 100029; Ding, Haiyang

    2014-07-01

    Highlights: • The effect of I amount on the photovoltaic performance was investigated. • The enhancement in η of ZnO:I DSSCs was from 38% to 77% compared with ZnO DSSCs. • Appropriate I doping enhanced light harness and inhibited charge recombination. - Abstract: We prepare a series of iodine doped zinc oxide monodisperse aggregates (ZnO:I) with various iodine concentrations as the photoanodes of dye-sensitized solar cells (DSSCs) to study iodine dopant amount-dependent photovoltaic performance. The iodine-doped DSSCs achieve overall conversion efficiency (η) of 3.6–4.6%. The enhancement in η of ZnO:I DSSCs is from 38% to 77% as compared to undopedmore » ZnO DSSCs. The significantly enhanced η of DSSCs is found to be correlated with iodine dopant amount. The optimum iodine dopant amount is determined to be 2.3 wt% by X-ray photoelectron spectroscopy. Furthermore, the incident photon to current conversion efficiency and electrochemical impedance spectroscopy data reveal a systematic correlation between photovoltaic properties and the iodine dopant amount. The enhancement of open-circuit potential of ZnO:I cells is arising from negative shift of their flat-band potential, as demonstrated by Mott–Schottky measurement.« less

  3. Nano-sized quaternary CuGa2In3S8 as an efficient photocatalyst for solar hydrogen production.

    PubMed

    Kandiel, Tarek A; Anjum, Dalaver H; Takanabe, Kazuhiro

    2014-11-01

    The synthesis of quaternary metal sulfide (QMS) nanocrystals is challenging because of the difficulty to control their stoichiometry and phase structure. Herein, quaternary CuGa2In3S8 photocatalysts with a primary particle size of ≈4 nm are synthesized using a facile hot-injection method by fine-tuning the sulfur source injection temperature and aging time. Characterization of the samples reveals that quaternary CuGa2In3S8 nanocrystals exhibit n-type semiconductor characteristics with a transition band gap of ≈1.8 eV. Their flatband potential is located at -0.56 V versus the standard hydrogen electrode at pH 6.0 and is shifted cathodically by 0.75 V in solutions with pH values greater than 12.0. Under optimized conditions, the 1.0 wt % Ru-loaded CuGa2In3S8 photocatalyst exhibits a photocatalytic H2 evolution response up to 700 nm and an apparent quantum efficiency of (6.9±0.5) % at 560 nm. These results indicate clearly that QMS nanocrystals have great potential as nano-photocatalysts for solar H2 production. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

    PubMed

    Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

    2014-04-01

    Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages without affecting QON-V. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Temporal differentiation of pH-dependent capacitive current from dopamine.

    PubMed

    Yoshimi, Kenji; Weitemier, Adam

    2014-09-02

    Voltammetric recording of dopamine (DA) with fast-scan cyclic voltammetry (FSCV) on carbon fiber microelectrodes have been widely used, because of its high sensitivity to dopamine. However, since an electric double layer on a carbon fiber surface in a physiological ionic solution behaves as a capacitor, fast voltage manipulation in FSCV induces large capacitive current. The faradic current from oxidation/reduction of target chemicals must be extracted from this large background current. It is known that ionic shifts, including H(+), influence this capacitance, and pH shift can cause confounding influences on the FSCV recordings within a wide range of voltage. Besides FSCV with a triangular waveform, we have been using rectangular pulse voltammetry (RPV) for dopamine detection in the brain. In this method, the onset of a single pulse causes a large capacitive current, but unlike FSCV, the capacitive current is restricted to a narrow temporal window of just after pulse onset (<5 ms). In contrast, the peak of faradic current from dopamine oxidation occurs after a delay of more than a few milliseconds. Taking advantage of the temporal difference, we show that RPV could distinguish dopamine from pH shifts clearly and easily. In addition, the early onset current was useful to evaluate pH shifts. The narrow voltage window of our RPV pulse allowed a clear differentiation of dopamine and serotonin (5-HT), as we have shown previously. Additional recording with RPV, alongside FSCV, would improve identification of chemicals such as dopamine, pH, and 5-HT.

  6. Pathogenic plasticity of Kv7.2/3 channel activity is essential for the induction of tinnitus.

    PubMed

    Li, Shuang; Choi, Veronica; Tzounopoulos, Thanos

    2013-06-11

    Tinnitus, the perception of phantom sound, is often a debilitating condition that affects many millions of people. Little is known, however, about the molecules that participate in the induction of tinnitus. In brain slices containing the dorsal cochlear nucleus, we reveal a tinnitus-specific increase in the spontaneous firing rate of principal neurons (hyperactivity). This hyperactivity is observed only in noise-exposed mice that develop tinnitus and only in the dorsal cochlear nucleus regions that are sensitive to high frequency sounds. We show that a reduction in Kv7.2/3 channel activity is essential for tinnitus induction and for the tinnitus-specific hyperactivity. This reduction is due to a shift in the voltage dependence of Kv7 channel activation to more positive voltages. Our in vivo studies demonstrate that a pharmacological manipulation that shifts the voltage dependence of Kv7 to more negative voltages prevents the development of tinnitus. Together, our studies provide an important link between the biophysical properties of the Kv7 channel and the generation of tinnitus. Moreover, our findings point to previously unknown biological targets for designing therapeutic drugs that may prevent the development of tinnitus in humans.

  7. New design of a passive type RADFET reader for enhanced sensitivity

    NASA Astrophysics Data System (ADS)

    Lee, Dae-Hee

    2016-07-01

    We present a new design of a passive type RADFET reader with enhanced radiation sensitivity. Using a electostatic plate, we have applied a static electric field to the gate voltage, which impacts a positive biasing on the p-type MOSFET. The resultant effect shows that 1.8 times of radiation sensitivity increased when we measured the threshold voltage shift of the RADFET exposed to 30 krad irradiation. We discuss further about the characteristic changes of a RADFET according to the positive biasing on the gate voltage.

  8. Temporal and voltage stress stability of high performance indium-zinc-oxide thin film transistors

    NASA Astrophysics Data System (ADS)

    Song, Yang; Katsman, Alexander; Butcher, Amy L.; Paine, David C.; Zaslavsky, Alexander

    2017-10-01

    Thin film transistors (TFTs) based on transparent oxide semiconductors, such as indium zinc oxide (IZO), are of interest due to their improved characteristics compared to traditional a-Si TFTs. Previously, we reported on top-gated IZO TFTs with an in-situ formed HfO2 gate insulator and IZO active channel, showing high performance: on/off ratio of ∼107, threshold voltage VT near zero, extracted low-field mobility μ0 = 95 cm2/V·s, and near-perfect subthreshold slope at 62 mV/decade. Since device stability is essential for technological applications, in this paper we report on the temporal and voltage stress stability of IZO TFTs. Our devices exhibit a small negative VT shift as they age, consistent with an increasing carrier density resulting from an increasing oxygen vacancy concentration in the channel. Under gate bias stress, freshly annealed TFTs show a negative VT shift during negative VG gate bias stress, while aged (>1 week) TFTs show a positive VT shift during negative VG stress. This indicates two competing mechanisms, which we identify as the field-enhanced generation of oxygen vacancies and the field-assisted migration of oxygen vacancies, respectively. A simplified kinetic model of the vacancy concentration evolution in the IZO channel under electrical stress is provided.

  9. Carvacrol modulates voltage-gated sodium channels kinetics in dorsal root ganglia.

    PubMed

    Joca, Humberto Cavalcante; Vieira, Daiana Cardoso Oliveira; Vasconcelos, Aliny Perreira; Araújo, Demetrius Antônio Machado; Cruz, Jader Santos

    2015-06-05

    Recent studies have shown that many of plant-derived compounds interact with specific ion channels and thereby modulate many sensing mechanisms, such as nociception. The monoterpenoid carvacrol (5-isopropyl-2-methylphenol) has an anti-nociceptive effect related to a reduction in neuronal excitability and voltage-gated Na(+) channels (NaV) inhibition in peripheral neurons. However, the detailed mechanisms of carvacrol-induced inhibition of neuronal NaV remain elusive. This study explores the interaction between carvacrol and NaV in isolated dorsal root ganglia neurons. Carvacrol reduced the total voltage-gated Na(+) current and tetrodotoxin-resistant (TTX-R) Na(+) current component in a concentration-dependent manner. Carvacrol accelerates current inactivation and induced a negative-shift in voltage-dependence of steady-state fast inactivation in total and TTX-R Na(+) current. Furthermore, carvacrol slowed the recovery from inactivation. Carvacrol provoked a leftward shift in both the voltage-dependence of steady-state inactivation and activation of the TTX-R Na(+) current component. In addition, carvacrol-induced inhibition of TTX-R Na(+) current was enhanced by an increase in stimulation frequency and when neurons were pre-conditioned with long depolarization pulse (5s at -50 mV). Taken all results together, we herein demonstrated that carvacrol affects NaV gating properties. The present findings would help to explain the mechanisms underlying the analgesic activity of carvacrol. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Breakdown in helium in high-voltage open discharge with subnanosecond current front rise

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schweigert, I. V., E-mail: ischweig@itam.nsc.ru; Alexandrov, A. L.; Bokhan, P. A.

    Investigations of high-voltage open discharge in helium have shown a possibility of generation of current pulses with subnanosecond front rise, due to ultra-fast breakdown development. The open discharge is ignited between two planar cathodes with mesh anode in the middle between them. For gas pressure 6 Torr and 20 kV applied voltage, the rate of current rise reaches 500 A/(cm{sup 2} ns) for current density 200 A/cm{sup 2} and more. The time of breakdown development was measured for different helium pressures and a kinetic model of breakdown in open discharge is presented, based on elementary reactions for electrons, ions andmore » fast atoms. The model also includes various cathode emission processes due to cathode bombardment by ions, fast atoms, electrons and photons of resonant radiation with Doppler shift of frequency. It is shown, that the dominating emission processes depend on the evolution of the discharge voltage during the breakdown. In the simulations, two cases of voltage behavior were considered: (i) the voltage is kept constant during the breakdown; (ii) the voltage is reduced with the growth of current. For the first case, the exponentially growing current is maintained due to photoemission by the resonant photons with Doppler-shifted frequency. For the second case, the dominating factor of current growth is the secondary electron emission. In both cases, the subnanosecond rise of discharge current was obtained. Also the effect of gas pressure on breakdown development was considered. It was found that for 20 Torr gas pressure the time of current rise decreases to 0.1 ns, which is in agreement with experimental data.« less

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bean, Bruce Palmer

    The effects of ether and halothane on membrane currents in the voltage clamped crayfish giant axon membrane were investigated. Concentrations of ether up to 300 mM and of halothane up to 32 mM had no effect on resting potential or leakage conductance. Ether and halothane reduced the size of sodium currents without changing the voltage dependence of the peak currents or their reversal potential. Ether and halothane also produced a reversible, dose-dependent speeding of sodium current decay at all membrane potentials. Ether reduced the time constants for inactivation, and also shifted the midpoint of the steady-state inactivation curve in themore » hyperpolarizing direction. Potassium currents were smaller with ether present, with no change in the voltage dependence of steady-state currents. The activation of potassium channels was faster with ether present. There was no apparent change in the capacitance of the crayfish giant axon membrane with ether concentrations of up to 100 mM. Experiments on sodium channel inactivation kinetics were performed using 4-aminopyridine to block potassium currents. Sodium currents decayed with a time course generally fit well by a single exponential. The time constant of decay was a steep function of voltage, especially in the negative resistance region of the peak current vs voltage relation.The time course of inactivation was very similar to that of the decay of the current at the same potential. The measurement of steady-state inactivation curves with different test pulses showed no shifts along the voltage asix. The voltage-dependence of the integral of sodium conductance was measured to test models of sodium channel inactivation in which channels must open before inactivating; the results appear inconsistent with some of the simplest cases of such models.« less

  12. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    PubMed

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. © 2016 Tuluc et al.

  13. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels

    PubMed Central

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred

    2016-01-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. PMID:27185857

  14. Welding Experiments of Aluminum Alloy by Space GHTA Welding at ISS Orbital Pressure

    NASA Astrophysics Data System (ADS)

    Suita, Yoshikazu; Takai, Daisuke; Sugiyama, Satoshi; Terajima, Noboru; Tsukuda, Yoshiyuki; Fujisawa, Shoichiro; Imagawa, Kichiro

    As a feasible welding method in space, the authors previously proposed the space GHTA (Gas Hollow Tungsten Arc) welding process. However, space GHTA welding with a high-frequency device for arc start may cause electromagnetic noise problems for the computer equipment placed on the ISS (International Space Station). Therefore, in this report, welding experiments of space GHTA welding using aluminum alloy with a high-voltage DC device for arc start were carried out at the ISS orbital pressure, 10-5 Pa. It is clear from the experiments using a high-voltage DC device in a high-vacuum condition, that there is a shifting phenomenon in which the spark discharge shifts to either a glow discharge or an arc discharge when starting the arc. Welding projects in space need an arc discharge, so we investigated the effects of welding parameters on the arc formation ratio. As a result, space GHTA welding with a high-voltage DC device can be used for arc start when welding at the ISS orbital pressure.

  15. Apparatus and method for monitoring the presence of a conductive media

    DOEpatents

    DuVall, Bruce W.; Valentine, James W.; Morey, Kenneth O.

    1979-01-01

    An inductive level sensor has inductively coupled primary and secondary windings. Circuitry drives the primary with an AC signal of constant current magnitude and selected frequency f to induce in the secondary, a voltage signal V of magnitude .vertline.V.vertline., frequency f and phase difference .phi. from the driving signal. Circuitry operates to generate a voltage output signal proportional to .vertline.V.vertline. cos (.phi.-.theta.), where .theta. is a selectively set phase shift factor. By properly and selectively adjusting the frequency f and phase shift factor .theta., an output signal .vertline.V.vertline. cos (.phi.-.theta.) can be provided which self-compensates for changes in mutual inductance caused by operating temperature variations so that an output signal is produced which is substantially linearly proportional to changes in the level of a pool of liquid metal being monitored. Disclosed also is calibration circuitry and circuitry for converting the voltage signal .vertline.V.vertline. cos (.phi.-.theta.) into a current signal.

  16. Distinct pH regulation of slow and rapid anion channels at the plasma membrane of Arabidopsis thaliana hypocotyl cells.

    PubMed

    Colcombet, Jean; Lelièvre, Françoise; Thomine, Sébastien; Barbier-Brygoo, Hélène; Frachisse, Jean-Marie

    2005-07-01

    Variations in both intracellular and extracellular pH are known to be involved in a wealth of physiological responses. Using the patch-clamp technique on Arabidopsis hypocotyl cells, it is shown that rapid-type and slow-type anion channels at the plasma membrane are both regulated by pH via distinct mechanisms. Modifications of pH modulate the voltage-dependent gating of the rapid channel. While intracellular alkalinization facilitates channel activation by shifting the voltage gate towards negative potentials, extracellular alkalinization shifts the activation threshold to more positive potentials, away from physiological resting membrane potentials. By contrast, pH modulates slow anion channel activity in a voltage-independent manner. Intracellular acidification and extracellular alkalinization increase slow anion channel currents. The possible role of these distinct modulations in physiological processes involving anion efflux and modulation of extracellular and/or intracellular pH, such as elicitor and ABA signalling, are discussed.

  17. External protons destabilize the activated voltage sensor in hERG channels.

    PubMed

    Shi, Yu Patrick; Cheng, Yen May; Van Slyke, Aaron C; Claydon, Tom W

    2014-03-01

    Extracellular acidosis shifts hERG channel activation to more depolarized potentials and accelerates channel deactivation; however, the mechanisms underlying these effects are unclear. External divalent cations, e.g., Ca(2+) and Cd(2+), mimic these effects and coordinate within a metal ion binding pocket composed of three acidic residues in hERG: D456 and D460 in S2 and D509 in S3. A common mechanism may underlie divalent cation and proton effects on hERG gating. Using two-electrode voltage clamp, we show proton sensitivity of hERG channel activation (pKa = 5.6), but not deactivation, was greatly reduced in the presence of Cd(2+) (0.1 mM), suggesting a common binding site for the Cd(2+) and proton effect on activation and separable effects of protons on activation and deactivation. Mutational analysis confirmed that D509 plays a critical role in the pH dependence of activation, as shown previously, and that cooperative actions involving D456 and D460 are also required. Importantly, neutralization of all three acidic residues abolished the proton-induced shift of activation, suggesting that the metal ion binding pocket alone accounts for the effects of protons on hERG channel activation. Voltage-clamp fluorimetry measurements demonstrated that protons shifted the voltage dependence of S4 movement to more depolarized potentials. The data indicate a site and mechanism of action for protons on hERG activation gating; protonation of D456, D460 and D509 disrupts interactions between these residues and S4 gating charges to destabilize the activated configuration of S4.

  18. Anode reactive bleed and injector shift control strategy

    DOEpatents

    Cai, Jun [Rochester, NY; Chowdhury, Akbar [Pittsford, NY; Lerner, Seth E [Honeoye Falls, NY; Marley, William S [Rush, NY; Savage, David R [Rochester, NY; Leary, James K [Rochester, NY

    2012-01-03

    A system and method for correcting a large fuel cell voltage spread for a split sub-stack fuel cell system. The system includes a hydrogen source that provides hydrogen to each split sub-stack and bleed valves for bleeding the anode side of the sub-stacks. The system also includes a voltage measuring device for measuring the voltage of each cell in the split sub-stacks. The system provides two levels for correcting a large stack voltage spread problem. The first level includes sending fresh hydrogen to the weak sub-stack well before a normal reactive bleed would occur, and the second level includes sending fresh hydrogen to the weak sub-stack and opening the bleed valve of the other sub-stack when the cell voltage spread is close to stack failure.

  19. Membrane permeable local anesthetics modulate NaV1.5 mechanosensitivity

    PubMed Central

    Beyder, Arthur; Strege, Peter R.; Bernard, Cheryl; Farrugia, Gianrico

    2012-01-01

    Voltage-gated sodium selective ion channel NaV1.5 is expressed in the heart and the gastrointestinal tract, which are mechanically active organs. NaV1.5 is mechanosensitive at stimuli that gate other mechanosensitive ion channels. Local anesthetic and antiarrhythmic drugs act upon NaV1.5 to modulate activity by multiple mechanisms. This study examined whether NaV1.5 mechanosensitivity is modulated by local anesthetics. NaV1.5 channels wereexpressed in HEK-293 cells, and mechanosensitivity was tested in cell-attached and excised inside-out configurations. Using a novel protocol with paired voltage ladders and short pressure pulses, negative patch pressure (-30 mmHg) in both configurations produced a hyperpolarizing shift in the half-point of the voltage-dependence of activation (V1/2a) and inactivation (V1/2i) by about -10 mV. Lidocaine (50 µM) inhibited the pressure-induced shift of V1/2a but not V1/2i. Lidocaine inhibited the tonic increase in pressure-induced peak current in a use-dependence protocol, but it did not otherwise affect use-dependent block. The local anesthetic benzocaine, which does not show use-dependent block, also effectively blocked a pressure-induced shift in V1/2a. Lidocaine inhibited mechanosensitivity in NaV1.5 at the local anesthetic binding site mutated (F1760A). However, a membrane impermeable lidocaine analog QX-314 did not affect mechanosensitivity of F1760A NaV1.5 when applied from either side of the membrane. These data suggest that the mechanism of lidocaine inhibition of the pressure-induced shift in the half-point of voltage-dependence of activation is separate from the mechanisms of use-dependent block. Modulation of NaV1.5 mechanosensitivity by the membrane permeable local anesthetics may require hydrophobic access and may involve membrane-protein interactions. PMID:22874086

  20. Electro-optic voltage sensor for sensing voltage in an E-field

    DOEpatents

    Woods, G.K.; Renak, T.W.

    1999-04-06

    A miniature electro-optic voltage sensor system capable of accurate operation at high voltages is disclosed. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam`s polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured. 18 figs.

  1. Electro-optic voltage sensor for sensing voltage in an E-field

    DOEpatents

    Woods, Gregory K.; Renak, Todd W.

    1999-01-01

    A miniature electro-optic voltage sensor system capable of accurate operation at high voltages. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam's polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured.

  2. Voltage-Clamp Studies on Uterine Smooth Muscle

    PubMed Central

    Anderson, Nels C.

    1969-01-01

    These studies have developed and tested an experimental approach to the study of membrane ionic conductance mechanisms in strips of uterine smooth muscle. The experimental and theoretical basis for applying the double sucrose-gap technique is described along with the limitations of this system. Nonpropagating membrane action potentials were produced in response to depolarizing current pulses under current-clamp conditions. The stepwise change of membrane potential under voltage-clamp conditions resulted in a family of ionic currents with voltage- and time-dependent characteristics. In sodium-free solution the peak transient current decreased and its equilibrium potential shifted along the voltage axis toward a more negative internal potential. These studies indicate a sodium-dependent, regenerative excitation mechanism. PMID:5796366

  3. Crebanine inhibits voltage-dependent Na+ current in guinea-pig ventricular myocytes.

    PubMed

    Xiao-Shan, He; Qing, Lin; Yun-Shu, Ma; Ze-Pu, Yu

    2014-01-01

    To study the effects of crebanine on voltage-gated Na(+) channels in cardiac tissues. Single ventricular myocytes were enzymatically dissociated from adult guinea-pig heart. Voltage-dependent Na(+) current was recorded using the whole cell voltage-clamp technique. Crebanine reversibly inhibited Na(+) current with an IC50 value of 0.283 mmol·L(-1) (95% confidence range: 0.248-0.318 mmol·L(-1)). Crebanine at 0.262 mmol·L(-1) caused a negative shift (about 12 mV) in the voltage-dependence of steady-state inactivation of Na(+) current, and retarded its recovery from inactivation, but did not affect its activation curve. In addition to blocking other voltage-gated ion channels, crebanine blocked Na(+) channels in guinea-pig ventricular myocytes. Crebanine acted as an inactivation stabilizer of Na(+) channels in cardiac tissues. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  4. Voltage and frequency dependence of prestin-associated charge transfer

    PubMed Central

    Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.

    2009-01-01

    Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917

  5. Frequency Preference Response to Oscillatory Inputs in Two-dimensional Neural Models: A Geometric Approach to Subthreshold Amplitude and Phase Resonance.

    PubMed

    Rotstein, Horacio G

    2014-01-01

    We investigate the dynamic mechanisms of generation of subthreshold and phase resonance in two-dimensional linear and linearized biophysical (conductance-based) models, and we extend our analysis to account for the effect of simple, but not necessarily weak, types of nonlinearities. Subthreshold resonance refers to the ability of neurons to exhibit a peak in their voltage amplitude response to oscillatory input currents at a preferred non-zero (resonant) frequency. Phase-resonance refers to the ability of neurons to exhibit a zero-phase (or zero-phase-shift) response to oscillatory input currents at a non-zero (phase-resonant) frequency. We adapt the classical phase-plane analysis approach to account for the dynamic effects of oscillatory inputs and develop a tool, the envelope-plane diagrams, that captures the role that conductances and time scales play in amplifying the voltage response at the resonant frequency band as compared to smaller and larger frequencies. We use envelope-plane diagrams in our analysis. We explain why the resonance phenomena do not necessarily arise from the presence of imaginary eigenvalues at rest, but rather they emerge from the interplay of the intrinsic and input time scales. We further explain why an increase in the time-scale separation causes an amplification of the voltage response in addition to shifting the resonant and phase-resonant frequencies. This is of fundamental importance for neural models since neurons typically exhibit a strong separation of time scales. We extend this approach to explain the effects of nonlinearities on both resonance and phase-resonance. We demonstrate that nonlinearities in the voltage equation cause amplifications of the voltage response and shifts in the resonant and phase-resonant frequencies that are not predicted by the corresponding linearized model. The differences between the nonlinear response and the linear prediction increase with increasing levels of the time scale separation between the voltage and the gating variable, and they almost disappear when both equations evolve at comparable rates. In contrast, voltage responses are almost insensitive to nonlinearities located in the gating variable equation. The method we develop provides a framework for the investigation of the preferred frequency responses in three-dimensional and nonlinear neuronal models as well as simple models of coupled neurons.

  6. Temperature dependence of negative bias under illumination stress and recovery in amorphous indium gallium zinc oxide thin film transistors

    NASA Astrophysics Data System (ADS)

    Hossain Chowdhury, Md Delwar; Migliorato, Piero; Jang, Jin

    2013-04-01

    We have investigated the temperature dependence of negative bias under illumination stress and recovery. The transfer characteristics exhibits a non-rigid shift towards negative gate voltages. For both stress and recovery, the voltage shift in deep depletion is twice that in accumulation. The results support the mechanism we previously proposed, which is creation and annealing of a double donor, likely to be an oxygen vacancy. The time dependence of stress and recovery can be fitted to stretched exponentials. Both processes are thermally activated with activation energies 1.06 eV and 1.25 eV for stress and recovery, respectively. A potential energy diagram is proposed to explain the results.

  7. Triple voltage dc-to-dc converter and method

    DOEpatents

    Su, Gui-Jia

    2008-08-05

    A circuit and method of providing three dc voltage buses and transforming power between a low voltage dc converter and a high voltage dc converter, by coupling a primary dc power circuit and a secondary dc power circuit through an isolation transformer; providing the gating signals to power semiconductor switches in the primary and secondary circuits to control power flow between the primary and secondary circuits and by controlling a phase shift between the primary voltage and the secondary voltage. The primary dc power circuit and the secondary dc power circuit each further comprising at least two tank capacitances arranged in series as a tank leg, at least two resonant switching devices arranged in series with each other and arranged in parallel with the tank leg, and at least one voltage source arranged in parallel with the tank leg and the resonant switching devices, said resonant switching devices including power semiconductor switches that are operated by gating signals. Additional embodiments having a center-tapped battery on the low voltage side and a plurality of modules on both the low voltage side and the high voltage side are also disclosed for the purpose of reducing ripple current and for reducing the size of the components.

  8. The role of a conserved proline residue in mediating conformational changes associated with voltage gating of Cx32 gap junctions.

    PubMed Central

    Ri, Y; Ballesteros, J A; Abrams, C K; Oh, S; Verselis, V K; Weinstein, H; Bargiello, T A

    1999-01-01

    We have explored the role of a proline residue located at position 87 in the second transmembrane segment (TM2) of gap junctions in the mechanism of voltage-dependent gating of connexin32 (Cx32). Substitution of this proline (denoted Cx32P87) with residues G, A, or V affects channel function in a progressive manner consistent with the expectation that a proline kink (PK) motif exists in the second transmembrane segment (TM2) of this connexin. Mutations of the preceding threonine residue T86 to S, A, C, V, N, or L shift the conductance-voltage relation of wild-type Cx32, such that the mutated channels close at smaller transjunctional voltages. The observed shift in voltage dependence is consistent with a reduction in the open probability of the mutant hemichannels at a transjunctional voltage (Vj) of 0 mV. In both cases in which kinetics were examined, the time constants for reaching steady state were faster for T86N and T86A than for wild type at comparable voltages, suggesting that the T86 mutations cause the energetic destabilization of the open state relative to the other states of the channel protein. The structural underpinnings of the observed effects were explored with Monte Carlo simulations. The conformational space of TM2 helices was found to differ for the T86A, V, N, and L mutants, which produce a less bent helix ( approximately 20 degrees bend angle) compared to the wild type, which has a approximately 37 degrees bend angle. The greater bend angle of the wild-type helix reflects the propensity of the T86 residue to hydrogen bond with the backbone carbonyl of amino acid residue I82. The relative differences in propensity for hydrogen bonding of the mutants relative to the wild-type threonine residue in the constructs we studied (T86A, V, N, L, S, and C) correlate with the shift in the conductance-voltage relation observed for T86 mutations. The data are consistent with a structural model in which the open conformation of the Cx32 channel corresponds to a more bent TM2 helix, and the closed conformation corresponds to a less bent helix. We propose that the modulation of the hydrogen-bonding potential of the T86 residue alters the bend angle of the PK motif and mediates conformational changes between open and closed channel states. PMID:10354417

  9. Electro-optical voltage sensor head

    DOEpatents

    Woods, Gregory K.

    1998-01-01

    A miniature electro-optic voltage sensor system capable of accurate operation at high voltages. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam's polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured.

  10. Electro-optical voltage sensor head

    DOEpatents

    Woods, G.K.

    1998-03-24

    A miniature electro-optic voltage sensor system capable of accurate operation at high voltages is disclosed. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam`s polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured. 6 figs.

  11. Nonlinear focal shift beyond the geometrical focus in moderately focused acoustic beams.

    PubMed

    Camarena, Francisco; Adrián-Martínez, Silvia; Jiménez, Noé; Sánchez-Morcillo, Víctor

    2013-08-01

    The phenomenon of the displacement of the position along the axis of the pressure, intensity, and radiation force maxima of focused acoustic beams under increasing driving voltages (nonlinear focal shift) is studied for the case of a moderately focused beam. The theoretical and experimental results show the existence of this shift along the axis when the initial pressure in the transducer increases until the acoustic field reaches the fully developed nonlinear regime of propagation. Experimental data show that at high amplitudes and for moderate focusing, the position of the on-axis pressure maximum and radiation force maximum can surpass the geometrical focal length. On the contrary, the on-axis pressure minimum approaches the transducer under increasing driving voltages, increasing the distance between the positive and negative peak pressure in the beam. These results are in agreement with numerical KZK model predictions and the existed data of other authors and can be explained according to the effect of self-refraction characteristic of the nonlinear regime of propagation.

  12. The Strong Effects Of On-Axis Focal Shift And Its Nonlinear Variation In Ultrasound Beams Radiated By Low Fresnel Number Transducers

    NASA Astrophysics Data System (ADS)

    Makov, Y. N.; Espinosa, V.; Sánchez-Morcillo, V. J.; Ramis, J.; Cruañes, J.; Camarena, F.

    2006-05-01

    On the basis of theoretical concepts, an accurate and complete experimental and numerical examination of the on-axis distribution and the corresponding temporal profiles for low-Fresnel-number focused ultrasound beams under increasing transducer input voltage has been performed. For a real focusing transducer with sufficiently small Fresnel number, a strong initial (linear) shift of the main on-axis pressure maximum from geometrical focal point towards the transducer, and its following displacement towards the focal point and backward motion as the driving transducer voltage increase until highly nonlinear regimes were fixed. The simultaneous monitoring of the temporal waveform modifications determines the real roles and interplay between different nonlinear effects (refraction and attenuation) in the observed dynamics of on-axis pressure maximum. The experimental results are in good agreement with numerical solutions of KZK equation, confirming that the observed dynamic shift of the maximum pressure point is related only to the interplay between diffraction, dissipation and nonlinearity of the acoustic wave.

  13. Motor Controller

    NASA Technical Reports Server (NTRS)

    1988-01-01

    M.H. Marks Enterprises' Power Factor Controller (PFC) matches voltage with motor's actual need. Plugged into a motor, PFC continuously determines motor load by sensing shifts between voltage and current flow. When it senses a light load, it cuts voltage to the minimum needed. It offers potential energy savings ranging from eight percent up to 65 percent depending on the application. Myles Marks started out with the notion of writing an article for Popular Electronics magazine at the same time offering to furnish kits to readers interested in assembling PFC's. Within two weeks from publication he had orders for 500 kits and orders are still coming three years later.

  14. A model of VDAC structural rearrangement in the presence of a salt activity gradient

    NASA Astrophysics Data System (ADS)

    Levadny, Victor; Colombini, Marco; Aguilella, Vicente M.

    2001-11-01

    We have considered the structural transformations of a voltage dependent anion-selective channel (VDAC) known as `gating'. We analysed the redistribution of VDAC among its states. The difference in electrostatic energy between the trans-closed and cis-closed states of VDAC is shown to be the cause of changes in the voltage dependence of the gating in the presence of a salt activity gradient. The asymmetry in the voltage dependence of the open probability about zero millivolts was connected with the apparent location of the voltage sensor. The theory describes the experimental data satisfactorily and explains the nature of the shift of the probability curve as well as the differences found in the asymmetry of the curve for different salts.

  15. Electroluminescence in CdSe/PVA nanocomposites

    NASA Astrophysics Data System (ADS)

    Kumari, Sarita; Ramrakhiani, M.; Khare, P. K.

    2018-05-01

    The synthesis of II-VI nanocrystal into the polymer matrix to form nanocomposites with adjustable nanocrystal is of great interest size is a big challenge to the scientific community. In present work semiconducting CdSe/PVA thin film were synthesized by single step solution method with different concentration of CdSe. The as-prepared products were characterized by UV-Visible absorption spectra and FESEM. Absorption spectra of CdSe/PVA nanocomposites indicated that the position of absorption edge shifts to smaller wavelength by increasing the concentration of CdSe. For Electroluminescence a turn on voltage is required for light emission and brightness increases with voltage. Turn on voltage is found to decrease as CdSe concentration is increased. The voltage-current curve represents ohmic nature for all EL cells.

  16. Electron refrigeration in hybrid structures with spin-split superconductors

    NASA Astrophysics Data System (ADS)

    Rouco, M.; Heikkilä, T. T.; Bergeret, F. S.

    2018-01-01

    Electron tunneling between superconductors and normal metals has been used for an efficient refrigeration of electrons in the latter. Such cooling is a nonlinear effect and usually requires a large voltage. Here we study the electron cooling in heterostructures based on superconductors with a spin-splitting field coupled to normal metals via spin-filtering barriers. The cooling power shows a linear term in the applied voltage. This improves the coefficient of performance of electron refrigeration in the normal metal by shifting its optimum cooling to lower voltage, and also allows for cooling the spin-split superconductor by reverting the sign of the voltage. We also show how tunnel coupling spin-split superconductors with regular ones allows for a highly efficient refrigeration of the latter.

  17. Correlation of proton irradiation induced threshold voltage shifts to deep level traps in AlGaN/GaN heterostructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Z.; Cardwell, D.; Sasikumar, A.

    2016-04-28

    The impact of proton irradiation on the threshold voltage (V{sub T}) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of V{sub T} was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 10{sup 14} cm{sup −2}. Silvaco Atlas simulations of V{sub T} shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different V{sub T} dependences on protonmore » irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed V{sub T} shifts. The proton irradiation induced V{sub T} shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.« less

  18. A New Method for Negative Bias Temperature Instability Assessment in P-Channel Metal Oxide Semiconductor Transistors

    NASA Astrophysics Data System (ADS)

    Djezzar, Boualem; Tahi, Hakim; Benabdelmoumene, Abdelmadjid; Chenouf, Amel; Kribes, Youcef

    2012-11-01

    In this paper, we present a new method, named on the fly oxide trap (OTFOT), to extract the bias temperature instability (BTI) in MOS transistors. The OTFOT method is based on charge pumping technique (CP) at low and high frequencies. We emphasize on the theoretical-based concept, giving a clear insight on the easy-use of the OTFOT methodology and demonstrating its viability to characterize the negative BTI (NBTI). Using alternatively high and low frequencies, OTFOT method separates the interface-traps (ΔNit) and border-trap (ΔNbt) (switching oxide-trap) densities independently and also their contributions to the threshold voltage shift (ΔVth), without needing additional methods. The experimental results, from two experimental scenarios, showing the extraction of NBTI-induced shifts caused by interface- and oxide-trap increases are also presented. In the first scenario, all stresses are performed on the same transistor. It exhibits an artifact value of exponent n. In the second scenario, each voltage stress is applied only on one transistor. Its results show an average n of 0.16, 0.05, and 0.11 for NBTI-induced ΔNit, ΔNbt, ΔVth, respectively. Therefore, OTFOT method can contribute to further understand the behavior of the NBTI degradation, especially through the threshold voltage shift components such as ΔVit and ΔVot caused by interface-trap and border-trap, respectively.

  19. Voltage sensing systems and methods for passive compensation of temperature related intrinsic phase shift

    DOEpatents

    Davidson, James R.; Lassahn, Gordon D.

