Sample records for flos lonicerae radix

  1. Lonicerae Japonicae Flos and Lonicerae Flos: A Systematic Pharmacology Review

    PubMed Central

    Li, Yujie; Cai, Weiyan; Weng, Xiaogang; Li, Qi; Wang, Yajie; Chen, Ying; Zhang, Wei; Yang, Qing; Guo, Yan; Zhu, Xiaoxin; Wang, Hainan

    2015-01-01

    Lonicerae japonicae flos, a widely used traditional Chinese medicine (TCM), has been used for several thousand years in China. Chinese Pharmacopeia once included Lonicerae japonicae flos of Caprifoliaceae family and plants of the same species named Lonicerae flos in general in the same group. Chinese Pharmacopeia (2005 Edition) lists Lonicerae japonicae flos and Lonicerae flos under different categories, although they have the similar history of efficacy. In this study, we research ancient books of TCM, 4 main databases of Chinese academic journals, and MEDLINE/PubMed to verify the origins and effects of Lonicerae japonicae flos and Lonicerae flos in traditional medicine and systematically summarized the research data in light of modern pharmacology and toxicology. Our results show that Lonicerae japonicae flos and Lonicerae flos are similar pharmacologically, but they also differ significantly in certain aspects. A comprehensive systematic review and a standard comparative pharmacological study of Lonicerae japonicae flos and Lonicerae flos as well as other species of Lonicerae flos support their clinical safety and application. Our study provides evidence supporting separate listing of Lonicerae japonicae flos and Lonicerae flos in Chinese Pharmacopeia as well as references for revision of relevant pharmacopeial records dealing with traditional efficacy of Lonicerae japonicae flos and Lonicerae flos. PMID:26257818

  2. [Research progress on chemical constituents and their differences between Lonicerae Japonicae Flos and Lonicerae Flos].

    PubMed

    Yang, Qian-Ru; Zhao, Yuan-Yuan; Hao, Jiang-Bo; Li, Wei-Dong

    2016-04-01

    The dried flower buds or initial flowers of Lonicerae Japonicae Flos and Lonicerae Flos, which belong to different species of Lonicera or Caprifoliaceae, are usually taken to clear away heat and toxic material and treat the exopathogenic wind-heat. They are two different herbs, and due to various reasons, there are far more controversies. This paper reviews the research on the chemical constituents and their differences between Lonicerae Japonicae Flos and Lonicerae Flos. Both of them contain the similar chemical constituents, such as organic acids, flavonoids, triterpenoidal saponins, iridoids, volatile oils and trace elements. But there are also differences between them. The main differences:Lonicerae Japonicae Flos contains a wealth of iridoids and flavonoids, while Lonicerae Flos contains more kinds of triterpenoidal saponins; the content of chlorogenic acid in Lonicerae Flos is significantly higher than that of Lonicerae Japonicae Flos; the content of rutin, luteoloside,luteolin-7-O-β-D-galactoside and lonicerin in Lonicerae Japonicae Flos is much higher than that of Lonicerae Flos; the content of Fe and Ni in Lonicerae Japonicae Flos is higher, while the content of Mn is higher in Lonicerae Flos. Finally, main problems and suggestions on chemical composition between Lonicerae Japonicae Flos and Lonicerae Flos were also discussed. Copyright© by the Chinese Pharmaceutical Association.

  3. [Antibacterial activity of 20 kinds of Chinese medicinal materials for Helicobacter pylori in vitro].

    PubMed

    Du, P; Zhu, S; Lü, P

    2001-03-01

    To study the antibacterial activity of 20 Chinese medicinal materials for helicobacter pylori in vitro and the culture of hylicobacter pylori. Doubled-diluted method and tomato juice culture medium were adopted. The detecting ratio of tomato juice culture medium to hylicobacter pylori was equal to that of skirrow culture medium; Radix Scutellariae, Flos Lonicerae, Radix Isatidis, Indigo Naturalis, Fructus Chebulae, Semen Ginkgo, Cortex Phellodendri, Rhizoma Corydalis and Cortex Fraxini have obvious effect of antibacterium to hyliocobater pylori.

  4. [Effect of gas-turbine green discoloring and drying processing methods on herbal quality of tetraploid Lonicerae Japonicae Flos].

    PubMed

    Hu, Xuan; Li, Wei-dong; Li, Ou; Hao, Jiang-bo; Liu, Jia-kun

    2012-09-01

    To study the effect of gas-turbine green discoloring and drying processing method on the quality of various Lonicerae Japonicae Flos herbs. DIKMA DiamonsilTM-C18 column (4.6 mm x 250 mm, 5 microm) was adopted using HPLC Waters 1525 and eluted with acetonitrile and 0.1% phosphate acid as the mobile phase. The flow rate was 1.0 mL x min(-1) , the column temperature was 25 degrees C the detection wavelength was 355 nm. After being processed by the gas-turbine green discoloring and drying method, tetraploid Lonicerae Japonicae Flos showed a green color. The contents of chlorogenic acid and galuteolin were 5.31% and 0.105% , both significantly higher by 18.0% and 32.1% than those of diploid Lonicerae Japonicae Flos processed by the same method. The content of chlorogenic acid in tetraploid Lonicerae Japonicae Flos processed the gas-turbine green discoloring and drying method were also remarkably higher than that of tetraploid and diploid Lonicerae Japonicae Flos processed by traditional processing method of natural drying. The gas-turbine green discoloring and drying processing method is a new-type drying method suitable for tetraploid Lonicerae Japonicae Flos. Under the condition of gas-turbine green discoloring and drying processing, tetraploid Lonicerae Japonicae Flos shows much higher quality than Lonicerae Japonicae Flos, suggesting that it is a good variety worth popularizing and applying.

  5. Characterization and identification of multiple constituents in Yinhuang granules by high-performance liquid chromatography with diode-array and time-of-flight mass spectrometry detection.

    PubMed

    Liu, E-Hu; Liu, Qun; Chu, Chu; Li, Ping

    2011-10-01

    A fast high-performance liquid chromatography (HPLC) method with diode-array detection (DAD) and time-of-flight mass spectrometry (TOF/MS) has been developed for the analysis of multi-constituent in Yinhuang granules, a well-known combined herbal remedy prepared from the extract mixtures of Flos Lonicerae and Radix Scutellariae. The fast HPLC analysis was performed on an Agilent ZorBax SB-C(18) column (4.6×50 mm, 1.8 μm) and 0.2% aqueous formic acid and acetonitrile was the optimum mobile phase for gradient elution in 17 min, which is five times faster than the performance of conventional columns packed with 5.0 μm particles. With various fragmentor voltages in TOF/MS, accurate mass measurements (<5 ppm error) for molecular ions and characteristic fragment ions represented reliable identification criteria for different constituents. A total of 28 compounds, including nine phenolic acids, three iridoid glycosides and nine saponins from Flos Lonicerae and seven flavonoids from Radix Scutellariae, were identified or tentatively characterized in the extract of Yinhuang granules. The established fast HPLC-DAD-TOF/MS method turns out to be useful and efficient for quality control of this commonly used Chinese herbal preparation. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Systematic review for geo-authentic Lonicerae Japonicae Flos.

    PubMed

    Yang, Xingyue; Liu, Yali; Hou, Aijuan; Yang, Yang; Tian, Xin; He, Liyun

    2017-06-01

    In traditional Chinese medicine, Lonicerae Japonicae Flos is commonly used as anti-inflammatory, antiviral, and antipyretic herbal medicine, and geo-authentic herbs are believed to present the highest quality among all samples from different regions. To discuss the current situation and trend of geo-authentic Lonicerae Japonicae Flos, we searched Chinese Biomedicine Literature Database, Chinese Journal Full-text Database, Chinese Scientific Journal Full-text Database, Cochrane Central Register of Controlled Trials, Wanfang, and PubMed. We investigated all studies up to November 2015 pertaining to quality assessment, discrimination, pharmacological effects, planting or processing, or ecological system of geo-authentic Lonicerae Japonicae Flos. Sixty-five studies mainly discussing about chemical fingerprint, component analysis, planting and processing, discrimination between varieties, ecological system, pharmacological effects, and safety were systematically reviewed. By analyzing these studies, we found that the key points of geo-authentic Lonicerae Japonicae Flos research were quality and application. Further studies should focus on improving the quality by selecting the more superior of all varieties and evaluating clinical effectiveness.

  7. Comparison of the Trace Elements and Active Components of Lonicera japonica flos and Lonicera flos Using ICP-MS and HPLC-PDA.

    PubMed

    Zhao, Yueran; Dou, Deqiang; Guo, Yueqiu; Qi, Yue; Li, Jun; Jia, Dong

    2018-06-01

    Thirteen trace elements and active constituents of 40 batches of Lonicera japonica flos and Lonicera flos were comparatively studied using inductively coupled plasma mass-spectrometry (ICP-MS) and high-performance liquid chromatography-photodiode array (HPLC-PDA). The trace elements were 24 Mg, 52 Cr, 55 Mn, 57 Fe, 60 Ni, 63 Cu, 66 Zn, 75 As, 82 Se, 98 Mo, 114 Cd, 202 Hg, and 208 Pb, and the active compounds were chlorogenic acid, 3,5-O-dicaffeoylquinc acid, 4,5-O-dicaffeoylquinc acid, luteolin-7-O-glucoside, and 4-O-caffeoylquinic acid. The data of 18 variables were statistically processed using principal component analysis (PCA) and discriminate analysis (DA) to classify L. japonica flos and L. flos. The validated method was developed to divide the 40 samples into two groups based on the PCA in terms of 18 variables. Furthermore, the species of Lonicera was better discriminated by using DA with 12 variables. These results suggest that the method and statistical analysis of the contents of trace elements and chemical components can classify the L. japonica flos and L. flos using 12 variables, such as 3,5-O-dicaffeoylquincacid, luteolin-7-O-glucoside, Cd, Mn, Hg, Pb, Ni, 4-O-caffeoyl-quinic acid, 4,5-O-dicaffeoylquinc acid, Fe, Mg, and Cr.

  8. [Data mining analysis of regularity of formulas containing Salviae Miltiorrhizae Radix et Rhizoma-Carthami Flos medicin pair in Dictionary of Chinese Medicine Prescription].

    PubMed

    Cui, Yi-Ran; Liu, Xin; Shen, Dan; Yang, Hong-Jun; Tang, Shi-Huan

    2016-02-01

    In this study, formulas containing Salviae Miltiorrhizae Radix et Rhizoma-Carthami Flos in the database of Dictionary of Chinese Medicine Prescription (DCMP) were extracted by using traditional Chinese medicine inheritance support system (TCMISS). The drugs pairs and formula composition rules were analyzed with data mining methods, such as association rules, improved mutual information method and complex system entropy clustering. Totally 39 formulas were included in this study and involved 280 Chinese medicines. The top 5 Chinese medicines most frequently used were Danggui (Angelica sinensis), Chuanxiong (Ligusticum chuanxiong), Xiangfu (Cyperi Rhizoma), Baishao(Radix Paeoniae Alba), Taoren(Prunus persica) and Shengdihuang (Radix Rehmanniae Recens). Six core medicinal pairs were obtained through clustering analysis, namely Danshen (Salviae Miltiorrhizae Radix et Rhizoma)-Xiangfu (Cyperi Rhizoma)-Honghua (Carthami Flos), Danshen (Salviae Miltiorrhizae Radix et Rhizoma)-Baishao (Radix Paeoniae Alba)-Honghua (Carthami Flos), Danshen (Salviae Miltiorrhizae Radix et Rhizoma)-Danggui (A. sinensis)-Xiagnfu (Cyperi Rhizoma)-Honghua (Carthami Flos), Danshen (Salviae Miltiorrhizae Radix et Rhizoma)-Danggui (A. sinensis)-Baishao (Radix Paeoniae Alba)-Honghua (Carthami Flos), Honghua (Carthami Flos)-Danshen (Salviae Miltiorrhizae Radix et Rhizoma)-Baishao (Radix Paeoniae Alba)-Danggui (A. sinensis), Danshen (Salviae Miltiorrhizae Radix et Rhizoma)-Baishao (Radix Paeoniae Alba)-Honghua (Carthami Flos)-Danggui (A. sinensis). The support degree was set at 11 (38.46%), with a confidence coefficient of 80%, and then 38 associated pairs were screened. These results suggested that Salviae Miltiorrhizae Radix et Rhizoma, Carthami Flos is often combined with herbs for activating blood and promoting circulation of qi to treat gynecopathy, stasis blood pain syndrome, stroke and other syndromes. Copyright© by the Chinese Pharmaceutical Association.

  9. [Study on Commercial Specification of Lonicerae Japonicae Flos].

    PubMed

    Zhou, Jie; Zou, Lin; Liu, Wei; Bian, Li-hua; Wang, Xiao; Zhang, Yong-qing; Dan, Staerk

    2015-04-01

    To provide the basis data for the institute of commercial specification standard of Lonicerae Japonicae Flos. 39 samples of Lonicerae Japonicae Flos commercial of different grades in market were collected, and vernier caliper and electronic balance were used to measure the numbers of flower bud and blooming rate per 0. 5 g, contamination content, browning degree, milden and rot, length, upside diameter, middle diameter and bottom diameter of Lonicerae Japonicae Flos. The content of neochlorogenic acid, chlorogenic acid, cryptochlorogenic acid, rutin, galuteolin,3,5-icaffeoylquinic acid and 4,5-dicaffeoylquinic acid were detected by HPLC. Correlation analysis, principal component analysis and cluster analysis were used by SPSS to analyze all index data,and the correlation of appearance characteristics and intrinsic active constituents was discussed. The numbers of flower bud and blooming rate per 0. 5 g, contamination content and browning degree were principal component indexes. The length of flower bud showed a significant correlation with galuteolin content, and the browning degree and upside diameter showed a significant correlation with chlorogenic acid content. Lonicerae Japonicae Flos commercial should be divided into four specification grades by sieved indexes.

  10. Development and Validation of an UPLC-MS/MS Method for Pharmacokinetic Comparison of Five Alkaloids from JinQi Jiangtang Tablets and Its Monarch Drug Coptidis Rhizoma

    PubMed Central

    Sun, Lili; Ding, Feifei; You, Guangjiao; Liu, Han; Wang, Meng; Ren, Xiaoliang; Deng, Yanru

    2017-01-01

    JinQi Jiangtang (JQJT) tablets, a Chinese patent medicine approved by the State Food and Drug Administration, are composed of Coptidis Rhizoma, Astragali Radix, and Lonicerae Japonicae Flos, and have a significant effect on diabetes. Coptidis Rhizoma is monarch drug in the prescription. The aim of the present study was to investigate and compare the pharmacokinetics of multiple ingredients from JQJT tablets and Coptidis Rhizoma extract (CRE) following oral administration in rats. Five alkaloids: coptisine chloride, epiberberine chloride, berberine chloride, jatrorrhizine chloride, and palmatine chloride, were simultaneously determined in rat plasma using established and validated ultra-high performance liquid chromatography mass spectrometry (UPLC-MS/MS). Significant pharmacokinetic differences were observed for the five alkaloids after a single administration of CRE and JQJT tablets. Compared with CRE, the Cmax values of palmatine chloride and jatrorrhizine chloride were decreased significantly, the AUC0–t values of four alkaloids (all except jatrorrhizine chloride) were notably decreased, and the mean residence times of all five alkaloids were significantly decreased after administration of JQJT tablets. The results indicated that the absorption characteristics of the five alkaloids from Coptidis Rhizoma would be influenced by the compatibility of Astragali Radix or Lonicerae Japonicae Flos from JQJT tablets, such that absorption was inhibited and elimination was accelerated. In conclusion, the developed strategy was suitable for the comparison of five alkaloids from JinQi Jiangtang tablets and its monarch drug, which could be valuable for compatibility studies of traditional Chinese medicines. PMID:29286316

  11. [Molecular authentication of Jinyinhua formula granule by using allele-specific PCR].

    PubMed

    Jiang, Chao; Tu, Li-Chan; Yuan, Yuan; Huang, Lu-Qi; Gao, Wei; Jin, Yan

    2017-07-01

    Traditional authentication method is hard to identify herb's authenticity of traditional Chinese medicine(TCM) formula granules because they have lost all their morphological characteristics. In this study, a new allele-specific PCR method was established for identifying the authentication of Jinyinhua formula granule (made from Lonicerae Japonicae Flos) based on an SNP site in trnL-trnF fragment. Genomic DNA was successfully extracted from Lonicerae Japonicae Flos and its formula granules by using an improved spin column method and then PCR was performed with the designed primer. Approximately 110 bp specific bands was obtained only in the authentic Lonicerae Japonicae Flos and its formula granules, while no bands were found in fake mixed products. In addition, the PCR product sequence was proved from Lonicerae Japonicae Flos trnL-trnF sequence by using BLAST method. Therefore, DNA molecular authentication method could make up the limitations of character identification method and microscopic identification, and quickly identify herb's authenticity of TCM formula granules, with enormous potential for market supervision and quality control. Copyright© by the Chinese Pharmaceutical Association.

  12. Rapid identification of Lonicerae japonicae Flos and Lonicerae Flos by Fourier transform infrared (FT-IR) spectroscopy and two-dimensional correlation analysis

    NASA Astrophysics Data System (ADS)

    Yan, Rui; Chen, Jian-bo; Sun, Su-qin; Guo, Bao-lin

    2016-11-01

    Lonicerae japonicae Flos (LJF) and Lonicerae Flos (LF) are widely-used herbs derived from several plants of the genus Lonicera with similar appearances. LF are usually misused or counterfeited as LJF for economically motivated adulteration. However, the saponins in LF may cause serious side-effects. In this research, the infrared spectroscopic tri-step identification approach is used to develop a simple and rapid method to discriminate LJF and LF to ensure the safety and efficacy of these herbal drugs. In the primary identification by Fourier transform infrared spectra, LJF and LF show different peaks near 1534, 1404, and 781 cm-1. In the secondary identification by the second derivative infrared spectra, LJF and LF show more different peaks near 1078, 1050, 988, 923, 855, 815, and 781 cm-1. In the tertiary identification by the two-dimensional correlation infrared spectra, the differences between LJF and LF are shown more remarkably and convincingly. The results show the potential of the infrared spectroscopic tri-step identification approach in the rapid identification of LJF and LF when the samples are too few to build a statistical recognition rule. This should be very helpful to ensure the quality, safety, and efficacy of LJF and LF for clinical applications.

  13. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    PubMed

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  14. Improvement of Intestinal Absorption of Forsythoside A and Chlorogenic Acid by Different Carboxymethyl Chitosan and Chito-oligosaccharide, Application to Flos Lonicerae - Fructus Forsythiae Herb Couple Preparations

    PubMed Central

    Zhou, Wei; Wang, Haidan; Zhu, Xuanxuan; Shan, Jinjun; Yin, Ailing; Cai, Baochang; Di, Liuqing

    2013-01-01

    The current study aims to investigate the effect of chitosan derivatives on the intestinal absorption and bioavailabilities of forsythoside A (FTA) and Chlorogenic acid (CHA), the major active components in Flos Lonicerae - Fructus Forsythiae herb couple. Biopharmaceutics and pharmacokinetics properties of the two compounds have been characterized in vitro, in situ as well as in rats. Based on the identified biopharmaceutics characteristics of the two compounds, the effect of chitosan derivatives as an absorption enhancer on the intestinal absorption and pharmacokinetics of FTA and CHA in pure compound form as well as extract form were investigated in vitro, in situ and in vivo. Both FTA and CHA demonstrated very limited intestinal permeabilities, leading to oral bioavailabilities being only 0.50% and 0.13% in rats, respectively. Results from both in vitro, in situ as well as in vivo studies consistently indicated that Chito-oligosaccharide (COS) at dosage of 25 mg/kg could enhance intestinal permeabilities significantly as well as the in vivo bioavailabilities of both FTA and CHA than CMCs in Flos Lonicerae - Fructus Forsythiae herb couple preparations, and was safe for gastrointestine from morphological observation. Besides, treatment with Flos Lonicerae - Fructus Forsythiae herb couple preparations with COS at the dosage of 25 mg/kg prevented MDCK damage after influenza virus propagation, which was significantly better than control. The current findings not only identified the usefulness of COS for the improved delivery of Flos Lonicerae - Fructus Forsythiae preparations but also demonstrated the importance of biopharmaceutical characterization in the dosage form development of traditional Chinese medicine. PMID:23675483

  15. Spectrum-Effect Relationships Between Chemical Fingerprints and Antibacterial Effects of Lonicerae Japonicae Flos and Lonicerae Flos Base on UPLC and Microcalorimetry

    PubMed Central

    Shi, Zhilong; Liu, Zhenjie; Liu, Chunsheng; Wu, Mingquan; Su, Haibin; Ma, Xiao; Zang, Yimei; Wang, Jiabo; Zhao, Yanling; Xiao, Xiaohe

    2016-01-01

    The traditional Chinese medicines Lonicerae Japonicae Flos (LJF, Jinyinhua in Chinese) and Lonicerae Flos (LF, Shanyinhua in Chinese) refer to the flower buds of five plants belonging to the Caprifoliaceae family. Until 2000, all of these were officially listed as a single item, LJF (Jinyinhua), in the Chinese Pharmacopoeia. However, there have recently been many academic controversies concerning the separation and combination of LJF and LF in administrative regulation. Till now there has been little work completed evaluating the relationships between biological activity and chemical properties among these drugs. Microcalorimetry and UPLC were used along with principal component analysis (PCA), hierarchical cluster analysis (HCA), and canonical correlation analysis (CCA) to investigate the relationships between the chemical ingredients and the antibacterial effects of LJF and LF. Using multivariate statistical analysis, LJF and LF could be initially separated according to their chemical fingerprints, and the antibacterial effects of the two herbal drugs were divided into two clusters. This result supports the disaggregation of LJF and LF by the Pharmacopoeia Committee. However, the sample of Lonicera fulvotomentosa Hsu et S. C. Cheng turned out to be an intermediate species, with similar antibacterial efficacy as LJF. The results of CCA indicated that chlorogenic acid and 3,4-Dicaffeoylquinic acid were the major components generating antibacterial effects. Furthermore, 3,4-Dicaffeoylquinic acid could be used as a new marker ingredient for quality control of LJF and LF. PMID:26869929

  16. Comparative Analysis of the Effects of Hydroxysafflor Yellow A and Anhydrosafflor Yellow B in Safflower Series of Herb Pairs Using Prep-HPLC and a Selective Knock-Out Approach.

    PubMed

    Qu, Cheng; Wang, Lin-Yan; Jin, Wen-Tao; Tang, Yu-Ping; Jin, Yi; Shi, Xu-Qin; Shang, Li-Li; Shang, Er-Xin; Duan, Jin-Ao

    2016-11-06

    The flower of Carthamus tinctorius L. (Carthami Flos, safflower), important in traditional Chinese medicine (TCM), is known for treating blood stasis, coronary heart disease, hypertension, and cerebrovascular disease in clinical and experimental studies. It is widely accepted that hydroxysafflor yellow A (HSYA) and anhydrosafflor yellow B (ASYB) are the major bioactive components of many formulae comprised of safflower. In this study, selective knock-out of target components such as HSYA and ASYB by using preparative high performance liquid chromatography (prep-HPLC) followed by antiplatelet and anticoagulation activities evaluation was used to investigate the roles of bioactive ingredients in safflower series of herb pairs. The results showed that both HSYA and ASYB not only played a direct role in activating blood circulation, but also indirectly made a contribution to the total bioactivity of safflower series of herb pairs. The degree of contribution of HSYA in the safflower and its series herb pairs was as follows: Carthami Flos-Ginseng Radix et Rhizoma Rubra (CF-GR) > Carthami Flos-Sappan Lignum (CF-SL) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Astragali Radix (CF-AR) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Glycyrrhizae Radix et Rhizoma (CF-GL) > Carthami Flos-Salviae Miltiorrhizae Radix et Rhizoma (CF-SM) > Carthami Flos (CF), and the contribution degree of ASYB in the safflower and its series herb pairs: CF-GL > CF-PS > CF-AS > CF-SL > CF-SM > CF-AR > CF-GR > CF. So, this study provided a significant and effective approach to elucidate the contribution of different herbal components to the bioactivity of the herb pair, and clarification of the variation of herb-pair compatibilities. In addition, this study provides guidance for investigating the relationship between herbal compounds and the bioactivities of herb pairs. It also provides a scientific basis for reasonable clinical applications and new drug development on the basis of the safflower series of herb pairs.

  17. [Advantages and problems of traditional Chinese medicine in treatment of acute pharyngitis].

    PubMed

    Zhang, Xia; Xie, Yan-Ming; Li, Guang-Xi; Gao, Yang; Zhao, Yuan-Chen; Tang, Jing-Jing; Yao, Xiao-Yan; Li, Meng

    2017-10-01

    This paper systematically studies relevant literatures at home and abroad in recent years. China National Knowledge Internet (CNKI) was used to collect the literatures for acute pharyngitis treated with traditional Chinese medicine from January 1, 2006, to December 31, 2016, and the bibliometric method was employed for statistical analysis. A total of 493 papers were preliminarily selected. According to the inclusion criteria and exclusion criteria, 182 eligible articles were selected. According to the evaluation and analysis of the literatures, the Guidelines for Clinical Research of New Drugs is currently used as the common standards for the diagnosis and treatment of acute pharyngitis; Chinese patent medicines are the main traditional Chinese medicine for treating this disease; Decoctions for treatment of this disease include Lonicerae Japonicae Flos, Scutellariae Radix, Platycodonis Radix, Forsythiae Fructus, Glycyrrhizae Radix et Rhizoma, Scrophdlariae Radix, Isatidis Radix, and Ophiopogonis Radix; The bloodletting puncture is the common external therapy. Traditional Chinese medicine and Western medicine have their own characteristics in the treatment of this disease. Western medicine for the treatment of acute pharyngitis are mainly antiviral, antibiotic and glucocorticoid drugs, whose disadvantages are toxicity, side effects, drug resistance and double infections. Traditional Chinese medicine doctors have rich experiences in the treatment of the disease, which is characterized by treatment determination based on syndrome differentiation, safe and reliable medication, significant curative effect, low drug resistance, and wide varieties of traditional Chinese medicine forms, convenient portability and taking, low price, and low toxic and side effects. It is an arduous and significant task to explore traditional Chinese medicine, and study and develop new-type effective drugs. Copyright© by the Chinese Pharmaceutical Association.

  18. Discovery of Anti-inflammatory Ingredients in Chinese Herbal Formula Kouyanqing Granule based on Relevance Analysis between Chemical Characters and Biological Effects

    PubMed Central

    Liu, Hong; Zheng, Yan-fang; Li, Chu-yuan; Zheng, Yu-ying; Wang, De-qin; Wu, Zhong; Huang, Lin; Wang, Yong-gang; Li, Pei-bo; Peng, Wei; Su, Wei-wei

    2015-01-01

    Kouyanqing Granule (KYQG) is a traditional Chinese herbal formula composed of Flos lonicerae (FL), Radix scrophulariae (RS), Radix ophiopogonis (RO), Radix asparagi (RA), and Radix et rhizoma glycyrrhizae (RG). In contrast with the typical method of separating and then biologicalily testing the components individually, this study was designed to establish an approach in order to define the core bioactive ingredients of the anti-inflammatory effects of KYQG based on the relevance analysis between chemical characters and biological effects. Eleven KYQG samples with different ingredients were prepared by changing the ratios of the 5 herbs. Thirty-eight ingredients in KYQG were identified using Ultra-fast liquid chromatography-Diode array detector-Quadrupole-Time-of-flight-Tandem mass spectrometry (UFLC-DAD-Q-TOF-MS/MS) technology. Human oral keratinocytes (HOK) were cultured for 24 hours with 5% of Cigarette smoke extract (CSE) to induce inflammation stress. Interleukin-1β (IL-1β), interleukin-6 (IL-6), interleukin-8 (IL-8), and tumour necrosis factor-α (TNF-α) were evaluated after treatment with the eleven KYQG samples. Grey relational analysis(GRA), Pearson’s correlations (PCC), and partial least-squares (PLS) were utilized to evaluate the contribution of each ingredient. The results indicated that KYQG significantly reduced interleukin-1β, interleukin-6, interleukin-8, and tumour necrosis factor-α levels, in which lysine, γ-aminobutyric acid, chelidonic acid, tyrosine, harpagide, neochlorogenic acid, chlorogenic acid, cryptochlorogenic acid, isoquercitrin, luteolin-7-o-glucoside, 3,4-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid, angoroside C, harpagoside, cinnamic acid, and ruscogenin play a vital role. PMID:26657159

  19. Discovery of Anti-inflammatory Ingredients in Chinese Herbal Formula Kouyanqing Granule based on Relevance Analysis between Chemical Characters and Biological Effects.

    PubMed

    Liu, Hong; Zheng, Yan-fang; Li, Chu-yuan; Zheng, Yu-ying; Wang, De-qin; Wu, Zhong; Huang, Lin; Wang, Yong-gang; Li, Pei-bo; Peng, Wei; Su, Wei-wei

    2015-12-10

    Kouyanqing Granule (KYQG) is a traditional Chinese herbal formula composed of Flos lonicerae (FL), Radix scrophulariae (RS), Radix ophiopogonis (RO), Radix asparagi (RA), and Radix et rhizoma glycyrrhizae (RG). In contrast with the typical method of separating and then biologicalily testing the components individually, this study was designed to establish an approach in order to define the core bioactive ingredients of the anti-inflammatory effects of KYQG based on the relevance analysis between chemical characters and biological effects. Eleven KYQG samples with different ingredients were prepared by changing the ratios of the 5 herbs. Thirty-eight ingredients in KYQG were identified using Ultra-fast liquid chromatography-Diode array detector-Quadrupole-Time-of-flight-Tandem mass spectrometry (UFLC-DAD-Q-TOF-MS/MS) technology. Human oral keratinocytes (HOK) were cultured for 24 hours with 5% of Cigarette smoke extract (CSE) to induce inflammation stress. Interleukin-1β (IL-1β), interleukin-6 (IL-6), interleukin-8 (IL-8), and tumour necrosis factor-α (TNF-α) were evaluated after treatment with the eleven KYQG samples. Grey relational analysis(GRA), Pearson's correlations (PCC), and partial least-squares (PLS) were utilized to evaluate the contribution of each ingredient. The results indicated that KYQG significantly reduced interleukin-1β, interleukin-6, interleukin-8, and tumour necrosis factor-α levels, in which lysine, γ-aminobutyric acid, chelidonic acid, tyrosine, harpagide, neochlorogenic acid, chlorogenic acid, cryptochlorogenic acid, isoquercitrin, luteolin-7-o-glucoside, 3,4-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid, angoroside C, harpagoside, cinnamic acid, and ruscogenin play a vital role.

  20. Study on the main components interaction from Flos Lonicerae and Fructus Forsythiae and their dissolution in vitro and intestinal absorption in rats.

    PubMed

    Zhou, Wei; Tan, Xiaobin; Shan, Jinjun; Wang, Shouchuan; Yin, Ailing; Cai, Baochang; Di, Liuqing

    2014-01-01

    The Flos Lonicerae-Fructus Forsythiae herb couple is the basic components of Chinese herbal preparations (Shuang-Huang-Lian tablet, Yin-Qiao-Jie-Du tablet and Fufang Qin-Lan oral liquid), and its pharmacological effects were significantly higher than that in Flos Lonicerae or Fructus Forsythiae, but the reasons remained unknown. In the present study, pattern recognition analysis (hierarchical cluster analysis (HCA) and principal component analysis (PCA)) combined with UHPLC-ESI/LTQ-Orbitrap MS system were performed to study the chemical constitution difference between co-decoction and mixed decoction in the term of chemistry. Besides, the pharmacokinetics in vivo and intestinal absorption in vitro combined with pattern recognition analysis were used to reveal the discrepancy between herb couple and single herbs in the view of biology. The observation from the chemical view in vitro showed that there was significant difference in quantity between co-decoction and mixed decoction by HCA, and the exposure level of isoforsythoside and 3, 5-dicaffeoylquinic acid in co-decoction, higher than that in mixed decoction, directly resulted in the discrepancy between co-decoction and mixed decoction using both PCA and HCA. The observation from the pharmacokinetics displayed that the exposure level in vivo of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A, higher than that in single herbs, was the main factor contributing to the difference by both PCA and HCA, interestingly consistent with the results obtained from Caco-2 cells in vitro, which indicated that it was because of intestinal absorption improvement of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A that resulted in a better efficacy of herb couple than that of single herbs from the perspective of biology. The results above illustrated that caffeic acid derivatives in Flos Lonicerae-Fructus Forsythiae herb couple could be considered as chemical markers for quality control of its preparations.

  1. Study on the Main Components Interaction from Flos Lonicerae and Fructus Forsythiae and Their Dissolution In Vitro and Intestinal Absorption in Rats

    PubMed Central

    Zhou, Wei; Tan, Xiaobin; Shan, Jinjun; Wang, Shouchuan; Yin, Ailing; Cai, Baochang; Di, Liuqing

    2014-01-01

    The Flos Lonicerae-Fructus Forsythiae herb couple is the basic components of Chinese herbal preparations (Shuang-Huang-Lian tablet, Yin-Qiao-Jie-Du tablet and Fufang Qin-Lan oral liquid), and its pharmacological effects were significantly higher than that in Flos Lonicerae or Fructus Forsythiae, but the reasons remained unknown. In the present study, pattern recognition analysis (hierarchical cluster analysis (HCA) and principal component analysis (PCA)) combined with UHPLC-ESI/LTQ-Orbitrap MS system were performed to study the chemical constitution difference between co-decoction and mixed decoction in the term of chemistry. Besides, the pharmacokinetics in vivo and intestinal absorption in vitro combined with pattern recognition analysis were used to reveal the discrepancy between herb couple and single herbs in the view of biology. The observation from the chemical view in vitro showed that there was significant difference in quantity between co-decoction and mixed decoction by HCA, and the exposure level of isoforsythoside and 3, 5-dicaffeoylquinic acid in co-decoction, higher than that in mixed decoction, directly resulted in the discrepancy between co-decoction and mixed decoction using both PCA and HCA. The observation from the pharmacokinetics displayed that the exposure level in vivo of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A, higher than that in single herbs, was the main factor contributing to the difference by both PCA and HCA, interestingly consistent with the results obtained from Caco-2 cells in vitro, which indicated that it was because of intestinal absorption improvement of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A that resulted in a better efficacy of herb couple than that of single herbs from the perspective of biology. The results above illustrated that caffeic acid derivatives in Flos Lonicerae-Fructus Forsythiae herb couple could be considered as chemical markers for quality control of its preparations. PMID:25275510

  2. Rapid and automatic chemical identification of the medicinal flower buds of Lonicera plants by the benchtop and hand-held Fourier transform infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Chen, Jianbo; Guo, Baolin; Yan, Rui; Sun, Suqin; Zhou, Qun

    2017-07-01

    With the utilization of the hand-held equipment, Fourier transform infrared (FT-IR) spectroscopy is a promising analytical technique to minimize the time cost for the chemical identification of herbal materials. This research examines the feasibility of the hand-held FT-IR spectrometer for the on-site testing of herbal materials, using Lonicerae Japonicae Flos (LJF) and Lonicerae Flos (LF) as examples. Correlation-based linear discriminant models for LJF and LF are established based on the benchtop and hand-held FT-IR instruments. The benchtop FT-IR models can exactly recognize all articles of LJF and LF. Although a few LF articles are misjudged at the sub-class level, the hand-held FT-IR models are able to exactly discriminate LJF and LF. As a direct and label-free analytical technique, FT-IR spectroscopy has great potential in the rapid and automatic chemical identification of herbal materials either in laboratories or in fields. This is helpful to prevent the spread and use of adulterated herbal materials in time.

  3. The screening research of anti-inflammatory bioactive markers from different flowering phases of Flos Lonicerae Japonicae.

    PubMed

    Jiang, Min; Han, Yan-qi; Zhou, Meng-ge; Zhao, Hong-zhi; Xiao, Xue; Hou, Yuan-yuan; Gao, Jie; Bai, Gang; Luo, Guo-an

    2014-01-01

    Flos Lonicerae Japonicae (FLJ) is an important cash crop in eastern Asia, and it is an anti-inflammatory Traditional Chinese Medicine. There are large variations in the quality of the marketed FLJ products. To find marker ingredients useful for quality control, a tandem technology integrating ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLC-Q/TOF), principal component analysis (PCA), heat map analysis and hierarchical cluster analysis coupled with a NF-κB luciferase reporter gene assay were used to identify the different ingredients from the green bud, white bud, flowering stage and leaf stages, as well as to screen the anti-inflammatory activity of FLJ compositions. As flowering progressed, the anti-inflammatory effects of FLJ gradually decreased; however, chlorogenic acid, swertiamarin and sweroside should be used to evaluate the quality of FLJ products.

  4. The Screening Research of Anti-Inflammatory Bioactive Markers from Different Flowering Phases of Flos Lonicerae Japonicae

    PubMed Central

    Jiang, Min; Han, Yan-qi; Zhou, Meng-ge; Zhao, Hong-zhi; Xiao, Xue; Hou, Yuan-yuan; Gao, Jie; Bai, Gang; Luo, Guo-an

    2014-01-01

    Flos Lonicerae Japonicae (FLJ) is an important cash crop in eastern Asia, and it is an anti-inflammatory Traditional Chinese Medicine. There are large variations in the quality of the marketed FLJ products. To find marker ingredients useful for quality control, a tandem technology integrating ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLC-Q/TOF), principal component analysis (PCA), heat map analysis and hierarchical cluster analysis coupled with a NF-κB luciferase reporter gene assay were used to identify the different ingredients from the green bud, white bud, flowering stage and leaf stages, as well as to screen the anti-inflammatory activity of FLJ compositions. As flowering progressed, the anti-inflammatory effects of FLJ gradually decreased; however, chlorogenic acid, swertiamarin and sweroside should be used to evaluate the quality of FLJ products. PMID:24809338

  5. Separation of chlorogenic acid and concentration of trace caffeic acid from natural products by pH-zone-refining countercurrent chromatography.

    PubMed

    Lu, Yuanyuan; Dong, Genlai; Gu, Yanxiang; Ito, Yoichiro; Wei, Yun

    2013-07-01

    Chlorogenic acid and caffeic acid were selected as test samples for separation by the pH-zone-refining countercurrent chromatography (CCC). The separation of these test samples was performed with a two-phase solvent system composed of methyl-tert-butyl-ether/acetonitrile/water at a volume ratio of 4:1:5 v/v/v where trifluoroacetic acid (TFA; 8 mM) was added to the organic stationary phase as a retainer and NH4 OH (10 mM) to the aqueous mobile phase as an eluter. Chlorogenic acid was successfully separated from Flaveria bidentis (L.) Kuntze (F. bidentis) and Lonicerae Flos by pH-zone-refining CCC, a slightly polar two-phase solvent system composed of methyl-tert-butyl-ether/acetonitrile/n-butanol/water at a volume ratio of 4:1:1:5 v/v/v/v was selected where TFA (3 mM) was added to the organic stationary phase as a retainer and NH4 OH (3 mM) to the aqueous mobile phase as an eluter. A 16.2 mg amount of chlorogenic acid with the purity of 92% from 1.4 g of F. bidentis, and 134 mg of chlorogenic acid at the purity of 99% from 1.3 g of crude extract of Lonicerae Flos have been obtained. These results suggest that pH-zone-refining CCC is suitable for the isolation of the chlorogenic acid from the crude extracts of F. bidentis and Lonicerae Flos. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. [HPLC specific chromatogram spectrum-effect relationship for Shuanghuanglian on MDCK cell injury induced by influenza A virus (H1N1)].

    PubMed

    Liu, Ting; Wang, Hai-dan; Di, Liu-qing; Kang, An; Zhao, Xiao-li; Zhu, Xuan-xuan; Li, Jun-song

    2015-11-01

    To establish HPLC specific chromatogram and its correlation with the protection effect of Shuanghuanglian on MDCK (Madin-Darby canine kidney) cell injury induced by influenza A virus( H1N1). Nine recipes of Shuanghuanglian based on the official prescription were prepared according to orthogonal test for HPLC analysis and MDCK cells protection experiment separately (cytopathic effect (CPE) method was used for observing the virus infectivity and MTT staining results were used as the determining indexes for drug concentration selection and analyzing cell viability). The results suggested that all the other Shuang-Huang-Lian recipes except recipe1 demonstrate protecting effect on MDCK cell injury induced by influenza A virus (P < 0.01, P < 0.001). Stepwise regression analysis was used for analyzing the relationships between HPLC fingerprint and the protecting effect of Shuanghuanglian on influenza A virus induced MDCK cell injury. Peak 2, 3, 6, 8 and 12 were found to be strongly related with anti-influenza A virus efficacy. Stepwise regression analysis of recipes data and efficacy data showed that Lonicerae Japonicae Flos and Forsythiae Fructus were positively associated with the protecting effect of cells injury. From HPLC fingerprints, we found that peak 2, 3, 12 were from Lonicerae Japonicae Flos and peak 6, 8 were from Forsythiae Fructus. Four peaks were identified through comparing the retention time between the standard and Shuanghuanglian recipes, and they were chlorogenicacid, cryptochlorogenic acid, forsythoside B and 3,4-dicaffeoylquinic acid respectively. Caffeic acid derivatives in Lonicerae Japonicae Flos and Forsythiae Fructus were found to be greatly correlated with anti-influenza A virus efficacy and maybe the substance basis of Shuanghuanglian.

  7. Pharmacokinetics and Tissue Distribution Study of Chlorogenic Acid from Lonicerae Japonicae Flos Following Oral Administrations in Rats

    PubMed Central

    Zhou, Yulu; Zhou, Ting; Pei, Qi; Liu, Shikun; Yuan, Hong

    2014-01-01

    Chlorogenic acid (ChA) is proposed as the major bioactive compounds of Lonicerae Japonicae Flos (LJF). Forty-two Wistar rats were randomly divided into seven groups to investigate the pharmacokinetics and tissue distribution of ChA, via oral administration of LJF extract, using ibuprofen as internal standard, employing a high performance liquid chromatography in conjunction with tandem mass spectrometry. Analytes were extracted from plasma samples and tissue homogenate by liquid–liquid extraction with acetonitrile, separated on a C 18 column by linear gradient elution, and detected by electrospray ionization mass spectrometry in negative selected multiple reaction monitoring mode. Our results successfully demonstrate that the method has satisfactory selectivity, linearity, extraction recovery, matrix effect, precision, accuracy, and stability. Using noncompartment model to study pharmacokinetics, profile revealed that ChA was rapidly absorbed and eliminated. Tissue study indicated that the highest level was observed in liver, followed by kidney, lung, heart, and spleen. In conclusion, this method was suitable for the study on pharmacokinetics and tissue distribution of ChA after oral administration. PMID:25140190

  8. Inhibition of IRAK-4 activity for rescuing endotoxin LPS-induced septic mortality in mice by lonicerae flos extract

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Sun Hong; Roh, Eunmiri; Kim, Hyun Soo

    Highlights: •Lonicerae flos extract (HS-23) is a clinical candidate, Phase I for sepsis treatment. •Here, HS-23 or its major constituents rescued LPS-induced septic mortality in mice. •As a mechanism, they directly inhibited IRAK-4-catalyzed kinase activity. •Thus, they suppressed LPS-induced expression of NF-κB/AP-1-target inflammatory genes. -- Abstract: Lonicerae flos extract (HS-23) is a clinical candidate currently undergoing Phase I trial in lipopolysaccharide (LPS)-injected healthy human volunteers, but its molecular basis remains to be defined. Here, we investigated protective effects of HS-23 or its major constituents on Escherichia coli LPS-induced septic mortality in mice. Intravenous treatment with HS-23 rescued LPS-intoxicated C57BL/6J micemore » under septic conditions, and decreased the levels of cytokines such as tumor necrosis factor α (TNF-α), interleukin (IL)-1β and high-mobility group box-1 (HMGB-1) in the blood. Chlorogenic acid (CGA) and its isomers were assigned as major constituents of HS-23 in the protection against endotoxemia. As a molecular mechanism, HS-23 or CGA isomers inhibited endotoxin LPS-induced autophosphorylation of the IL-1 receptor-associated kinase 4 (IRAK-4) in mouse peritoneal macrophages as well as the kinase activity of IRAK-4 in cell-free reactions. HS-23 consequently suppressed downstream pathways critical for LPS-induced activation of nuclear factor (NF)-κB or activating protein 1 (AP-1) in the peritoneal macrophages. HS-23 also inhibited various toll-like receptor agonists-induced nitric oxide (NO) production, and down-regulated LPS-induced expression of NF-κB/AP-1-target inflammatory genes in the cells. Taken together, HS-23 or CGA isomers exhibited anti-inflammatory therapy against LPS-induced septic mortality in mice, at least in part, mediated through the inhibition of IRAK-4.« less

  9. Optimization of Process Parameters and Kinetic Model of Enzymatic Extraction of Polyphenols from Lonicerae Flos

    PubMed Central

    Kong, Fansheng; Yu, Shujuan; Bi, Yongguang; Huang, Xiaojun; Huang, Mengqian

    2016-01-01

    Objective: To optimize and verify the cellulase extraction of polyphenols from honeysuckle and provide a reference for enzymatic extracting polyphenols from honeysuckle. Materials and Methods: The uniform design was used According to Fick's first law and kinetic model, fitting analysis of the dynamic process of enzymatic extracting polyphenols was conducted. Results: The optimum enzymatic extraction parameters for polyphenols from honeysuckle are found to be 80% (v/v) of alcohol, 35:1 (mL/g) of liquid-solid ratio, 80°C of extraction temperature, 8.5 of pH, 6.0 mg of enzyme levels, and 130 min of extraction time. Under the optimal conditions, the extraction rate of polyphenols was 3.03%. The kinetic experiments indicated kinetic equation had a good linear relationship with t even under the conditions of different levels of enzyme and temperature, which means fitting curve tallies well with the experimental values. Conclusion: The results of quantification showed that the results provide a reference for enzymatic extracting polyphenols from honeysuckle. SUMMARY Lonicerae flos (Lonicera japonica Thunb.) is a material of traditional Chinese medicine and healthy drinks, of which active compounds mainly is polyphenols. At present, plant polyphenols are the hotspots centents of food, cosmetic and medicine, because it has strong bioactivity. Several traditional methods are available for the extraction of plant polyphenols including impregnation, solvent extraction, ultrasonic extraction, hot-water extraction, alkaline dilute alcohol or alkaline water extraction, microwave extraction and Supercritical CO2 extraction. But now, an increasing number of research on using cellulase to extract active ingredients from plants. Enzymatic method is widely used for enzyme have excellent properties of high reaction efficiency and specificity, moderate reaction conditions, shorter extraction time and easier to control, less damage to the active ingredient. At present, the enzymatic extraction of polyphenols from honeysuckle and dynamic had not been reported. In this study, using cellulase to extract polyphenols from honeysuckle is first applied. Moreover, uniform design was used to optimize process and kinetic model of extraction was established to analyze the characteristics of enzymatic extraction, in order to improve the yield of polyphenols from honeysuckle and make maximum use of Lonicerae flos, which provide references for industrial production. PMID:27018039

  10. A herbal formula comprising Rosae Multiflorae Fructus and Lonicerae Japonicae Flos inhibits the production of inflammatory mediators and the IRAK-1/TAK1 and TBK1/IRF3 pathways in RAW 264.7 and THP-1 cells.

    PubMed

    Cheng, Brian Chi Yan; Yu, Hua; Su, Tao; Fu, Xiu-Qiong; Guo, Hui; Li, Ting; Cao, Hui-Hui; Tse, Anfernee Kai-Wing; Kwan, Hiu-Yee; Yu, Zhi-Ling

    2015-11-04

    As documented in the Chinese Materia Medica Grand Dictionary (), a herbal formula (RL) consisting of Rosae Multiflorae Fructus (multiflora rose hips) and Lonicerae Japonicae Flos (Japanese honeysuckle flowers) has traditionally been used in treating inflammatory disorders. RL was previously reported to inhibit the expression of various inflammatory mediators regulated by NF-κB and MAPKs that are components of the TLR4 signalling pathways. This study aims to provide further justification for clinical application of RL in treating inflammatory disorders by further delineating the involvement of the TLR4 signalling cascades in the effects of RL on inflammatory mediators. RL consisting of Rosae Multiflorae Fructus and Lonicerae Japonicae Flos (in 5:3 ratio) was extracted using absolute ethanol. We investigated the effect of RL on the production of cytokines and chemokines that are regulated by three key transcription factors of the TLR4 signalling pathways AP-1, NF-κB and IRF3 in LPS-stimulated RAW264.7 cells using the multiplex biometric immunoassay. Phosphorylation of AP-1, NF-κB, IRF3, IκB-α, IKKα/β, Akt, TAK1, TBK1, IRAK-1 and IRAK-4 were examined in LPS-stimulated RAW264.7 cells and THP-1 cells using Western blotting. Nuclear localizations of AP-1, NF-κB and IRF3 were also examined using Western blotting. RL reduced the secretion of various pro-inflammatory cytokines and chemokines regulated by transcription factors AP-1, NF-κB and IRF3. Phosphorylation and nuclear protein levels of these transcription factors were decreased by RL treatment. Moreover, RL inhibited the activation/phosphorylation of IκB-α, IKKα/β, TAK1, TBK1 and IRAK-1. Suppression of the IRAK-1/TAK1 and TBK1/IRF3 signalling pathways was associated with the effect of RL on inflammatory mediators in LPS-stimulated RAW264.7 and THP-1 cells. This provides further pharmacological basis for the clinical application of RL in the treatment of inflammatory disorders. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. Protection of Flos Lonicerae against acetaminophen-induced liver injury and its mechanism.

    PubMed

    Jiang, Ping; Sheng, Yu-chen; Chen, Yu-hao; Ji, Li-li; Wang, Zheng-tao

    2014-11-01

    This study aims to observe the protective action of Flos Lonicerae (FL) aqueous extract against acetaminophen (AP)-induced liver injury and its mechanism. Results show that FL decreases AP-increased serum alanine/aspartate transaminases (ALT/AST) activity, as well as total bilirubin (TB) amount, in mice. Histological evaluation of the liver further confirms the protection of FL against AP-induced hepatotoxicity. TdT-mediated biotin-dUTP nick-end labeling (TUNEL) assay shows that FL reduces AP-increased apoptotic cells. Furthermore, AP-decreased liver glutamate-cysteine ligase (GCL) enzymatic activity and glutathione (GSH) amount are both reversed by FL because of the increased expression of the catalytic subunit of GCL (GCLC) protein. The amount of chlorogenic acid (CGA), caffeic acid, and luteolin, the main active compounds in FL, is detected by high-performance liquid chromatography (HPLC). In addition, cell viability assay demonstrates that polyphenols in FL, such as CGA, caffeic acid, as well as isochlorogenic acids A, B, and C, can reverse AP-induced cytotoxicity. In conclusion, FL can prevent AP-induced liver injury by inhibiting apoptosis. The cellular antioxidant enzyme GCL is also involved in such protection. Polyphenols may be the main active hepato-protective ingredients in FL. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. On-line monitoring of extraction process of Flos Lonicerae Japonicae using near infrared spectroscopy combined with synergy interval PLS and genetic algorithm

    NASA Astrophysics Data System (ADS)

    Yang, Yue; Wang, Lei; Wu, Yongjiang; Liu, Xuesong; Bi, Yuan; Xiao, Wei; Chen, Yong

    2017-07-01

    There is a growing need for the effective on-line process monitoring during the manufacture of traditional Chinese medicine to ensure quality consistency. In this study, the potential of near infrared (NIR) spectroscopy technique to monitor the extraction process of Flos Lonicerae Japonicae was investigated. A new algorithm of synergy interval PLS with genetic algorithm (Si-GA-PLS) was proposed for modeling. Four different PLS models, namely Full-PLS, Si-PLS, GA-PLS, and Si-GA-PLS, were established, and their performances in predicting two quality parameters (viz. total acid and soluble solid contents) were compared. In conclusion, Si-GA-PLS model got the best results due to the combination of superiority of Si-PLS and GA. For Si-GA-PLS, the determination coefficient (Rp2) and root-mean-square error for the prediction set (RMSEP) were 0.9561 and 147.6544 μg/ml for total acid, 0.9062 and 0.1078% for soluble solid contents, correspondingly. The overall results demonstrated that the NIR spectroscopy technique combined with Si-GA-PLS calibration is a reliable and non-destructive alternative method for on-line monitoring of the extraction process of TCM on the production scale.

  13. Profiling and identification of chlorogenic acid metabolites in rats by ultra-high-performance liquid chromatography coupled with linear ion trap-Orbitrap mass spectrometer.

    PubMed

    Wang, Fei; Shang, Zhanpeng; Xu, Lulu; Wang, Zhibin; Zhao, Wenjing; Mei, XiaoDan; Lu, Jianqiu; Zhang, Jia Yu

    2018-06-01

    1. Chlorogenic acids (CGAs), one kind of major bioactive constituents isolated from Flos Lonicera Japonica, possess many biological activities, such as antibacterial, antioxidant and antiviral activities. In this study, we established an efficient strategy using ultra-high-performance liquid chromatography coupled with linear ion trap-Orbitrap mass spectrometry (UHPLC-LTQ-Orbitrap MS) to profile the in vivo metabolic fate of CGAs in rat urine and plasma. 2. The extract from Flos Lonicera Japonica was orally administrated to Sprague-Dawley (SD) rats at a dose of 1000 mg/kg body weight. Then, a combination of various post-acquisition data mining methods, including high-resolution extracted ion chromatogram (HREIC) and multiple mass defect filters (MMDFs) and diagnostic product ions (DPIs), were adopted to characterize the known and unknown CGA metabolites in SD rats. 3. As a result, a total of 68 CGA metabolites were unambiguously or tentatively screened and characterized. These metabolites, including 18 prototype compounds and 50 metabolites, were deduced to be yielded via methylation, hydrogenation, demethylation, dehydration, sulfate conjugation, glucuronide conjugation, glycosylation conjugation and their composite reactions, which mainly occurred to caffeoylquinic acids, dicaffeoylquinic acids, p-coumaroylquinic acids and feruloylquinic acids. 4. In conclusion, this study profiled CGA metabolites, which are useful in understanding the in vivo metabolic fate, effective forms, and pharmacological and toxic actions of CGAs.

  14. [Research on compatibility of prescriptions including Ginseng Radix et Rhizoma and Trogopterus Dung based on complex network analysis].

    PubMed

    Li, Meng-Wen; Fan, Xin-Sheng; Zhang, Ling-Shan; Wang, Cong-Jun

    2017-09-01

    The applications of prescriptions including Ginseng Radix et Rhizoma and Trogopterus Dung in contemporary literatures from 1949 to 2016 are compiled and the data mining techniques containing scale-free complex network method are utilized to explore its practical characteristics, with comparison between modern and ancient ones. The results indicate that malignant neoplasms, coronary heart disease which present Qi deficiency and blood stasis type are the main diseases treated by prescriptions including Ginseng Radix et Rhizoma and Trogopterus Dung according to the reports during 1949 to 2016. The complex network connection shows that Glycyrrhizae Radixet Rhizoma, Angelicae Sinensis Radix, Astragali Radix, Typhae Pollen, Salviae Miltiorrhizae Radix et Rhizoma are the primary drugs related to Ginseng Radix et Rhizoma and Trogopterus Dung. The next are Paeoniae Radix Alba, Atractylodis Macrocephalae Rhizoma, Persicae Semen, Foria, et al. Carthami Flos, Notoginseng Radix et Rhizoma, Cyperi Rhizoma, Bupleuri Radix are the peripheral ones. Also, Ginseng Radix et Rhizoma-Glycyrrhizae Radixet Rhizoma, Trogopterus Dung-Glycyrrhizae Radixet Rhizoma, Ginseng Radix et Rhizoma-Angelicae Sinensis Radix, Trogopterus Dung-Angelicae Sinensis Radix, Ginseng Radix et Rhizoma-Astragali Radix, Trogopterus Dung-Astragali Radix are the main paired drugs. The paired drugs including Ginseng Radix et Rhizoma-Trogopterus Dung-Glycyrrhizae Radixet Rhizoma, Ginseng Radix et Rhizoma-Trogopterus Dung-Angelicae Sinensis Radix, Ginseng Radix et Rhizoma-Trogopterus Dung-Astragali Radix, Ginseng Radix et Rhizoma-Trogopterus Dung-Typhae Pollen have a higher support degree. The main compatible drugs are different in ancient and modern prescriptions including Ginseng Radix et Rhizoma and Trogopterus Dung. Notoginseng Radix et Rhizoma, Typhae Pollen, Salviae Miltiorrhizae Radix et Rhizoma, Astragali Radix are utilized frequently in modern prescriptions while less used in ancient ones. It is also shown that more attentions are paid to the drugs contributing to invigorating Qi and promoting blood circulation in modern times with comparative results between modern and ancient prescriptions. Copyright© by the Chinese Pharmaceutical Association.

  15. [Investigation on Inhibitory Capacities of Seventeen Herbal Extracts on Oxidative Stress using Ultraviolet and Fluorescence Spectroscopy].

    PubMed

    Hou, Guang-yue; Zheng, Zhong; Song, Feng-rui; Liu, Zhi-qiang; Zhao, Bing

    2015-03-01

    Diabetic patients usually suffer from complications and the long-term secondary complications are the main cause of morbidity and mortality. The hyperglycemia-induced oxidative stress is one of the important pathogenesis of diabetic complications, while the oxidative stress is associated with the lipid peroxidation reaction and the formation of advanced glycation end products (AGEs). Our study was focus on the pathogenesis of diabetic complications and based on the oxidative stress reaction. In this research, the oxidative stress inhibiting effects of seventeen herbal extracts were studied based on spectroscopic methodology. The capacities of herbal extracts against the lipid peroxidation reaction of rat liver in vitro were investigated using spectrophotometric method. It showed that the inhibitory activity of Radix Scutellariae and Flos Sophorae Immaturus were better than other herbal extracts. Additionally, the herbal extracts rich in flavonoids, alkaloids and lignanoids showed good inhibitory activities on the lipid peroxidation reaction. On the contrary, the saponin-rich herbal extracts possessed weak inhibitory effects. We applied the BSA/glucose (fructose) system combined with fluorescent spectroscopy to determine the inhibitory activities of herbal extracts in glycation model reactions. The results showed that the AGEs formation inhibitory activity of Flos Sophorae Immaturus, Radix Scutellariae and Rhizoma Anemarrhenae were better than others in the BSA/glucose (fructose) system by fluorescene analysis. The results demonstrated that the herbal extracts rich in flavonoids were found to be more effective than that of those herbal extracts as alkaloids and terpenoids class in inhibiting oxidative stress, while the saponin-rich herbal extracts showed weak inhibitory activities against oxidative stress. The Flos Sophorae Immaturus and Radix Scutellariae extracts had better inhibitory activity to the oxidative stress, so their pharmacological activity could be explored in further investigations. These results demonstrated in this assay could provide a reference for the study of pharmacological activity, and thus lays the foundation for the further study of the application of natural products in the prevention and treatment of diabetic complications.

  16. Structural characterization and identification of iridoid glycosides, saponins, phenolic acids and flavonoids in Flos Lonicerae Japonicae by a fast liquid chromatography method with diode-array detection and time-of-flight mass spectrometry.

    PubMed

    Qi, Lian-Wen; Chen, Chun-Yun; Li, Ping

    2009-10-01

    A fast liquid chromatography method with diode-array detection (DAD) and time-of-flight mass spectrometry (TOF-MS) has been developed for analysis of constituents in Flos Lonicerae Japonicae (FLJ), a traditional Chinese medicine derived from the flower bud of Lonicera japonica. The chromatographic analytical time decreased to 25 min without sacrificing resolution using a column packed with 1.8-microm porous particles (4.6 x 50 mm), three times faster than the performance of conventional 5.0-microm columns (4.6 x 150 mm). Four major groups of compounds previously isolated from FLJ were structurally characterized by DAD-TOF-MS: iridoid glycosides showed maximum UV absorption at 240 nm; phenolic acids at 217, 242, and 326 nm; flavonoids at 255 and 355 nm; while saponins had no absorption. In electrospray ionization (ESI)-TOF-MS experiments, elimination of a glucose unit (162 Da), and successive losses of H(2)O, CH(3)OH and CO, were generally observed in iridoid glycosides; saponins were characterized by a series of identical aglycone ions; phenolic acids typically generated a base peak at [M-H-caffeoyl](-) by loss of a caffeic acid unit (162 Da) and several marked quinic acid moiety ions; cleavage of the glycosidic bond (loss of 162 or 308 Da), subsequent losses of H(2)O, CO, RDA and C-ring fragmentation were the most possible fragmentation pathways for flavonoids. By accurate mass measurements within 4 ppm error for each molecular ion and subsequent fragment ions, as well as the 'full mass spectral' information of TOF-MS, a total of 41 compounds including 13 iridoid glycosides, 11 phenolic acids, 7 saponins, and 10 flavonoids were identified in a methanolic extract of FLJ. Copyright (c) 2009 John Wiley & Sons, Ltd.

  17. A herbal formula consisting of Rosae Multiflorae Fructus and Lonicerae Japonicae Flos inhibits inflammatory mediators in LPS-stimulated RAW 264.7 macrophages.

    PubMed

    Cheng, Brian Chi-Yan; Ma, Xiao-Qing; Kwan, Hiu-Yee; Tse, Kai-Wing; Cao, Hui-Hui; Su, Tao; Shu, Xin; Wu, Zheng-zhi; Yu, Zhi-ling

    2014-05-14

    A herbal formula (RL) consisting of Rosae Multiflorae Fructus (Yingshi) and Lonicerae Japonicae Flos (Jinyinhua) has been traditionally used to treat inflammatory disorders. This study aims to investigate the anti-inflammatory mode and mechanism of action of the ethanol extract of RL so as to provide a pharmacological basis for the use of RL in treating inflammatory diseases. RL consisting of Yingshi and Jinyinhua (in 5:3 ratio) was extracted using absolute ethanol. We investigated its effects on nitric oxide (NO), interleukin-6 (IL-6), tumour necrosis factor (TNF)-α, inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), mitogen-activated protein kinases (MAPKs) and nuclear factor κB (NFκB) in mouse RAW 264.7 macrophages activated with lipopolysaccharide (LPS). RL could decrease the secretion of NO, IL-6 and TNF-α into the culture medium and the cellular protein levels of iNOS and COX-2, which were associated with the reduction of the phosphorylation/activation of JNK and p38, and the inhibition of the transcriptional activity of NF-κB. The present study demonstrated an inhibitory effect of RL on the inflammatory mediators regulated by the NF-κB and MAPK signalling pathways in LPS-stimulated RAW 264.7 macrophages, providing a pharmacological basis for RL in the control of inflammatory disorders. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. [Data mining analysis of professor Li Fa-zhi AIDS herpes zoster medical record].

    PubMed

    Wang, Dan-Ni; Li, Zhen; Xu, Li-Ran; Guo, Hui-Jun

    2013-08-01

    Analysis of professor Li Fa-zhi in the treatment of AIDS drug laws of herpes zoster and postherpetic neuralgia, provide reference for the use of Chinese medicine treatment of AIDS, herpes zoster and postherpetic neuralgia. By using the method of analyzing the complex network of Weishi county, Henan in 2007 October to 2011 July during an interview with professor Li Fa-zhi treatment of AIDS of herpes zoster and postherpetic neuralgia patients, patients are input structured clinical information collection system, into the analysis of the data, carries on the research analysis theory of traditional Chinese medicine compatibility system algorithm and complex network analysis the use of complex networks. The use of multi-dimensional query analysis of AIDS drugs, the core of herpes zoster and postherpetic neuralgia treated in this study are Scutellariae Radix, Glucyrrhizae Radix, Carthame Flos, Plantaginis Semen, Trichosamthis Fructus, Angelicae Sinensis Radix, Gentianae Radix; core prescription for Longdan Xiegan decoction and Trichosanthes red liquorice decoction. Professor Li Fa-zhi treatment of AIDS, herpes zoster and postherpetic neuralgia by clearing heat and removing dampness and activating blood circulation to.

  19. Inhibition of IRAK-4 activity for rescuing endotoxin LPS-induced septic mortality in mice by lonicerae flos extract.

    PubMed

    Park, Sun Hong; Roh, Eunmiri; Kim, Hyun Soo; Baek, Seung-Il; Choi, Nam Song; Kim, Narae; Hwang, Bang Yeon; Han, Sang-Bae; Kim, Youngsoo

    2013-12-13

    Lonicerae flos extract (HS-23) is a clinical candidate currently undergoing Phase I trial in lipopolysaccharide (LPS)-injected healthy human volunteers, but its molecular basis remains to be defined. Here, we investigated protective effects of HS-23 or its major constituents on Escherichia coli LPS-induced septic mortality in mice. Intravenous treatment with HS-23 rescued LPS-intoxicated C57BL/6J mice under septic conditions, and decreased the levels of cytokines such as tumor necrosis factor α (TNF-α), interleukin (IL)-1β and high-mobility group box-1 (HMGB-1) in the blood. Chlorogenic acid (CGA) and its isomers were assigned as major constituents of HS-23 in the protection against endotoxemia. As a molecular mechanism, HS-23 or CGA isomers inhibited endotoxin LPS-induced autophosphorylation of the IL-1 receptor-associated kinase 4 (IRAK-4) in mouse peritoneal macrophages as well as the kinase activity of IRAK-4 in cell-free reactions. HS-23 consequently suppressed downstream pathways critical for LPS-induced activation of nuclear factor (NF)-κB or activating protein 1 (AP-1) in the peritoneal macrophages. HS-23 also inhibited various toll-like receptor agonists-induced nitric oxide (NO) production, and down-regulated LPS-induced expression of NF-κB/AP-1-target inflammatory genes in the cells. Taken together, HS-23 or CGA isomers exhibited anti-inflammatory therapy against LPS-induced septic mortality in mice, at least in part, mediated through the inhibition of IRAK-4. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. IRAK4 as a molecular target in the amelioration of innate immunity-related endotoxic shock and acute liver injury by chlorogenic acid.

    PubMed

    Park, Sun Hong; Baek, Seung-Il; Yun, Jieun; Lee, Seungmin; Yoon, Da Young; Jung, Jae-Kyung; Jung, Sang-Hun; Hwang, Bang Yeon; Hong, Jin Tae; Han, Sang-Bae; Kim, Youngsoo

    2015-02-01

    Mice lacking the IL-1R-associated kinase 4 (IRAK4) are completely resistant to LPS-induced endotoxic disorder or the TLR9 agonist CpG DNA plus d-galactosamine-induced acute liver injury (ALI), whereas wild-type strains succumb. However, translational drugs against sepsis or ALI remain elusive. Lonicerae flos extract is undergoing the clinical trial phase I in LPS-injected healthy human volunteers for sepsis treatment. In the current study, chlorogenic acid (CGA), a major anti-inflammatory constituent of lonicerae flos extract, rescued endotoxic mortality of LPS-intoxicated C57BL/6 mice, as well as ameliorated ALI of LPS/d-galactosamine-challenged C57BL/6 mice. As a mechanism, CGA inhibited various TLR agonist-, IL-1α-, or high-mobility group box-1-stimulated autophosphorylation (activation) of IRAK4 in peritoneal macrophages from C57BL/6 or C3H/HeJ mice via directly affecting the kinase activity of IRAK4, a proximal signal transducer in the MyD88-mediated innate immunity that enhances transcriptional activity of NF-κB or AP-1. CGA consequently attenuated protein or mRNA levels of NF-κB/AP-1 target genes encoding TNF-α, IL-1α, IL-6, and high-mobility group box-1 in vivo under endotoxemia or ALI. Finally, this study suggests IRAK4 as a molecular target of CGA in the treatment of innate immunity-related shock and organ dysfunction following insult of various TLR pathogens from bacteria and viruses. Copyright © 2015 by The American Association of Immunologists, Inc.

  1. Diagnostic fragment-ion-based and extension strategy coupled to DFIs intensity analysis for identification of chlorogenic acids isomers in Flos Lonicerae Japonicae by HPLC-ESI-MS(n).

    PubMed

    Zhang, Jia-Yu; Zhang, Qian; Li, Ning; Wang, Zi-Jian; Lu, Jian-Qiu; Qiao, Yan-Jiang

    2013-01-30

    A method of modified diagnostic fragment-ion-based extension strategy (DFIBES) coupled to DFIs (diagnostic fragmentation ions) intensity analysis was successfully established to simultaneously screen and identify the chlorogenic acids (CGAs) in Flos Lonicerae Japonicae (FLJ) by HPLC-ESI-MS(n). DFIs, such as m/z 191 [quinic acid-H](-), m/z 179 [caffeic acid-H](-) and m/z 173 [quinic acid-H-H2O](-) were determined or proposed from the fragmentation patterns analysis of corresponding reference substances for every chemical family of CGAs. A "structure extension" method was then proposed based on the well-demonstrated fragmentation patterns and was successively applied into the rapid screening of CGAs in FLJ. Considering that substitution isomerism is a common phenomenon, a full ESI-MS(n) fragmentation analysis according to the intensity of DFIs has been performed to identify the CGA isomers. Based on the DFIs and intensity analysis, 41 peaks attributed to CGAs including 4 caffeoylquinic acids (CQA), 7 CQA glycosides, 6 dicaffeoylquinic acids (DiCQA), 10 DiCQA glycosides, 1 tricaffeoylquinic acids (TriCQA), 4p-coumaroylquinic acids (pCoQA), 3 feruloylquinic acids (FQA) and 6 caffeoylferuloylquinic acids (CFQA) were identified preliminarily in a 65-min chromatographic run. It was the first time to systematically report the presence of CGAs in FLJ, especially for CQA glycosides, DiCQA glycosides, TriCQA, pCoQA and CFQA. All the results indicated that the method of developed DFIBES coupled to DFIs analysis was feasible, reliable and universal for screening and identifying the constituents with the same carbon skeletons especially the isomeric compounds from the complex extract of TCMs. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. A strategy for comprehensive identification of sequential constituents using ultra-high-performance liquid chromatography coupled with linear ion trap-Orbitrap mass spectrometer, application study on chlorogenic acids in Flos Lonicerae Japonicae.

    PubMed

    Zhang, Jia-yu; Wang, Zi-jian; Li, Yun; Liu, Ying; Cai, Wei; Li, Chen; Lu, Jian-qiu; Qiao, Yan-jiang

    2016-01-15

    The analytical methodologies for evaluation of multi-component system in traditional Chinese medicines (TCMs) have been inadequate or unacceptable. As a result, the unclarity of multi-component hinders the sufficient interpretation of their bioactivities. In this paper, an ultra-high-performance liquid chromatography coupled with linear ion trap-Orbitrap (UPLC-LTQ-Orbitrap)-based strategy focused on the comprehensive identification of TCM sequential constituents was developed. The strategy was characterized by molecular design, multiple ion monitoring (MIM), targeted database hits and mass spectral trees similarity filter (MTSF), and even more isomerism discrimination. It was successfully applied in the HRMS data-acquisition and processing of chlorogenic acids (CGAs) in Flos Lonicerae Japonicae (FLJ), and a total of 115 chromatographic peaks attributed to 18 categories were characterized, allowing a comprehensive revelation of CGAs in FLJ for the first time. This demonstrated that MIM based on molecular design could improve the efficiency to trigger MS/MS fragmentation reactions. Targeted database hits and MTSF searching greatly facilitated the processing of extremely large information data. Besides, the introduction of diagnostic product ions (DPIs) discrimination, ClogP analysis, and molecular simulation, raised the efficiency and accuracy to characterize sequential constituents especially position and geometric isomers. In conclusion, the results expanded our understanding on CGAs in FLJ, and the strategy could be exemplary for future research on the comprehensive identification of sequential constituents in TCMs. Meanwhile, it may propose a novel idea for analyzing sequential constituents, and is promising for quality control and evaluation of TCMs. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Data mining and frequency analysis for licorice as a "Two-Face" herb in Chinese Formulae based on Chinese Formulae Database.

    PubMed

    Guo, Jianming; Shang, Erxin; Zhao, Jinlong; Fan, Xinsheng; Duan, Jinao; Qian, Dawei; Tao, Weiwei; Tang, Yuping

    2014-09-25

    Liquorice is the root of Glycyrrhiza uralensis Fisch. or Glycyrrhiza glabra L., Leguminosae. Licorice is described as 'National Venerable Master' in Chinese medicine and plays paradoxical roles, i.e. detoxification/strengthen efficacy and inducing/enhancing toxicity. Therefore, licorice was called "Two-Face" herb in this paper. The aim of this study is to discuss the paradoxical roles and the perspective usage of this "Two-Face" herb using data mining and frequency analysis. More than 96,000 prescriptions from Chinese Formulae Database were selected. The frequency and the prescription patterns were analyzed using Microsoft SQL Server 2000. Data mining methods (frequent itemsets) were used to analyze the regular patterns and compatibility laws of the constituent herbs in the selected prescriptions. The result showed that licorice (Radix glycyrrhizae) was the most frequently used herb in Chinese Formulae Database, other frequently used herbs including Radix Angelicae Sinensis (Dang gui), Radix et rhizoma ginseng (Ren shen), etc. Toxic herbs such as Radix aconiti lateralis praeparata (Fu zi), Rhizoma pinelliae (Ban xia) and Cinnabaris (Zhu sha) are top 3 herbs that most frequently used in combination with licorice. Radix et rhizoma ginseng (Ren shen), Poria (Fu ling), Radix Angelicae Sinensis (Dang gui) are top 3 nontoxic herbs that most frequently used in combination with licorice. Moreover, Licorice was seldom used with sargassum (Hai Zao), Herba Cirsii Japonici (Da Ji), Euphorbia kansui (Gan Sui) and Flos genkwa (Yuan Hua), which proved the description of contradictory effect of Radix glycyrrhizae and these herbs as recorded in Chinese medicine theory. This study showed the principle pattern of Chinese herbal drugs used in combination with licorice or not. The principle patterns and special compatibility laws reported here could be useful and instructive for scientific usage of licorice in clinic application. Further pharmacological and chemical researches are needed to evaluate the efficacy and the combination pattern of these Chinese herbs. The mechanism of the combination pattern of these prescriptions should also be investigated whether additive, synergistic or antagonistic effect exist using in vitro or in vivo models. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. Herbal medicine for hand-foot syndrome induced by fluoropyrimidines: A systematic review and meta-analysis.

    PubMed

    Deng, Bo; Sun, Wei

    2018-04-16

    The aims of this study were to evaluate the efficacy of herbal medicine for the prevention and management of hand-foot syndrome (HFS) induced by fluoropyrimidines and to identify herbs associated with HFS alleviation for further research. The PubMed, Cochrane, Springer, China National Knowledge Infrastructure, and Wanfang databases were searched up to May 2017 for randomized controlled trials (RCTs) that evaluated herbal medicine for relieving HFS in patients undergoing fluoropyrimidine-based chemotherapy. Study evaluation and synthesis methods were in accordance with the Cochrane Handbook, and data were analyzed using RevMan 5.3. In total, 35 RCTs (2,668 participants) were included. Meta-analysis showed that the addition of herbal medicine significantly reduced the incidences of all-grade and high-grade HFS. The total effective rate and complete remission rate of HFS patients increased significantly with herbal medicine arm. Further sensitivity analysis identified Paeoniae Radix Alba, Carthami Flos, Cinnamomi Ramulus, and Glycyrrhizae Radix et Rhizoma as being consistently associated with significant reductions in HFS incidence without important heterogeneity. However, the lack of blinding in most studies may have led to overestimation of these effects. More high-quality RCTs and experimental research are needed to confirm and investigate the efficacy of the herbs identified in this study. Copyright © 2018 John Wiley & Sons, Ltd.

  5. Kampo Medicine: Evaluation of the Pharmacological Activity of 121 Herbal Drugs on GABAA and 5-HT3A Receptors

    PubMed Central

    Hoffmann, Katrin M.; Herbrechter, Robin; Ziemba, Paul M.; Lepke, Peter; Beltrán, Leopoldo; Hatt, Hanns; Werner, Markus; Gisselmann, Günter

    2016-01-01

    Kampo medicine is a form of Japanese phytotherapy originating from traditional Chinese medicine (TCM). During the last several decades, much attention has been paid to the pharmacological effects of these medical plants and their constituents. However, in many cases, a systematic screening of Kampo remedies to determine pharmacologically relevant targets is still lacking. In this study, a broad screening of Kampo remedies was performed to look for pharmacologically relevant 5-HT3A and GABAA receptor ligands. Several of the Kampo remedies are currently used for symptoms such as nausea, emesis, gastrointestinal motility disorders, anxiety, restlessness, or insomnia. Therefore, the pharmacological effects of 121 herbal drugs from Kampo medicine were analyzed as ethanol tinctures on heterologously expressed 5-HT3A and GABAA receptors, due to the involvement of these receptors in such pathophysiological processes. The tinctures of Lindera aggregata (radix) and Leonurus japonicus (herba) were the most effective inhibitory compounds on the 5-HT3A receptor. Further investigation of known ingredients in these compounds led to the identification of leonurine from Leonurus as a new natural 5-HT3A receptor antagonist. Several potentiating herbs (e.g., Magnolia officinalis (cortex), Syzygium aromaticum (flos), and Panax ginseng (radix)) were also identified for the GABAA receptor, which are all traditionally used for their sedative or anxiolytic effects. A variety of tinctures with antagonistic effects Salvia miltiorrhiza (radix) were also detected. Therefore, this study reveals new insights into the pharmacological action of a broad spectrum of herbal drugs from Kampo, allowing for a better understanding of their physiological effects and clinical applications. PMID:27524967

  6. [The analyses and identification of Flos rhododendri mollis and Flos chrysanthemi indici via infrared spectroscopy].

    PubMed

    Jin, Zhe-Xiong; Wang, Yue; Zhou, Qun; Chen, Jian-Bo; Ma, Fang; Sun, Su-Qin

    2014-09-01

    In this study, major chemical components of Flos rhododendri mollis and Flos chrysanthemi indici were characterized using Fourier transform infrared spectroscopy (FTIR). For Flos rhododendri mollis, the bands at 1,648 and 1,543 cm(-1) were attributed to amide I and amide II , respectively, indicating that it contained proteins probably resulting in immunization. In case of Flos chrysanthemi indici, stretching vibration of C==O function group was responsible for the bands at 1,734 and 1,515 cm(-1), as a result of essential oils, lipids, etc. Since FTIR spectra of Flos rhododendri mollis and Flos chrysanthemi indici are almost identical and it is difficult to discriminate them, two-step identification was investigated via secondary derivative of the FTIR spectra. The bands at 1,656 and 1,515 cm(-1) corresponds to flavonoides in Flos rhododendri mollis and Flos chrysanthemi indici. In the secondary derivative of the FTIR spectrum of Flos chrysanthemi indici, characteristic bands of inulin were present at 1,163, 1,077, 1,026, 986 and 869 cm(-1), and therefore Flos chrysanthemi indici contained inulin as well. Tri-step identification was carried out for Flos rhododendri mollis and Flos chrysanthemi indici by means of comparing their 2D-IR correlation spectra in different wave number range. In the characteristic range of flavonoides (1,700-1,400 cm(-1)), Flos rhododendri mollis exhibited 3 obvious autopeaks, while 10 autopeaks were visualized in the 2D-IR correlation spectrum of Flos chrysanthemi indici Moreover, in the characteristic range of glucoside (1,250-900 cm(-1)), 10 and 9 autopeaks were present in the 2D-IR correlation spectra of Flos rhododendri mollis and Flos chrysanthemi indici, respectively. Therefore, the tri-step identification of FTIR is a time-saving; accurate, cost-saving and convenient method to effectively distinguish traditional Chinese medicines.

  7. Comparison of five Lonicera flowers by simultaneous determination of multi-components with single reference standard method and principal component analysis.

    PubMed

    Gao, Wen; Wang, Rui; Li, Dan; Liu, Ke; Chen, Jun; Li, Hui-Jun; Xu, Xiaojun; Li, Ping; Yang, Hua

    2016-01-05

    The flowers of Lonicera japonica Thunb. were extensively used to treat many diseases. As the demands for L. japonica increased, some related Lonicera plants were often confused or misused. Caffeoylquinic acids were always regarded as chemical markers in the quality control of L. japonica, but they could be found in all Lonicera species. Thus, a simple and reliable method for the evaluation of different Lonicera flowers is necessary to be established. In this work a method based on single standard to determine multi-components (SSDMC) combined with principal component analysis (PCA) for control and distinguish of Lonicera species flowers have been developed. Six components including three caffeoylquinic acids and three iridoid glycosides were assayed simultaneously using chlorogenic acid as the reference standard. The credibility and feasibility of the SSDMC method were carefully validated and the results demonstrated that there were no remarkable differences compared with external standard method. Finally, a total of fifty-one batches covering five Lonicera species were analyzed and PCA was successfully applied to distinguish the Lonicera species. This strategy simplifies the processes in the quality control of multiple-componential herbal medicine which effectively adapted for improving the quality control of those herbs belonging to closely related species. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Characterization, pharmacokinetics and tissue distribution of chlorogenic acid-loaded self-microemulsifying drug delivery system.

    PubMed

    Chen, Li; Liu, Chang-Shun; Chen, Qing-Zhen; Wang, Sen; Xiong, Yong-Ai; Jing, Jing; Lv, Jia-Jia

    2017-03-30

    The purpose of this study was to develop a self-microemulsifying drug delivery system (SMEDDS) to improve the oral bioavailability of Chlorogenic acid (CA), an important bioactive compound from Lonicerae Japonicae Flos with poor permeability. SMEDDS was prepared and characterized by self-emulsifying rate, morphological observation, droplet size determination, stability, in vitro release, in vivo bioavailability and tissue distribution experiments. Results shown that the SMEDDS of CA has a high self-emulsifying rate (>98%) in the dissolution media, and its microemulsion exhibits small droplet size (16.37nm) and good stability. In vitro release test showed a complete release of CA from SMEDDS in 480min. After oral administration in mice, significantly enhanced bioavailability of CA was achieved through SMEDDS (249.4% relative to the CA suspension). Interestingly, SMEDDS significantly changed the tissue distribution of CA and showed a better targeting property to the kidney (2.79 of the relative intake efficiency). It is suggested that SMEDDS improves the oral bioavailability of CA may mainly through increasing its absorption and slowing the metabolism of absorbed CA via changing its distribution from the liver to the kidney. In conclusion, it is indicated that SMEDDS is a promising carrier for the oral delivery of CA. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. The therapeutic effect of Yinhuangerchen mixture on Avian infectious laryngotracheitis.

    PubMed

    Zhang, Tie; Chen, Jian; Wang, Chunguang; Shi, Wanyu; Li, Dinggang

    2018-06-08

    The study was conducted to investigate the effect of Yinhuangerchen mixture (YM) on Avian infectious laryngotracheitis (AILT) induced by artificial infection and provide a scientific basis for its clinical application. A total of 200 chickens were challenged with infectious laryngotracheitis virus (ILTV). At 72 h post-challenge, the chickens were treated with different doses of YM or the Chinese herbal medicine Houyanjing powder. The relative expression of ILTV, the pathological changes of trachea, and the number of SIgA-secreting cells were detected. Thin-layer chromatography results confirmed that the YM contained Scutellaria baicalensis, Flos lonicerae, Pericarpium citri reticulatae, and Liquorice. The AILT model was successfully established by artificial infection. In the high-dose YM group (HD) and middle-dose YM group (MD), the effective rate of treatment was 100 and 96.7%, respectively, and the overall cure rate was 83.3%. In addition, the results of necropsy showed that the degree of tissue damage in chicken trachea was relatively low. Compared with positive control group, HD and MD chicken had lower relative expression of ILTV but more SIgA-secreting cells. In conclusion, YM can reduce ILTV level in tissue, mitigate tissue damage caused by infection, and enhance mucosal immunity having obvious therapeutic effect on AILT.

  10. Repeatability Assessment by ISO 11843-7 in Quantitative HPLC for Herbal Medicines.

    PubMed

    Chen, Liangmian; Kotani, Akira; Hakamata, Hideki; Tsutsumi, Risa; Hayashi, Yuzuru; Wang, Zhimin; Kusu, Fumiyo

    2015-01-01

    We have proposed an assessment methods to estimate the measurement relative standard deviation (RSD) of chromatographic peaks in quantitative HPLC for herbal medicines by the methodology of ISO 11843 Part 7 (ISO 11843-7:2012), which provides detection limits stochastically. In quantitative HPLC with UV detection (HPLC-UV) of Scutellaria Radix for the determination of baicalin, the measurement RSD of baicalin by ISO 11843-7:2012 stochastically was within a 95% confidence interval of the statistically obtained RSD by repetitive measurements (n = 6). Thus, our findings show that it is applicable for estimating of the repeatability of HPLC-UV for determining baicalin without repeated measurements. In addition, the allowable limit of the "System repeatability" in "Liquid Chromatography" regulated in a pharmacopoeia can be obtained by the present assessment method. Moreover, the present assessment method was also successfully applied to estimate the measurement RSDs of quantitative three-channel liquid chromatography with electrochemical detection (LC-3ECD) of Chrysanthemi Flos for determining caffeoylquinic acids and flavonoids. By the present repeatability assessment method, reliable measurement RSD was obtained stochastically, and the experimental time was remarkably reduced.

  11. Three new genera and three new species of Nearctic Lasiopteridi (Diptera: Cecidomyiidae: Cecidomyiinae) from Asteraceae and Caprifoliaceae, and the tribe Rhopalomyiini subsumed under Oligotrophini.

    PubMed

    Gagné, Raymond J

    2016-08-30

    Three new Nearctic genera of gall midges (Diptera: Cecidomyiidae), each with a new species, are described: Helianthecis Gagné for Helianthecis capitum Gagné, new species, that lives in flower heads of Helianthus spp. (Asteraceae) from North Dakota to Texas; Lonicerae Gagné for Lonicerae russoi Gagné, new species, and Lonicerae lonicera (Felt), new combination, that form bud galls on Lonicera spp. (Caprifoliaceae) in California; and Chiosperma Gagné for Chiosperma turgidum Gagné, new species, that forms a bud gall on Symphoricarpos albus (L.) S.F. Blake (Caprifoliaceae) in Washington. The three new genera belong to the supertribe Lasiopteridi and are placed in the tribe Oligotrophini. The tribes Oligotrophini and Rhopalomyiini are combined.

  12. Anti-osteoarthritic effects of ChondroT in a rat model of collagenase-induced osteoarthritis.

    PubMed

    Jeong, Jiwon; Bae, Kiljoon; Kim, Sun-Gil; Kwak, Dongwook; Moon, Young-Joo; Choi, Chan-Hun; Kim, Young-Ran; Na, Chang-Su; Kim, Seon-Jong

    2018-04-19

    Previously, we reported that ChondorT showed significant anti-arthritis and anti-inflammatory effects. ChondroT, a new herbal medication, consists of the water extracts of Osterici Radix, Lonicerae Folium, Angelicae Gigantis Radix, Clematidis Radix, and Phellodendri Cortex (6:4:4:4:3). The objective of this study was to investigate the effects of ChondroT in collagenase-induced osteoarthritis rat model. Osteoarthritis was induced by the injection of collagenase into the right knee joint cavity of rats. The samples were divided into seven groups [intact (n = 6), control (n = 6), indomethacin (n = 6), Joins tab (n = 6), ChondroT50 (n = 6), ChondroT100 (n = 6), and ChondroT200 (n = 6)]. The control group was administered normal saline, indomethacin group was administered indomethacin (2 mg/kg), and Joins tab group was administered Joins Tab (20 mg/kg). The ChondroT50, ChondroT100, and ChondroT200 groups were administered 50, 100, and 200 mg/kg of ChondroT, respectively. All oral administrations were initiated 7 days after the induction of arthritis and were continued for a total of 12 days. At the end of the experiment, serum aminotransferase, albumin, blood urea nitrogen, creatinine, leukocyte, and inflammatory cytokines [tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6] were analyzed. Hematoxylin and eosin (H&E) and safranin O-fast green staining of the articular structures of the knee joint were performed. TNF-α and IL-1β decreased in the ChondroT100 and ChondroT200 groups compared with those in the control group. IL-6 and aspartate aminotransferase decreased in the ChondroT50, ChondroT100, and ChondroT200 groups compared with that in the control group. Albumin, WBC and lymphocytes decreased in the ChondroT100 and ChondroT200 groups compared with those in the control group. In H&E stain, synoviocytes, cartilage lacunae, and chondrocytes were well preserved in the ChondroT100 and ChondroT200 groups, and safranin O-fast staining showed a clear reaction of proteoglycans in the ChondroT100 and ChondroT200 groups. Based on these results, it can be proposed that ChondroT has anti-osteoarthritic effects on collagenase-induced rat model.

  13. [Studies on the chemical constituents of Lonicera macranthoides].

    PubMed

    Jia, Xiao-Dong; Zhao, Xing-Zeng; Wang, Ming; Dong, Yun-Fa; Feng, Xu

    2008-07-01

    To study the chemical constituents of flower buds of Lonicera macranthoides. The 90% EtOH extract of Lonicera macranthoides. was successively partitioned with petroleum ether and ethyl acetete. Repeated column chromatography of the ethyl acetete fraction afforded the following compounds (1-9): ginnol (1), triacontanol (2), ursolic acid (3), beta-sitosterol (4), triacontane (5), palmitic acid (6), beta-daucosterol (7), 3-decyl-3-octyldocosan-1-ol (8), 3-dodecyl-3-nonyldocosan-1-ol (9). All compounds except 4 are isolated from this plant for the first time while compounds 2, 3, 5, 8 and 9 are their first time been isolated from genus Lonicera.

  14. [The content of zinc and cadmium in medicinal plants and their infusions].

    PubMed

    Celechovská, O; Pízová, M; Konícková, J

    2004-11-01

    The content of cadmium and zinc in the elder (Sambucus nigra) and the lime tree (Tilia spec.) collected from four different localities in the Czech Republic was studied. From the elder, the flowers (Sambuci flos), pollen, and fruits (Sambuci fructus) were collected, from the lime tree, the flowers (Tiliae flos) were used. The highest content of Zn and Cd was found in the pollen of the elder ( Zn 65.0-94.4 mg.kg(-1), Cd 14.1-43.1 microg.kg(-1)), the lowest in its fruits (Zn 4.5-14.7 mg.kg(-1), Cd max. 8.1 microg.kg(-1)). The content of Zn was lower in the Tiliae flos (13.8-32.5 mg.kg(-1)) than in the Sambuci flos (30.8-49.9 mg.kg(-1)). The Cd content in Tiliae flos (9.9-58.9 microg.kg(-1)) was higher in comparison with the Sambuci flos (3.3-15.3 microg.kg(-1)). The concentration of Cd in the infusion (10, 30 and 60 min) was found under the detection limit of the used metod (0.04 microg.l(-1)). The highest content of Zn transported to the infusion came from the Tiliae flos (20-36%), from the Sambuci flos (17-25%), and from the Sambuci fruits (12-19%). The content of both zinc and cadmium in the studied drugs depends on the localities of the original of plants.

  15. [Determination of genkwanin in flos Genkwa by HPLC].

    PubMed

    Zhang, B; Yuan, S; Xia, K

    1996-04-01

    In this paper, the method for determining genkwanin in Flos Genkwa was established by HPLC. Detected at 332nm on a Lichrosorb 5 RP-18 column with a mobile phase of methanol-water-acetic acid (65:35:5), the content of genkwanin in Flos Genkwa was determined to be 0.16%. The recovery rate was 95.46% and RSD 1.15%.

  16. Traditional chinese medicine Xuebijing treatment is associated with decreased mortality risk of patients with moderate paraquat poisoning.

    PubMed

    Gong, Ping; Lu, Zhidan; Xing, Jing; Wang, Na; Zhang, Yu

    2015-01-01

    Paraquat poisoning causes multiple organ injury and high mortality due to severe toxicity and lack of effective treatment. Xuebijing (XBJ) injection, a traditional Chinese medicine preparation of five Chinese herbs (Radix Salviae Miltiorrhiae, Rhizoma Chuanxiong, Flos Carthami, Angelica Sinensis and Radix Paeoniae Rubra), has an anti-inflammatory effect and is widely used in the treatment of sepsis. This retrospective study was designed to evaluate the effects of XBJ combined with conventional therapy on mortality risk of patients with acute paraquat poisoning. Out of 68 patients, 27 were treated with conventional therapy (control group) and 41 were treated with intravenous administration of XBJ (100 ml, twice a day, up to 7 days) plus conventional therapy (XBJ group). Vital organ function, survival time within 28 days and adverse events during the treatment were reviewed. Results indicated that XBJ treatment significantly increased median survival time among patients ingesting 10-30 ml of paraquat (P=0.02) compared with the control group. After adjustment for covariates, XBJ treatment was associated significantly with a lower mortality risk (adjusted HR 0.242, 95% CI 0.113 to 0.516, P=0.001) compared with the control group. Additionally, compared with Day 1, on Day 3 the value of PaO2/FiO2 was significantly decreased, and the values of serum alanine aminotransferase, creatinine and troponin T were significantly increased in the control group (all P<0.05), but these values were significant improved in the XBJ group (all P<0.05). Only one patient had skin rash with itch within 30 minutes after injection and no severe adverse events were found in the XBJ group. In conclusion, XBJ treatment is associated with decreased mortality risk of patients with moderate paraquat poisoning, which may be attributed to improved function of vital organs with no severe adverse events.

  17. Traditional Chinese Medicine Xuebijing Treatment Is Associated with Decreased Mortality Risk of Patients with Moderate Paraquat Poisoning

    PubMed Central

    Gong, Ping; Xing, Jing; Wang, Na

    2015-01-01

    Paraquat poisoning causes multiple organ injury and high mortality due to severe toxicity and lack of effective treatment. Xuebijing (XBJ) injection, a traditional Chinese medicine preparation of five Chinese herbs (Radix Salviae Miltiorrhiae, Rhizoma Chuanxiong, Flos Carthami, Angelica Sinensis and Radix Paeoniae Rubra), has an anti-inflammatory effect and is widely used in the treatment of sepsis. This retrospective study was designed to evaluate the effects of XBJ combined with conventional therapy on mortality risk of patients with acute paraquat poisoning. Out of 68 patients, 27 were treated with conventional therapy (control group) and 41 were treated with intravenous administration of XBJ (100 ml, twice a day, up to 7 days) plus conventional therapy (XBJ group). Vital organ function, survival time within 28 days and adverse events during the treatment were reviewed. Results indicated that XBJ treatment significantly increased median survival time among patients ingesting 10-30 ml of paraquat (P=0.02) compared with the control group. After adjustment for covariates, XBJ treatment was associated significantly with a lower mortality risk (adjusted HR 0.242, 95% CI 0.113 to 0.516, P=0.001) compared with the control group. Additionally, compared with Day 1, on Day 3 the value of PaO2/FiO2 was significantly decreased, and the values of serum alanine aminotransferase, creatinine and troponin T were significantly increased in the control group (all P<0.05), but these values were significant improved in the XBJ group (all P<0.05). Only one patient had skin rash with itch within 30 minutes after injection and no severe adverse events were found in the XBJ group. In conclusion, XBJ treatment is associated with decreased mortality risk of patients with moderate paraquat poisoning, which may be attributed to improved function of vital organs with no severe adverse events. PMID:25923333

  18. [Traditional Chinese medicine pairs (III)--effect of extract of Ginseng Radix et Rhizoma and Puerariae Lobatae Radix on intestinal absorption in rats].