    2001-01-01

    A small sized electro-optic voltage sensor capable of accurate measurement of high levels of voltages without contact with a conductor or voltage source is provided. When placed in the presence of an electric field, the sensor receives an input beam of electromagnetic radiation into the sensor. A polarization beam displacer serves as a filter to separate the input beam into two beams with orthogonal linear polarizations. The beam displacer is oriented in such a way as to rotate the linearly polarized beams such that they enter a Pockels crystal at a preferred angle of 45 degrees. The beam displacer is therefore capable of causing a linearly polarized beam to impinge a crystal at a desired angle independent of temperature. The Pockels electro-optic effect induces a differential phase shift on the major and minor axes of the input beam as it travels through the Pockels crystal, which causes the input beam to be elliptically polarized. A reflecting prism redirects the beam back through the crystal and the beam displacer. On the return path, the polarization beam displacer separates the elliptically polarized beam into two output beams of orthogonal linear polarization representing the major and minor axes. In crystals that introduce a phase differential attributable to temperature, a compensating crystal is provided to cancel the effect of temperature on the phase differential of the input beam. The system may include a detector for converting the output beams into electrical signals, and a signal processor for determining the voltage based on an analysis of the output beams. The output beams are amplitude modulated by the frequency of the electric field and the amplitude of the output beams is proportional to the magnitude of the electric field, which is related to the voltage being measured.

  20. Investigation of the Effects of Facility Background Pressure on the Performance and Voltage-Current Characteristics of the High Voltage Hall Accelerator

    NASA Technical Reports Server (NTRS)

    Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Spektor, Rostislav

    2014-01-01

    The National Aeronautics and Space Administration (NASA) Science Mission Directorate In-Space Propulsion Technology office is sponsoring NASA Glenn Research Center to develop a 4 kW-class Hall thruster propulsion system for implementation in NASA science missions. A study was conducted to assess the impact of varying the facility background pressure on the High Voltage Hall Accelerator (HiVHAc) thruster performance and voltage-current characteristics. This present study evaluated the HiVHAc thruster performance in the lowest attainable background pressure condition at NASA GRC Vacuum Facility 5 to best simulate space-like conditions. Additional tests were performed at selected thruster operating conditions to investigate and elucidate the underlying physics that change during thruster operation at elevated facility background pressure. Tests were performed at background pressure conditions that are three and ten times higher than the lowest realized background pressure. Results indicated that the thruster discharge specific impulse and efficiency increased with elevated facility background pressure. The voltage-current profiles indicated a narrower stable operating region with increased background pressure. Experimental observations of the thruster operation indicated that increasing the facility background pressure shifted the ionization and acceleration zones upstream towards the thruster's anode. Future tests of the HiVHAc thruster are planned at background pressure conditions that are expected to be two to three times lower than what was achieved during this test campaign. These tests will not only assess the impact of reduced facility background pressure on thruster performance, voltage-current characteristics, and plume properties; but will also attempt to quantify the magnitude of the ionization and acceleration zones upstream shifting as a function of increased background pressure.

  1. BK channel β1 subunits regulate airway contraction secondary to M2 muscarinic acetylcholine receptor mediated depolarization.

    PubMed

    Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert

    2011-04-01

    The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges.

  2. BK channel β1 subunits regulate airway contraction secondary to M2 muscarinic acetylcholine receptor mediated depolarization

    PubMed Central

    Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert

    2011-01-01

    Abstract The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges. PMID:21300746

  3. Coherent control of the Goos-Hänchen shift via Fano interference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Shaopeng; Yang, Wen-Xing, E-mail: wenxingyang@seu.edu.cn; Zhu, Zhonghu

    2016-04-14

    A scheme of enhanced Goos-Hänchen (GH) shifts in reflected and transmitted light beams is exploited in a cavity, where an asymmetric double AlGaAs/GaAs quantum well structure with resonant tunneling to a common continuum is employed as the intracavity medium. With the help of Fano-type interference induced by resonant tunneling, the generated GH shifts that contain a negative lateral shift in reflected light beam and a positive lateral shift in transmitted light beam are found to be significantly enhanced. More interestingly, these GH shifts in reflected and transmitted light beams are modulated by means of a control beam and external biasmore » voltage, in which maximum negative shift of 1.86 mm and positive shift of 0.37 mm are achievable.« less

  4. Frustrated honeycomb-lattice bilayer quantum antiferromagnet in a magnetic field

    NASA Astrophysics Data System (ADS)

    Krokhmalskii, Taras; Baliha, Vasyl; Derzhko, Oleg; Schulenburg, Jörg; Richter, Johannes

    2018-05-01

    Frustrated bilayer quantum magnets have attracted attention as flat-band spin systems with unconventional thermodynamic properties. We study the low-temperature properties of a frustrated honeycomb-lattice bilayer spin-1/2 isotropic (XXX) Heisenberg antiferromagnet in a magnetic field by means of an effective low-energy theory using exact diagonalizations and quantum Monte Carlo simulations. Our main focus is on the magnetization curve and the temperature dependence of the specific heat indicating a finite-temperature phase transition in high magnetic fields.

  5. Total Ionizing Dose Effects in MOS Oxides and Devices

    NASA Technical Reports Server (NTRS)

    Oldham, Timothy R.; McLean, F. B.

    2003-01-01

    The development of military and space electronics technology has traditionally been heavily influenced by the commercial semiconductor industry. The development of MOS technology, and particularly CMOS technology, as dominant commercial technologies has occurred entirely within the lifetime of the NSREC. For this reason, it is not surprising that the study of radiation interactions with MOS materials, devices and circuits has been a major theme of this conference for most of its history. The basic radiation problem in a MOS transistor is illustrated. The application of an appropriate gate voltage causes a conducting channel to form between the source and drain, so that current flows when the device is turned on. In Fig. lb, the effect of ionizing radiation is illustrated. Radiation-induced trapped charge has built up in the gate oxide, which causes a shift in the threshold voltage (that is, a change in the voltage which must be applied to turn the device on). If this shift is large enough, the device cannot be turned off, even at zero volts applied, and the device is said to have failed by going depletion mode.

  6. Threshold voltage variation depending on single grain boundary and stored charges in an adjacent cell for vertical silicon–oxide–nitride–oxide–silicon NAND flash memory

    NASA Astrophysics Data System (ADS)

    Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo

    2018-04-01

    The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.

  7. Study of SiO2-Si and metal-oxide-semiconductor structures using positrons

    NASA Astrophysics Data System (ADS)

    Leung, T. C.; Asoka-Kumar, P.; Nielsen, B.; Lynn, K. G.

    1993-01-01

    Studies of SiO2-Si and metal-oxide-semiconductor (MOS) structures using positrons are summarized and a concise picture of the present understanding of positrons in these systems is provided. Positron annihilation line-shape S data are presented as a function of the positron incident energy, gate voltage, and annealing, and are described with a diffusion-annihilation equation for positrons. The data are compared with electrical measurements. Distinct annihilation characteristics were observed at the SiO2-Si interface and have been studied as a function of bias voltage and annealing conditions. The shift of the centroid (peak) of γ-ray energy distributions in the depletion region of the MOS structures was studied as a function of positron energy and gate voltage, and the shifts are explained by the corresponding variations in the strength of the electric field and thickness of the depletion layer. The potential role of the positron annihilation technique as a noncontact, nondestructive, and depth-sensitive characterization tool for the technologically important, deeply buried interface is shown.

  8. Design and assessment of a robust voltage amplifier with 2.5 GHz GBW and >100 kGy total dose tolerance

    NASA Astrophysics Data System (ADS)

    Verbeeck, J.; Leroux, P.; Steyaert, M.

    2011-01-01

    A differential voltage amplifier with a gain-bandwidth product of 2.5Ghz and using adaptive biasing has been designed in a standard CMOS technology and assessed under radiation and temperature variations. The principle used in this ASIC will be employed in the design of a Gbps TIA with improved tolerance for γ-irradiation and temperature for an optical instrumentation (LIDAR) receiver aiming at operation in harsh environments. The voltage amplifier was tested under gamma radiation and features a gain degradation of merely 4.5% up to a total dose of 100kGy. In order to verify the radiation effects on the IC, the threshold voltage shift of the separate transistors has been investigated. Temperature characterization has shown that the amplifier features a reduction of the voltage gain by only 5.6% for a temperature range of -40 till 130 °C.

  9. The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

    PubMed

    Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

    2013-03-01

    The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

  10. Effect of gate bias sweep rate on the threshold voltage of in-plane gate nanowire transistor

    NASA Astrophysics Data System (ADS)

    Liu, H. X.; Li, J.; Tan, R. R.

    2018-01-01

    In2O3 nanowire electric-double-layer (EDL) transistors with in-plane gate gated by SiO2 solid-electrolyte are fabricated on transparent glass substrates. The gate voltage sweep rates can effectively modulate the threshold voltage (Vth) of nanowire device. Both depletion mode and enhancement mode are realized, and the Vth shift of the nanowire transistors is estimated to be 0.73V (without light). This phenomenon is due to increased adsorption of oxygen on the nanowire surface by the slower gate voltage sweep rates. Adsorbed oxygens capture electrons and cause a surface of nanowire channel was depleted. The operation voltage of transistor was 1.0 V, because the EDL gate dielectric can lead to high gate dielectric capacitance. These transparent in-plane gate nanowire transistors are promising for “see-through” nanoscale sensors.

  11. Holographic Structuring of Elastomer Actuator: First True Monolithic Tunable Elastomer Optics.

    PubMed

    Ryabchun, Alexander; Kollosche, Matthias; Wegener, Michael; Sakhno, Oksana

    2016-12-01

    Volume diffraction gratings (VDGs) are inscribed selectively by diffusive introduction of benzophenone and subsequent UV-holographic structuring into an electroactive dielectric elastomer actuator (DEA), to afford a continuous voltage-controlled grating shift of 17%. The internal stress coupling of DEA and optical domain allows for a new generation of true monolithic tunable elastomer optics with voltage controlled properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. XE991 and Linopirdine Are State-Dependent Inhibitors for Kv7/KCNQ Channels that Favor Activated Single Subunits.

    PubMed

    Greene, Derek L; Kang, Seungwoo; Hoshi, Naoto

    2017-07-01

    M-channel inhibitors, especially XE991, are being used increasingly in animal experiments; however, insufficient characterization of XE991 at times confounds the interpretation of results when using this compound. Here, we demonstrate that XE991 and linopirdine are state-dependent inhibitors that favor the activated-subunit of neuronal Kv7/KCNQ channels. We performed patch-clamp experiments on homomeric Kv7.2 or heteromeric Kv7.2/3 channels expressed in Chinese hamster ovary cells to characterize XE991 and linopirdine. Neither inhibitor was efficacious around the resting membrane potential of cells in physiologic conditions. Inhibition of Kv7.2 and Kv7.2/3 channels by XE991 was closely related with channel activation. When the voltage dependence of activation was left-shifted by retigabine or right-shifted by the mutation, Kv7.2(R214D), the shift in half-activation voltage proportionally coincided with the shift in the half-effective potential for XE991 inhibition. Inhibition kinetics during XE991 wash-in was facilitated at depolarized potentials. Ten-minute washout of XE991 resulted in ∼30% current recovery, most of which was attributed to surface transport of Kv7.2 channels. Linopirdine also exhibited similar inhibition characteristics, with the exception of near- complete current recovery after washout at depolarized potentials. Inhibition kinetics of both XE991 and linopirdine was not as sensitive to changes in voltage as would be predicted by open- channel inhibition. Instead, they were well explained by binding to a single activated subunit. The characteristics of XE991 and linopirdine should be taken into account when these M-channel inhibitors are used in experiments. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  13. Voltage-dependent formation of gramicidin channels in lipid bilayers.

    PubMed Central

    Sandblom, J; Galvanovskis, J; Jilderos, B

    2001-01-01

    The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628

  14. Current-voltage characteristics of organic photovoltaic cells following deposition of cathode electrode

    PubMed Central

    Saeki, Hiroyuki; Hirohara, Kazuto; Koshiba, Yasuko; Horie, Satoshi; Misaki, Masahiro; Takeshita, Kimiya; Ishida, Kenji; Ueda, Yasukiyo

    2010-01-01

    The current-voltage characteristics of benzoporphine-fullerene solar cells were measured subsequent to the deposition of Al as a cathode material. Even in vacuum, a shift in the open circuit voltage was observed at 20 min after Al deposition. Moreover, the displacement of inert gases (N2or Ar) in the evaporation chamber enhanced the photovoltaic parameters. The power conversion efficiency was increased by 24% over the initial characteristics (from 1.04% to 1.29%), which indicates that the structure of the organic-metal interface changed rapidly after Al deposition, even if the process was performed in an air-free glovebox. PMID:21151322

  15. A pH sensor with a double-gate silicon nanowire field-effect transistor

    NASA Astrophysics Data System (ADS)

    Ahn, Jae-Hyuk; Kim, Jee-Yeon; Seol, Myeong-Lok; Baek, David J.; Guo, Zheng; Kim, Chang-Hoon; Choi, Sung-Jin; Choi, Yang-Kyu

    2013-02-01

    A pH sensor composed of a double-gate silicon nanowire field-effect transistor (DG Si-NW FET) is demonstrated. The proposed DG Si-NW FET allows the independent addressing of the gate voltage and hence improves the sensing capability through an application of asymmetric gate voltage between the two gates. One gate is a driving gate which controls the current flow, and the other is a supporting gate which amplifies the shift of the threshold voltage, which is a sensing metric, and which arises from changes in the pH. The pH signal is also amplified through modulation of the gate oxide thickness.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abbaszadeh, D.; Wetzelaer, G. A. H.; Dutch Polymer Institute, P.O. Box 902, 5600 AX, Eindhoven

    The quenching of excitons at the poly(3,4-ethylenedioxythiophene):poly(styrenesulfonic acid) (PEDOT:PSS) anode in blue polyalkoxyspirobifluorene-arylamine polymer light-emitting diodes is investigated. Due to the combination of a higher electron mobility and the presence of electron traps, the recombination zone shifts from the cathode to the anode with increasing voltage. The exciton quenching at the anode at higher voltages leads to an efficiency roll-off. The voltage dependence of the luminous efficiency is reproduced by a drift-diffusion model under the condition that quenching of excitons at the PEDOT:PSS anode and metallic cathode is of equal strength. Experimentally, the efficiency roll-off at high voltages due tomore » anode quenching is eliminated by the use of an electron-blocking layer between the anode and the light-emitting polymer.« less

  17. Hot-Electron-Induced Device Degradation during Gate-Induced Drain Leakage Stress

    NASA Astrophysics Data System (ADS)

    Kim, Kwang-Soo; Han, Chang-Hoon; Lee, Jun-Ki; Kim, Dong-Soo; Kim, Hyong-Joon; Shin, Joong-Shik; Lee, Hea-Beoum; Choi, Byoung-Deog

    2012-11-01

    We studied the interface state generation and electron trapping by hot electrons under gate-induced drain leakage (GIDL) stress in p-type metal oxide semiconductor field-effect transistors (P-MOSFETs), which are used as the high-voltage core circuit of flash memory devices. When negative voltage was applied to a drain in the off-state, a GIDL current was generated, but when high voltage was applied to the drain, electrons had a high energy. The hot electrons produced the interface state and electron trapping. As a result, the threshold voltage shifted and the off-state leakage current (trap-assisted drain junction leakage current) increased. On the other hand, electron trapping mitigated the energy band bending near the drain and thus suppressed the GIDL current generation.

  18. Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana

    PubMed Central

    Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing

    2015-01-01

    Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363

  19. The Study of Phase-shift Super-Frequency Induction Heating Power Supply

    NASA Astrophysics Data System (ADS)

    Qi, Hairun; Peng, Yonglong; Li, Yabin

    This paper combines pulse-width phase-shift power modulation with fixed-angle phase-locked-control to adjust the inverter's output power, this method not only meets the work conditions of voltage inverter, but also realizes the large-scale of power modulation, and the main circuit is simple, the switching devices realize soft switching. This paper analyzes the relationship between the output power and phase-shift angle, the control strategy is simulated by Matlab/Simulink, and the results show that the method is feasible and meets the theoretical analysis

  20. Structural and dielectric properties of thin ZrO2 films on silicon grown by atomic layer deposition from cyclopentadienyl precursor

    NASA Astrophysics Data System (ADS)

    Niinistö, J.; Putkonen, M.; Niinistö, L.; Kukli, K.; Ritala, M.; Leskelä, M.

    2004-01-01

    ZrO2 thin films with thicknesses below 20 nm were deposited by the atomic layer deposition process on Si(100) substrates at 350 °C. An organometallic precursor, Cp2Zr(CH3)2 (Cp=cyclopentadienyl, C5H5) was used as the zirconium source and water or ozone as oxygen source. The influence of oxygen source and substrate pretreatment on the dielectric properties of ZrO2 films was investigated. Structural characterization with high-resolution transmission electron microscopy was performed to films grown onto HF-etched or native oxide covered silicon. Strong inhibition of ZrO2 film growth was observed with the water process on HF-etched Si. Ozone process on HF-etched Si resulted in interfacial SiO2 formation between the dense and uniform film and the substrate while water process produced interfacial layer with intermixing of SiO2 and ZrO2. The effective permittivity of ZrO2 in Al/ZrO2/Si/Al capacitor structures was dependent on the ZrO2 layer thickness and oxygen source used. The interfacial layer formation increased the capacitance equivalent oxide thickness (CET). CET of 2.0 nm was achieved with 5.9 nm ZrO2 film deposited with the H2O process on HF-stripped Si. The ozone-processed films showed good dielectric properties such as low hysteresis and nearly ideal flatband voltage. The leakage current density was lower and breakdown field higher for the ozone-processed ZrO2 films.

  1. Palette of fluorinated voltage-sensitive hemicyanine dyes

    PubMed Central

    Yan, Ping; Acker, Corey D.; Zhou, Wen-Liang; Lee, Peter; Bollensdorff, Christian; Negrean, Adrian; Lotti, Jacopo; Sacconi, Leonardo; Antic, Srdjan D.; Kohl, Peter; Mansvelder, Huibert D.; Pavone, Francesco S.; Loew, Leslie M.

    2012-01-01

    Optical recording of membrane potential permits spatially resolved measurement of electrical activity in subcellular regions of single cells, which would be inaccessible to electrodes, and imaging of spatiotemporal patterns of action potential propagation in excitable tissues, such as the brain or heart. However, the available voltage-sensitive dyes (VSDs) are not always spectrally compatible with newly available optical technologies for sensing or manipulating the physiological state of a system. Here, we describe a series of 19 fluorinated VSDs based on the hemicyanine class of chromophores. Strategic placement of the fluorine atoms on the chromophores can result in either blue or red shifts in the absorbance and emission spectra. The range of one-photon excitation wavelengths afforded by these new VSDs spans 440–670 nm; the two-photon excitation range is 900–1,340 nm. The emission of each VSD is shifted by at least 100 nm to the red of its one-photon excitation spectrum. The set of VSDs, thus, affords an extended toolkit for optical recording to match a broad range of experimental requirements. We show the sensitivity to voltage and the photostability of the new VSDs in a series of experimental preparations ranging in scale from single dendritic spines to whole heart. Among the advances shown in these applications are simultaneous recording of voltage and calcium in single dendritic spines and optical electrophysiology recordings using two-photon excitation above 1,100 nm. PMID:23169660

  2. A study on the high temperature-dependence of the electrical properties in a solution-deposited zinc-tin-oxide thin-film transistor operated in the saturation region

    NASA Astrophysics Data System (ADS)

    Yu, Kyeong Min; Bae, Byung Seong; Jung, Myunghee; Yun, Eui-Jung

    2016-06-01

    We investigate the effects of high temperatures in the range of 292 - 393 K on the electrical properties of solution-processed amorphous zinc-tin-oxide (a-ZTO) thin-film transistors (TFTs) operated in the saturation region. The fabricated a-ZTO TFTs have a non-patterned bottom gate and top contact structure, and they use a heavily-doped Si wafer and SiO2 as a gate electrode and a gate insulator layer, respectively. In a-ZTO TFTs, the trap release energy ( E TR ) was deduced by using Maxwell-Boltzmann statistics. The decreasing E TR toward zero with increasing gate voltage (the density of trap states ( n s )) in the a-ZTO active layer can be attributed to a shift of the Fermi level toward the mobility edge with increasing gate voltage. The TFTs with low gate voltage (low n s ) exhibit multiple trap and release characteristics and show thermally-activated behavior. In TFTs with a high gate voltage (high n s ), however, we observe decreasing mobility and conductivity with increasing temperature at temperatures ranging from 303 to 363 K. This confirms that the E TR can drop to zero, indicating a shift of the Fermi level beyond the mobility edge. Hence, the mobility edge is detected at the cusp between thermally-activated transport and band transport.

  3. Zn2+ reduction induces neuronal death with changes in voltage-gated potassium and sodium channel currents.

    PubMed

    Tian, Kun; He, Cong-Cong; Xu, Hui-Nan; Wang, Yu-Xiang; Wang, Hong-Gang; An, Di; Heng, Bin; Pang, Wei; Jiang, Yu-Gang; Liu, Yan-Qiang

    2017-05-01

    In the present study, cultured rat primary neurons were exposed to a medium containing N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), a specific cell membrane-permeant Zn 2+ chelator, to establish a model of free Zn 2+ deficiency in neurons. The effects of TPEN-mediated free Zn 2+ ion reduction on neuronal viability and on the performance of voltage-gated sodium channels (VGSCs) and potassium channels (Kvs) were assessed. Free Zn 2+ deficiency 1) markedly reduced the neuronal survival rate, 2) reduced the peak amplitude of I Na , 3) shifted the I Na activation curve towards depolarization, 4) modulated the sensitivity of sodium channel voltage-dependent inactivation to a depolarization voltage, and 5) increased the time course of recovery from sodium channel inactivation. In addition, free Zn 2+ deficiency by TPEN notably enhanced the peak amplitude of transient outward K + currents (I A ) and delayed rectifier K + currents (I K ), as well as caused hyperpolarization and depolarization directional shifts in their steady-state activation curves, respectively. Zn 2+ supplementation reversed the effects induced by TPEN. Our results indicate that free Zn 2+ deficiency causes neuronal damage and alters the dynamic characteristics of VGSC and Kv currents. Thus, neuronal injury caused by free Zn 2+ deficiency may correlate with its modulation of the electrophysiological properties of VGSCs and Kvs. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Ph-Dependent Inhibition of Voltage-Gated H+ Currents in Rat Alveolar Epithelial Cells by Zn2+ and Other Divalent Cations

    PubMed Central

    Cherny, Vladimir V.; DeCoursey, Thomas E.

    1999-01-01

    Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017

  5. Voltage-sensing phosphatase modulation by a C2 domain.

    PubMed

    Castle, Paul M; Zolman, Kevin D; Kohout, Susy C

    2015-01-01

    The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function.

  6. Voltage-sensing phosphatase modulation by a C2 domain

    PubMed Central

    Castle, Paul M.; Zolman, Kevin D.; Kohout, Susy C.

    2015-01-01

    The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function. PMID:25904865

  7. Effect of Fluorine Diffusion on Amorphous-InGaZnO-Based Thin-Film Transistors.

    PubMed

    Jiang, Jingxin; Furuta, Mamoru

    2018-08-01

    This study investigated the effect of fluorine (F) diffusion from a fluorinated siliconnitride passivation layer (SiNX:F-Pa) into amorphous-InGaZnO-based thin-film transistors (a-IGZO TFTs). The results of thermal desorption spectroscopy and secondary ion mass spectrometry revealed that F was introduced into the SiOX etch-stopper layer (SiOX-ES) during the deposition of a SiNX:F-Pa, and did not originate from desorption of Si-F bonds; and that long annealing times enhanced F diffusion from the SiOX-ES layer to the a-IGZO channel. Improvements to the performance and threshold-voltage (Vth) negative shift of IGZO TFTs were achieved when annealing time increased from 1 h to 3 h; and capacitance-voltage results indicated that F acted as a shallow donor near the source side in a-IGZO and induced the negative Vth shift. In addition, it was found that when IGZO TFTs with SiNX:F-Pa were annealed 4 h, a low-resistance region was formed at the backchannel of the TFT, leading to a drastic negative Vth shift.

  8. Buckling-dependent switching behaviours in shifted bilayer germanene nanoribbons: A computational study

    NASA Astrophysics Data System (ADS)

    Arjmand, T.; Tagani, M. Bagheri; Soleimani, H. Rahimpour

    2018-01-01

    Bilayer germanene nanoribbons are investigated in different stacks like buckled and flat armchair and buckled zigzag germanene nanoribbons by performing theoretical calculations using the nonequilibrium Greens function method combined with density functional theory. In these bilayer types, the current oscillates with change of interlayer distances or intra-layer overlaps and is dependent on the type of the bilayer. Band gap of AA-stacked of shifted flat bilayer armchair germanene nanoribbon oscillates by change of interlayer distance which is in contrast to buckled bilayer armchair germanene nanoribbon. So, results show the buckling makes system tend to be a semiconductor with wide band gap. Therefore, AA-stacked of shifted flat bilayer armchair germanene nanoribbon has properties between zigzag and armchair edges, the higher current under bias voltages similar to zigzag edge and also oscillations in current like buckled armchair edges. Also, it is found that HOMO-LUMO band gap strongly affects oscillation in currents and their I-V characteristic. This kind of junction improves the switching properties at low voltages around the band gap.

  9. Notes on Experiments.

    ERIC Educational Resources Information Center

    Physics Education, 1982

    1982-01-01

    Describes: (1) an apparatus which provides a simple method for measuring Stefan's constant; (2) a simple phase shifting circuit; (3) a radioactive decay computer program (for ZX81); and (4) phase difference between transformer voltages. (Author/JN)

  10. Two-stage unified stretched-exponential model for time-dependence of threshold voltage shift under positive-bias-stresses in amorphous indium-gallium-zinc oxide thin-film transistors

    NASA Astrophysics Data System (ADS)

    Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In

    2017-08-01

    In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.

  11. Initialize and Weak-Program Erasing Scheme for High-Performance and High-Reliability Ferroelectric NAND Flash Solid-State Drive

    NASA Astrophysics Data System (ADS)

    Miyaji, Kousuke; Yajima, Ryoji; Hatanaka, Teruyoshi; Takahashi, Mitsue; Sakai, Shigeki; Takeuchi, Ken

    Initialize and weak-program erasing scheme is proposed to achieve high-performance and high-reliability Ferroelectric (Fe-) NAND flash solid-state drive (SSD). Bit-by-bit erase VTH control is achieved by the proposed erasing scheme and history effects in Fe-NAND is also suppressed. History effects change the future erase VTH shift characteristics by the past program voltage. The proposed erasing scheme decreases VTH shift variation due to history effects from ±40% to ±2% and the erase VTH distribution width is reduced from over 0.4V to 0.045V. As a result, the read and VPASS disturbance decrease by 42% and 37%, respectively. The proposed erasing scheme is immune to VTH variations and voltage stress. The proposed erasing scheme also suppresses the power and bandwidth degradation of SSD.

  12. Study of mechanism of stress-induced threshold voltage shift and recovery in top-gate amorphous-InGaZnO4 thin-film transistors with source- and drain-offsets

    NASA Astrophysics Data System (ADS)

    Mativenga, Mallory; Kang, Dong Han; Lee, Ung Gi; Jang, Jin

    2012-09-01

    Bias instability of top-gate amorphous-indium-gallium-zinc-oxide thin-film transistors with source- and drain-offsets is reported. Positive and negative gate bias-stress (VG_STRESS) respectively induce reversible negative threshold-voltage shift (ΔVTH) and reduction in on-current. Migration of positive charges towards the offsets lowers the local resistance of the offsets, resulting in the abnormal negative ΔVTH under positive VG_STRESS. The reduction in on-current under negative VG_STRESS is due to increase in resistance of the offsets when positive charges migrate away from the offsets. Appropriate drain and source bias-stresses applied simultaneously with VG_STRESS either suppress or enhance the instability, verifying lateral ion migration to be the instability mechanism.

  13. pH-dependent electron-transport properties of carbon nanotubes.

    PubMed

    Back, Ju Hee; Shim, Moonsub

    2006-11-30

    Carbon nanotube electrochemical transistors integrated with microfluidic channels are utilized to examine the effects of aqueous electrolyte solutions on the electron-transport properties of single isolated carbon nanotubes. In particular, pH and concentration of supporting inert electrolytes are examined. A systematic threshold voltage shift with pH is observed while the transconductance and subthreshold swing remain independent of pH and concentration. Decreasing pH leads to a negative shift of the threshold voltage, indicating that protonation does not lead to hole doping. Changing the type of contact metal does not alter the observed pH response. The pH-dependent charging of SiO2 substrate is ruled out as the origin based on measurements with suspended nanotube transistors. Increasing the ionic strength leads to reduced pH response. Contributions from possible surface chargeable chemical groups are considered.

  14. Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons.

    PubMed

    Brown, Maile R; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H; Kaczmarek, Leonard K

    2016-07-01

    Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express "high threshold" voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. Copyright © 2016 the American Physiological Society.

  15. Physiological modulators of Kv3.1 channels adjust firing patterns of auditory brain stem neurons

    PubMed Central

    Brown, Maile R.; El-Hassar, Lynda; Zhang, Yalan; Alvaro, Giuseppe; Large, Charles H.

    2016-01-01

    Many rapidly firing neurons, including those in the medial nucleus of the trapezoid body (MNTB) in the auditory brain stem, express “high threshold” voltage-gated Kv3.1 potassium channels that activate only at positive potentials and are required for stimuli to generate rapid trains of actions potentials. We now describe the actions of two imidazolidinedione derivatives, AUT1 and AUT2, which modulate Kv3.1 channels. Using Chinese hamster ovary cells stably expressing rat Kv3.1 channels, we found that lower concentrations of these compounds shift the voltage of activation of Kv3.1 currents toward negative potentials, increasing currents evoked by depolarization from typical neuronal resting potentials. Single-channel recordings also showed that AUT1 shifted the open probability of Kv3.1 to more negative potentials. Higher concentrations of AUT2 also shifted inactivation to negative potentials. The effects of lower and higher concentrations could be mimicked in numerical simulations by increasing rates of activation and inactivation respectively, with no change in intrinsic voltage dependence. In brain slice recordings of mouse MNTB neurons, both AUT1 and AUT2 modulated firing rate at high rates of stimulation, a result predicted by numerical simulations. Our results suggest that pharmaceutical modulation of Kv3.1 currents represents a novel avenue for manipulation of neuronal excitability and has the potential for therapeutic benefit in the treatment of hearing disorders. PMID:27052580

  16. Broadband linear high-voltage amplifier for radio frequency ion traps.

    PubMed

    Kuhlicke, Alexander; Palis, Klaus; Benson, Oliver

    2014-11-01

    We developed a linear high-voltage amplifier for small capacitive loads consisting of a high-voltage power supply and a transistor amplifier. With this cost-effective circuit including only standard parts sinusoidal signals with a few volts can be amplified to 1.7 kVpp over a usable frequency range at large-signal response spanning four orders of magnitude from 20 Hz to 100 kHz under a load of 10 pF. For smaller output voltages the maximum frequency shifts up to megahertz. We test different capacitive loads to probe the influence on the performance. The presented amplifier is sustained short-circuit proof on the output side, which is a significant advantage over other amplifier concepts. The amplifier can be used to drive radio frequency ion traps for single charged nano- and microparticles, which will be presented in brief.

  17. Plenoptic camera based on a liquid crystal microlens array

    NASA Astrophysics Data System (ADS)

    Lei, Yu; Tong, Qing; Zhang, Xinyu; Sang, Hongshi; Xie, Changsheng

    2015-09-01

    A type of liquid crystal microlens array (LCMLA) with tunable focal length by the voltage signals applied between its top and bottom electrodes, is fabricated and then the common optical focusing characteristics are tested. The relationship between the focal length and the applied voltage signals is given. The LCMLA is integrated with an image sensor and further coupled with a main lens so as to construct a plenoptic camera. Several raw images at different voltage signals applied are acquired and contrasted through the LCMLA-based plenoptic camera constructed by us. Our experiments demonstrate that through utilizing a LCMLA in a plenoptic camera, the focused zone of the LCMLA-based plenoptic camera can be shifted effectively only by changing the voltage signals loaded between the electrodes of the LCMLA, which is equivalent to the extension of the depth of field.

  18. Low-voltage all-inorganic perovskite quantum dot transistor memory

    NASA Astrophysics Data System (ADS)

    Chen, Zhiliang; Zhang, Yating; Zhang, Heng; Yu, Yu; Song, Xiaoxian; Zhang, Haiting; Cao, Mingxuan; Che, Yongli; Jin, Lufan; Li, Yifan; Li, Qingyan; Dai, Haitao; Yang, Junbo; Yao, Jianquan

    2018-05-01

    An all-inorganic cesium lead halide quantum dot (QD) based Au nanoparticle (NP) floating-gate memory with a solution processed layer-by-layer method is demonstrated. Easy synthesis at room temperature and excellent stability make all-inorganic CsPbBr3 perovskite QDs suitable as a semiconductor layer in low voltage nonvolatile transistor memory. The bipolarity of QDs has both electrons and holes stored in the Au NP floating gate, resulting in bidirectional shifts of initial threshold voltage according to the applied programing and erasing pulses. Under low operation voltage (±5 V), the memory achieved a great memory window (˜2.4 V), long retention time (>105 s), and stable endurance properties after 200 cycles. So the proposed memory device based on CsPbBr3 perovskite QDs has a great potential in the flash memory market.

  19. A theoretical approach to study the optical sensitivity of a MESFET

    NASA Astrophysics Data System (ADS)

    Dutta, Sutanu

    2018-05-01

    A theoretical model to study the optical sensitivity of a metal-semiconductor field effect transistor has been proposed for a relatively high drain field. An analytical expression of drain current of the device has been derived for a MESFET under optical illumination considering field dependent mobility of electrons across the channel. The variation of drain current with and without optical illumination has been studied with drain and gate voltages. The optical sensitivity of the drain current has been studied for different biasing conditions and gate lengths. In addition, the shift in threshold voltage of a MESFET under optical illumination is determined and optical sensitivity of the device in terms of its threshold voltage has been studied.

  20. Direct electronic probing of biological complexes formation

    NASA Astrophysics Data System (ADS)

    Macchia, Eleonora; Magliulo, Maria; Manoli, Kyriaki; Giordano, Francesco; Palazzo, Gerardo; Torsi, Luisa

    2014-10-01

    Functional bio-interlayer organic field - effect transistors (FBI-OFET), embedding streptavidin, avidin and neutravidin as bio-recognition element, have been studied to probe the electronic properties of protein complexes. The threshold voltage control has been achieved modifying the SiO2 gate diaelectric surface by means of the deposition of an interlayer of bio-recognition elements. A threshold voltage shift with respect to the unmodified dielectric surface toward more negative potential values has been found for the three different proteins, in agreement with their isoelectric points. The relative responses in terms of source - drain current, mobility and threshold voltage upon exposure to biotin of the FBI-OFET devices have been compared for the three bio-recognition elements.

  1. Addressable inverter matrix for process and device characterization

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Sayah, H. R.

    1985-01-01

    The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated in this study, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold voltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

  2. FIBER AND INTEGRATED OPTICS: Nonlinearity of a channel-waveguide phase modulator

    NASA Astrophysics Data System (ADS)

    Parygin, V. N.; Zhmakin, I. N.; Baglikov, V. B.

    1993-09-01

    The phase velocity of light in a channel waveguide using a LiNbO3 crystal is analyzed as a function of the voltage applied to the crystal. A refinement of the method of an effective refractive index is proposed. This refinement makes it possible to use the method near the cutoff for a waveguide mode. At voltages on the order of 10 V, the nonlinearity of the phase characteristic amounts to ~ 5 · 10- 4 of the linear phase shift.

  3. Membrane voltage fluctuations reduce spike frequency adaptation and preserve output gain in CA1 pyramidal neurons in a high conductance state

    PubMed Central

    Fernandez, Fernando R.; Broicher, Tilman; Truong, Alan; White, John A.

    2011-01-01

    Modulating the gain of the input-output function of neurons is critical for processing of stimuli and network dynamics. Previous gain control mechanisms have suggested that voltage fluctuations play a key role in determining neuronal gain in vivo. Here we show that, under increased membrane conductance, voltage fluctuations restore Na+ current and reduce spike frequency adaptation in rat hippocampal CA1 pyramidal neurons in vitro. As a consequence, membrane voltage fluctuations produce a leftward shift in the f-I relationship without a change in gain, relative to an increase in conductance alone. Furthermore, we show that these changes have important implications for the integration of inhibitory inputs. Due to the ability to restore Na+ current, hyperpolarizing membrane voltage fluctuations mediated by GABAA-like inputs can increase firing rate in a high conductance state. Finally, our data show that the effects on gain and synaptic integration are mediated by voltage fluctuations within a physiologically relevant range of frequencies (10–40 Hz). PMID:21389243

  4. Point mutation of a conserved aspartate, D69, in the muscarinic M2 receptor does not modify voltage-sensitive agonist potency.