    PubMed

    Chen, Yi-hang; Li, Meng-xuan; Meng, Zhao-qing; Yang, Jiao-jiao; Huang, Wen-zhe; Wang, Zhen-zhong; Wang, Yue-sheng; Xiao, Wei

    2015-08-01

    This study focused on the intestinal absorption of traditional Chinese medicines (TCM) to reveal the scientific connotation of the compatibility of TCM pairs. The single pass intestinal perfusion (SPIP) was used in rats to compare the absorption of single extracts from Puerariae Lobatae Radix, single extracts from Ginseng Radix et Rhizoma, combined extracts from Puerariae Lobatae Radix and Ginseng Radix et Rhizoma and Puerariae Lobatae Radix and Ginseng Radix et Rhizoma mixture in rats. The content of puerarin, ginsenoside Rg1, ginsenoside Re and ginsenoside Rb1 in liquid were tested by HPLC. The speed constant (Ka) and apparent permeability coefficients (Papp) were calculated and compared. Specifically, the order of puerarin Ka and Papp values from high to low was Ginseng Radix et Rhizoma and Puerariae Lobatae Radix mixture > single extracts from Puerariae Lobatae Radix > combined extracts from Ginseng Radix et Rhizoma and Puerariae Lobatae Radix; the order of ginsenosides Ka and Papp values from high to low was Ginseng Radix et Rhizoma and Puerariae Lobatae Radix mixture > single extracts from Ginseng Radix et Rhizoma > combined extracts from Ginseng Radix et Rhizoma and Puerariae Lobatae Radix. The combined administration of Ginseng Radix et Rhizoma and Puerariae Lobatae Radix may improve the absorption in the intestinal tract.

  19. Management Approaches for Water Quality Enhancement at Whitney Point and East Sidney Lake, New York

    DTIC Science & Technology

    1990-08-01

    flos- aguae Anabaena sp. (colonial blue-greens) 8-16-88 Aphanizomenon flos- aguae Anabaena planctonica Coccoid sp. (colonial blue-greens...Goelosphaeriui sp. Microcystis aerug~inosa Comphosphaeria sp. 9-9-88 Aphanizomenon flos- aguae Oscillatoria sp. Melosira spp. Table 9 Dominant Phytoplankton Species...study (Kennedy et al. 1988). Sampling period was initiated in early April, 1988 and completed in early September, 1988. In situ variables, measured at

  20. Biosynthesis of flat silver nanoflowers: from Flos Magnoliae Officinalis extract to simulation solution

    NASA Astrophysics Data System (ADS)

    Jing, Xiaolian; Huang, Jiale; Wu, Lingfeng; Sun, Daohua; Li, Qingbiao

    2014-03-01

    Flat Ag nanoflowers were directly synthesized from the bioreduction of AgNO3 using Flos Magnoliae Officinalis extract without any additional stabilizer or protective agent at room temperature. Effects of concentrations of the Flos Magnoliae Officinalis extract on the Ag nanostructures were investigated. The main components containing flavone, polyphenol, protein, and reducing sugar in the plant extract were thoroughly determined before and after the reaction, and the dialysis experiments were also conducted. The results of components analysis and dialysis showed that gallic acid representing polyphenols played an important role in the biosynthesis of silver nanoplates. Trisodium citrate combined gallic acid solution, instead of Flos Magnoliae Officinalis extract, was employed and successfully simulated the biosynthesis process of the flat Ag nanoflowers.

  1. [Study on Chemical Constituents from Roots of Lonicera macranthoides].

    PubMed

    Liu, Wen-juan; Chen, Yu; Ma, Xin; Zhao, You-yi; Feng, Xu

    2014-12-01

    To study chemical constituents of the roots of Lonicera macranthoides. The chemical constituents were isolated and purified by means of several chromatographic techniques and their structures were elucidated by spectroscopic methods. Seven compounds were isolated and identified as ribenol (1), excoecarin C (2), 18-hydroxy-13-epi-manoyloxide (3), asiatic acid (4), oleanolic acid (5), β-sitosterol (6) and β-daucosterol (7). Compounds 1-4 are obtained from this genus for the first time. Compound 5 is obtained from this plant for the first time. All the compounds are found from the roots of Lonicera mac- ranthoides for the first time.

  2. A Regional Guidebook for Applying the Hydrogeomorphic Approach to Assessing Wetland Functions of Forested Wetlands in Alluvial Valleys of the Coastal Plain of the Southeastern United States

    DTIC Science & Technology

    2013-04-01

    galli Barnyard grass Imperata   cylindrica    Cogongrass Ligustrum japonicum   Japanese privet Ligustrum sinense   Chinese Privet Lonicera japonica... Imperata   cylindrica    Cogongrass Ligustrum japonicum   Japanese privet Ligustrum sinense   Chinese Privet Lonicera japonica   Japanese Honeysuckle...crus-galli Barnyard grass Imperata   cylindrica    Cogongrass Ligustrum japonicum   Japanese privet Ligustrum sinense   Chinese Privet Lonicera

  3. The combined effects of Dolichospermum flos-aquae, light, and temperature on microcystin production by Microcystis aeruginosa

    NASA Astrophysics Data System (ADS)

    Chen, Ruoqi; Li, Fangfang; Liu, Jiadong; Zheng, Hongye; Shen, Fei; Xue, Yarong; Liu, Changhong

    2016-11-01

    The effects of light, temperature, and coculture on the intracellular microcystin-LR (MC-LR) quota of Microcystis aeruginosa were evaluated based on coculture experiments with nontoxic Dolichospermum ( Anabaena) flos-aquae. The MC-LR quota and transcription of mcyB and mcyD genes encoding MC synthetases in M. aeruginosa were evaluated on the basis of cell counts, high-performance liquid chromatography, and reverse-transcription quantitative real-time PCR. The MC-LR quotas of M. aeruginosa in coculture with a 1/1 ratio of inoculum of the two species were significantly lower relative to monocultures 6-d after inoculation. Decreased MC-LR quotas under coculture conditions were enhanced by increasing the D. flos-aquae to M. aeruginosa ratio in the inoculum and by environmental factors, such as temperature and light intensity. Moreover, the transcriptional concentrations of mcyB and mcyD genes in M. aeruginosa were significantly inhibited by D. flos-aquae competition in coculture ( P <0.01), lowered to 20% of initial concentrations within 8 days. These data suggested that coculture eff ects by D. flos-aquae not only reduced M. aeruginosa's intracellular MC-LR quota via inhibition of genes encoding MC synthetases, but also that this eff ect was regulated by environmental factors, including temperature and light intensities.

  4. [Effect of Radix scutellariae on the growth and form of Porphyromanus endodontics in vitro].

    PubMed

    Tan, Hong; Tang, Yaling; Zhou, Xuedong; Xiao, Xiaorong; Li, Jiyao

    2003-07-01

    To provide scientific evidence for underpinning the use of Radix Scutellariae in the treatment of pulp and periapical diseases. Using minute amount serial dilution test, this study assessed the minimal inhibitory concentration of Radix Scutellariae extreact against Porphyromanus Endodontics. The forms of Porphyromanus endodontics treated with Radix Scutellariae extract at different concentrations were observed by use of SEM. The MIC of Radix Scutellariae extract was determined to be 1 mg/ml. Radix Scutellariae changed the forms of Porphyromanus endodontics, making them become bigger, longer and crumbled. Radix Scutellariae could inhibit the growth of Porphyromanus Endodontics.

  5. [Study on intersection and regulation mechanism of "efficacy-toxicity network" of aconite in combination environment of Sini decoction].

    PubMed

    Li, Zhi-yong; Bao, Hong-juan; Zhang, Shuo-feng; Ye, Tian-yuan; Yang, Ce; Li, Yan-wen

    2015-02-01

    To explore the intersection and regulation mechanism of "efficacy-toxicity network" of Glycyrrhizae Radix et Rhizoma, Zingiberis Rhizoma and Aconiti Lateralis Radix Praeparata's action gene in the combination environment of Sini decoction with the network pharmacological method. The gene interaction network of Aconiti Lateralis Radix Praeparata, Glycyrrhizae Radix et Rhizoma, Zingiberis Rhizoma were mined and established with Cytoscape software and Agilent literature search plug-in. The "efficiency-toxicity network" intersection of Aconiti Lateralis Radix Praeparata was formed according to its effects in anti-heart failure, neurotoxicity and cardiotoxicity. The target genes were clustered with Clusterviz plug-in. And the possible pathways of the "efficacy-tox- icity network" intersection of Glycyrrhizae Radix et Rhizoma, Zingiberis Rhizoma and Aconiti Lateralis Radix Praeparata were forecasted in DAVID database. There were five genes related to neurotoxicity, cardiotoxicity and anti-heart failure function of Aconiti Lateralis Radix Praeparata, namely AKT1, BAX, HCC, IL6 and IL8, which formed 47 nodes genes in the "efficiency-toxicity network" intersection of Aconiti Lateralis Radix Praeparata. There were 29 and 27 coincident genes in the "efficiency-toxicity network" of Glycyrrhizae Radix et Rhizoma, Zingiberis Rhizoma and Aconiti Lateralis Radix Praeparata. There were 23 and 17 possible regulatory pathways. In the combination environment of Sini decoction, Glycyrrhizae Radix et Rhizoma and Zingiberis Rhizoma may regulate the efficiency-toxicity network of Aconiti Lateralis Radix Praeparata by influencing immune-inflammatory signaling pathway, apoptosis-autophagy signaling pathway, nerve cell and myocardial ischemia and hypoxia protection signaling pathways.

  6. Predicting the spatial distribution of Lonicera japonica, based on species occurrence data from two watersheds in Western Kentucky and Tennessee

    Treesearch

    Dongjiao Liu; Hao Jiang; Robin Zhang; Kate S. He

    2011-01-01

    The spatial distribution of most invasive plants is poorly documented and studied. This project examined and compared the spatial distribution of a successful invasive plant, Japanese honeysuckle (Lonicera japonica), in two similar-sized but ecologically distinct watersheds in western Kentucky (Ledbetter Creek) and western Tennessee (Panther Creek)....

  7. Mass Spectral Investigation on Toxins. I. Isolation, Purification, and Characterization of Hepatotoxins from Freshwater Blue-Green Algae (Cyanobacteria) by High-Performance Liquid Chromatography and Fast Atom Bombardment Mass Spectrometric Techniques.

    DTIC Science & Technology

    1986-09-01

    analysis ’" methods in environmental samples. The hepatotoxins from laboratory cultures of M. aeruginosa Strain 7820,15 Anabena flos- aguae (A. 4flos...flos- aguae S-23-g-1l (8 lug) F1 The results from the amino acid analysis using the Llqui-Mat Analyzer are listed in Table 2. The elution times of the...Runnegar, M.T.C., and Huynh, V.L. Effec- tiveness of Activated Carbon in the Removal of Algal Toxin from Potable Water Supplies: A Pilot Plant

  8. Natural Toxins. Characterization, Pharmacology and Therapeutics: Proceedings of the World Congress on Animal, Plant and Microbial Toxins (9th) Held in Stillwater, Oklahoma on 31 July - 5 August 1988

    DTIC Science & Technology

    1988-08-01

    Argentina, Chile and the Peoples Republic of China (Skulberg, et al., 1984; Carmichael et al., 1985, Gorham and Carmichael, 1988). Not all blooms of a...Uh_. flos-aauae that occurred in lakes and ponds of New Hampshire from 1966 through 1980. Toxic cells and extracts of Avh. flos- aguae were shown to be...strain S- 2 3 -g-l (Krishnamurthy et al., 1986 a,b). The identification of a peptide toxin from A flos- aguae S-23-g-l provides the first evidence that

  9. Effect of erythromycin exposure on the growth, antioxidant system and photosynthesis of Microcystis flos-aquae.

    PubMed

    Wan, Jinjin; Guo, Peiyong; Peng, Xiaofang; Wen, Keqi

    2015-01-01

    Erythromycin, a macrolide antibiotic, is commonly used in human life. This compound and its derivatives have been detected in various aquatic compartments and may pose a serious threat to aquatic organisms. This study investigated the effects of erythromycin on the growth, antioxidant system and photosynthesis of Microcystis flos-aquae. The results showed that at 0.001-0.1 μg L(-1), erythromycin could stimulate the growth of M. flos-aquae and increase its photosynthetic activity; however, it did not significantly increase the activities of superoxide dismutase (SOD) and catalase (CAT) or the levels of malondialdehyde (MDA) and reactive oxygen species (ROS). In contrast, the growth of M. flos-aquae was significantly inhibited (p<0.01) at high levels of erythromycin, reaching an inhibition rate of 81.6% at 40 μg L(-1) erythromycin. At the same time, the activities of SOD and CAT along with MDA content also increased significantly (p<0.01), indicating that the high concentrations of erythromycin caused a severe oxidative stress on algae. However, the balance between oxidants and antioxidant enzymes were disrupted because ROS content simultaneously increased. In addition, the fluorescence parameters of M. flos-aquae decreased significantly with both exposure time and increasing concentration of erythromycin, indicating that photosynthesis was inhibited. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. The association of two invasive shrubs, common buckthorn (Rhamnus cathartica) and Tartarian honeysuckle (Lonicera tatarica), with oak communities in the midwestern United States

    Treesearch

    Lisa A. Schulte; Erik C. Mottl; Brian J. Palik

    2011-01-01

    Oak forests throughout North America are declining due to changes in disturbance regimes that have led to increased competition from other tree and shrub species. We evaluated associations between oak regeneration, the occurrence of two common invasive shrubs (common buckthorn (Rhamnus cathartica L.) and Tartarian honeysuckle (Lonicera...

  11. [Contents of total anthocyanins and total saponins as well as composition of saponin monomers of Purple and Green Notoginseng Radix et Rhizoma].

    PubMed

    Zhao, Chang-ling; Yang, Sheng-chao; Chen, Zhong-jian; Shen, Yong; Wei, Fu-gang; Wang, Wu; Long, Ting-ju

    2014-10-01

    The contents of total anthocyanins and total saponins as well as the composition of saponin monomers of Purple and Green Notoginseng Radix et Rhizoma were studied to compare the medicinal quality and commercial values. Three-year-old Notoginseng Radix et Rhizoma was selected as the research materials. The contents of total anthocyanins and total saponins were determined by spectrophotometry. The compositions of saponin monomers were monitored by HPLC. The significance of content differences was determined by variance analysis. The contents of total anthocyanins and total saponins of Purple Notoginseng Radix et Rhizomawere about 204.85% and 33.86% higher than those of Green Notoginseng Radix et Rhizoma respectively. The Purple and Green Notoginseng Radix et Rhizoma both contained five saponin monomers whose contents were as follows: ginsenoside Rg1 > ginsenoside Rb1 > notoginsenoside R1 > ginsenoside Rd > ginsenoside Re. The contents of notoginsenoside R1, ginsenoside Rd and ginsenoside Re of Purple Notoginseng Radix et Rhizoma were about 16.03%, 10.83% and 5.39% higher than those of Green Notoginseng Radix et Rhizoma respectively. However, the contents of ginsenoside Rg1 and ginsenoside Rb1 of Green Notoginseng Radix et Rhizoma were about 0.93% and 3.33% higher than those of Purple Notoginseng Radix et Rhizoma respectively. With respect to Green Notoginseng Radix et Rhizoma, the increase of the total anthocyanins in Purple Notoginseng Radix et Rhizoma reached a significant level, but the increases of total saponins, notoginsenoside R1, ginsenoside Rd and ginsenoside Re and the decreases of ginsenoside Rg1 and ginsenoside Rb1 did not. The total anthocyanins accumulation in Notoginseng Radix et Rhizoma implies the content increases of the total saponins, notoginsenoside R1, ginsenoside Rd and ginsenoside Re, and the slight decreases of ginsenoside Rg1 and ginsenoside Rb1 contents; but the type and relative contents of saponin monomers remain unchanged. The medicinal quality and commercial value of Purple Notoginseng Radix et Rhizoma are higher than those of Green Notoginseng Radix et Rhizoma.

  12. [Detection of agent "zhuanggenling" and investigation of utilization of plant growth retardants in traditional Chinese medicine cultivation].

    PubMed

    Zhai, Yu-yao; Guo, Bao-lin; Huang, Wen-hua

    2015-02-01

    Plant growth retardant as one of plant growth regulator can inhibit the cell division, elongation and growth rate in shoot apical meristem (SAM), which can be reversed by gibberellin regulate the product of photosynthesis transfer to the root and rhizome part. As commonly used plant growth retardant, paclobutrazol, uniconazole, chlorocholine chloride, mepiquat chloride, choline chloride and daminozide are used to promote the growth of root and rhizome, call as "zhuanggenling", "pengdasu", "pengdaji" etc. Single or recombination of plant growth regulator is registered as pesticide, and called as pesticide "zhuanggenling" in this paper. Growth regulator which registered as a foliar fertilizer or fertilization was called agricultural fertilizer "zhuanggenling" in this paper. The author investigate the usage of "zhuanggenling" in the root and rhizome of medicinal plants cultivation from 2012 to 2014 in Sichuan province, Huangyuan town, Mianyang (Ophiopogonis Radix); Pengzhou Aoping town (Chuanxiong Rhizoma); Pengshan Xiejia town (Alismatis Rhizoma); Jiangyou Taiping town and Zhangming town (Aconiti Lateralis Radix Praeparata); Yunnan Wenshan (Notoginseng Radix et Rhizoma); Henan province, Wuzhidafeng Town (Rehmanniae Radix, Achyranthis Bidentatae Radix, Dioscoreae Rhizoma); Gansu Min county (Codonopsis Radix, Angelicae Sinensis Radix); Gansu Li county (Rhei Radix et Rhizoma). The result showed that "zhuanggenling" were applied in the most medicinal plant cultivation except Rhei Radix et Rhizoma. It has been applied widespreadly in Ophiopogonis Radix, Alismatis Rhizoma, Achyranthis Bidentatae Radix, Codonopsis Radix; Rehmanniae Radix, commonly in Angelicae Sinensis Radix application, and occasionally in Chuanxiong Rhizoma, Aconiti Lateralis Radix Praeparata, Notoginseng Radix et Rhizoma and Dioscoreae Rhizoma. In 53 collected sample from plantation areas, fifteen (28%) were pesticide "zhuanggenling", thirty-eight (72%) were pesticide "zhuanggenling". UPLC analysis results showed that 38 farmers fertilizer "zhuanggenling" content of 6 kinds of plant growth retardant. It is regarded that fertilizer "zhuanggenling" was dominant in medicinal plant cultivation, and that the plant growth retardant is added widespreadly in farm fertilizer "zhuanggenling". All evidence proves conclusively that "zhuanggenling" have been used in the proper way, whereas some others have been misused or even abused in the use regarding to type, number, use frequency. The root or rhizoma are increased to 20%-200%. But there is lack of evaluation to appraise the quality of medicinal materials from the aspects of research or industry. "zhuanggenling" has become a important Chemical control material besides fertilizer, insecticidal sterilization of pesticide

  13. Outcomes from Flexible Learning Options for Disenfranchised Youth: What Counts?

    ERIC Educational Resources Information Center

    te Riele, Kitty; Wilson, Kimberley; Wallace, Valda; McGinty, Sue; Lewthwaite, Brian

    2017-01-01

    Flexible Learning Options (FLOs) are common across many countries to enable secondary school completion by young people for whom mainstream schooling has not worked well. Access to high-quality education through FLOs is a social justice issue. In the context of an inclination among governments for accountability and evidence-based policy, as well…

  14. The structural and functional connectivity of the grassland plant Lychnis flos-cuculi

    PubMed Central

    Aavik, T; Holderegger, R; Bolliger, J

    2014-01-01

    Understanding the relationship between structural and functional connectivity is essential for successful restoration and conservation management, particularly in intensely managed agricultural landscapes. We evaluated the relationship between structural and functional connectivity of the wetland plant Lychnis flos-cuculi in a fragmented agricultural landscape using landscape genetic and network approaches. First, we studied the effect of structural connectivity, such as geographic distance and various landscape elements (forest, agricultural land, settlements and ditch verges), on gene flow among populations as a measurement of functional connectivity. Second, we examined the effect of structural graph-theoretic connectivity measures on gene flow among populations and on genetic diversity within populations of L. flos-cuculi. Among landscape elements, forests hindered gene flow in L. flos-cuculi, whereas gene flow was independent of geographic distance. Among the structural graph-theoretic connectivity variables, only intrapopulation connectivity, which was based on population size, had a significant positive effect on gene flow, that is, more gene flow took place among larger populations. Unexpectedly, interpopulation connectivity of populations, which takes into account the spatial location and distance among populations, did not influence gene flow in L. flos-cuculi. However, higher observed heterozygosity and lower inbreeding was observed in populations characterised by higher structural interpopulation connectivity. This finding shows that a spatially coherent network of populations is significant for maintaining the genetic diversity of populations. Nevertheless, lack of significant relationships between gene flow and most of the structural connectivity measures suggests that structural connectivity does not necessarily correspond to functional connectivity. PMID:24253937

  15. [Molecular identification of astragali radix and its adulterants by ITS sequences].

    PubMed

    Cui, Zhan-Hu; Li, Yue; Yuan, Qing-Jun; Zhou, Li-She; Li, Min-Hui

    2012-12-01

    To explore a new method for identification Astragali Radix from its adulterants by using ITS sequence. Thirteen samples of the different Astragali Radix materials and 6 samples of the adulterants of the roots of Hedysarum polybotrys, Medicago sativa and Althaea rosea were collected. ITS sequence was amplified by PCR and sequenced unidirectionally. The interspecific K-2-P distances of Astragali Radix and its adulterants were calculated, and NJ tree and UPGMA tree were constructed by MEGA 4. ITS sequences were obtained from 19 samples respectively, there were Astragali Radix 646-650 bp, H. polybotrys 664 bp, Medicago sativa 659 bp, Althaea rosea 728 bp, which were registered in the GenBank. Phylogeny trees reconstruction using NJ and UPGMA analysis based on ITS nucleotide sequences can effectively distinguish Astragali Radix from adulterants. ITS sequence can be used to identify Astragali Radix from its adulterants successfully and is an efficient molecular marker for authentication of Astragali Radix and its adulterants.

  16. Anti-Inflammatory Activities of Pentaherbs Formula, Berberine, Gallic Acid and Chlorogenic Acid in Atopic Dermatitis-Like Skin Inflammation.

    PubMed

    Tsang, Miranda S M; Jiao, Delong; Chan, Ben C L; Hon, Kam-Lun; Leung, Ping C; Lau, Clara B S; Wong, Eric C W; Cheng, Ling; Chan, Carmen K M; Lam, Christopher W K; Wong, Chun K

    2016-04-20

    Atopic dermatitis (AD) is a common allergic skin disease, characterized by dryness, itchiness, thickening and inflammation of the skin. Infiltration of eosinophils into the dermal layer and presence of edema are typical characteristics in the skin biopsy of AD patients. Previous in vitro and clinical studies showed that the Pentaherbs formula (PHF) consisting of five traditional Chinese herbal medicines, Flos Lonicerae, Herba Menthae, Cortex Phellodendri, Cortex Moutan and Rhizoma Atractylodis at w/w ratio of 2:1:2:2:2 exhibited therapeutic potential in treating AD. In this study, an in vivo murine model with oxazolone (OXA)-mediated dermatitis was used to elucidate the efficacy of PHF. Active ingredients of PHF water extract were also identified and quantified, and their in vitro anti-inflammatory activities on pruritogenic cytokine IL-31- and alarmin IL-33-activated human eosinophils and dermal fibroblasts were evaluated. Ear swelling, epidermis thickening and eosinophils infiltration in epidermal and dermal layers, and the release of serum IL-12 of the murine OXA-mediated dermatitis were significantly reduced upon oral or topical treatment with PHF (all p < 0.05). Gallic acid, chlorogenic acid and berberine contents (w/w) in PHF were found to be 0.479%, 1.201% and 0.022%, respectively. Gallic acid and chlorogenic acid could suppress the release of pro-inflammatory cytokine IL-6 and chemokine CCL7 and CXCL8, respectively, in IL-31- and IL-33-treated eosinophils-dermal fibroblasts co-culture; while berberine could suppress the release of IL-6, CXCL8, CCL2 and CCL7 in the eosinophil culture and eosinophils-dermal fibroblasts co-culture (all p < 0.05). These findings suggest that PHF can ameliorate allergic inflammation and attenuate the activation of eosinophils.

  17. Augmentation of immune cell activity against tumor cells by Rauwolfia radix.

    PubMed

    Jin, Guang-Bi; Hong, Tie; Inoue, Satoshi; Urano, Tomohiko; Cho, Shigefumi; Otsu, Koji; Kitahara, Maya; Ouchi, Yasuyoshi; Cyong, Jong-Chol

    2002-08-01

    In this study, we investigated the effect of Rauwolfia radix on heat shock protein (HSP) 70 expression and cytotoxicity against tumor cells in activated human T cells. When activated T cells were cultured with Rauwolfia radix for 18 h, HSP70 expression after heat shock was remarkably increased, and cytotoxicity against T98G tumor cells was augmented. Moreover, Rauwolfia radix also enhanced the cytotoxicity of heat shocked activated T cells against Molt-4 and T98G tumor cells. Secretions of interferon-gamma (IFN-gamma) and tumor necrosis alpha (TNF-alpha), due to Concanavalin A (Con A) stimulation, were increased by Rauwolfia radix in activated T cells. To investigate the antitumor effect in vivo, EL-4 tumor-bearing mice were administered with Rauwolfia radix in drinking water. The survival period of the Rauwolfia radix treatment group was significantly prolonged compared with that of the control group. Reserpine, the major active ingredient of Rauwolfia radix, also enhanced the cytotoxicity of activated T cells against Molt-4 and T98G tumor cells, and prolonged the survival period of EL-4 tumor-bearing mice. Taken together, our results suggest that Rauwolfia radix can enhance the activity of immune cells against tumor cells.

  18. Analysis on the Application and Characteristics of Chinese Patent Medicines Containing Dried Rehmanniae Radix

    NASA Astrophysics Data System (ADS)

    Guo, Hui; Miao, Yanyan; Miao, mingsan

    2018-01-01

    Dried Rehmanniae Radix has sweet taste, and its drug property is cold.It acts on heart, liver and kidney.It has the effect of clearing heat and cooling blood, nourishing yin and promoting fluid production.The active constituents of dried Rehmanniae Radix are mainly iridoid glycosides, polysaccharides, oligosaccharides and so on.This article sorted and analyzed the application forms, efficacy, applicable symptomsh and the frequency of the use of single traditional Chinese medicine in the Chinese patent medicines containing dried Rehmanniae Radix in the Chinese Pharmacopoeia of 2015. This method provides a train of thought for the further study of the pharmacological constituents of dried Rehmanniae Radix, and supplements the pharmacodynamics of Chinese herbal medicine of dried Rehmanniae Radix. It also provides ideas for the improvement of dried Rehmanniae Radix prescription and the new usage of its old prescription.

  19. Comparison of a Resonant Mirror Biosensor (IAsys) and a Quartz Crystal Microbalance (QCM) for the Study on Interaction between Paeoniae Radix 801 and Endothelin-1.

    PubMed

    Huang, Jiadong; Lin, Qing; Yu, Jinghua; Ge, Shenguang; Li, Jing; Yu, Min; Zhao, Zixia; Wang, Xinsheng; Zhang, Xiuming; He, Xiaorui; Yuan, Liang; Yin, Huijun; Osa, Tetsuo; Chen, Keji; Chen, Qiang

    2008-12-15

    A resonant mirror biosensor, IAsys, and a quartz crystal microbalance (QCM) are known independently as surface sensitive analytical devices capable of label-free and in situ bioassays. In this study, an IAsys and a QCM are employed for a new study on the action mechanism of Paeoniae Radix 801 (P. radix 801) by detecting the specific interaction between P. radix 801 and endothelin-1 (ET-1). In the experiments, ET-1 was immobilized on the surfaces of the IAsys cuvette and the QCM substrate by surface modification techniques, and then P. radix 801 solution was contacted to the cuvette and the substrate, separately. Then, the binding and interaction process between P. radix 801 and ET-1 was monitored by IAsys and QCM, respectively. The experimental results showed that P. radix 801 binds ET-1 specifically. The IAsys and QCM response curves to the ET-1 immobilization and P. radix 801 binding are similar in reaction process, but different in binding profiles, reflecting different resonation principles. Although both IAsys and QCM could detect the interaction of P. radix 801 and ET-1 with high reproducibility and reliability through optimization of the ET-1 coating, the reproducibility and reliability obtained by IAsys are better than those obtained by QCM, since the QCM frequency is more sensitive to temperature fluctuations, atmospheric changes and mechanical disturbances. However, IAsys and QCM are generally potent and reliable tools to study the interaction of P. radix 801 and ET-1, and can conclusively be applied to the action mechanism of P. radix 801.

  20. A rapid integrated bioactivity evaluation system based on near-infrared spectroscopy for quality control of Flos Chrysanthemi.

    PubMed

    Ding, Guoyu; Li, Baiqing; Han, Yanqi; Liu, Aina; Zhang, Jingru; Peng, Jiamin; Jiang, Min; Hou, Yuanyuan; Bai, Gang

    2016-11-30

    For quality control of herbal medicines or functional foods, integral activity evaluation has become more popular in recent studies. The majority of researchers focus on the relationship between chromatography/mass spectroscopy and bioactivity, but the connection with spectrum-activity is easily ignored. In this paper, the near infrared reflection spectra (NIRS) of Flos Chrysanthemi samples were collected as a representative spectrum technology, and corresponding anti-inflammation activities were utilized to illustrate the spectrum-activity study. HPLC/Q-TOF-MS identification and heat map clustering were used to select the quality markers (Q-marker) from five cultivars of Flos Chrysanthemi. Using boxplot analysis and the interval limits of detection (LODs) theory, six crucial markers, namely, chlorogenic acid, 3,5-dicaffeoylquinic acid, 1,5-dicaffeoylquinic acid, luteoloside, apigenin-7-O-β-d-glucoside, and luteolin-7-O-6-malonylglucoside were screened out. Then partial least squares regression (PLSR) calibration models combined with synergy interval partial least squares (siPLS) and 12 different spectral pretreatment methods were developed for the parameters optimization of these Q-markers in Flos Chrysanthemi powder. After comparing the relationship between Q-marker contents and anti-inflammation activity via three machine learning approaches and PLSR, back-propagation neural network (BP-ANN) displayed a more excellent non-linear fitting effect, as its R for new batches reached 0.89. These results indicated that the integrated NIRS and bioactive strategy was suitable for fast quality management in Flos Chrysanthemi, and also applied to other botanical food quality control. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Volatile organic compounds released from Microcystis flos-aquae under nitrogen sources and their toxic effects on Chlorella vulgaris.

    PubMed

    Xu, Qinghuan; Yang, Lin; Yang, Wangting; Bai, Yan; Hou, Ping; Zhao, Jingxian; Zhou, Lv; Zuo, Zhaojiang

    2017-01-01

    Eutrophication promotes massive growth of cyanobacteria and algal blooms, which can poison other algae and reduce biodiversity. To investigate the differences in multiple nitrogen (N) sources in eutrophicated water on the emission of volatile organic compounds (VOCs) from cyanobacteria, and their toxic effects on other algal growth, we analyzed VOCs emitted from Microcystis flos-aquae with different types and concentrations of nitrogen, and determined the effects under Normal-N and Non-N conditions on Chlorella vulgaris. M. flos-aquae released 27, 22, 20, 27, 19, 25 and 17 compounds, respectively, with NaNO 3 , NaNO 2 , NH 4 Cl, urea, Ser, Lys and Arg as the sole N source. With the reduction in N amount, the emission of VOCs was increased markedly, and the most VOCs were found under Non-N condition. C. vulgaris cell propagation, photosynthetic pigment and Fv/Fm declined significantly following exposure to M. flos-aquae VOCs under Non-N condition, but not under Normal-N condition. When C. vulgaris cells were treated with two terpenoids, eucalyptol and limonene, the inhibitory effects were enhanced with increasing concentrations. Therefore, multiple N sources in eutrophicated water induce different VOC emissions from cyanobacteria, and reduction in N can cause nutrient competition, which can result in emissions of more VOCs. Those VOCs released from M. flos-aquae cells under Non-N for nutrient competition can inhibit other algal growth. Among those VOCs, eucalyptol and limonene are the major toxic agents. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Antioxidant effects of Genkwa flos flavonoids on Freund׳s adjuvant-induced rheumatoid arthritis in rats.

    PubMed

    Zhang, Chun-Feng; Zhang, Su-Li; He, Xin; Yang, Xiao-Lin; Wu, Hai-Tao; Lin, Bao-Qin; Jiang, Cui-Ping; Wang, Jun; Yu, Chun-Hao; Yang, Zhong-Lin; Wang, Chong-Zhi; Li, Ping; Yuan, Chun-Su

    2014-05-14

    Genkwa flos (Daphne genkwa Sieb. et Zucc.), a Chinese herbal medicine, has been traditionally used for over two thousand years in China for inflammation related symptoms, including joint pain. To evaluate the antioxidative effects of flavonoid aglycones (FA) isolated from Genkwa flos on adjuvant arthritis in rats and to identify the relationship between antioxidant potential and whole blood viscosity (WBV). FA compounds were identified using LC-MS and the content was assayed by HPLC. Arthritis was induced by an intradermal injection of Freund׳s complete adjuvant in the footpad. The effects of FA on paw volumes, secondary arthritis scores, histopathology of joints, and body and organ weights were measured. The antioxidant effects of FA and WBV were determined. LC-MS analysis showed that the FA contained four major compounds: luteolin, apigenin, hydroxygenkwanin and genkwanin. FA significantly decreased paw edema, arthritis scores, and weight loss. These observations were consistent with the reduction of oxidative stress and the improvement of the WBV. FA significantly decreased arthritis in a rat model through antioxidant and hemorheological modulatory mechanisms. The Genkwa flos flavonoids may have clinical potential for the treatment of rheumatoid arthritis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Analysis of lignans in Magnoliae Flos by turbulent flow chromatography with online solid-phase extraction and high-performance liquid chromatography with tandem mass spectrometry.

    PubMed

    Zhou, Xuan; Chen, Cen; Ye, Xiaolan; Song, Fenyun; Fan, Guorong; Wu, Fuhai

    2016-04-01

    In this study, a method coupling turbulent flow chromatography with online solid-phase extraction and high-performance liquid chromatography with tandem mass spectrometry was developed for analyzing the lignans in Magnoliae Flos. By the online pretreatment of turbulent flow chromatography solid-phase extraction, the impurities removal and analytes concentration were automatically processed, and the lignans were separated rapidly and well. Seven lignans of Magnoliae Flos including epieudesmin, magnolin, 1-irioresinol-B-dimethyl ether, epi-magnolin, fargesin aschantin, and demethoxyaschantin were identified by comparing their retention behavior, UV spectra, and mass spectra with those of reference substances or literature data. The developed method was validated, and the good results showed that the method was not only automatic and rapid, but also accurate and reliable. The turbulent flow chromatography with online solid-phase extraction and high-performance liquid chromatography with tandem mass spectrometry method holds a high potential to become an effective method for the quality control of lignans in Magnoliae Flos and a useful tool for the analysis of other complex mixtures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. [Metabonomics on toxicity reduction of Glycyrrhizae Radix et Rhizoma for Aconiti Lateralis Radix Preparata in Sini Tang].

    PubMed

    Li, Ying; Fu, Chao-Mei; Peng, Wei; Li, Bo; Fu, Shu; Zhang, Hui-Min

    2016-04-01

    To analyze the endogenous metabolite changes in rat plasma after intervention by Sini Tang and Sini Tang without Glycyrrhizae Radix et Rhizoma based on GC-MS metabonomics technology, and study the toxicity reduction effect of Glycyrrhizae Radix et Rhizoma in Sini Tang on Aconiti Lateralis Radix Preparata. Eighteen SD rats were randomly divided into normal group, Sini Tang group and Sini Tang without Glycyrrhizae Radix et Rhizoma group on average. The rats in Sini Tang group and Sini Tang without Glycyrrhizae Radix et Rhizoma group were treated respectively with physic liquor by intragastric administration at the dose of 0.02 mL•g ⁻¹ (equivalent to 0.8 g•mL ⁻¹ crude drugs) once a day for 7 days. The rats in normal group were given with equal volume of saline solution. The plasma samples were collected from each rat 0.5 h after the last administration for GC-MS detection. The data was used for multivariate statistical analysis to obtain 14 potential metabolic markers(13 of them were identified). Then their relative content and metabolic pathways were analyzed. Compared with Sini Tang without Glycyrrhizae Radix et Rhizoma group, seven metabolic markers of were reduced in Sini Tang group. Analysis on physiological functions of these potential metabolic markers showed that the Glycyrrhizae Radix et Rhizoma in Sini Tang could reduce the toxicity of Aconiti Lateralis Radix Preparata by adjusting the glycolysis, lipid metabolism, citrate cycle and some amino acids metabolism. Copyright© by the Chinese Pharmaceutical Association.

  5. [Features of Professor Ma Kun's medication in treating ovulatory infertility].

    PubMed

    Tong, Ya-Jing; Zhang, Hui-Xian; Chen, Yan-Xia; Dong, Mei-Ling; Ma, Kun

    2017-12-01

    In order to analyze Professor Ma Kun's medication in treating anovulatory infertility, her prescriptions for treating anovulatory infertility in 2012-2015 were collected. The medication features and the regularity of prescriptions were mined by using traditional Chinese medicine inheritance support system, association rules, complex system entropy clustering and other mining methods. Finally, a total of 684 prescriptions and 300 kinds of herbs were screened out, with a total frequency of 11 156 times; And 68 core combinations and 8 new prescriptions were mined. The top three frequently used herbs by effect were respectively tonic herb, blood circulation promoting herb, and Qi-circulation promoting herb. The top three tastes were sweetness, bitterness and pungent flavor. The results showed 28 herbs with a high frequency of ≥100.The top 10 frequently used herbs were respectively Angelica Sinensis Radix, Cyperi Rhizoma, Chuanxiong Rhizome, Paeoniae Radix Rubra, Cyathulae Radix, Taxilli Herba, Cuscutae Semen, Codonopsis Radix, Ligustri Lucidi Fructus, Paeoniae Albaand Paeoniae Radix Alba. The association rules analysis showed commonly used herbal pairs, including Rehmanniae Radix Preparata-Chuanxiong Rhizome, Rehmanniae Radix Preparata-Angelica Sinensis Radix, Cuscutae Semen-Dipsaci Radix. In conclusion, Professor Ma has treated anovulatory infertility by nourishing the kidney and activating blood throughout the treatment course, and attached the importance to the relationship between Qi and blood and there gulation of liver, spleen and kidney in treating anovulatory infertility. Copyright© by the Chinese Pharmaceutical Association.

  6. [Effect of Codonopsis Radix maintained with sulfur fumigation on immune function in mice].

    PubMed

    Liu, Cheng-song; Wang, Yu-ping; Shi, Yan-bin; Ma, Xing-ming; Li, Hui-li; Zhang, Xiao-yun; Li, Shou-tang

    2014-11-01

    To investigate the immune function of mice being given the extract of Codonopsis Radix maintained with sulfur fumigation. Mice were divided into five groups. Except the normal control group, the mice were fed with the extract of Codonopsis Radix maintained with sulfur fumigation at the high,medium and low doses, as well as medium dose of Codonopsis Radix maintained with low-temperature vacuum method, respectively. Mice were treated once a day for 10 continuous days. Weight change,organ indexes, blood cell indices, macrophage phagocytic function, and IL-2 and IFN-γ levels were measured. Compared with normal control group, Codonopsis Radix maintained with sulfur fumigation at medium and high doses inhibited body weight increase of mice; white blood cell count of high dose group was significantly increased; significant increase of macrophage phagocytosis were observed for all groups except the normal control group; and spleen index and IFN-γ level of Codonopsis Radix maintained with sulfur fumigation medium dose group were increased significantly. Codonopsis Radix maintained with sulfur fumigation can promote mouse immune function to a certain degree. There was no difference in immune effect between Codonopsis Radix maintained with sulfur fumigation and low-temperature vacuum method during experimental period. However,taking the extract of Codonopsis Radix maintained with sulfur fumigation can exert negative effect on appetite and body weight in mice.

  7. [The effect of Redix Scutellariae on butyrate of Porphyromonas endodontalis in vitro].

    PubMed

    Li, Ji-yao; Tang, Ya-ling; Tan, Hong; Zhou, Xue-dong; Zhang, Ping

    2004-02-01

    To study the effect of Radix Scutellariae on the growth, metabolism of Porphyromonas endodontalis (P.e), as a preparation for studying the mechanism of Radix Scutellariae in treating pulp and periapical diseases. P.e was chosen as the experimental bacteria. Radix Scutellariae was extracted by means of reflux with 80% ethanol. The value of MIC of Radix Scutellariae was measured by minute amount serial dilusion test, and the production of butyrate was measured by high liquid chromatograph(HPLC). Radix Scutellariae could inhibit the growth of P.e, of which the MIC was 100 mg/L. Following the increase in concentration of Radix Scutellariae, the amount of butyrate decreased to (3.527 +/- 0.009) mg/L, (3.048 +/- 0.005) mg/L, (2.490 +/- 0.011) mg/L, (2.209 +/- 0.016) mg/L, respectively (P < 0.05). Radix Scutellariae could inhibit the growth and metabolism of P.e and might be an effective agent in treating pulp and periapical diseases.

  8. [Analysis of different forms Linderae Radix based on HPLC and NIRS fingerprints].

    PubMed

    Du, Wei-Feng; Yue, Xian-Ke; Wu, Yao; Ge, Wei-Hong; Lu, Tu-Lin; Wang, Zhi-Min

    2016-10-01

    Three different forms of Linderae Radix were evaluated by HPLC combined with NIRS fingerprint. The Linderae Radix was divided into three forms, including spindle root, straight root and old root. The HPLC fingerprints were developed, and then cluster analysis was performed using the SPSS software. The near-infrared spectra of Linderae Radix was collected, and then established the discriminant analysis model. The similarity values of the spindle root and straight root all were above 0.990, while the similarity value of the old root was less than 0.850. Two forms of Linderae Radix were obviously divided into three parts by the NIRS model and Cluster analysis. The results of HPLC and FT-NIR analysis showed the quality of Linderae Radix old root was different from the spindle root and straight root. The combined use of the two methods could identify different forms of Linderae Radix quickly and accurately. Copyright© by the Chinese Pharmaceutical Association.

  9. Anti-inflammatory and cytotoxic effects of methanol, ethanol, and water extracts of Angelicae Dahuricae Radix.

    PubMed

    Wang, Myeong-Hyeon; Jeong, Su-Hyeon; Guo, Huifang; Park, Jun-Beom

    2016-01-01

    Angelicae Dahuricae Radix has been used for the treatment of headaches, rhinitis, and colds in traditional medicine. Methanol, ethanol, and water extracts of Angelicae Dahuricae Radix were collected. A statistically significant reduction in the cellular viability of the mouse leukemic monocyte macrophage cell line was noted after treatment with water extracts of Angelicae Dahuricae Radix. Stimulation with lipopolysaccharides (LPS) for 24 h led to a robust increase in nitric oxide production, but Angelicae Dahuricae Radix at 400 μg/mL concentration significantly suppressed nitric oxide produced by the LPS-stimulated RAW 264.7 cells in 70% ethanol, absolute ethanol, 70% methanol, absolute methanol, and boiling water groups (P < 0.05). Pretreatment with absolute ethanol extract of Angelicae Dahuricae Radix suppressed the LPS-stimulated inducible nitric oxide synthase, interleukin-1β, and cycloxygenase-2 expression. Angelicae Dahuricae Radix showed significant cytotoxic effects on the human adenocarcinoma cell line and keratin-forming cell line. (J Oral Sci 58, 125-131, 2016).

  10. Optimization of Microwave-Assisted Extraction Conditions for Five Major Bioactive Compounds from Flos Sophorae Immaturus (Cultivars of Sophora japonica L.) Using Response Surface Methodology.

    PubMed

    Liu, Jin-Liang; Li, Long-Yun; He, Guang-Hua

    2016-03-02

    Microwave-assisted extraction was applied to extract rutin; quercetin; genistein; kaempferol; and isorhamnetin from Flos Sophorae Immaturus. Six independent variables; namely; solvent type; particle size; extraction frequency; liquid-to-solid ratio; microwave power; and extraction time were examined. Response surface methodology using a central composite design was employed to optimize experimental conditions (liquid-to-solid ratio; microwave power; and extraction time) based on the results of single factor tests to extract the five major components in Flos Sophorae Immaturus. Experimental data were fitted to a second-order polynomial equation using multiple regression analysis. Data were also analyzed using appropriate statistical methods. Optimal extraction conditions were as follows: extraction solvent; 100% methanol; particle size; 100 mesh; extraction frequency; 1; liquid-to-solid ratio; 50:1; microwave power; 287 W; and extraction time; 80 s. A rapid and sensitive ultra-high performance liquid chromatography method coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry (EIS-Q-TOF MS/MS) was developed and validated for the simultaneous determination of rutin; quercetin; genistein; kaempferol; and isorhamnetin in Flos Sophorae Immaturus. Chromatographic separation was accomplished on a Kinetex C18 column (100 mm × 2.1 mm; 2.6 μm) at 40 °C within 5 min. The mobile phase consisted of 0.1% aqueous formic acid and acetonitrile (71:29; v/v). Isocratic elution was carried out at a flow rate of 0.35 mL/min. The constituents of Flos Sophorae Immaturus were simultaneously identified by EIS-Q-TOF MS/MS in multiple reaction monitoring mode. During quantitative analysis; all of the calibration curves showed good linear relationships (R² > 0.999) within the tested ranges; and mean recoveries ranged from 96.0216% to 101.0601%. The precision determined through intra- and inter-day studies showed an RSD% of <2.833%. These results demonstrate that the developed method is accurate and effective and could be readily utilized for the comprehensive quality control of Flos Sophorae Immaturus.

  11. Flavone synthases from Lonicera japonica and L. macranthoides reveal differential flavone accumulation

    NASA Astrophysics Data System (ADS)

    Wu, Jie; Wang, Xiao-Chen; Liu, Yang; Du, Hui; Shu, Qing-Yan; Su, Shang; Wang, Li-Jin; Li, Shan-Shan; Wang, Liang-Sheng

    2016-01-01

    Flavones are important secondary metabolites found in many plants. In Lonicera species, flavones contribute both physiological and pharmaceutical properties. However, flavone synthase (FNS), the key enzyme responsible for flavone biosynthesis, has not yet been characterized in Lonicera species. In this study, FNSII genes were identified from Lonicera japonica Thunb. and L. macranthoides Hand.-Mazz. In the presence of NADPH, the recombinant cytochrome P450 proteins encoded by LjFNSII-1.1, LjFNSII-2.1, and LmFNSII-1.1 converted eriodictyol, naringenin, and liquiritigenin to the corresponding flavones directly. The different catalytic properties between LjFNSII-2.1 and LjFNSII-1.1 were caused by a single amino acid substitution at position 242 (glutamic acid to lysine). A methionine at position 206 and a leucine at position 381 contributed considerably to the high catalytic activity of LjFNSII-1.1. In addition, LjFNSII-1.1&2.1 and LmFNSII-1.1 also biosynthesize flavones that were further modified by O-glycosylation in transgenic tobacco. The expression levels of the FNSII genes were consistent with flavone accumulation patterns in flower buds. Our findings suggested that the weak catalytic activity of LmFNSII-1.1 and the relatively low expression of LmFNSII-1.1 in flowers might be responsible for the low levels of flavone accumulation in flower buds of L. macranthoides.

  12. [National physician master Jin Shiyuan's dispensing technology of Aconiti Lateralis Radix Praeparata based on Li Shizhen's pharmaceutical academic thought].