    PubMed

    Ågren, Richard; Sahlholm, Kristoffer; Nilsson, Johanna; Århem, Peter

    2018-01-29

    The muscarinic M 2 receptor (M 2 R) has been shown to display voltage-sensitive agonist binding, based on G protein-activated inward rectifier potassium channel (GIRK) opening and radioligand binding at different membrane voltages. A conserved aspartate in transmembrane segment (TM) II of M 2 R, D69, has been proposed as the voltage sensor. While a recent paper instead presented evidence of tyrosines in TMs III, VI, and VII acting as voltage sensors, these authors were not able to record GIRK channel activation by a D69N mutant M 2 R. In the present study, we succeeded in recording ACh-induced GIRK channel activation by this mutant at -80 and 0 mV. The acetylcholine EC 50 was about 2.5-fold higher at 0 mV, a potency shift very similar to that observed at wild-type M 2 R, indicating that voltage sensitivity persists at the D69N mutant. Thus, our present observations corroborate the notion that D69 is not responsible for voltage sensitivity of the M 2 R. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Giga-seal formation alters properties of sodium channels of human myoballs.

    PubMed

    Fahlke, C; Rüdel, R

    1992-03-01

    The influence of giga-seal formation on the properties of the Na+ channels within the covered membrane patch was investigated with a whole-cell pipette and a patch pipette applied to the same cell. Current kinetics, current/voltage relation and channel densities were determined in three combinations: (i) voltage-clamping and current recording with the whole-cell pipette, (ii) voltage-clamping with the whole-cell pipette and current recording with the patch pipette and, (iii) voltage-clamping and current recording with the patch pipette. The Hodgkin-Huxley (1952) parameters tau m and tau h were smaller for the patch currents than for the whole cell, and the h infinity curve was shifted in the negative direction. The channel density was of the order of 10 times smaller. All effects were independent of the extracellular Ca2+ concentration. The capacitive current generated in the patch by the whole-cell Na+ current and its effect on the transmembrane voltage of the patch were evaluated. The kinetic parameters of the Na+ channels in the patch did not depend on whether the voltage was clamped with the whole-cell pipette or the patch pipette. Thus, the results are not due to spurious voltage.

  6. Improved frequency/voltage converters for fast quartz crystal microbalance applications.

    PubMed

    Torres, R; García, J V; Arnau, A; Perrot, H; Kim, L To Thi; Gabrielli, C

    2008-04-01

    The monitoring of frequency changes in fast quartz crystal microbalance (QCM) applications is a real challenge in today's instrumentation. In these applications, such as ac electrogravimetry, small frequency shifts, in the order of tens of hertz, around the resonance of the sensor can occur up to a frequency modulation of 1 kHz. These frequency changes have to be monitored very accurately both in magnitude and phase. Phase-locked loop techniques can be used for obtaining a high performance frequency/voltage converter which can provide reliable measurements. Sensitivity higher than 10 mVHz, for a frequency shift resolution of 0.1 Hz, with very low distortion in tracking both the magnitude and phase of the frequency variations around the resonance frequency of the sensor are required specifications. Moreover, the resonance frequency can vary in a broad frequency range from 5 to 10 MHz in typical QCM sensors, which introduces an additional difficulty. A new frequency-voltage conversion system based on a double tuning analog-digital phase-locked loop is proposed. The reported electronic characterization and experimental results obtained with conducting polymers prove its reliability for ac-electrogravimetry measurements and, in general, for fast QCM applications.

  7. Effect of 30 MeV Li3+ ion and 8 MeV electron irradiation on N-channel MOSFETs

    NASA Astrophysics Data System (ADS)

    Prakash, A. P. G.; Ganesh, K. C. P.; Nagesha, Y. N.; Umakanth, D.; Arora, S. K.; Siddappa, K.

    The effect of 30 MeV Li3+ ion and 8 MeV electron irradiation on the threshold voltage (V-TH), the voltage shift due to interface trapped charge (DeltaV(Nit)), the voltage shift due to oxide trapped charge (DeltaV(Not)), the density of interface trapped charge (DeltaN(it)), the density of oxide trapped charge (DeltaN(ot) ) and the drain saturation current (I-D Sat) were studied as a function of fluence. Considerable increase in DeltaN(it) and DeltaN(ot) , and decrease in V-TH and I-D Sat were observed in both types of irradiation. The observed difference in the properties of Li3+ ion and electron irradiated MOSFETs are interpreted on the basis of energy loss process associated with the type of radiation. The study showed that the 30 MeV Li3+ ion irradiation produce more damage when compared to the 8 MeV electron irradiation because of the higher electronic energy loss value. High temperature annealing studies showed that trapped charge generated during ion and electron irradiation was annealed out at 500 degreesC.

  8. An All Oxide-Based Imperceptible Thin-Film Transistor with Humidity Sensing Properties

    PubMed Central

    Kim, Kyung Su; Ahn, Cheol Hyoun; Kang, Won Jun; Cho, Sung Woon; Jung, Sung Hyeon; Yoon, Dae Ho; Cho, Hyung Koun

    2017-01-01

    We have examined the effects of oxygen content and thickness in sputtered InSnO (ITO) electrodes, especially for the application of imperceptible amorphous-InGaZnO (a-IGZO) thin-film transistors (TFTs) in humidity sensors. The imperceptible a-IGZO TFT with 50-nm ITO electrodes deposited at Ar:O2 = 29:0.3 exhibited good electrical performances with Vth of −0.23 V, SS of 0.34 V/dec, µFE of 7.86 cm2/V∙s, on/off ratio of 8.8 × 107, and has no degradation for bending stress up to a 3.5-mm curvature. The imperceptible oxide TFT sensors showed the highest sensitivity for the low and wide gate bias of −1~2 V under a wide range of relative humidity (40–90%) at drain voltage 1 V, resulting in low power consumption by the sensors. Exposure to water vapor led to a negative shift in the threshold voltage (or current enhancement), and an increase in relative humidity induced continuous threshold voltage shift. In particular, compared to conventional resistor-type sensors, the imperceptible oxide TFT sensors exhibited extremely high sensitivity from a current amplification of >103. PMID:28772888

  9. An All Oxide-Based Imperceptible Thin-Film Transistor with Humidity Sensing Properties.

    PubMed

    Kim, Kyung Su; Ahn, Cheol Hyoun; Kang, Won Jun; Cho, Sung Woon; Jung, Sung Hyeon; Yoon, Dae Ho; Cho, Hyung Koun

    2017-05-13

    We have examined the effects of oxygen content and thickness in sputtered InSnO (ITO) electrodes, especially for the application of imperceptible amorphous-InGaZnO ( a -IGZO) thin-film transistors (TFTs) in humidity sensors. The imperceptible a -IGZO TFT with 50-nm ITO electrodes deposited at Ar:O₂ = 29:0.3 exhibited good electrical performances with V th of -0.23 V, SS of 0.34 V/dec, µ FE of 7.86 cm²/V∙s, on/off ratio of 8.8 × 10⁷, and has no degradation for bending stress up to a 3.5-mm curvature. The imperceptible oxide TFT sensors showed the highest sensitivity for the low and wide gate bias of -1~2 V under a wide range of relative humidity (40-90%) at drain voltage 1 V, resulting in low power consumption by the sensors. Exposure to water vapor led to a negative shift in the threshold voltage (or current enhancement), and an increase in relative humidity induced continuous threshold voltage shift. In particular, compared to conventional resistor-type sensors, the imperceptible oxide TFT sensors exhibited extremely high sensitivity from a current amplification of >10³.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pfeffer, H.; Saewert, G.

    This paper reports on a 6 kV modulator built and installed at Fermilab to drive the electron gun anode for the Tevatron Electron Lens (TEL). The TEL was built with the intention of shifting the individual (anti)proton bunch tunes to even out the tune spread among all 36 bunches with the desire of improving Tevatron integrated luminosity. This modulator is essentially a 6 kV arbitrary waveform generator that enables the TEL to define the electron beam intensity on a bunch-by-bunch basis. A voltage waveform is constructed having a 7 μs duration that corresponds to the tune shift requirements of amore » 12-bunch (anti)proton beam pulse train. This waveform is played out for any one or all three bunch trains in the Tevatron. The programmed waveform voltages transition to different levels at time intervals corresponding to the 395 ns bunch spacing. In addition, complex voltage waveforms can be played out at a sustained rate of 143 kHz over the full 6 kV output range. This paper describes the novel design of the inductive adder topology employing five transformers. It describes the design aspects that minimize switching losses for this multi-kilovolt, high repetition rate and high duty factor application.« less

  11. A Paramagnetic Molecular Voltmeter

    PubMed Central

    Surek, Jack T.; Thomas, David D.

    2008-01-01

    We have developed a general electron paramagnetic resonance (EPR) method to measure electrostatic potential at spin labels on proteins to millivolt accuracy. Electrostatic potential is fundamental to energy-transducing proteins like myosin, because molecular energy storage and retrieval is primarily electrostatic. Quantitative analysis of protein electrostatics demands a site-specific spectroscopic method sensitive to millivolt changes. Previous electrostatic potential studies on macromolecules fell short in sensitivity, accuracy and/or specificity. Our approach uses fast-relaxing charged and neutral paramagnetic relaxation agents (PRAs) to increase nitroxide spin label relaxation rate solely through collisional spin exchange. These PRAs were calibrated in experiments on small nitroxides of known structure and charge to account for differences in their relaxation efficiency. Nitroxide longitudinal (R1) and transverse (R2) relaxation rates were separated by applying lineshape analysis to progressive saturation spectra. The ratio of measured R1 increases for each pair of charged and neutral PRAs measures the shift in local PRA concentration due to electrostatic potential. Voltage at the spin label is then calculated using the Boltzmann equation. Measured voltages for two small charged nitroxides agree with Debye-Hückel calculations. Voltage for spin-labeled myosin fragment S1 also agrees with calculation based on the pK shift of the reacted cysteine. PMID:17964835

  12. Improved frequency/voltage converters for fast quartz crystal microbalance applications

    NASA Astrophysics Data System (ADS)

    Torres, R.; García, J. V.; Arnau, A.; Perrot, H.; Kim, L. To Thi; Gabrielli, C.

    2008-04-01

    The monitoring of frequency changes in fast quartz crystal microbalance (QCM) applications is a real challenge in today's instrumentation. In these applications, such as ac electrogravimetry, small frequency shifts, in the order of tens of hertz, around the resonance of the sensor can occur up to a frequency modulation of 1kHz. These frequency changes have to be monitored very accurately both in magnitude and phase. Phase-locked loop techniques can be used for obtaining a high performance frequency/voltage converter which can provide reliable measurements. Sensitivity higher than 10mV/Hz, for a frequency shift resolution of 0.1Hz, with very low distortion in tracking both the magnitude and phase of the frequency variations around the resonance frequency of the sensor are required specifications. Moreover, the resonance frequency can vary in a broad frequency range from 5to10MHz in typical QCM sensors, which introduces an additional difficulty. A new frequency-voltage conversion system based on a double tuning analog-digital phase-locked loop is proposed. The reported electronic characterization and experimental results obtained with conducting polymers prove its reliability for ac-electrogravimetry measurements and, in general, for fast QCM applications.

  13. Effect of high power CO2 and Yb:YAG laser radiation on the characteristics of TIG arc in atmospherical pressure argon and helium

    NASA Astrophysics Data System (ADS)

    Wu, Shikai; Xiao, Rongshi

    2015-04-01

    The effects of laser radiation on the characteristics of the DC tungsten inert gas (TIG) arc were investigated by applying a high power slab CO2 laser and a Yb:YAG disc laser. Experiment results reveal that the arc voltage-current curve shifts downwards, the arc column expands, and the arc temperature rises while the high power CO2 laser beam vertically interacts with the TIG arc in argon. With the increase of the laser power, the voltage-current curve of the arc shifts downwards more significantly, and the closer the laser beam impingement on the arc to the cathode, the more the decrease in arc voltage. Moreover, the arc column expansion and the arc temperature rise occur mainly in the region between the laser beam incident position and the anode. However, the arc characteristics hardly change in the cases of the CO2 laser-helium arc and YAG laser-arc interactions. The reason is that the inverse Bremsstrahlung absorption coefficients are greatly different due to the different electron densities of the argon and helium arcs and the different wave lengths of CO2 and YAG lasers.

  14. The voltage-sensing domain of a phosphatase gates the pore of a potassium channel

    PubMed Central

    Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L.; Thiel, Gerhard

    2013-01-01

    The modular architecture of voltage-gated K+ (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates KvSynth1, a functional voltage-gated, outwardly rectifying K+ channel. KvSynth1 displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V1/2 = +56 mV; z of ∼1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains. PMID:23440279

  15. Synaptic transistor with a reversible and analog conductance modulation using a Pt/HfOx/n-IGZO memcapacitor

    NASA Astrophysics Data System (ADS)

    Yang, Paul; Kim, Hyung Jun; Zheng, Hong; Beom, Geon Won; Park, Jong-Sung; Kang, Chi Jung; Yoon, Tae-Sik

    2017-06-01

    A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.

  16. Synaptic transistor with a reversible and analog conductance modulation using a Pt/HfOx/n-IGZO memcapacitor.

    PubMed

    Yang, Paul; Jun Kim, Hyung; Zheng, Hong; Won Beom, Geon; Park, Jong-Sung; Jung Kang, Chi; Yoon, Tae-Sik

    2017-06-02

    A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.

  17. Independent variations of applied voltage and injection current for controlling the quantum-confined Stark effect in an InGaN/GaN quantum-well light-emitting diode.

    PubMed

    Chen, Horng-Shyang; Liu, Zhan Hui; Shih, Pei-Ying; Su, Chia-Ying; Chen, Chih-Yen; Lin, Chun-Han; Yao, Yu-Feng; Kiang, Yean-Woei; Yang, C C

    2014-04-07

    A reverse-biased voltage is applied to either device in the vertical configuration of two light-emitting diodes (LEDs) grown on patterned and flat Si (110) substrates with weak and strong quantum-confined Stark effects (QCSEs), respectively, in the InGaN/GaN quantum wells for independently controlling the applied voltage across and the injection current into the p-i-n junction in the lateral configuration of LED operation. The results show that more carrier supply is needed in the LED of weaker QCSE to produce a carrier screening effect for balancing the potential tilt in increasing the forward-biased voltage, when compared with the LED of stronger QCSE. The small spectral shift range in increasing injection current in the LED of weaker QCSE is attributed not only to the weaker QCSE, but also to its smaller device resistance such that a given increment of applied voltage leads to a larger increment of injection current. From a viewpoint of practical application in LED operation, by applying a reverse-biased voltage in the vertical configuration, the applied voltage and injection current in the lateral configuration can be independently controlled by adjusting the vertical voltage for keeping the emission spectral peak fixed.

  18. Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (α1S) expressing two complementary protein fragments

    PubMed Central

    Ahern, Chris A; Vallejo, Paola; Mortenson, Lindsay; Coronado, Roberto

    2001-01-01

    Background The L-type Ca2+ channel formed by the dihydropyridine receptor (DHPR) of skeletal muscle senses the membrane voltage and opens the ryanodine receptor (RyR1). This channel-to-channel coupling is essential for Ca2+ signaling but poorly understood. We characterized a single-base frame-shift mutant of α1S, the pore subunit of the DHPR, that has the unusual ability to function voltage sensor for excitation-contraction (EC) coupling by virtue of expressing two complementary hemi-Ca2+ channel fragments. Results Functional analysis of cDNA transfected dysgenic myotubes lacking α1S were carried out using voltage-clamp, confocal Ca2+ indicator fluoresence, epitope immunofluorescence and immunoblots of expressed proteins. The frame-shift mutant (fs-α1S) expressed the N-terminal half of α1S (M1 to L670) and the C-terminal half starting at M701 separately. The C-terminal fragment was generated by an unexpected restart of translation of the fs-α1S message at M701 and was eliminated by a M701I mutation. Protein-protein complementation between the two fragments produced recovery of skeletal-type EC coupling but not L-type Ca2+ current. Discussion A premature stop codon in the II-III loop may not necessarily cause a loss of DHPR function due to a restart of translation within the II-III loop, presumably by a mechanism involving leaky ribosomal scanning. In these cases, function is recovered by expression of complementary protein fragments from the same cDNA. DHPR-RyR1 interactions can be achieved via protein-protein complementation between hemi-Ca2+ channel proteins, hence an intact II-III loop is not essential for coupling the DHPR voltage sensor to the opening of RyR1 channel. PMID:11806762

  19. Molecular determinants of voltage-dependent gating and binding of pore-blocking drugs in transmembrane segment IIIS6 of the Na(+) channel alpha subunit.

    PubMed

    Yarov-Yarovoy, V; Brown, J; Sharp, E M; Clare, J J; Scheuer, T; Catterall, W A

    2001-01-05

    Mutations of amino acid residues in the inner two-thirds of the S6 segment in domain III of the rat brain type IIA Na(+) channel (G1460A to I1473A) caused periodic positive and negative shifts in the voltage dependence of activation, consistent with an alpha-helix having one face on which mutations to alanine oppose activation. Mutations in the outer one-third of the IIIS6 segment all favored activation. Mutations in the inner half of IIIS6 had strong effects on the voltage dependence of inactivation from closed states without effect on open-state inactivation. Only three mutations had strong effects on block by local anesthetics and anticonvulsants. Mutations L1465A and I1469A decreased affinity of inactivated Na(+) channels up to 8-fold for the anticonvulsant lamotrigine and its congeners 227c89, 4030w92, and 619c89 as well as for the local anesthetic etidocaine. N1466A decreased affinity of inactivated Na(+) channels for the anticonvulsant 4030w92 and etidocaine by 3- and 8-fold, respectively, but had no effect on affinity of the other tested compounds. Leu-1465, Asn-1466, and Ile-1469 are located on one side of the IIIS6 helix, and mutation of each caused a positive shift in the voltage dependence of activation. Evidently, these amino acid residues face the lumen of the pore, contribute to formation of the high-affinity receptor site for pore-blocking drugs, and are involved in voltage-dependent activation and coupling to closed-state inactivation.

  20. Role of the Local Anesthetic Receptor in the State-Dependent Inhibition of Voltage-Gated Sodium Channels by the Insecticide Metaflumizone

    PubMed Central

    von Stein, Richard T.

    2012-01-01

    Sodium channel inhibitor (SCI) insecticides selectively target voltage-gated sodium (Nav) channels in the slow-inactivated state by binding at or near the local anesthetic receptor within the sodium channel pore. Metaflumizone is a new insecticide for the treatment of fleas on domesticated pets and has recently been reported to block insect sodium channels in the slow-inactivated state, thereby implying that it is also a member of the SCI class. Using the two-electrode voltage-clamp technique, we examined metaflumizone inhibition of rat Nav1.4 sodium channels expressed in Xenopus laevis oocytes. Metaflumizone selectively inhibited Nav1.4 channels at potentials that promoted slow inactivation and shifted the voltage dependence of slow inactivation in the direction of hyperpolarization. Metaflumizone perfusion at a hyperpolarized holding potential also shifted the conductance-voltage curve for activation in the direction of depolarization and antagonized use-dependent lidocaine inhibition of fast-inactivated sodium channels, actions not previously observed with other SCI insecticides. We expressed mutated Nav1.4/F1579A and Nav1.4/Y1586A channels to investigate whether metaflumizone shares the domain IV segment S6 (DIV-S6) binding determinants identified for other SCI insecticides. Consistent with previous investigations of SCI insecticides on rat Nav1.4 channels, the F1579A mutation reduced sensitivity to block by metaflumizone, whereas the Y1586A mutation paradoxically increased the sensitivity to metaflumizone. We conclude that metaflumizone selectively inhibits slow-inactivated Nav1.4 channels and shares DIV-S6 binding determinants with other SCI insecticides and therapeutic drugs. However, our results suggest that metaflumizone interacts with resting and fast-inactivated channels in a manner that is distinct from other compounds in this insecticide class. PMID:22127519

  1. NMR structural and dynamical investigation of the isolated voltage-sensing domain of the potassium channel KvAP: implications for voltage gating.

    PubMed

    Shenkarev, Zakhar O; Paramonov, Alexander S; Lyukmanova, Ekaterina N; Shingarova, Lyudmila N; Yakimov, Sergei A; Dubinnyi, Maxim A; Chupin, Vladimir V; Kirpichnikov, Mikhail P; Blommers, Marcel J J; Arseniev, Alexander S

    2010-04-28

    The structure and dynamics of the isolated voltage-sensing domain (VSD) of the archaeal potassium channel KvAP was studied by high-resolution NMR. The almost complete backbone resonance assignment and partial side-chain assignment of the (2)H,(13)C,(15)N-labeled VSD were obtained for the protein domain solubilized in DPC/LDAO (2:1) mixed micelles. Secondary and tertiary structures of the VSD were characterized using secondary chemical shifts and NOE contacts. These data indicate that the spatial structure of the VSD solubilized in micelles corresponds to the structure of the domain in an open state of the channel. NOE contacts and secondary chemical shifts of amide protons indicate the presence of tightly bound water molecule as well as hydrogen bond formation involving an interhelical salt bridge (Asp62-R133) that stabilizes the overall structure of the domain. The backbone dynamics of the VSD was studied using (15)N relaxation measurements. The loop regions S1-S2 and S2-S3 were found mobile, while the S3-S4 loop (voltage-sensor paddle) was found stable at the ps-ns time scale. The moieties of S1, S2, S3, and S4 helices sharing interhelical contacts (at the level of the Asp62-R133 salt bridge) were observed in conformational exchange on the micros-ms time scale. Similar exchange-induced broadening of characteristic resonances was observed for the VSD solubilized in the membrane of lipid-protein nanodiscs composed of DMPC, DMPG, and POPC/DOPG lipids. Apparently, the observed interhelical motions represent an inherent property of the VSD of the KvAP channel and can play an important role in the voltage gating.

  2. Effect of substrate thinning on the electronic transport characteristics of AlGaN/GaN HEMTs

    NASA Astrophysics Data System (ADS)

    Zhu, Hui; Meng, Xiao; Zheng, Xiang; Yang, Ying; Feng, Shiwei; Zhang, Yamin; Guo, Chunsheng

    2018-07-01

    We studied how substrate thinning affected the electronic transport characteristics of AlGaN/GaN HEMTs. By thinning their sapphire substrate from 460 μm to 80 μm, we varied the residual stress in these HEMTs. The thinned sample showed decreased drain-source current and occurrence of kink effect. Furthermore, shown by current transient measurements and time constant analysis, the detrapping behaviors of trap states shifted toward a larger time constant, and the detrapping behavior under the gate and in the gate-drain access region showed increased amplitude. By using pulsed current-voltage measurements, the thinned sample showed a positive shift of the threshold voltage, a decrease in peak transconductance, and an aggravation in current collapse, as compared with the thick one. The degradation of electrical behavior were associated with the structural degradation, as confirmed by the increase of pit density on the thinned sample surface.

  3. Tunneling calculations for GaAs-Al(x)Ga(1-x)As graded band-gap sawtooth superlattices

    NASA Technical Reports Server (NTRS)

    Forrest, Kathrine; Meijer, Paul H. E.

    1990-01-01

    The transmission resonance spectra and tunneling current-voltage characteristics for direct conduction band electrons in sawtooth GaAs-Al(x)Ga(1-x)As superlattices are computed. Only direct-gap interfaces are considered. It is found that sawtooth superlattices exhibit resonant tunneling similar to that in step superlattices, manifested by correlation of peaks and regions of negative differential resistance in the current-voltage curves with transmission resonances. The Stark shift of the resonances of step-barrier superlattices is a linear function of the field, whereas in sawtooth superlattices under strong fields the shift is not a simple function of the field. This follows from the different ways in which the two structures deform under uniform electric fields: the sawtooth deforms into a staircase, at which field strength all barriers to tunneling are eradicated. The step-barrier superlattice always presents some barrier to tunneling, no matter how high the electric field strength.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Won Lee, Sang; Suh, Dongseok, E-mail: energy.suh@skku.edu; Department of Energy Science and Department of Physics, Sungkyunkwan University, Suwon 440-746

    A prior requirement of any developed transistor for practical use is the stability test. Random network carbon nanotube-thin film transistor (CNT-TFT) was fabricated on SiO{sub 2}/Si. Gate bias stress stability was investigated with various passivation layers of HfO{sub 2} and Al{sub 2}O{sub 3}. Compared to the threshold voltage shift without passivation layer, the measured values in the presence of passivation layers were reduced independent of gate bias polarity except HfO{sub 2} under positive gate bias stress (PGBS). Al{sub 2}O{sub 3} capping layer was found to be the best passivation layer to prevent ambient gas adsorption, while gas adsorption on HfO{submore » 2} layer was unavoidable, inducing surface charges to increase threshold voltage shift in particular for PGBS. This high performance in the gate bias stress test of CNT-TFT even superior to that of amorphous silicon opens potential applications to active TFT industry for soft electronics.« less

  5. External pH effects on the depolarization-activated K channels in guard cell protoplasts of Vicia faba

    PubMed Central

    1994-01-01

    Previous studies reveal that the pH of the apoplastic solution in the guard cell walls may vary between 7.2 and 5.1 in closed and open stomata, respectively. During these aperture and pH changes, massive K+ fluxes cross the cellular plasma membrane driving the osmotic turgor and volume changes of guard cells. Therefore, we examined the effect of extracellular pH on the depolarization-activated K channels (KD channels), which constitute the K+ efflux pathway, in the plasma membrane of Vicia faba guard cell protoplasts. We used patch clamp, both in whole cells as well as in excised outside-out membrane patches. Approximately 500 KD channels, at least, could be activated by depolarization in one protoplast (density: approximately 0.6 micron-2). Acidification from ph 8.1 to 4.4 decreased markedly the whole-cell conductance, GK, of the KD channels, shifted its voltage dependence, GK- EM, to the right on the voltage axis, slowed the rate of activation and increased the rate of deactivation, whereas the single channel conductance was not affected significantly. Based on the GK-EM shifts, the estimated average negative surface charge spacing near the KD channel is 39 A. To quantify the effects of protons on the rates of transitions between the hypothesized conformational states of the channels, we fitted the experimental macroscopic steady state conductance-voltage relationship and the voltage dependence of time constants of activation and deactivation, simultaneously, with a sequential three-state model CCO. In terms of this model, protonation affects the voltage-dependent properties via a decrease in localized, rather than homogeneous, surface charge sensed by the gating moieties. In terms of either the CO or CCO model, the protonation of a site with a pKa of 4.8 decreases the voltage-independent number of channels, N, that are available for activation by depolarization. PMID:8035163

  6. Evaluation of beam divergence of a negative hydrogen ion beam using Doppler shift spectroscopy diagnostics

    NASA Astrophysics Data System (ADS)

    Deka, A. J.; Bharathi, P.; Pandya, K.; Bandyopadhyay, M.; Bhuyan, M.; Yadav, R. K.; Tyagi, H.; Gahlaut, A.; Chakraborty, A.

    2018-01-01

    The Doppler Shift Spectroscopy (DSS) diagnostic is in the conceptual stage to estimate beam divergence, stripping losses, and beam uniformity of the 100 keV hydrogen Diagnostics Neutral Beam of International Thermonuclear Experimental Reactor. This DSS diagnostic is used to measure the above-mentioned parameters with an error of less than 10%. To aid the design calculations and to establish a methodology for estimation of the beam divergence, DSS measurements were carried out on the existing prototype ion source RF Operated Beam Source in India for Negative ion Research. Emissions of the fast-excited neutrals that are generated from the extracted negative ions were collected in the target tank, and the line broadening of these emissions were used for estimating beam divergence. The observed broadening is a convolution of broadenings due to beam divergence, collection optics, voltage ripple, beam focusing, and instrumental broadening. Hence, for estimating the beam divergence from the observed line broadening, a systematic line profile analysis was performed. To minimize the error in the divergence measurements, a study on error propagation in the beam divergence measurements was carried out and the error was estimated. The measurements of beam divergence were done at a constant RF power of 50 kW and a source pressure of 0.6 Pa by varying the extraction voltage from 4 kV to10 kV and the acceleration voltage from 10 kV to 15 kV. These measurements were then compared with the calorimetric divergence, and the results seemed to agree within 10%. A minimum beam divergence of ˜3° was obtained when the source was operated at an extraction voltage of ˜5 kV and at a ˜10 kV acceleration voltage, i.e., at a total applied voltage of 15 kV. This is in agreement with the values reported in experiments carried out on similar sources elsewhere.

  7. The electrical performance and gate bias stability of an amorphous InGaZnO thin-film transistor with HfO2 high-k dielectrics

    NASA Astrophysics Data System (ADS)

    Wang, Ruo Zheng; Wu, Sheng Li; Li, Xin Yu; Zhang, Jin Tao

    2017-07-01

    In this study, we set out to fabricate an amorphous indium gallium zinc oxide (a-IGZO) thin-film transistor (TFT) with SiNx/HfO2/SiNx (SHS) sandwiched dielectrics. The J-V and C-V of this SHS film were extracted by the Au/p-Si/SHS/Ti structure. At room temperature the a-IGZO with SHS dielectrics showed the following electrical properties: a threshold voltage of 2.9 V, a subthreshold slope of 0.35 V/decade, an on/off current ratio of 3.5 × 107, and a mobility of 12.8 cm2 V-1 s-1. Finally, we tested the influence of gate bias stress on the TFT, and the result showed that the threshold voltage shifted to a positive voltage when applying a positive gate voltage to the TFT.

  8. Technique for enhancing the power output of an electrostatic generator employing parametric resonance

    DOEpatents

    Post, Richard F.

    2016-02-23

    A circuit-based technique enhances the power output of electrostatic generators employing an array of axially oriented rods or tubes or azimuthal corrugated metal surfaces for their electrodes. During generator operation, the peak voltage across the electrodes occurs at an azimuthal position that is intermediate between the position of minimum gap and maximum gap. If this position is also close to the azimuthal angle where the rate of change of capacity is a maximum, then the highest rf power output possible for a given maximum allowable voltage at the minimum gap can be attained. This rf power output is then coupled to the generator load through a coupling condenser that prevents suppression of the dc charging potential by conduction through the load. Optimized circuit values produce phase shifts in the rf output voltage that allow higher power output to occur at the same voltage limit at the minimum gap position.

  9. Phosphatidic acid modulation of Kv channel voltage sensor function.

    PubMed

    Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick

    2014-10-06

    Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid.

  10. Investigation of the novel attributes in double recessed gate SiC MESFETs at drain side

    NASA Astrophysics Data System (ADS)

    Orouji, Ali A.; Razavi, S. M.; Ebrahim Hosseini, Seyed; Amini Moghadam, Hamid

    2011-11-01

    In this paper, the potential impact of drain side-double recessed gate (DS-DRG) on silicon carbide (SiC)-based metal semiconductor field effect transistors (MESFETs) is studied. We investigate the device performance focusing on breakdown voltage, threshold voltage, drain current and dc output conductance with two-dimensional and two-carrier device simulation. Our simulation results demonstrate that the channel thickness under the gate in the drain side is an important factor in the breakdown voltage. Also, the positive shift in the threshold voltage for the DS-DRG structure is larger in comparison with that for the source side-double recessed gate (SS-DRG) SiC MESFET. The saturated drain current for the DS-DRG structure is larger compared to that for the SS-DRG structure. The maximum dc output conductance in the DS-DRG structure is smaller than that in the SS-DRG structure.

  11. Development of a digital solar simulator based on full-bridge converter

    NASA Astrophysics Data System (ADS)

    Liu, Chen; Feng, Jian; Liu, Zhilong; Tong, Weichao; Ji, Yibo

    2014-02-01

    With the development of solar photovoltaic, distribution schemes utilized in power grid had been commonly application, and photovoltaic (PV) inverter is an essential equipment in grid. In this paper, a digital solar simulator based on full-bridge structure is presented. The output characteristic curve of system is electrically similar to silicon solar cells, which can greatly simplify research methods of PV inverter, improve the efficiency of research and development. The proposed simulator consists on a main control board based on TM320F28335, phase-shifted zero-voltage-switching (ZVS) DC-DC full-bridge converter and voltage and current sampling circuit, that allows emulating the voltage-current curve with the open-circuit voltage (Voc) of 900V and the short-circuit current (Isc) of 18A .When the system connected to a PV inverter, the inverter can quickly track from the open-circuit to the maximum power point and keep stability.

  12. Spectral shape deformation in inverse spin Hall voltage in Y{sub 3}Fe{sub 5}O{sub 12}|Pt bilayers at high microwave power levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lustikova, J., E-mail: lustikova@imr.tohoku.ac.jp; Shiomi, Y.; Handa, Y.

    2015-02-21

    We report on the deformation of microwave absorption spectra and of the inverse spin Hall voltage signals in thin film bilayers of yttrium iron garnet (YIG) and platinum at high microwave power levels in a 9.45-GHz TE{sub 011} cavity. As the microwave power increases from 0.15 to 200 mW, the resonance field shifts to higher values, and the initially Lorentzian spectra of the microwave absorption intensity as well as the inverse spin Hall voltage signals become asymmetric. The contributions from opening of the magnetization precession cone and heating of YIG cannot well reproduce the data. Control measurements of inverse spinmore » Hall voltages on thin-film YIG|Pt systems with a range of line widths underscore the role of spin-wave excitations in spectral deformation.« less

  13. Advanced p-MOSFET Ionizing-Radiation Dosimeter

    NASA Technical Reports Server (NTRS)

    Buehler, Martin G.; Blaes, Brent R.

    1994-01-01

    Circuit measures total dose of ionizing radiation in terms of shift in threshold gate voltage of doped-channel metal oxide/semiconductor field-effect transistor (p-MOSFET). Drain current set at temperature-independent point to increase accuracy in determination of radiation dose.

  14. Experimental investigation on On-Off current ratio behavior near onset voltage for a pentacene based organic thin film transistor

    NASA Astrophysics Data System (ADS)

    Amrani, Aumeur El; Es-saghiri, Abdeljabbar; Boufounas, El-Mahjoub; Lucas, Bruno

    2018-06-01

    The performance of a pentacene based organic thin film transistor (OTFT) with polymethylmethacrylate as a dielectric insulator and indium tin oxide based electrical gate is investigated. On the one hand, we showed that the threshold voltage increases with gate voltage, and on the other hand that it decreases with drain voltage. Thus, we noticed that the onset voltage shifts toward positive voltage values with the drain voltage increase. In addition, threshold-onset differential voltage (TODV) is proposed as an original approach to estimate an averaged carrier density in pentacene. Indeed, a value of about 4.5 × 1016 cm-3 is reached at relatively high gate voltage of -50 V; this value is in good agreement with that reported in literature with other technique measurements. However, at a low applied gate voltage, the averaged pentacene carrier density remains two orders of magnitude lower; it is of about 2.8 × 1014 cm-3 and remains similar to that obtained from space charge limited current approach for low applied bias voltage of about 2.2 × 1014 cm-3. Furthermore, high IOn/IOff and IOn/IOnset current ratios of 5 × 106 and 7.5 × 107 are reported for lower drain voltage, respectively. The investigated OTFTs also showed good electrical performance including carrier mobility increasing with gate voltage; mobility values of 4.5 × 10-2 cm2 V-1 s-1 and of 4.25 × 10-2 cm2 V-1 s-1 are reached for linear and saturation regimes, respectively. These results remain enough interesting since current modulation ratio exceeds a value of 107 that is a quite important requirement than high mobility for some particular logic gate applications.

  15. Effects of the β1 auxiliary subunit on modification of Rat Na{sub v}1.6 sodium channels expressed in HEK293 cells by the pyrethroid insecticides tefluthrin and deltamethrin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Bingjun; Soderlund, David M., E-mail: dms6@cornell.edu

    We expressed rat Na{sub v}1.6 sodium channels with or without the rat β1 subunit in human embryonic kidney (HEK293) cells and evaluated the effects of the pyrethroid insecticides tefluthrin and deltamethrin on whole-cell sodium currents. In assays with the Na{sub v}1.6 α subunit alone, both pyrethroids prolonged channel inactivation and deactivation and shifted the voltage dependence of channel activation and steady-state inactivation toward hyperpolarization. Maximal shifts in activation were ~ 18 mV for tefluthrin and ~ 24 mV for deltamethrin. These compounds also caused hyperpolarizing shifts of ~ 10–14 mV in the voltage dependence of steady-state inactivation and increased inmore » the fraction of sodium current that was resistant to inactivation. The effects of pyrethroids on the voltage-dependent gating greatly increased the size of sodium window currents compared to unmodified channels; modified channels exhibited increased probability of spontaneous opening at membrane potentials more negative than the normal threshold for channel activation and incomplete channel inactivation. Coexpression of Na{sub v}1.6 with the β1 subunit had no effect on the kinetic behavior of pyrethroid-modified channels but had divergent effects on the voltage-dependent gating of tefluthrin- or deltamethrin-modified channels, increasing the size of tefluthrin-induced window currents but decreasing the size of corresponding deltamethrin-induced currents. Unexpectedly, the β1 subunit did not confer sensitivity to use-dependent channel modification by either tefluthrin or deltamethrin. We conclude from these results that functional reconstitution of channels in vitro requires careful attention to the subunit composition of channel complexes to ensure that channels in vitro are faithful functional and pharmacological models of channels in neurons. - Highlights: • We expressed Na{sub v}1.6 sodium channels with or without β1 subunits in HEK293 cells. • Tefluthrin and deltamethrin shifted channel gating to hyperpolarized potentials. • The β1 subunit had opposite effects on the actions of tefluthrin and deltamethrin. • Auxiliary subunits are required for full reconstitution of channel function. • Channels in HEK293 cells exhibit properties similar to channels in neurons.« less

  16. Analog circuit for controlling acoustic transducer arrays

    DOEpatents

    Drumheller, Douglas S.

    1991-01-01

    A simplified ananlog circuit is presented for controlling electromechanical transducer pairs in an acoustic telemetry system. The analog circuit of this invention comprises a single electrical resistor which replaces all of the digital components in a known digital circuit. In accordance with this invention, a first transducer in a transducer pair of array is driven in series with the resistor. The voltage drop across this resistor is then amplified and used to drive the second transducer. The voltage drop across the resistor is proportional and in phase with the current to the transducer. This current is approximately 90 degrees out of phase with the driving voltage to the transducer. This phase shift replaces the digital delay required by the digital control circuit of the prior art.

  17. An inductor-based converter with EMI reduction for low-voltage thermoelectric energy harvesting

    NASA Astrophysics Data System (ADS)

    Wang, Chuang; Zhao, Kai; Li, Zunchao

    2017-07-01

    This paper presents a self-powered inductor-based converter which harvests thermoelectric energy and boosts extremely low voltage to a typical voltage level for supplying body sensor nodes. Electromagnetic interference (EMI) of the converter is reduced by spreading spectrum of fundamental frequency and harmonics via pseudo-random modulation, which is obtained via combining the linear feedback shift register and digitally controlled oscillator. Besides, the methods, namely extracting energy near MPP and reducing the power dissipation, are employed to improve the power efficiency. The presented inductor-based converter is designed and verified in CSMC CMOS 0.18-µm 1P6M process. The results reveal that it achieves the high efficiency and EMI reduction at the same time.

  18. Transport Signatures of Quasiparticle Poisoning in a Majorana Island.

    PubMed

    Albrecht, S M; Hansen, E B; Higginbotham, A P; Kuemmeth, F; Jespersen, T S; Nygård, J; Krogstrup, P; Danon, J; Flensberg, K; Marcus, C M

    2017-03-31

    We investigate effects of quasiparticle poisoning in a Majorana island with strong tunnel coupling to normal-metal leads. In addition to the main Coulomb blockade diamonds, "shadow" diamonds appear, shifted by 1e in gate voltage, consistent with transport through an excited (poisoned) state of the island. Comparison to a simple model yields an estimate of parity lifetime for the strongly coupled island (∼1  μs) and sets a bound for a weakly coupled island (>10  μs). Fluctuations in the gate-voltage spacing of Coulomb peaks at high field, reflecting Majorana hybridization, are enhanced by the reduced lever arm at strong coupling. When converted from gate voltage to energy units, fluctuations are consistent with previous measurements.

  19. Annealing effects on the chemical deposited CdS films and the electrical properties of CdS/CdTe solar cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Junfeng; Institute of Materials Science, Darmstadt University of Technology, Petersenstr. 23, 64287 Darmstadt; Liao, Cheng, E-mail: Cliao@pku.edu.cn

    2011-02-15

    Graphical abstract: From XPS core level spectras, compared with as-depositing CdS (sample A), the Fermi level is shifting closer to the conduction band after annealing treatment in the oxygen (sample B) while it is shifting closer to the valence band after annealing treatment in the argon-hydrogen (sample C). That might be the main reason of the different performance of the final devices. The open circuit voltage of the CdS/CdTe solar cell increases when the CBD CdS is annealed with oxygen, while the performance of the solar cell decreases when the CBD CdS is annealed with argon-hydrogen. Research highlights: {yields} Twomore » different methods (oxidation and reduction) were used to anneal CdS films for CdTe solar cells. {yields} Electrical properties were analyzed by XPS (Fermi levels of CdS films). {yields} Annealing treatment in oxidation atmosphere could shift Fermi level of CdS film to higher position and consequently improve the CdS/CdTe junction and performance of solar cells. -- Abstract: CdS layers grown by chemical bath deposition (CBD) are annealed in the oxygen and argon-hydrogen atmosphere respectively. It has been found that the open circuit voltage of the CdS/CdTe solar cell increases when the CBD CdS is annealed with oxygen before the deposition of CdTe by close spaced sublimation (CSS), while the performance of the solar cell decreases when the CBD CdS is annealed with argon-hydrogen. Electronic properties of the CdS films are investigated using X-ray photo-electron spectroscopy (XPS), which indicates that the Fermi level is shifting closer to the conduction band after annealing in the oxygen and consequently a higher open circuit voltage of the solar cell can be obtained.« less

  20. Computer-aided design comparisons of monolithic and hybrid MEM-tunable VCSELs

    NASA Astrophysics Data System (ADS)

    Ochoa, Edward M.; Nelson, Thomas R., Jr.; Blum-Spahn, Olga; Lott, James A.

    2003-07-01

    We report and use our micro-electro-mechanically tunable vertical cavity surface emitting laser (MEM-TVCSEL) computer-aided design methodology to investigate the resonant frequency design space for monolithic and hybrid MEM-TVCSELs. For various initial optical air gap thickness, we examine the sensitivity of monolithic or hybrid MEM-TVCSEL resonant frequency by simulating zero, two, and four percent variations in III-V material growth thickness. As expected, as initial optical airgap increases, tuning range decreases due to less coupling between the active region and the tuning mirror. However, each design has different resonant frequency sensitivity to variations in III-V growth parameters. In particular, since the monolithic design is comprised of III-V material, the shift in all growth thicknesses significantly shifts the resonant frequency response. However, for hybrid MEMTVCSELs, less shift results, since the lower reflector is an Au mirror with reflectivity independent of III-V growth variations. Finally, since the hybrid design is comprised of a MUMPS polysilicon mechanical actuator, pull-in voltage remains independent of the initial optical airgap between the tuning reflector and the III-V material. Conversely, as the initial airgap increases in the monolithic design, the pull-in voltage significantly increases.

  1. Charge injection from gate electrode by simultaneous stress of optical and electrical biases in HfInZnO amorphous oxide thin film transistor

    NASA Astrophysics Data System (ADS)

    Kwon, Dae Woong; Kim, Jang Hyun; Chang, Ji Soo; Kim, Sang Wan; Sun, Min-Chul; Kim, Garam; Kim, Hyun Woo; Park, Jae Chul; Song, Ihun; Kim, Chang Jung; Jung, U. In; Park, Byung-Gook

    2010-11-01

    A comprehensive study is done regarding stabilities under simultaneous stress of light and dc-bias in amorphous hafnium-indium-zinc-oxide thin film transistors. The positive threshold voltage (Vth) shift is observed after negative gate bias and light stress, and it is completely different from widely accepted phenomenon which explains that negative-bias stress results in Vth shift in the left direction by bias-induced hole-trapping. Gate current measurement is performed to explain the unusual positive Vth shift under simultaneous application of light and negative gate bias. As a result, it is clearly found that the positive Vth shift is derived from electron injection from gate electrode to gate insulator.

  2. Transmembrane potential measurements on plant cells using the voltage-sensitive dye ANNINE-6.

    PubMed

    Flickinger, Bianca; Berghöfer, Thomas; Hohenberger, Petra; Eing, Christian; Frey, Wolfgang

    2010-11-01

    The charging of the plasma membrane is a necessary condition for the generation of an electric-field-induced permeability increase of the plasmalemma, which is usually explained by the creation and the growth of aqueous pores. For cells suspended in physiological buffers, the time domain of membrane charging is in the submicrosecond range. Systematic measurements using Nicotiana tabacum L. cv. Bright Yellow 2 (BY-2) protoplasts stained with the fast voltage-sensitive fluorescence dye ANNINE-6 have been performed using a pulsed laser fluorescence microscopy setup with a time resolution of 5 ns. A clear saturation of the membrane voltage could be measured, caused by a strong membrane permeability increase, commonly explained by enhanced pore formation, which prevents further membrane charging by external electric field exposure. The field strength dependence of the protoplast's transmembrane potential V (M) shows strong asymmetric saturation characteristics due to the high resting potential of the plants plasmalemma. At the pole of the hyperpolarized hemisphere of the cell, saturation starts at an external field strength of 0.3 kV/cm, resulting in a measured transmembrane voltage shift of ∆V(M) = -150 mV, while on the cathodic (depolarized) cell pole, the threshold for enhanced pore formation is reached at a field strength of approximately 1.0 kV/cm and ∆V(M) = 450 mV, respectively. From this asymmetry of the measured maximum membrane voltage shifts, the resting potential of BY-2 protoplasts at the given experimental conditions can be determined to V(R) = -150 mV. Consequently, a strong membrane permeability increase occurs when the membrane voltage diverges |V(M)| = 300 mV from the resting potential of the protoplast. The largest membrane voltage change at a given external electric field occurs at the cell poles. The azimuthal dependence of the transmembrane potential, measured in angular intervals of 10° along the circumference of the cell, shows a flattening and a slight decrease at higher fields at the pole region due to enhanced pore formation. Additionally, at the hyperpolarized cell pole, a polarization reversal could be observed at an external field range around 1.0 kV/cm. This behavior might be attributed to a fast charge transfer through the membrane at the hyperpolarized pole, e.g., by voltage-gated channels.

  3. Upsets in Erased Floating Gate Cells With High-Energy Protons

    DOE PAGES

    Gerardin, S.; Bagatin, M.; Paccagnella, A.; ...

    2017-01-01

    We discuss upsets in erased floating gate cells, due to large threshold voltage shifts, using statistical distributions collected on a large number of memory cells. The spread in the neutral threshold voltage appears to be too low to quantitatively explain the experimental observations in terms of simple charge loss, at least in SLC devices. The possibility that memories exposed to high energy protons and heavy ions exhibit negative charge transfer between programmed and erased cells is investigated, although the analysis does not provide conclusive support to this hypothesis.

  4. A Microwave Tunable Bandpass Filter for Liquid Crystal Applications

    NASA Astrophysics Data System (ADS)

    Cao, Weiping; Jiang, Di; Liu, Yupeng; Yang, Yuanwang; Gan, Baichuan

    2017-07-01

    In this paper, a novel microwave continuously tunable band-pass filter, based on nematic liquid crystals (LCs), is proposed. It uses liquid crystal (LC) as the electro-optic material to mainly realize frequency shift at microwave band by changing the dielectric anisotropy, when applying the bias voltage. According to simulation results, it achieves 840 MHz offset. Comparing to the existing tunable filter, it has many advantages, such as continuously tunable, miniaturization, low processing costs, low tuning voltage, etc. Thus, it has shown great potentials in frequency domain and practical applications in modern communication.

  5. Nanowire Photonic Systems

    DTIC Science & Technology

    2009-12-22

    b) From top to bottom, (i) AFM topograph of the p-i-n SiNW, (ii) plot of EFM phase-shift vs . position recorded along the nanowire axis and (iii...c) Current vs . applied voltage curve for a typical SiNW p-i-n junction at room temperature. (d) Current vs . applied reverse voltage data of a p-i...incident laser power. Iph vs . laser power (Figure 3c) measured at 22, 20 and 18 V show linear dependences with slopes of 1.16, 0.94 and 0.72 nA/μW

  6. Ion trap device

    DOEpatents

    Ibrahim, Yehia M.; Smith, Richard D.

    2016-01-26

    An ion trap device is disclosed. The device includes a series of electrodes that define an ion flow path. A radio frequency (RF) field is applied to the series of electrodes such that each electrode is phase shifted approximately 180 degrees from an adjacent electrode. A DC voltage is superimposed with the RF field to create a DC gradient to drive ions in the direction of the gradient. A second RF field or DC voltage is applied to selectively trap and release the ions from the device. Further, the device may be gridless and utilized at high pressure.

  7. Effect of Photogenerated Carriers on Ferroelectric Polarization Reversal

    NASA Astrophysics Data System (ADS)

    Weis, Martin; Li, Jun; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa

    2011-12-01

    Three non-symmetric switching peaks were observed in current-voltage (J-V) characteristic of the pentacene/poly(vinylidene fluoride-trifluoroethylene) double-layer device. However, upon illumination only two symmetric switching peaks appeared during the same J-V measurement. The similar difference between dark and illumination were also obtained in capacitance-voltage characteristics. These results showed the strong influence of internal fields by photogenerated carriers, which modifies the polarization reversal process of ferroelectric layer. The gradual shift of the polarization reversal with increase of illumination intensity is assigned to the space-charge field of trapped electrons.

  8. An alternating voltage battery with two salt-water oscillators

    NASA Astrophysics Data System (ADS)

    Cervellati, Rinaldo; Soldà, Roberto

    2001-05-01

    We built a simple alternating voltage battery that periodically reverses value and sign of its electromotive force (emf). This battery consists of two coupled concentration salt-water oscillators that are phase shifted by initially extracting some drops of salt solution from one of the two oscillators. Although the actual frequency (period: ˜30 s) and emf (˜±55 mV) is low, our battery is suitable to demonstrate a practical application of oscillating systems in the physical, chemical, or biological laboratory for undergraduates. Interpretation of the phenomenon is given.

  9. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    NASA Astrophysics Data System (ADS)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  10. Tuning the threshold voltage of carbon nanotube transistors by n-type molecular doping for robust and flexible complementary circuits

    PubMed Central

    Wang, Huiliang; Wei, Peng; Li, Yaoxuan; Han, Jeff; Lee, Hye Ryoung; Naab, Benjamin D.; Liu, Nan; Wang, Chenggong; Adijanto, Eric; Tee, Benjamin C.-K.; Morishita, Satoshi; Li, Qiaochu; Gao, Yongli; Cui, Yi; Bao, Zhenan

    2014-01-01

    Tuning the threshold voltage of a transistor is crucial for realizing robust digital circuits. For silicon transistors, the threshold voltage can be accurately controlled by doping. However, it remains challenging to tune the threshold voltage of single-wall nanotube (SWNT) thin-film transistors. Here, we report a facile method to controllably n-dope SWNTs using 1H-benzoimidazole derivatives processed via either solution coating or vacuum deposition. The threshold voltages of our polythiophene-sorted SWNT thin-film transistors can be tuned accurately and continuously over a wide range. Photoelectron spectroscopy measurements confirmed that the SWNT Fermi level shifted to the conduction band edge with increasing doping concentration. Using this doping approach, we proceeded to fabricate SWNT complementary inverters by inkjet printing of the dopants. We observed an unprecedented noise margin of 28 V at VDD = 80 V (70% of 1/2VDD) and a gain of 85. Additionally, robust SWNT complementary metal−oxide−semiconductor inverter (noise margin 72% of 1/2VDD) and logic gates with rail-to-rail output voltage swing and subnanowatt power consumption were fabricated onto a highly flexible substrate. PMID:24639537

  11. Sodium channel dysfunction in intractable childhood epilepsy with generalized tonic–clonic seizures

    PubMed Central

    Rhodes, Thomas H; Vanoye, Carlos G; Ohmori, Iori; Ogiwara, Ikuo; Yamakawa, Kazuhiro; George, Alfred L

    2005-01-01

    Mutations in SCN1A, the gene encoding the brain voltage-gated sodium channel α1 subunit (NaV1.1), are associated with genetic forms of epilepsy, including generalized epilepsy with febrile seizures plus (GEFS+ type 2), severe myoclonic epilepsy of infancy (SMEI) and related conditions. Several missense SCN1A mutations have been identified in probands affected by the syndrome of intractable childhood epilepsy with generalized tonic–clonic seizures (ICEGTC), which bears similarity to SMEI. To test whether ICEGTC arises from molecular mechanisms similar to those involved in SMEI, we characterized eight ICEGTC missense mutations by whole-cell patch clamp recording of recombinant human SCN1A heterologously expressed in cultured mammalian cells. Two mutations (G979R and T1709I) were non-functional. The remaining alleles (T808S, V983A, N1011I, V1611F, P1632S and F1808L) exhibited measurable sodium current, but had heterogeneous biophysical phenotypes. Mutant channels exhibited lower (V983A, N1011I and F1808L), greater (T808S) or similar (V1611F and P1632S) peak sodium current densities compared with wild-type (WT) SCN1A. Three mutations (V1611F, P1632S and F1808L) displayed hyperpolarized conductance–voltage relationships, while V983A exhibited a strong depolarizing shift in the voltage dependence of activation. All mutants except T808S had hyperpolarized shifts in the voltage dependence of steady-state channel availability. Three mutants (V1611F, P1632S and F1808L) exhibited persistent sodium current ranging from ∼1–3% of peak current amplitude that was significantly greater than WT-SCN1A. Several mutants had impaired slow inactivation, with V983A showing the most prominent effect. Finally, all of the functional alleles exhibited reduced use-dependent channel inhibition. In summary, SCN1A mutations associated with ICEGTC result in a wide spectrum of biophysical defects, including mild-to-moderate gating impairments, shifted voltage dependence and reduced use dependence. The constellation of biophysical abnormalities for some mutants is distinct from those previously observed for GEFS+ and SMEI, suggesting possible, but complex, genotype–phenotype correlations. PMID:16210358

  12. Positions of the cytoplasmic end of BK α S0 helix relative to S1–S6 and of β1 TM1 and TM2 relative to S0–S6

    PubMed Central

    Liu, Guoxia; Zakharov, Sergey I.; Yao, Yongneng

    2015-01-01

    The large-conductance, voltage- and Ca2+-gated K+ (BK) channel consists of four α subunits, which form a voltage- and Ca2+-gated channel, and up to four modulatory β subunits. The β1 subunit is expressed in smooth muscle, where it slows BK channel kinetics and shifts the conductance–voltage (G-V) curve to the left at [Ca2+] > 2 µM. In addition to the six transmembrane (TM) helices, S1–S6, conserved in all voltage-dependent K+ channels, BK α has a unique seventh TM helix, S0, which may contribute to the unusual rightward shift in the G-V curve of BK α in the absence of β1 and to a leftward shift in its presence. Such a role is supported by the close proximity of S0 to S3 and S4 in the voltage-sensing domain. Furthermore, on the extracellular side of the membrane, one of the two TM helices of β1, TM2, is adjacent to S0. We have now analyzed induced disulfide bond formation between substituted Cys residues on the cytoplasmic side of the membrane. There, in contrast, S0 is closest to the S2–S3 loop, from which position it is displaced on the addition of β1. The cytoplasmic ends of β1 TM1 and TM2 are adjacent and are located between the S2–S3 loop of one α subunit and S1 of a neighboring α subunit and are not adjacent to S0; i.e., S0 and TM2 have different trajectories through the membrane. In the absence of β1, 70% of disulfide bonding of W43C (S0) and L175C (S2–S3) has no effect on V50 for activation, implying that the cytoplasmic end of S0 and the S2–S3 loop move in concert, if at all, during activation. Otherwise, linking them together in one state would obstruct the transition to the other state, which would certainly change V50. PMID:25667410

  13. Ionic currents in the guinea-pig taenia coli.

    PubMed Central

    Inomata, H; Kao, C Y

    1976-01-01

    Short segments of portions of taenia coli of the guinea-pig averaging 54 mum X 219 mum X ca. 200 mum have been studied by a double sucrose-gap voltage-clamp technique. 2. The average total capacitance was 0-4 muF, corresponding to approximately 10(4) cells, if a specific membrane capacitance of 3 muF/cm2 were assumed. 3. A significant resistance, averaging 11-4omega, was in series with the membrane, and seriously limited the accuracy of the voltage control possible. 4. On depolarization, an early transient inward current was followed by a late maintained outwary current. 5. The late current was carried mainly by K+, because its direction could be reversed if the preparation were first depolarized in isotonic K2SO4 and held back to the original resting potential. 6. After appropriate corrections for residual capacitative and leakage currents, a reversal potential for the late current (Eb) was determined to be 15-20 mV more negative than the natural resting potential. It was not affected by the amplitude or the duration of the activating voltage step, but could be changed by prolonged applications of holding current. 7. At rest, the ratio of PNa:PK was 0-16:1; for Eb it was 0-05:1. 8. The reversal potential for the transient early inward current (Ea) averaged 22 mV in Krebs-bicarbonate solution, but was shifted to about 35 mV when the late current was first suppressed with tetraethylammonium ion. The shift suggested that there was some overlap of the early and late currents. 9. Reduction of [Na+]o to 50% of normal, or replacement of all Na+ with dimethyldiethanol ammonium ion and choline ion, failed to cause any significant shifts in the reversal potential of the early current or reduce the magnitude of the early current. 10. Reduction of [Ca2+]o to 0-25 or 0-1 of the normal caused shifts of the Ea toward the negative and reductions in the early current. These changes can occur without changes in the maximum chord conductance of the early current, such as might happen in ordinary Krebs-bicarbonate solution, or in preparations which had been depolarized by prior treatment with isotonic K2SO4 and then held back to the original membrane voltage. 11. Increase of [Ca2+]o to 5 times normal increased the early inward current, and the maximum chord conductances of the early and late currents, but did not shift the Ea. 12. In preparations pretreated with TEA, increasing [Ca2+]o to 5 times normal shifted Ea toward 45 mV. 13. The various observations are interpreted to mean that the early current in the taenia coli is carried principally by influx of Ca2+, and not by Na+. PMID:1255524

  14. Surface and Interface Chemistry for Gate Stacks on Silicon

    NASA Astrophysics Data System (ADS)

    Frank, M. M.; Chabal, Y. J.

    This chapter addresses the fundamental silicon surface science associated with the continued progress of nanoelectronics along the path prescribed by Moore's law. Focus is on hydrogen passivation layers and on ultrathin oxide films encountered during silicon cleaning and gate stack formation in the fabrication of metal-oxide-semiconductor field-effect transistors (MOSFETs). Three main topics are addressed. (i) First, the current practices and understanding of silicon cleaning in aqueous solutions are reviewed, including oxidizing chemistries and cleans leading to a hydrogen passivation layer. The dependence of the final surface termination and morphology/roughness on reactant choice and pH and the influence of impurities such as dissolved oxygen or metal ions are discussed. (ii) Next, the stability of hydrogen-terminated silicon in oxidizing liquid and gas phase environments is considered. In particular, the remarkable stability of hydrogen-terminated silicon surface in pure water vapor is discussed in the context of atomic layer deposition (ALD) of high-permittivity (high-k) gate dielectrics where water is often used as an oxygen precursor. Evidence is also provided for co-operative action between oxygen and water vapor that accelerates surface oxidation in humid air. (iii) Finally, the fabrication of hafnium-, zirconium- and aluminum-based high-k gate stacks is described, focusing on the continued importance of the silicon/silicon oxide interface. This includes a review of silicon surface preparation by wet or gas phase processing and its impact on high-k nucleation during ALD growth, and the consideration of gate stack capacitance and carrier mobility. In conclusion, two issues are highlighted: the impact of oxygen vacancies on the electrical characteristics of high-k MOS devices, and the way alloyed metal ions (such as Al in Hf-based gate stacks) in contact with the interfacial silicon oxide layer can be used to control flatband and threshold voltages.

  15. Origin of the transition voltage in gold-vacuum-gold atomic junctions.

    PubMed

    Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin

    2013-01-18

    The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments.

  16. Microstructure of a-C:H films prepared on a microtrench and analysis of ions and radicals behavior

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hirata, Yuki; Choi, Junho, E-mail: choi@mech.t.u-tokyo.ac.jp

    2015-08-28

    Amorphous carbon films (a-C:H) were prepared on a microtrench (4-μm pitch and 4-μm depth), and the uniformity of film thickness and microstructure of the films on the top, sidewall, and bottom surfaces of the microtrench were evaluated by scanning electron microscopy and Raman spectroscopy. The a-C:H films were prepared by bipolar-type plasma based ion implantation and deposition (bipolar PBII&D), and the negative pulse voltage, which is the main parameter dominating the film structure, was changed from −1.0 to −15 kV. Moreover, the behavior of ions and radicals was analyzed simultaneously by combining the calculation methods of Particle-In-Cell/Monte Carlo Collision (PIC-MCC) andmore » Direct Simulation Monte Carlo (DSMC) to investigate the coating mechanism for the microtrench. The results reveal that the thickness uniformity of a-C:H films improves with decreasing negative pulse voltage due to the decreasing inertia of incoming ions from the trench mouth, although the film thickness on the sidewall tends to be much smaller than that on the top and bottom surfaces of the trench. The normalized flux and the film thickness show similar behavior, i.e., the normalized flux or thickness at the bottom surface increases at low negative pulse voltages and then saturates at a certain value, whereas at the sidewall it monotonically decreases with increasing negative voltage. The microstructure of a-C:H films on the sidewall surface is very different from that on the top and bottom surfaces. The film structure at a low negative pulse voltage shifts to more of a polymer-like carbon (PLC) structure due to the lower incident energy of ions. Although the radical flux on the sidewall increases slightly, the overall film structure is not significantly changed because this film formation at a low negative voltage is originally dominated by radicals. On the other hand, the flux of radicals is dominant on the sidewall in the case of high negative pulse voltage, resulting in a deviation from the Raman behavior of a-C:H films deposited by bipolar PBII&D. This tendency intensifies as the negative voltage becomes greater. Also, the energy of incident ions on the sidewall of the trench increases with increasing negative voltage, which causes a shift in the Raman data of the sidewall to the bottom right corner on the figure depicting the relationship of the FWHM(G) and the G-peak position, indicating increased graphitization of a-C:H film.« less

  17. Microstructure of a-C:H films prepared on a microtrench and analysis of ions and radicals behavior

    NASA Astrophysics Data System (ADS)

    Hirata, Yuki; Choi, Junho

    2015-08-01

    Amorphous carbon films (a-C:H) were prepared on a microtrench (4-μm pitch and 4-μm depth), and the uniformity of film thickness and microstructure of the films on the top, sidewall, and bottom surfaces of the microtrench were evaluated by scanning electron microscopy and Raman spectroscopy. The a-C:H films were prepared by bipolar-type plasma based ion implantation and deposition (bipolar PBII&D), and the negative pulse voltage, which is the main parameter dominating the film structure, was changed from -1.0 to -15 kV. Moreover, the behavior of ions and radicals was analyzed simultaneously by combining the calculation methods of Particle-In-Cell/Monte Carlo Collision (PIC-MCC) and Direct Simulation Monte Carlo (DSMC) to investigate the coating mechanism for the microtrench. The results reveal that the thickness uniformity of a-C:H films improves with decreasing negative pulse voltage due to the decreasing inertia of incoming ions from the trench mouth, although the film thickness on the sidewall tends to be much smaller than that on the top and bottom surfaces of the trench. The normalized flux and the film thickness show similar behavior, i.e., the normalized flux or thickness at the bottom surface increases at low negative pulse voltages and then saturates at a certain value, whereas at the sidewall it monotonically decreases with increasing negative voltage. The microstructure of a-C:H films on the sidewall surface is very different from that on the top and bottom surfaces. The film structure at a low negative pulse voltage shifts to more of a polymer-like carbon (PLC) structure due to the lower incident energy of ions. Although the radical flux on the sidewall increases slightly, the overall film structure is not significantly changed because this film formation at a low negative voltage is originally dominated by radicals. On the other hand, the flux of radicals is dominant on the sidewall in the case of high negative pulse voltage, resulting in a deviation from the Raman behavior of a-C:H films deposited by bipolar PBII&D. This tendency intensifies as the negative voltage becomes greater. Also, the energy of incident ions on the sidewall of the trench increases with increasing negative voltage, which causes a shift in the Raman data of the sidewall to the bottom right corner on the figure depicting the relationship of the FWHM(G) and the G-peak position, indicating increased graphitization of a-C:H film.

  18. A 6 kV arbitrary waveform generator for the Tevatron Electron Lens

    DOE PAGES

    Pfeffer, H.; Saewert, G.

    2011-11-09

    This paper reports on a 6 kV modulator built and installed at Fermilab to drive the electron gun anode for the Tevatron Electron Lens (TEL). The TEL was built with the intention of shifting the individual (anti)proton bunch tunes to even out the tune spread among all 36 bunches with the desire of improving Tevatron integrated luminosity. This modulator is essentially a 6 kV arbitrary waveform generator that enables the TEL to define the electron beam intensity on a bunch-by-bunch basis. A voltage waveform is constructed having a 7 μs duration that corresponds to the tune shift requirements of amore » 12-bunch (anti)proton beam pulse train. This waveform is played out for any one or all three bunch trains in the Tevatron. The programmed waveform voltages transition to different levels at time intervals corresponding to the 395 ns bunch spacing. In addition, complex voltage waveforms can be played out at a sustained rate of 143 kHz over the full 6 kV output range. This paper describes the novel design of the inductive adder topology employing five transformers. It describes the design aspects that minimize switching losses for this multi-kilovolt, high repetition rate and high duty factor application.« less

  19. Modulation of nano-selenium on tetrodotoxin-sensitive voltage-gated sodium currents in rat dorsal root ganglion neurons.

    PubMed

    Yuan, Huijun; Lan, Tonghan; Lin, Jiarui

    2005-01-01

    Nano-Selenium, a novel Nano technology production, was demonstrated to be useful in medical and scientific researches. Here, we investigated the effects of Nano-Selenium on tetrodotoxin-sensitive (TTX-S) voltage-dependent Na+channels in isolated rat dorsal root ganglion neurons, using whole-cell patch-clamp method. Nano-Selenium irreversibly decreased TTX-S Na+current (INa) in a concentration-dependent manner and shifted the maximum of the current/voltage relationship from -67mV to -52mV, without modifying the threshold potential of the current. Nano-Selenium shifted the steady-state activation and inactivation curves to the left. In the contrast of Na2SeO3, the inhibition effect of 1nM Nano-Se was much stronger. The cell treated with 1nM Na2SeO3firstly, still respond to futher addition of 1nM Nano-Selenium. These results prove Nano-Selenium to be a novel antiagonist, acted within the channel pore, not on or near the exterior surface of the channel protein where it would experience the membrane electric field, which possesses a distinct binding site from Na2SeO3.

  20. Poly-Si TFTs integrated gate driver circuit with charge-sharing structure

    NASA Astrophysics Data System (ADS)

    Chen, Meng; Lei, Jiefeng; Huang, Shengxiang; Liao, Congwei; Deng, Lianwen

    2017-06-01

    A p-type low-temperature poly-Si thin film transistors (LTPS TFTs) integrated gate driver using 2 non-overlapped clocks is proposed. This gate driver features charge-sharing structure to turn off buffer TFT and suppresses voltage feed-through effects. It is analyzed that the conventional gate driver suffers from waveform distortions due to voltage uncertainty of internal nodes for the initial period. The proposed charge-sharing structure also helps to suppress the unexpected pulses during the initialization phases. The proposed gate driver shows a simple circuit, as only 6 TFTs and 1 capacitor are used for single-stage, and the buffer TFT is used for both pulling-down and pulling-up of output electrode. Feasibility of the proposed gate driver is proven through detailed analyses. Investigations show that voltage bootrapping can be maintained once the bootrapping capacitance is larger than 0.8 pF, and pulse of gate driver outputs can be reduced to 5 μs. The proposed gate driver can still function properly with positive {V}{TH} shift within 0.4 V and negative {V}{TH} shift within -1.2 V and it is robust and promising for high-resolution display. Project supported by the Science and Technology Project of Hunan Province, China (No. 2015JC3401)

  1. Abnormal threshold voltage shift under hot carrier stress in Ti1-xNx/HfO2 p-channel metal-oxide-semiconductor field-effect transistors

    NASA Astrophysics Data System (ADS)

    Tsai, Jyun-Yu; Chang, Ting-Chang; Lo, Wen-Hung; Ho, Szu-Han; Chen, Ching-En; Chen, Hua-Mao; Tseng, Tseung-Yuen; Tai, Ya-Hsiang; Cheng, Osbert; Huang, Cheng-Tung

    2013-09-01

    This work investigates the channel hot carrier (CHC) effect in HfO2/Ti1-xNx p-channel metal oxide semiconductor field effect transistors (p-MOSFETs). Generally, the subthreshold swing (S.S.) should increase during CHC stress (CHCS), since interface states will be generated near the drain side under high electric field due to drain voltage (Vd). However, our experimental data indicate that S.S. has no evident change under CHCS, but threshold voltage (Vth) shifts positively. This result can be attributed to hot carrier injected into high-k dielectric near the drain side. Meanwhile, it is surprising that such Vth degradation is not observed in the saturation region during stress. Therefore, drain-induced-barrier-lowering (DIBL) as a result of CHC-induced electron trapping is proposed to explain the different Vth behaviors in the linear and saturation regions. Additionally, the influence of different nitrogen concentrations in HfO2/Ti1-xNx p-MOSFETs on CHCS is also investigated in this work. Since nitrogen diffuses to SiO2/Si interface induced pre-Nit occurring to degrades channel mobility during the annealing process, a device with more nitrogen shows slightly less impact ionization, leading to insignificant charge trapping-induced DIBL behavior.

  2. Combine Flash-Based FPGA TID and Long-Term Retention Reliabilities Through VT Shift

    NASA Astrophysics Data System (ADS)

    Wang, Jih-Jong; Rezzak, Nadia; Dsilva, Durwyn; Xue, Fengliang; Samiee, Salim; Singaraju, Pavan; Jia, James; Nguyen, Victor; Hawley, Frank; Hamdy, Esmat

    2016-08-01

    Reliability test results of data retention and total ionizing dose (TID) in 65 nm Flash-based field programmable gate array (FPGA) are presented. Long-chain inverter design is recommended for reliability evaluation because it is the worst case design for both effects. Based on preliminary test data, both issues are unified and modeled by one natural decay equation. The relative contributions of TID induced threshold-voltage shift and retention mechanisms are evaluated by analyzing test data.

  3. Electro-optic voltage sensor for sensing voltage in an E-field

    DOEpatents

    Davidson, James R.; Crawford, Thomas M.; Seifert, Gary D.

    2002-03-26

    A miniature electro-optic voltage sensor and system capable of accurate operation at high voltages has a sensor body disposed in an E-field. The body receives a source beam of electromagnetic radiation. A polarization beam displacer separates the source light beam into two beams with orthogonal linear polarizations. A wave plate rotates the linear polarization to rotated polarization. A transducer utilizes Pockels electro-optic effect and induces a differential phase shift on the major and minor axes of the rotated polarization in response to the E-field. A prism redirects the beam back through the transducer, wave plate, and polarization beam displacer. The prism also converts the rotated polarization to circular or elliptical polarization. The wave plate rotates the major and minor axes of the circular or elliptical polarization to linear polarization. The polarization beam displacer separates the beam into two beams of orthogonal linear polarization representing the major and minor axes. The system may have a transmitter for producing the beam of electro-magnetic radiation; a detector for converting the two beams into electrical signals; and a signal processor for determining the voltage.