    PubMed

    Yuan, Yi-Ping; Zhai, Hua-Qiang; Guo, Zhao-Juan; Zhang, Tian; Kong, Li-Ting; Jia, Xiao-Yu; Tian, Wei-Lan; Li, Rui

    2016-05-01

    To collect Li Shizhen's experience in Aconiti Lateralis Radix Praeparata identification and clinical application, compare and analyze national physician master Jin Shiyuan's practical operation and theoretical knowledge, which is beneficial for the inheritance and improvement of Aconiti Lateralis Radix Praeparata clinical dispensing technology. In the analysis process, CNKI, Wanfang and other databases were searched with "Aconiti Lateralis Radix Praeparata", "Li Shizhen", "pharmacological method state theory" "Jin Shiyuan" and "Chinese medicine dispensing technology" as the key words. In addition, Treatise on Febrile Disease, Compendium of Materia Medica, Chinese Pharmacopoeia(2015 edition), Notes to Medical Professions(Yi Zong Shuo Yue), and other medicine books were accessed to summarize the processing methods and decoction dosage of Aconiti Lateralis Radix Praeparata in both ancient and modern medicine, and in consideration of technical research and practice operation, Li Shizhen's description of Aconiti Lateralis Radix Praeparata and Professor Jin Shiyuan's research on Aconiti Lateralis Radix Praeparata dispensing technology were analyzed and collected. Li Shizhen recorded the nature identification and clinical application of Aconiti Lateralis Radix Praeparata by using pharmacological method state theory in Compendium of Materia Medica. National physician master Jin Shiyuan carries forward the essence of Li Shizhen's pharmaceutical academic thought with his own proficient knowledge structure in medicine, providing scientific pharmaceutical service for clinical application of Aconiti Lateralis Radix Praeparata Professor. Jin Shiyuan put forward the dispensing technology for the first time, including nature identification technology, clinical processing technology, clinical decocting technology, prescription coping technology, and class specifications of Aconiti Lateralis Radix Praeparata. In this paper, Aconiti Lateralis Radix Praeparata was used as an example to analyze the key dispensing technology of traditional Chinese medicine, and apply the key dispensing technology of traditional Chinese medicine in various commonly used Chinese medicines in the future. Copyright© by the Chinese Pharmaceutical Association.

  13. Characterization and discrimination of raw and vinegar-baked Bupleuri radix based on UHPLC-Q-TOF-MS coupled with multivariate statistical analysis.

    PubMed

    Lei, Tianli; Chen, Shifeng; Wang, Kai; Zhang, Dandan; Dong, Lin; Lv, Chongning; Wang, Jing; Lu, Jincai

    2018-02-01

    Bupleuri Radix is a commonly used herb in clinic, and raw and vinegar-baked Bupleuri Radix are both documented in the Pharmacopoeia of People's Republic of China. According to the theories of traditional Chinese medicine, Bupleuri Radix possesses different therapeutic effects before and after processing. However, the chemical mechanism of this processing is still unknown. In this study, ultra-high-performance liquid chromatography with quadruple time-of-flight mass spectrometry coupled with multivariate statistical analysis including principal component analysis and orthogonal partial least square-discriminant analysis was developed to holistically compare the difference between raw and vinegar-baked Bupleuri Radix for the first time. As a result, 50 peaks in raw and processed Bupleuri Radix were detected, respectively, and a total of 49 peak chemical compounds were identified. Saikosaponin a, saikosaponin d, saikosaponin b 3 , saikosaponin e, saikosaponin c, saikosaponin b 2 , saikosaponin b 1 , 4''-O-acetyl-saikosaponin d, hyperoside and 3',4'-dimethoxy quercetin were explored as potential markers of raw and vinegar-baked Bupleuri Radix. This study has been successfully applied for global analysis of raw and vinegar-processed samples. Furthermore, the underlying hepatoprotective mechanism of Bupleuri Radix was predicted, which was related to the changes of chemical profiling. Copyright © 2017 John Wiley & Sons, Ltd.

  14. [Effectiveness of different maintenance methods for codonopsis radix].

    PubMed

    Shi, Yan-Bin; Wang, Yu-Ping; Li, Yan; Liu, Cheng-Song; Li, Hui-Li; Zhang, Xiao-Yun; Li, Shou-Tang

    2014-05-01

    To observe different maintenance methods including vacuum-packing, storage together with tobacco, storage together with fennel, ethanol steam and sulfur fumigation for the protection of Codonopsis Radix against mildew and insect damage, and to analyze the content of polysaccharide and flavonoids of Codonopsis Radix tested in this studies, so as to look for the scientific maintenance methods replacing traditional sulfur fumigation. Except for the sulfur fumigation, naturally air-dried Codonopsis Radix was used to investigate the maintenance effectiveness of the above methods, respectively. Mildew was observed by visual inspection, and the content of polysaccharide and flavonoids were determined by ultra-violet and visible spectrophotometer. Comprehensive evaluation was given based on the results of the different maintenance methods. Low-temperature vacuum-packing, ambient-temperature vacuum-packing and sulfur fumigation could keep Codonopsis Radix from mildew and insect damage for one year, but ambient-temperature vacuum-packing showed flatulent phenomenon; ethanol steam could keep Codonopsis Radix from mildew and insects for over half a year; storage together with tobacco or fennel did not have maintenance effect. The difference of polysaccharide and flavonoids contents of all tested Codonopsis Radix was not statistically significant. Low temperature vacuum-packing maintenance can replace traditional sulfur fumigation, and it can maintain the quality of Codonopsis Radix to a certain extent.

  15. Classified one-step high-radix signed-digit arithmetic units

    NASA Astrophysics Data System (ADS)

    Cherri, Abdallah K.

    1998-08-01

    High-radix number systems enable higher information storage density, less complexity, fewer system components, and fewer cascaded gates and operations. A simple one-step fully parallel high-radix signed-digit arithmetic is proposed for parallel optical computing based on new joint spatial encodings. This reduces hardware requirements and improves throughput by reducing the space-bandwidth produce needed. The high-radix signed-digit arithmetic operations are based on classifying the neighboring input digit pairs into various groups to reduce the computation rules. A new joint spatial encoding technique is developed to present both the operands and the computation rules. This technique increases the spatial bandwidth product of the spatial light modulators of the system. An optical implementation of the proposed high-radix signed-digit arithmetic operations is also presented. It is shown that our one-step trinary signed-digit and quaternary signed-digit arithmetic units are much simpler and better than all previously reported high-radix signed-digit techniques.

  16. Radix Bupleuri: A Review of Traditional Uses, Botany, Phytochemistry, Pharmacology, and Toxicology.

    PubMed

    Yang, Fude; Dong, Xiaoxv; Yin, Xingbin; Wang, Wenping; You, Longtai; Ni, Jian

    2017-01-01

    Radix Bupleuri (Chaihu) has been used as a traditional medicine for more than 2000 years in China, Japan, Korea, and other Asian countries. Phytochemical studies demonstrated that this plant contains essential oils, triterpenoid saponins, polyacetylenes, flavonoids, lignans, fatty acids, and sterols. Crude extracts and pure compounds isolated from Radix Bupleuri exhibited various biological activities, such as anti-inflammatory, anticancer, antipyretic, antimicrobial, antiviral, hepatoprotective, neuroprotective, and immunomodulatory effects. However, Radix Bupleuri could also lead to hepatotoxicity, particularly in high doses and with long-term use. Pharmacokinetic studies have demonstrated that the major bioactive compounds (saikosaponins a, b 2 , c, and d) were absorbed rapidly in rats after oral administration of the extract of Radix Bupleuri . This review aims to comprehensively summarize the traditional uses, botany, phytochemistry, pharmacology, toxicology, and pharmacokinetics of Radix Bupleuri reported to date with an emphasis on its biological properties and mechanisms of action.

  17. Chemosynthesis pathway and bioactivities comparison of saponins in radix and flower of Panax notoginseng (Burk.) F.H. Chen.

    PubMed

    Zhou, Xin; Chen, Lin-Lin; Xie, Rui Fang; Lam, Wing; Zhang, Zi-Jia; Jiang, Zao-Li; Cheng, Yung-Chi

    2017-04-06

    Panax notoginseng (Burk.) F.H. Chen is a well known medicinal plant. Its radix is used in the history while its flower is recently used for health care. In this study we compared chemical ingredients and bioactivities in cell culture for radix and flower of Panax notoginseng (Burk.) F.H. Chen. The liquid chromatography-mass spectrometry system was applied to determine the contents of saponins in flower and radix of Panax notoginseng (Burk.) F.H. Chen. Transcription specific luciferase reporter assay and qPCR method for selected RNA were carried out to assess the impacts of flower and radix extract on the transcription signal pathways. The results of chemical analysis showed that the contents of saponins in flower and radix are very different: the contents of Rg1, Rb1, Re, R1, Rg3-20R, Rh1 and Rf in radix are abundant; in contrast, the contents of Rb3, Fc, Ft1, Rb2 and Rh2-20s in flowers are plentiful. There are substantial variations of those saponin contents from one batch vs another. Based on relative content of saponins, the chemosynthesis pathway of ingredients in radix and flower are proposed: for radix, both PPT (Protopanaxatriol) and PPD (Protopanaxadiol) type triterpenoids are involved, the main pathway is PPT→Rb 1 →Rg 1 →R 1 or PPD→Rh 2 20s→Rg3(20s)→R d →Rb 1 ; for flowers, only PPD is main passage with PPD→Rh 2 (20s)→Rg 3 (20s)→R d →Rb 2 →Fc. The results of signal transcription assays demonstrated that herb water extract of radix and flower had no significant influences on most of transcription activities. However, total saponins of radix and flower which have highly content of saponins were able to inhibit the inflammatory related transcriptional activities and their related mRNA expression of IFNα, TNFα, il-6 and TGFβ as well as induce anti-oxygen NrF2 activities. In summary, although chemical ingredients and chemosynthesis pathway of flower and radix for Panax notoginseng (Burk.) F.H. Chen were different, these differences might not result in their differences of pharmacological activities. Copyright © 2017. Published by Elsevier B.V.

  18. Inhibitory effect of saponins and polysaccharides from Radix ranunculi ternati on human gastric cancer BGC823 cells.

    PubMed

    Niu, Lidan; Zhou, Yingfeng; Sun, Bing; Hu, Junling; Kong, Lingyu; Duan, Sufang

    2013-01-01

    The effects of different Radix ranunculi ternati extracts on human gastric cancer BGC823 cells were investigated, different methods were used to extract the saponins and polysaccharides from Radix ranunculi ternati, and MTT assay and colony formation assay were used to observe the effects of saponins and polysaccharides from Radix ranunculi ternati on in-vitro cultured human gastric cancer BGC823 cells. The results found that the saponins and polysaccharides from Radix Ranunculi Ternati had certain effects on both the growth and colony formation of human gastric cancer BGC823 cells, while improving the immune function of normal mice, of which saponins had more significant effects than polysaccharides.

  19. Comparison of the Protective Effects of Radix Astragali, α-Lipoic Acid, and Vitamin E on Acute Acoustic Trauma.

    PubMed

    Xiong, Min; Lai, Huangwen; Yang, Chuanhong; Huang, Weiyi; Wang, Jian; Fu, Xiaoyan; He, Qinglian

    2012-01-01

    Oxidative damage is a critical role which involves hearing loss induced by impulse noise. That exogenous antioxidant agents reduce noise induced hearing loss (NIHL) has been well demonstrated in both animal studies and clinical practices. Choosing a stronger and more effective antioxidant is very important for treatment of NIHL. Vitamin E, α-lipoic acid, and radix astragali are the most commonly used anti-oxidants for cochlear oxidative damage from acoustic trauma. In this study, the protective effects of radix astragali, α-lipoic acid, and vitamin E on acute acoustic trauma are investigated. Guinea pigs in the experimental groups were intragastrically administered vitamin E, α-lipoic acid, and radix astragali. Auditory thresholds were assessed by sound-evoked auditory brainstem response (ABR) at click and tone bursts of 8, 16 and 32 kHz, 24 hours before and 72 hours after exposure to impulse noise. Cochlear malondialdehyde (MDA) concentrations were detected. Hair cell damage was analyzed by scanning electron microscopy. Vitamin E, α-lipoic acid, and radix astragali significantly reduced ABR deficits, reduced hair cell damage, and decreased the concentrations of MDA. α-lipoic acid and radix astragali were better than vitamin E, and there were no significant differences between α-lipoic acid and radix astragali. α-lipoic acid or radix astragali are recommended for treatment of NIHL.

  20. [Thinking on development of Shanxi Astragali Radix industry].

    PubMed

    Qin, Xue-Mei; Li, Ai-Ping; Li, Ke; Li, An-Ping; Ning, Lu-Hong

    2016-12-01

    Shanxi, a traditional production area to produce genuine Astragali Radix of high quality, has experienced major changes in the pattern of resources. This area once accounted for half of Astragali Radix industry, but now only serves as the largest supply area of traditional wild Astragali Radix. Furthermore, the strategic position of Shanxi Astragali Radix industry will become more prominent and more important to economic and social development in face of the diversity of market demands, especially for the strong demands of high-end Astragali Radix. In addition, Astragalus industry involves the simultaneous development of the first, second and tertiary industries in many areas, and it is typical and representative in the traditional Chinese medicine industry development. However, the application and industrial development of Shanxi Astragali Radix have been restricted due to the problems such as blind promotion of transplanting cultivation technology, and lack of science and technology including efficacy investigation, safety evaluation, standardization and controllability studies. Therefore, we would analyze the production history, resource structure, the current situation and progress of industry development, scientific research foundation and existing problem in this paper, and put forward countermeasures for development and technical innovation in order to make Astragali Radix industry bigger and stronger through innovation-driven and make benefits for demos. This thought provides a reference for the exploratory development of other large varieties of Chinese medicinal materials. Copyright© by the Chinese Pharmaceutical Association.

  1. Comparison of Chemical Constituents in Scrophulariae Radix Processed by Different Methods based on UFLC-MS Combined with Multivariate Statistical Analysis.

    PubMed

    Wang, Shengnan; Hua, Yujiao; Zou, Lisi; Liu, Xunhong; Yan, Ying; Zhao, Hui; Luo, Yiyuan; Liu, Juanxiu

    2018-02-01

    Scrophulariae Radix is one of the most popular traditional Chinese medicines (TCMs). Primary processing of Scrophulariae Radix is an important link which closely related to the quality of products in this TCM. The aim of this study is to explore the influence of different processing methods on chemical constituents in Scrophulariae Radix. The difference of chemical constituents in Scrophulariae Radix processed by different methods was analyzed by using ultra fast liquid chromatography-triple quadrupole-time of flight mass spectrometry coupled with principal component analysis and orthogonal partial least squares discriminant analysis. Furthermore, the contents of 12 index differential constituents in Scrophulariae Radix processed by different methods were simultaneously determined by using ultra fast liquid chromatography coupled with triple quadrupole-linear ion trap mass spectrometry. Gray relational analysis was performed to evaluate the different processed samples according to the contents of 12 constituents. All of the results demonstrated that the quality of Scrophulariae Radix processed by "sweating" method was better. This study will provide the basic information for revealing the change law of chemical constituents in Scrophulariae Radix processed by different methods and facilitating selection of the suitable processing method of this TCM. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. [Clinical study on aconite prescriptions with incompatible herbs in different areas based on association rules and analysis on compatibility features].

    PubMed

    Zuo, Ting; Fan, Xin-sheng; Tian, Shuo; Jiang, Chen-xue; Chen, Fei

    2015-03-01

    To explore the current application and features of Aconite prescriptions with incompatible herbs in grade A class three hospitals in east China and central China through a clinical study and comparative analysis. Clinical prescriptions containing Aconite with incompatible herbs were collected. Association rules were utilized to analyze the compatible features of these herbs. This analysis found that the frequently used incompatible herba; pairs are Aconiti Lateralis Radix Praeparata-Pinelliae Rhizoma, with the support rate of 44.45%, occupying nearly half of the surveyed prescriptions; Pinelliae Rhizoma is the most frequently used herb in the two areas, with support rate up to 76.24%. Among the top 10 herbal pairs in the support rate, except for Aconiti Lateralis Radix Praeparata and Pinelliae Rhizoma, the top 10 herbs in Central China were mostly for warming the middle jiao and tonifying qi, such as Zingiberis Rhizoma, Atractylodis Macrocephalae Rhizoma and Codonopsis Radix; Whereas those in east China were mostly for activating and nourishing blood, such as Angelicae Sinensis Radix, Chuanxiong Rhizoma, and Salviae Miltiorrhizae Radix et Rhizoma. Among the top 10 herbal pairs in the support rate, except for Aconiti Lateralis Radix Praeparata-Pinelliae Rhizoma, the core herbal pairs applied in central China were mainly for resolving phlegm and warming the middle jiao, such as Pinelliae Rhizoma-Glycyrrhizae Radix et Rhizoma, Pinelliae Rhizoma-Zingiberis Rhizoma; Whereas those in east China were principally for activating blood and tonifying qi, like Atractylodis Macrocephalae Rhizoma and Pinelliae Rhizoma, Angelicae Sinensis Radix and Pinelliae Rhizoma. Among the core herbal groups in the two areas, the most frequently used herbal groups in the two areas are Aconiti Lateralis Radix Praeparata, Glycyrrhizae Radix et Rhizoma and Pinelliae Rhizoma with the support rate of 59.73%, accounting for the highest proportion among all of herbal groups. There are the combined clinical application of Aconite with incompatible herbs, mostly with Aconiti Lateralis Radix Praeparata-Pinelliae Rhizoma, but with differences in the combined application in east China and central China.

  3. Exploiting genes and functional diversity of chlorogenic acid and luteolin biosyntheses in Lonicera japonica and their substitutes.

    PubMed

    Yuan, Yuan; Wang, Zhouyong; Jiang, Chao; Wang, Xumin; Huang, Luqi

    2014-01-25

    Chlorogenic acids (CGAs) and luteolin are active compounds in Lonicera japonica, a plant of high medicinal value in traditional Chinese medicine. This study provides a comprehensive overview of gene families involved in chlorogenic acid and luteolin biosynthesis in L. japonica, as well as its substitutes Lonicera hypoglauca and Lonicera macranthoides. The gene sequence feature and gene expression patterns in various tissues and buds of the species were characterized. Bioinformatics analysis revealed that 14 chlorogenic acid and luteolin biosynthesis-related genes were identified from the L. japonica transcriptome assembly. Phylogenetic analyses suggested that the function of individual gene could be differentiation and induce active compound diversity. Their orthologous genes were also recognized in L. hypoglauca and L. macranthoides genomic datasets, except for LHCHS1 and LMC4H2. The expression patterns of these genes are different in the tissues of L. japonica, L. hypoglauca and L. macranthoides. Results also showed that CGAs were controlled in the first step of biosynthesis, whereas both steps controlled luteolin in the bud of L. japonica. The expression of LJFNS2 exhibited positive correlation with luteolin levels in L. japonica. This study provides significant information for understanding the functional diversity of gene families involved in chlorogenic acid and the luteolin biosynthesis, active compound diversity of L. japonica and its substitutes, and the different usages of the three species. Copyright © 2012. Published by Elsevier B.V.

  4. [Discover potential inhibitors of 5-LOX and LTA4H from Rhei Radix et Rhizoma, Notopterygii Rhizoma et Radix and Genitana Macrophyllae Radix based on molecular simulation methods].

    PubMed

    Gu, Yu; Zhang, Xu; Chen, Yan-Kun; Zhao, Bo-Wen; Zhang, Yan-Ling

    2017-12-01

    5-lipoxygenase (5-LOX) and leukotriene A4 hydrolase (LTA4H), as the major targets of 5-LOX branch in the arachidonic acid (AA) metabolic pathway, play an important role in the treatment of inflammation. Rhei Radix et Rhizoma, Notopterygii Rhizoma et Radix and Genitana Macrophyllae Radix have clear anti-inflammation activities. In this paper, the targets of 5-LOX and LTA4H were used as the research carrier, and Hiphop module in DS4.0 (Discovery studio) was used to construct ingredients database for preliminary screening of three traditional Chinese medicines based on target inhibitor pharmacophore, so as to obtain 5-LOX and LTA4H potential active ingredients. The ingredients obtained in initial pharmacophore screening were further screened by using CDOCKER module, and the screening rules were established based on the score of initial compound and the key amino acids to obtain 12 potential 5-LOX inhibitors and 7 potential LTA4H inhibitors. To be more specific, the potential 5-LOX inhibitors included 6 ingredients in Rhei Radix et Rhizoma, such as procyanidins B2-3,3'-O-double gallate and revandchinone 2; four ingredients in notopterygium, such as dodecanoic acid and so on. On the other hand, potential LTA4H inhibitors included revandchinone 1, revandchinone 4 in Rhei Radix et Rhizoma, tridecanoic acid, tetracosanoic acid and methyl eicosanoate in Notopterygii Rhizoma et Radix, montanic acid methyl ester and N-docosanoyl-O-aminobenzoate in Genitana Macrophyllae Radix and so on. The molecular simulation methods were highly efficient and time-saving to obtain the potential inhibitors of 5-LOX and LTA4H, which could provide assistance for discovering the chemical quality indicators of anti-inflammatory efficacy of three Chinese herbs, and may be helpful to promote the whole-process quality control of three Chinese herbs. Copyright© by the Chinese Pharmaceutical Association.

  5. [Quality assessment of sulfur-fumigated paeoniae alba radix].

    PubMed

    Wang, Zhao; Chen, Yu-Wu; Wang, Qiong; Sun, Lei; Xu, Wei-Yi; Jin, Hong-Yu; Ma, Shuang-Cheng

    2014-08-01

    The samples of sulfur-fumigated Paeoniae Alba Radix acquired both by random spot check from domestic market and self-production by the research group in the laboratory were used to evaluate the effects of sulphur fumigation on the quality of Paeoniae Alba Radix by comparing sulfur-fumigated degree and character, the content of paeoniflorin and paeoniflorin sulfurous acid ester, and changes of the fingerprint. We used methods in Chinese Pharmacopeia to evaluate the character of sulfur-fumigated Paeoniae Alba Radix and determinate the content of aulfur-fumigated paeoniflorin. LC-MS method was used to analyze paeoniflorin-converted products. HPLC fingerprint methods were established to evaluate the differences on quality by similarity. Results showed that fumigated Paeoniae Alba Radix became white and its unique fragrance disappeared, along with the production of pungent sour gas. It also had a significant effect on paeoniflorin content. As sulfur smoked degree aggravated, paeoniflorin content decreased subsequently, some of which turned into paeoniflorin sulfurous acid ester, and this change was not reversible. Fingerprint also showed obvious changes. Obviously, sulfur fumigation had severe influence on the quality of Paeoniae Alba Radix, but we can control the quality of the Paeoniae Alba Radix by testing the paeoniflorin sulfurous acid ester content.

  6. [NIR Fingerprints of Different Medicinal Parts of Angelicae Sinensis Radix].

    PubMed

    Zhang, Ya-ya; Gu, Zhi-rong; Ding, Jun-xia; Wang, Yao-peng; Sun, Yu-jing; Wang, Ya-li

    2015-07-01

    To investigate the spectrum characteristics of near-intrared dittuse retlectance spectroscopy (NIR) fingerprint of different medicinal parts of Angelicae Sinensis Radix. 96 batches of samples were collected from 14 counties of Gansu Province and Yunnan Province. The NIR fingerprints were collected by integrated sphere. Similarity analysis and partial least square discriminant analysis(PLS-DA) were used to analyze the fingerprint. The average spectrum of NIR fingerprint of different medicinal parts of Angelicae Sinensis Radix showed some differences; the absorbance in characteristic absorption was in a decreasing order of body > tail > head > whole. Most NIR fingerprint similarities of different medicinal parts of Angelicae Sinensis Radix exceeded 0. 95. The established model of PLS-DA could be used to accurately classify the medicinal parts of Angelicae Sinensis Radix. The differences of NIR fingerprints of different medicinal parts of Angelicae Sinensis Radix were mainly existing in the wave number ranges of 8,443 - 8,284 cm -1, 7,003 - 6,896 cm-1, 6,102 - 5,864 cm-1, 4,847 - 4,674 cm-1, and 4,386 - 4,208 cm-1. The different medicinal parts of Angelicae Sinensis Radix have some differences in chemical components.

  7. Cause and control of Radix Ophiopogonis browning during storage.

    PubMed

    Wang, Hui; Qi, Jin; Han, Dong-Qi; Xu, Tian; Liu, Ji-Hua; Qin, Min-Jian; Zhu, Dan-Ni; Bo-Yang, Yu

    2015-01-01

    In the storage of Radix Ophiopogonis, browning often happens to cause potential risk with regard to safety. Previously few reports investigate the browning of Radix Ophiopogonis. In this research, the causes and mechanisms of the browning of Radix Ophiopogonis were preliminarily elucidated. Content determination by high-performance liquid chromatography (HPLC) and spectrophotometry, enzyme activity determination by colorimetry, and morphological observation by electron microscopy were performed in the present study. Uniform design and three-dimensional response surfaces were applied to investigate the relationship between browning and storage factors. The cortex cell wall of browned Radix Ophiopogonis was ruptured. Compared with the normal Radix Ophiopogonis, cellulase and polyphenol oxidase enzymes were activated, the levels of 5-hydroxymethylfurfural (5-HMF), total sugars, and reducing sugars were increased, while the levels of polysaccharides and methylophiopogonanone A were decreased in browned Radix Ophiopogonis. The relationship between the storage factors and degree of browning (Y) could be described by following correlation equation: Y = - 0.625 4 + 0.020 84 × X3 + 0.001 514 × X1 × X2 - 0.000 964 4 × X2 × X3. Accompanied with browning under storage conditions, the chemical composition of Radix Ophiopogonis was altered. Following the activation of cellulase, the rupture of the cortex cell wall and the outflow of cell substances flowed out, which caused the Radix Ophiopogonis tissue to become soft and sticky. The main causes of the browning were the production of 5-HMF, the activation of polyphenol oxidase, Maillard reactions and enzymatic browning. Browning could be effectively prevented when the air relative humidity (HR), temperature, and moisture content were under 25% RH, 12 °C and 18%, respectively. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  8. PREPARATION AND PROPERTIES OF COMPOUND ARNEBIAE RADIX MICROEMULSION GEL

    PubMed Central

    Chen, Jing; He, Yanping; Gao, Ting; Zhang, Licheng; Zhao, Yuna

    2017-01-01

    Background: Compound Arnebiae radix oil has been clinically applied to treat burns and scalds for a long time. However, it is unstable and inconvenient to use. The aim of this study was to prepare a compound Arnebiae radix microemulsion gel for transdermal delivery system and evaluate its characteristics. Materials and Methods: Based on the solubility of Shikonin, the active component of Arnebiae radix and the results of phase studies, adequate ratio of each component in microemulsion was determined. The optimized microemulsion gel was prepared using Carbomer 940. The gels were characterized in terms of appearance, preliminary stability test and the content of Shikonin in the compound Arnebiae radix microemulsion gel with HPLC analysis. Results: The optimized conditions for preparing microemulsion were Tween-80, glycerin, isopropyl myristate (IPM) with the ratio of 6:3:2. The optimal microemulsion gel was obtained with Carbomer 940 (1.0%). Conclusion: The prepared compound Arnebiae radix microemulsion gel showed good stability over time. It is more convenience in application than the previous used formulations. PMID:28480438

  9. PREPARATION AND PROPERTIES OF COMPOUND ARNEBIAE RADIX MICROEMULSION GEL.

    PubMed

    Chen, Jing; He, Yanping; Gao, Ting; Zhang, Licheng; Zhao, Yuna

    2017-01-01

    Compound Arnebiae radix oil has been clinically applied to treat burns and scalds for a long time. However, it is unstable and inconvenient to use. The aim of this study was to prepare a compound Arnebiae radix microemulsion gel for transdermal delivery system and evaluate its characteristics. Based on the solubility of Shikonin, the active component of Arnebiae radix and the results of phase studies, adequate ratio of each component in microemulsion was determined. The optimized microemulsion gel was prepared using Carbomer 940. The gels were characterized in terms of appearance, preliminary stability test and the content of Shikonin in the compound Arnebiae radix microemulsion gel with HPLC analysis. The optimized conditions for preparing microemulsion were Tween-80, glycerin, isopropyl myristate (IPM) with the ratio of 6:3:2. The optimal microemulsion gel was obtained with Carbomer 940 (1.0%). The prepared compound Arnebiae radix microemulsion gel showed good stability over time. It is more convenience in application than the previous used formulations.

  10. Radix Ilicis Pubescentis total flavonoids combined with mobilization of bone marrow stem cells to protect against cerebral ischemia/reperfusion injury

    PubMed Central

    Miao, Ming-san; Guo, Lin; Li, Rui-qi; Ma, Xiao

    2016-01-01

    Previous studies have shown that Radix Ilicis Pubescentis total flavonoids have a neuroprotective effect, but it remains unclear whether Radix Ilicis Pubescentis total flavonoids have a synergistic effect with the recombinant human granulocyte colony stimulating factor-mobilized bone marrow stem cell transplantation on cerebral ischemia/reperfusion injury. Rat ischemia models were administered 0.3, 0.15 and 0.075 g/kg Radix Ilicis Pubescentis total flavonoids from 3 days before modeling to 2 days after injury. Results showed that Radix Ilicis Pubescentis total flavonoids could reduce pathological injury in rats with cerebral ischemia/reperfusion injury. The number of Nissl bodies increased, Bax protein expression decreased, Bcl-2 protein expression increased and the number of CD34-positive cells increased. Therefore, Radix Ilicis Pubescentis total flavonoids can improve the bone marrow stem cell mobilization effect, enhance the anti-apoptotic ability of nerve cells, and have a neuroprotective effect on cerebral ischemia/reperfusion injury in rats. PMID:27073381

  11. [Industrialization condition and development strategy of Notopterygii Rhizoma et Radix].

    PubMed

    Jiang, Shun-Yuan; Sun, Hui; Wang, Hong-Lan; Ma, Xiao-Jun; Qin, Ji-Hong; Xin, Jun; Sun, Hong-Bing; Du, Jiu-Zhen; Yin, Li

    2017-07-01

    Notopterygii Rhizoma et Radix, the underground part of Notopterygium incisum and N. franchetii, is used as a classical traditional Chinese medicine, and as raw materials for 262 Chinese patent drugs production in 694 pharmaceutical factories currently. It plays an important role in the whole Chinese medicine industry with irreplaceable important economic and social values. However, wild resource of was abruptly depleted, and large-scale artificial cultivation has been inapplicable. In this study, Utilization history and the industrialization status of Notopterygii Rhizoma et Radix were summarized. Resource distribution, ecological suitability of Notopterygii Rhizoma et Radix and core technologies for seeds production, seedling breeding, large-scale cultivation has been reported by current studies, and basic conditions are already available for industrialization production of Notopterygii Rhizoma et Radix. However, there still some key technical problems need to be solved in the further research, and some policy dimensions need to be focused on in the coming industrialization cultivation of Notopterygii Rhizoma et Radix. Copyright© by the Chinese Pharmaceutical Association.

  12. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry.

    PubMed

    Zhu, Hongbin; Wang, Chunyan; Qi, Yao; Song, Fengrui; Liu, Zhiqiang; Liu, Shuying

    2012-11-08

    This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in combination with multivariate data analysis provides a very flexible and reliable method for quality assessment of toxic herbal medicine. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Metabolic profiles of the Flos Abelmoschus manihot extract by intestinal bacteria from the normal and CKD model rats based on UPLC-Q-TOF/MS.

    PubMed

    Du, Le-Yue; Tao, Jin-Hua; Jiang, Shu; Qian, Da-Wei; Guo, Jian-Ming; Duan, Jin-Ao

    2017-02-01

    Flos Abelmoschus manihot is a traditional herbal medicine widely used in clinical practice to tackle chronic kidney disease (CKD) for thousands of years. Nowadays, many studies indicate that gut bacteria are closely related to the progression of CKD and CKD-related complications. In this study, a UPLC-Q-TOF/MS method coupled with the MetaboLynx™ software was established and successfully applied to investigate the metabolites and metabolic profile of Flos A. manihot extract by intestinal bacteria from normal and CKD rats. Eight parent components and eight metabolites were characterized by their protonated ions. Among these compounds, 15 were detected in the two group samples while M16 was only determined in the CKD model samples. Compared with the quercetin-type glycosides, fewer myricetin-type and gossypetin-type metabolites were obtained in the two group samples. These metabolites suggested that deglycosylation and methylation are the major metabolic pathways of Flos A. manihot extract. Few differences of metabolite classes were observed in the two group samples. However, the concentrations of aglycones such as quercetin, myricetin and gossypetin in the normal samples were notably higher than those in the CKD model samples. The results are important in unravelling the pharmacological effects of A. manihot and clarifying its mechanism of action in vivo. Copyright © 2016 John Wiley & Sons, Ltd.

  14. Toxin content and cytotoxicity of algal dietary supplements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heussner, A.H.; Mazija, L.; Fastner, J.

    Blue-green algae (Spirulina sp., Aphanizomenon flos-aquae) and Chlorella sp. are commercially distributed as organic algae dietary supplements. Cyanobacterial dietary products in particular have raised serious concerns, as they appeared to be contaminated with toxins e.g. microcystins (MCs) and consumers repeatedly reported adverse health effects following consumption of these products. The aim of this study was to determine the toxin contamination and the in vitro cytotoxicity of algae dietary supplement products marketed in Germany. In thirteen products consisting of Aph. flos-aquae, Spirulina and Chlorella or mixtures thereof, MCs, nodularins, saxitoxins, anatoxin-a and cylindrospermopsin were analyzed. Five products tested in an earliermore » market study were re-analyzed for comparison. Product samples were extracted and analyzed for cytotoxicity in A549 cells as well as for toxin levels by (1) phosphatase inhibition assay (PPIA), (2) Adda-ELISA and (3) LC–MS/MS. In addition, all samples were analyzed by PCR for the presence of the mcyE gene, a part of the microcystin and nodularin synthetase gene cluster. Only Aph. flos-aquae products were tested positive for MCs as well as the presence of mcyE. The contamination levels of the MC-positive samples were ≤ 1 μg MC-LR equivalents g{sup −1} dw. None of the other toxins were found in any of the products. However, extracts from all products were cytotoxic. In light of the findings, the distribution and commercial sale of Aph. flos-aquae products, whether pure or mixed formulations, for human consumption appear highly questionable. -- Highlights: ► Marketed algae dietary supplements were analyzed for toxins. ► Methods: Phosphatase inhibition assay (PPIA), Adda-ELISA, LC-MS/MS. ► Aph. flos-aquae products all tested positive for microcystins. ► Products tested negative for nodularins, saxitoxins, anatoxin-a, cylindrospermopsin. ► Extracts from all products were cytotoxic.« less

  15. Effect of Small-Scale Turbulence on the Physiology and Morphology of Two Bloom-Forming Cyanobacteria.

    PubMed

    Xiao, Yan; Li, Zhe; Li, Chao; Zhang, Zhen; Guo, Jinsong

    2016-01-01

    The main goal of the present work is to test the hypothesis that small-scale turbulence affected physiological activities and the morphology of cyanobacteria in high turbulence environments. Using quantified turbulence in a stirring device, we conducted one set of experiments on cultures of two strains of cyanobacteria with different phenotypes; i.e., unicellular Microcystis flos-aquae and colonial Anabaena flos-aquae. The effect of small-scale turbulence examined varied from 0 to 8.01×10-2 m2s-3, covering the range of turbulence intensities experienced by cyanobacteria in the field. The results of photosynthesis activity and the cellular chlorophyll a in both strains did not change significantly among the turbulence levels, indicating that the potential indirect effects of a light regime under the gradient of turbulent mixing could be ignored. However, the experiments demonstrated that small-scale turbulence significantly modulated algal nutrient uptake and growth in comparison to the stagnant control. Cellular N and C of the two stains showed approximately the same responses, resulting in a similar pattern of C/N ratios. Moreover, the change in the phosphate uptake rate was similar to that of growth in two strains, which implied that growth characteristic responses to turbulence may be dependent on the P strategy, which was correlated with accumulation of polyphosphate. Additionally, our results also showed the filament length of A. flos-aquae decreased in response to high turbulence, which could favor enhancement of the nutrient uptake. These findings suggested that both M. flos-aquae and A. flos-aquae adjust their growth rates in response to turbulence levels in the ways of asynchronous cellular stoichiometry of C, N, and P, especially the phosphorus strategy, to improve the nutrient application efficiency. The fact that adaptation strategies of cyanobacteria diversely to turbulence depending on their physiological conditions presents a good example to understand the direct cause-effect relationship between hydrodynamic forces and algae.

  16. Comparative pharmacokinetics of chlorogenic acid in beagles after oral administrations of single compound, the extracts of Lonicera japanica, and the mixture of chlorogenic acid, baicalin, and Forsythia suspense.

    PubMed

    Liu, Rong; Lai, Ke; Xiao, Yu; Ren, Jing

    2017-12-01

    Chlorogenic acid (ChA) is the major compound in Shuang-Huang-Lian (SHL), which is mainly composed of ChA, baicalin, and Forsythia suspense Thunb Vahl. The effects of co-existing compounds in SHL and Lonicera japanica Thunb on the absorption of ChA was investigated. According to 3 × 3 Latin-square test, ChA alone, the extracts of Lonicera japanica, or the mixture of ChA, baicalin and Forsythia suspense (ChA effective doses is 60 mg/kg) was separately given to six beagles for seven days. The oral pharmacokinetic parameters of ChA in plasma, urine and faeces were quantified by HPLC/UV and analyzed. The pharmacokinetic parameters of ChA alone, the extracts of Lonicera japanica, and the mixture of ChA, baicalin, and Forsythia suspense were as followed: C max (2.350 ± 0.483, 1.655 ± 0.576, 2.332 ± 0.606 μg/mL), AUC 0-∞ (6.324 ± 1.853, 4.216 ± 1.886, 6.074 ± 1.473 μg·h/mL), t 1/2 (0.911 ± 0.187, 1.204 ± 0.309, 1.094 ± 0.193 h), and T max (1.861 ± 0.499, 1.000 ± 0.459, 1.833 ± 0.279 h). Accumulative fraction excretion of ChA in urine were 0.73 ± 0.55, 1.25 ± 1.23, 1.05 ± 0.96%, while that in faeces were 0.68 ± 0.94, 0.19 ± 0.40, and 1.76 ± 3.57%. Co-existing compounds in SHL have no effect on the absorption of ChA, while the concomitant compounds in Lonicera japanica could decrease that of ChA. ChA in Beagles might have high biological transformation.

  17. Pathophysiology and Toxicokinetic Studies of Blue-Green Algae Intoxication in the Swine Model

    DTIC Science & Technology

    1989-09-26

    In that study a ratio of L� of toxin to CTR infused into similar in situ rat gut loop preparations ameliorated the toxicoses and the liver weights...that had been produced and extracted from laboratory grown Anabaena flos- aguae NCR-525-17, paraoxon, or a control solution. Each of the 5 treatments was...Carmichael, W. W. (1987) Anatoxin-a(s), an 3 anticholinesterase from the cyanobacterium Anabaena flos- aguae NRC-525-17. Toxicon 25:1221. 3 Matsunaga, S

  18. Determination and Isolation of Four Anti-tumour Saponins from Lonicera macranthoides by HPLC-ESI-QTOF/MS and HSCCC.

    PubMed

    Liu, Xuehui; Zhou, Rongrong; Shen, Bingbing; Chen, Lin; Zhou, Qingyijun; Wan, Dan; Huang, Luqi; Zhang, Shuihan

    2017-01-01

    Lonicera macranthoides is a Chinese herb that contains a large number of bioactive spanions possessing important pharmacological activities, such as anti-tumour activity. However, detailed information about their anti-tumor activity and bioactive compounds is limited. In order to evaluate the scientific basis, the method of high-speed counter-current chromatography (HSCCC) combined with high performance liquid chromatography mass spectrometry (HPLC-ESI-QTOF/MS) has been developed to separate, purify and analyze saponins from Lonicera macranthoides. Four main saponins, Macranthoidin B (I), Macranthoidin A (II), Macranthoides B (III) and Akebia saponin D (IV) were separated by HSCCC with the solvent systems of ethyl acetate-nbutanol- water (3:2:5) and n-butanol-water-methanol-ethyl acetate (1:6:0.5:4). The purities of these four bioactive ingredients (I-IV) identified and detected by HPLC-ESI-QTOF/MS were 95.1%, 92.7%, 91.8% and 96.3%, respectively. The separated saponins were evaluated for their cytotoxic activities against six tumor cell lines (MCF-7, Hela, A549, HepG2, HT29 and Eca109). Results show that compounds I-IV exhibited particular significant anti-tumor activities against human mammary adenocarcinoma MCF-7 cell with IC50 values ranging from 12.7 to 30.8 µM. It was demonstrated that the combinative method using HPLC-ESI-QTOF/MS and HSCCC was suitable for rapid screening and isolating saponins of Lonicera macranthoides and the isolated compounds have great potential for the development of new antitumor drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  19. [Molecular mechanism of Bupleuri Radix and Scutellariae Radix drug pair for depression based on integrative pharmacology platform of traditional Chinese medicine].

    PubMed

    Wang, Jian-Ting; Wang, Shang; Liu, Song-Lin; Wang, Yan-Chun; Li, Jia-Geng; Chen, Yu

    2018-04-01

    Xiaochaihu decoction is a classic prescription of traditional Chinese medicine. Modern research has proved its anti-depression effect. However, its pharmacological mechanism for anti-depression effect is difficult to be unveiled because of the complexity of compound Chinese medicines. Bupleuri Radix and Scutellariae Radix is the core drug pair of Xiaochaihu decoction. In this research, Bupleuri Radix and Scutellariae Radix were analyzed by the integrative pharmacology platform to study its molecular mechanism for anti-depression. One hundred and sixteen active ingredients were predicted, 62 for Bupleuri Radix, mainly including saikosaponins, acids, alcohols, and 54 for Scutellariae Radix, mainly including flavonoids and glycosides. Its anti-depression effect was relevant to 118 core targets, including 22 known disease targets, such as serotonin receptor(HTR2C), activating transcription factor(ATF1, ATF2), δ opioid receptor(OPRD1), μ opioid receptor (OPRM1), κ opioid receptor(OPRK1), inositol monophosphatase(IMPA1), Toll-like receptor 4 (TLR4), histamine H1 receptor(HRH1), neurotrophic factor tyrosine kinase receptor1 (NTRK1), Glycogen synthetase kinase 3β(GSK3β), etc. The antidepressant effect involved positive regulation of transcription from RNA polymerase Ⅱ promoter, transcription factor binding, cytosol, transcriptional regulation of DNA template, enzyme binding, endocrine system, nervous system, neurotrophin signaling pathway, cell growth and death, signal transduction, thyroid hormone signaling pathway and other related biological processes and metabolic pathways. This study provides a scientific evidence for further study of the anti-depression mechanism of this drug pair. Copyright© by the Chinese Pharmaceutical Association.

  20. Eurycoma longifolia in Radix for the treatment of ethanol-induced gastric lesion in rats.

    PubMed

    Qodriyah, H M S; Asmadi, A Y

    2013-12-01

    The effect of treatment with Radix on ethanol-induced gastric lesions was investigated. The main ingredient of Radix is Eurycoma longifolia. Twenty-four rats of the Sprague-Dawley species were randomly divided into four groups. Three groups were given 0.5 mL 100% ethanol orally. Another group was used as a control and was given only distilled water orally (control). After 6 h all the rats were fed with normal diet. One group that was administered with ethanol was only given distilled water orally (no treatment). Another two groups that were administered with ethanol were treated with oral Radix 0.128 mg g(-1) b.wt. (Radix) and oral ranitidine 21.4 mg kg(-1) b.wt. (Ranitidine), respectively. After one week, all the rats were fasted overnight and sacrificed. The stomach was isolated and examined for the presence and severity of gastric lesions. Measurements for malondialdehyde content and gastric acid concentration were also done. It is found that the ulcer index was lower in the Radix and ranitidine group compared to the no treatment group whereas in the control group there was no lesion. There was no difference in ulcer index between the Radix and ranitidine group. The gastric MDA content was significantly higher in all the groups that were induced with ethanol compared to the control group but no difference between all the ethanol-induced groups. There was no difference in the gastric acid concentration in all groups. Hence it is concluded that Eurycoma longifolia in Radix is as effective as ranitidine in the treatment of ethanol-induced gastric lesions in rats.

  1. Discrimination and Proper Use of Polygoni Multiflori Radix, Cynanchi Wilfordii Radix, and Cynanchi Auriculati Radix in Korea: A Descriptive Review

    PubMed Central

    Lee, Beom-Joon; Lee, Kyungjin

    2015-01-01

    Polygoni Multiflori Radix (PMR), Cynanchi Wilfordii Radix (CWR), and Cynanchi Auriculati Radix (CAR) are very popular herbal medicines in Traditional Korean Medicine, Traditional Chinese Medicine, and Kampo Medicine. However, the plant origins, efficacies, and traditional uses of these herbal medicines differ. In Korea, PMR is called Ha Su O (He Shou Wu in China), and CWR is called Baek Ha Su O or Baek Su O (Bai Shou Wu in China). Baek Su O refers to CWR in Korea and CAR in China. CAR has not been used as a traditional herbal medicine, and it cannot be legally used as a food or food ingredient in Korea. However, CAR is cultivated in Korea and imported from China. Because the morphology of CWR and CAR is very similar, they are often confused and misused in Korea. This review discusses the reasons for the confusion and misuse of these substances in Korea and provides the exact plant origins, efficacies, uses, components, and toxicities of PMR, CWR, and CAR so that they can be correctly understood and used. PMID:26539235

  2. Radix mesiolingualis and radix distolingualis: a case report of a tooth with an unusual morphology

    PubMed Central

    Aeran, Himanshu; Singh, Inderpreet

    2016-01-01

    Variation in the root and canal morphology of the maxillary first molars is quite common. The most common configuration is 3 roots and 3 or 4 canals. Nonetheless, other possibilities still exist. The presence of an additional palatal root is rather uncommon and has been reported to have an incidence of 0.06 - 1.6% in varying populations studied. Whenever two palatal roots exist, one of them is the normal palatal root, the other is a supernumerary structure which can be located either mesiolingually (radix mesiolingualis) or distolingually (radix distolingualis). This case report describes successful endodontic treatment of a maxillary first molar with radix mesiolingualis and radix distolingualis. Identification of this variation was done through clinical examination along with the aid of multiangled radiographs, and an accurate assessment of this morphology was made with the help of a cone-beam computed tomography imaging. In addition to the literature review, this article also discusses the epidemiology, classifications, morphometric features, guidelines for diagnosis, and endodontic management of a maxillary first molar with extra-palatal root. PMID:27847755

  3. The figure-of-eight radix nasi flap for medial canthal defects.

    PubMed

    Seyhan, Tamer

    2010-09-01

    Basal cell carcinomas commonly involve the medial canthal region and reconstruction of medial canthal defects is a challenging problem in reconstructive surgery. A new axial pattern flap raised from radix nasi region has been successfully used for the medial canthal defects in eight patients in figure-of-eight manner. One of the ellipses of the figure of eight is the defect, the other is the radix nasi flap. The radix nasi flap with a dimension up to 25 mm is transposed to the defect based either on ipsilateral anastomosis of the dorsal nasal artery with angular artery (AA) or with the connection of its source artery (i.e. ophthalmic artery) if the AA is damaged. All flaps survived and no tumour recurrence was observed. The donor sites were closed primarily and hidden at the radix nasi crease in all cases. The radix nasi flap in figure-of-eight fashion is good alternative for defects of the medial canthal area in terms of attaining a suitable colour and texture and minimal surgical scars. Copyright 2009 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  4. Concentrating phenolic acids from Lonicera japonica by nanofiltration technology

    NASA Astrophysics Data System (ADS)

    Li, Cunyu; Ma, Yun; Li, Hongyang; Peng, Guoping

    2017-03-01

    Response surface analysis methodology was used to optimize the concentrate process of phenolic acids from Lonicera japonica by nanofiltration technique. On the basis of the influences of pressure, temperature and circulating volume, the retention rate of neochlorogenic acid, chlorogenic acid and 4-dicaffeoylquinic acid were selected as index, molecular weight cut-off of nanofiltration membrane, concentration and pH were selected as influencing factors during concentrate process. The experiment mathematical model was arranged according to Box-Behnken central composite experiment design. The optimal concentrate conditions were as following: nanofiltration molecular weight cut-off, 150 Da; solutes concentration, 18.34 µg/mL; pH, 4.26. The predicted value of retention rate was 97.99% under the optimum conditions, and the experimental value was 98.03±0.24%, which was in accordance with the predicted value. These results demonstrate that the combination of Box-Behnken design and response surface analysis can well optimize the concentrate process of Lonicera japonica water-extraction by nanofiltration, and the results provide the basis for nanofiltration concentrate for heat-sensitive traditional Chinese medicine.