  4. Design and construction of a home-made and cheaper argon arc lamp

    NASA Astrophysics Data System (ADS)

    Sabaeian, Mohammad; Nazari-Tarkarani, Zeinab; Ebrahimzadeh, Azadeh

    2018-05-01

    The authors report on the design and construction of an argon arc lamp which provides noticeably a cheaper instrument for laser and medical applications. Cesium-doped tungsten and pure tungsten rods were used, respectively, for the lamp cathode and anode. To seal the glassy tube, a 50-50 Fe-Ni alloy was successfully used as a medium to attach the tungsten electrodes to the borosilicate glass tube. Starting voltage of the lamp versus the gas pressure, operation voltage-current diagram at various gas pressures, and lamp spectrum in the various pressures were measured. A comparison was made with krypton arc lamp. The lamp operation was satisfactory without any crack or fracture during lightening operation. The results showed that the lamp-lightening threshold voltage depends linearly on the pressure and arc length in such a way that there is an increase in the voltage by raising these two parameters. We have also observed that by increasing the argon pressure, there is a shifting in emission spectrum from the ultraviolet to the visible region. Comparison with krypton arc lamp indicated that argon lamp needs a higher threshold lightening voltage.

  5. Modulation of voltage-gated conductances of retinal horizontal cells by UV-excited TiO2 nanoparticles.

    PubMed

    Meshik, Xenia; Choi, Min; Baker, Adam; Malchow, R Paul; Covnot, Leigha; Doan, Samuel; Mukherjee, Souvik; Farid, Sidra; Dutta, Mitra; Stroscio, Michael A

    2017-04-01

    This study examines the ability of optically-excited titanium dioxide nanoparticles to influence voltage-gated ion channels in retinal horizontal cells. Voltage clamp recordings were obtained in the presence and absence of TiO 2 and ultraviolet laser excitation. Significant current changes were observed in response to UV light, particularly in the -40 mV to +40 mV region where voltage-gated Na + and K + channels have the highest conductance. Cells in proximity to UV-excited TiO 2 exhibited a left-shift in the current-voltage relation of around 10 mV in the activation of Na + currents. These trends were not observed in control experiments where cells were excited with UV light without being exposed to TiO 2 . Electrostatic force microscopy confirmed that electric fields can be induced in TiO 2 with UV light. Simulations using the Hodgkin-Huxley model yielded results which agreed with the experimental data and showed the I-V characteristics of individual ion channels in the presence of UV-excited TiO 2 . Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Action of certain tropine esters on voltage-clamped lobster axon.

    PubMed

    Blaustein, M P

    1968-03-01

    Tropine p-tolylacetate (TPTA) and its quaternary analogue, tropine p-tolylacetate methiodide (TPTA MeI) decrease the early transient (Na) and late (K) currents in the voltage-clamped lobster giant axon. These agents, which block the nerve action potential, reduce the maximum Na and K conductance increases associated with membrane depolarization. They also slow the rate at which the sodium conductance is increased and shift the (normalized) membrane conductance vs. voltage curves in the direction of depolarization along the voltage axis. All these effects are qualitatively similar to those resulting from the action of procaine on the voltage-clamped axon. One unusual effect of the tropine esters, noticeable particularly at large depolarization steps, is that they cause the late, K current to reach a peak and then fall off with increasing pulse duration. This effect has not been reported to occur as a result of procaine action. Tropine p-chlorophenyl acetate (TPClphiA), which differs from TPTA only by the substitution of a p-Cl for a p-CH(3) group on the benzene ring, had a negligible effect on axonal excitability.

  7. Action of Certain Tropine Esters on Voltage-Clamped Lobster Axon

    PubMed Central

    Blaustein, M. P.

    1968-01-01

    Tropine p-tolylacetate (TPTA) and its quaternary analogue, tropine p-tolylacetate methiodide (TPTA MeI) decrease the early transient (Na) and late (K) currents in the voltage-clamped lobster giant axon. These agents, which block the nerve action potential, reduce the maximum Na and K conductance increases associated with membrane depolarization. They also slow the rate at which the sodium conductance is increased and shift the (normalized) membrane conductance vs. voltage curves in the direction of depolarization along the voltage axis. All these effects are qualitatively similar to those resulting from the action of procaine on the voltage-clamped axon. One unusual effect of the tropine esters, noticeable particularly at large depolarization steps, is that they cause the late, K current to reach a peak and then fall off with increasing pulse duration. This effect has not been reported to occur as a result of procaine action. Tropine p-chlorophenyl acetate (TPClφA), which differs from TPTA only by the substitution of a p-Cl for a p-CH3 group on the benzene ring, had a negligible effect on axonal excitability. PMID:5648830

  8. Potential role of voltage-sensing phosphatases in regulation of cell structure through the production of PI(3,4)P2.

    PubMed

    Yamaguchi, Shinji; Kurokawa, Tatsuki; Taira, Ikuko; Aoki, Naoya; Sakata, Souhei; Okamura, Yasushi; Homma, Koichi J

    2014-04-01

    Voltage-sensing phosphatase, VSP, consists of the transmembrane domain, operating as the voltage sensor, and the cytoplasmic domain with phosphoinositide-phosphatase activities. The voltage sensor tightly couples with the cytoplasmic phosphatase and membrane depolarization induces dephosphorylation of several species of phosphoinositides. VSP gene is conserved from urochordate to human. There are some diversities among VSP ortholog proteins; range of voltage of voltage sensor motions as well as substrate selectivity. In contrast with recent understandings of biophysical mechanisms of VSPs, little is known about its physiological roles. Here we report that chick ortholog of VSP (designated as Gg-VSP) induces morphological feature of cell process outgrowths with round cell body in DF-1 fibroblasts upon its forced expression. Expression of the voltage sensor mutant, Gg-VSPR153Q with shifted voltage dependence to a lower voltage led to more frequent changes of cell morphology than the wild-type protein. Coexpression of PTEN that dephosphorylates PI(3,4)P2 suppressed this effect by Gg-VSP, indicating that the increase of PI(3,4)P2 leads to changes of cell shape. In addition, visualization of PI(3,4)P2 with the fluorescent protein fused with the TAPP1-derived pleckstrin homology (PH) domain suggested that Gg-VSP influenced the distribution of PI(3,4)P2 . These findings raise a possibility that one of the VSP's functions could be to regulate cell morphology through voltage-sensitive tuning of phosphoinositide profile. © 2013 Wiley Periodicals, Inc.

  9. Observation of localized ground and excited orbitals in graphene photonic ribbons

    NASA Astrophysics Data System (ADS)

    Cantillano, C.; Mukherjee, S.; Morales-Inostroza, L.; Real, B.; Cáceres-Aravena, G.; Hermann-Avigliano, C.; Thomson, R. R.; Vicencio, R. A.

    2018-03-01

    We report on the experimental realization of a quasi-one-dimensional photonic graphene ribbon supporting four flat-bands (FBs). We study the dynamics of fundamental and dipolar modes, which are analogous to the s and p orbitals, respectively. In the experiment, both modes (orbitals) are effectively decoupled from each other, implying two sets of six bands, where two of them are completely flat (dispersionless). Using an image generator setup, we excite the s and p FB modes and demonstrate their non-diffracting propagation for the first time. Our results open an exciting route towards photonic emulation of higher orbital dynamics.

  10. A comparative study of charge movement in rat and frog skeletal muscle fibres.

    PubMed

    Hollingworth, S; Marshall, M W

    1981-12-01

    1. The middle of the fibre voltage--clamp technique (Adrian & Marshall, 1977), modified where necessary for electrically short muscle fibres, has been used to measure non-linear charge movements in mammalian fast twitch (rat extensor digitorum longus), mammalian slow twitch (rat soleus) and frog (sartorius) muscles. 2. The maximum amount of charge moved in mammalian fast twitch muscle at 2 degrees C in hypertonic solution, was 3--5 times greater than in slow twitch muscle. The voltage distribution of fast twitch charge was 10--15 mV more positive when compared to slow twitch. 3. In both mammalian muscle types hypertonic Ringer solution negatively shifted the voltage distribution of charge some 6 mV. The steepness of charge moved around mechanical threshold was unaffected by hypertonicity. 4. The amount of charge in frog sartorius fibres at 2 degrees C in hypertonic solution was about half of that in rat fast twitch muscle; the voltage distribution of the frog charge was similar to rat soleus muscle. 5. Warming between 2 and 15 degrees C had no effect on either the amount of steady-state distribution of charge in mammalian or frog muscles. 6. At 2 degrees C, the kinetics of charge movement in fast and slow twitch mammalian muscles were similar and 2--3 times faster than frog muscle at the same temperature. In fast and slow mammalian fibres at 2 degrees C similar times were taken to shift the same fractions of the total amount of charge. The Q10 of charge movement kinetics was between 1.2 and 2.0 in the three muscles studied.

  11. Tonic dopamine induces persistent changes in the transient potassium current through translational regulation

    PubMed Central

    Rodgers, EW; Krenz, W-D; Baro, DJ

    2012-01-01

    Neuromodulatory effects can vary with their mode of transmission. Phasic release produces local and transient increases in dopamine (DA) up to micromolar concentrations. Additionally, since DA is released from open synapses and reuptake mechanisms are not nearby, tonic nanomolar DA exists in the extracellular space. Do phasic and tonic transmissions similarly regulate voltage dependent ionic conductances in a given neuron? It was previously shown that DA could immediately alter the transient potassium current (IA) of identified neurons in the stomatogastric ganglion (STG) of the spiny lobster, Panulirus interruptus. Here we show that DA can also persistently alter IA, and that DA’s immediate and persistent effects oppose one another. The lateral pyloric neuron (LP) exclusively expresses type 1 DA receptors (D1Rs). Micromolar DA produces immediate depolarizing shifts in the voltage dependence of LP IA, whereas tonic nanomolar DA produces a persistent increase in LP IA maximal conductance (Gmax) through a translation dependent mechanism involving target of rapamycin (TOR). The pyloric dilator neuron (PD) exclusively expresses type 2 DA receptors (D2Rs). Micromolar DA produces an immediate hyperpolarizing shift in PD IA voltage dependence of activation, whereas tonic DA persistently decreases PD IA Gmax through a translation dependent mechanism not involving TOR. The persistent effects on IA Gmax do not depend on LP or PD activity. These data suggest a role for tonic modulators in the regulation of voltage gated ion channel number; and furthermore, that dopaminergic systems may be organized to limit the amount of change they can impose on a circuit. PMID:21917788

  12. Using Passive Two-Port Networks to Study the Forced Vibrations of Piezoceramic Transducers

    NASA Astrophysics Data System (ADS)

    Karlash, V. L.

    2017-09-01

    A generalization and subsequent development of experimental techniques, including methods of studying the phase-frequency relations between the measured components of admittance and instantaneous power are considered. The conditions of electric loading where electric currents, voltages, or instantaneous powers of constant amplitude in the piezoresonators are specified are numerically modeled. It is particularly established that the advanced Mason circuit with additional switch allows acquiring much more data on the forced vibrations of piezoceramic transducers than the classical circuit. The measured (at an arbitrary frequency) voltage drop across the piezoelement, its pull-up resistor, and at the input of the measuring circuit allow determining, with high accuracy, the current, conductivity, impedance, instantaneous power, and phase shifts when the amplitudes of electric current and voltage are given.

  13. Review of mixer design for low voltage - low power applications

    NASA Astrophysics Data System (ADS)

    Nurulain, D.; Musa, F. A. S.; Isa, M. Mohamad; Ahmad, N.; Kasjoo, S. R.

    2017-09-01

    A mixer is used in almost all radio frequency (RF) or microwave systems for frequency translation. Nowadays, the increase market demand encouraged the industry to deliver circuit designs to create proficient and convenient equipment with very low power (LP) consumption and low voltage (LV) supply in both digital and analogue circuits. This paper focused on different Complementary Metal Oxide Semiconductor (CMOS) design topologies for LV and LP mixer design. Floating Gate Metal Oxide Semiconductor (FGMOS) is an alternative technology to replace CMOS due to their high ability for LV and LP applications. FGMOS only required a few transistors per gate and can have a shift in threshold voltage (VTH) to increase the LP and LV performances as compared to CMOS, which makes an attractive option to replace CMOS.

  14. Investigating the origin of efficiency droop by profiling the voltage across the multi-quantum well of an operating light-emitting diode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Taewoong; Seong, Tae-Yeon; School of Materials Science and Engineering, Korea University, Seoul 136-713

    Efficiency droop is a phenomenon in which the efficiency of a light-emitting diode (LED) decreases with the increase in current density. To analyze efficiency droop, direct experimental observations on the energy conversion occurring inside the LED is required. Here, we present the measured voltage profiles on the cross section of an operating LED and analyze them with the cross-sectional temperature profiles obtained in a previous study under the same operation conditions. The measured voltage profiles suggest that with increases in the injection current density, electron depletion shifts from the multi-quantum well through an electron blocking layer to the p-GaN region.more » This is because electron leakage increases with increases in current density.« less

  15. Acidic pH modulation of Na+ channels in trigeminal mesencephalic nucleus neurons.

    PubMed

    Kang, In-Sik; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung

    2016-12-07

    Cell bodies of trigeminal mesencephalic nucleus (Vmes) neurons are located within the central nervous system, and therefore, peripheral as well as central acidosis can modulate the excitability of Vmes neurons. Here, we report the effect of acidic pH on voltage-gated Na channels in acutely isolated rat Vmes neurons using a conventional whole-cell patch clamp technique. Acidic pH (pH 6.0) slightly but significantly shifted both the activation and steady-state fast inactivation relationships toward depolarized potentials. However, acidic pH (pH 6.0) had a minor effect on the inactivation kinetics of voltage-gated Na channels. Less sensitivity of voltage-gated Na channels to acidic pH may allow Vmes neurons to transduce the precise proprioceptive information even under acidic pH conditions.

  16. Artificial phosphorylation sites modulate the activity of a voltage-gated potassium channel

    NASA Astrophysics Data System (ADS)

    Ariyaratne, Amila; Zocchi, Giovanni

    2015-03-01

    The KvAP potassium channel is representative of a family of voltage-gated ion channels where the membrane potential is sensed by a transmembrane helix containing several positively charged arginines. Previous work by Wang and Zocchi [A. Wang and G. Zocchi, PLoS ONE 6, e18598 (2011), 10.1371/journal.pone.0018598] showed how a negatively charged polyelectrolyte attached in proximity to the voltage sensing element can bias the opening probability of the channel. Here we introduce three phosphorylation sites at the same location and show that the response curve of the channel shifts by about 20 mV upon phosphorylation, while other characteristics such as the single-channel conductance are unaffected. In summary, we construct an artificial phosphorylation site which confers allosteric regulation to the channel.

  17. Redundancy Technology With A Focused Ion Beam

    NASA Astrophysics Data System (ADS)

    Komano, Haruki; Hashimoto, Kazuhiko; Takigawa, Tadahiro

    1989-08-01

    Fuse cutting with a focused ion beam to activate redundancy circuits is proposed. In order to verify its potential usefulness, experiments have been performed. Fuse-cutting time was evaluated using aluminum fuses with a thin passivation layer, which are difficult to cut by conventional laser-beam technology due to the material's high reflectivity. The fuse width and thickness were 2 and 0.8 μm, respectively. The fuse was cut in 5 seconds with a 30 keV focused ion beam of 0.3 A/cm2 current density. Since the fuses used in DRAMs will be smaller, their cutting time will become shorter by scanning an ion beam on narrower areas. Moreover, it can be shortened by increasing current density. Fuses for redundancy technology in 256 k CMOS SRAMs were cut with a focused ion beam. The operation of the memories was checked with a memory tester. It was confirmed that memories which had failure cells operated normally after focused-ion-beam fuse-cutting. Focused ion beam irradiation effects upon a device have been studied. When a 30 keV gallium focused ion beam was irradiated near the gate of MOSFETs, a threshold voltage shift was not observed at an ion dose of 0.3 C/cm2 which corresponded to the ion dose in cutting a fuse. However, when irradiated on the gate, a threshold voltage shift was observed at ion doses of more than 8 x 10-4 C/cm2. The voltage shift was caused by the charge of ions within the passivation layer. It is necessary at least not to irradiate a focused ion beam on a device in cutting fuses. It is concluded that the focused-ion-beam method will be advantageous for future redundancy technology application.

  18. Multimodal Examination of Atrial Fibrillation Substrate: Correlation of Left Atrial Bipolar Voltage Using Multi-Electrode Fast Automated Mapping, Point-by-Point Mapping, and Magnetic Resonance Image Intensity Ratio.

    PubMed

    Zghaib, Tarek; Keramati, Ali; Chrispin, Jonathan; Huang, Dong; Balouch, Muhammad A; Ciuffo, Luisa; Berger, Ronald D; Marine, Joseph E; Ashikaga, Hiroshi; Calkins, Hugh; Nazarian, Saman; Spragg, David D

    2018-01-01

    Bipolar voltage mapping, as part of atrial fibrillation (AF) ablation, is traditionally performed in a point-by-point (PBP) approach using single-tip ablation catheters. Alternative techniques for fibrosis-delineation include fast-anatomical mapping (FAM) with multi-electrode circular catheters, and late gadolinium-enhanced magnetic-resonance imaging (LGE-MRI). The correlation between PBP, FAM, and LGE-MRI fibrosis assessment is unknown. In this study, we examined AF substrate using different modalities (PBP, FAM, and LGE-MRI mapping) in patients presenting for an AF ablation. LGE-MRI was performed pre-ablation in 26 patients (73% males, age 63±8years). Local image-intensity ratio (IIR) was used to normalize myocardial intensities. PBP- and FAM-voltage maps were acquired, in sinus rhythm, prior to ablation and co-registered to LGE-MRI. Mean bipolar voltage for all 19,087 FAM voltage points was 0.88±1.27mV and average IIR was 1.08±0.18. In an adjusted mixed-effects model, each unit increase in local IIR was associated with 57% decrease in bipolar voltage (p<0.0001). IIR of >0.74 corresponded to bipolar voltage <0.5 mV. A total of 1554 PBP-mapping points were matched to the nearest FAM-point. In an adjusted mixed-effects model, log-FAM bipolar voltage was significantly associated with log-PBP bipolar voltage (ß=0.36, p<0.0001). At low-voltages, FAM-mapping distribution was shifted to the left compared to PBP-mapping; at intermediate voltages, FAM and PBP voltages were overlapping; and at high voltages, FAM exceeded PBP-voltages. LGE-MRI, FAM and PBP-mapping show good correlation in delineating electro-anatomical AF substrate. Each approach has fundamental technical characteristics, the awareness of which allows proper assessment of atrial fibrosis.

  19. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    PubMed

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  20. Faraday-Shielded dc Stark-Shift-Free Optical Lattice Clock

    NASA Astrophysics Data System (ADS)

    Beloy, K.; Zhang, X.; McGrew, W. F.; Hinkley, N.; Yoon, T. H.; Nicolodi, D.; Fasano, R. J.; Schäffer, S. A.; Brown, R. C.; Ludlow, A. D.

    2018-05-01

    We demonstrate the absence of a dc Stark shift in an ytterbium optical lattice clock. Stray electric fields are suppressed through the introduction of an in-vacuum Faraday shield. Still, the effectiveness of the shielding must be experimentally assessed. Such diagnostics are accomplished by applying high voltage to six electrodes, which are grounded in normal operation to form part of the Faraday shield. Our measurements place a constraint on the dc Stark shift at the 10-20 level, in units of the clock frequency. Moreover, we discuss a potential source of error in strategies to precisely measure or cancel nonzero dc Stark shifts, attributed to field gradients coupled with the finite spatial extent of the lattice-trapped atoms. With this consideration, we find that Faraday shielding, complemented with experimental validation, provides both a practically appealing and effective solution to the problem of dc Stark shifts in optical lattice clocks.

  1. Faraday-Shielded dc Stark-Shift-Free Optical Lattice Clock.

    PubMed

    Beloy, K; Zhang, X; McGrew, W F; Hinkley, N; Yoon, T H; Nicolodi, D; Fasano, R J; Schäffer, S A; Brown, R C; Ludlow, A D

    2018-05-04

    We demonstrate the absence of a dc Stark shift in an ytterbium optical lattice clock. Stray electric fields are suppressed through the introduction of an in-vacuum Faraday shield. Still, the effectiveness of the shielding must be experimentally assessed. Such diagnostics are accomplished by applying high voltage to six electrodes, which are grounded in normal operation to form part of the Faraday shield. Our measurements place a constraint on the dc Stark shift at the 10^{-20} level, in units of the clock frequency. Moreover, we discuss a potential source of error in strategies to precisely measure or cancel nonzero dc Stark shifts, attributed to field gradients coupled with the finite spatial extent of the lattice-trapped atoms. With this consideration, we find that Faraday shielding, complemented with experimental validation, provides both a practically appealing and effective solution to the problem of dc Stark shifts in optical lattice clocks.

  2. Investigation of interface property in Al/SiO2/ n-SiC structure with thin gate oxide by illumination

    NASA Astrophysics Data System (ADS)

    Chang, P. K.; Hwu, J. G.

    2017-04-01

    The reverse tunneling current of Al/SiO2/ n-SiC structure employing thin gate oxide is introduced to examine the interface property by illumination. The gate current at negative bias decreases under blue LED illumination, yet increases under UV lamp illumination. Light-induced electrons captured by interface states may be emitted after the light sources are off, leading to the recovery of gate currents. Based on transient characteristics of gate current, the extracted trap level is close to the light energy for blue LED, indicating that electron capture induced by lighting may result in the reduction of gate current. Furthermore, bidirectional C- V measurements exhibit a positive voltage shift caused by electron trapping under blue LED illumination, while a negative voltage shift is observed under UV lamp illumination. Distinct trapping and detrapping behaviors can be observed from variations in I- V and C- V curves utilizing different light sources for 4H-SiC MOS capacitors with thin insulators.

  3. Improving positive and negative bias illumination stress stability in parylene passivated IGZO transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiazadeh, Asal; Universidade do Algarve, FCT, 8000-139 Faro; Gomes, Henrique L.

    The impact of a parylene top-coating layer on the illumination and bias stress instabilities of indium-gallium-zinc oxide thin-film transistors (TFTs) is presented and discussed. The parylene coating substantially reduces the threshold voltage shift caused by continuous application of a gate bias and light exposure. The operational stability improves by 75%, and the light induced instability is reduced by 35%. The operational stability is quantified by fitting the threshold voltage shift with a stretched exponential model. Storage time as long as 7 months does not cause any measurable degradation on the electrical performance. It is proposed that parylene plays not onlymore » the role of an encapsulation layer but also of a defect passivation on the top semiconductor surface. It is also reported that depletion-mode TFTs are less sensitive to light induced instabilities. This is attributed to a defect neutralization process in the presence of free electrons.« less

  4. Fully solution processed Al-TiO2-Si (MIS) structured photo-detector

    NASA Astrophysics Data System (ADS)

    Mondal, Sandip; Kumar, Arvind

    2018-05-01

    We demonstrate the fabrication of a high performance photo detector by fully solution processed technique. The detector is fabricated with photo sensitive, low temperature (200˚C) and sol-gel processed titanium dioxide (TiO2) dielectric material on silicon substrate in the form of MIS structure with top aluminum gate. The optical detection experiment is performed on Al—TiO2—Si (MIS) device by measuring the capacitance—voltage (CV at 100 kHz) curve within the visible region of light (365 — 700 nm). The presence of light shift the flat band voltage (VFB) from 290 mV to 360 mV due to the generation of photo activated charge carriers by UV (365 nm) and white light, respectively. Moreover, the generation of the charge carrier increases drastically by the combination of UV and white, which resulting as a very large shift (600 mV) in the VFB. The entire experiment was performed in normal lab conditions with open air environment, without any clean room facility.

  5. Shift in Chemical Potential of Superconducting Bi2212 Measured by Ultrafast Photoemission Spectroscopy

    NASA Astrophysics Data System (ADS)

    Miller, Tristan; Smallwood, Chris; Zhang, Wentao; Eisaki, Hiroshi; Lee, Dung-Hai; Lanzara, Alessandra

    2015-03-01

    Time- and Angle-resolved photoemission spectroscopy (tr-ARPES) has been used to directly measure the dynamics of many different properties of high-temperature superconductors, including the quasiparticle relaxation, cooper pair recombination, and many-body interactions. There have also been several intriguing results on several materials showing how laser pulses can manipulate their chemical potential on ultrafast timescales, and it's been suggested that these effects could find applications in optoelectronic devices. Studies on GaAs have also found that laser pulses may induce a surface voltage effect. Here, we extend these studies for the first time to a Bi2212 sample in the superconducting state, and disentangle the shift in chemical potential from surface voltage effects. This work was supported by Berkeley Lab's program on Quantum Materials, funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Materials Sciences and Engineering Division, under Contract No. DE-AC02-05CH11231.

  6. Electrostatic shape-shifting ion optics

    DOEpatents

    Dahl, David A.; Scott, Jill R.; Appelhans, Anthony D.

    2006-05-02

    Electrostatic shape-shifting ion optics includes an outer electrode that defines an interior region between first and second opposed open ends. A first inner electrode is positioned within the interior region of the outer electrode at about the first open end. A second inner electrode is positioned within the interior region of the outer electrode at about the second open end. A first end cap electrode is positioned at about a first open end of the first inner electrode so that the first end cap electrode substantially encloses the first open end of the first inner electrode. A second end cap electrode is positioned at about a second open end of the second inner electrode so that the second end cap electrode substantially encloses the second open end of the second inner electrode. A voltage source operatively connected to each of the electrodes applies voltage functions to each of the electrodes to produce an electric field within an interior space enclosed by the electrodes.

  7. Voltage Scaling of Graphene Device on SrTiO3 Epitaxial Thin Film.

    PubMed

    Park, Jeongmin; Kang, Haeyong; Kang, Kyeong Tae; Yun, Yoojoo; Lee, Young Hee; Choi, Woo Seok; Suh, Dongseok

    2016-03-09

    Electrical transport in monolayer graphene on SrTiO3 (STO) thin film is examined in order to promote gate-voltage scaling using a high-k dielectric material. The atomically flat surface of thin STO layer epitaxially grown on Nb-doped STO single-crystal substrate offers good adhesion between the high-k film and graphene, resulting in nonhysteretic conductance as a function of gate voltage at all temperatures down to 2 K. The two-terminal conductance quantization under magnetic fields corresponding to quantum Hall states survives up to 200 K at a magnetic field of 14 T. In addition, the substantial shift of charge neutrality point in graphene seems to correlate with the temperature-dependent dielectric constant of the STO thin film, and its effective dielectric properties could be deduced from the universality of quantum phenomena in graphene. Our experimental data prove that the operating voltage reduction can be successfully realized due to the underlying high-k STO thin film, without any noticeable degradation of graphene device performance.

  8. Phosphatidic acid modulation of Kv channel voltage sensor function

    PubMed Central

    Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick

    2014-01-01

    Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. DOI: http://dx.doi.org/10.7554/eLife.04366.001 PMID:25285449

  9. Increase in the Random Dopant Induced Threshold Fluctuations and Lowering in Sub 100 nm MOSFETs Due to Quantum Effects: A 3-D Density-Gradient Simulation Study

    NASA Technical Reports Server (NTRS)

    Asenov, Asen; Slavcheva, G.; Brown, A. R.; Davies, J. H.; Saini, S.

    2000-01-01

    In this paper we present a detailed simulation study of the influence of quantum mechanical effects in the inversion layer on random dopant induced threshold voltage fluctuations and lowering in sub 100 nm MOSFETs. The simulations have been performed using a 3-D implementation of the density gradient (DG) formalism incorporated in our established 3-D atomistic simulation approach. This results in a self-consistent 3-D quantum mechanical picture, which implies not only the vertical inversion layer quantisation but also the lateral confinement effects related to current filamentation in the 'valleys' of the random potential fluctuations. We have shown that the net result of including quantum mechanical effects, while considering statistical dopant fluctuations, is an increase in both threshold voltage fluctuations and lowering. At the same time, the random dopant induced threshold voltage lowering partially compensates for the quantum mechanical threshold voltage shift in aggressively scaled MOSFETs with ultrathin gate oxides.

  10. A single-molecule diode.

    PubMed

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B; Mayor, Marcel

    2005-06-21

    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic pi -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical pi-systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode.

  11. A single-molecule diode

    PubMed Central

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel

    2005-01-01

    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208

  12. Electron emission controller with pulsed heating of filament

    NASA Astrophysics Data System (ADS)

    Durakiewicz, Tomasz

    1996-11-01

    A novel circuit has been invented for the versatile and safe stabilization of the electron emission current (Ie) produced by a hot filament in mass spectrometers or in ionization gauges. The voltage signal, which is directly proportional to Ie, is provided to the inverting input of a comparator, whereas the noninverting input is connected to the reference voltage. In addition to the commonly used negative feedback loop, a positive feedback loop was introduced by siting a resistor between the noninverting input and the output of the comparator, which results in a pulsation of the filament voltage. The pulses are rectangular, so that the power dissipated by the transistor in the filament power supply circuit is radically reduced. To refine the switching action of the transistor, the output of the comparator is connected through a capacitor to the transistor gate. A concise discussion of the phase shift between Ie, the filament temperature Tf, and the filament voltage Vf, including time constants for different modes of power dissipation, is included.

  13. Contribution of Sialic Acid to the Voltage Dependence of Sodium Channel Gating

    PubMed Central

    Bennett, Eric; Urcan, Mary S.; Tinkle, Sally S.; Koszowski, Adam G.; Levinson, Simon R.

    1997-01-01

    A potential role for sialic acid in the voltage-dependent gating of rat skeletal muscle sodium channels (rSkM1) was investigated using Chinese hamster ovary (CHO) cells stably transfected with rSkM1. Changes in the voltage dependence of channel gating were observed after enzymatic (neuraminidase) removal of sialic acid from cells expressing rSkM1 and through the expression of rSkM1 in a sialylation-deficient cell line (lec2). The steady-state half-activation voltages (Va) of channels under each condition of reduced sialylation were ∼10 mV more depolarized than control channels. The voltage dependence of the time constants of channel activation and inactivation were also shifted in the same direction and by a similar magnitude. In addition, recombinant deletion of likely glycosylation sites from the rSkM1 sequence resulted in mutant channels that gated at voltages up to 10 mV more positive than wild-type channels. Thus three independent means of reducing channel sialylation show very similar effects on the voltage dependence of channel gating. Finally, steady-state activation voltages for channels subjected to reduced sialylation conditions were much less sensitive to the effects of external calcium than those measured under control conditions, indicating that sialic acid directly contributes to the negative surface potential. These results are consistent with an electrostatic mechanism by which external, negatively charged sialic acid residues on rSkM1 alter the electric field sensed by channel gating elements. PMID:9089440

  14. Clues to understanding cold sensation: Thermodynamics and electrophysiological analysis of the cold receptor TRPM8

    PubMed Central

    Brauchi, Sebastian; Orio, Patricio; Latorre, Ramon

    2004-01-01

    The cold and menthol receptor, TRPM8, also designated CMR1, is a member of the transient receptor potential (TRP) family of excitatory ion channels. TRPM8 is a channel activated by cold temperatures, voltage, and menthol. In this study, we characterize the cold- and voltage-induced activation of TRPM8 channel in an attempt to identify the temperature- and voltage-dependent components involved in channel activation. Under equilibrium conditions, decreasing temperature has two effects. (i) It shifts the normalized conductance vs. voltage curves toward the left, along the voltage axis. This effect indicates that the degree of order is higher when the channel is in the open configuration. (ii) It increases the maximum channel open probability, suggesting that temperature affects both voltage-dependent and -independent pathways. In the temperature range between 18°C and 25°C, large changes in enthalpy (ΔH = -112 kcal/mol) and entropy (ΔS = -384 cal/mol K) accompany the activation process. The Q10 calculated in the same temperature range is 24. This thermodynamic analysis strongly suggests that the process of opening involves large conformational changes of the channel-forming protein. Therefore, the highly temperature-dependent transition between open and closed configurations is possible because enthalpy and entropy are both large and compensate each other. Our data also demonstrate that temperature and voltage interact allosterically to enhance channel opening. PMID:15492228

  15. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    NASA Astrophysics Data System (ADS)

    Bhowmik, R. N.; Vijayasri, G.

    2015-06-01

    We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  16. Investigation of an anomalous hump phenomenon in via-type amorphous In-Ga-Zn-O thin-film transistors under positive bias temperature stress

    NASA Astrophysics Data System (ADS)

    Yang, Jianwen; Liao, Po-Yung; Chang, Ting-Chang; Chen, Bo-Wei; Huang, Hui-Chun; Su, Wan-Ching; Chiang, Hsiao-Cheng; Zhang, Qun

    2017-04-01

    Amorphous InGaZnO thin film transistors (a-IGZO TFTs) with an etching-stop layer (ESL) exhibit an anomalous negative shift of threshold voltage (Vth) under positive bias temperature stress. TFTs with wider and shorter channels show a clear hump phenomenon, resulting from the existence of both main channels and parasitic channels. The electrons trapped in the gate insulator are responsible for the positive shift in the main channel characteristics. The electrons trapped near the IGZO edges and the holes injected into the ESL layer above InGaZnO (IGZO) jointly determine the shift of the parasitic TFT performance.

  17. Free-energy relationships in ion channels activated by voltage and ligand

    PubMed Central

    Chowdhury, Sandipan

    2013-01-01

    Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

  18. Origin of positive fixed charge at insulator/AlGaN interfaces and its control by AlGaN composition

    NASA Astrophysics Data System (ADS)

    Matys, M.; Stoklas, R.; Blaho, M.; Adamowicz, B.

    2017-06-01

    The key feature for the precise tuning of Vth in GaN-based metal-insulator-semiconductor (MIS) high electron mobility transistors is the control of the positive fixed charge (Qf) at the insulator/III-N interfaces, whose amount is often comparable to the negative surface polarization charge ( Qp o l -). In order to clarify the origin of Qf, we carried out a comprehensive capacitance-voltage (C-V) characterization of SiO2/AlxGa1-xN/GaN and SiN/AlxGa1-xN/GaN structures with Al composition (x) varying from 0.15 to 0.4. For both types of structures, we observed a significant Vth shift in C-V curves towards the positive gate voltage with increasing x. On the contrary, the Schottky gate structures exhibited Vth shift towards the more negative biases. From the numerical simulations of C-V curves using the Poisson's equation supported by the analytical calculations of Vth, we showed that the Vth shift in the examined MIS structures is due to a significant decrease in the positive Qf with rising x. Finally, we examined this result with respect to various hypotheses developed in the literature to explain the origin of the positive Qf at insulator/III-N interfaces.

  19. Gating kinetics of batrachotoxin-modified Na+ channels in the squid giant axon. Voltage and temperature effects.

    PubMed Central

    Correa, A M; Bezanilla, F; Latorre, R

    1992-01-01

    The gating kinetics of batrachotoxin-modified Na+ channels were studied in outside-out patches of axolemma from the squid giant axon by means of the cut-open axon technique. Single channel kinetics were characterized at different membrane voltages and temperatures. The probability of channel opening (Po) as a function of voltage was well described by a Boltzmann distribution with an equivalent number of gating particles of 3.58. The voltage at which the channel was open 50% of the time was a function of [Na+] and temperature. A decrease in the internal [Na+] induced a shift to the right of the Po vs. V curve, suggesting the presence of an integral negative fixed charge near the activation gate. An increase in temperature decreased Po, indicating a stabilization of the closed configuration of the channel and also a decrease in entropy upon channel opening. Probability density analysis of dwell times in the closed and open states of the channel at 0 degrees C revealed the presence of three closed and three open states. The slowest open kinetic component constituted only a small fraction of the total number of transitions and became negligible at voltages greater than -65 mV. Adjacent interval analysis showed that there is no correlation in the duration of successive open and closed events. Consistent with this analysis, maximum likelihood estimation of the rate constants for nine different single-channel models produced a preferred model (model 1) having a linear sequence of closed states and two open states emerging from the last closed state. The effect of temperature on the rate constants of model 1 was studied. An increase in temperature increased all rate constants; the shift in Po would be the result of an increase in the closing rates predominant over the change in the opening rates. The temperature study also provided the basis for building an energy diagram for the transitions between channel states. PMID:1318096

  20. Differential sensitivity to perchlorate and caffeine of tetracaine-resistant Ca2+ release in frog skeletal muscle.

    PubMed

    Píriz, Nazira; Brum, Gustavo; Pizarro, Gonzalo

    2006-01-01

    In voltage clamped frog skeletal muscle fibres 0.2 mM tetracaine strongly suppresses Ca(2+) release. After this treatment Ca(2+) release flux lacks its characteristic initial peak and the remaining steady component is strongly reduced when compared with the control condition. We studied the effect of two agonists of Ca(2+) release on these tetracaine treated fibres. 8 mM ClO(4)(-) added after tetracaine potentiated release flux from 0.11 +/- 0.03 mM s(-1) to 0.34 +/- 0.07 mM s(-1) (n = 6) although without recovery of the peak at any test voltage. The voltage dependence of the increased release was shifted towards more negative potentials (approximately -10 mV). The effects of ClO(4)(-) on charge movement under these conditions showed the previously described characteristic changes consisting in a left shift of its voltage dependence (approximately -9 mV) together with a slower kinetics, both at the ON and OFF transients. Caffeine at 0.5 mM in the presence of the same concentration of tetracaine failed to potentiate release flux independently of the test voltage applied. When the cut ends of the fibre were exposed to a 10 mM BAPTA intracellular solution, in the absence of tetracaine, the peak was progressively abolished. Under these conditions caffeine potentiated release restoring the peak (from 0.63 +/- 0.12 mM s(-1) to 1.82 +/- 0.23 mM s(-1)) with no effect on charge movement. Taken together the present results suggest that tetracaine is blocking a Ca(2+) sensitive component of release flux. It is speculated that the suppressed release includes a component that is dependent on Ca(2+) and mainly mediated by the activation of the beta ryanodine receptors (the RyR3 equivalent isoform). These receptors are located parajunctionally in the frog and are not interacting with the dihydropyridine receptor.