  5. Comparison of algorithms for computing the two-dimensional discrete Hartley transform

    NASA Technical Reports Server (NTRS)

    Reichenbach, Stephen E.; Burton, John C.; Miller, Keith W.

    1989-01-01

    Three methods have been described for computing the two-dimensional discrete Hartley transform. Two of these employ a separable transform, the third method, the vector-radix algorithm, does not require separability. In-place computation of the vector-radix method is described. Operation counts and execution times indicate that the vector-radix method is fastest.

  6. Study of the distribution patterns of the constituent herbs in classical Chinese medicine prescriptions treating respiratory disease by data mining methods.

    PubMed

    Fu, Xian-Jun; Song, Xu-Xia; Wei, Lin-Bo; Wang, Zhen-Guo

    2013-08-01

    To provide the distribution pattern and compatibility laws of the constituent herbs in prescriptions, for doctor's convenience to make decision in choosing correct herbs and prescriptions for treating respiratory disease. Classical prescriptions treating respiratory disease were selected from authoritative prescription books. Data mining methods (frequent itemsets and association rules) were used to analyze the regular patterns and compatibility laws of the constituent herbs in the selected prescriptions. A total of 562 prescriptions were selected to be studied. The result exhibited that, Radix glycyrrhizae was the most frequently used in 47.2% prescriptions, other frequently used were Semen armeniacae amarum, Fructus schisandrae Chinese, Herba ephedrae, and Radix ginseng. Herbal ephedrae was always coupled with Semen armeniacae amarum with the confidence of 73.3%, and many herbs were always accompanied by Radix glycyrrhizae with high confidence. More over, Fructus schisandrae Chinese, Herba ephedrae and Rhizoma pinelliae was most commonly used to treat cough, dyspnoea and associated sputum respectively besides Radix glycyrrhizae and Semen armeniacae amarum. The prescriptions treating dyspnoea often used double herb group of Herba ephedrae & Radix glycyrrhizae, while prescriptions treating sputum often used double herb group of Rhizoma pinelliae & Radix glycyrrhizae and Rhizoma pinelliae & Semen armeniacae amarum, triple herb groups of Rhizoma pinelliae & Semen armeniacae amarum & Radix glycyrrhizae and Pericarpium citri reticulatae & Rhizoma pinelliae & Radix glycyrrhizae. The prescriptions treating respiratory disease showed common compatibility laws in using herbs and special compatibility laws for treating different respiratory symptoms. These principle patterns and special compatibility laws reported here could be useful for doctors to choose correct herbs and prescriptions in treating respiratory disease.

  7. The design of disengaging mechanism of radix pseudostellariae and soil

    NASA Astrophysics Data System (ADS)

    Xiao, Shungen; Song, Mengmeng; Chen, Chanwei

    2017-12-01

    With the continuous development of the scale of the cultivation of the radix pseudostellariae, the traditional separation mode cannot adapt to the mass production of the crown prince, and the existing manual separation mode is of great labor intensity and low degree of mechanization. Therefore, it is necessary to design a disengaging mechanism of radix pseudostellariae and soil on the basis of the design principle of modern agricultural machinery. According to the physical characteristics and growing environment of radix pseudostellariae, a drum-type separating component is presented, and the drum screen separating mechanism and vibration mechanism of the disengaging mechanism are designed. In this paper, the movement rule and time of the mixture of radix pseudostellariae and soil are determined in the drum screen. Rotation speed of the drum screen is calculated, and the operation rules of the eccentric wheel in the vibration mechanism are summarized.

  8. [Effect of Radix euphorbiae pekinensis extract on bioavailability of paclitaxel after their oral co-administration].

    PubMed

    Li, Minghua; Peng, Li; Yang, Fuheng; Liu, Sijia; Wang, Shengqi

    2015-06-01

    To evaluate the effect of Radix euphorbiae pekinensis extract on the permeability and bioavailability of paclitaxel co-administered orally. Based on Ussing Chamber and in vivo experiment, the permeability and bioavailability of paclitaxel were evaluated after oral co-administration with radix euphorbiae pekinensis in rats. The contents of paclitaxel in the permeates and the blood samples were determined using HPLC and LC-MS/MS method, respectively. In Radix euphorbiae pekinensis co-administration group, the Papp of the mucosal-to-serosal (M-S) transport or serosal-to-mucosal transport (S-M) of paclitaxel in the jejunum or ileum segment differed significantly from those in verapamil co-administration group and blank control group (P<0.05), but the Papp of S-M transport in the colon showed no significant difference from that in the blank control group. In the blank group, the average absolute bioavailability (AB%) of orally administered paclitaxel was only 2.81%, compared to that of 7.63% in radix euphorbiae pekinensis group. The average AB% in verapamil group was about 1.5 times that of the blank group. Co-administration of Radix euphorbiae pekinensis extract can increase the bioavailability of orally administered paclitaxel.

  9. Zebrafish neurotoxicity from aphantoxins--cyanobacterial paralytic shellfish poisons (PSPs) from Aphanizomenon flos-aquae DC-1.

    PubMed

    Zhang, Delu; Hu, Chunxiang; Wang, Gaohong; Li, Dunhai; Li, Genbao; Liu, Yongding

    2013-05-01

    Aphanizomenon flos-aquae (A. flos-aquae), a cyanobacterium frequently encountered in water blooms worldwide, is source of neurotoxins known as PSPs or aphantoxins that present a major threat to the environment and to human health. Although the molecular mechanism of PSP action is well known, many unresolved questions remain concerning its mechanisms of toxicity. Aphantoxins purified from a natural isolate of A. flos-aquae DC-1 were analyzed by high-performance liquid chromatography (HPLC), the major component toxins were the gonyautoxins1 and 5 (GTX1 and GTX5, 34.04% and 21.28%, respectively) and the neosaxitoxin (neoSTX, 12.77%). The LD50 of the aphantoxin preparation was determined to be 11.33 μg/kg (7.75 μg saxitoxin equivalents (STXeq) per kg) following intraperitoneal injection of zebrafish (Danio rerio). To address the neurotoxicology of the aphantoxin preparation, zebrafish were injected with low and high sublethal doses of A. flos-aquae DC-1 toxins 7.73 and 9.28 μg /kg (5.3 and 6.4 μg STXeq/kg, respectively) and brain tissues were analyzed by electron microscopy and RT-PCR at different timepoints postinjection. Low-dose aphantoxin exposure was associated with chromatin condensation, cell-membrane blebbing, and the appearance of apoptotic bodies. High-dose exposure was associated with cytoplasmic vacuolization, mitochondrial swelling, and expansion of the endoplasmic reticulum. At early timepoints (3 h) many cells exhibited characteristic features of both apoptosis and necrosis. At later timepoints apoptosis appeared to predominate in the low-dose group, whereas necrosis predominated in the high-dose group. RT-PCR revealed that mRNA levels of the apoptosis-related genes encoding p53, Bax, caspase-3, and c-Jun were upregulated after aphantoxin exposure, but there was no evidence of DNA laddering; apoptosis could take place by pathways independent of DNA fragmentation. These results demonstrate that aphantoxin exposure can cause cell death in zebrafish brain tissue, with low doses inducing apoptosis and higher doses inducing necrosis. Copyright © 2011 Wiley Periodicals, Inc.

  10. Anti-diarrhoeal and anti-microbial activity of Flos populi (male inflorescence of Populus tomentosa Carrière) aqueous extracts.

    PubMed

    Xu, Qianqian; Shen, Zhiqiang; Wang, Yubo; Guo, Shijin; Li, Feng; Wang, Yanping; Zhou, Chunfeng

    2013-07-09

    Flos populi (male inflorescence of Populus tomentosa Carrière) has been traditionally used in East Asian countries for the treatment of various inflammatory diseases, strengthening the spleen and stomach, anti-rheumatic, anti-tumor and anti-diarrhoeal. To evaluate the in vivo or in vitro anti-diarrhoeal and anti-microbial activity of Flos populi aqueous extract. Acute toxicity of Flos populi aqueous extract (FPAE) was investigated. Castor oil-induced diarrhoea method was used to evaluate the anti-diarrhoeal activity, inhibition of defecation and diarrhoea were determined in mice, effects on castor oil-induced enteropooling, intestinal transit and intestinal fluid secretion in rats or mice. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of FPAE against strains of three clinical bacterial isolates and one reference strain were used to test the anti-microbial activity. The FPAE reduced the frequency of diarrhoea episodes and decreased the propulsion of charcoal meal through the gastrointestinal tract in a dose dependent manner. FPAE (100-500 mg/kg, p.o.) produced dose-dependent and significant (P<0.01) protection of mice against castor oil-induced diarrhoea. FPAE, dose-dependently and significantly (P< 0.01) delayed the onset of castor-oil induced diarrhoea, decreased the frequency of defecation, and reduced the severity of diarrhoea. Compared with control animals, FPAE, dose-dependently and significantly (P< 0.01) decreased the volume of castor oil-induced intestinal fluid secretion, and reduced the number, weight and wetness of faecal droppings. There was no deaths or abnormalities in behaviour seen in the acute toxicity test. The aqueous extract displayed anti-microbial effects to three species of bacteria in anti-microbial test. The findings of this study indicate that FPAE possesses anti-diarrhoeal property in rats and mice and confirm the ethnomedicinal use of Flos Populi as a valuable natural remedy for the treatment, management and/or control of diarrhoea. These results may support the fact that this plant is traditionally used to cure diarrhoea. Crown Copyright © 2013. Published by Elsevier Ireland Ltd. All rights reserved.

  11. [Study on effect of oil-bearing solution environment of Caryophylli Flos and other traditional Chinese medicines on system flux and oil recovery rate].

    PubMed

    Fan, Wen-Ling; Guo, Li-Wei; Lin, Ying; Shen, Jie; Cao, Gui-Ping; Zhu, Yun; Xu, Min; Yang, Lei

    2013-10-01

    The membrane enrichment process of traditional Chinese medicine volatile oil is environmental friendly and practical, with a good application prospect. In this article, oil-bearing solutions of eight traditional Chinese medicines, namely Caryophylli Flos, Schizonepetae Herba, Eupatorii Herb, Acori Talarinowii Rhizoma, Magnoliae Flos, Chrysanthemum indicum, Cyperi Rhizoma and Citri Reticulatae Pericarpium Viride, were taken as the experimental system. Under unified conditions (membrane: PVDF-14W, temperature: 40 degreeC, pressure: 0. 1 MPa, membrane surface speed: 150 r min- 1), trans-membrane was conducted for above eight oil-bearing solutions to explore the effect of their oil-bearing solution environment on system flux and oil recovery rate. The results showed that systems with smaller pH had a lower flux, without significant effect on oil recovery rate. Greater differences between the surface tension of solutions and that of pure water contributed to a lower oil recovery rate. The conductivity had no notable effect on membrane enrichment process. Systems with high turbidity had a lower flux, without remarkable effect on oil recovery rat. Heavy oils showed lower flux than light ones, but with a slightly higher oil recovery rat. Systems with higher viscosity had a lower flux than those with lower viscosity. Except for Magnoliae Flos volatile oil, all of the remaining volatile oils showed a much higher oil recovery rat than systems with high viscosity. The above results could provide data support and theoretical basis for the industrialization of membrane enrichment volatile oil technology.

  12. [Study on process and principle of lactose grinding modification to decrease hygroscopic of Rhodiolae Crenulatae Radix et Rhizoma extract].

    PubMed

    Zhang, Ding-Kun; Zhang, Fang; Lin, Jun-Zhi; Han, Li; Wu, Zhen-Feng; Yang, Ying-Guang; Yang, Ming

    2014-04-01

    In this paper, Rhodiolae Crenulatae Radix et Rhizoma extract,with high hygroscopic,was selected as research model, while lactose was selected as modifiers to study the effect of the grinding modification method on the hygroscopic. Subsequently, particle size distribution, scannin electron microscopy, infrared spectroscopy and surface properties were adopted for a phase analysis. The results showed that the modified extract, prepared by Rhodiolae Crenulatae Radix et Rhizoma extract grinding 5 min with the same amount of lactose UP2, which hygroscopic initial velocity, acceleration, and critical relative humidity moisture were less than that of Rhodiolae Crenulatae Radix et Rhizoma extract and the mixture dramatically. In addition, compared with the mixture, the size distribution of modified extract was much less, the microstructure was also difference, while the infrared spectroscopy and surface properties were similar with that of lactose. It is the main principle that lactose particle adhered to the surface of Rhodiolae Crenulatae Radix et Rhizoma extract after grinding mofication to decress the moisture obviously.

  13. [Study on extraction process of zhanjin ruji].

    PubMed

    Du, Zhi-qian; Du, Tian-xin; Wang, Zhong-dong; Li, Gen-lin

    2003-01-01

    To select the optimum extraction process of Zhanjin Ruji. To observe influence of extraction time upon the extraction rate of volatile oil, the orthogonal test was adopted to observe the extraction process by alcohol from the extraction rate and content of the total saponins in Radix Notoginseng. The three kinds of herbs including Radix Angelicae Sinensis, Resina Olibani and Myrrha were extracted with water for 3 hours, 95% of volatile oil can be distilled. The three kinds of herbs including Radix Notoginseng, Herba Lycopodii and Radix Gentianae Macrophyllac were extracted by alcohol. Four factors such as alcohol concentration(A), extraction times(B), extraction time(C), and solvent amount(D), had not significant effect on the content of total saponins in Radix Notoginseng in herbal extraction, but factor A and B had significant effect on the extraction rate. The optimum extraction process was as follows extracted with 5 times the amount of the solvent volum 60% alcohol for 3 times and with each time for 1 hour. Three times experiments showed that the extraction rate was 26.5% and the content of the total saponins in Radix Notoginseng was 17.28% mg.g-1. The above experimental results can provide experimental basis for deciding the extraction process of Zhanjin Ruji.

  14. Relationship between the antidiarrhoeal effects of Hange-Shashin-To and its active components.

    PubMed

    Kase, Y; Saitoh, K; Makino, B; Hashimoto, K; Ishige, A; Komatsu, Y

    1999-09-01

    This study was designed to examine the relationship between the antidiarrhoeal effects of Hange-Shashin-To (TJ-14) and its active components. Oral treatment with TJ-14 at 1000 mg/kg significantly inhibited castor oil-induced diarrhoea. Both the 50% methanol eluate fraction (fraction III) and the methanol eluate fraction (fraction IV) showed antidiarrhoeal effects at oral doses of 68 mg/kg and 63 mg/kg, respectively, corresponding to 1000 mg/kg of TJ-14. TJ-14 (1000 mg/kg, p.o.) showed a significant increase in blood corticosterone levels. Increased blood corticosterone was noted after the oral administration of 63 mg/kg of fraction IV. The inhibitory activity of TJ-14 on cyclooxygenase-2 (COX-2) was also observed in fractions III and IV. The main component of fraction III was Scutellariae Radix-derived baicalin. Fraction IV contained Glycyrrhizae Radix-derived glycyrrhizin and isoliquiritin, Coptidis Rhizoma-derived berberine, coptisine and palmitine. Ginseng Radix-derived saponins were also present in fraction IV. These compounds inhibited castor-oil induced diarrhoea at oral doses of 10 or 30 mg/kg. Thus, the present results indicate that Scutellariae Radix, Glycyrrhizae Radix, Ginseng radix and Coptidis Rhizoma-derived components are involved in the antidiarrhoeal action of TJ-14. Copyright 1999 John Wiley & Sons, Ltd.

  15. Identification and quantification of the major volatile constituents in antidepressant active fraction of xiaoyaosan by gas chromatography-mass spectrometry.

    PubMed

    Zhou, Yuzhi; Ren, Yanling; Ma, Zhijie; Jia, Guangcheng; Gao, Xiaoxia; Zhang, Lizeng; Qin, Xuemei

    2012-05-07

    Xiaoyaosan (XYS), a well-known formula for relieving depression, was originated from the book of "Taiping Huimin Heji Jufang" in Song Dynasty (960-1127 AD), composed of Radix Bupleuri, Radix Angelicae Sinensis, Radix Paeoniae Alba, Rhizoma Atractylodis Macrocephalae, Poria, Herba Menthae, Rhizoma Zingiberis Recens and Radix Glycyrrhizae with dose proportion of 6:6:6:6:6:3:2:2. It is commonly used for the treatment of depression-related syndromes in China. In the formula, Radix Bupleuri usually serves as the principal drug, Radix Angelicae Sinensis and Radix Paeoniae Alba serve as the ministerial drugs, Rhizoma Atractylodis Macrocephalae, Poria, Herba Menthae and Rhizoma Zingiberis Recens serve as adjunctive drugs, Radix Glycyrrhizae serves as messenger drug, they coordinate with each other and enhance the effect of the formula. In our previous experiments, the antidepressant effect of XYS was revealed. However, the antidepressant part (or component) of this prescription was still obscure. An experimental despair animal model: the mice tail suspension test (TST) was used to evaluate the antidepressant activity of XYS and its fractions. GC-MS method was developed to identify the volatile components and determine 4 major volatile components in active fraction. In the TST test, the effect of a low polar fraction (XY-EA) was superior to other fractions of XYS. 13 volatile compounds in the XY-EA were identified on the basis of standards, isolation and structural determination in our laboratory, NIST 05 database and literature data. The content of 4 major volatile compounds in XY-EA which is 6.703%. The petroleum ether fraction (XY-EA) appears to be the active fraction of XYS. 4 major components Z-ligustilide, palmitic acid, atractylenolide I, and atractylenolide II may be the antidepressant active compounds. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. Rehmanniae Radix in osteoporosis: A review of traditional Chinese medicinal uses, phytochemistry, pharmacokinetics and pharmacology.

    PubMed

    Liu, Chenyue; Ma, Rufeng; Wang, Lili; Zhu, Ruyuan; Liu, Haixia; Guo, Yubo; Zhao, Baosheng; Zhao, Shangang; Tang, Jinfa; Li, Yu; Niu, Jianzhao; Fu, Min; Zhang, Dongwei; Gao, Sihua

    2017-02-23

    Emerging clinical usage and pharmacological effects have been achieved in using Rehmanniae Radix either singly or in combination with other herbs to treat skeletal diseases in traditional Chinese medicine (TCM) in the recent years. This study is aimed to provide a comprehensive review about the historical TCM interpretation of the action of Rehmanniae Radix in osteoporosis, its usage in clinical trials and osteoporotic models, its main phytochemical constituents, and its pharmacokinetics. Several databases included PubMed, China Knowledge Resource Integrated Database, China Science and Technology Journal Database, National Science and Technology Library and the Web of Science Database were consulted to locate the publications pertaining to Rehmanniae Radix. The initial inquiry was conducted for the presence of the following terms combinations in the abstracts: Rehmanniae Radix, Dihuang, phytochemistry, pharmacokinetics, osteoporosis, bone, osteoclast and osteoblast. About 330 research papers and reviews were consulted. In TCM, Rehmanniae Radix exerts the anti-osteoporotic effect via regulating the functions of kidney and liver as well as improving blood circulation. 107 clinical trials are identified that used Rehmanniae Radix in combination with other herbs to treat post-menopausal, senile and secondary osteoporosis. Most of the clinical trials are characterized by high efficacy and no obvious adverse effects. However, the efficacies of these clinical trials are limited because of small patient sample size, short treatment duration and poor clinical design. In addition, TCM herbs under the clinical study are not clear because of a lack of standardization and authentication. The pharmacokinetics data demonstrate that the ingredients of Rehmanniae Radix are widely distributed after administration, and that catalpol and ajugol as well as acetoside are supposed to be the active constituents. More than 140 individual compounds have been currently isolated from this plant and reported to show pleiotropic effects on various diseases. Rehmanniae Radix displays bone protecting features in the osteoporosis models via the delicate balance between osteoclastogenesis and osteoblastogenesis through single herb extracts and its isolated compounds. The successful inclusion of Rehmanniae Radix in clinical trials and preclinical studies for the management of osteoporosis has attracted rising attentions for identifying potential anti-osteoporotic candidates from this plant and clinical existing TCM formulas, which will further speed up anti-osteoporosis drug discovery processes. Properly designed and well controlled prospective studies are still needed to further demonstrate bone protective actions and safe use of this herb and its ingredients. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  17. Efficacy of herbal tincture as treatment option for retained placenta in dairy cows.

    PubMed

    Cui, Dongan; Li, Jianxi; Wang, Xuezhi; Xie, Jiasheng; Zhang, Kai; Wang, Xurong; Zhang, Jingyan; Wang, Lei; Qin, Zhe; Yang, Zhiqiang

    2014-02-01

    Retained placenta remains therapeutic challenge in cattle. Certain traditional medicines are believed to be able to alleviate retained placenta condition and improve overall fertility in cows. The aim of the present study was to evaluate the efficacy of an herbal tincture for treatment of retained placenta. The herbal tincture was extracted from a combination of Herba Leonuri, Angelicae Sinensis Radix, Flos Carthami, Myrrha and Rhizoma Cyperi by percolation with 70% ethanol to a concentration of 0.5g crude herb/ml. Cows diagnosed with retained placenta (n=48) were randomly divided into one of two treatment groups (A and B), with animals in group A (n=26) receiving herbal tincture orally, and cows in group B (n=22) receiving oxytetracycline infusion into the uterus. Eighty six cows with no clinically visible pathological conditions, given birth alone and with no retained placenta diagnosis were included into control group (C). Retained placenta was expelled within 72h following initial treatment in 19 cows in group A, yet no cows in group B were recorded to expel placenta in the same time. The median number of days to first service (70.0 vs. 102.5 days; P<0.05) and median number of days open (76.0 vs. 134.0 days; P<0.01) were lower in group A than in group B. Percentage of cows pregnant within 100 days postpartum was the highest for animals in group A compared to controls (61.5% vs. 39.5%, P<0.05), and for animals in group B (61.5% vs. 22.7%; P<0.01). Herbal tincture used in the present study might facilitate expulsion of retained placenta and improve subsequent fertility, thus could present effective treatment option for retained placenta in cows. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Determination of triazine herbicides and their metabolites in multiple medicinal parts of traditional Chinese medicines using streamlined pretreatment and UFLC-ESI-MS/MS.

    PubMed

    Liu, Congmin; Dou, Xiaowen; Zhang, Lei; Li, Qian; Qin, Jia'an; Duan, Yaping; Yang, Meihua

    2018-01-01

    A rapid, sensitive, and reliable ultra-fast liquid chromatography combined with electrospray ionization tandem mass spectrometry (UFLC-ESI-MS/MS) method was established and applied to simultaneous determination of 31 triazine herbicides and their metabolites in multiple medicinal parts of traditional Chinese medicines (TCMs). A streamlined pretreatment approach using one-step extraction and dilution was proposed, which provided high-throughput processing, excellent recovery, and negligible interference. Afterwards, multiple-reaction monitoring (MRM) and information-dependent acquisition (IDA) triggered enhanced product ion spectra (EPI) was adopted to identify and quantify the targets in a single analysis. The optimized method was then validated according to the guidelines of the European Commission for the following parameters: Matrix effects, specificity, accuracy, precision, linearity, range, and stability. The LOD and LOQ for the 31 triazine herbicides were 0.1-10 μg kg -1 and 0.5-25 μg kg -1 , respectively. Recoveries at three concentration levels were within 67.9-120.3% with an associated precision RSD <20%. Using the proposed approach, trazines herbicides were determined from 44 commercially available TCMs. The detection rate of triazine herbicides residues was 15.9% of the total samples. Among them, atrazine, simeton, and simetryn were found in the radix, herba, and seed TCMs with values far below the referenced maximum residue limits (MRLs), but no residues were detected in either the flos or fructus. Taken together, this method has the potential to provide a means for triazines screening in extensive matrices, thereby laying the foundation for pesticide registration on TCMs. Moreover, it has the potential to guide further triazine residue control in TCMs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. [Optimization of stir-baking with vinegar technology for Curcumae Radix by orthogonal test].

    PubMed

    Shi, Dianhua; Su, Benzheng; Sun, Lili; Zhang, Jun; Qu, Yongsheng

    2011-05-01

    To optimize the stir-baking with vinegar technology for Curcumae Radix. The intrinsic quality (the content of Curcumin) and traditional outward appearance were chosen as indexes. The best technology was determined by orthogonal test L9 (3(4)). The factors of the moistening time, stir-baking temperature and stir-baking time were investigated. The optimal technology was as follows: the quantity of vinegar was 10%, the moistening time was 10 min, the stir-baking temperature was 130 degrees C and the stir-baking time was 10 min. The optimal stir-baking with vinegar technology for Curcumae Radix is reasonable, which can be used to guide the standardized production of Curcumae Radix stir-baked with vinegar.

  20. Simultaneous quantification of six alkaloid components from commercial stemonae radix by solid phase extraction-high-performance liquid chromatography coupled with evaporative light scattering detector

    PubMed Central

    Zhang, Rong-Rong; Lu, Dan-Yi; Yang, Zhen-Ya; Zhao, Wen; But, Paul Pui-Hay; Shaw, Pang-Chui; Jiang, Ren-Wang; Ma, Zhi-Guo

    2015-01-01

    Background: Stemonae radix has been applied in traditional Chinese medicine for centuries. Alkaloids are the main active ingredient in stemonae radix, so their composition and concentration levels are directly linked to clinic effects. Objective: The objective was to develop an analytical method with multiple markers for quality survey of commercial stemonae radix. Materials and Methods: A method for simultaneous determination of six compounds in commercial stemonae radix was performed using solid-phase extraction and high-performance liquid chromatography coupled with evaporative light scattering detector. The separation was carried out on an Agilent TC-C18 column with 0.1% acetonitrile solution of triethylamine aqueous solution and acetonitrile as the mobile phase under gradient elution within 70 min. The hierarchical clustering analysis (HCA) was successfully used to classify the samples in accordance with their chemical constituents. Results: Linearity (R2 > 0.9990), intra- and inter-day precision (relative standard deviations <4%), limit of detection (0.011–0.086 μg/mL), limit of quantification (0.033–0.259 μg/mL) of the six alkaloids were determined, and the recoveries were between 96.6% and 103.7%. The method was successfully applied to analysis 36 batches of commercial stemonae radix. All the samples could be classified into five clusters by HCA. Conclusion: This article provides an accurate and simple analytical method for quality survey of commercial stemonae radix. Because of the significant chemical variations, careful selection of Stemona sources with obvious antitussive value but devoid of croomine followed by good agricultural practice and good manufacturing practice process is suggested. PMID:25829776

  1. [Preliminary study on standardization of production and processing of Angelicae Sinensis Radix pieces].

    PubMed

    Nie, Rui-Jie; Wang, Ying-Zi; Sun, Zhen-Yang; Wang, Si-Yu; Zhang, Jing-Zhen

    2017-12-01

    Study on the standardization of Chinese materia medica is an important action for modernization and globalization for traditional Chinese medicine. Standardization on the processing of Chinese herbal pieces is an important part in the study on standardization of Chinese materia medica, so it is of great significance to establish the technical processing standards of Angelicae Sinensis Radix pieces for improving its quality. In this study, single factor experiment was designed to optimize the softening, cutting and drying processes of Angelicae Sinensis Radix. With ferulic acid, Angelicae Sinensis Radix polysaccharide, volatile oil and extracts (water and ethanol) content as the quality index, the effects of different softening, cutting and drying processes on the contents of the five components in Angelicae Sinensis Radix were analyzed, and the normalized distance evaluation method was used to analyze the experimental data. The results showed that the content of five components in Angelicae Sinensis Radix was affected by different softening methods and drying temperature, but the thickness of slice had little effect on the content. The best preparation process for Angelicae Sinensis Radix was as follows: Non-medicinal parts were removed; mildewed and rot as well as moth-eaten parts were removed; washed by the flowing drinking water; stacked in the drug pool; moistening method was used for softening, where 125 mL water was sprayed for every 1 kg of herbs every 2.5 h; upper part of herbs covered with clean and moist cotton, and cut into thin slices (1-2 mm) after 15 h moistening until appropriate softness, with disk thickness of 1-2 cm, then received blast drying for 6 h at 55 ℃, and turned over for 2 times during the drying. Copyright© by the Chinese Pharmaceutical Association.

  2. The Influence of Aconitum carmichaelii Debx. on the Pharmacokinetic Characteristics of Main Components in Rheum palmatum L.

    PubMed

    Li, Yun-xia; Gong, Xiao-hong; Li, Yan; Zhang, Ruo-qi; Yuan, An; Zhao, Meng-jie; Zeng, Dai-wen; Peng, Cheng

    2015-08-01

    Rhei Radix et Rhizoma was one of the commonly used traditional Chinese medicines, and the compatibility of Rhei Radix et Rhizoma and Aconiti Lateralis Radix Praeparata was the basic herb pair applied in many Chinese traditional prescription. Rhubarb anthraquinones were the main bioactive materials of Rhei Radix et Rhizoma. To elucidate the compatibility of Rhei Radix et Rhizoma and Aconiti Lateralis Radix Praeparata, the pharmacokinetics of rhubarb anthraquinones as the main marker constituents were investigated. In the present study, pharmacokinetic differences of rhubarb anthraquinones were detected after oral administration of extract of Rheum palmatum L. and compatibility with Aconitum carmichaelii Debx. After oral administration, no difference of peak time can be found for anthraquinones between rhubarb group and compatibility group. But Cmax and area under the curve of aloe-emodin, emodin and chrysophanol in compatibility group were significantly higher than that in rhubarb group. Although the Cmax of rhein in compatibility group was much lower than that in rhubarb group, the area under the curve value was similar in two groups. The clearance and t1/2 of rhubarb anthraquinone were also changed after compatibility. The change of pharmacokinetics characteristics of rhubarb anthraquinone after compatibility may be caused by the drug-drug interaction medicated by chemical reaction and cytochromes P450. Copyright © 2015 John Wiley & Sons, Ltd.

  3. A study of Semen Strychni-induced renal injury and herb-herb interaction of Radix Glycyrrhizae extract and/or Rhizoma Ligustici extract on the comparative toxicokinetics of strychnine and brucine in rats.

    PubMed

    Gu, Liqiang; Wang, Xiaofan; Liu, Zhenzhen; Ju, Ping; Zhang, Lunhui; Zhang, Yuanyuan; Ma, Bingjie; Bi, Kaishun; Chen, Xiaohui

    2014-06-01

    Recently, the renal injury caused by Semen strychni and its major toxic constituents, strychnine and brucine, was reported in many clinical cases. Hence, this study was conducted to investigate the renal injury induced by Semen Strychni and the protective effects of Radix Glycyrrhizae and Rhizoma Ligustici. The protective mechanisms were related to the comparative toxicokinetics of strychnine and brucine. Serum and urine uric acid and creatinine were used as renal function markers to evaluate the condition of kidney, and renal injury was directly reflected by histopathological changes. Compared with rats in blank group and protective herb groups, rats in Semen Strychni high-dose group showed significant differences in the results of renal function markers, and various glomerular and tubular degenerations were found in the histopathological study. The decreased AUC (only strychnine) and Cmax, the increased Tmax by Radix Glycyrrhizae and the decreased T1/2 by Radix Glycyrrhizae and Rhizoma Ligustici were found in model groups. Results indicated that high dose of Semen Strychni might induce renal injury. Radix Glycyrrhizae and Rhizoma Ligustici might work together and have effects on the elimination of strychnine and brucine. The protective effects of Radix Glycyrrhizae might also be explained by the slow absorption of the alkaloids. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Photosynthetic Physiological Response of Radix Isatidis (Isatis indigotica Fort.) Seedlings to Nicosulfuron

    PubMed Central

    Ning, Na; Wen, Yinyuan; Dong, Shuqi; Yin, Meiqiang; Guo, Meijun; Wang, Binqiang; Feng, Lei; Guo, Pingyi

    2014-01-01

    Radix Isatidis (Isatis indigotica Fort.) is one of the most important traditional Chinese medicine plants. However, there is no suitable herbicide used for weed control in Radix Isatidis field during postemergence stage. To explore the safety of sulfonylurea herbicide nicosulfuron on Radix Isatidis (Isatis indigotica Fort.) seedlings and the photosynthetic physiological response of the plant to the herbicide, biological mass, leaf area, photosynthetic pigment content, photosynthetic rate, chlorophyll fluorescence characteristics, and P700 parameters of Radix Isatidis seedlings were analyzed 10 d after nicosulfuron treatment at 5th leaf stage in this greenhouse research. The results showed that biological mass, total chlorophyll, chlorophyll a, and carotenoids content, photosynthetic rate, stomatal conductance, PS II maximum quantum yield, PS II effective quantum yield, PS II electron transport rate, photochemical quenching, maximal P700 change, photochemical quantum yield of PS I, and PS I electron transport rate decreased with increasing herbicide concentrations, whereas initial fluorescence, quantum yield of non-regulated energy dissipation in PS II and quantum yield of non-photochemical energy dissipation due to acceptor side limitation in PS I increased. It suggests that nicosulfuron ≥1 mg L−1 causes the damage of chloroplast, PS II and PS I structure. Electron transport limitations in PS I receptor side, and blocked dark reaction process may be the main cause of the significantly inhibited growth and decreased photosynthetic rate of Radix Isatidis seedlings. PMID:25165819

  5. [Standardization of production of process Notopterygii Rhizoma et Radix slices].

    PubMed

    Sun, Zhen-Yang; Wang, Ying-Zi; Nie, Rui-Jie; Zhang, Jing-Zhen; Wang, Si-Yu

    2017-12-01

    Notopterol, isoimperatorin, volatile oil and extract (water and ethanol) were used as the research objects in this study to investigate the effects of different softening method, slice thickness and drying methods on the quality of Notopterygii Rhizoma et Radix slices, and the experimental data were analyzed by homogeneous distance evaluation method. The results showed that different softening, cutting and drying processes could affect the content of five components in Notopterygii Rhizoma et Radix incisum. The best processing technology of Notopterygii Rhizoma et Radix slices was as follows: non-medicinal parts were removed; mildewed and rot as well as moth-eaten parts were removed; washed by the flowing drinking water; stacked in the drug pool; moistening method was used for softening, where 1/8 volume of water was sprayed for every 1 kg of herbs every 2 h; upper part of herbs covered with clean and moist cotton, and cut into thick slices (2-4 mm) after 12 h moistening until appropriate softness, then received blast drying for 4 h at 50 ℃, and turned over for 2 times during the drying. The process is practical and provides the experimental basis for the standardization of the processing of Notopterygii Rhizoma et Radix, with great significance to improve the quality of Notopterygii Rhizoma et Radix slices. Copyright© by the Chinese Pharmaceutical Association.

  6. [Changes of chemical constituents in Rubiae Radix et Rhizoma before and after carbonized by UPLC-Q-TOF-MS method].

    PubMed

    Chen, Yi; Shan, Ming-Qiu; Wang, Hai-Li; Xue, Lu; Zhang, Li; Ding, An-Wei

    2017-03-01

    In order to explore the effect on chemical constituents after carbonized, the changes of chemical constituents in raw and carbonized Rubiae Radix et Rhizoma were analyzed by UPLC-Q-TOF-MS. The research also used principal component analysis(PCA) and orthogonal partial least squares discriminant analysis(OPLS-DA) for data statistics to find out the main differences on components before and after carbonized. The accurate m/z values of Q-TOF-MS and Q-TOF-MS-MS fragments were applied to identify the structures. The results showed that 6 more discrepant constituents were existed between raw and carbonized Rubiae Radix et Rhizoma. Three constituents were selected as the main discrepant components according to the peak area (276 nm) and identified, as lucidin, xanthopurpurin and 1,3,6-trihydroxy-2-methylanthraquinone. After carbonized, contents of xanthopurpurin and 1,3,6-trihydroxy-2-methylanthraquinone were observably increasing, while lucidin was obviously decreasing. They could be used as the chemical markers for the differentiation between raw and carbonized Rubiae Radix et Rhizoma. The results of this experiment played an important role in the study of processing principle of carbonized Rubiae Radix et Rhizoma. It also provided important evidences for the interpretation of effective material based on carbonized Rubiae Radix et Rhizoma. Copyright© by the Chinese Pharmaceutical Association.

  7. [Study on arsenic speciation changes in crude and processed traditional Chinese medicines by HPLC-ICP-MS].

    PubMed

    Jin, Peng-fei; Wu, Xue-jun; Zou, Ding; Kuang, Yong-mei; Hu, Xin; Jiang, Wen-qing; Sun, Chun-hua

    2011-03-01

    A HPLC-ICP-MS method for simultaneous determination of As(III), As(V), MMA and DMA in traditional Chinese medicines (TCMs) was established, and the contents of As(III), As(V), MMA and DMA in a TCM with high total arsenic content (Cordyceps) and 5 crude and processed TCMs (Radix Astragali, Radix et Rhizoma Rhei, Radix Scutellariae, Radix Polygoni Multiflori and Radix Rehmanniae) were determined and analyzed. The method validation indicated that the correlative coefficients (r) for all speciations were bigger than 0.9984; the limits of quantitation (LOQ) were from 0.8 to 1.0 microg x L(-1); the reproducibility and stability were satisfactory with all RSDs less than 10%; the spiked recoveries ranged from 82.40% to 119.5%. The results of samples analysis showed that the inorganic arsenic (As(III) and As(V)) was the dominating speciation in the tested TCMs; MMA and DMA were not found in all plant resourced TCMs, but MMA was found in Cordyceps; all the tested TCMs indicated a content increasing of inorganic arsenic after processing.

  8. [Research model on commodity specification standard of radix Chinese materia medica].

    PubMed

    Kang, Chuan-Zhi; Zhou, Tao; Jiang, Wei-Ke; Huang, Lu-Qi; Guo, Lan-Ping

    2016-03-01

    As an important part of the market commodity circulation, the standard grade of Chinese traditional medicine commodity is very important to restrict the market order and guarantee the quality of the medicinal material. The State Council issuing the "protection and development of Chinese herbal medicine (2015-2020)" also make clear that the important task of improving the circulation of Chinese herbal medicine industry norms and the commodity specification standard of common traditional Chinese medicinal materials. However, as a large class of Chinese herbal medicines, the standard grade of the radix is more confused in the market circulation, and lack of a more reasonable study model in the development of the standard. Thus, this paper summarizes the research background, present situation and problems, and several key points of the commodity specification and grade standard in radix herbs. Then, the research model is introduced as an example of Pseudostellariae Radix, so as to provide technical support and reference for formulating commodity specifications and grades standard in other radix traditional Chinese medicinal materials. Copyright© by the Chinese Pharmaceutical Association.

  9. Herbal Medicines Induced Anticholinergic Poisoning in Hong Kong

    PubMed Central

    Chan, Thomas Y. K.

    2016-01-01

    In the present review, the main objective was to report the incidence and causes of herbal medicines induced anticholinergic poisoning in Hong Kong during 1989–2012 and to emphasize the importance of pharmacovigilance, investigations and preventive measures. Relevant papers, official figures and unpublished data were obtained from Medline search, the Department of Health and the Drug and Poisons Information Bureau. In the New Territories East (where ~20% of the Hong Kong population lived), the incidence of herbal medicines induced anticholinergic poisoning during 1989–1993 was 0.09 per 100,000 population. There were no confirmed cases during 1994–1996. In the whole of Hong Kong, the incidence during 2000–June 2005 was 0.03 per 100,000 population. Contamination of Rhizoma Atractylodis (50%) and erroneous substitution (42%) were the main causes. The incidence during 2008–2012 was 0.06 per 100,000 population. Contamination of non-toxic herbs (50%) and erroneous substitution (41%) were the main causes. In Hong Kong, contamination of non-toxic herbs by tropane alkaloids and substitution of Flos Campsis by toxic Flos Daturae Metelis were the predominant causes of herbal medicines induced anticholinergic poisoning. Systematic studies along the supply chain are necessary to identify the likely sources of contamination. If erroneous substitution of Flos Campsis by Flos Daturae Metelis could be prevented, 40% of herbal medicines induced anticholinergic poisoning would not have occurred. Regular inspection of the retailer, continuing education for the staff in the herbal trade and repeated publicity measures will also be required. Pharmacovigilance of herbal medicines should help determine the incidence and causes of adverse reactions and monitor the effectiveness of preventive measures. PMID:26999208

  10. Compassion fatigue: experiences in occupational health, human resources, counselling and police.

    PubMed

    Tehrani, Noreen

    2010-03-01

    This study examines the impact that working with distressed employees, clients and members of the public has on four caring professions: occupational health advisors (OHAs), human resource advisors (HRs), counsellors (CLs) and family liaison officers (FLOs). To measure the levels of compassion fatigue in caring professions and to identify the mechanisms that lead to increased levels of personal growth. Two hundred and seventy-six professionals (64 HRs, 53 OHAs, 114 CLs and 45 FLOs) completed the Carer Belief Inventory (CBI) (Tehrani, N. The cost of caring-the impact of secondary trauma on assumptions values and beliefs. Couns Psychol Q 2007;20:1-15.) and Short-Form of the Goldberg questionnaire (Goldberg D, Bridges K, Duncan-Jones P, Grayson D. Detecting anxiety and depression in a general medical setting. Br Med J 1988;297:897-899). The participants in the study were attendees at presentations or training courses on employee wellbeing. Survey involved in the study also measured sources of support and coping mechanism. There were few differences in the level of negative beliefs between groups, although CLs were found to experience more feelings of isolation and FLOs and CLs were more likely to believe that there was no justice in the world. OHAs, CLs and FLOs were significantly more likely to demonstrate personal growth than HRs. Reflection on the work facilitated through professional or peer supervision and a healthy lifestyle was found to be associated with higher levels of personal growth and satisfaction with their performance at work. The results suggest that the provision of professional or peer supervision may be helpful in increasing reflection and 'sense making' leading to personal development and growth. Other forms of support that were found to be helpful included taking exercise, healthy eating and engaging in a hobby.

  11. On the design of a radix-10 online floating-point multiplier

    NASA Astrophysics Data System (ADS)

    McIlhenny, Robert D.; Ercegovac, Milos D.

    2009-08-01

    This paper describes an approach to design and implement a radix-10 online floating-point multiplier. An online approach is considered because it offers computational flexibility not available with conventional arithmetic. The design was coded in VHDL and compiled, synthesized, and mapped onto a Virtex 5 FPGA to measure cost in terms of LUTs (look-up-tables) as well as the cycle time and total latency. The routing delay which was not optimized is the major component in the cycle time. For a rough estimate of the cost/latency characteristics, our design was compared to a standard radix-2 floating-point multiplier of equivalent precision. The results demonstrate that even an unoptimized radix-10 online design is an attractive implementation alternative for FPGA floating-point multiplication.

  12. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii.

  13. IN VIVO EFFECT OF GUIDING-HERB RADIX PLATYCODONIS AND RADIX CYATHULAE ON PAEONIFLORIN PHARMACOKINETICS OF XUEFU ZHUYU TANG IN RATS.

    PubMed

    Tang, Song-Qi; Chen, Yun-Hui; Chen, Xi-Ping; Zhang, Xiao-Dan; Huang, Wei

    2017-01-01

    Xuefu Zhuyu Tang (XFZYT), first recorded in Correction of Errors in Medical Works by Qing-ren Wang, has been proven reliable and effective for curing various diseases such as atherosclerosis, hypertension, hyperlipidemia, and angina pectoris. It consists of 11 herbs and two of them, Radix platycodonis and Radix cyathulae , have been traditionally considered as guiding herbs and deeply valued by tens of millions of Chinese medicine practitioners. Do Radix platycodonis and Radix cyathulae affect the pharmacokinetics of the effective constituent-paeoniflorin of XFZYT? If yes, in what way? This study aims to answer these questions. The medicinal solutions of XFZYT, XFZYT without Radix platycodonis (XFZYT-JG), XFZYT without Radix cyathulae (XFZYT-NX), and XFZYT without Radix platycodonis and Radix cyathulae (XFZYT-JG-NX) were prepared and administrated to rats in the normal group and the blood-stasis model group by gavage, respectively. The blood samples of rats in the normal group were obtained 5, 10, 15, 20, 30, 45, 60, 120, and 240 minutes after gavage; whereas the blood samples of rats in the blood-stasis model group were obtained 10, 15, 20, 30, 45, 90, 150, and 240 minutes after gavage. Biological samples were processed; the assays of specificity, precision, linearity, intra-day and inter-day precisions, recovery and stability were conducted; high performance liquid chromatography was performed to detect paeoniflorin content; and DAS software was adopted to generate pharmacokinetic parameters. Mobile phase was composed of acetonitrile and water (16:84), detection wavelength was 230 nm, and riboflavin was set as internal standard substance. The pharmacokinetic parameters of the rats in the normal group after oral gavage of XFZYT, XFZYT-JG, XFZYT-NX, and XFZYT-JG-NX were C max = (0.363±0.248, 0.065±0.020, 0.099±0.033, 0.099±0.020) mg/L, T max = (0.276±0.084, 0.583±0.342, 0.555±0.228, 0.317±0.033)h, t 1/2 = (0.501±0.241, 1.021±0.522, 0.853±0.377, 1.227±0.402) h; and AUC 0-∞ = (0.381±0.415, 0.13±0.085, 0.166±0.066, 0.185±0.059) mg/L·h.; whereas the pharmacokinetic parameters for the rats in the blood-stasis model group after oral gavage of XFZYT, XFZYT-JG, XFZYT-NX, and XFZYT-JG-NX were C max = (0.315±0.153, 0.215±0.044, 0.228±0.056, 0.248±0.09) mg/L, T max = (0.5±0, 0.667±0.129, 0.5±0, 0.542±0.102) h, t 1/2 = (0.408±0.146, 0.813±0.135, 0.708±0.383, 0.741±0.173) h, and AUC 0-∞ = (0.306±0.157, 0.408±0.136, 0.368±0.159, 0.381±0.246) mg/L·h. The guiding herbs, Radix platycodoni s and Radix cyathulae , significantly increased the absorption amount and rate of paeoniflorin in XFZYT, and accelerated its elimination from the blood.

  14. [Study on detoxication of kansui radix on normal liver cells LO2 after stir-baking with vinegar].

    PubMed

    Yan, Xiaojing; Zhang, Li; Li, Lin; Cao, Yudan; Li, Zhengjun; Tang, Yuping; Ding, Anwei

    2012-06-01

    To compare the toxicity on normal liver cells LO2 before and after Kansui Radix stir-baked with vinegar, and make a preliminary study on the mechanism of detoxication of Kansui Radix stir-baked with vinegar. The MTT method was adopted to detect the cell activity, with normal liver cells LO2 as the study object. The morphology of cells were observed, and the level or content of AST, ALT, LDH, SOD, Na+-K+-ATPase, Ca2+-Mg2+ -ATPase, GSH and MDA were determined in cell culture supernatant and splitting supernatant. Compared with the control group, Kansui can obviously inhibit the cell activity (P < 0.01) and morphology, and increase the levels of ALT, AST, and LDH (P < 0.01) in the supernatant fluid of cell incubation, and decrease the level of SOD and the content of GSH (P < 0.01). Besides, it significantly increased the content of MDA (P < 0.01) and significantly decreased the level of Na+-K+-ATPase and Ca2+-Mg2+ -ATPase (P < 0.01) in the supernatant fluid of cell dissociation. Compared with Kansui group of various doses, Kansui Radix stir-baked with vinegar can significantly decrease the cell proliferation inhibition and the trend of morphological variation, and obviously decrease the levels of ALT, AST, and LDH (P < 0.01) in the supernatant fluid of cell incubation, and significantly increase the level of SOD and the content of GSH (P < 0.01), and significantly decrease the content of MDA (P < 0.01). Additionally, it significantly increased the level of Na+-K+-ATPase and Ca2+-Mg2+ ATPase (P < 0.01) in the supernatant fluid of cell dissociation, and showed a certain dose-effect relationship. Stir-baking with rice vinegar can release the hepatotoxicity of Kansui Radix. Its possible mechanism was that Kansui Radix stir-baked with vinegar can decrease the influence of Kansui Radix on the permeability of liver cells LO2 membrane and oxidative damage, in order to provide basis for further exploration of the detoxication mechanism of Kansui Radix stir-baked with vinegar.