  1. Magnetic Compensation for Second-Order Doppler Shift in LITS

    NASA Technical Reports Server (NTRS)

    Burt, Eric; Tjoelker, Robert

    2008-01-01

    The uncertainty in the frequency of a linear-ion-trap frequency standard (LITS) can be reduced substantially by use of a very small magnetic inhomogeneity tailored to compensate for the residual second-order Doppler shift. An effect associated with the relativistic time dilatation, one cause of the second-order Doppler shift, is ion motion that is attributable to the trapping radio-frequency (RF)electromagnetic field used to trap ions. The second-order Doppler shift is reduced by using a multi-pole trap; however it is still the largest source of systematic frequency shift in the latest generation of LITSs, which are among the most stable clocks in the world. The present compensation scheme reduces the frequency instability of the affected LITS to about a tenth of its previous value. The basic principles of prior generation LITSs were discussed in several prior NASA Tech Briefs articles. Below are recapitulated only those items of basic information necessary to place the present development in context. A LITS includes a microwave local oscillator, the frequency of which is stabilized by comparison with the frequency of the ground state hyperfine transition of 199Hg+ ions. The comparison involves a combination of optical and microwave excitation and interrogation of the ions in a linear ion trap in the presence of a nominally uniform magnetic field. In the current version of the LITS, there are two connected traps (see figure): (1) a quadrupole trap wherein the optical excitation and measurement take place and (2) a 12-pole trap (denoted the resonance trap), wherein the microwave interrogation takes place. The ions are initially loaded into the quadrupole trap and are thereafter shuttled between the two traps. Shuttling ions into the resonance trap allows sensitive microwave interrogation to take place well away from loading interference. The axial magnetic field for the resonance trap is generated by an electric current in a finely wound wire coil surrounded by magnetic shields. In the quadrupole and 12-pole traps, the potentials are produced by RF voltages applied to even numbers (4 and 12, respectively) of parallel rods equally spaced around a circle. The polarity of the voltage on each rod is opposite that of the voltage on the adjacent rod. As a result, the amplitude of the RF trapping field is zero along the centerline and increases, with radius, to a maximum value near the rods.

  2. A Photostable Silicon Rhodamine Platform for Optical Voltage Sensing

    PubMed Central

    Huang, Yi-Lin; Walker, Alison S.; Miller, Evan W.

    2015-01-01

    This paper describes the design and synthesis of a photostable, far-red to near-infrared (NIR) platform for optical voltage sensing. We developed a new, sulfonated silicon rhodamine fluorophore and integrated it with a phenylenevinylene molecular wire to create a Berkeley Red Sensor of Transmembrane potential, or BeRST 1 (“burst”). BeRST 1 is the first member of a class of farred to NIR voltage sensitive dyes that make use of a photoinduced electron transfer (PeT) trigger for optical interrogation of membrane voltage. We show that BeRST 1 displays bright, membrane-localized fluorescence in living cells, high photostability, and excellent voltage sensitivity in neurons. Depolarization of the plasma membrane results in rapid fluorescence increases (24% ΔF/F per 100 mV). BeRST 1 can be used in conjunction with fluorescent stains for organelles, Ca2+ indicators, and voltage-sensitive fluorescent proteins. In addition, the red-shifted spectral profile of BeRST 1, relative to commonly employed optogenetic actuators like ChannelRhodopsin2 (ChR2), which require blue light, enables optical electrophysiology in neurons. The high speed, sensitivity, photostability and long-wavelength fluorescence profiles of BeRST 1 make it a useful platform for the non-invasive, optical dissection of neuronal activity. PMID:26237573

  3. GaN HEMTs with p-GaN gate: field- and time-dependent degradation

    NASA Astrophysics Data System (ADS)

    Meneghesso, G.; Meneghini, M.; Rossetto, I.; Canato, E.; Bartholomeus, J.; De Santi, C.; Trivellin, N.; Zanoni, E.

    2017-02-01

    GaN-HEMTs with p-GaN gate have recently demonstrated to be excellent normally-off devices for application in power conversion systems, thanks to the high and robust threshold voltage (VTH>1 V), the high breakdown voltage, and the low dynamic Ron increase. For this reason, studying the stability and reliability of these devices under high stress conditions is of high importance. This paper reports on our most recent results on the field- and time-dependent degradation of GaN-HEMTs with p-GaN gate submitted to stress with positive gate bias. Based on combined step-stress experiments, constant voltage stress and electroluminescence testing we demonstrated that: (i) when submitted to high/positive gate stress, the transistors may show a negative threshold voltage shift, that is ascribed to the injection of holes from the gate metal towards the p-GaN/AlGaN interface; (ii) in a step-stress experiment, the analyzed commercial devices fail at gate voltages higher than 9-10 V, due to the extremely high electric field over the p-GaN/AlGaN stack; (iii) constant voltage stress tests indicate that the failure is also time-dependent and Weibull distributed. The several processes that can explain the time-dependent failure are discussed in the following.

  4. New ion trap for atomic frequency standard applications

    NASA Technical Reports Server (NTRS)

    Prestage, J. D.; Dick, G. J.; Maleki, L.

    1989-01-01

    A novel linear ion trap that permits storage of a large number of ions with reduced susceptibility to the second-order Doppler effect caused by the radio frequency (RF) confining fields has been designed and built. This new trap should store about 20 times the number of ions a conventional RF trap stores with no corresponding increase in second-order Doppler shift from the confining field. In addition, the sensitivity of this shift to trapping parameters, i.e., RF voltage, RF frequency, and trap size, is greatly reduced.

  5. Electro-optic-waveguide frequency translator in LiNbO(3) fabricated by proton exchange.

    PubMed

    Wong, K K; De La Rue, R M; Wright, S

    1982-11-01

    An optical waveguide phase modulator has been fabricated on X-cut LiNbO(3) by using proton exchange in benzoic acid. The phase modulator was operated as a serrodyne optical-frequency translator with shifted-signal to imagesignal discrimination of 52 dB for a 4-MHz frequency shift. The amplitude of the sawtooth driving signal was 10 V peak to peak. Application of a de bias voltage of either polarity was found to cause a substantial reduction in transmitted-light intensity.

  6. Modeling Proton Irradiation in AlGaN/GaN HEMTs: Understanding the Increase of Critical Voltage

    NASA Astrophysics Data System (ADS)

    Patrick, Erin; Law, Mark E.; Liu, Lu; Cuervo, Camilo Velez; Xi, Yuyin; Ren, Fan; Pearton, Stephen J.

    2013-12-01

    A combination of TRIM and FLOODS models the effect of radiation damage on AlGaN/GaN HEMTs. While excellent fits are obtained for threshold voltage shift, the models do not fully explain the increased reliability observed experimentally. In short, the addition of negatively-charged traps in the GaN buffer layer does not significantly change the electric field at the gate edges at radiation fluence levels seen in this study. We propose that negative trapped charge at the nitride/AlGaN interface actually produces the virtual-gate effect that results in decreasing the magnitude of the electric field at the gate edges and thus the increase in critical voltage. Simulation results including nitride interface charge show significant changes in electric field profiles while the I-V device characteristics do not change.

  7. All-optical mapping of barrel cortex circuits based on simultaneous voltage-sensitive dye imaging and channelrhodopsin-mediated photostimulation

    PubMed Central

    Lo, Shun Qiang; Koh, Dawn X. P.; Sng, Judy C. G.; Augustine, George J.

    2015-01-01

    Abstract. We describe an experimental approach that uses light to both control and detect neuronal activity in mouse barrel cortex slices: blue light patterned by a digital micromirror array system allowed us to photostimulate specific layers and columns, while a red-shifted voltage-sensitive dye was used to map out large-scale circuit activity. We demonstrate that such all-optical mapping can interrogate various circuits in somatosensory cortex by sequentially activating different layers and columns. Further, mapping in slices from whisker-deprived mice demonstrated that chronic sensory deprivation did not significantly alter feedforward inhibition driven by layer 5 pyramidal neurons. Further development of voltage-sensitive optical probes should allow this all-optical mapping approach to become an important and high-throughput tool for mapping circuit interactions in the brain. PMID:26158003

  8. Impact of magnetite nanoparticle incorporation on optical and electrical properties of nanocomposite LbL assemblies.

    PubMed

    Yashchenok, Alexey M; Gorin, Dmitry A; Badylevich, Mikhail; Serdobintsev, Alexey A; Bedard, Matthieu; Fedorenko, Yanina G; Khomutov, Gennady B; Grigoriev, Dmitri O; Möhwald, Helmuth

    2010-09-21

    Optical and electrical properties of polyelectrolyte/iron oxide nanocomposite planar films on silicon substrates were investigated for different amount of iron oxide nanoparticles incorporated in the films. The nanocomposite assemblies prepared by the layer-by-layer assembly technique were characterized by ellipsometry, atomic force microscopy, and secondary ion mass-spectrometry. Absorption spectra of the films reveal a shift of the optical absorption edge to higher energy when the number of deposited layers decreases. Capacitance-voltage and current-voltage measurements were applied to study the electrical properties of metal-oxide-semiconductor structures prepared by thermal evaporation of gold electrodes on nanocomposite films. The capacitance-voltage measurements show that the dielectric constant of the film increases with the number of deposited layers and the fixed charge and the trapped charge densities have a negative sign.

  9. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  10. In situ NMR spectroscopy of supercapacitors: insight into the charge storage mechanism.

    PubMed

    Wang, Hao; Forse, Alexander C; Griffin, John M; Trease, Nicole M; Trognko, Lorie; Taberna, Pierre-Louis; Simon, Patrice; Grey, Clare P

    2013-12-18

    Electrochemical capacitors, commonly known as supercapacitors, are important energy storage devices with high power capabilities and long cycle lives. Here we report the development and application of in situ nuclear magnetic resonance (NMR) methodologies to study changes at the electrode-electrolyte interface in working devices as they charge and discharge. For a supercapacitor comprising activated carbon electrodes and an organic electrolyte, NMR experiments carried out at different charge states allow quantification of the number of charge storing species and show that there are at least two distinct charge storage regimes. At cell voltages below 0.75 V, electrolyte anions are increasingly desorbed from the carbon micropores at the negative electrode, while at the positive electrode there is little change in the number of anions that are adsorbed as the voltage is increased. However, above a cell voltage of 0.75 V, dramatic increases in the amount of adsorbed anions in the positive electrode are observed while anions continue to be desorbed at the negative electrode. NMR experiments with simultaneous cyclic voltammetry show that supercapacitor charging causes marked changes to the local environments of charge storing species, with periodic changes of their chemical shift observed. NMR calculations on a model carbon fragment show that the addition and removal of electrons from a delocalized system should lead to considerable increases in the nucleus-independent chemical shift of nearby species, in agreement with our experimental observations.

  11. In Situ NMR Spectroscopy of Supercapacitors: Insight into the Charge Storage Mechanism

    PubMed Central

    2013-01-01

    Electrochemical capacitors, commonly known as supercapacitors, are important energy storage devices with high power capabilities and long cycle lives. Here we report the development and application of in situ nuclear magnetic resonance (NMR) methodologies to study changes at the electrode–electrolyte interface in working devices as they charge and discharge. For a supercapacitor comprising activated carbon electrodes and an organic electrolyte, NMR experiments carried out at different charge states allow quantification of the number of charge storing species and show that there are at least two distinct charge storage regimes. At cell voltages below 0.75 V, electrolyte anions are increasingly desorbed from the carbon micropores at the negative electrode, while at the positive electrode there is little change in the number of anions that are adsorbed as the voltage is increased. However, above a cell voltage of 0.75 V, dramatic increases in the amount of adsorbed anions in the positive electrode are observed while anions continue to be desorbed at the negative electrode. NMR experiments with simultaneous cyclic voltammetry show that supercapacitor charging causes marked changes to the local environments of charge storing species, with periodic changes of their chemical shift observed. NMR calculations on a model carbon fragment show that the addition and removal of electrons from a delocalized system should lead to considerable increases in the nucleus-independent chemical shift of nearby species, in agreement with our experimental observations. PMID:24274637

  12. Enhanced tunability of electrical and magnetic properties in (La,Sr)MnO3 thin films via field-assisted oxygen vacancy modulation

    NASA Astrophysics Data System (ADS)

    Wong, Hon Fai; Ng, Sheung Mei; Cheng, Wang Fai; Liu, Yukuai; Chen, Xinxin; von Nordheim, Danny; Mak, Chee Leung; Dai, Jiyan; Ploss, Bernd; Leung, Chi Wah

    2017-12-01

    We investigated the tunability of the transport and magnetic properties in 7.5 nm La0.7Sr0.3MnO3 (LSMO) epitaxial films in a field effect geometry with the ferroelectric copolymer P(VDF-TrFE) as the gate insulator. Two different switching behaviors were observed upon application of gate voltages with either high or low magnitudes. The application of single voltage pulses of alternating polarity with an amplitude high enough to switch the remanent polarization of the ferroelectric copolymer led to a 15% change of the resistance of the LSMO channel at temperature 300 K (but less than 1% change at 20 K). A minimal shift of the peak in the resistance-temperature plot was observed, implying that the Curie temperature TC of the manganite layer is not changed. Alternatively, the application of a chain of low voltage pulses was found to shift TC by more than 16 K, and a change of the channel resistance by a 45% was obtained. We attribute this effect to the field-assisted injection and removal of oxygen vacancies in the LSMO layer, which can occur across the thickness of the oxide film. By controlling the oxygen migration, the low-field switching route offers a simple method for modulating the electric and magnetic properties of manganite films.

  13. Ionic currents and charge movements in organ-cultured rat skeletal muscle.

    PubMed

    Hollingworth, S; Marshall, M W; Robson, E

    1984-12-01

    The middle of the fibre voltage-clamp technique was used to measure ionic currents and non-linear charge movements in intact, organ-cultured (in vitro denervated) mammalian fast-twitch (rat extensor digitorum longus) muscle fibres. Muscle fibres organ cultured for 4 days can be used as electrophysiological and morphological models for muscles in vivo denervated for the same length of time. Sodium currents in organ-cultured muscle fibres are similar to innervated fibres except that in the temperature range 0-20 degrees C (a) in the steady state, the voltage distribution of inactivation in cultured fibres is shifted negatively some 20 mV; (b) at the same temperature and membrane potential, the time constant of inactivation in cultured fibres is about twice that of innervated fibres. Potassium currents in innervated and cultured fibres at 15 degrees C can be fitted with the Hodgkin-Huxley n variable raised to the second power. Despite the large range we would estimate that the maximum value of the steady-state potassium conductance of cultured fibres is about one-half that of innervated fibres. The estimated maximum amount of charge moved in cultured fibre is about one-third that in innervated fibres. Compared to innervated fibres, culturing doubles the kinetics of the decay phase of charge movement. The possibility of a negative shift of the voltage distribution of charge movements in cultured fibres is discussed.

  14. A spot laser modulated resistance switching effect observed on n-type Mn-doped ZnO/SiO2/Si structure.

    PubMed

    Lu, Jing; Tu, Xinglong; Yin, Guilin; Wang, Hui; He, Dannong

    2017-11-09

    In this work, a spot laser modulated resistance switching (RS) effect is firstly observed on n-type Mn-doped ZnO/SiO 2 /Si structure by growing n-type Mn-doped ZnO film on Si wafer covered with a 1.2 nm native SiO 2 , which has a resistivity in the range of 50-80 Ω∙cm. The I-V curve obtained in dark condition evidences the structure a rectifying junction, which is further confirmed by placing external bias. Compared to the resistance state modulated by electric field only in dark (without illumination), the switching voltage driving the resistance state of the structure from one state to the other, shows clear shift under a spot laser illumination. Remarkably, the switching voltage shift shows a dual dependence on the illumination position and power of the spot laser. We ascribe this dual dependence to the electric filed produced by the redistribution of photo-generated carriers, which enhance the internal barrier of the hetero-junction. A complete theoretical analysis based on junction current and diffusion equation is presented. The dependence of the switching voltage on spot laser illumination makes the n-type Mn-doped ZnO/SiO 2 /Si structure sensitive to light, which thus allows for the integration of an extra functionality in the ZnO-based photoelectric device.

  15. Modeling and Simulation of Linear and Nonlinear MEMS Scale Electromagnetic Energy Harvesters for Random Vibration Environments

    PubMed Central

    Sassani, Farrokh

    2014-01-01

    The simulation results for electromagnetic energy harvesters (EMEHs) under broad band stationary Gaussian random excitations indicate the importance of both a high transformation factor and a high mechanical quality factor to achieve favourable mean power, mean square load voltage, and output spectral density. The optimum load is different for random vibrations and for sinusoidal vibration. Reducing the total damping ratio under band-limited random excitation yields a higher mean square load voltage. Reduced bandwidth resulting from decreased mechanical damping can be compensated by increasing the electrical damping (transformation factor) leading to a higher mean square load voltage and power. Nonlinear EMEHs with a Duffing spring and with linear plus cubic damping are modeled using the method of statistical linearization. These nonlinear EMEHs exhibit approximately linear behaviour under low levels of broadband stationary Gaussian random vibration; however, at higher levels of such excitation the central (resonant) frequency of the spectral density of the output voltage shifts due to the increased nonlinear stiffness and the bandwidth broadens slightly. Nonlinear EMEHs exhibit lower maximum output voltage and central frequency of the spectral density with nonlinear damping compared to linear damping. Stronger nonlinear damping yields broader bandwidths at stable resonant frequency. PMID:24605063

  16. Neutralisation of a single voltage sensor affects gating determinants in all four pore-forming S6 segments of Ca(V)1.2: a cooperative gating model.

    PubMed

    Beyl, Stanislav; Depil, Katrin; Hohaus, Annette; Stary-Weinzinger, Anna; Linder, Tobias; Timin, Eugen; Hering, Steffen

    2012-10-01

    Voltage sensors trigger the closed-open transitions in the pore of voltage-gated ion channels. To probe the transmission of voltage sensor signalling to the channel pore of Ca(V)1.2, we investigated how elimination of positive charges in the S4 segments (charged residues were replaced by neutral glutamine) modulates gating perturbations induced by mutations in pore-lining S6 segments. Neutralisation of all positively charged residues in IIS4 produced a functional channel (IIS4(N)), while replacement of the charged residues in IS4, IIIS4 and IVS4 segments resulted in nonfunctional channels. The IIS4(N) channel displayed activation kinetics similar to wild type. Mutations in a highly conserved structure motif on S6 segments ("GAGA ring": G432W in IS6, A780T in IIS6, G1193T in IIIS6 and A1503G in IVS6) induce strong left-shifted activation curves and decelerated channel deactivation kinetics. When IIS4(N) was combined with these mutations, the activation curves were shifted back towards wild type and current kinetics were accelerated. In contrast, 12 other mutations adjacent to the GAGA ring in IS6-IVS6, which also affect activation gating, were not rescued by IIS4(N). Thus, the rescue of gating distortions in segments IS6-IVS6 by IIS4(N) is highly position-specific. Thermodynamic cycle analysis supports the hypothesis that IIS4 is energetically coupled with the distantly located GAGA residues. We speculate that conformational changes caused by neutralisation of IIS4 are not restricted to domain II (IIS6) but are transmitted to gating structures in domains I, III and IV via the GAGA ring.

  17. Effect of oxygen, moisture and illumination on the stability and reliability of dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (DNTT) OTFTs during operation and storage.

    PubMed

    Ding, Ziqian; Abbas, Gamal; Assender, Hazel E; Morrison, John J; Yeates, Stephen G; Patchett, Eifion R; Taylor, D Martin

    2014-09-10

    We report a systemic study of the stability of organic thin film transistors (OTFTs) both in storage and under operation. Apart from a thin polystyrene buffer layer spin-coated onto the gate dielectric, the constituent parts of the OTFTs were all prepared by vacuum evaporation. The OTFTs are based on the semiconducting small molecule dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (DNTT) deposited onto the surface of a polystyrene-buffered in situ polymerized diacrylate gate insulator. Over a period of 9 months, no degradation of the hole mobility occurred in devices stored either in the dark in dry air or in uncontrolled air and normal laboratory fluorescent lighting conditions. In the latter case, rather than decreasing, the mobility actually increased almost 2-fold to 1.5 cm(2)/(V · s). The devices also showed good stability during repeat on/off cycles in the dark in dry air. Exposure to oxygen and light during the on/off cycles led to a positive shift of the transfer curves due to electron trapping when the DNTT was biased into depletion by the application of positive gate voltage. When operated in accumulation, negative gate voltage under the same conditions, the transfer curves were stable. When voltage cycling in moist air in the dark, the transfer curves shifted to negative voltages, thought to be due to the generation of hole traps either in the semiconductor or its interface with the dielectric layer. When subjected to gate bias stress in dry air in the dark for at least 144 h, the device characteristics remained stable.

  18. Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide.

    PubMed

    Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício

    2015-02-01

    This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. 29 CFR 1926.952 - Mechanical equipment.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... of each shift during which the equipment is to be used to determine that the brakes and operating systems are in proper working condition. (3) No employer shall use any motor vehicle equipment having an... certified for work on the proper voltage, mechanical equipment shall not be operated closer to any energized...

  20. 29 CFR 1926.952 - Mechanical equipment.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... of each shift during which the equipment is to be used to determine that the brakes and operating systems are in proper working condition. (3) No employer shall use any motor vehicle equipment having an... certified for work on the proper voltage, mechanical equipment shall not be operated closer to any energized...

  1. Miniature Piezoelectric Macro-Mass Balance

    NASA Technical Reports Server (NTRS)

    Sherrit, Stewart; Trebi-Ollennu, Ashitey; Bonitz, Robert G.; Bar-Cohen, Yoseph

    2010-01-01

    Mass balances usually use a strain gauge that requires an impedance measurement and is susceptible to noise and thermal drift. A piezoelectric balance can be used to measure mass directly by monitoring the voltage developed across the piezoelectric balance, which is linear with weight or it can be used in resonance to produce a frequency change proportional to the mass change (see figure). The piezoelectric actuator/balance is swept in frequency through its fundamental resonance. If a small mass is added to the balance, the resonance frequency shifts down in proportion to the mass. By monitoring the frequency shift, the mass can be determined. This design allows for two independent measurements of mass. Additionally, more than one sample can be verified because this invention allows for each sample to be transported away from the measuring device upon completion of the measurement, if required. A piezoelectric actuator, or many piezoelectric actuators, was placed between the collection plate of the sampling system and the support structure. As the sample mass is added to the plate, the piezoelectrics are stressed, causing them to produce a voltage that is proportional to the mass and acceleration. In addition, a change in mass delta m produces a change in the resonance frequency with delta f proportional to delta m. In a microgravity environment, the spacecraft could be accelerated to produce a force on the piezoelectric actuator that would produce a voltage proportional to the mass and acceleration. Alternatively, the acceleration could be used to force the mass on the plate, and the inertial effects of the mass on the plate would produce a shift in the resonance frequency with the change in frequency related to the mass change. Three prototypes of the mass balance mechanism were developed. These macro-mass balances each consist of a solid base and an APA 60 Cedrat flextensional piezoelectric actuator supporting a measuring plate. A similar structure with 3 APA 120 Cedrat flextensional piezoelectric actuators spaced equidistantly at 120 degrees supporting the plate and a softer macro balance with an APA 150 actuator/sensor were developed. These flextensional actuators were chosen because they increase the sensitivity of the actuator to stress, allow the piezoelectric to be pre-stressed, and the piezoelectric element is a stacked multilayer actuator, which has a considerably lower input impedance than a monolithic element that allows for common instruments (e.g., input impedance of 10 megohms) to measure the voltage without rapidly discharging the charge/voltage on the piezoelectric actuator.

  2. Quantum-Chemical Approach to NMR Chemical Shifts in Paramagnetic Solids Applied to LiFePO4 and LiCoPO4.

    PubMed

    Mondal, Arobendo; Kaupp, Martin

    2018-04-05

    A novel protocol to compute and analyze NMR chemical shifts for extended paramagnetic solids, accounting comprehensively for Fermi-contact (FC), pseudocontact (PC), and orbital shifts, is reported and applied to the important lithium ion battery cathode materials LiFePO 4 and LiCoPO 4 . Using an EPR-parameter-based ansatz, the approach combines periodic (hybrid) DFT computation of hyperfine and orbital-shielding tensors with an incremental cluster model for g- and zero-field-splitting (ZFS) D-tensors. The cluster model allows the use of advanced multireference wave function methods (such as CASSCF or NEVPT2). Application of this protocol shows that the 7 Li shifts in the high-voltage cathode material LiCoPO 4 are dominated by spin-orbit-induced PC contributions, in contrast with previous assumptions, fundamentally changing interpretations of the shifts in terms of covalency. PC contributions are smaller for the 7 Li shifts of the related LiFePO 4 , where FC and orbital shifts dominate. The 31 P shifts of both materials finally are almost pure FC shifts. Nevertheless, large ZFS contributions can give rise to non-Curie temperature dependences for both 7 Li and 31 P shifts.

  3. Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.

    PubMed

    Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo

    2012-10-16

    The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.

  4. Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP

    PubMed Central

    Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo

    2013-01-01

    The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304

  5. Sensitivity-Enhanced CMOS Phase Luminometry System Using Xerogel-Based Sensors.

    PubMed

    Lei Yao; Khan, R; Chodavarapu, V P; Tripathi, V S; Bright, F V

    2009-10-01

    We present the design and implementation of a phase luminometry sensor system with improved and tunable detection sensitivity achieved using a complementary metal-oxide semiconductor (CMOS) integrated circuit. We use sol-gel derived xerogel thin films as an immobilization media to house oxygen (O2) responsive luminescent molecules. The sensor operates on the principal of phase luminometry wherein a sinusoidal modulation signal is used to excite the luminophores encapsulated in the porous xerogel films and the corresponding phase shift of the emission signals is monitored. The phase shift is directly related to excited state lifetimes of the luminophores which in turn are related to the concentration of the target analyte species present in the vicinity of the luminophores. The CMOS IC, which consists of a 16 times 16 high-gain phototransistor array, current-to-voltage converter, amplifier and tunable phase shift detector, consumes an average power of 14 mW with 5-V power supply operating at a 38-kHz modulation frequency. The output of the IC is a dc voltage that corresponds to the detected luminescence phase shift with respect to the excitation signal. As a prototype, we demonstrate an oxygen sensor system by encapsulating the luminophore tris(4,7-diphenyl-1,10-phenanthroline)ruthenium(II) within the xerogel matrices. The sensor system showed a fast response on the order of few seconds and we obtained a detection sensitivity of 118 mV per 1% change in O2 concentration. The system demonstrates a novel concept to tune and improve the detection sensitivity for specific concentrations of the target analyte in many biomedical monitoring applications.

  6. Correlation of interface states/border traps and threshold voltage shift on AlGaN/GaN metal-insulator-semiconductor high-electron-mobility transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Tian-Li, E-mail: Tian-Li.Wu@imec.be; Groeseneken, Guido; Department of Electrical Engineering, KU Leuven, Leuven

    2015-08-31

    In this paper, three electrical techniques (frequency dependent conductance analysis, AC transconductance (AC-g{sub m}), and positive gate bias stress) were used to evaluate three different gate dielectrics (Plasma-Enhanced Atomic Layer Deposition Si{sub 3}N{sub 4}, Rapid Thermal Chemical Vapor Deposition Si{sub 3}N{sub 4}, and Atomic Layer Deposition (ALD) Al{sub 2}O{sub 3}) for AlGaN/GaN Metal-Insulator-Semiconductor High-Electron-Mobility Transistors. From these measurements, the interface state density (D{sub it}), the amount of border traps, and the threshold voltage (V{sub TH}) shift during a positive gate bias stress can be obtained. The results show that the V{sub TH} shift during a positive gate bias stress ismore » highly correlated to not only interface states but also border traps in the dielectric. A physical model is proposed describing that electrons can be trapped by both interface states and border traps. Therefore, in order to minimize the V{sub TH} shift during a positive gate bias stress, the gate dielectric needs to have a lower interface state density and less border traps. However, the results also show that the commonly used frequency dependent conductance analysis technique to extract D{sub it} needs to be cautiously used since the resulting value might be influenced by the border traps and, vice versa, i.e., the g{sub m} dispersion commonly attributed to border traps might be influenced by interface states.« less

  7. Chloride and salicylate influence prestin-dependent specific membrane capacitance: support for the area motor model.

    PubMed

    Santos-Sacchi, Joseph; Song, Lei

    2014-04-11

    The outer hair cell is electromotile, its membrane motor identified as the protein SLC26a5 (prestin). An area motor model, based on two-state Boltzmann statistics, was developed about two decades ago and derives from the observation that outer hair cell surface area is voltage-dependent. Indeed, aside from the nonlinear capacitance imparted by the voltage sensor charge movement of prestin, linear capacitance (Clin) also displays voltage dependence as motors move between expanded and compact states. Naturally, motor surface area changes alter membrane capacitance. Unit linear motor capacitance fluctuation (δCsa) is on the order of 140 zeptofarads. A recent three-state model of prestin provides an alternative view, suggesting that voltage-dependent linear capacitance changes are not real but only apparent because the two component Boltzmann functions shift their midpoint voltages (Vh) in opposite directions during treatment with salicylate, a known competitor of required chloride binding. We show here using manipulations of nonlinear capacitance with both salicylate and chloride that an enhanced area motor model, including augmented δCsa by salicylate, can accurately account for our novel findings. We also show that although the three-state model implicitly avoids measuring voltage-dependent motor capacitance, it registers δCsa effects as a byproduct of its assessment of Clin, which increases during salicylate treatment as motors are locked in the expanded state. The area motor model, in contrast, captures the characteristics of the voltage dependence of δCsa, leading to a better understanding of prestin.

  8. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G.

    2015-06-15

    We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling.more » The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.« less

  9. Performance of dual inverter fed open end winding induction motor drive using carrier shift PWM techniques

    NASA Astrophysics Data System (ADS)

    Priya Darshini, B.; Ranjit, M.; Babu, V. Ramesh

    2018-04-01

    In this paper different Multicarrier PWM (MCPWM) techniques are proposed for dual inverter fed open end induction motor (IM) drive to achieve multilevel operation. To generate the switching pulses for the dual inverter sinusoidal modulating signal is compared with multi carrier signals. A common mode voltage (CMV) has been analyzed in the proposed open end winding induction motor drive. All the proposed techniques mitigate the CMV along with the harmonic distortion in the phase voltage. To authenticate the proposed work several simulation techniques have been carried out using MATLAB/SIMULINK and the corresponding results are presented and compared.

  10. Probing the function of neuronal populations: combining micromirror-based optogenetic photostimulation with voltage-sensitive dye imaging

    PubMed Central

    Tsuda, Sachiko; Kee, Michelle Z.L.; Cunha, Catarina; Kim, Jinsook; Yan, Ping; Loew, Leslie M.; Augustine, George J.

    2013-01-01

    Recent advances in our understanding of brain function have come from using light to either control or image neuronal activity. Here we describe an approach that combines both techniques: a micromirror array is used to photostimulate populations of presynaptic neurons expressing channelrhodopsin-2, while a red-shifted voltage-sensitive dye allows optical detection of resulting postsynaptic activity. Such technology allowed us to control the activity of cerebellar interneurons while simultaneously recording inhibitory responses in multiple Purkinje neurons, their postsynaptic targets. This approach should substantially accelerate our understanding of information processing by populations of neurons within brain circuits. PMID:23254260

  11. Synchronization algorithm for three-phase voltages of an inverter and a grid

    NASA Astrophysics Data System (ADS)

    Nos, O. V.

    2017-07-01

    This paper presents the results of designing a joint phase-locked loop for adjusting the phase shifts (speed) and Euclidean norm of three-phase voltages of an inverter to the same grid parameters. The design can be used, in particular, to match the potentials of two parallel-connected power sources for the fundamental harmonic at the moments of switching the stator windings of an induction AC motor from a converter to a centralized power-supply system and back. Technical implementation of the developed synchronization algorithm will significantly reduce the inductance of the current-balancing reactor and exclude emergency operation modes in the electric motor power circuit.

  12. Voltage-dependent Ca2+ release from the SR of feline ventricular myocytes is explained by Ca2+-induced Ca2+ release.

    PubMed

    Piacentino, V; Dipla, K; Gaughan, J P; Houser, S R

    2000-03-15

    1. Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. 2. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3',5'-monophosphate (cAMP) in the pipette or in the presence of the beta-adrenergic agonist isoproterenol (isoprenaline; ISO). 3. The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. 4. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (VŁ = -57.8 +/- 0.49 mV). 5. ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. 6. The voltage-contraction relationship in 200 microM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. 7. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis.

  13. Differential inhibition of N and P/Q Ca2+ currents by 5-HT1A and 5-HT1D receptors in spinal neurons of Xenopus larvae

    PubMed Central

    Sun, Qian-Quan; Dale, Nicholas

    1998-01-01

    In whole-cell patch clamp recordings made from non-sensory neurons acutely isolated from the spinal cord of Xenopus (stage 40–42) larvae, two forms of inhibition of the high voltage-activated (HVA) Ca2+ currents were produced by 5-HT. One was voltage dependent and associated with both slowing of the activation kinetics and shifting of the voltage dependence of the HVA currents. This inhibition was relieved by strong depolarizing prepulses. A second form of inhibition was neither associated with slowing of the activation kinetics nor relieved by depolarizing prepulses and was thus voltage independent. In all neurons examined, 5-HT (1 μM) reversibly reduced 34 ± 1.6 % (n = 102) of the HVA Ca2+ currents. In about 40 % of neurons, the inhibition was totally voltage independent. In another 5 %, the inhibition was totally voltage dependent. In the remaining neurons, inhibition was only partially (by around 40 %) relieved by a large depolarizing prepulse, suggesting that in these, the inhibition consisted of both voltage-dependent and -independent components. By using selective channel blockers, we found that 5-HT acted on both N- and P/Q-type channels. However, whereas the inhibition of P/Q-type currents was only voltage independent, the inhibition of N-type currents had both voltage-dependent and -independent components. The effects of 5-HT on HVA Ca2+ currents were mediated by 5-HT1A and 5-HT1D receptors. The 5-HT1A receptors not only preferentially caused voltage-independent inhibition, but did so by acting mainly on the ω-agatoxin-IVA-sensitive Ca2+ channels. In contrast, the 5-HT1D receptor produced both voltage-dependent and -independent inhibition and was preferentially coupled to ω-conotoxin-GVIA sensitive channels. This complexity of modulation may allow fine tuning of transmitter release and calcium signalling in the spinal circuitry of Xenopus larvae. PMID:9625870

  14. Design and measurement of fully digital ternary content addressable memory using ratioless static random access memory cells and hierarchical-AND matching comparator

    NASA Astrophysics Data System (ADS)

    Nishikata, Daisuke; Ali, Mohammad Alimudin Bin Mohd; Hosoda, Kento; Matsumoto, Hiroshi; Nakamura, Kazuyuki

    2018-04-01

    A 36-bit × 32-entry fully digital ternary content addressable memory (TCAM) using the ratioless static random access memory (RL-SRAM) technology and fully complementary hierarchical-AND matching comparators (HAMCs) was developed. Since its fully complementary and digital operation enables the effect of device variabilities to be avoided, it can operate with a quite low supply voltage. A test chip incorporating a conventional TCAM and a proposed 24-transistor ratioless TCAM (RL-TCAM) cells and HAMCs was developed using a 0.18 µm CMOS process. The minimum operating voltage of 0.25 V of the developed RL-TCAM, which is less than half of that of the conventional TCAM, was measured via the conventional CMOS push–pull output buffers with the level-shifting and flipping technique using optimized pull-up voltage and resistors.