  15. [Study on separation of essential oil of Caryophylli flos from oil-in-water emulsion by microfiltration].

    PubMed

    Han, Zhifeng; Shen, Jie; Guo, Liwei; Fan, Wenlin

    2011-01-01

    To separate essential oil of Caryophyllix flos from oil-in-water emulsion, and to enrich the essential oil by microfiltration (MF). Using membrane flux and removal rate of COD as the indicatrixes, the membrane material as well as the operating conditions containing pressure, surface speed, temperature were optimized. The results showed that QWLM membrane of hydrophilic is the proper membrane, and the best operating conditions was at 0.06 MPa, 60 degrees C, and 150 r min(-1) stir speed. It can be concluded that MF is a reasonable way to enrich essential oil of C. flox.

  16. Environmentally friendly ionic liquid-in-water microemulsions for extraction of hydrophilic and lipophilic components from Flos Chrysanthemi.

    PubMed

    Chen, Jue; Cao, Jun; Gao, Wen; Qi, Lian-Wen; Li, Ping

    2013-10-21

    Ionic liquids (ILs) have numerous chemical applications as environmentally green solvents that are extending into microemulsion applications. In this work, a novel benign IL-in-water microemulsion system modified by an IL surfactant has been proposed for simultaneous extraction of hydrophilic and lipophilic constituents from Flos Chrysanthemi (Chrysanthemum morifolium). Constituents were analyzed by rapid-resolution liquid chromatography coupled with quadrupole time-of-flight mass spectrometry. A mixture-design approach was used to optimize the IL surfactant and the IL oil phase in the microemulsion system. Microemulsions consisting of 6.0% 1-dodecyl-3-methylimidazolium hydrogen sulfate, 0.1% 1-vinyl-3-methylimidazolium hexafluorophosphate and 93.9% water offered the acceptable extract efficiency that are comparable to or even better than conventional volatile organic solvents. This assay was fully validated with respect to the linearity of response (r(2) > 0.999 over two orders of magnitude), precision (intra-RSD < 0.49 and inter-day RSD < 2.21), and accuracy (recoveries ranging from 93.73% to 101.84%). The proposed IL-in-water microemulsion method provided an environmentally friendly alternative for efficient extraction of compounds from Flos Chrysanthemi and could be extended to complex environmental and pharmaceutical samples.

  17. A network pharmacology-integrated metabolomics strategy for clarifying the difference between effective compounds of raw and processed Farfarae flos by ultra high-performance liquid chromatography-quadrupole-time of flight mass spectrometry.

    PubMed

    Ding, Mingya; Li, Zhen; Yu, Xie-An; Zhang, Dong; Li, Jin; Wang, Hui; He, Jun; Gao, Xiu-Mei; Chang, Yan-Xu

    2018-07-15

    This study aimed to clarify the difference between the effective compounds of raw and processed Farfarae flos using a network pharmacology-integrated metabolomics strategy. First, metabolomics data were obtained by ultra high-performance liquid chromatography-quadrupole-time of flight mass spectrometry (UHPLC-Q-TOF/MS). Then, metabolomics analysis was developed to screen for the influential compounds that were different between raw and processed Farfarae flos. Finally, a network pharmacology approach was applied to verify the activity of the screened compounds. As a result, 4 compounds (chlorogenic acid, caffeic acid, rutin and isoquercitrin) were successfully screened, identified, quantified and verified as the most influential effective compounds. They may synergistically inhibit the p38, JNK and ERK-mediated pathways, which would induce the inhibition of the expression of the IFA virus. The results revealed that the proposed network pharmacology-integrated metabolomics strategy was a powerful tool for discovering the effective compounds that were responsible for the difference between raw and processed Chinese herbs. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Oxygen radical absorbance capacity of phycocyanin and phycocyanobilin from the food supplement Aphanizomenon flos-aquae.

    PubMed

    Benedetti, Serena; Benvenuti, Francesca; Scoglio, Stefano; Canestrari, Franco

    2010-02-01

    The oxygen radical absorbance capacity (ORAC) assay has been widely used to quantify peroxyl radical scavenging capacity of pure antioxidant compounds and antioxidant plant/food extracts. However, it has never been applied to natural compounds derived from microalgae-based dietary supplements, namely, phycocyanin (PC) and phycocyanobilin (PCB), for which a strong radical scavenger activity has been documented. In this article, we applied the ORAC method to investigate the capacity of PC and PCB purified from the edible microalga Aphanizomenon flos-aquae to directly quench peroxyl radicals in comparison to well-known antioxidants molecules such as Trolox, ascorbic acid, and reduced glutathione. As a result, PCB was found to have the highest ORAC value (22.18 micromol of Trolox/micromol of compound), comparable to that of PC (20.33 micromol of Trolox/micromol of compound), hence confirming that PCB is mostly responsible for the scavenger activity of PC and making the protein a possible source of the antioxidant in vivo. Our data further corroborate the use of these natural compounds from A. flos-aquae as dietary antioxidant supplements in the treatment of clinical conditions related to oxidative stress.

  19. Transport properties of puerarin and effect of Radix Angelicae Dahuricae extract on the transport of puerarin in Caco-2 cell model.

    PubMed

    Liang, Xin-Li; Zhao, Li-Jun; Liao, Zheng-Gen; Zhao, Guo-Wei; Zhang, Jing; Chao, Yun-Chao; Yang, Ming; Yin, Rong-Li

    2012-12-18

    Angelicae Dahurica (Hoffm.)Benth.& Hook.f.ex Franch.&Sav combined with Pueraria labota (Willd.)Ohwi has been widely used as herb-pairs in traditional Chinese medicine (TCM) for utilization of antipyretic analgesic and anti-inflammatory drugs, and modern pharmacological studies have shown that application compatibility of the two drugs has the effects of cardiovascular disease treatment. The previous study has proved that Radix Angelicae Dahuricae extract could enhance the intestinal absorption of puerarin in Pueraria. But the underlying compatibility mechanism of the two herbs remains unknown. In this study we tried to further evaluate the improvement of Radix Angelicae Dahuricae extract on the puerarin using the Caco-2 cell model and explore the transport properties of puerarin through the above research to discuss the possible effect mechanism of Radix Angelicae Dahuricae extract on the transport of puerarin and the underlying compatibility mechanism of the two herbs. The aim of this work was to study the transport properties of puerarin in Radix Pueraria across Caco-2 cell membrane and to explore how the Radix Angelicae Dahuricae extract affected the transport of puerarin using the well-characterized, human-based intestinal Caco-2 cell model as a platform. The bidirectional transport, and the effects of time, drug concentration, pH, P-gp inhibitors (Verapamil, Cyclosporin A), MRP inhibitor (MK-571) and EDTA-Na(2) (tight junction modulator) on the absorption of puerarin were observed. Then the influence of extract of Radix Angelicae Dahuricae on the transport of puerarin was studied. Drug concentration was measured by HPLC and the apparent permeability coefficients (Papp) and apparent permeability ratio (PDR) were calculated. The results showed that the transport (Papp) of puerarin in Caco-2 cell monolayer model had time and concentration dependence, and the transport showed saturation characteristics with the time and concentration of puerarin to a certain degree. The Papp of puerarin transported on Caco-2 cell monolayer model was significantly changed when the specified inhibitors of P-gp were added to the model and the PDR decreased from 1.74 to 0.43. The absorption of puerarin was improved when combined with Radix Angelicae Dahuricae. The intestinal absorption of puerarin is by passive diffusion as the dominating process and active transportation was mediated by P-gp and MRP transporter in Caco-2 cell monolayer model, and Radix Angelicae Dahuricae could enhance the intestinal absorption of puerarin. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. [Analysis of commercial specifications and grades of wild and cultivated Gentianae Macrophyllae Radix based on multi-indicative constituents].

    PubMed

    Yang, Yan-Mei; Lin, Li; Lu, You-Yuan; Ma, Xiao-Hui; Jin, Ling; Zhu, Tian-Tian

    2016-03-01

    The study is aimed to analyze the commercial specifications and grades of wild and cultivated Gentianae Macrophllae Radix based on multi-indicative constituents. The seven kinds of main chemical components containing in Gentianae Macrophyllae Radix were determined by UPLC, and then the quality levels of chemical component of Gentianae Macrophyllae Radix were clustered and classified by modern statistical methods (canonical correspondence analysis, Fisher discriminant analysis and so on). The quality indices were selected and their correlations were analyzed. Lastly, comprehensively quantitative grade division for quality under different commodity-specifications and different grades of same commodity-specifications of wild and planting were divided. The results provide a basis for a reasonable division of specification and grade of the commodity of Gentianae Macrophyllae Radix. The range of quality evaluation of main index components (gentiopicrin, loganin acid and swertiamarin) was proposed, and the Herbal Quality Index (HQI) was introduced. The rank discriminant function was established based on the quality by Fisher discriminant analysis. According to the analysis, the quality of wild and cultivated Luobojiao, one of the commercial specification of Gentianae Macrophyllae Radix was the best, Mahuajiao, the other commercial specification, was average , Xiaoqinjiao was inferior. Among grades, the quality of first-class cultivated Luobojiao was the worst, of second class secondary, and the third class the best; The quality of the first-class of wild Luobojiao was secondary, and the second-class the best; The quality of the second-class of Mahuajiao was secondary, and the first-class was the best; the quality of first-class Xiaoqinjiao was secondary, and the second-class was the better one between the two grades, but not obvious significantly. The method provides a new idea and method for evaluation of comprehensively quantitative on the quality of Gentianae Macrophyllae Radix. Copyright© by the Chinese Pharmaceutical Association.

  1. Effects of radix polygoni multiflori components on tyrosinase activity and melanogenesis.

    PubMed

    Guan, Shuyu; Su, Weiwei; Wang, Ning; Li, Peibo; Wang, Yonggang

    2008-04-01

    Radix Polygoni multiflori is a herb used effectively to prevent graying and treat skin depigmentation diseases in traditional Chinese medicine but its active ingredients have not been discovered yet. In this investigation, we tested six compounds isolated from Radix Polygoni multiflori, to discover the active component on melanogenesis. Three experiments were performed in the present investigation: mushroom tyrosinase activity, melanin content B16 cell proliferation assay. Among all the six components tested, THSG showed the most potent effects on tyrosinase activation and melanogenesis; it was shown to be a potent tyrosinase activator and a melanogenesis stimulator in this study. On the other hand, we found that gallic acid significantly inhibited tyrosinase and, in addition, anthraquinones were cytotoxic to melanoma cells. They were both harmful to melanogenesis. Therefore, we propose that THSG acts as the active ingredient of Radix Polygoni multiflori on melanogenesis.

  2. [Determination of four coumarin constituents before and after Angelicae Dahuricae Radix stewed with yellow rice wine and research on its mutual transformation mechanism].

    PubMed

    Yuan, Zi-Min; Wang, Jing; Jia, Tian-Zhu; Chen, Jian-Feng

    2016-08-01

    To determine the contents of oxypeucedanin, oxypeucedanin hydrate, byakangelicol and byak-angelicin both before and after Angelicae Dahuricae Radix was stewed with yellow rice wine by high-performance liquid chromatography, and study the mutual transformation mechanisms of oxypeucedanin into oxypeucedanin hydrate, as well as byakangelicol into byak-angelicin. The research results indicated that the contents of oxypeucedanin and byakangelicol were decreased, but the contents of oxypeucedanin hydrate and byak-angelicin were increased after Angelicae Dahuricae Radix was processed with yellow rice wine. The contents' changes of these chemical compounds were due to the ring opening reaction of epoxy compounds, such as oxypeucedanin and byakangelicol under the weak acidity and heating conditions of yellow rice wine. This research could provide a scientific basis for the processing mechanism of Angelicae Dahuricae Radix with yellow rice wine stewing. Copyright© by the Chinese Pharmaceutical Association.

  3. [Ecology suitability study of Chinese materia medica Gentianae Macrophyllae Radix].

    PubMed

    Lu, You-Yuan; Yang, Yan-Mei; Ma, Xiao-Hui; Zhang, Xiao-Bo; Zhu, Shou-Dong; Jin, Ling

    2016-09-01

    This paper is aimed to predict ecology suitability distribution of Gentianae Macrophyllae Radix and search the main ecological factors affecting the suitability distribution. The 313 distribution information about G. macrophylla, 186 distribution information about G. straminea, 343 distribution information about G. dauricaand 131 distribution information about G. crasicaulis were collected though investigation and network sharing platform data . The ecology suitable distribution factors for production Gentianae Macrophyllae Radix was analyzed respectively by the software of ArcGIS and MaxEnt with 55 environmental factors. The result of MaxEnt prediction was very well (AUC was above 0.9). The results of predominant factors analysis showed that precipitation and altitude were all the major factors impacting the ecology suitable of Getiana Macrophylla Radix production. G. macrophylla ecology suitable region was mainly concentrated in south of Gansu, Shanxi, central of Shaanxi and east of Qinghai provinces. G. straminea ecology suitable region was mainly concentrated in southwest of Gansu, east of Qinghai, north and northwest of Sichuan, east of Xizang province. G. daurica ecology suitable region was mainly concentrated in south and southwest of Gansu, east of Qinghai, Shanxi and north of Shaanxi province. G. crasicaulis ecology suitable region was mainly concentrated in Sichuan and north of Yunnan, east of Xizang, south of Gansu and east of Qinghai province. The ecological suitability distribution result of Gentianae Macrophyllae Radix was consistent with each species actual distribution. The study could provide reference for the collection and protection of wild resources, meanwhile, provide the basis for the selection of cultivation area of Gentiana Macrophylla Radix. Copyright© by the Chinese Pharmaceutical Association.

  4. [Puerariae Lobatae Radix elevated expression levels of OB-R, IRS2, GLUT1 and GLUT2 to regulate glucose metabolism in insulin-resistance HepG2 cells].

    PubMed

    Li, Yu; Luo, Xin-Xin; Yan, Feng-Dong; Wei, Zhang-Bin; Tu, Jun

    2017-05-01

    To observe the anti-hyperglycemic effect of Puerariae Lobatae Radix in hepatocyte insulin resistance(IR) models, and investigate its preliminary molecular mechanism. IR-HepG2 cell model was stably established with 1×10-9 mol•L⁻¹ insulin plus 3.75×10-6 mol•L-1 dexamethasone treatment for 48 h according to optimized protocol in our research group. After IR-HepG2 cells were treated with different concentrations(5%,10% and 15%) of Puerariae Lobatae Radix-containing serum, cell viability was detected by CCK-8 assay; the glucose consumptions in IR-HepG2 cells were separately detected at different time points (12, 15, 18, 21, 24, 30, 36 h) by using glucose oxidase method; intracellular glycogen content was detected by anthrone method; and the protein expression levels of leptin receptor (Ob-R), insulin receptor substrate-2 (IRS2), glucose transporter 1(GLUT1) and GLUT2 were detected by Western blot assay. The results showed that Puerariae Lobatae Radix-containing serum (5%, 10% and 15%) had no significant effect on IR-HepG2 cell viability; 5% and 10% Puerariae Lobatae Radix-containing serum significantly increased glucose consumption of IR-HepG2 cells (P<0.01) at 18, 21 and 24 h; 15% Puerariae Lobatae Radix-containing serum elevated the glucose consumption of IR-HepG2 cells at 15 h (P<0.05), and significantly elevated the glucose consumption at 18, 21, 24 and 30 h (P<0.01) in a dose-dependent manner. The optimized time of anti-hyperglycemic effect was defined as 24 h, and further study showed that Puerariae Lobatae Radix-containing serum could increase intracellular glycogen content after 24 h treatment (P<0.01), and up-regulate IRS2, Ob-R, GLUT1 and GLUT2 protein expression levels. Our results indicated that Puerariae Lobatae Radix-containing serum could achieve the anti-hyperglycemic effect through important PI3K/PDK signaling pathway partially by up-regulating the expression levels of Ob-R and IRS2, GLUT1 and GLUT2 in IR-HepG2 cells, accelerating the glucose transport into hepatocytes and increasing hepatic glycogen synthesis to enhance the anti-hyperglycemic effect of IR-HepG2 cells. Copyright© by the Chinese Pharmaceutical Association.

  5. Dihydroisocoumarins from Radix Glycyrrhizae.

    PubMed

    Zhao, Songsong; Yan, Xinjia; Zhao, Ying; Wen, Jing; Zhao, Zhenzhen; Liu, Hongwei

    2018-05-11

    Radix Glycyrrhizae is the rhizome of Glycyrrhiza inflata Bat., Glycyrrhiza uralensis Fisch. or Glycyrrhiza glabra L. The present paper describes the isolation and the structural elucidation of three new dihydroisocoumarins obtained from the 70% EtOH extract of Radix Glycyrrhizae. And the cytotoxic activities of these new compounds were also evaluated using four cell lines, subsequently. A pair of new dihydroisocoumarin epimers ((3R,4S)-4,8-dihydroxy-3-methyl-1-oxoisochroman-5-yl)methyl acetate (1) and ((3R,4R)-4,8-dihydroxy-3-methyl-1-oxoisochroman-5-yl)methyl acetate (2) along with a new dihydroisocoumarin (3R,4R)-4,8-dihydroxy-3,5-dimethylisochroman-1-one (3) were isolated from Radix Glycyrrhizae. Their structures were elucidated on the basis of chemical and spectral analysis, including 1D, 2D NMR analyses, HR-ESI-MSand ECD calculation comparing with those of experimental CD spectra. Cytotoxic activities of the three compounds were evaluated using the HepG2, A549, LoVo and Hela cell lines, respectively. IC 50 values indicated compounds 1-3 exhibited moderate or less cytotoxic activity in vitro. Dihydroisocoumarin is not the common components in Radix Glycyrrhizae, a series of dihydroisocoumarin were obtained in this plant could be a supplement to the chemical study of this plant.

  6. Peptide Nucleic Acid Based Molecular Authentication for Identification of Four Medicinal Paeonia Species Using Melting Array Analysis of the Internal Transcribed Spacer 2 Region.

    PubMed

    Kim, Wook Jin; Yang, Sungyu; Choi, Goya; Moon, Byeong Cheol

    2017-11-07

    Accurate taxonomic identification of plant materials in herbal medicines is important for product quality control. The genus Paeonia (Saxifragales) is the source of the herbal preparations Paeoniae Radix (Paeoniae Radix Alba and Paeoniae Radix Rubra) and Moutan Radicis Cotex. However, confusion has arisen regarding their contents due to linguistic and taxonomic ambiguities, similar morphologies and different definitions of Paeoniae Radix in the Korean and Chinese national pharmacopoeias, leading to the distribution of adulterated products. To develop a method for identifying the four Paeonia species used in these medicines, three fluorescently-labeled peptide nucleic acid (PNA) probes were designed against ITS2 sequences containing single nucleotide polymorphisms (SNPs) and used in a real-time PCR melting curve assay. Each of the four Paeonia species was accurately identified using this analysis. The accuracy and analytical stability of the PNA melting curve assay was confirmed using commercially available samples of the four Paeonia species. This assay is a reliable genetic tool to distinguish between different Paeonia -derived herbal medicines and identify the botanical origins of Paeoniae Radix and Moutan Radicis Cortex. This technique may also contribute to quality control and standardization of herbal medicines by providing a reliable authentication tool and preventing the distribution of inauthentic adulterants.

  7. Evaluation of the Influence of Sulfur-Fumigated Paeoniae Radix Alba on the Quality of Si Wu Tang by Chromatographic and Chemometric Analysis

    PubMed Central

    Pei, Ke; Duan, Yu; Qiao, Feng-Xian; Tu, Si-Cong; Liu, Xiao; Wang, Xiao-Li; Song, Xiao-Qing; Fan, Kai-Lei; Cai, Bao-Chang

    2016-01-01

    An accurate and reliable method of high-performance liquid chromatographic fingerprint combining with multi-ingredient determination was developed and validated to evaluate the influence of sulfur-fumigated Paeoniae Radix Alba on the quality and chemical constituents of Si Wu Tang. Multivariate data analysis including hierarchical cluster analysis and principal component analysis, which integrated with high-performance liquid chromatographic fingerprint and multi-ingredient determination, was employed to evaluate Si Wu Tang in a more objective and scientific way. Interestingly, in this paper, a total of 37 and 36 peaks were marked as common peaks in ten batches of Si Wu Tang containing sun-dried Paeoniae Radix Alba and ten batches of Si Wu Tang containing sulfur-fumigated Paeoniae Radix Alba, respectively, which indicated the changed fingerprint profile of Si Wu Tang when containing sulfur-fumigated herb. Furthermore, the results of simultaneous determination for multiple ingredients showed that the contents of albiflorin and paeoniflorin decreased significantly (P < 0.01) and the contents of gallic acid and Z-ligustilide decreased to some extent at the same time when Si Wu Tang contained sulfur-fumigated Paeoniae Radix Alba. Therefore, sulfur-fumigation processing may have great influence on the quality of Chinese herbal prescription. PMID:27034892

  8. [Influence of different original processing methods on quality of Salvia Miltiorrhizae Radix et Rhizoma from Shandong].

    PubMed

    Zhao, Zhi-Gang; Gao, Shu-Rui; Hou, Jun-Ling; Wang, Wen-Quan; Xu, Zhen-Guang; Song, Yan; Zhang, Xian-Ming; Li, Jun

    2014-04-01

    In this paper the contents of rosmarinic acid, salvianolic acid B, crytotanshinone, tanshinone II(A) in samples of different original processed Salvia Miltiorrhizae Radix et Rhizoma were determined by HPLC. Different processing methods have varied influences on four active ingredients in Salvia Miltiorrhizae Radix et Rhizoma. Sun-drying reduced the content of crytotanshinone, tanshi-none II(A) and rosmarinic acid, integralsamples were better than those cut into segments. Oven dry method had great influence on water--soluble ingredients, high temperature (80-100 degrees C) could easily cause big loss of rosmarinic acid and salvianolic acid B. The role of traditional processing method "fahan: was complicated, the content of rosmarinic acid decreased, crytotanshinone and tanshinone II(A) increased, and salvianolic acid B showed no difference after "fahan". Drying in the shade and oven dry under low temperatrure (40-60 degrees C) were all effective to keep active ingredients of Salvia Miltiorrhizae Radix et Rhizoma, and, there was no difference between integral samples and samples cut into segments. Therefore, considering comprehensively the content of active ingredients in Salvia Miltiorrhizae Radix et Rhizoma, and processing costing etc., shade-drying or oven dry underlow temperature (40-60 degrees C) should be the most suitable original processing method.

  9. Removal of Anabaena flos-aquae in water treatment process using Moringa oleifera and assessment of fatty acid profile of generated sludge.

    PubMed

    Moreti, Livia O R; Coldebella, Priscila Ferri; Camacho, Franciele P; Carvalho Bongiovani, Milene; Pereira de Souza, Aloisio Henrique; Kirie Gohara, Aline; Matsushita, Makoto; Fernandes Silva, Marcela; Nishi, Letícia; Bergamasco, Rosângela

    2016-01-01

    This study aimed to evaluate the efficiency of the coagulation/flocculation/dissolved air flotation (C/F/DAF) process using the coagulant Moringa oleifera (MO) seed powder, and to analyse the profile of fatty acids present in the generated sludge after treatment. For the tests, deionized water artificially contaminated with cell cultures of Anabaena flos-aquae was used, with a cell density in the order of 10(4) cells mL(-1). C/F/DAF tests were conducted using 'Flotest' equipment. For fatty acid profile analyses, a gas chromatograph equipped with a flame ionization detector was used. It was seen that the optimal dosage (100 mg L(-1)) of MO used in the C/F/DAF process was efficient at removing nearly all A. flos-aquae cells (96.4%). The sludge obtained after treatment contained oleic acid (61.7%) and palmitic acid (10.8%). Thus, a water treatment process using C/F/DAF linked to integral MO powder seed was found to be efficient in removing cells of cyanobacteria, and produced a sludge rich in oleic acid that is a precursor favourable for obtaining quality biodiesel, thus becoming an alternative application for the recycling of such biomass.

  10. Real-time Detection and Monitoring of Loop Mediated Amplification (LAMP) Reaction Using Self-quenching and De-quenching Fluorogenic Probes.

    PubMed

    Gadkar, Vijay J; Goldfarb, David M; Gantt, Soren; Tilley, Peter A G

    2018-04-03

    Loop-mediated isothermal amplification (LAMP) is an isothermal nucleic acid amplification (iNAAT) technique known for its simplicity, sensitivity and speed. Its low-cost feature has resulted in its wide scale application, especially in low resource settings. The major disadvantage of LAMP is its heavy reliance on indirect detection methods like turbidity and non-specific dyes, which often leads to the detection of false positive results. In the present work, we have developed a direct detection approach, whereby a labelled loop probe quenched in its unbound state, fluoresces only when bound to its target (amplicon). Henceforth, referred to as Fluorescence of Loop Primer Upon Self Dequenching-LAMP (FLOS-LAMP), it allows for the sequence-specific detection of LAMP amplicons. The FLOS-LAMP concept was validated for rapid detection of the human pathogen, Varicella-zoster virus, from clinical samples. The FLOS-LAMP had a limit of detection of 500 copies of the target with a clinical sensitivity and specificity of 96.8% and 100%, respectively. The high level of specificity is a major advance and solves one of the main shortcomings of the LAMP technology, i.e. false positives. Self-quenching/de-quenching probes were further used with other LAMP primer sets and different fluorophores, thereby demonstrating its versatility and adaptability.

  11. High performance liquid chromatography time of flight electrospray ionization mass spectrometry for quantification of sesquiterpenes in Chrysanthemi indici Flos active extract

    PubMed Central

    Fu, Ling; Wang, Pan; Sun, Yiqun; Wang, Yangyang; Zhao, Jing; Ye, Yuting; Zhang, Yanbin; Bi, Yuefeng

    2015-01-01

    Background: Chrysanthemi indici Flos, a traditional herbal medicine is used to clearing heat–toxicity, removing the liver fire, and improving eyesight. In our preliminary work, an active extract of CTC in C. An indici Flos with anti-hepatitis B virus and liver protective activity was found by HepG2.2.1.5 test and experiment of protein synthesis in mice's injured liver. In this work, we aimed to study the active faction CTC further by qualitative and quantitative analysis method. Materials and Methods: High performance liquid chromatography time of flight electrospray ionization mass spectrometry (HPLC TOF ESI-MS) analysis method of the CTC was established. Cumambrin A and angeloylcumambrin B in CTC were analyzed by high performance liquid chromatography-ultraviolet-evaporative light scattering detector (HPLC-UV-ELSD) analysis methods. A binary gradient elution program was conducted for chromatographic separation with acetonitrile (A) and ultrapure water (B) as follows: 0–10 min, 42–46% A; 10–20 min, 46–55% A; 20–25 min, 55–60% A; and 25–35 min, 60–75% A. The column temperature and UV wavelength were set at 30°C and 205 nm. Result: Ten constituents including (3R, 5R, 6S, 7S, 10R)-7-(2-hydroxy-2-propyl)-10-methyl-4-methyleneperhy, dronaphthal-ene-3, 5, 6-triol acetone solvate; (+)-edusmance-4, (14)-ene-11, 13-diol; linarin; luteolin; apigenin; tricin; 5, 3’,4’- trimethyl-6,7-dimethoxy flavones; cumambrin A; acacetin; and angeloylcumambrin B in CTC were identified by HPLC TOF ESI-MS. The contents of sesquiterpenes in CTC were decreased by storing years. Conclusions: The results showed that both UV and ELSD methods were feasible, accurate, and the determination results were in good consistency. The contents of two sesquiterpenes decreased with storing years. Two sesquiterpenes could be used as quality control for C. indici flos CTC. PMID:26600718

  12. Risk of Liver Injury Associated with Chinese Herbal Products Containing Radix bupleuri in 639,779 Patients with Hepatitis B Virus Infection

    PubMed Central

    Lee, Chang-Hsing; Wang, Jung-Der; Chen, Pau-Chung

    2011-01-01

    Background Chinese herbal products (CHPs) containing Radix bupleuri are often prescribed for chronic hepatitis. There have been no epidemiological studies in populations with hepatitis B virus (HBV) infection. Our study was conducted to determine the association between the use of CHPs containing Radix bupleuri and the risk of hospitalisation related to liver injury among HBV-infected patients in Taiwan. Methods From a total of 639,779 patients with diagnoses related to HBV infection, we included hospitalised adult cases with a primary diagnosis of liver injury in the database of Taiwan's national health insurance during the period 1997–2004. Case-control and case-crossover designs were used to assess the risk of hospitalisation with conditional logistic regression models constructed and adjusted for 270 conventionally hepatotoxic drugs. Cumulative doses of these CHPs and Radix bupleuri were assessed for any dose-response relationship. Findings In total, we collected 1,080 cases fulfilled the inclusion criteria. In the case-control design, the adjusted odds ratio was 1.90 (95% confidence interval [CI]: 1.30 to 2.77). The risks from prescribing the CHPs Xiao-Chai-Hu-Tang and Long-Dan-Xie-Gan-Tang were significantly high, and dose-response relationships were found. The risk of adding each 19 gm dose of Radix bupleuri was 2.19 (95% CI: 1.66 to 2.89). The results using the case-crossover design remained similar. Conclusions Prescribing Xiao-Chai-Hu-Tang, Long-Dan-Xie-Gan-Tang, or CHPs containing more than 19 gram of Radix bupleuri in HBV-infected patients might increase their risks of liver injury. Further studies are indicated to corroborate the above findings. PMID:21264326

  13. Simultaneous quantitative analysis of main components in linderae reflexae radix with one single marker.

    PubMed

    Wang, Li-Li; Zhang, Yun-Bin; Sun, Xiao-Ya; Chen, Sui-Qing

    2016-05-08

    Establish a quantitative analysis of multi-components by the single marker (QAMS) method for quality evaluation and validate its feasibilities by the simultaneous quantitative assay of four main components in Linderae Reflexae Radix. Four main components of pinostrobin, pinosylvin, pinocembrin, and 3,5-dihydroxy-2-(1- p -mentheneyl)- trans -stilbene were selected as analytes to evaluate the quality by RP-HPLC coupled with a UV-detector. The method was evaluated by a comparison of the quantitative results between the external standard method and QAMS with a different HPLC system. The results showed that no significant differences were found in the quantitative results of the four contents of Linderae Reflexae Radix determined by the external standard method and QAMS (RSD <3%). The contents of four analytes (pinosylvin, pinocembrin, pinostrobin, and Reflexanbene I) in Linderae Reflexae Radix were determined by the single marker of pinosylvin. This fingerprint was the spectra determined by Shimadzu LC-20AT and Waters e2695 HPLC that were equipped with three different columns.

  14. A High-Speed Design of Montgomery Multiplier

    NASA Astrophysics Data System (ADS)

    Fan, Yibo; Ikenaga, Takeshi; Goto, Satoshi

    With the increase of key length used in public cryptographic algorithms such as RSA and ECC, the speed of Montgomery multiplication becomes a bottleneck. This paper proposes a high speed design of Montgomery multiplier. Firstly, a modified scalable high-radix Montgomery algorithm is proposed to reduce critical path. Secondly, a high-radix clock-saving dataflow is proposed to support high-radix operation and one clock cycle delay in dataflow. Finally, a hardware-reused architecture is proposed to reduce the hardware cost and a parallel radix-16 design of data path is proposed to accelerate the speed. By using HHNEC 0.25μm standard cell library, the implementation results show that the total cost of Montgomery multiplier is 130 KGates, the clock frequency is 180MHz and the throughput of 1024-bit RSA encryption is 352kbps. This design is suitable to be used in high speed RSA or ECC encryption/decryption. As a scalable design, it supports any key-length encryption/decryption up to the size of on-chip memory.

  15. Metabolomics-based optimal koji fermentation for tyrosinase inhibition supplemented with Astragalus radix.

    PubMed

    Kim, Ah Jin; Choi, Jung Nam; Kim, Jiyoung; Yeo, Soo Hwan; Choi, Ji Ho; Lee, Choong Hwan

    2012-01-01

    The present study was focused on improving the quality of rice koji by fermentation with a selected Aspergillus oryzae strain and a plant Astragalus radix. A. oryzae KCCM 60345 was used as main inoculant and the Astragalus radix was added as supplement in rice koji preparation. LC-MS based metabolite analysis and tyrosinase inhibitory activities were studied for different time periods. A. oryzae KCCM 60345 fermented rice koji supplemented with Astragalus showed higher tyrosinase inhibition activity at 4 d of fermentation and metabolite analysis with PCA and PLS-DA indicated differences in kojic acid, calycosin-7-O-β-D-glucoside, ononin, calycosin, and formononetin as compared with other forms of rice koji fermentation. By correlation analysis between metabolites and tyrosinase inhibitory activity, calycosin and kojic acid were identified as major tyrosinase inhibitors. Based on these results, we concluded that A. oryzae KCCM 60345 supplemented with Astragalus radix is useful for whitening effects, and we identified optimal conditions for rice koji preparation.

  16. A combined A431 cell membrane chromatography and online high performance liquid chromatography/mass spectrometry method for screening compounds from total alkaloid of Radix Caulophylli acting on the human EGFR.

    PubMed

    Sun, Meng; Ren, Jing; Du, Hui; Zhang, Yanmin; Zhang, Jie; Wang, Sicen; He, Langchong

    2010-10-15

    We have developed an online analytical method that combines A431 cell membrane chromatography (A431/CMC) with high performance liquid chromatography and mass spectrometry (LC/MS) for identifying active components from Radix Caulophylli acting on human EGFR. Retention fractions on A431/CMC model were captured onto an enrichment column and the components were directly analyzed by combining a 10-port column switcher with an LC/MS system for separation and preliminary identification. Using Sorafenib tosylate as a positive control, taspine and caulophine from Radix Caulophylli were identified as the active molecules which could act on the EGFR. This A431/CMC-online-LC/MS method can be applied for screening active components acting on EGFR from traditional Chinese medicines exemplified by Radix Caulophylli and will be of great utility in drug discovery using natural medicinal herbs as a source of novel compounds. Copyright © 2010 Elsevier B.V. All rights reserved.

  17. Diversification of CYCLOIDEA expression in the evolution of bilateral flower symmetry in Caprifoliaceae and Lonicera (Dipsacales)

    PubMed Central

    Howarth, Dianella G.; Martins, Tiago; Chimney, Edward; Donoghue, Michael J.

    2011-01-01

    Background and Aims The expression of floral symmetry genes is examined in the CYCLOIDEA lineage following duplication, and these are linked to changes in flower morphology. The study focuses on Dipsacales, comparing DipsCYC2 gene expression in Viburnum (radially symmetrical Adoxaceae) to members of early-diverging lineages of the bilaterally symmetrical Caprifoliaceae (Diervilla and Lonicera). Methods Floral tissue from six species, which included dorsal, lateral and ventral regions of the corolla, was dissected. RNA was extracted from these tissues and each copy of DipsCYC2 was amplified with reverse transcriptase PCR. Key Results Members of DipsCYC2 were expressed across the corolla in the radially symmetrical Viburnum plicatum. A shift to bilaterally symmetrical flowers at the base of the Caprifoliaceae was accompanied by a duplication of the DipsCYC2 gene, resulting in DipsCYC2A and DipsCYC2B, and by loss of expression of both of these copies in the ventral petal. In Lonicera (Caprifolieae), there is a shift from flowers with two dorsally and three ventrally oriented corolla lobes to a clear differentiation of dorsal, lateral and ventral lobes. This shift entailed a decoupling of expression of DipsCYC2A and DipsCYC2B; DipsCYC2B continues to be expressed in the dorsal and lateral lobes, while DipsCYC2A expression is restricted to just the two dorsal lobes. A reversion to more radially symmetrical flowers within Lonicera was accompanied by a re-expansion of expression of both DipsCYC2A and DipsCYC2B. Conclusions The transition to bilateral symmetry in Caprifoliaceae involved: (a) duplication of an ancestral DipsCYC2 gene; (b) the loss of expression of both of these copies in the ventral petal; and (c) changes in the zone of expression, with one copy continuing to be expressed across the dorsal and lateral petals, and the other copy becoming restricted in expression to the dorsal corolla lobes. PMID:21478175

  18. Analytical Research to Determine the effects of the Components of ONGABO on the Viability of HepG2 Cancer Cells by Using the Sovereign, Minister, Assistant and Courier Principle (君臣佐使論)

    PubMed Central

    Shin, Jeong-Hun; Jun, Seung-lyul; Hwang, Sung-Yeoun; Ahn, Seong-Hun

    2012-01-01

    Objectives: This study used the basic principle of Oriental medicine, the sovereign, minister, assistant and courier principle (君臣佐使論) to investigate the effects of the component of ONGABO, which is composed of Ginseng Radix (Red Ginseng), Angelica Gigantis Radix, Schisandrae Fructus, Cuscuta Semen and Curcumae tuber on the viability of HepG2 cells. Methods: Single and mixed extracts of the component of ONGABO were prepared by lypohilizing powder of Red Ginseng (6-year root from Kanghwa), Angelica Gigantis Radix, Schisandrae Fructus, Cuscuta Semen, Curcumae Tuber (from Omniherb Co., Ltd., Korea) at the laboratory of herbal medicine in Woosuk University and were eluted after being macerated with 100% ethanol for three days. The cell viability of HepG2 was determined by using an absorptiometric analysis with PrestoBlue (Invitrogen) reagent after the plate had been incubated for 48 hours. All of the experiments were repeated three times to obtain the average value and standard deviation. The statistical analysis was done and the correlation factor was obtained by using Microsoft Office Excel 2007 and Origin 6.0 software. Results: Although Ginseng Radix (Red Ginseng) and Schisandrae Fructus did not enhance the viability of HepG2 cells, they were shown to provide protection of those cells. On the other hand, Angelica Gigantis Radix decreased the viability of HepG2 cells significantly, Cuscuta Semen and Curcumae Tuber had a small or no effect on the viability of HepG2 cells. Conclusions: In the sovereign, minister, assistant and courier principle (君臣佐使論), Ginseng Radix (Red Ginseng) corresponds to the sovereign component because it provides cell protection effects, Angelica Gigantis Radix corresponds to minister medicinal because it kills cells, Schisandrae Fructus corresponds to the assistant medicinal to help red ginseng having cell protect effects. Cuscuta Semen and Curcumae Tuber correspond to the courier medicinal having no effect in cell viability in HepG2. We hope this study provides motivation for advanced research on the sovereign, minister, assistant and courier principle. PMID:25780653

  19. Analytical Research to Determine the effects of the Components of ONGABO on the Viability of HepG2 Cancer Cells by Using the Sovereign, Minister, Assistant and Courier Principle ().

    PubMed

    Shin, Jeong-Hun; Jun, Seung-Lyul; Hwang, Sung-Yeoun; Ahn, Seong-Hun

    2012-12-01

    This study used the basic principle of Oriental medicine, the sovereign, minister, assistant and courier principle () to investigate the effects of the component of ONGABO, which is composed of Ginseng Radix (Red Ginseng), Angelica Gigantis Radix, Schisandrae Fructus, Cuscuta Semen and Curcumae tuber on the viability of HepG2 cells. Single and mixed extracts of the component of ONGABO were prepared by lypohilizing powder of Red Ginseng (6-year root from Kanghwa), Angelica Gigantis Radix, Schisandrae Fructus, Cuscuta Semen, Curcumae Tuber (from Omniherb Co., Ltd., Korea) at the laboratory of herbal medicine in Woosuk University and were eluted after being macerated with 100% ethanol for three days. The cell viability of HepG2 was determined by using an absorptiometric analysis with PrestoBlue (Invitrogen) reagent after the plate had been incubated for 48 hours. All of the experiments were repeated three times to obtain the average value and standard deviation. The statistical analysis was done and the correlation factor was obtained by using Microsoft Office Excel 2007 and Origin 6.0 software. Although Ginseng Radix (Red Ginseng) and Schisandrae Fructus did not enhance the viability of HepG2 cells, they were shown to provide protection of those cells. On the other hand, Angelica Gigantis Radix decreased the viability of HepG2 cells significantly, Cuscuta Semen and Curcumae Tuber had a small or no effect on the viability of HepG2 cells. In the sovereign, minister, assistant and courier principle (), Ginseng Radix (Red Ginseng) corresponds to the sovereign component because it provides cell protection effects, Angelica Gigantis Radix corresponds to minister medicinal because it kills cells, Schisandrae Fructus corresponds to the assistant medicinal to help red ginseng having cell protect effects. Cuscuta Semen and Curcumae Tuber correspond to the courier medicinal having no effect in cell viability in HepG2. We hope this study provides motivation for advanced research on the sovereign, minister, assistant and courier principle.

  20. [Chemical Constituents from Processed Products of Aconitum Vilmoriniani Radix].

    PubMed

    Guo, Zhi-jun; Yang, Zhu-ya; Tan, Wen-hong; Zhou, Zhi-hong; Ma, Xiao-xia

    2015-05-01

    To investigate the chemical constituents of the processed products of Aconitum Vilmorinian Radix. The constituents were isolated by repeated column chromatography over silica gel, alumina and RP-C18 as well as recrystallization. The structures were elucidated on the basis of spectral analysis and physicochemical properties. Ten compounds were obtained from the methanol extract, and they were identified as yunaconitine (1), 8-deacetyl-yunaconitine (2), geniculatine C (3), vilmorrianine B (4), vilmorrianine C(5), vilmorrianine D (6), talatisamine (7), β-sitosterol (8), β-daucosterol (9) and β-sitosterol acetate (10). All compounds are obtained from the processed products of Aconitum Vilmoriniani Radix for the first time.

  1. Green biosynthesis of silver nanoparticles using Althaea officinalis radix hydroalcoholic extract.

    PubMed

    Korbekandi, Hassan; Asghari, Gholamreza; Chitsazi, Mohammad Reza; Bahri Najafi, Rahim; Badii, Akbar; Iravani, Siavash

    2016-01-01

    The objectives were to study the potential of Althaea officinalis radix in production of silver NPs, and the effect of the extract ethanol concentration on the produced NPs. Seventy and ninety-six percent hydroalcoholic extracts were prepared by percolation of the plant powder. The extract was concentrated by rotary evaporator and then freeze-dried. Silver ions were determined using atomic absorption analysis. The NPs were characterized by Nano-Zeta Sizer and TEM. Both of 70% and 96% of hydroalcoholic extracts of A. officinalis radix successfully synthesized spherical and poly-dispersed silver NPs. The conversion was fast and almost completed in 5 h.

  2. Simultaneous determination of five coumarins in Angelicae dahuricae Radix by HPLC/UV and LC-ESI-MS/MS.

    PubMed

    Park, Ah Yeon; Park, So-Young; Lee, Jaehyun; Jung, Mihye; Kim, Jinwoong; Kang, Sam Sik; Youm, Jeong-Rok; Han, Sang Beom

    2009-10-01

    Rapid, simple and reliable HPLC/UV and LC-ESI-MS/MS methods for the simultaneous determination of five active coumarins of Angelicae dahuricae Radix, byakangelicol (1), oxypeucedanin (2), imperatorin (3), phellopterin (4) and isoimperatorin (5) were developed and validated. The separation condition for HPLC/UV was optimized using a Develosil RPAQUEOUS C(30) column using 70% acetonitrile in water as the mobile phase. This HPLC/UV method was successful for providing the baseline separation of the five coumarins with no interfering peaks detected in the 70% ethanol extract of Angelicae dahuricae Radix. The specific determination of the five coumarins was also accomplished by a triple quadrupole tandem mass spectrometer equipped with an electrospray ionization source (LC-ESI-MS/MS). Multiple reaction monitoring (MRM) in the positive mode was used to enhance the selectivity of detection. The LC-ESI-MS/MS methods were successfully applied for the determination of the five major coumarins in Angelicae dahuricae Radix. These HPLC/UV and LC-ESI-MS/MS methods were validated in terms of recovery, linearity, accuracy and precision (intra- and inter-day validation). Taken together, the shorter analysis time involved makes these HPLC/UV and LC-ESI-MS/MS methods valuable for the commercial quality control of Angelicae dahuricae Radix extracts and its pharmaceutical preparations. Copyright (c) 2009 John Wiley & Sons, Ltd.

  3. Gas chromatography-mass spectrometry analysis of essential oils from five parts of Chaihu (Radix Bupleuri Chinensis).

    PubMed

    Meng, Jie; Chen, Xingfu; Yang, Wenyu; Song, Jiuhua; Zhang, Yu; Li, Zhifei; Yang, Xingwang; Yang, Zhanguo

    2014-12-01

    To analyze the essential oils from flowers, leaves, stems, roots, and fruits of Chaihu (Radix Bupleuri Chinensis). We extracted essential oils from different parts of Chaihu (Radix Bupleuri Chinensis) using a steam distillation method. The essential oils were analyzed by gas chromatography-mass spectrometry (GC-MS). Data were collected in full scan mode (m/z 60-600). Volatile components were identified based on their retention indices and by comparing their mass spectra with those in the National Institute of Standards and Technology 2005 database, assisted by tandem mass spectrometry information. The relative content of each constituent was determined by area normalization. We identified 111 components, of which 12 were common to all 5 parts, 30 were found only in roots, 14 were found only in flowers, 6 were found only in leaves, 4 were found only in stems, and 17 were found only in fruits. Our results show that the stems, flowers, leaves, and fruits of Chaihu (Radix Bupleuri Chinensis) contain a high concentration of essential oils, and that the exact composition of the essential oils differs among the plant parts. To develop new medicines and make full use of the Chaihu (Radix Bupleuri Chinensis) resource, it is important to characterize the essential oils from different parts of the plant. In future research, it will be important to determine the pharmacological effects of the various components and the essential oil mixtures.

  4. Application of near-infrared spectroscopy for the rapid quality assessment of Radix Paeoniae Rubra

    NASA Astrophysics Data System (ADS)

    Zhan, Hao; Fang, Jing; Tang, Liying; Yang, Hongjun; Li, Hua; Wang, Zhuju; Yang, Bin; Wu, Hongwei; Fu, Meihong

    2017-08-01

    Near-infrared (NIR) spectroscopy with multivariate analysis was used to quantify gallic acid, catechin, albiflorin, and paeoniflorin in Radix Paeoniae Rubra, and the feasibility to classify the samples originating from different areas was investigated. A new high-performance liquid chromatography method was developed and validated to analyze gallic acid, catechin, albiflorin, and paeoniflorin in Radix Paeoniae Rubra as the reference. Partial least squares (PLS), principal component regression (PCR), and stepwise multivariate linear regression (SMLR) were performed to calibrate the regression model. Different data pretreatments such as derivatives (1st and 2nd), multiplicative scatter correction, standard normal variate, Savitzky-Golay filter, and Norris derivative filter were applied to remove the systematic errors. The performance of the model was evaluated according to the root mean square of calibration (RMSEC), root mean square error of prediction (RMSEP), root mean square error of cross-validation (RMSECV), and correlation coefficient (r). The results show that compared to PCR and SMLR, PLS had a lower RMSEC, RMSECV, and RMSEP and higher r for all the four analytes. PLS coupled with proper pretreatments showed good performance in both the fitting and predicting results. Furthermore, the original areas of Radix Paeoniae Rubra samples were partly distinguished by principal component analysis. This study shows that NIR with PLS is a reliable, inexpensive, and rapid tool for the quality assessment of Radix Paeoniae Rubra.