  15. A tunable acoustic metamaterial with double-negativity driven by electromagnets

    PubMed Central

    Chen, Zhe; Xue, Cheng; Fan, Li; Zhang, Shu-yi; Li, Xiao-juan; Zhang, Hui; Ding, Jin

    2016-01-01

    With the advance of the research on acoustic metamaterials, the limits of passive metamaterials have been observed, which prompts the studies concerning actively tunable metamaterials with adjustable characteristic frequency bands. In this work, we present a tunable acoustic metamaterial with double-negativity composed of periodical membranes and side holes, in which the double-negativity pass band can be controlled by an external direct-current voltage. The tension and stiffness of the periodically arranged membranes are actively controlled by electromagnets producing additional stresses, and thus, the transmission and phase velocity of the metamaterial can be adjusted by the driving voltage of the electromagnets. It is demonstrated that a tiny direct-current voltage of 6V can arise a shift of double-negativity pass band by 40% bandwidth, which exhibits that it is an easily controlled and highly tunable acoustic metamaterial, and furthermore, the metamaterial marginally causes electromagnetic interference to the surroundings. PMID:27443196

  16. Structural basis of lipid-driven conformational transitions in the KvAP voltage-sensing domain.

    PubMed

    Li, Qufei; Wanderling, Sherry; Sompornpisut, Pornthep; Perozo, Eduardo

    2014-02-01

    Voltage-gated ion channels respond to transmembrane electric fields through reorientations of the positively charged S4 helix within the voltage-sensing domain (VSD). Despite a wealth of structural and functional data, the details of this conformational change remain controversial. Recent electrophysiological evidence showed that equilibrium between the resting ('down') and activated ('up') conformations of the KvAP VSD from Aeropyrum pernix can be biased through reconstitution in lipids with or without phosphate groups. We investigated the structural transition between these functional states, using site-directed spin-labeling and EPR spectroscopic methods. Solvent accessibility and interhelical distance determinations suggest that KvAP gates through S4 movements involving an ∼3-Å upward tilt and simultaneous ∼2-Å axial shift. This motion leads to large accessibly changes in the intracellular water-filled crevice and supports a new model of gating that combines structural rearrangements and electric-field remodeling.

  17. Light-induced hysteresis and recovery behaviors in photochemically activated solution-processed metal-oxide thin-film transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jo, Jeong-Wan; Park, Sung Kyu, E-mail: yhkim76@skku.edu, E-mail: skpark@cau.ac.kr; Kim, Yong-Hoon, E-mail: yhkim76@skku.edu, E-mail: skpark@cau.ac.kr

    2014-07-28

    In this report, photo-induced hysteresis, threshold voltage (V{sub T}) shift, and recovery behaviors in photochemically activated solution-processed indium-gallium-zinc oxide (IGZO) thin-film transistors (TFTs) are investigated. It was observed that a white light illumination caused negative V{sub T} shift along with creation of clockwise hysteresis in electrical characteristics which can be attributed to photo-generated doubly ionized oxygen vacancies at the semiconductor/gate dielectric interface. More importantly, the photochemically activated IGZO TFTs showed much reduced overall V{sub T} shift compared to thermally annealed TFTs. Reduced number of donor-like interface states creation under light illumination and more facile neutralization of ionized oxygen vacancies bymore » electron capture under positive gate potential are claimed to be the origin of the less V{sub T} shift in photochemically activated TFTs.« less

  18. A mixed solution-processed gate dielectric for zinc-tin oxide thin-film transistor and its MIS capacitance

    NASA Astrophysics Data System (ADS)

    Kim, Hunho; Kwack, Young-Jin; Yun, Eui-Jung; Choi, Woon-Seop

    2016-09-01

    Solution-processed gate dielectrics were fabricated with the combined ZrO2 and Al2O3 (ZAO) in the form of mixed and stacked types for oxide thin film transistors (TFTs). ZAO thin films prepared with double coatings for solid gate dielectrics were characterized by analytical tools. For the first time, the capacitance of the oxide semiconductor was extracted from the capacitance-voltage properties of the zinc-tin oxide (ZTO) TFTs with the combined ZAO dielectrics by using the proposed metal-insulator-semiconductor (MIS) structure model. The capacitance evolution of the semiconductor from the TFT model structure described well the threshold voltage shift observed in the ZTO TFT with the ZAO (1:2) gate dielectric. The electrical properties of the ZTO TFT with a ZAO (1:2) gate dielectric showed low voltage driving with a field effect mobility of 37.01 cm2/Vs, a threshold voltage of 2.00 V, an on-to-off current ratio of 1.46 × 105, and a subthreshold slope of 0.10 V/dec.

  19. Temperature dependence of DC transport characteristics for a two-dimensional electron gas in an undoped Si/SiGe heterostructure

    NASA Astrophysics Data System (ADS)

    Chou, Kuan-Yu; Hsu, Nai-Wen; Su, Yi-Hsin; Chou, Chung-Tao; Chiu, Po-Yuan; Chuang, Yen; Li, Jiun-Yun

    2018-02-01

    We investigate DC characteristics of a two-dimensional electron gas (2DEG) in an undoped Si/SiGe heterostructure and its temperature dependence. An insulated-gate field-effect transistor was fabricated, and transfer characteristics were measured at 4 K-300 K. At low temperatures (T < 45 K), source electrons are injected into the buried 2DEG channel first and drain current increases with the gate voltage. By increasing the gate voltage further, the current saturates followed by a negative transconductance observed, which can be attributed to electron tunneling from the buried channel to the surface channel. Finally, the drain current is saturated again at large gate biases due to parallel conduction of buried and surface channels. By increasing the temperature, an abrupt increase in threshold voltage is observed at T ˜ 45 K and it is speculated that negatively charged impurities at the Al2O3/Si interface are responsible for the threshold voltage shift. At T > 45 K, the current saturation and negative transconductance disappear and the device acts as a normal transistor.

  20. Top-gate organic depletion and inversion transistors with doped channel and injection contact

    NASA Astrophysics Data System (ADS)

    Liu, Xuhai; Kasemann, Daniel; Leo, Karl

    2015-03-01

    Organic field-effect transistors constitute a vibrant research field and open application perspectives in flexible electronics. For a commercial breakthrough, however, significant performance improvements are still needed, e.g., stable and high charge carrier mobility and on-off ratio, tunable threshold voltage, as well as integrability criteria such as n- and p-channel operation and top-gate architecture. Here, we show pentacene-based top-gate organic transistors operated in depletion and inversion regimes, realized by doping source and drain contacts as well as a thin layer of the transistor channel. By varying the doping concentration and the thickness of the doped channel, we control the position of the threshold voltage without degrading on-off ratio or mobility. Capacitance-voltage measurements show that an inversion channel can indeed be formed, e.g., an n-doped channel can be inverted to a p-type inversion channel with highly p-doped contacts. The Cytop polymer dielectric minimizes hysteresis, and the transistors can be biased for prolonged cycles without a shift of threshold voltage, indicating excellent operation stability.

  1. Fabrication and Characteristics of Pentacene/Vanadium Pentoxide Field-Effect Transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Minagawa, M.; Nakai, K.; Baba, A.

    2011-12-23

    Organic field-effect transistors (OFETs) were fabricated using pentacene thin layer, and the effects of inserted Lewis-acid thin layers on electrical properties were investigated. The OFETs have active layers of pentacene and vanadium pentoxide (V{sub 2}O{sub 5}) as a Lewis-acid layer. Typical source-drain current (I{sub DS}) vs. source-drain voltage (V{sub DS}) curves were observed under negative gate voltages (V{sub G}S) application, and the shift of the threshold voltage for FET driving (V{sub t}) to positive side was also observed by V{sub 2}O{sub 5} layer insertion, that is, -2.5 V for device with V{sub 2}O{sub 5} layer and -5.7 V for devicemore » without V{sub 2}O{sub 5} layer. It was thought that charge transfer (CT) complexes which were formed at the interface between pentacene and V{sub 2}O{sub 5} layer were dissociated by the applied gate voltage, and the generated holes seem to contribute to drain current and the apparent V{sub t} improvement.« less

  2. A mixed solution-processed gate dielectric for zinc-tin oxide thin-film transistor and its MIS capacitance

    PubMed Central

    Kim, Hunho; Kwack, Young-Jin; Yun, Eui-Jung; Choi, Woon-Seop

    2016-01-01

    Solution-processed gate dielectrics were fabricated with the combined ZrO2 and Al2O3 (ZAO) in the form of mixed and stacked types for oxide thin film transistors (TFTs). ZAO thin films prepared with double coatings for solid gate dielectrics were characterized by analytical tools. For the first time, the capacitance of the oxide semiconductor was extracted from the capacitance-voltage properties of the zinc-tin oxide (ZTO) TFTs with the combined ZAO dielectrics by using the proposed metal-insulator-semiconductor (MIS) structure model. The capacitance evolution of the semiconductor from the TFT model structure described well the threshold voltage shift observed in the ZTO TFT with the ZAO (1:2) gate dielectric. The electrical properties of the ZTO TFT with a ZAO (1:2) gate dielectric showed low voltage driving with a field effect mobility of 37.01 cm2/Vs, a threshold voltage of 2.00 V, an on-to-off current ratio of 1.46 × 105, and a subthreshold slope of 0.10 V/dec. PMID:27641430

  3. Stable organic thin-film transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin

    Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperatureovertimeperiods upto5.9×105 s do not vary monotonically andmore » remain below 0.2 V in microcrystalline OTFTs (mc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V-1 s-1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies.« less

  4. Stable organic thin-film transistors

    DOE PAGES

    Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin; ...

    2018-01-12

    Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperatureovertimeperiods upto5.9×105 s do not vary monotonically andmore » remain below 0.2 V in microcrystalline OTFTs (mc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V-1 s-1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies.« less

  5. Stable organic thin-film transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin

    2018-01-01

    Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperatureovertimeperiods upto5.9×105 s do not vary monotonically andmore » remain below 0.2 V in microcrystalline OTFTs (mc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V−1 s−1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies.« less

  6. Stable organic thin-film transistors

    PubMed Central

    Jia, Xiaojia; Fuentes-Hernandez, Canek; Wang, Cheng-Yin; Park, Youngrak; Kippelen, Bernard

    2018-01-01

    Organic thin-film transistors (OTFTs) can be fabricated at moderate temperatures and through cost-effective solution-based processes on a wide range of low-cost flexible and deformable substrates. Although the charge mobility of state-of-the-art OTFTs is superior to that of amorphous silicon and approaches that of amorphous oxide thin-film transistors (TFTs), their operational stability generally remains inferior and a point of concern for their commercial deployment. We report on an exhaustive characterization of OTFTs with an ultrathin bilayer gate dielectric comprising the amorphous fluoropolymer CYTOP and an Al2O3:HfO2 nanolaminate. Threshold voltage shifts measured at room temperature over time periods up to 5.9 × 105 s do not vary monotonically and remain below 0.2 V in microcrystalline OTFTs (μc-OTFTs) with field-effect carrier mobility values up to 1.6 cm2 V−1 s−1. Modeling of these shifts as a function of time with a double stretched-exponential (DSE) function suggests that two compensating aging mechanisms are at play and responsible for this high stability. The measured threshold voltage shifts at temperatures up to 75°C represent at least a one-order-of-magnitude improvement in the operational stability over previous reports, bringing OTFT technologies to a performance level comparable to that reported in the scientific literature for other commercial TFTs technologies. PMID:29340301

  7. Silicon graphene waveguide tunable broadband microwave photonics phase shifter.

    PubMed

    Capmany, José; Domenech, David; Muñoz, Pascual

    2014-04-07

    We propose the use of silicon graphene waveguides to implement a tunable broadband microwave photonics phase shifter based on integrated ring cavities. Numerical computation results show the feasibility for broadband operation over 40 GHz bandwidth and full 360° radiofrequency phase-shift with a modest voltage excursion of 0.12 volt.

  8. 76 FR 22148 - Petitions for Modification of Application of Existing Mandatory Safety Standards

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-20

    ..., grounded phase, under-voltage, and ground monitoring protection; (b) the trailing cable short-circuit... activated; (c) the solenoid valves will be connected to the CO monitoring system through PLC programming... surface location, either the CO monitoring room or the security station. Either, two miners on each shift...

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Jae-Min; Kim, Doyoung; Kim, Hyungjun

    We investigated the ultraviolet (UV) light photostability of plasma-enhanced and thermal atomic layer deposition of ZnO thin film transistor (TFT). The negative shift of threshold voltage was similarly observed in both cases by UV exposure due to the increment of carrier concentration. Additionally, the transfer curves of TFT using thermal ALD ZnO:N active layer were exhibited recovery characteristics.

  10. Influence of Oil Saturation Upon Spectral Induced Polarization of Oil Bearing Sands

    EPA Science Inventory

    The presence of oil in an unconsolidated granular porous material such as sand changes both the resistivity of the material and the value of the phase shift between the low-frequency current and the voltage. The resistivity and the phase angle can be written as a complex-valued r...

  11. 49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...

  12. 49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...

  13. 49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...

  14. 49 CFR Appendix D to Part 192 - Criteria for Cathodic Protection and Determination of Measurements

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... I. Criteria for cathodic protection— A. Steel, cast iron, and ductile iron structures. (1) A... accordance with sections II and IV of this appendix. This criterion of voltage shift applies to structures... into the structure surface as measured by an earth current technique applied at predetermined current...

  15. Visible-light-induced instability in amorphous metal-oxide based TFTs for transparent electronics

    NASA Astrophysics Data System (ADS)

    Ha, Tae-Jun

    2014-10-01

    We investigate the origin of visible-light-induced instability in amorphous metal-oxide based thin film transistors (oxide-TFTs) for transparent electronics by exploring the shift in threshold voltage (Vth). A large hysteresis window in amorphous indium-gallium-zinc-oxide (a-IGZO) TFTs possessing large optical band-gap (≈3 eV) was observed in a visible-light illuminated condition whereas no hysteresis window was shown in a dark measuring condition. We also report the instability caused by photo irradiation and prolonged gate bias stress in oxide-TFTs. Larger Vth shift was observed after photo-induced stress combined with a negative gate bias than the sum of that after only illumination stress and only negative gate bias stress. Such results can be explained by trapped charges at the interface of semiconductor/dielectric and/or in the gate dielectric which play a role in a screen effect on the electric field applied by gate voltage, for which we propose that the localized-states-assisted transitions by visible-light absorption can be responsible.

  16. A wideband photonic microwave phase shifter with 360-degree phase tunable range based on a DP-QPSK modulator

    NASA Astrophysics Data System (ADS)

    Chen, Yang

    2018-03-01

    A novel wideband photonic microwave phase shifter with 360-degree phase tunable range is proposed based on a single dual-polarization quadrature phase shift-keying (DP-QPSK) modulator. The two dual-parallel Mach-Zehnder modulators (DP-MZMs) in the DP-QPSK modulator are properly biased to serve as a carrier-suppressed single-sideband (CS-SSB) modulator and an optical phase shifter (OPS), respectively. The microwave signal is applied to the CS-SSB modulator, while a control direct-current (DC) voltage is applied to the OPS. The first-order optical sideband generated from the CS-SSB modulator and the phase tunable optical carrier from the OPS are combined and then detected in a photodetector, where a microwave signal is generated with its phase controlled by the DC voltage applied to the OPS. The proposed technique is theoretically analyzed and experimentally demonstrated. Microwave signals with a carrier frequency from 10 to 23 GHz are continuously phase shifted over 360-degree phase range. The proposed technique features very compact configuration, easy phase tuning and wide operation bandwidth.

  17. New Energy-Dependent Soft X-Rav Damage In MOS Devices

    NASA Astrophysics Data System (ADS)

    Chan, Tung-Yi; Gaw, Henry; Seligson, Daniel; Pan, Lawrence; King, Paul L.; Pianetta, Piero

    1988-06-01

    An energy-dependent soft x-ray-induced device damage has been discovered in MOS devices fabricated using standard CMOS process. MOS devices were irradiated by monochromatic x-rays in energy range just above and below the silicon K-edge (1.84 keV). Photons below the K-edge is found to create more damage in the oxide and oxide/silicon interface than photons above the K-edge. This energy-dependent damage effect is believed to be due to charge traps generated during device fabrication. It is found that data for both n- and p-type devices lie along a universal curve if normalized threshold voltage shifts are plotted against absorbed dose in the oxide. The threshold voltage shift saturates when the absorbed dose in the oxide exceeds 1.4X105 mJ/cm3, corresponding to 6 Mrad in the oxide. Using isochronal anneals, the trapped charge damage is found to recover with an activation energy of 0.38 eV. A discrete radiation-induced damage state appears in the low frequency C-V curve in a temperature range from 1750C to 325°C.

  18. Fabrication of arrayed Si nanowire-based nano-floating gate memory devices on flexible plastics.

    PubMed

    Yoon, Changjoon; Jeon, Youngin; Yun, Junggwon; Kim, Sangsig

    2012-01-01

    Arrayed Si nanowire (NW)-based nano-floating gate memory (NFGM) devices with Pt nanoparticles (NPs) embedded in Al2O3 gate layers are successfully constructed on flexible plastics by top-down approaches. Ten arrayed Si NW-based NFGM devices are positioned on the first level. Cross-linked poly-4-vinylphenol (PVP) layers are spin-coated on them as isolation layers between the first and second level, and another ten devices are stacked on the cross-linked PVP isolation layers. The electrical characteristics of the representative Si NW-based NFGM devices on the first and second levels exhibit threshold voltage shifts, indicating the trapping and detrapping of electrons in their NPs nodes. They have an average threshold voltage shift of 2.5 V with good retention times of more than 5 x 10(4) s. Moreover, most of the devices successfully retain their electrical characteristics after about one thousand bending cycles. These well-arrayed and stacked Si NW-based NFGM devices demonstrate the potential of nanowire-based devices for large-scale integration.

  19. Tailoring the charge carrier in few layers MoS2 field-effect transistors by Au metal adsorbate

    NASA Astrophysics Data System (ADS)

    Singh, Arun Kumar; Pandey, Rajiv K.; Prakash, Rajiv; Eom, Jonghwa

    2018-04-01

    It is an essential to tune the charge carrier concentrations in semiconductor in order to approach high-performance of the electronic and optoelectronic devices. Here, we report the effect of thin layer of gold (Au) metal on few layer (FL) molybdenum disulfide (MoS2) by atomic force microscopy (AFM), Raman spectroscopy and electrical charge transport measurements. The Raman spectra and charge transport measurements show that Au thin layer affect the electronic properties of the FL MoS2. After deposition of Au thin layer, the threshold voltages of FL MoS2 field-effect transistors (FETs) shift towards positive gate voltages, this reveal the p-doping in FL MoS2 nanosheets. The shift of peak frequencies of the Raman bands are also analyzed after the deposition of Au metal films of different thickness on FL MoS2 nanosheets. The surface morphology of Au metal on FL MoS2 is characterized by AFM and shows the smoother and denser film in comparison to Au metal on SiO2.

  20. Spatial Light Modulators and Applications: Summaries of Papers Presented at the Spatial Light Modulators and Applications Topical Meeting Held on March 15-17, 1993 in Palm Springs, California

    DTIC Science & Technology

    1993-03-17

    modulator: Number of Elements 16 x 16 Pixel Size 1 mmxl mm Area Fill Factor > 90% Reflectance > 90% Phase Shift 900 Frame Rate > 1 kHz Operational Spectral...electro-optic constants. By using reflected light from the second interface a factor of two increase in phase shift is obtained for an applied voltage vs...wavelengths in general require thinner PLZT wafers. One of the objectives of the SLM design was to maximize pixel area fill factor and thereby the

  1. Modeling and simulation of floating gate nanocrystal FET devices and circuits

    NASA Astrophysics Data System (ADS)

    Hasaneen, El-Sayed A. M.

    The nonvolatile memory market has been growing very fast during the last decade, especially for mobile communication systems. The Semiconductor Industry Association International Technology Roadmap for Semiconductors states that the difficult challenge for nonvolatile semiconductor memories is to achieve reliable, low power, low voltage performance and high-speed write/erase. This can be achieved by aggressive scaling of the nonvolatile memory cells. Unfortunately, scaling down of conventional nonvolatile memory will further degrade the retention time due to the charge loss between the floating gate and drain/source contacts and substrate which makes conventional nonvolatile memory unattractive. Using nanocrystals as charge storage sites reduces dramatically the charge leakage through oxide defects and drain/source contacts. Floating gate nanocrystal nonvolatile memory, FG-NCNVM, is a candidate for future memory because it is advantageous in terms of high-speed write/erase, small size, good scalability, low-voltage, low-power applications, and the capability to store multiple bits per cell. Many studies regarding FG-NCNVMs have been published. Most of them have dealt with fabrication improvements of the devices and device characterizations. Due to the promising FG-NCNVM applications in integrated circuits, there is a need for circuit a simulation model to simulate the electrical characteristics of the floating gate devices. In this thesis, a FG-NCNVM circuit simulation model has been proposed. It is based on the SPICE BSIM simulation model. This model simulates the cell behavior during normal operation. Model validation results have been presented. The SPICE model shows good agreement with experimental results. Current-voltage characteristics, transconductance and unity gain frequency (fT) have been studied showing the effect of the threshold voltage shift (DeltaVth) due to nanocrystal charge on the device characteristics. The threshold voltage shift due to nanocrystal charge has a strong effect on the memory characteristics. Also, the programming operation of the memory cell has been investigated. The tunneling rate from quantum well channel to quantum dot (nanocrystal) gate is calculated. The calculations include various memory parameters, wavefunctions, and energies of quantum well channel and quantum dot gate. The use of floating gate nanocrystal memory as a transistor with a programmable threshold voltage has been demonstrated. The incorporation of FG-NCFETs to design programmable integrated circuit building blocks has been discussed. This includes the design of programmable current and voltage reference circuits. Finally, we demonstrated the design of tunable gain op-amp incorporating FG-NCFETs. Programmable integrated circuit building blocks can be used in intelligent analog and digital systems.

  2. Irreversible modification of sodium channel inactivation in toad myelinated nerve fibres by the oxidant chloramine-T.

    PubMed Central

    Wang, G K

    1984-01-01

    The effects of externally applied chloramine-T on the excitability of single toad myelinated nerve fibres were studied. Chloramine-T is a mild oxidant which reacts specifically with the cysteine and methionine residues of proteins. Chloramine-T prolongs the action potential of a single myelinated fibre by more than 1000-fold. This effect is concentration- and time-dependent; higher concentrations and longer incubation times increase prolongation. Under voltage-clamp conditions, sodium channel inactivation is markedly inhibited by chloramine-T while sodium channel activation remains normal. Prolonged depolarization of the membrane leads to a maintained sodium current. The maintained sodium currents show activation kinetics, dependence on membrane potential, and reversal potentials which are similar to those of normal, inactivating sodium currents in untreated fibres. Both the maintained and the peak sodium currents are equally inhibited by tetrodotoxin. After partial removal of sodium inactivation by brief exposures to chloramine-T, the voltage dependence of the steady-state sodium current inactivation (h infinity) is shifted in the depolarized direction by about 20 mV, even after correction for the non-inactivating component contributed by the maintained current. The phenomena described here imply that cysteine or methionine residues are critical for the sodium channel inactivation processes. The two different modifications of inactivation, its removal shown by the maintained current, and the shift in the voltage-dependence of the remaining inactivatable channels, reveal that at least two separate residues are modified by chloramine-T. PMID:6321714

  3. Protection relay of phase-shifting device with thyristor switch for high voltage power transmission lines

    NASA Astrophysics Data System (ADS)

    Lachugin, V. F.; Panfilov, D. I.; Akhmetov, I. M.; Astashev, M. G.; Shevelev, A. V.

    2014-12-01

    Problems of functioning of differential current protection systems of phase shifting devices (PSD) with mechanically changed coefficient of transformation of shunt transformer are analyzed. Requirements for devices of protection of PSD with thyristor switch are formulated. Based on use of nonlinear models of series-wound and shunt transformers of PSD modes of operation of major protection during PSD, switching to zero load operation and to operation under load and during short circuit operation were studied for testing PSD with failures. Use of the principle of duplicating by devices of differential current protection (with realization of functions of breaking) of failures of separate pares of PSD with thyristor switch was substantiated. To ensure protection sensitivity to the shunt transformer winding short circuit, in particular, to a short circuit that is not implemented in the current differential protection for PSD with mechanical switch, the differential current protection reacting to the amount of primary ampere-turns of high-voltage and low-voltage winding of this transformer was designed. Studies have shown that the use of differential current cutoff instead of overcurrent protection for the shunt transformer wndings allows one to provide the sensitivity during thyristor failure with the formation of a short circuit. The results of simulation mode for the PSD with switch thyristor designed to be installed as switching point of Voskhod-Tatarskaya-Barabinsk 220 kV transmission line point out the efficiency of the developed solutions that ensure reliable functioning of the PSD.

  4. Molecular mechanism of pharmacological activation of BK channels

    PubMed Central

    Gessner, Guido; Cui, Yong-Mei; Otani, Yuko; Ohwada, Tomohiko; Soom, Malle; Hoshi, Toshinori; Heinemann, Stefan H.

    2012-01-01

    Large-conductance voltage- and Ca2+-activated K+ (Slo1 BK) channels serve numerous cellular functions, and their dysregulation is implicated in various diseases. Drugs activating BK channels therefore bear substantial therapeutic potential, but their deployment has been hindered in part because the mode of action remains obscure. Here we provide mechanistic insight into how the dehydroabietic acid derivative Cym04 activates BK channels. As a representative of NS1619-like BK openers, Cym04 reversibly left-shifts the half-activation voltage of Slo1 BK channels. Using an established allosteric BK gating model, the Cym04 effect can be simulated by a shift of the voltage sensor and the ion conduction gate equilibria toward the activated and open state, respectively. BK activation by Cym04 occurs in a splice variant-specific manner; it does not occur in such Slo1 BK channels using an alternative neuronal exon 9, which codes for the linker connecting the transmembrane segment S6 and the cytosolic RCK1 domain—the S6/RCK linker. In addition, Cym04 does not affect Slo1 BK channels with a two-residue deletion within this linker. Mutagenesis and model-based gating analysis revealed that BK openers, such as Cym04 and NS1619 but not mallotoxin, activate BK channels by functionally interacting with the S6/RCK linker, mimicking site-specific shortening of this purported passive spring, which transmits force from the cytosolic gating ring structure to open the channel's gate. PMID:22331907

  5. Ionization asymmetry effects on the properties modulation of atmospheric pressure dielectric barrier discharge sustained by tailored voltage waveforms

    NASA Astrophysics Data System (ADS)

    Zhang, Z. L.; Nie, Q. Y.; Zhang, X. N.; Wang, Z. B.; Kong, F. R.; Jiang, B. H.; Lim, J. W. M.

    2018-04-01

    The dielectric barrier discharge (DBD) is a promising technology to generate high density and uniform cold plasmas in atmospheric pressure gases. The effective independent tuning of key plasma parameters is quite important for both application-focused and fundamental studies. In this paper, based on a one-dimensional fluid model with semi-kinetics treatment, numerical studies of ionization asymmetry effects on the properties modulation of atmospheric DBD sustained by tailored voltage waveforms are reported. The driving voltage waveform is characterized by an asymmetric-slope fundamental sinusoidal radio frequency signal superimposing one or more harmonics, and the effects of the number of harmonics, phase shift, as well as the fluctuation of harmonics on the sheath dynamics, impact ionization of electrons and key plasma parameters are investigated. The results have shown that the electron density can exhibit a substantial increase due to the effective electron heating by a spatially asymmetric sheath structure. The strategic modulation of harmonics number and phase shift is capable of raising the electron density significantly (e.g., nearly three times in this case), but without a significant increase in the gas temperature. Moreover, by tailoring the fluctuation of harmonics with a steeper slope, a more profound efficiency in electron impact ionization can be achieved, and thus enhancing the electron density effectively. This method then enables a novel alternative approach to realize the independent control of the key plasma parameters under atmospheric pressure.

  6. Effect of Channel Thickness, Annealing Temperature and Channel Length on Nanoscale Ga2O3-In2O3-ZnO Thin Film Transistor Performance.

    PubMed

    Kumaresan, Yogeenth; Pak, Yusin; Lim, Namsoo; Lee, Ryeri; Song, Hui; Kim, Tae Heon; Choi, Boran; Jung, Gun Young

    2016-06-01

    We demonstrated the effect of active layer (channel) thickness and annealing temperature on the electrical performances of Ga2O3-In2O3-ZnO (GIZO) thin film transistor (TFT) having nanoscale channel width (W/L: 500 nm/100 μm). We found that the electron carrier concentration of the channel was decreased significantly with increasing the annealing temperature (100 degrees C to 300 degrees C). Accordingly, the threshold voltage (V(T)) was shifted towards positive voltage (-12.2 V to 10.8 V). In case of channel thickness, the V(T) was shifted towards negative voltage with increasing the channel thickness. The device with channel thickness of 90 nm annealed at 200 degrees C revealed the best device performances in terms of mobility (10.86 cm2/Vs) and V(T) (0.8 V). The effect of channel length was also studied, in which the channel width, thickness and annealing temperature were kept constant such as 500 nm, 90 nm and 200 degrees C, respectively. The channel length influenced the on-current level significantly with small variation of V(T), resulting in lower value of on/off current ratio with increasing the channel length. The device with channel length of 0.5 μm showed enhanced on/off current ratio of 10(6) with minimum V(T) of 0.26 V.

  7. Interfacial dynamic surface traps of lead sulfide (PbS) nanocrystals: test-platform for interfacial charge carrier traps at the organic/inorganic functional interface

    NASA Astrophysics Data System (ADS)

    Kim, Youngjun; Ko, Hyungduk; Park, Byoungnam

    2018-04-01

    Nanocrystal (NC) size and ligand dependent dynamic trap formation of lead sulfide (PbS) NCs in contact with an organic semiconductor were investigated using a pentacene/PbS field effect transistor (FET). We used a bilayer pentacene/PbS FET to extract information of the surface traps of PbS NCs at the pentacene/PbS interface through the field effect-induced charge carrier density measurement in the threshold and subthreshold regions. PbS size and ligand dependent trap properties were elucidated by the time domain and threshold voltage measurements in which threshold voltage shift occurs by carrier charging and discharging in the trap states of PbS NCs. The observed threshold voltage shift is interpreted in context of electron trapping through dynamic trap formation associated with PbS NCs. To the best of our knowledge, this is the first demonstration of the presence of interfacial dynamic trap density of PbS NC in contact with an organic semiconductor (pentacene). We found that the dynamic trap density of the PbS NC is size dependent and the carrier residence time in the specific trap sites is more sensitive to NC size variation than to NC ligand exchange. The probing method presented in the study offers a means to investigate the interfacial surface traps at the organic-inorganic hetero-junction, otherwise understanding of the buried surface traps at the functional interface would be elusive.

  8. High sensitivity pH sensing on the BEOL of industrial FDSOI transistors

    NASA Astrophysics Data System (ADS)

    Rahhal, Lama; Ayele, Getenet Tesega; Monfray, Stéphane; Cloarec, Jean-Pierre; Fornacciari, Benjamin; Pardoux, Eric; Chevalier, Celine; Ecoffey, Serge; Drouin, Dominique; Morin, Pierre; Garnier, Philippe; Boeuf, Frederic; Souifi, Abdelkader

    2017-08-01

    In this work we demonstrate the use of Fully Depleted Silicon On Insulator (FDSOI) transistors as pH sensors with a 23 nm silicon nitride sensing layer built in the Back-End-Of-Line (BEOL). The back end process to deposit the sensing layer and fabricate the electrical structures needed for testing is detailed. A series of tests employing different pH buffer solutions has been performed on transistors of different geometries, controlled via the back gate. The main findings show a shift of the drain current (ID) as a function of the back gate voltage (VB) when different pH buffer solutions are probed in the range of pH 6 to pH 8. This shift is observed at VB voltages swept from 0 V to 3 V, demonstrating the sensor operation at low voltage. A high sensitivity of up to 250 mV/pH unit (more than 4-fold larger than Nernstian response) is observed on FDSOI MOS transistors of 0.06 μm gate length and 0.08 μm gate width. She is currently working as a Postdoctoral researcher at Institut des nanotechnologies de Lyon in collaboration with STMicroelectronics and Université de Sherbrook (Canada) working on ;Integration of ultra-low-power gas and pH sensors with advanced technologies;. Her research interest includes selection, machining, optimisation and electrical characterisation of the sensitive layer for a low power consumption gas sensor based on advanced MOS transistors.

  9. De Novo Mutation in the SCN5A Gene Associated with Brugada Syndrome.

    PubMed

    Wang, Lumin; Meng, Xiangyun; Yuchi, Zhiguang; Zhao, Zhenghang; Xu, Dehui; Fedida, David; Wang, Zhuren; Huang, Chen

    2015-01-01

    Brugada syndrome (BrS) is a genetically determined cardiac electrical disorder, characterized by typical electrocardiography (ECG) alterations, and it is an arrhythmogenic syndrome that may lead to sudden cardiac death. The most common genotype found among BrS patients is caused by mutations in the SCN5A gene, which lead to a loss of function of the cardiac sodium (Na(+)) channel (Nav1.5) by different mechanisms. The assay of confocal laser microscopy and western blot were used to identify the expression and location of L812Q at the cell surface. Characterization of Nav1.5 L812Q mutant Na(+) channels was text by patch-clamp recordings, and the PHYRE2 server was used to build a model for human Nav1.5 channel. Here, we report that a novel missense SCN5A mutation, L812Q, localized in the DII-S4 transmembrane region of the Nav1.5 channel protein, was identified in an index patient who showed a typical BrS type-1 ECG phenotype. The mutation was absent in the patient's parents and brother. Heterologous expression of the wild-type (WT) and L812Q mutant Nav1.5 channels in human embryonic kidney cells (HEK293 cells) reveals that the mutation results in a reduction of Na(+) current density as well as ∼20 mV hyperpolarizing shift of the voltage dependence of inactivation. The voltage dependence of activation and the time course for recovery from inactivation are not affected by the mutation. The hyperpolarizing shift of the voltage dependence of inactivation caused a reduction of the Na(+) window current as well. In addition, western blot and confocal laser microscopy imaging experiments showed that the mutation causes fewer channel to be expressed at the membrane than WT channel. A large proportion of the mutant channels are retained in the cytoplasm, probably in the endoplasmic reticulum. The decrease of channel expression, hyperpolarizing shift of voltage dependence of inactivation, and a decline of Na(+) window current caused by L812Q mutation lead to a reduction of Na(+) current during the upstroke and the repolarization phases of cardiac action potential, which contribute to the development of BrS. © 2015 S. Karger AG, Basel.

  10. Paradigm shift in lead design.

    PubMed

    Irnich, W

    1999-09-01

    During the past 30 years there has been a tremendous development in electrode technology from bulky (90 mm2) to pin-sized (1.0 mm2) electrodes. Simultaneously, impedance has increased from 110 Ohms to >1 kOhms, which has been termed a "paradigm shift" in lead design. If current is responsible for stimulation, why is its impedance a key factor in saving energy? Further, what mechanism is behind this development based on experimental findings and what conclusion can be drawn from it to optimize electrode size? If it is assumed that there is always a layer of nonexcitable tissue between the electrode surface and excitable myocardium and that the electric field (potential gradient) produced by the electrode at this boundary is reaching threshold level, then a formula can be derived for the voltage threshold that completely describes the electrophysiology and electrophysics of a hemispherical electrode. Assuming that the mean chronic threshold for porous steroid-eluting electrodes is 0.6 V with 0.5-ms pulse duration, thickness of nonexcitable tissue can be estimated to be 1.5 mm. Taking into account this measure and the relationship between chronaxie and electrode area, voltage threshold, impedance, and energy as a function of surface area can be calculated. The lowest voltage for 0.5-ms pulse duration is reached with r(o) = 0.5 d, yielding a surface area of 4 mm2 and a voltage threshold of 0.62 V, an impedance of 1 kOhms, and an energy level of 197 nJ. It can be deduced from our findings that a further reduction of surface areas below 1.6 mm2 will not diminish energy threshold substantially, if pulse duration remains at 0.5 ms. Lowest energy is reached with t = chronaxie, yielding an energy level <100 nJ with surface areas < or =1.5 mm2. It is striking to see how well the theoretically derived results correspond to the experimental findings. It is also surprising that the hemispheric model so accurately approximates experimental results with differently shaped electrodes that it can be concluded that electrode shape seems to play a minor role in electrode efficiency. Further energy reduction can only be achieved by reducing the pulse duration to chronaxie. A real paradigm shift will occur only if the fundamentals of electrostimulation in combination with electrophysics are accepted by the pacing community.