  5. Regulation of chlorogenic acid biosynthesis by hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase in Lonicera japonica.

    PubMed

    Zhang, Jingru; Wu, Minlin; Li, Weidong; Bai, Genben

    2017-12-01

    For many centuries, Lonicera japonica has been used as an effective herb for the treatment of inflammation and swelling because of the presence of bioactive components such as chlorogenic acid (CGA). To clarify the relationship between L. japonica hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase (HQT) gene expression and CGA content, an HQT eukaryotic expression system was constructed using Gateway cloning. L. japonica callus transformed with HQT was obtained using Agrobacterium tumefaciens-mediated transformation. We found a positive correlation between CGA content, determined by High-Performance Liquid Chromatography (HPLC), and the expression of HQT, analyzed by semi-quantitative RT-PCR. This study demonstrates that the HQT gene positively regulates CGA synthesis and lays the foundation for further study into enhancing efficacious components of medicinal plants. Copyright © 2017. Published by Elsevier Masson SAS.

  6. [Effects of traditional tibetan medicine, Fructus Lonicerae microphyllae on phagecytosis and cytokines production of murine macrophages].

    PubMed

    Wang, Ju-Le; Sun, Yang; Zhou, Hui-Ying; Xu, Qiang; Dun, Zhu

    2006-01-01

    To explore the effects of traditional Tibetan medicine, Fructus Lonicerae microphyllae (FLM) on phagecytosis and cytokines production of murine macrophages. The phagecytosis of murine macrophages was analyzed by neutral red phagecytosis assay. The activities of IL-1 and TNF-alpha were measured by biological methods. The mRNA of TNF-alpha and INF-gamma expressed by macrophages was detected by RT-PCR. The phagecytosis of murine macrophages was significantly enhanced by FLM at a concentration from 1 microg x mL(-1) to 100 microg x mL(-1) and the secretions of IL-1, and TNF-alpha from macrophages were markedly induced by FLM. Meanwhile, FLM also increased the expression of TNF-alpha mRNA and INF-gamma mRHA from macrophages in vitro. FLM could promote phagecytosis and cytokines production of murine macrophages.

  7. Antioxidant capacity and phenolic compounds of Lonicerae macranthoides by HPLC-DAD-QTOF-MS/MS.

    PubMed

    Hu, Xin; Chen, Lin; Shi, Shuyun; Cai, Ping; Liang, Xuejuan; Zhang, Shuihan

    2016-05-30

    Lonicerae macranthoides with strong antioxidant activity is commonly used in traditional Chinese medicine and folk tea/beverage. However, detailed information about its antioxidant activity and bioactive compounds is limited. Then at first, we comparatively evaluated total phenolic content (TPC), total flavonoid content (TFC) and antioxidant activities of water extract, petroleum ether, ethyl acetate and n-butanol fractions of L. macranthoides. Ethyl acetate fraction exhibited the highest level of TPC (207.38 mg GAE/g DW), TFC (53.06 mg RE/g DW) and the best DPPH scavenge activity and reducing power. n-Butanol fraction showed the best ABTS(+) and O2(-) scavenging activities. Interestingly, water extract, ethyl acetate and n-butanol fractions showed stronger antioxidant activities than positive control, butylated hydroxytoluene (BHT). After that, thirty-one antioxidant phenolic compounds, including twenty-two phenolic acids and nine flavonoids, were screened by DPPH-HPLC experiment and then identified using HPLC-DAD-QTOF-MS/MS. It is noted that twenty-one compounds (1, 3-4, 6-17, 19, 23, 26, 28-29, and 31), as far as was known, were discovered from L. macranthoide for the first time, and eleven of them (3-4, 10-17, and 23) were reported in Lonicera species for the first time. Results indicated that L. macranthoides could serve as promising source of rich antioxidants in foods, beverages and medicines for health promotion. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Analysis of Three Compounds in Flos Farfarae by Capillary Electrophoresis with Large-Volume Sample Stacking

    PubMed Central

    Hao, Zeng-Yan; Li, Lu; Huang, Ya-yun

    2017-01-01

    The aim of this study was to develop a method combining an online concentration and high-efficiency capillary electrophoresis separation to analyze and detect three compounds (rutin, hyperoside, and chlorogenic acid) in Flos Farfarae. In order to get good resolution and enrichment, several parameters such as the choice of running buffer, pH and concentration of the running buffer, organic modifier, temperature, and separation voltage were all investigated. The optimized conditions were obtained as follows: the buffer of 40 mM NaH2P04-40 mM Borax-30% v/v methanol (pH 9.0); the sample hydrodynamic injection of up to 4 s at 0.5 psi; 20 kV applied voltage. The diode-array detector was used, and the detection wavelength was 364 nm. Based on peak area, higher levels of selective and sensitive improvements in analysis were observed and about 14-, 26-, and 5-fold enrichment of rutin, hyperoside, and chlorogenic acid were achieved, respectively. This method was successfully applied to determine the three compounds in Flos Farfarae. The linear curve of peak response versus concentration was from 20 to 400 µg/ml, 16.5 to 330 µg/mL, and 25 to 500 µg/mL, respectively. The regression coefficients were 0.9998, 0.9999, and 0.9991, respectively. PMID:29056967

  9. A rapid analysis of water for anatoxin a, the unstable toxic alkaloid from Anabaena flos-aquae, the stable non-toxic alkaloids left after bioreduction and a related amine which may be nature's precursor to anatoxin a.

    PubMed

    Smith, R A; Lewis, D

    1987-04-01

    Poisoning of animals by Anabaena Flos-Aquae alkaloid is a common, but sporadic event (1). Anatoxin A is the toxic principle responsible for acute fatalities (2), and tends to disappear along with the toxicity within a few days of the event, thus complicating diagnosis. This report reveals our simplified analytical methodology for Anatoxin A (2-acetyl-9-azabicyclo[4.2.1] non-2,3-ene), for the non-toxic compounds into which it bioreduces, the chair and boat forms of 2-acetyl-9-azabicyclo[4.2.1] nonane, and for an as yet uncharacterized amine C10H15N.

  10. Optimization of extraction of linarin from Flos chrysanthemi indici by response surface methodology and artificial neural network.

    PubMed

    Pan, Hongye; Zhang, Qing; Cui, Keke; Chen, Guoquan; Liu, Xuesong; Wang, Longhu

    2017-05-01

    The extraction of linarin from Flos chrysanthemi indici by ethanol was investigated. Two modeling techniques, response surface methodology and artificial neural network, were adopted to optimize the process parameters, such as, ethanol concentration, extraction period, extraction frequency, and solvent to material ratio. We showed that both methods provided good predictions, but artificial neural network provided a better and more accurate result. The optimum process parameters include, ethanol concentration of 74%, extraction period of 2 h, extraction three times, solvent to material ratio of 12 mL/g. The experiment yield of linarin was 90.5% that deviated less than 1.6% from that obtained by predicted result. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Rapid quantification of multi-components in alcohol precipitation liquid of Codonopsis Radix using near infrared spectroscopy (NIRS).

    PubMed

    Luo, Yu; Li, Wen-Long; Huang, Wen-Hua; Liu, Xue-Hua; Song, Yan-Gang; Qu, Hai-Bin

    2017-05-01

    A near infrared spectroscopy (NIRS) approach was established for quality control of the alcohol precipitation liquid in the manufacture of Codonopsis Radix. By applying NIRS with multivariate analysis, it was possible to build variation into the calibration sample set, and the Plackett-Burman design, Box-Behnken design, and a concentrating-diluting method were used to obtain the sample set covered with sufficient fluctuation of process parameters and extended concentration information. NIR data were calibrated to predict the four quality indicators using partial least squares regression (PLSR). In the four calibration models, the root mean squares errors of prediction (RMSEPs) were 1.22 μg/ml, 10.5 μg/ml, 1.43 μg/ml, and 0.433% for lobetyolin, total flavonoids, pigments, and total solid contents, respectively. The results indicated that multi-components quantification of the alcohol precipitation liquid of Codonopsis Radix could be achieved with an NIRS-based method, which offers a useful tool for real-time release testing (RTRT) of intermediates in the manufacture of Codonopsis Radix.

  12. The radix nasi island flap: a versatile musculocutaneous flap for defects of the eyelids, nose, and malar region.

    PubMed

    Seyhan, Tamer

    2009-03-01

    A versatile musculocutan flap from the radix nasi region, the radix nasi island flap, is described. The flap has an axial blood supply derived from the dorsal nasal branch of the ophthalmic artery which is anastomosed to the terminal branch of the facial artery. The flap includes the skin, subcutaneous tissue, and procerus muscle. Ten patients, aged 50 to 86 years, have been reconstructed with this flap for defects in the nose (in 4 cases), midface (in 4 cases) and lower eyelids (in 2 cases). The mean flap size was 17 x 23 mm (range: 15 x 20 to 20 x 27 mm). All flaps fully survived. Additional complications and morbidity were not observed. The donor sites were closed a primarily closure in all cases. Follow-up ranged from 3 to 12 months (mean: 8.2 months). The radix nasi flap is a safe flap, has minimal donor site morbidity, and is especially suited for nasal and midface reconstruction in terms of attaining a suitable color and thickness.

  13. An Improved LC-MS/MS Method for Simultaneous Determination of the Eleven Bioactive Constituents for Quality Control of Radix Angelicae Pubescentis and Its Related Preparations

    PubMed Central

    Li, Jin; Zhang, Qiu-Hong; He, Jun; Liu, Er-wei; Gao, Xiu-mei; Chang, Yan-xu

    2015-01-01

    An improved LC-MS/MS method was developed for simultaneous determination of eleven bioactive constituents of Radix Angelicae Pubescentis and its related preparations. It was the first report on the quantification of bioactive constituents in different preparations of Radix Angelicae Pubescentis by LC-MS/MS analytical method. These samples were separated with an Agilent Zorbax Extend reversed-phase C18 column (1.8 μm, 4.6 × 100 mm) by linear gradient elution using aqueous ammonium acetate and acetonitrile as mobile phase. The flow rate was 0.3 mL min−1. The eleven bioactive constituents showed good regression (R > 0.990) within test ranges and the recoveries were in the range of 87.1–110%. The limit of detections and quantifications for most of the major constituents were less than 0.5 and 1.0 ng mL−1, respectively. All results indicated that the developed method could be readily utilized as a suitable quality control method for Radix Angelicae Pubescentis and related preparations. PMID:26078992

  14. Identification and comparative quantification of bio-active phthalides in essential oils from si-wu-tang, fo-shou-san, radix angelica and rhizoma chuanxiong.

    PubMed

    Tang, Yuping; Zhu, Min; Yu, Sheng; Hua, Yongqing; Duan, Jin-Ao; Su, Shulan; Zhang, Xu; Lu, Yin; Ding, Anwei

    2010-01-15

    Phthalides are important bio-active constituents in Si-Wu-Tang and Fo-Shou-San, two commonly used Traditional Chinese Medicine (TCM) combined prescriptions mainly derived from Radix Angelica and Rhizoma Chuanxiong. In this paper, the contents of eight phthalides, including Z-ligustilide, E-ligustilide, Z-butylenephthalide, E-butylene-phthalide, 3-butylphthalide, neocnidilide and senkyunolide A were determined or estimated by gas chromatography-mass spectrometry (GC-MS). The results showed GC-MS was a simple, rapid, and high sensitive method for analyzing phthalides in Si-Wu-Tang, Fo-Shou-San, Radix Angelica and Rhizoma Chuanxiong, and the extractable contents of each phthalides including Z-ligustilide, E-ligustilide, Z-butylenephthalide, etc. varied after Radix Angelica, Rhizoma Chuanxiong were combined into a formulation, such as Si-Wu-Tang and Fo-Shou-San. Furthermore, inhibition activity of essential oils from Si-Wu-Tang, Fo-Shou-San, Radix Angelica and Rhizoma Chuanxiong on uterine contraction was tested in an in vitro assay, and the results showed that the activity of the essential oil is higher as the content of the phthalides increase, which demonstrated that phthalides are possibly main active components inhibiting mice uterine contraction in vitro. All of the results suggested that comparative analysis of chemical components and pharmacological activities of each herb and formula is possibly helpful to elucidate the active components in traditional Chinese medicine, and to reveal the compatibility mechanism of TCM formulae.

  15. The potential of three different PCR-related approaches for the authentication of mixtures of herbal substances and finished herbal medicinal products.

    PubMed

    Doganay-Knapp, Kirsten; Orland, Annika; König, Gabriele M; Knöss, Werner

    2018-04-01

    Herbal substances and preparations thereof play an important role in healthcare systems worldwide. Due to the variety of these products regarding origin, composition and processing procedures, appropriate methodologies for quality assessment need to be considered. A majority of herbal substances is administered as multicomponent mixtures, especially in the field of Traditional Chinese Medicine and ayurvedic medicine, but also in finished medicinal products. Quality assessment of complex mixtures of herbal substances with conventional methods is challenging. Thus, emphasis of the present work was directed on the development of complementary methods to elucidate the composition of mixtures of herbal substances and finished herbal medicinal products. An indispensable prerequisite for the safe and effective use of herbal medicines is the unequivocal authentication of the medicinal plants used therein. In this context, we investigated the potential of three different PCR-related methods in the characterization and authentication of herbal substances. A multiplex PCR assay and a quantitative PCR (qPCR) assay were established to analyze defined mixtures of the herbal substances Quercus cortex, Juglandis folium, Aristolochiae herba, Matricariae flos and Salviae miltiorrhizae radix et rhizoma and a finished herbal medicinal product. Furthermore, a standard cloning approach using universal primers targeting the ITS region was established in order to allow the investigation of herbal mixtures with unknown content. The cloning approach had some limitations regarding the detection/recovery of the components in defined mixtures of herbal substances, but the complementary use of two sets of universal primer pairs increased the detection of components out of the mixture. While the multiplex PCR did not retrace all components in the defined mixtures of herbal substances, the established qPCR resulted in simultaneous and specific detection of the five target sequences in all defined mixtures. These data indicate that for authentication purposes, complementary PCR-related methods are highly recommendable for the analysis of herbal mixtures in parallel. Copyright © 2018 Elsevier GmbH. All rights reserved.

  16. Polysaccharides from astragali radix restore chemical-induced blood vessel loss in zebrafish

    PubMed Central

    2012-01-01

    Background Astragali Radix has been used widely for the treatment of cardiovascular and cerebrovascular diseases, and to enhance endurance and stamina in traditional Chinese medicine (TCM) for over 2000 years. The polysaccharide constituents of Astragali Radix (ARP) are considered as one of the major constituents contributing to the multiple pharmacological effects of this medicinal plant. The purpose of the study is to evaluate the vascular regenerative activities of ARPs in a chemically-induced blood vessel loss model in zebrafish. Methods Blood vessel loss was induced in both Tg(fli-1a:EGFP)y1 and Tg(fli-1a:nEGFP)y7 embryos by administration of 300 nM VEGFR tyrosine kinase inhibitor II (VRI) for 3 h at 24 hpf (hour post-fertilization). Then, the blood vessel damaged zebrafish were treated with ARPs for 21 h and 45 h after VRI withdrawal. Morphological changes in intersegmental vessels (ISVs) of zebrafish larvae were observed under the fluorescence microscope and measured quantitatively. The rescue effect of ARPs in the zebrafish models was validated by measuring the relative mRNA expressions of Kdrl, Kdr and Flt-1 using real-time PCR. Results Two polysaccharide fractions, P4 (50000 D < molecular weight & diameter < 0.1 μm) and P5 (molecular diameter > 0.1 μm), isolated from Astragali Radix by ultrafiltration, produced a significant and dose-dependent recovery in VRI-induced blood vessel loss in zebrafish. Furthermore, the down-regulation of Flk-1 and Flt-1 mRNA expression induced by VRI was reversed by treatment with P4. Conclusion The present study demonstrates that P4 isolated from Astragali Radix reduces VRI-induced blood vessel loss in zebrafish. These findings support the hypothesis that polysaccharides are one of the active constituents in Astragali Radix, contributing to its beneficial effect on treatment of diseases associated with a deficiency in angiogenesis. PMID:22357377

  17. The Influence of Compatibility of Rhubarb and Radix Scutellariae on the Pharmacokinetics of Anthraquinones and Flavonoids in Rat Plasma.

    PubMed

    Zhang, Yaqing; Zhang, Zunjian; Song, Rui

    2018-06-01

    Rhubarb-Radix scutellariae is a classic herb pair, which is commonly used to clear away heat and toxin in clinic. The aim of this study was to investigate the influence of compatibility of Rhubarb and Radix scutellariae on the pharmacokinetic behaviors of anthraquinones and flavonoids in rat plasma. Eighteen rats were randomly divided into three groups, and were orally administered Rhubarb and/or Radix scutellariae extracts. A sensitive and rapid UPLC-MS/MS method was developed and validated to determine the concentrations of baicalin, baicalein, wogonside, wogonin, rhein, and emodin in rat plasma. The concentrations of phase II conjugates of flavonoid aglycones and anthraquinone aglycones were also determined after hydrolyzing the plasma with sulfatase. Compared with administration of Radix scutellariae alone, co-administration of Rhubarb significantly decreased the first maximum plasma concentration (C max1 ) of baicalin, wogonside, and the phase II conjugates of baicalein, wogonin to 46.40, 61.27, 41.49, and 20.50%, respectively. The area under the plasma concentration-time curve from time zero to infinity (AUC 0-∞ ) was significantly decreased from 82.60 ± 20.22 to 51.91 ± 7.46 μM·h for rhein and 276.83 ± 98.02 to 175.42 ± 86.82 μM·h for the phase II conjugates of wogonin after compatibility. The time to reach the first maximum plasma concentration (T max1 ) of anthraquinones was shortened and the second peak of anthraquinones disappeared after compatibility. Compatibility of Rhubarb and Radix scutellariae can significantly affect the pharmacokinetic behaviors of characteristic constituents of the two herbs. The cause of these pharmacokinetic differences was further discussed combined with the in vivo ADME (absorption, disposition, metabolism, and excretion) processes of anthraquinones and flavonoids.

  18. Preclinical Evidence of Rapid-Onset Antidepressant-Like Effect in Radix Polygalae Extract

    PubMed Central

    Park, Hyunwoo; Kim, Yoorim; Park, Sung Hyun; Swanberg, Kelley; Shin, Joo-Yeon; Ha, Sang-Kyu; Cho, Yoonju; Bang, Soo-Yong; Lew, Jae-Hwan; Cho, Seung-Hun; Maeng, Sungho

    2014-01-01

    Radix Polygalae (the root of Polygala tenuifolia) is a herb widely used in traditional Asian medicine that is thought to exert a variety of neuropsychiatric effects. Radix Polygalae extract can protect against N-methyl D-aspartate (NMDA) neurotoxicity and induce brain-derived neurotrophic factor (BDNF) expression, suggesting modulatory roles at glutamatergic synapses and possible antidepressant action. In accordance with this hypothesis, Radix Polygalae extract demonstrated antidepressant-like effects in 8-week-old male C57Bl/6 mice by decreasing behavioral despair in the forced swim and tail suspension tasks and increasing hedonic-like behavior in the female urine sniffing test 30 minutes after a single oral administration of 0.1 mg/kg. Reduced latency to acquire a food pellet in the novely suppressed feeding paradigm, without change in anxiety-like behaviors suggested a rapid-onset nature of the antidepressant-like effect. In addition, it decreased the number of failed escapes in the learned helplessness paradigm after two oral administrations 24 hours and 30 minutes before the first test. Finally, it reversed anhedonia as measured by saccharin preference in mice exposed to the chronic stress model after two administrations of 0.1 mg/kg, in contrast to the repeated administration generally needed for similar effect by monoamergic antidepressants. Immobility reduction in tail suspension task was blocked by the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor antagonist NBQX, a pattern previously demonstrated by ketamine and other ketamine-like rapid-onset antidepressants. Also similarly to ketamine, Radix Polygalae appeared to acutely decrease phosphorylation of GluR1 serine-845 in the hippocampus while leaving the phosphorylation of hippocampal mTOR serine 2448 unchanged. These findings serve as preclinical evidence that Radix Polygalae extract exerts rapid-onset antidepressant effects by modulating glutamatergic synapses in critical brain circuits of depression and may be worthy of further evaluation as a safe substitute to other rapid-onset antidepressants known to have unacceptable side effects. PMID:24520403

  19. [Effect of enzymolysis after acid and alkali pretreatment on extraction of tanshinones from Salviae Miltiorrhizae Radix et Rhizoma residues].

    PubMed

    Dai, Xin-Xin; Shen, Fei; Su, Shu-Lan; Zhang, Sen; Guo, Sheng; Jiang, Shu; Qian, Da-Wei; Duan, Jin-Ao

    2016-09-01

    Salviae Miltiorrhizae Radix et Rhizoma residues were pre-treated with acid and alkali, degraded by using cellulose, and the effects of different processing methods on the extraction rate of tanshinones were compared to provide scientific basis for development and utilization of tanshinones from Salviae Miltiorrhizae Radix et Rhizoma residues. The results showed that in the Salviae Miltiorrhizae Radix et Rhizoma residues without pre-treatment, enzymatic hydrolysis time of 4.5 d could make most of the cellulose degraded when the concentration of substrate enzyme concentration was 6 U•mL-1, and the highest glucose concentration was 59.74 mg•g⁻¹. It was found that the best effect was achieved after alkali pre-treatment-cellulose C degradation among the different pre-treatment methods, and the glucose content reached 119.50 mg•g⁻¹, followed by the same concentration of acid pre-treatment-cellulose C degradation. The extraction amount of tanshinone ⅡA was increased by 82.54% after enzyme degradation, with a mass fraction of 2.451 mg•g⁻¹; extraction amount of tanshinone I was increased by 81.82% after enzyme degradation, with a mass fraction of 2.373 mg•g⁻¹; extraction amount of cryptotanshinone was increased by 64.4% after enzyme degradation, with a mass fraction of 1.080 mg•g⁻¹; extraction amount of dihydrotanshinone I was increased by 61.3% after enzyme degradation, with a mass fraction of 0.601 2 mg•g⁻¹. Acid and alkali pre-treatment combined with cellulose degradation could effectively improve the extraction rate of tanshinones from Salviae Miltiorrhizae Radix et Rhizoma residues. This method is operable and practical, and it is beneficial for improving the utilization efficiency of tanshinones (resource based chemicals) from Salviae Miltiorrhizae Radix et Rhizoma residues. Copyright© by the Chinese Pharmaceutical Association.

  20. Toxicity and Detoxification Effects of Herbal Caowu via Ultra Performance Liquid Chromatography/Mass Spectrometry Metabolomics Analyzed using Pattern Recognition Method

    PubMed Central

    Yan, Yan; Zhang, Aihua; Dong, Hui; Yan, Guangli; Sun, Hui; Wu, Xiuhong; Han, Ying; Wang, Xijun

    2017-01-01

    Background: Caowu (Radix Aconiti kusnezoffii, CW), the root of Aconitum kusnezoffii Reichb., has widely used clinically in rheumatic arthritis, painful joints, and tumors for thousands of years. However, the toxicity of heart and central nervous system induced by CW still limited the application. Materials and Methods: Metabolomics was performed to identify the sensitive and reliable biomarkers and to characterize the phenotypically biochemical perturbations and potential mechanisms of CW-induced toxicity, and the detoxification by combinatorial intervention of CW with Gancao (Radix Glycyrrhizae) (CG), Baishao (Radix Paeoniae Alba) (CB), and Renshen (Radix Ginseng) (CR) was also analyzed by pattern recognition methods. Results: As a result, the metabolites were characterized and responsible for pentose and glucuronate interconversions, tryptophan metabolism, amino sugar and nucleotide sugar metabolism, taurine and hypotaurine metabolism, fructose and mannose metabolism, and starch and sucrose metabolism, six networks of which were the same to the metabolic pathways of Chuanwu (Radix Aconiti, CHW) group. The ascorbate and aldarate metabolism was also characterized by CW group. The urinary metabolomics also revealed CW-induced serious toxicity to heart and liver. Thirteen significant metabolites were identified and had validated as phenotypic toxicity biomarkers of CW, five biomarkers of which were commonly owned in Aconitum. The changes of toxicity metabolites obtained from combinatorial intervention of CG, CB, and CR also were analyzed to investigate the regulation degree of toxicity biomarkers adjusted by different combinatorial interventions at 6th month. Conclusion: Metabolomics analyses coupled with pattern recognition methods in the evaluation of drug toxicity and finding detoxification methods were highlighted in this work. SUMMARY Metabolomics was performed to characterize the biochemical potential mechanisms of Caowu toxicityThirteen significant metabolites were identified and validated as phenotypic toxicity biomarkers of CaowuMetabolite changes of toxicity obtained can be adjusted by different combinatorial interventions.Pattern recognition plot reflects the toxicity effects tendency of the urine metabolic fluctuations according to time after treatment of herbal Caowu. Abbreviations used: CW: Caowu (Radix Aconiti kusnezoffii); CHW: Chuanwu (Radix Aconiti); TCM: Traditional Chinese Medicine; CG: Caowu and Gancao; CB: Caowu and Baishao; CR: Caowu and Renshen; QC: Quality control; UPLC: Ultra performance liquid chromatography; MS: Mass spectrometry; PCA: Principal component analysis; PLS-DA: Partial least squares-discriminant analysis; OPLS: Orthogonal projection to latent structures analysis. PMID:29200734

  1. Sub-seasonal oxygen and carbon isotope variations in shells of modern Radix sp. (Gastropoda) from the Tibetan Plateau: potential of a new archive for palaeoclimatic studies

    NASA Astrophysics Data System (ADS)

    Taft, Linda; Wiechert, Uwe; Riedel, Frank; Weynell, Marc; Zhang, Hucai

    2012-02-01

    Carbon and oxygen isotope ratios have been measured for nine aragonite shells of the gastropod genus Radix from the lake Bangda Co (30°29'N, 97°04'E, 4450 m a.s.l.) at the south-eastern edge and from two characteristic sites at the lake Kyaring Co (31°09'N, 88°17'E, 4650 m a.s.l.) on the central Tibetan Plateau. Radix shells were sampled for isotope ratio analysis with high spatial resolution along the ontogenetic spiral of growth providing the basis of isotope records with a sub-seasonal time-resolution. δ18O values of shells from Bangda Co are on average ˜-15.0‰ relative to PDB and the pattern exhibits a clear onset and progression of the summer monsoon precipitation indicated by a strong "amount effect". This pattern mirrors the precipitation pattern in the respective year and region as expected for a small (surface area ca 0.3 km2) and shallow (<5 m) lake or habitat with short water residence times and little evaporative 18O enrichment of the lake water. In contrast, δ18O values of Radix shells from Kyaring Co habitat A which is connected to the deep (several tens of metres) and big (surface area ca 660 km2) lake, average at ˜-13.0‰ consistent with a higher evaporation rate and longer water residence time. The latter is supported by more 18O enriched water in this habitat. The δ18O values of Radix shells from Kyaring Co habitat B are nearly as low as shells from Bangda Co due to the similar habitat characteristic but isotopic patterns of these shells exhibit a weaker "amount effect". In both lake systems δ13C values of the shells are coupled with oxygen isotopes because a large amount of isotopically light carbon is washed from mountain slopes into the lake during the rainy season. Although other processes influence the isotopic patterns, e.g. biological productivity (δ13C) or temperature (δ18O), these influences are minor compared with the monsoon signal or the effect of evaporation in the Radix shell records. The overall weaker amount effect in Radix shells from Kyaring Co habitat B compared with shells from Bangda Co are consistent with a current decreasing monsoon influence from the south-eastern edge towards the central Tibetan Plateau. Thus, fossil shells of the gastropod genus Radix are a valuable archive for reconstructing climatic and environmental changes on the Tibetan Plateau and provide information about former habitat sizes and depths.

  2. Simultaneous determination of bioactive components of Radix Angelicae Sinensis-Radix Paeoniae Alba herb couple in rat plasma and tissues by UPLC-MS/MS and its application to pharmacokinetics and tissue distribution.

    PubMed

    Luo, Niancui; Li, Zhenhao; Qian, Dawei; Qian, Yefei; Guo, Jianming; Duan, Jin-Ao; Zhu, Min

    2014-07-15

    A highly sensitive and rapid ultra performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) has been developed and validated for simultaneous quantification of seven components in rat plasma and five components in rat tissues after oral administration of the extracts of different combination Radix Angelicae Sinensis-Radix Paeoniae Alba herb couple and has been applied to compare the different pharmacokinetics and tissue distribution properties of these bioactive components. The extracts of Radix Angelicae Sinensis (RAS), Radix Paeoniae Alba (RPA) and Radix Angelicae Sinensis-Radix Paeoniae Alba herb couple (RRHC) were orally administrated to rats, respectively. The concentrations of ferulic acid, caffeic acid, vanillic acid, ligustilide, paeoniflorin, albiflorin and oxypaeoniflorin in rat plasma and the concentrations of ferulic acid, vanillic acid, paeoniflorin, albiflorin and oxypaeoniflorin in tissues were determined by UPLC-MS/MS. The plasma samples were pretreated by protein precipitation with methanol and the tissue samples were homogenated with water and pretreated by protein precipitation with methanol. Chromatographic separation was performed on a C18 column using 0.1% formic acid-acetonitrile as mobile phase for gradient elution. A triple quadrupole (TQ) tandem mass spectrometry equipped with an electrospray ionization source was used as detector operating both in positive and negative ionization mode and operated by multiple-reaction monitoring (MRM) scanning. Noncompartmental pharmacokinetic parameters were calculated by DAS 2.0 program. The differences between each group were compared by SPSS 16.0 with Independent-Samples T-test. The pharmacokinetic parameters (such as Cmax, Tmax, T1/2, AUC0-T, MRT0-T, Vz/F or CLz/F) of all the detected components between the single herb (RAS or RPA) and herb pair (RRHP) showed significant differences (P<0.05). It indicated that the compatibility of RAS and RPA could alter the pharmacokinetics features of each component. Tissue distribution results showed that ferulic acid, vanillic acid, paeoniflorin, albiflorin and oxypaeoniflorin mostly distributed in liver and kidney both in herb couple and single herb distributed most in liver and kidney. Compared with single herb, RRHC could increase or decrease the concentrations of five components at different time points compared with the sing herb. The results indicated the method was successfully applied to the comparative study on pharmacokinetics and tissue distribution of different combination of RRHC in rats. The compatibility of two Chinese herbs could alter the pharmacokinetics and tissue distribution properties of major bio-active components in the single herb. The results might be helpful for further investigation of compatibility mechanism of RRHC. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. The effects of wine-processing on ascending and descending: The distribution of flavonoids in rat tissues after oral administration of crude and wine-processed Radix scutellariae.

    PubMed

    Huang, Ping; Tan, Shanzhong; Zhang, Yong-xin; Li, Jun-song; Chai, Chuan; Li, Jin-ji; Cai, Bao-chang

    2014-08-08

    Ascending and descending theory is a core principle of traditional Chinese medicine (TCM) theories. It plays an essential role in TCM clinical applications. Some TCM medicine has specific properties, which could alter the inclination and direction of their actions. The properties of the ascending and floating process of one herbal medicine are affected by means of herb processing. Wine-processing, which is sautéing with rice wine, is one of the most popular technologies of herb processing. Wine-processing increases the inclination and direction of its actions, thereby producing or strengthening their efficacy in cleaning the upper-energizer heat. Radix scutellariae, the dried roots of Scutellaria baicalensis Georgi, is a well-known TCM used for the treatment of inflammation, pyrexia, jaundice, etc. Recently, wine-processed Radix scutellariae was normally applied in clinical studies for the treatment of upper-energizer syndrome. In order to investigate the effects of wine-processing on ascending and descending of Radix scutellariae, the comparative study of distribution of flavonoids in rat tissues of triple energizers (SanJiao-upper, middle, lower jiao) after oral administration of crude and wine-processed Radix scutellariae aqueous extracts was carried out. The rats were randomly assigned to two groups and orally administered with crude and wine-processed Radix scutellariae aqueous extracts, respectively. At different pre-determined time points after administration, the concentrations of compounds in rat tissue homogenate were determined, and the main tissue pharmacokinetic parameters were investigated. Tissue pharmacokinetic parameters including AUC0-t, t1/2, Tmax and Cmax were calculated using DAS 2.0. An unpaired Student t-test was used to compare the differences in tissue pharmacokinetic parameters between the two groups. All the results were expressed as arithmetic mean±S.D. The parameters of Cmax and AUC0-t of some flavonoids in wine-processed Radix scutellariae were remarkably increased (p<0.05, p<0.01, p<0.001) in the rat upper-energizer tissues (lung and heart) compared with those of the crude group. However, in the rat middle- and lower-energizer tissues (spleen, liver and kidney), the Cmax and AUC0-t of some flavonoids were significantly decreased (p<0.05, p<0.01) compared with the crude group. The main explanation for these differences seems to the effects of wine-processing on ascending and descending theory. All of these differences in the distribution of triple energizers after oral administration of crude and wine-processed Radix scutellariae aqueous extracts may lead to the increase of efficacy on the upper-energizer tissues and were in compliance with the ascending and descending theory. Therefore, wine-processing was recommended when Radix scutellariae was used for cleaning the upper-energizer heat and humidity. The obtained knowledge can be used to evaluate the impact of these differences on the efficacy of both the drugs in clinical applications and might be helpful in explaining the effects of wine-processing on ascending and descending theory. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. A review of the phylogeny, ecology and toxin production of bloom-forming Aphanizomenon spp. and related species within the Nostocales (cyanobacteria).

    PubMed

    Cirés, Samuel; Ballot, Andreas

    2016-04-01

    The traditional genus Aphanizomenon comprises a group of filamentous nitrogen-fixing cyanobacteria of which several memebers are able to develop blooms and to produce toxic metabolites (cyanotoxins), including hepatotoxins (microcystins), neurotoxins (anatoxins and saxitoxins) and cytotoxins (cylindrospermopsin). This genus, representing geographically widespread and extensively studied cyanobacteria, is in fact heterogeneous and composed of at least five phylogenetically distant groups (Aphanizomenon, Anabaena/Aphanizomenon like cluster A, Cuspidothrix, Sphaerospermopsis and Chrysosporum) whose taxonomy is still under revision. This review provides a thorough insight into the phylogeny, ecology, biogeography and toxicogenomics (cyr, sxt, and ana genes) of the five best documented "Aphanizomenon" species with special relevance for water risk assessment: Aphanizomenon flos-aquae, Aphanizomenon gracile, Cuspidothrix issatschenkoi, Sphaerospermopsis aphanizomenoides and Chrysosporum ovalisporum. Aph. flos-aquae, Aph. gracile and C. issatschenkoi have been reported from temperate areas only whereas S. aphanizomenoides shows the widest distribution from the tropics to temperate areas. Ch. ovalisporum is found in tropical, subtropical and Mediterranean areas. While all five species show moderate growth rates (0.1-0.4day -1 ) within a wide range of temperatures (15-30°C), Aph. gracile and A. flos-aquae can grow from around (or below) 10°C, whereas Ch. ovalisporum and S. aphanizomenoides are much better competitors at high temperatures over 30°C or even close to 35°C. A. gracile has been confirmed as the producer of saxitoxins and cylindrospermopsin, C. issatschenkoi of anatoxins and saxitoxins and Ch. ovalisporum of cylindrospermopsin. The suspected cylindrospermopsin or anatoxin-a production of A. flos-aquae or microcystin production of S. aphanizomenoides is still uncertain. This review includes a critical discussion on the the reliability of toxicity reports and on the invasive potential of "Aphanizomenon" species in a climate change scenario, together with derived knowledge gaps and research needs. As a whole, this work is intended to represent a key reference for scientists and water managers involved in the major challenges of identifying, preventing and mitigating toxic Aphanizomenon blooms. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. In vivo effects of Aphanizomenon flos-aquae DC-1 aphantoxins on gas exchange and ion equilibrium in the zebrafish gill.

    PubMed

    Zhang, Delu; Liu, Siyi; Zhang, Jing; Zhang, Jian Kong; Hu, Chunxiang; Liu, Yongding

    2016-08-01

    Aphantoxins, neurotoxins or paralytic shellfish poisons (PSPs) generated by Aphanizomenon flos-aquae, are a threat to environmental safety and human health in eutrophic waters worldwide. The molecular mechanisms of neurotoxin function have been studied; however, the effects of these neurotoxins on oxidative stress, ion transport, gas exchange, and branchial ultrastructure in fish gills are not fully understood. Aphantoxins extracted from A. flos-aquae DC-1 were detected by high-performance liquid chromatography. The major ingredients were gonyautoxins 1 and 5 and neosaxitoxin, which comprised 34.04%, 21.28%, and 12.77% of the total, respectively. Zebrafish (Danio rerio) were administered A. flos-aquae DC-1 aphantoxins at 5.3 or 7.61μg saxitoxin equivalents (eq)/kg (low and high doses, respectively) by intraperitoneal injection. The activities of Na(+)-K(+)-ATPase (NKA), carbonic anhydrase (CA), and lactate dehydrogenase (LDH), ultrastructural alterations in chloride and epithelial cells, and reactive oxygen species (ROS) and total antioxidative capacity (T-AOC) were investigated in the gills during the first 24h after exposure. Aphantoxins significantly increased the level of ROS and decreased the T-AOC in zebrafish gills from 3 to 12h post-exposure, suggesting an induction of oxidative stress and inhibition of antioxidant capacity. Reduced activities of NKA and CA demonstrated abnormal ion transport and gas exchange in the gills of aphantoxin-treated fish. Toxin administration also resulted in increased LDH activity and ultrastructural alterations in chloride and epithelial cells, suggesting a disruption of function and structure in zebrafish gills. The observed abnormalities in zebrafish gills occurred in a time- and dose-dependent manner. These findings demonstrate that aphantoxins or PSPs may inhibit ion transport and gas exchange, increase LDH activity, and result in ultrastructural damage to the gills through elevations in oxidative stress and reduced antioxidant capacity. These effects of aphantoxins in the gills of zebrafish suggest an induction of respiratory toxicity. The parameters investigated in this study may be also considered as biomarkers for studying aphantoxin/PSP exposure and cyanobacterial blooms in nature. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. [Study on extraction and purification process of total ginsenosides from Radix Ginseng].

    PubMed

    Xie, Li-Ling; Ren, Li; Lai, Xian-Sheng; Cao, Jun-Hui; Mo, Quan-Yi; Chen, Wei-Wen

    2009-10-01

    To optimize the technological parameters of the extraction and purification process of total ginsenosides from Radix Ginseng. With the contents of ginsenoside Rg1, ginsenoside Re and ginsenoside Rb1, the orthogonal design was adopted to optimize the extraction process. The purification process was studied by optimizing the elutive ratio of total ginsenosides as the marker. HPLC and spectrophotometer were employed for the study. The optimum conditions were as follows:Using 8 times volume of 75% ethanol extracting for 120 minutes and 2 times, the extraction temperature was 85 degrees C. AB-8 macroporous resin was selected, and the eluant was 4 BV 70% ethanol. The optimal conditions of extracting and purifying the total ginsenosides from Radix Ginseng is feasible.

  7. Unbiased metabolite profiling by liquid chromatography-quadrupole time-of-flight mass spectrometry and multivariate data analysis for herbal authentication: classification of seven Lonicera species flower buds.

    PubMed

    Gao, Wen; Yang, Hua; Qi, Lian-Wen; Liu, E-Hu; Ren, Mei-Ting; Yan, Yu-Ting; Chen, Jun; Li, Ping

    2012-07-06

    Plant-based medicines become increasingly popular over the world. Authentication of herbal raw materials is important to ensure their safety and efficacy. Some herbs belonging to closely related species but differing in medicinal properties are difficult to be identified because of similar morphological and microscopic characteristics. Chromatographic fingerprinting is an alternative method to distinguish them. Existing approaches do not allow a comprehensive analysis for herbal authentication. We have now developed a strategy consisting of (1) full metabolic profiling of herbal medicines by rapid resolution liquid chromatography (RRLC) combined with quadrupole time-of-flight mass spectrometry (QTOF MS), (2) global analysis of non-targeted compounds by molecular feature extraction algorithm, (3) multivariate statistical analysis for classification and prediction, and (4) marker compounds characterization. This approach has provided a fast and unbiased comparative multivariate analysis of the metabolite composition of 33-batch samples covering seven Lonicera species. Individual metabolic profiles are performed at the level of molecular fragments without prior structural assignment. In the entire set, the obtained classifier for seven Lonicera species flower buds showed good prediction performance and a total of 82 statistically different components were rapidly obtained by the strategy. The elemental compositions of discriminative metabolites were characterized by the accurate mass measurement of the pseudomolecular ions and their chemical types were assigned by the MS/MS spectra. The high-resolution, comprehensive and unbiased strategy for metabolite data analysis presented here is powerful and opens the new direction of authentication in herbal analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Response of cellular stoichiometry and phosphorus storage of the cyanobacteria Aphanizomenon flos-aquae to small-scale turbulence

    NASA Astrophysics Data System (ADS)

    Li, Zhe; Xiao, Yan; Yang, Jixiang; Li, Chao; Gao, Xia; Guo, Jinsong

    2017-11-01

    Turbulent mixing, in particular on a small scale, affects the growth of microalgae by changing diffusive sublayers and regulating nutrient fluxes of cells. We tested the nutrient flux hypothesis by evaluating the cellular stoichiometry and phosphorus storage of microalgae under different turbulent mixing conditions. Aphanizomenon flos-aquae were cultivated in different stirring batch reactors with turbulent dissipation rates ranging from 0.001 51 m2/s3 to 0.050 58 m2/s3, the latter being the highest range observed in natural aquatic systems. Samples were taken in the exponential growth phase and compared with samples taken when the reactor was completely stagnant. Results indicate that, within a certain range, turbulent mixing stimulates the growth of A. flos-aquae. An inhibitory effect on growth rate was observed at the higher range. Photosynthesis activity, in terms of maximum effective quantum yield of PSII (the ratio of F v/ F m) and cellular chlorophyll a, did not change significantly in response to turbulence. However, Chl a/C mass ratio and C/N molar ratio, showed a unimodal response under a gradient of turbulent mixing, similar to growth rate. Moreover, we found that increases in turbulent mixing might stimulate respiration rates, which might lead to the use of polyphosphate for the synthesis of cellular constituents. More research is required to test and verify the hypothesis that turbulent mixing changes the diffusive sublayer, regulating the nutrient flux of cells.

  9. Simultaneous analysis and retention behavior of major isoflavonoids in Radix Puerariae lobatae and Radix Puerariae thomsonii by high performance liquid chromatography with cyclodextrins as a mobile phase modifier.

    PubMed

    Zeng, Aiguo; Xing, Jianfeng; Wang, Changhe; Song, Jie; Li, Cong; Yang, Xin; Yang, Guangde

    2012-01-27

    In order to differentiate two species of Radix Puerariae (Radix Puerariae lobatae and Radix Puerariae thomsonii) and to determine major isoflavonoids (puerarin, daidzin, daidzein and genistein) in the samples, a simple high performance liquid chromatography (HPLC) method with isocratic elution employing cyclodextrins (CDs) as mobile phase additives was developed. Various factors affecting the retention of isoflavonoids in the C(18) reversed-phase column, such as the nature of CDs, the concentration of hydroxypropyl-β-cyclodextrin (HP-β-CD) and the methanol percentage in the mobile phase, were studied. Experimental results confirmed that HP-β-CD, as a very effective mobile phase additive, could markedly reduce the retention of isoflavonoids, especially daidzein and genistein. The elution of four isoflavonoids could be achieved on a Kromasil(®) C(18) column within 56 min by using the methanol-water contained 5 mM HP-β-CD (25/75, v/v) mixture as the mobile phase. The formation of the inclusion complexes between isoflavonoids and HP-β-CD explained the modification of the retention of analytes. The apparent formation constants determined by HPLC confirmed that the stoichiometry of HP-β-CD-isoflavonoid complexes was 1:1, and the stability of the complexes depended on the size and property of isoflavonoids. The optimized method was successfully applied for the simultaneous determination of major isoflavonoids in P. lobatae and P. thomsonii samples. This work provides a useful method for the analysis of traditional Chinese herbs. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Semicustom integrated circuits and the standard transistor array radix (STAR)

    NASA Technical Reports Server (NTRS)

    Edge, T. M.

    1977-01-01

    The development, application, pros and cons of the semicustom and custom approach to the integration of circuits are described. Improvements in terms of cost, reliability, secrecy, power, and size reduction are examined. Also presented is the standard transistor array radix, a semicustom approach to digital integrated circuits that offers the advantages of both custom and semicustom approaches to integration.

  11. Sodium dithionite-enhanced quality of radix scutellariae through modification of secondary metabolism

    PubMed Central

    Huimin, Guo; Xiaoying, Fu; Hongwei, Du; Wei, Cong; Xiangcai, Meng

    2016-01-01

    Introduction: The quality of radix scutellariae is particularly associated with environmental stresses, but detailed mechanisms remained unclear. Plant under unfavorable situation generates redundant reactive oxygen species (ROS), and ROS can modify the secondary metabolism. The varied quality of radix scutellariae could be explained by ROS. Materials and Methods: .004, 0.4, and 40 μmol/L of sodium dithionite (Na2S2O4), a material producing ROS, were applied to Scutellaria baicalensis to mimic unfavorable situation. The relationship between ROS, antioxidant enzymes activity, and secondary metabolite was investigated. Results: ROS level fails to rise due to both the antioxidase and the secondary metabolites. The activities of both superoxide dismutase and catalase in the roots of S. baicalensis showed a moderately improvement, meanwhile the phenylalanine ammonia lyase was strongly expressed, and the biosynthesis of flavonoids was heavily elevated. Although the glycosides such as baicalin and wogonoside changed little, the aglycones with the highest effective, such as baicalein and wogonin, were increased by approximately 50%-100%. Conclusion: This is very valuable in insight into the stress physiology and provides a strong tool to enhance the quality of radix scutellariae. PMID:28123992

  12. Discrimination and chemical characterization of different Paeonia lactifloras (Radix Paeoniae Alba and Radix Paeoniae Rubra) by infrared macro-fingerprint analysis-through-separation

    NASA Astrophysics Data System (ADS)

    Wang, Yang; Wang, Ping; Xu, Changhua; Sun, Suqin; Zhou, Qun; Shi, Zhe; Li, Jin; Chen, Tao; Li, Zheng; Cui, Weili

    2015-11-01

    Paeonia lactiflora, a commonly used herbal medicine (HM) in Traditional Chinese Medicine (TCM), mainly has two species, Radix Paeoniae Alba (RPA) and Radix Paeoniae Rubra (RPR), for different clinical applications in TCM. For expounding the chemical profile of RPA and RPR and ensuring the clinical efficacy and safety, an infrared macro-fingerprint analysis-through-separation method integrated with statistical pattern recognition was developed to analyze and discriminate the two Paeonia lactifloras. In IR spectra, the major difference between the two was in the range of 1200-900 cm-1: the strongest peak of RPA was at 1024 cm-1, while that of RPR was 1049 cm-1. The difference was magnified in second derivative spectra. The findings were further verified by investigating the separation process of total glucosides, stepwisely monitored by both of IR and UPLC-MS/MS. Simultaneously, the aqueous extracts of RPA and RPR had been separated continuously to acquire the comprehensively hierarchical chemical characteristics for undoubtedly identification and subsequently discrimination of the two herbs. Moreover, 60 batches of the two HMs (30 for each) were objectively classified by principal component regression (PCR) model based on IR macro-fingerprints.

  13. Application of Fourier transform near-infrared spectroscopy combined with high-performance liquid chromatography in rapid and simultaneous determination of essential components in crude Radix Scrophulariae.