  11. Controlling the thermoelectric effect by mechanical manipulation of the electron's quantum phase in atomic junctions.

    PubMed

    Aiba, Akira; Demir, Firuz; Kaneko, Satoshi; Fujii, Shintaro; Nishino, Tomoaki; Tsukagoshi, Kazuhito; Saffarzadeh, Alireza; Kirczenow, George; Kiguchi, Manabu

    2017-08-11

    The thermoelectric voltage developed across an atomic metal junction (i.e., a nanostructure in which one or a few atoms connect two metal electrodes) in response to a temperature difference between the electrodes, results from the quantum interference of electrons that pass through the junction multiple times after being scattered by the surrounding defects. Here we report successfully tuning this quantum interference and thus controlling the magnitude and sign of the thermoelectric voltage by applying a mechanical force that deforms the junction. The observed switching of the thermoelectric voltage is reversible and can be cycled many times. Our ab initio and semi-empirical calculations elucidate the detailed mechanism by which the quantum interference is tuned. We show that the applied strain alters the quantum phases of electrons passing through the narrowest part of the junction and hence modifies the electronic quantum interference in the device. Tuning the quantum interference causes the energies of electronic transport resonances to shift, which affects the thermoelectric voltage. These experimental and theoretical studies reveal that Au atomic junctions can be made to exhibit both positive and negative thermoelectric voltages on demand, and demonstrate the importance and tunability of the quantum interference effect in the atomic-scale metal nanostructures.

  12. Modeling development of converter topologies and control for BTB voltage source converters. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, L.

    1998-08-01

    This report presents the results of an investigation into the merits of using a back-to-back voltage source converter (BTB-VSC) as an alternative to a conventional back-to-back high voltage DC link (HVDC). The report presents the basic benefits of the new technology along with the basic control blocks needed to implement the design. The report also describes a model of the BTB-VSC implemented in EMTDC{trademark} and discusses the use of the model. Simulation results, showing how the model responds to various control actions and system disturbances, are presented. This modeling work developed a detailed EMTDC{trademark} model using the appropriate converter technologymore » and magnetic interface configuration. Various possible converter and magnetic interface configurations were examined and the most promising configuration was used for the model. The chosen configuration minimizes the number of high voltage transformers needed and minimizes the complexity non-standard interfacing transformers. There is no need for transformers with phase shifts other than zero or thirty degrees (wye-wye or wye-delta). The only non-standard feature is the necessity of bringing the neutral side of the high voltage winding on the wye-wye unit out through bushings and to insulate the wye-wye transformer for the system voltage which is twice the transformer winding voltage. The developed EMTDC{trademark} model was used to demonstrate the possibility of achieving independent control of the real power transmitted and the voltages at the AC terminals. The model also demonstrates the ability to interconnect weak AC systems without the necessity of additional voltage support equipment as is the case with the conventional back-to-back DC interconnection. The model has been shown to work with short circuit ratios less than 2 based on the total rating of the high voltage transformers.« less

  13. Lateral and Vertical Organic Transistors

    NASA Astrophysics Data System (ADS)

    Al-Shadeedi, Akram

    An extensive study has been performed to provide a better understanding of the operation principles of doped organic field-effect transistors (OFETs), organic p-i-n diodes, Schottky diodes, and organic permeable base transistors (OPBTs). This has been accomplished by a combination of electrical and structural characterization of these devices. The discussion of doped OFETs focuses on the shift of the threshold voltage due to increased doping concentrations and the generation and transport of minority charge carriers. Doping of pentacene OFETs is achieved by co-evaporation of pentacene with the n-dopant W2(hpp)4. It is found that pentacene thin film are efficiently doped and that a conductivity in the range of 2.6 x 10-6 S cm-1 for 1 wt% to 2.5 x 10-4 S cm-1 for 16 wt% is reached. It is shown that n-doped OFET consisting of an n-doped channel and n-doped contacts are ambipolar. This behavior is surprising, as n-doping the contacts should suppress direct injection of minority charge carriers (holes). It was proposed that minority charge carrier injection and hence the ambipolar characteristic of n-doped OFETs can be explained by Zener tunneling inside the intrinsic pentacene layer underneath the drain electrode. It is shown that the electric field in this layer is indeed in the range of the breakdown field of pentacene based p-i-n Zener homodiodes. Doping the channel has a profound influence on the onset voltage of minority (hole) conduction. The onset voltage can be shifted by lightly n-doping the channel. The shift of onset voltage can be explained by two mechanisms: first, due to a larger voltage that has to be applied to the gate in order to fully deplete the n-doped layer. Second, it can be attributed to an increase in hole trapping by inactive dopants. Moreover, it has been shown that the threshold voltage of majority (electron) conduction is shifted by an increase in the doping concentration, and that the ambipolar OFETs can be turned into unipolar OFETs at high doping concentrations. In subsequent chapters, the working mechanisms of OPBTs are discussed. OPBTs consist of two Schottky diodes (top and bottom diode), and the charge transport in these C60-based Schottky diodes is studied first. Two transport regimes can be distinguished in forward direction - injection limited currents (ILCs) and space charge limited currents (SCLCs). It is found that the current increases exponentially with applied voltage in the ILC regime and depends quadratically on the applied voltage in the SCLC regime. Furthermore, it is observed that the forward and backward currents of the Schottky diode are increased by decreasing the C60 layer thickness, increasing the active area, and increasing the temperature. Furthermore, in order to reach a high performance, various treatments have been applied. Air exposure, a variation of the thickness of the top electrode, as well as annealing of the diodes are used to optimize the diodes. OPBTs are processed by using the semiconductor C60 due its high charge carrier mobility and good film-forming properties. Again, the working mechanism of OPBTs is studied by electrical characterization (base-sweep measurements and output characteristics). To achieve a high performance of OPBTs, various treatments and techniques have been applied. The annealing of the OPBTs after fabrication changes the morphology of the base electrode. Thus, openings (pinholes) are formed in the base electrode, which enables a high current transfer from the upper to lower semiconductor layer. The formation of openings is proved by analyzing SEM and TEM image of the base electrode. Adding a doped layer at the emitter is another process to optimize the OPBTs. The doped layer ensures a high charge carrier injection at the emitter, leading to a high transmission and current gain. Furthermore, it has been observed that the ON/OFF ratio and transconductance of OPBTs increases by decreasing their active area. A very high transconductance gm of 37 S/cm2 is reached, which has the potential to boost the switching speed of organic transistors to 5 MHz. Furthermore, it is shown that the base electrode thickness is an essential parameter for OPBTs. The current gain beta decreases by increasing thickness of base electrode, whereas the ON/OFF ratio increases for thicker base electrodes.

  14. Very large phase shift of microwave signals in a 6 nm Hf x Zr1-x O2 ferroelectric at ±3 V

    NASA Astrophysics Data System (ADS)

    Dragoman, Mircea; Modreanu, Mircea; Povey, Ian M.; Iordanescu, Sergiu; Aldrigo, Martino; Romanitan, Cosmin; Vasilache, Dan; Dinescu, Adrian; Dragoman, Daniela

    2017-09-01

    In this letter, we report for the first time very large phase shifts of microwaves in the 1-10 GHz range, in a 1 mm long gold coplanar interdigitated structure deposited over a 6 nm Hf x Zr1-x O2 ferroelectric grown directly on a high resistivity silicon substrate. The phase shift is larger than 60° at 1 GHz and 13° at 10 GHz at maximum applied DC voltages of ±3 V, which can be supplied by a simple commercial battery. In this way, we demonstrate experimentally that the new ferroelectrics based on HfO2 could play an important role in the future development of wireless communication systems for very low power applications.

  15. Synthesis of ultrawideband radiation of combined antenna arrays excited by nanosecond bipolar voltage pulses

    NASA Astrophysics Data System (ADS)

    Koshelev, V. I.; Plisko, V. V.; Sevostyanov, E. A.

    2017-05-01

    To broaden the spectrum of high-power ultrawideband radiation, it is suggested to synthesize an electromagnetic pulse summing the pulses of different length in free space. On the example of model pulses corresponding to radiation of combined antennas excited by bipolar voltage pulses of the length of 2 and 3 ns, the possibility of twofold broadening of the radiation spectrum was demonstrated. Radiation pulses with the spectrum width exceeding three octaves were obtained. Pattern formation by the arrays of different geometry excited by the pulses having different time shifts was considered. Optimum array structure with the pattern maximum in the main direction was demonstrated on the example of a 2×2 array.

  16. Electrically tunable all-dielectric optical metasurfaces based on liquid crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Komar, Andrei; Fang, Zheng; Bohn, Justus

    2017-02-13

    We demonstrate electrical tuning of the spectral response of a Mie-resonant dielectric metasurface consisting of silicon nanodisks embedded into liquid crystals. We use the reorientation of nematic liquid crystals in a moderate applied electric field to alter the anisotropic permittivity tensor around the metasurface. By switching a control voltage ‘on’ and ‘off’ we induce a large spectral shift of the metasurface resonances, resulting in an absolute transmission modulation up to 75%. To the best of our knowledge, this is the first experimental demonstration of voltage control of a dielectric metasurface, paving the way for new types of electrically tunable metadevices,more » including dynamic displays and holograms.« less

  17. Probing the function of neuronal populations: combining micromirror-based optogenetic photostimulation with voltage-sensitive dye imaging.

    PubMed

    Tsuda, Sachiko; Kee, Michelle Z L; Cunha, Catarina; Kim, Jinsook; Yan, Ping; Loew, Leslie M; Augustine, George J

    2013-01-01

    Recent advances in our understanding of brain function have come from using light to either control or image neuronal activity. Here we describe an approach that combines both techniques: a micromirror array is used to photostimulate populations of presynaptic neurons expressing channelrhodopsin-2, while a red-shifted voltage-sensitive dye allows optical detection of resulting postsynaptic activity. Such technology allowed us to control the activity of cerebellar interneurons while simultaneously recording inhibitory responses in multiple Purkinje neurons, their postsynaptic targets. This approach should substantially accelerate our understanding of information processing by populations of neurons within brain circuits. Copyright © 2013 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

  18. Nonvolatile memory with graphene oxide as a charge storage node in nanowire field-effect transistors

    NASA Astrophysics Data System (ADS)

    Baek, David J.; Seol, Myeong-Lok; Choi, Sung-Jin; Moon, Dong-Il; Choi, Yang-Kyu

    2012-02-01

    Through the structural modification of a three-dimensional silicon nanowire field-effect transistor, i.e., a double-gate FinFET, a structural platform was developed which allowed for us to utilize graphene oxide (GO) as a charge trapping layer in a nonvolatile memory device. By creating a nanogap between the gate and the channel, GO was embedded after the complete device fabrication. By applying a proper gate voltage, charge trapping, and de-trapping within the GO was enabled and resulted in large threshold voltage shifts. The employment of GO with FinFET in our work suggests that graphitic materials can potentially play a significant role for future nanoelectronic applications.

  19. Wireless Infrared Data Link

    NASA Technical Reports Server (NTRS)

    Roth, Timothy E.

    1995-01-01

    Infrared transmitter and receiver designed for wireless transmission of information on measured physical quantity (for example, temperature) from transducer device to remote-acquisition system. In transmitter, output of transducer amplified and shifted with respect to bias or reference level, then fed to voltage-to-frequency converter to control frequency of repetition of current pulses applied to infrared-light-emitting diode. In receiver, frequency of repetition of pulses converted back into voltage indicative of temperature or other measured quantity. Potential applications include logging data while drilling for oil, transmitting measurements from rotors in machines without using slip rings, remote monitoring of temperatures and pressures in hazardous locations, and remote continuous monitoring of temperatures and blood pressures in medical patients, who thus remain mobile.

  20. Characterization of SiO2/SiC interface states and channel mobility from MOSFET characteristics including variable-range hopping at cryogenic temperature

    NASA Astrophysics Data System (ADS)

    Yoshioka, Hironori; Hirata, Kazuto

    2018-04-01

    The characteristics of SiC MOSFETs (drain current vs. gate voltage) were measured at 0.14-350 K and analyzed considering variable-range hopping conduction through interface states. The total interface state density was determined to be 5.4×1012 cm-2 from the additional shift in the threshold gate voltage with a temperature change. The wave-function size of interface states was determined from the temperature dependence of the measured hopping current and was comparable to the theoretical value. The channel mobility was approximately 100 cm2V-1s-1 and was almost independent of temperature.

  1. Addressable inverter matrix for process and device characterization

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Sayah, H. R.

    1985-01-01

    The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold vltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

  2. Voltage-dependent Ca2+ release from the SR of feline ventricular myocytes is explained by Ca2+-induced Ca2+ release

    PubMed Central

    Piacentino, Valentino; Dipla, Konstantina; Gaughan, John P; Houser, Steven R

    2000-01-01

    Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 °C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3′,5′-monophosphate (cAMP) in the pipette or in the presence of the β-adrenergic agonist isoproterenol (isoprenaline; ISO). The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (V½ =−57·8 ± 0·49 mV). ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. The voltage-contraction relationship in 200 μM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis. PMID:10718736

  3. An allosteric model of the molecular interactions of excitation- contraction coupling in skeletal muscle

    PubMed Central

    1993-01-01

    A contact interaction is proposed to exist between the voltage sensor of the transverse tubular membrane of skeletal muscle and the calcium release channel of the sarcoplasmic reticulum. This interaction is given a quantitative formulation inspired in the Monod, Wyman, and Changeux model of allosteric transitions in hemoglobin (Monod, J., J. Wyman, and J.-P. Changeux. 1965. Journal of Molecular Biology. 12:88- 118), and analogous to one proposed by Marks and Jones for voltage- dependent Ca channels (Marks, T. N., and S. W. Jones. 1992. Journal of General Physiology. 99:367-390). The allosteric protein is the calcium release channel, a homotetramer, with two accessible states, closed and open. The kinetics and equilibrium of this transition are modulated by voltage sensors (dihydropyridine receptors) pictured as four units per release channel, each undergoing independent voltage-driven transitions between two states (resting and activating). For each voltage sensor that moves to the activating state, the tendency of the channel to open increases by an equal (large) factor. The equilibrium and kinetic equations of the model are solved and shown to reproduce well a number of experimentally measured relationships including: charge movement (Q) vs. voltage, open probability of the release channel (Po) vs. voltage, the transfer function relationship Po vs. Q, and the kinetics of charge movement, release activation, and deactivation. The main consequence of the assumption of allosteric coupling is that primary effects on the release channel are transmitted backward to the voltage sensor and give secondary effects. Thus, the model reproduces well the effects of perchlorate, described in the two previous articles, under the assumption that the primary effect is to increase the intrinsic tendency of the release channel to open, with no direct effects on the voltage sensor. This modification of the open-closed equilibrium of the release channel causes a shift in the equilibrium dependency of charge movement with voltage. The paradoxical slowing of charge movement by perchlorate also results from reciprocal effects of the channel on the allosterically coupled voltage sensors. The observations of the previous articles plus the simulations in this article constitute functional evidence of allosteric transmission. PMID:8245819

  4. Statistical study of generalized nonlinear phase step estimation methods in phase-shifting interferometry.

    PubMed

    Langoju, Rajesh; Patil, Abhijit; Rastogi, Pramod

    2007-11-20

    Signal processing methods based on maximum-likelihood theory, discrete chirp Fourier transform, and spectral estimation methods have enabled accurate measurement of phase in phase-shifting interferometry in the presence of nonlinear response of the piezoelectric transducer to the applied voltage. We present the statistical study of these generalized nonlinear phase step estimation methods to identify the best method by deriving the Cramér-Rao bound. We also address important aspects of these methods for implementation in practical applications and compare the performance of the best-identified method with other bench marking algorithms in the presence of harmonics and noise.

  5. The effects of some inhalation anaesthetics on the sodium current of the squid giant axon.

    PubMed Central

    Haydon, D A; Urban, B W

    1983-01-01

    The effects of diethyl ether, methoxyflurane, halothane, dichloromethane and chloroform on the ionic currents and electrical capacity of the squid giant axon have been examined. The peak inward current in voltage-clamped axons was reduced reversibly by each substance. Sodium currents under voltage clamp were recorded in intracellularly perfused axons before, during, and sometimes after exposure to the test substances, and the records were fitted with equations similar to those proposed by Hodgkin & Huxley (1952). Shifts in the dependence of the steady-state activation and inactivation parameters (m infinity and h infinity) on membrane potential, reductions in the peak heights of the activation and inactivation time constants (tau m and tau h) and decreases in the maximum Na conductance (gNa) have been tabulated. For each of the anaesthetics the steady-state inactivation curve was shifted in the hyperpolarizing direction though less markedly than for the hydrocarbons. The steady-state activation curve was in each instance shifted in the depolarizing direction, as for the alcohols and other surface active substances. In common with both the hydrocarbons and the surface active substances the peak time constants were invariably reduced. The membrane capacity at 100 kHz was affected significantly only by methoxyflurane, where decreases of ca. 9% were observed for 3 mM solutions. The extent to which the results can be accounted for in terms of the perturbation of membrane lipid has been discussed. PMID:6312031

  6. Nano-scale mass sensor based on the vibration analysis of a magneto-electro-elastic nanoplate resting on a visco-Pasternak substrate

    NASA Astrophysics Data System (ADS)

    Khanmirza, E.; Jamalpoor, A.; Kiani, A.

    2017-10-01

    In this paper, a magneto-electro-elastic nanoplate resting on a visco-Pasternak medium with added concentrated nanoparticles is presented as a mass nanosensor according to the vibration analysis. The MEE nanoplate is supposed to be subject to external electric voltage and magnetic potential. In order to take into account the size effect on the sensitivity of the sensor, the nonlocal elasticity theory in conjunction with the Kirchhoff plate theory is applied. Partial differential equations are derived by implementing Hamilton's variational principle. Equilibrium equations were solved analytically to determine an explicit closed-form statement for both the damped frequency shift and the relative damped frequency shift using Navier's approach. A genetic algorithm (GA) is employed to achieve the optimal added nanoparticle location to gain the most sensitivity performance of the nanosensor. Numerical studies are performed to illustrate the variation of the sensitivity property corresponding to various values of the number of attached nanoparticles, the mass of each nanoparticle, the nonlocal parameter, external electric voltage and magnetic potential, the aspect ratio, and visco-Pasternak parameters. Some numerical outcomes of this paper show that the minimum value of the damped frequency shift occurs for a certain value of the length-to-thickness ratio. Also, it is shown that the external magnetic and external electric potentials have a different effect on the sensitivity property. It is anticipated that the results reported in this work can be considered as a benchmark in future micro-structures issues.

  7. Distinct perinatal features of the hyperpolarization-activated non-selective cation current Ih in the rat cortical plate

    PubMed Central

    2012-01-01

    Background During neocortical development, multiple voltage- and ligand-gated ion channels are differentially expressed in neurons thereby shaping their intrinsic electrical properties. One of these voltage-gated ion channels, the hyperpolarization-activated cyclic nucleotide-gated (HCN) channel and its current Ih, is an important regulator of neuronal excitability. Thus far, studies on an early Ih appearance in rodent neocortex are missing or conflicting. Therefore, we focused our study on perinatal neocortical Ih and its properties. Results In the perinatal rat neocortex we observed a rapid increase in the number of neurons exhibiting Ih. Perinatal Ih had unique properties: first, a pronounced cAMP sensitivity resulting in a marked shift of the voltage sufficient for half-maximum activation of the current towards depolarized voltages and second, an up to 10 times slower deactivation at physiological membrane potentials when compared to the one at postnatal day 30. The combination of these features was sufficient to suppress membrane resonance in our in silico and in vitro experiments. Although all four HCN subunits were present on the mRNA level we only detected HCN4, HCN3 and HCN1 on the protein level at P0. HCN1 protein at P0, however, appeared incompletely processed. At P30 glycosilated HCN1 and HCN2 dominated. By in silico simulations and heterologous co-expression experiments of a ‘slow’ and a ‘fast’ Ih conducting HCN channel subunit in HEK293 cells, we mimicked most characteristics of the native current, pointing to a functional combination of subunit homo- or heteromeres. Conclusion Taken together, these data indicate a HCN subunit shift initiated in the first 24 hours after birth and implicate a prominent perinatal role of the phylogenetically older HCN3 and/or HCN4 subunits in the developing neocortex. PMID:22694806

  8. Effect of tunneling layers on the performances of floating-gate based organic thin-film transistor nonvolatile memories

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Wei, E-mail: wwei99@jlu.edu.cn; Han, Jinhua; Ying, Jun

    2014-09-22

    Two types of floating-gate based organic thin-film transistor nonvolatile memories (FG-OTFT-NVMs) were demonstrated, with poly(methyl methacrylate co glycidyl methacrylate) (P(MMA-GMA)) and tetratetracontane (TTC) as the tunneling layer, respectively. Their device performances were measured and compared. In the memory with a P(MMA-GMA) tunneling layer, typical unipolar hole transport was obtained with a relatively small mobility of 0.16 cm{sup 2}/V s. The unidirectional shift of turn-on voltage (V{sub on}) due to only holes trapped/detrapped in/from the floating gate resulted in a small memory window of 12.5 V at programming/erasing voltages (V{sub P}/V{sub E}) of ±100 V and a nonzero reading voltage. Benefited from the well-ordered moleculemore » orientation and the trap-free surface of TTC layer, a considerably high hole mobility of 1.7 cm{sup 2}/V s and a visible feature of electrons accumulated in channel and trapped in floating-gate were achieved in the memory with a TTC tunneling layer. High hole mobility resulted in a high on current and a large memory on/off ratio of 600 at the V{sub P}/V{sub E} of ±100 V. Both holes and electrons were injected into floating-gate and overwritten each other, which resulted in a bidirectional V{sub on} shift. As a result, an enlarged memory window of 28.6 V at the V{sub P}/V{sub E} of ±100 V and a zero reading voltage were achieved. Based on our results, a strategy is proposed to optimize FG-OTFT-NVMs by choosing a right tunneling layer to improve the majority carrier mobility and realize ambipolar carriers injecting and trapping in the floating-gate.« less

  9. A conserved threonine in the S1-S2 loop of KV7.2 and K V7.3 channels regulates voltage-dependent activation.

    PubMed

    Füll, Yvonne; Seebohm, Guiscard; Lerche, Holger; Maljevic, Snezana

    2013-06-01

    The voltage-gated potassium channels KV7.2 and KV7.3 (KCNQ2/3 genes) play an important role in regulating neuronal excitability. More than 50 KCNQ2/3 mutations have been identified to cause an inherited form of epilepsy in newborns. For two of those (E119G and S122L) found in the S1-S2 region of KV7.2, we previously showed a decreased channel availability mainly at action potential subthreshold voltages caused by a slight depolarizing shift of the activation curve. Interestingly, recent studies revealed that a threonine residue within the S1-S2 loop, highly conserved among different classes of KV channels, is crucial for both their function and surface expression. To investigate the functional role of the homologous threonine residues in KV7.2 (T114) and KV7.3 (T144) channels, we replaced them with alanine and examined the electrophysiological properties using heterologous expression in CHO cells and whole cell patch clamping. Channels comprising mutant subunits yielded decreased potassium currents with slowed activation and accelerated deactivation kinetics. However, the most striking effect was a depolarizing shift in the voltage dependence of activation reaching +30 mV upon co-expression of both mutant subunits. Potential interactions of T114 within the channel were analyzed by creating a 3D homology model of KV7.2 in an open state suggesting that this residue plays a central role in the formation of a stable interface between the S1-S2 and the S5 segment helices. This could be the explanation why substitution of the conserved threonine in KV7.2 and KV7.3 channels destabilizes the open and favors the closed state of these channels.

  10. Low operation voltage and high thermal stability of a WSi2 nanocrystal memory device using an Al2O3/HfO2/Al2O3 tunnel layer

    NASA Astrophysics Data System (ADS)

    Uk Lee, Dong; Jun Lee, Hyo; Kyu Kim, Eun; You, Hee-Wook; Cho, Won-Ju

    2012-02-01

    A WSi2 nanocrystal nonvolatile memory device was fabricated with an Al2O3/HfO2/Al2O3 (AHA) tunnel layer and its electrical characteristics were evaluated at 25, 50, 70, 100, and 125 °C. The program/erase (P/E) speed at 125 °C was approximately 500 μs under threshold voltage shifts of 1 V during voltage sweeping of 8 V/-8 V. When the applied pulse voltage was ±9 V for 1 s for the P/E conditions, the memory window at 125 °C was approximately 1.25 V after 105 s. The activation energies for the charge losses of 5%, 10%, 15%, 20%, 25%, 30%, and 35% were approximately 0.05, 0.11, 0.17, 0.21, 0.23, 0.23, and 0.23 eV, respectively. The charge loss mechanisms were direct tunneling and Pool-Frenkel emission between the WSi2 nanocrystals and the AHA barrier engineered tunneling layer. The WSi2 nanocrystal memory device with multi-stacked high-K tunnel layers showed strong potential for applications in nonvolatile memory devices.

  11. Investigation of tunable terahertz metamaterial perfect absorber with anisotropic dielectric liquid crystal

    NASA Astrophysics Data System (ADS)

    Hokmabadi, Mohammad P.; Tareki, Abubaker; Rivera, Elmer; Kung, Patrick; Lindquist, Robert G.; Kim, Seongsin M.

    2017-01-01

    In this letter, we report the unique design, simulation and experimental verification of an electrically tunable THz metamaterial perfect absorber consisting of complementary split ring resonator (CSRR) arrays integrated with liquid crystal as the subwavelength spacer in between. We observe a shift in resonance frequency of about 5.0 GHz at 0.567 THz with a 5 V bias voltage at 1KHz between the CSRR and the metal backplane, while the absorbance and full width at half maximum bandwidth are maintained at 90% and 0.025 THz, respectively. Simulated absorption spectrum by using a uniaxial model of LC matches perfectly the experiment data and demonstrates that the effective refractive index of LC changes between 1.5 and 1.7 by sweeping a 1 kHz bias voltage from 0 V to 5 V. By matching simulation and experiment for different bias voltages, we also estimate the angle of LC molecules versus the bias voltage. Additionally, we study the created THz fields inside the spacer to gain a better insight of the characteristics of tunable response of this device. This structure and associated study can support the design of liquid crystal based tunable terahertz detectors and sensors for various applications.

  12. Characterizing featureless Mott insulating state by quasiparticle interference: A dynamical mean field theory view

    NASA Astrophysics Data System (ADS)

    Mukherjee, Shantanu; Lee, Wei-Cheng

    2015-12-01

    The quasiparticle interferences (QPIs) of the featureless Mott insulators are investigated by a T -matrix formalism implemented with the dynamical mean field theory (T -DMFT). In the Mott insulating state, due to the singularity at zero frequency in the real part of the electron self-energy [Re Σ (ω )˜η /ω ] predicted by DMFT, where η can be considered as the "order parameter" for the Mott insulating state, QPIs are completely washed out at small bias voltages. However, a further analysis shows that Re Σ (ω ) serves as an energy-dependent chemical potential shift. As a result, the effective bias voltage seen by the system is e V'=e V -Re Σ (e V ) , which leads to a critical bias voltage e Vc˜√{η } satisfying e V'=0 if and only if η is nonzero. Consequently, the same QPI patterns produced by the noninteracting Fermi surfaces appear at this critical bias voltage e Vc in the Mott insulating state. We propose that this reentry of noninteracting QPI patterns at e Vc could serve as an experimental signature of the Mott insulating state, and the order parameter can be experimentally measured as η ˜(eVc) 2 .

  13. Performance analysis of resistive switching devices based on BaTiO3 thin films

    NASA Astrophysics Data System (ADS)

    Samardzic, Natasa; Kojic, Tijana; Vukmirovic, Jelena; Tripkovic, Djordjije; Bajac, Branimir; Srdic, Vladimir; Stojanovic, Goran

    2016-03-01

    Resitive switching devices, memristors, have recenty attracted much attention due to promising performances and potential applications in the field of logic and memory devices. Here, we present thin film BaTiO3 based memristor fabricated using ink-jet printing technique. Active material is a single layer barium titanate film with thickness of ̴100 nm, sandwitched between metal electodes. Printing parameters were optimized aiming to achieve stable drop flow and uniform printed layer. Current-voltage characteristics show typical memristive behavior with pinched hysteresis loop crossed at the origin, with marked differences between High Resistive State (HRS) and Low Resistive State (LRS). Obtained resistive states are stable during numerous switching processes. The device also shows unipolar switching effect for negative voltage impulses. Variable voltage impulse amplitudes leads to the shifting of the energy levels of electode contacts resulting in changing of the overall current through the device. Structural charcterization have been performed using XRD analysis and SEM micrography. High-temperature current-voltage measurements combined with transport parameter analysis using Hall efect measurement system (HMS 3000) and Impedance Analyzer AC measurements allows deeper insigth into conduction mechanism of ferroelectric memristors.

  14. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

    PubMed

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  15. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels

    PubMed Central

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447

  16. Epitaxy of Zn{sub 2}TiO{sub 4} (1 1 1) thin films on GaN (0 0 1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hsiao, Chu-Yun; Wu, Jhih-Cheng; Shih, Chuan-Feng, E-mail: cfshih@mail.ncku.edu.tw

    2013-03-15

    Highlights: ► High-permittivity spinel Zn{sub 2}TiO{sub 4} thin films were grown on GaN (0 0 1) by sputtering. ► Oxygen atmosphere and post heat-treatment annealing effectively enhanced epitaxy. ► The epitaxial Zn{sub 2}TiO{sub 4} modifies the dielectric properties of ceramic oxide. - Abstract: High-permittivity spinel Zn{sub 2}TiO{sub 4} thin films were grown on GaN (0 0 1) by rf-sputtering. Grazing-angle, powder, and pole-figure X-ray diffractometries (XRD) were performed to identify the crystallinity and the preferred orientation of the Zn{sub 2}TiO{sub 4} films. Lattice image at the Zn{sub 2}TiO{sub 4} (1 1 1)/GaN (0 0 1) interface was obtained by high-resolutionmore » transmission-electron microscopy (HR-TEM). An oxygen atmosphere in sputtering and post heat-treatment using rapid thermal annealing effectively enhanced the epitaxy. The epitaxial relationship was determined from the XRD and HR-TEM results: (111){sub Zn{sub 2TiO{sub 4}}}||(001){sub GaN}, (202{sup ¯}){sub Zn{sub 2TiO{sub 4}}}||(110){sub GaN},and[21{sup ¯}1{sup ¯}]{sub Zn{sub 2TiO{sub 4}}}||[01{sup ¯}10]{sub GaN}. Finally, the relative permittivity, interfacial trap density and the flat-band voltage of the Zn{sub 2}TiO{sub 4} based capacitor were ∼18.9, 8.38 × 10{sup 11} eV{sup −1} cm{sup −2}, and 1.1 V, respectively, indicating the potential applications of the Zn{sub 2}TiO{sub 4} thin film to the GaN-based metal-oxide-semiconductor capacitor.« less

  17. Comparison of mega-voltage cone-beam computed tomography prostate localization with online ultrasound and fiducial markers methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gayou, Olivier; Miften, Moyed

    2008-02-15

    The online image-guided localization data from 696 ultrasound (United States), 598 mega-voltage cone-beam computed tomography (MV-CBCT), and 393 seed markers (SMs) couch alignments for patients undergoing intensity modulation radiotherapy of the prostate were analyzed. Daily US, MV-CBCT and SM images were acquired for 19, 17 and 12 patients, respectively, after each patient was immobilized in a vacuum cradle and setup to skin markers as the center of mass. The couch shifts applied in the lateral (left-right/LR), vertical (anterior-posterior/AP), and longitudinal (superior-inferior/SI) directions, along with the magnitude of the three-dimensional (3D) shift vector, were analyzed and compared for all three methods.more » The percentage of shifts larger than 5 mm in all directions was also compared. Clinical target volume-planning target volume (CTV-to-PTV) expansion margins were estimated based on the localization data with US, CB, and SM image guidance. Results show the US data have greater variability. Systematic and random shifts were -1.2{+-}6.8 mm (LR), -2.8{+-}5.1 mm (SI) and -1.0{+-}5.9 mm (AP) for US, 1.0{+-}3.9 mm (LR), -1.3{+-}2.5 mm (SI) and -0.3{+-}3.9 mm (AP) for CB, and -1.0{+-}3.4 mm (LR), 0.0{+-}3.4 mm (SI) and 0.5{+-}4.1 mm (AP) for SM. The mean 3D shift distance was larger using US (8.8{+-}6.2 mm) compared to CB and SM (5.3{+-}3.4 mm and 5.2{+-}3.7 mm, respectively). The percentage of US shifts larger than 5 mm were 34%, 31%, and 38% in the LR, SI, and AP directions, respectively, compared to 18%, 6%, and 16% for CB and 14%, 10%, and 20% for SM. MV-CBCT and SM localization data suggest a different distribution of prostate center-of-mass shifts with smaller variability, compared to US. The online MV-CBCT and SM image-guidance data show that for treatments that do not include daily prostate localization, one can use a CTV-to-PTV margin that is 4 mm smaller than the one suggested by US data, hence allowing more rectum and bladder sparing and potentially improving the therapeutic ratio.« less

  18. Interplay of Bias-Driven Charging and the Vibrational Stark Effect in Molecular Junctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yajing; Zolotavin, Pavlo; Doak, Peter

    We observe large, reversible, bias driven changes in the vibrational energies of PCBM based on simultaneous transport and surface-enhanced Raman spectroscopy (SERS) measurements on PCBM-gold junctions. A combination of linear and quadratic shifts in vibrational energies with voltage is analyzed and compared with similar measurements involving C-60-gold junctions. A theoretical model based on density functional theory (DFT) calculations suggests that both a vibrational Stark effect and bias-induced charging of the junction contribute to the shifts in vibrational energies. In the PCBM case, a linear vibrational Stark effect is observed due to the permanent electric dipole moment of PCBM. The vibrationalmore » Stark shifts shown here for PCBM junctions are comparable to or larger than the charging effects that dominate in C-60 junctions.« less

  19. Experimental-Numerical Comparison of the Cantilever MEMS Frequency Shift in presence of a Residual Stress Gradient.

    PubMed

    Ballestra, Alberto; Somà, Aurelio; Pavanello, Renato

    2008-02-06

    The dynamic characterization of a set of gold micro beams by electrostatic excitation in presence of residual stress gradient has been studied experimentally. A method to determine the micro-cantilever residual stress gradient by measuring the deflection and curvature and then identifying the residual stress model by means of frequency shift behaviour is presented. A comparison with different numerical FEM models and experimental results has been carried out, introducing in the model the residual stress of the structures, responsible for an initial upward curvature. Dynamic spectrum data are measured via optical interferometry and experimental frequency shift curves are obtained by increasing the dc voltage applied to the specimens. A good correspondence is pointed out between measures and numerical models so that the residual stress effect can be evaluated for different configurations.

  20. Experimental-Numerical Comparison of the Cantilever MEMS Frequency Shift in presence of a Residual Stress Gradient

    PubMed Central

    Ballestra, Alberto; Somà, Aurelio; Pavanello, Renato

    2008-01-01

    The dynamic characterization of a set of gold micro beams by electrostatic excitation in presence of residual stress gradient has been studied experimentally. A method to determine the micro-cantilever residual stress gradient by measuring the deflection and curvature and then identifying the residual stress model by means of frequency shift behaviour is presented. A comparison with different numerical FEM models and experimental results has been carried out, introducing in the model the residual stress of the structures, responsible for an initial upward curvature. Dynamic spectrum data are measured via optical interferometry and experimental frequency shift curves are obtained by increasing the dc voltage applied to the specimens. A good correspondence is pointed out between measures and numerical models so that the residual stress effect can be evaluated for different configurations. PMID:27879733

Some links on this page may take you to non-federal websites. Their policies may differ from this site.
Top