    PubMed

    Li, Xiaomeng; Fang, Dansi; Cong, Xiaodong; Cao, Gang; Cai, Hao; Cai, Baochang

    2012-12-01

    A method is described using rapid and sensitive Fourier transform near-infrared spectroscopy combined with high-performance liquid chromatography-diode array detection for the simultaneous identification and determination of four bioactive compounds in crude Radix Scrophulariae samples. Partial least squares regression is selected as the analysis type and multiplicative scatter correction, second derivative, and Savitzky-Golay filter were adopted for the spectral pretreatment. The correlation coefficients (R) of the calibration models were above 0.96 and the root mean square error of predictions were under 0.028. The developed models were applied to unknown samples with satisfactory results. The established method was validated and can be applied to the intrinsic quality control of crude Radix Scrophulariae.

  14. [Determination of metal elements in Achyranthis bidentatae radix from various habitats].

    PubMed

    Tu, Wan-Qian; Zhang, Liu-Ji

    2011-12-01

    To establish an atomic absorption spectrometry method for determination of the contents of metal elements in Achyranthis Bidentatae Radix and analyze 21 batches of samples from different areas. Fe, Mn, Ca, Mg, K, Zn and Cu were detected by atomic absorption spectrometry with hydrogen flame detector, Pb, As and Cd were detected by graphite furnace atomic absorption, Hg was detected by cold atomic absorption. The heavy metal contents met the requirement of Chinese Pharmacopoeia. The contents of K, Mg, Cu and Mn in the samples of geo-authentic areas were higher,while the contents of Fe, Zn, Hg and Pb in the samples of non-authentic areas were higher. This method is sample, accurate, repeatable and could be used to evaluate the quality of Achyranthis Bidentatae Radix.

  15. [Comparison of sulfur fumigation processing and direct hot air heating technology on puerarin contents and efficacy of Puerariae Thomsonii Radix].

    PubMed

    Yu, Hong-Li; Zhang, Qian; Jin, Yang-Ping; Wang, Kui-Long; Lu, Tu-Lin; Li, Lin

    2016-07-01

    In order to compare the effect of sulfur fumigation processing and direct hot air heating technology on puerarin contents and efficacy of Puerariae Thomsonii Radix, the fresh roots of Pueraria thomsonii were cut into small pieces and prepared into direct sunshine drying samples, direct hot air drying samples, and sulfur fumigation-hot air drying samples. Moisture contents of the samples were then determined. The puerarin contents of different samples were compared by HPLC method. Moreover, the models of drunkenness mice were established, and then with superoxide dismutase (SOD) content as the index, aqueous decoction extracts of Puerariae Thomsonii Radix samples with sulfur fumigation processing and non-sulfur fumigation processing methods were administrated by ig; the effects of sulfur fumigation on contents of SOD in mice liver and serum were determined, and the sulfur fumigation samples and non-sulfur fumigation samples were investigated for moth and mildew under different packaging and storage conditions. Results showed that the sulfur fumigation samples significantly changed the puerarin content from Puerariae Thomsonii Radix. The content of puerarin was decreased gradually when increasing the times of sulfur fumigation and amount of sulfur. SOD content in drunken mice liver and serum was significantly decreased when increasing the times of sulfur fumigation, showing significant difference with both direct sunshine drying group and direct hot air drying group. Moth and mildew were not found in the sulfur fumigation samples and direct hot air drying samples whose moisture contents were lower than the limit in Pharmacopoeia. Research showed that sulfur fumigation can significantly reduce the content of main active ingredients and reduce the efficacy of Puerariae Thomsonii Radix, indicating that the quality of Puerariae Thomsonii Radix was significantly decreased after sulfur fumigation. However, the contents of the main active ingredients, efficacy and storage results of the direct hot air drying samples were similar to those in direct sunshine drying samples, so the hot air drying process was a nice drying technology which could be promoted for use. Copyright© by the Chinese Pharmaceutical Association.

  16. [Simultaneous determination of seven alkaloids and three flavonoids in Sophorae Tonkinensis Radix et Rhizoma by HPLC].

    PubMed

    Han, Fu-Man; Wang, Li-Xin; Chen, Ying; Chen, Liang-Mian; Feng, Wei-Hong; Wang, Jin-Yu; Liu, De-Wen; You, Yun; Tong, Yan

    2016-12-01

    In this study, an HPLC method was developed for simultaneous determination of seven alkaloids (cytosine, oxymatrine, N-oxysophocarpine, N-methylcytisine, sophoranol, matrine, and sophocarpine) and three flavonoids (trifolirhizin, fermononetin, and maackiain) from different samples of Sophorae Tonkinensis Radix et Rhizoma. Samples were analyzed on a Welch XtimateTM C₁₈ column (4. 6 mm× 250 mm, 5 μm) eluted with the mobile phase of acetonitrile (A) and 0.01 mol•L⁻¹ ammonium acetate solution (pH 8.0) (B) in a linear gradient mode as follows: 0-20 min,4%-14% A;20-30 min,14%-25% A;30-45 min,25%-40% A;45-65 min,40%-55% A;65-75 min,55% A. The flow rate of the mobile phase, the column temperature, and the PDA detector wavelength were set at 1.0 mL•min⁻¹, 30 ℃, and 225 nm, respectively. For the method validation, these ten compounds showed good separation and satisfactory linearity (r≥0.999 7) within the concentration ranges tested. The mean recoveries were in the range of 98.60% to 102.6% with the RSD (n=6) between 0.60% and 3.7%. This method was proved to be simple, accurate and repeatable. The quantitative results showed that there were significant differences in the contents of seven alkaloids and three flavonoids among the different samples. This result revealed that the quality of Sophorae Tonkinensis Radix et Rhizoma varied widely. This method could be used for the simultaneous determination of the multi-ingredients from Sophorae Tonkinensis Radix et Rhizoma, which might provide scientific evidences to evaluate/control the quality of Sophorae Tonkinensis Radix et Rhizoma, comprehensively. Copyright© by the Chinese Pharmaceutical Association.

  17. Simultaneous determination of chromones and coumarins in Radix Saposhnikoviae by high performance liquid chromatography with diode array and tandem mass detectors.

    PubMed

    Kim, Min Kyung; Yang, Dong-Hyug; Jung, Mihye; Jung, Eun Ha; Eom, Han Young; Suh, Joon Hyuk; Min, Jung Won; Kim, Unyong; Min, Hyeyoung; Kim, Jinwoong; Han, Sang Beom

    2011-09-16

    Methods using high performance liquid chromatography with diode array detection (HPLC-DAD) and tandem mass spectrometry (HPLC-MS/MS) were developed and validated for the simultaneous determination of 5 chromones and 6 coumarins: prim-O-glucosylcimifugin (1), cimifugin (2), nodakenin (3), 4'-O-β-d-glucosyl-5-O-methylvisamminol (4), sec-O-glucosylhamaudol (5), psoralen (6), bergapten (7), imperatorin (8), phellopterin (9), 3'-O-angeloylhamaudol (10) and anomalin (11), in Radix Saposhnikoviae. The separation conditions for HPLC-DAD were optimized using an Ascentis Express C18 (4.6 mm×100 mm, 2.7 μm particle size) fused-core column. The mobile phase was composed of 10% aqueous acetonitrile (A) and 90% acetonitrile (B) and the elution was performed under a gradient mode at a flow rate of 1.0 mL/min. The detection wavelength was set at 300 nm. The HPLC-DAD method yielded a base line separation of the 11 components in 50% methanol extract of Radix Saposhnikoviae with no interfering peaks detected. The HPLC-DAD method was validated in terms of linearity, accuracy and precision (intra- and inter-day), limit of quantification (LOQ), recovery, and robustness. Specific determination of the 11 components was also accomplished by a triple quadrupole tandem mass spectrometer equipped with an electrospray ionization (ESI) source. This HPLC-MS/MS method was also validated by determining the linearity, limit of quantification, accuracy, and precision. Quantification of the 11 components in 51 commercial Radix Saposhnikoviae samples was successfully performed using the developed HPLC-DAD method. The identity, batch-to-batch consistency, and authenticity of Radix Saposhnikoviae were successfully monitored by the proposed HPLC-DAD and HPLC-MS/MS methods. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Simultaneous separation and determination of praeruptorin A, B and C by micellar electrokinetic chromatography using sodium dodecyl sulphate and sodium cholate as mixed micelles.

    PubMed

    Chen, Meng; Chang, Ruimiao; Xu, Liying; Huang, Yayun; Zhang, Hongfen; Chen, Anjia

    2018-02-02

    Praeruptorin A, B and C are major bioactive constituents in Peucedani Radix. They display anti-inflammatory effect, anti-hypertension effect, antiplatelet aggregation, potential anti-cancer activities and so on. They are worthy of investigation as potentially novel and versatile drugs. To develop a method using micellar electrokinetic chromatography (MEKC) for the application in simultaneously separation and determination of praeruptorin A, B and C from Peucedani Radix and its medicinal preparations. Method optimisation was carried out by investigating influences of significant factors on the separation. The method was subjected to validation. The determination of praeruptorin A, B and C in Peucedani Radix and its drug formulations was accomplished by the developed method. The optimal separation condition was 20 mM borate buffer containing 40 mM sodium cholate (SC), 22 mM sodium dodecyl sulphate (SDS) and 25% (v/v) acetonitrile (pH 10.00); 15 kV of voltage; 25°C of temperature; detection at 224 nm. Under this condition, three analytes were baseline separated within 16 min. A good linearity was obtained with correlation coefficients from 0.9988 to 0.9995. The limits of detection (LODs) and limits of quantitation (LOQs) ranged from 0.50 to 0.80 μg/mL and from 1.50 to 2.50 μg/mL, respectively. The recoveries ranged between 95.3% and 103.4%. The proposed method has been successfully applied to the simultaneous determination of praeruptorin A, B and C in Peucedani Radix and its pharmaceutical preparations. Additionally, it could be a potential alternative to the quality control of Peucedani Radix. Copyright © 2018 John Wiley & Sons, Ltd.

  19. Use of HPLC for the detection of iron chelators in cultures of bacteria, fungi, and algae. [E. coli; Bacillus megaterium; Ustilago sphaerogena; Anabaena flos-aqua

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyer, G.L.; Speirs, R.J.; Morse, P.D.

    1990-06-01

    Iron is essential for the growth of living cells. To meet biochemical needs, microorganisms, including algae, produce high affinity chelators termed siderophores. These compounds solubilize Fe and increase its bioavailability. We have developed a new method to study siderophore formation in cultured and natural environments. Based on the fact siderophores tightly bind 55-Fe, the radioactive complexes can be separated by HPLC using an inert PRP-1 column and detected by scintillation counting. This method cleanly resolves several known siderophores, including ferrichrome A, ferrichrome, desferal, and rhodotorulic acid. The optimization of the method and its use for analysis of siderophore formation inmore » bacteria (E. coli, and Bacillus megaterium), fungi (Ustilago sphaerogena), and cyanobacteria (Anabaena flos-aqua UTEX 1444 and Anabaena sp. ATCC 27898) will be presented.« less

  20. Toxicity of volcanic-ash leachate to a blue-green alga. Results of a preliminary bioassay experiment

    USGS Publications Warehouse

    McKnight, Diane M.; Feder, G.L.; Stiles, E.A.

    1981-01-01

    To assess the possible effects of volcanic ash from the May 18,1980, eruption of Mt. St. Helens, Washington, on aquatic ecosystems, we conducted a bioassay experiment with a blue-green alga, Anabaena flos-aquae. Results showed that leachate (obtained by leaching 151 g of ash with 130 mL of simulated freshwater) was lethal to Anabaena flos-aquae cultures when diluted as much as 1:100 with culture medium. Cultures exposed to a 1:500 dilution grew, but a toxic effect was indicated by abnormalities in the Anabaena filaments. This study indicates that ash from the Mt. St. Helens volcano could have an effect on aquatic ecosystems in the areas of significant ashfall. Further study is needed to determine the toxic chemical constituents in the ash and also its possible effects on other aquatic organisms.

  1. Effect of lithium salts addition on the ionic liquid based extraction of essential oil from Farfarae Flos.

    PubMed

    Li, Zhen-Yu; Zhang, Sha-Sha; Jie-Xing; Qin, Xue-Mei

    2015-01-01

    In this study, an ionic liquids (ILs) based extraction approach has been successfully applied to the extraction of essential oil from Farfarae Flos, and the effect of lithium chloride was also investigated. The results indicated that the oil yields can be increased by the ILs, and the extraction time can be reduced significantly (from 4h to 2h), compared with the conventional water distillation. The addition of lithium chloride showed different effect according to the structures of ILs, and the oil yields may be related with the structure of cation, while the chemical compositions of essential oil may be related with the anion. The reduction of extraction time and remarkable higher efficiency (5.41-62.17% improved) by combination of lithium salt and proper ILs supports the suitability of the proposed approach. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Typical ultraviolet spectra in combination with diagnostic mass fragmentation analysis for the rapid and comprehensive profiling of chlorogenic acids in the buds of Lonicera macranthoides.

    PubMed

    Zhang, Shui-Han; Hu, Xin; Shi, Shu-Yun; Huang, Lu-Qi; Chen, Wei; Chen, Lin; Cai, Ping

    2016-05-01

    A major challenge of profiling chlorogenic acids (CGA) in natural products is to effectively detect unknown or minor isomeric compounds. Here, we developed an effective strategy, typical ultraviolet (UV) spectra in combination with diagnostic mass fragmentation analysis based on HPLC-DAD-QTOF-MS/MS, to comprehensively profile CGA in the buds of Lonicera macranthoides. First, three CGA UV patterns were obtained by UV spectra screening. Second, 13 types of CGA classified by molecular weights were found by thorough analysis of CGA peaks using high-resolution MS. Third, selected ion monitoring (SIM) was carried out for each type of CGA to avoid overlooking of minor ones. Fourth, MS/MS spectra of each CGA were investigated. Then 70 CGA were identified by matching their UV spectra, accurate mass signals and fragmentation patterns with standards or previously reported compounds, including six caffeoylquinic acids (CQA), six diCQA, one triCQA, three caffeoylshikimic acids (CSA), six diCSA, one triCSA, three p-coumaroylquinic acids (pCoQA), four p-coumaroylcaffeoylquinic acids (pCoCQA), four feruloylquinic acids (FQA), five methyl caffeoylquinates (MCQ), three ethyl caffeoylquinates (ECQ), three dimethoxycinnamoylquinic acids (DQA), six caffeoylferuloylquinic acids (CFQA), six methyl dicaffeoylquinates (MdiCQ), four FQA glycosides (FQAG), six MCQ glycosides (MCQG), and three ethyl dicaffeoylquinates (EdiCQ). Forty-five of them were discovered from Lonicera species for the first time, and it is noted that CGA profiles were investigated for the first time in L. macranthoides. Results indicated that the developed method was a useful approach to explore unknown and minor isomeric compounds from complex natural products.

  3. Molecular and morphological characterization of the cercariae of Lecithodendrium linstowi (Dollfus, 1931), a trematode of bats, and incrimination of the first intermediate snail host, Radix balthica.

    PubMed

    Enabulele, Egie E; Lawton, Scott P; Walker, Anthony J; Kirk, Ruth S

    2018-03-01

    Lecithodendrium linstowi is one of the most prevalent and abundant trematodes of bats, but the larval stages and intermediate hosts have not been identified. We present the first molecular and morphological characterization of the cercariae of L. linstowi based on a phylogenetic analysis of partial fragments of LSU and ITS2 rDNA. The first intermediate host was incriminated as Radix balthica by DNA barcoding using cox1 and ITS2 sequences, although the snail morphologically resembled Radix peregra, emphasizing the requirement for molecular identification of lymnaeids as important intermediate hosts of medical and veterinary impact. The application of molecular data in this study has enabled linkage of life cycle stages and accurate incrimination of the first intermediate host.

  4. [Application of relative quality constant in grades evaluation of Glycyrrizae Radix et Rhizome pieces].

    PubMed

    Deng, Zhe; Jiao, Meng-Jiao; Zhang, Jun; Xian, Jing; Zhang, Qing; Chen, Chang; Wang, Yue-Sheng; Liu, An

    2017-07-01

    Quality constant evaluation is a comprehensive method for grades evaluation of traditional Chinese medicine pieces, but when it comes to Glycyrrizae Radix et Rhizome pieces, grades evaluation is diverged due to significant difference in contents of liquiritin and glycyrrhizic acid and unreasonable weight of index. To solve this problem, we have established a relative quality constant method in this paper to evaluate grades of Glycyrrizae Radix et Rhizome pieces. Twenty-nine batches of different quality samples were collected and tested, and finally, 17 batches of them were chosen as researcher objects. The results revealed that the range of the relative quality constant of these samples was from 1.78 to 11.49. When Glycyrrizae Radix et Rhizome pieces are divided into three grades: the relative quality constant of first grade is greater than or equal to 9.19; the second grade is greater than or equal to 5.75 but less than 9.19; while the third grade is less than 5.75. This research indicates that relative quality constant can divide the grades of herbal pieces in a scientific, reasonable, objective and specific way and remedy the shortage of quality constant perfectly. It provides a novel mode for grading pieces of Chinese medicine that contains multi-target ingredients. Copyright© by the Chinese Pharmaceutical Association.

  5. Toxicological safety and stability of the components of an irradiated Korean medicinal herb, Paeoniae Radix

    NASA Astrophysics Data System (ADS)

    Yu, Young-Beob; Jeong, Ill-Yun; Park, Hae-Ran; Oh, Heon; Jung, Uhee; Jo, Sung-Kee

    2004-09-01

    As utilization of medicinal herbs in food and bio-industry increases, mass production and the supply of herbs with a high quality are required. As the use of fumigants and preservatives for herbs is being restricted, safe hygienic technologies are demanded. To consider the possibility of the application of irradiation technology for this purpose, the genotoxicological safety and stability of the active components of the γ-irradiated Paeoniae Radix were studied. The herb was irradiated with γ-rays at a practical dosage of 10 kGy, and then it was extracted with hot water. The genotoxicity of the extract of the irradiated herb was examined in two short-term in vitro tests: (1) Ames test in Salmonella typhimurium; (2) Micronucleus test in cultured Chinese hamster ovary (CHO) cells. The extract of the irradiated herb did not show mutagenicity in the Ames test of the Salmonella reverse mutation assay, and did not show cytogenetic toxicity in the culture of the CHO cells. HPLC chromatogram of paeoniflorin in the irradiated Paeoniae Radix was similar with that of the non-irradiated sample. The quantity of paeoniflorin did not change significantly with irradiation. These results suggest that γ-irradiated Paeoniae Radix is toxicologically safe and chemically stable.

  6. Simultaneous determination of 15 marker constituents in various radix Astragali preparations by solid-phase extraction and high-performance liquid chromatography.

    PubMed

    Qi, Lian-Wen; Yu, Qing-Tao; Yi, Ling; Ren, Mei-Ting; Wen, Xiao-Dong; Wang, Yu-Xia; Li, Ping

    2008-01-01

    An improved quality control method was developed to simultaneously determine 15 major constituents (eight flavonoids and seven saponins) in various radix Astragali preparations, using SPE for pretreatment of samples, HPLC with diode-array and evaporative light scattering detectors (DAD-ELSD) for quantification in one run, and HPLC-ESI-TOF/MS for definite identification of compounds in preparations. Optimum separations were obtained with a ZORBAX C(18) column, using a gradient elution with 0.3% aqueous formic acid and ACN. This established method was fully validated with respect to linearity, precision, repeatability, and accuracy, and was successfully applied to quantify the 15 compounds in 19 commercial samples, including 3 dosage forms, i. e., oral solution, injection, concentrated granule, and its processed products of radix Astragali. The results demonstrated that many factors might result in significant differences in quality of the final preparations, including crude drugs, pretreatment processes, manufacturing procedure, storage conditions, etc. Then the developed method provided a reasonable and powerful manner to ensure the efficacy, safety, and batch-to-batch uniformity of radix Astragali products by standardizing each procedure, and thus should be proposed as quality control for the clinical use and modernization of herbal preparations.

  7. Astragali radix: could it be an adjuvant for oxaliplatin-induced neuropathy?

    PubMed Central

    Di Cesare Mannelli, Lorenzo; Pacini, Alessandra; Micheli, Laura; Femia, Angelo Pietro; Maresca, Mario; Zanardelli, Matteo; Vannacci, Alfredo; Gallo, Eugenia; Bilia, Anna Rita; Caderni, Giovanna; Firenzuoli, Fabio; Mugelli, Alessandro; Ghelardini, Carla

    2017-01-01

    Neurotoxicity is a major side effect of platinum derivatives both during and after treatment. In the absence of effective pharmacological compounds, the opportunity to identify safe adjuvant treatments among medicinal plants seems appropriate. Astragali radix is an adaptogenic herbal product recently analyzed in platinum-treated cancer patients. With the aim of evaluating the anti-neuropathic profile of Astragali radix, a previously characterized aqueous (Aqu) and two hydroalcoholic (20%HA and 50%HA) extracts were tested in a rat model of oxaliplatin-induced neuropathy. Repeated administrations significantly reduced oxaliplatin-dependent hypersensitivity with 50%HA, the most effective, fully preventing mechanical and thermal hypersensitivity. Ex vivo, 50%HA reduced morphometric and molecular alterations induced by oxaliplatin in peripheral nerve and dorsal-root-ganglia. In the spinal cord and in brain areas, 50%HA significantly decreased activation of microglia and astrocytes. Furthermore, 50%HA prevented the nephro- and hepato-toxicity induced by the anticancer drug. The protective effect of 50%HA did not alter oxaliplatin-induced apoptosis in colon tumors of Pirc rats, an Apc-driven model of colon carcinogenesis. The hydroalcoholic extract (50%HA) of Astragali radix relieves pain and promotes the rescue mechanisms that protect nervous tissue from the damages triggering chronic pain. A safe profile strongly suggests the usefulness of this natural product in oxaliplatin-induced neuropathy. PMID:28186109

  8. High performance liquid chromatography used for quality control of Achyranthis Radix.

    PubMed

    Zhao, Bing Tian; Jeong, Su Yang; Moon, Dong Cheul; Son, Kun Ho; Son, Jong Keun; Woo, Mi Hee

    2012-08-01

    To establish a standard of quality control and to identify reliable Achyranthis Radix, three phytoecdysones including ecdysterone (1), 25R-inokosterone (2) and 25S-inokosterone (3) were determined by quantitative HPLC/UV analysis. Three phytoecdysones were separated with an YMC J'sphere ODS C(18) column (250 mm × 4.6 mm, 4 μm) by isocratic elution using 0.1% formic acid in water and acetonitrile (85:15, v/v%) as the mobile phase. The flow rate was 1.0 mL/min and the UV detector wavelength was set at 245 nm. The standards were quantified by HPLC/UV from Achyranthes bidentata Blume and Achyranthes japonica Nakai, as well as Cyathula capitata Moq. and Cyathula officinalis Kuan, which are of a different genus but are comparative herbs. The method was successfully used in the analysis of Achyranthis Radix of different geographical origin or genera with relatively simple conditions and procedures, and the assay results were satisfactory for linearity, recovery, precision, accuracy, stability and robustness. The HPLC analytical method for pattern recognition analysis was validated by repeated analysis of eighteen A. bidentata Blume samples and ten A. japonica Nakai samples. The results indicate that the established HPLC/UV method is suitable for quantitation and pattern recognition analyses for quality evaluation of Achyranthis Radix.

  9. [The metabolic fingerprint of the compatibility of Radix Aconite and Radix Paeoniae Alba and its effect on CYP450 enzymes].

    PubMed

    Bi, Yun-Feng; Zheng, Zhong; Pi, Zi-Feng; Liu, Zhi-Qiang; Song, Feng-Rui

    2014-12-01

    Using a UPLC-MS/MS (MRM) and cocktail probe substrates method, the metabolic fingerprint of the compatibility of Radix Aconite (RA) and Radix Paeoniae Alba (RPA) and its effect on CYP450 enzymes were investigated. These main CYP isoforms include CYP 1A2, CYP 2C, CYP 2E1, CYP 2D and CYP 3A. Compared with the inhibition effect of RA decoctions on CYP450 isoforms, their co-decoctions of RA and RPA with different proportions can decrease RA' inhibition on CYP3A, CYP2D, CYP2C and CYP1A2, but can not reduce RA' effect on CYP2E1. The metabolic fingerprints of RA decoction and co-decoctions with different proportions of RPA in CYP450 of rat liver were analyzed by UPLC-MS. Compared with the metabolic fingerprints of RA decoction, the intensity of diester-diterpenoid aconitum alkaloids decreased significantly, while the intensity of monoester-diterpenoid alkaloids significantly increased in the metabolic fingerprints of co-decoctions of RA and RPA. The results suggest that RA coadministration with RPA increased the degradation of toxic alkaloid and show the effect of toxicity reducing and efficacy enhancing.

  10. Prescription pattern of chinese herbal products for breast cancer in taiwan: a population-based study.

    PubMed

    Lai, Jung-Nien; Wu, Chien-Tung; Wang, Jung-Der

    2012-01-01

    Background. Chinese herbal products (CHPs) given as a therapy for symptom relief have gained widespread popularity among women with breast cancer. The aim of this study was to analyze the utilization of CHP among women with breast cancer in Taiwan. Methods. The usage, frequency of services, and CHP prescribed for breast cancer among women with breast cancer were evaluated, recruited from a randomly sampled cohort of 1,000,000 beneficiaries from the National Health Insurance Research Database. The logistic regression method was employed to estimate the odds ratios (ORs) for utilization of CHP. Results. 81.5 percent (N = 2, 236) of women with breast cancer utilized traditional Chinese medicine (TCM) and 18% of them sought TCM with the intent of treating their breast cancer. Jia-wei-xiao-yao-san (Augmented Rambling Powder) was the most frequently prescribed formula for treating breast cancer. Among the top 10 most frequently prescribed CHP for treating breast cancer, seven contained dang qui (Angelica sinensis-radix) and six contained ren shen (Panax ginseng-radix), which are reported to have potential beneficial synergistic effects on breast cancer cells. Conclusion. CHP containing dang qui (Angelica sinensis-radix) or ren shen (Panax ginseng-radix) are the most frequently prescribed for breast cancer and their effects should be taken into account by healthcare providers.

  11. New Cholinesterase Inhibitory Constituents from Lonicera quinquelocularis

    PubMed Central

    Khan, Dilfaraz; Khan, Hidayat Ullah; Khan, Farmanullah; Khan, Shafiullah; Badshah, Syed; Khan, Abdul Samad; Samad, Abdul; Ali, Farman; Khan, Ihsanullah; Muhammad, Nawshad

    2014-01-01

    A phytochemical investigation on the ethyl acetate soluble fraction of Lonicera quinquelocularis (whole plant) led to the first time isolation of one new phthalate; bis(7-acetoxy-2-ethyl-5-methylheptyl) phthalate (3) and two new benzoates; neopentyl-4-ethoxy-3, 5-bis (3-methyl-2-butenyl benzoate (4) and neopentyl-4-hydroxy-3, 5-bis (3-methyl-2-butenyl benzoate (5) along with two known compounds bis (2-ethylhexyl phthalate (1) and dioctyl phthalate (2). Their structures were established on the basis of spectroscopic analysis and by comparison with available data in the literature. All the compounds (1–5) were tested for their acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitory activities in dose dependent manner. The IC50 (50% inhibitory effect) values of compounds 3 and 5 against AChE were 1.65 and 3.43 µM while the values obtained against BChE were 5.98 and 9.84 µM respectively. Compounds 2 and 4 showed weak inhibition profile. PMID:24733024

  12. Virtual reality balance training for elderly: Similar skiing games elicit different challenges in balance training.

    PubMed

    de Vries, Aijse W; Faber, Gert; Jonkers, Ilse; Van Dieen, Jaap H; Verschueren, Sabine M P

    2018-01-01

    Virtual Reality (VR) balance training may have advantages over regular exercise training in older adults. However, results so far are conflicting potentially due to the lack of challenge imposed by the movements in those games. Therefore, the aim of this study was to assess to which extent two similar skiing games challenge balance, as reflected in center of mass (COM) movements relative to their Functional Limits of Stability (FLOS). Thirty young and elderly participants performed two skiing games, one on the Wii Balance board (Wiiski), which uses a force plate, and one with the Kinect sensor (Kinski), which performs motion tracking. During gameplay, kinematics were captured using seven opto-electronical cameras. FLOS were obtained for eight directions. The influence of games and trials on COM displacement in each of the eight directions, and maximal COM speed, were tested with Generalized Estimated Equations. In all directions with anterior and medio-lateral, but not with a posterior component, subjects showed significantly larger maximal %FLOS displacements during the Kinski game than during the Wiiski game. Furthermore, maximal COM displacement, and COM speed in Kinski remained similar or increased over trials, whereas for Wiiski it decreased. Our results show the importance of assessing the movement challenge in games used for balance training. Similar games impose different challenges, with the control sensors and their gain settings playing an important role. Furthermore, adaptations led to a decrease in challenge in Wiiski, which might limit the effectiveness of the game as a balance-training tool. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Interactions between traditional Chinese medicine and western drugs in Taiwan: A population-based study.

    PubMed

    Chen, Kuan Chen; Lu, Richard; Iqbal, Usman; Hsu, Ko-Ching; Chen, Bi-Li; Nguyen, Phung-Anh; Yang, Hsuan-Chia; Huang, Chih-Wei; Li, Yu-Chuan Jack; Jian, Wen-Shan; Tsai, Shin-Han

    2015-12-01

    Drug-drug interactions have long been an active research area in clinical medicine. In Taiwan, however, the widespread use of traditional Chinese medicines (TCM) presents additional complexity to the topic. Therefore, it is important to see the interaction between traditional Chinese and western medicine. (1) To create a comprehensive database of multi-herb/western drug interactions indexed according to the ways in which physicians actually practice and (2) to measure this database's impact on the detection of adverse effects between traditional Chinese medicine compounds and western medicines. First, a multi-herb/western medicine drug interactions database was created by separating each TCM compound into its constituent herbs. Each individual herb was then checked against an existing single-herb/western drug interactions database. The data source comes from the National Health Insurance research database, which spans the years 1998-2011. This study estimated the interaction prevalence rate and further separated the rates according to patient characteristics, distribution by county, and hospital accreditation levels. Finally, this new database was integrated into a computer order entry module of the electronic medical records system of a regional teaching hospital. The effects it had were measured for two months. The most commonly interacting Chinese herbs were Ephedrae Herba and Angelicae Sinensis Radix/Angelicae Dahuricae Radix. Ephedrae Herba contains active ingredients similar to in ephedrine. 15 kinds of traditional Chinese medicine compounds contain Ephedrae Herba. Angelicae Sinensis Radix and Angelicae Dahuricae Radix contain ingredients similar to coumarin, a blood thinner. 9 kinds of traditional Chinese medicine compounds contained Angelicae Sinensis Radix/Angelicae Dahuricae Radix. In the period from 1998 to 2011, the prevalence of herb-drug interactions related to Ephedrae Herba was 0.18%. The most commonly prescribed traditional Chinese compounds were MA SHING GAN SHYR TANG (23.1%), followed by SHEAU CHING LONG TANG (15.5%) and DINQ CHUAN TANG (13.2%). The prevalence of herb-drug interactions related to Angelicae Sinensis Radix, Angelicae Dahuricae Radix was 4.59%. The most common traditional Chinese compound formula were TSANG EEL SAAN (32%), followed by HUOH SHIANG JENQ CHIH SAAN (31.4%) and SHY WUH TANG (10.7%). Once the multi-herb drug interaction database was deployed in a hospital system, there were 480 prescriptions that indicated a TCM-western drug interaction. Physicians were alerted 24 times during two months. These alerts resulted in a prescription change four times (16.7%). Due to the unique cultural factors that have resulted in widespread acceptance of both western and traditional Chinese medicine, Taiwan stands well positioned to report on the prevalence of interactions between western drugs and traditional Chinese medicine and devise ways to reduce their incidence. This study built a multi-herb/western drug interactions database, embedded inside a hospital clinical information system, and then examined the effects that drug interaction alerts had on clinician prescribing behaviour. The results demonstrated that western drug/traditional Chinese medicine interactions are prevalent and that western-trained physicians tend to change their prescribing behaviour more than traditional Chinese medicine physicians in their response to medication interaction alerts. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. [Study on extraction process of Radix Bupleuri].

    PubMed

    Zhao, Lei; Liu, Benliang; Wu, Fuxiang; Tao, Lanping; Liu, Jian

    2004-10-01

    The orthogonal design was used to optimize extraction process of Radix Bupleuri with content of total saponin and yield of the extract as markers. Factors that have been chosen were ethanol concentration, ethanol consumption, extraction times and extraction time. Each factor had three levels. The result showed that the optimum extraction condition was 80% ethanol, 4 times the amount of material, refluxing for 4 times, 60 minutes each time. The optimized process was stable and workable.

  15. Endodontic management of radix paramolaris with six canals: a clinical case report.

    PubMed

    Acharya, N; Singh, A; Samant, P S; Gautam, V

    2013-01-01

    Endodontic therapy of mandibular molars is a challenging task due to its varied root canal morphology. A mandibular first molar with additional buccal root (Radix paramolaris) and additional distolingual root (Radix Entomolaris) is an example of its varied anatomy. A successful management of atypical root canal configurations is an important aspect in determining the success rate of root canal therapy. The detail knowledge of the root morphology and canal anatomy allows the clinician for accurate location of the extra roots and canals and accordingly the refinement of the access cavity for the stress free entry of complex anatomy. Hence, for a successful root canal therapy, clinician must be aware of the external and internal anatomic variations .The aim of this clinical case report is to present and describe the unusual presence of two separate mesial roots and six root canals in mandibular first molar, detected during routine endodontic therapy.

  16. [Historical investigation of dentifrice in China].

    PubMed

    Kubo, M; Song, Q; Tang, F

    2001-01-01

    A herbal literature survey was carried out on data concerning historical pharmacognostical changes of "dentifrice" in China and how diseases of the teeth and gums had been treated there in ancient times. It had been considered to be a matter of utmost importance that to prevent teeth from decaying, only the brushing of teeth with a toothbrush was necessary. Over time, various tooth agents have been found to treat oral diseases the teeth and gums. Glycyrrhizae Radix, Ginseng Radix, Scutellariae Radix, Menthae Herbal, and salt were widely used materials. Investigations from all approaches are being carried out to develop remedies for oral diseases, including Kampo medicine and the pharmacological effects of numerous crude drugs. When tracing the pharmacognostical changes of dentifrice in ancient China, we felt wonder at and admiration for the abundance of clinical experiences described in the old herbal and medical literature we researched.

  17. Simultaneous quantification of chrysophanol and physcion in rat plasma by ultra fast liquid chromatography-tandem mass spectrometry and application of the technique to comparative pharmacokinetic studies of Radix et Rhei Rhizoma extract alone and Dahuang Fuzi Decoction.

    PubMed

    Liu, Xiao; Li, Huan; Wu, Li; Xing, Jiangwa; Poh, Yanhong; Cai, Hao; Cai, Bao Chang

    2015-02-01

    Most herbal medicines are prescribed in combination based on the theory of TCM to obtain synergistic effects or diminish the possible adverse reactions. Compatibility refers to the combination of two or more herbs based on the clinical settings and the properties of herbs. Chrysophanol and physcion are the main effective compounds in Radix et Rhizoma Rhei and Dahuang Fuzi Decoction which is the combination of Radix et Rhizoma Rhei, Radix Aconiti Lateralis Praeparata and Radix et Rhizoma Asari. However, chrysophanol and physcion are difficult to detect in vivo because of their low concentration and interference from endogenous compounds. The aim of this study is to develop a rapid, specific and sensitive ultra high performance liquid chromatography-triple quadrupole tandem mass method to simultaneously quantify chrysophanol and physcion in rat plasma, in order to better understand the pharmacokinetics and compatibility mechanism of Dahuang Fuzi Decoction for the first time. Multiple reaction monitoring (MRM) mode was applied for the quantitation at [M-H](-)m/z 253.0→m/z 225.1 for chrysophanol, [M-H](-) for m/z 283.1→m/z 240.0 physcion and [M-H](-)m/z 239.0→m/z 211.0 for IS. The analytes were separated on an Agilent Eclipse plus C18 column (100mm×2.1mm, 1.8μm) column within a total running time of 6.5min using a mixture of 3mM ammonium acetate in water and methanol (95:5, v/v) with a time program flow gradient according to the "plus gradient chromatography" theory. The inclusion of the ammonium acetate in the UFLC mobile phase dramatically improved the detection limit of the tested compounds and decreased the interference by matrix effects, which have been referred to as "LC-electrolyte effects". Finally, we demonstrated the application of a validated method in a comparative pharmacokinetic study of rats receiving an oral dose of Dahuang Fuzi Decoction or Radix et Rhei Rhizoma, the monarch drug in the prescription. Pharmacokinetic parameters showed significant difference between the two groups. The achieved comparative pharmacokinetic results were helpful to clarify the combination mechanism of Dahuang Fuzi Decoction. Copyright © 2015. Published by Elsevier B.V.

  18. Detection of an abundant plant-based small RNA in consumers

    USDA-ARS?s Scientific Manuscript database

    Mechanisms of delivery of plant small RNAs to consumers must be addressed in order to harness this technology to positively impact agbiotechnology. Two groups have used honeysuckle (Lonicera japonica) feeding regimes to detect a plant-based small RNA, termed MIR2911, in sera. Meanwhile, numerous gro...

  19. Forage yield of Japanese honeysuckle after repeated burning or mowing

    Treesearch

    John J. Stransky

    1984-01-01

    Japanese honeysuckle (Lonicera japonica) plantings were burned, mowed, or left untreated in February 1973, and again in March 1978, to measure forage yields from honeysuckle after repeated treatments and to determine whether burning or mowing confines honeysuckle to food plots and prevents accumulation of large, impenetrable mats. Two growing...

  20. The extent of selected nonnative invasive plants on southern forest lands

    Treesearch

    Sonja N. Oswalt; Christopher M. Oswalt

    2011-01-01

    Studies suggest that the southern United States is an area of primary concern with regards to the spread of nonnative invasive plant species. Recent data show that species such as Japanese honeysuckle (Lonicera japonica) and Nepalese browntop (Microstegium vimineum) are invading forests and displacing native species throughout the...

  1. Multiresidue analysis of pesticides in traditional Chinese medicines using gas chromatography - negative chemical ionization tandem mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    In this study, a residue analysis method for the simultaneous determination of 107 pesticides in the traditional Chinese medicines (TCMs), Angelica sinensis, Angelica dahurica, Leonurus heterophyllus Sweet, Pogostemon cablin, and Lonicera japonica Thunb, was developed using gas chromatography couple...

  2. [Studies on extraction process of Radix Platycodi].

    PubMed

    Wu, Biyuan; Sun, Jun; Jiang, Hongfang

    2002-06-01

    The orthogonal design was used to optimize the extraction process of Radix Platycodi with content of total saponin and yield of the extract as markers. Factors that have been chosen were alcohol concentration, alcohol consumption, extraction times and extraction time. Each factor has three levels. The result showed that the optimum extraction condition obtained was 70% alcohol, 3 times the amount of material, refluxing for 5 times, 60 minutes each time, the optimized process was stable and workable.

  3. Orthogonal array design in optimizing the extraction efficiency of active constituents from roots of Panax notoginseng.

    PubMed

    Dong, T T X; Zhao, K J; Huang, W Z; Leung, K W; Tsim, K W K

    2005-08-01

    The root of Panax notoginseng (Radix Notoginseng, Sanqi) is a commonly used traditional Chinese medicine, which is mainly cultivated in Wenshan of Yunnan China. The identified active constituents in Radix Notoginseng include saponin, ssavonoid and polysaccharide; however, the levels of these active constituents vary greatly with different extraction processes. This variation causes a serious problem in standardizing the herbal extract. By using HPLC and spectrophotometry, the contents of notoginsenoside R(1), ginsenoside R(g1), R(b1), R(d), and ssavonoids were determined in the extracts of Radix Notoginseng that were derived from different processes of extraction according to an orthogonal array experimental design having three variable parameters: nature of extraction solvent, extraction volume and extraction time. The nature of extraction solvent and extraction volume were two distinct factors in obtaining those active constituents, while the time of extraction was a subordinate factor. The optimized condition of extraction therefore is considered to be 20 volumes of water and extracted for 24 h. In good agreement with the amount of active constituents, the activity of anti-platelet aggregation was found to be the highest in the extract that contained a better yield of the active constituents. The current results provide an optimized extraction method for the quality control of Radix Notoginseng. Copyright (c) 2005 John Wiley & Sons, Ltd.

  4. [Pharmacokinetic study of six aconitine alkaloids in aconiti lateralis radix praeparata in beagle dogs].

    PubMed

    Xiao, Ri-Ping; Lai, Xiao-Ping; Zhao, Yai; Yu, Liang-Wen; Zhu, Yue-Lan; Li, Geng

    2014-02-01

    To study the pharmacokinetics characteristics of six Aconitum alkaloids aconitine (AC), mesaconitine (MA), hypaconitine (HA), benzoylaconine (BAC), benzoylmesaconine (BMA) and benzoylhypaconine (BHA) in beagle dogs. An ultra performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) method was developed for simultaneous quantitation of six Aconitum alkaloids in beagle dog plasma after oral administration of Aconiti Lateralis Radix Praeparata decoction. UPLC/MS/MS system coupled with an electrospray ionization (ESI) source was performed in multiple-reaction monitoring (MRM) mode. Sample preparation was performed with solid-phase extraction(SPE) on a 3 mL HLB cartridge before the analysis. The separation was applied on a Waters C8 column (100 mm x 2.1 mm, 1.7 microm) and a gradient elution of methanol and 0.2% formic acid-water was used as mobile phase. The pharmacokinetic parameters were calculated by the results of the analysis through the DAS 2. 1 software (Drug and Statistics for Windows). The results showed that the fitting model for the six Aconitum alkaloids was the one-compartment model pharmacokinetics. The method is successfully used for the pharmacokinetic evaluation of the six Aconitum alkaloids in beagle dog plasma, it can help monitor the ADME/Tox process when taking Aconiti Lateralis Radix Praeparata by observing the pharmacokinetic process. The results provide a good reference for clinical treatment and safe application of Aconiti Lateralis Radix Praeparata.

  5. [Discussion on the botanical origin of Isatidis radix and Isatidis folium based on DNA barcoding].

    PubMed

    Sun, Zhi-Ying; Pang, Xiao-Hui

    2013-12-01

    This paper aimed to investigate the botanical origins of Isatidis Radix and Isatidis Folium, and clarify the confusion of its classification. The second internal transcribed spacer (ITS2) of ribosomal DNA, the chloroplast matK gene of 22 samples from some major production areas were amplified and sequenced. Sequence assembly and consensus sequence generation were performed using the CodonCode Aligner. Phylogenetic study was performed using MEGA 4.0 software in accordance with the Kimura 2-Parameter (K2P) model, and the phylogenetic tree was constructed using the neighbor-joining methods. The results showed that the length of ITS2 sequence of the botanical origins of Isatidis Radix and Isatidis Folium was 191 bp. The sequence showed that some samples had several SNP sites, and some samples had heterozygosis sites. In the NJ tree, based on ITS2 sequence, the studied samples were separated into two groups, and one of them was gathered with Isatis tinctoria L. The studied samples also were divided into two groups obviously based on the chloroplast matK gene. In conclusion, our results support that the botanical origins of Isatidis Radix and Isatidis Folium are Isatis indigotica Fortune, and Isatis indigotica and Isatis tinctoria are two distinct species. This study doesn't support the opinion about the combination of these two species in Flora of China.

  6. [Nasal submicron emulsion of Scutellariae Radix extract preparation technology research based on phase transfer of solute technology].

    PubMed

    Shi, Ya-jun; Shi, Jun-hui; Chen, Shi-bin; Yang, Ming

    2015-07-01

    Based on the demand of nasal drug delivery high drug loadings, using the unique phase transfer of solute, integrating the phospholipid complex preparation and submicron emulsion molding process of Scutellariae Radix extract, the study obtained the preparation of the high drug loadings submicron emulsion of Scutellariae Radix extract. In the study of drug solution dispersion method, the uniformity of drug dispersed as the evaluation index, the traditional mixing method, grinding, homogenate and solute phase transfer technology were investigated, and the solute phase transfer technology was adopted in the last. With the adoption of new technology, the drug loading capacity reached 1.33% (phospholipid complex was 4%). The drug loading capacity was improved significantly. The transfer of solute method and timing were studied as follows,join the oil phase when the volume of phospholipid complex anhydrous ethanol solution remaining 30%, the solute phase transfer was completed with the continued recycling of anhydrous ethanol. After drug dissolved away to oil phase, the preparation technology of colostrum was determined with the evaluation index of emulsion droplet form. The particle size of submicron emulsion, PDI and stability parameters were used as evaluation index, orthogonal methodology were adopted to optimize the submicron emulsion ingredient and main influential factors of high pressure homogenization technology. The optimized preparation technology of Scutellariae Radix extract nasal submicron emulsion is practical and stable.

  7. Quantum Mechanics and the Principle of Least Radix Economy

    NASA Astrophysics Data System (ADS)

    Garcia-Morales, Vladimir

    2015-03-01

    A new variational method, the principle of least radix economy, is formulated. The mathematical and physical relevance of the radix economy, also called digit capacity, is established, showing how physical laws can be derived from this concept in a unified way. The principle reinterprets and generalizes the principle of least action yielding two classes of physical solutions: least action paths and quantum wavefunctions. A new physical foundation of the Hilbert space of quantum mechanics is then accomplished and it is used to derive the Schrödinger and Dirac equations and the breaking of the commutativity of spacetime geometry. The formulation provides an explanation of how determinism and random statistical behavior coexist in spacetime and a framework is developed that allows dynamical processes to be formulated in terms of chains of digits. These methods lead to a new (pre-geometrical) foundation for Lorentz transformations and special relativity. The Parker-Rhodes combinatorial hierarchy is encompassed within our approach and this leads to an estimate of the interaction strength of the electromagnetic and gravitational forces that agrees with the experimental values to an error of less than one thousandth. Finally, it is shown how the principle of least-radix economy naturally gives rise to Boltzmann's principle of classical statistical thermodynamics. A new expression for a general (path-dependent) nonequilibrium entropy is proposed satisfying the Second Law of Thermodynamics.

  8. Anti-inflammatory activities of Ophiopogonis Radix on hydrogen peroxide-induced cellular senescence of normal human dermal fibroblasts.

    PubMed

    Kitahiro, Yumi; Koike, Atsushi; Sonoki, Aska; Muto, Mei; Ozaki, Kazuo; Shibano, Makio

    2018-06-30

    Ophiopogonis Radix (Ophiopogon root), which nourishes the yin, has been used in clinical practice to promote fluid secretion and to moisturize the lungs and skin in traditional Chinese and Japanese (Kampo) medicine. To evaluate this traditional medicinal effect, we investigated the anti-chronic inflammatory effect of Radix Ophiopogonis on senescent cells. Conversely, although several phenotypes of Ophiopogon japonicus Ker-Gawler (Liliaceae) are prevalent in Japan and China, we used these Ophiopogon roots by considering them as one crude drug, Ophiopogonis Radix. In this study, it was revealed that there are two chemotypes (Types A and B) in the root of the original plant, O. japonicus. Methylophiopogonanone A (compound 1) and methylophiopogonanone B (compound 2) were isolated as index compounds from Type A and compound 1 and ophiopogonanone A (compound 3) from Type B. In addition, ophiopogonin B (compound 4) was isolated as the main steroidal saponin from both Type A and B. The results indicated that two different methanol extracts (from Types A and B) and the main constituents of O. japonicus (compound 1-4), significantly downregulated the expression of interleukin (IL)-6 and IL-8, which were enhanced by senescent normal human dermal fibroblasts. Moreover, the two different methanol extracts and compounds 1-4 decreased IL-6 production in a strong and concentration-dependent manner by the ELISA method.

  9. Quantitative LC-MS/MS analysis of seven ginsenosides and three aconitum alkaloids in Shen-Fu decoction

    PubMed Central

    2013-01-01

    Background Shen-Fu decoction is a traditional Chinese medicine prescription with a 3:2 ratio of Radix Ginseng and Fuzi (Radix Aconiti lateralis praeparata). Ginsenosides and alkaloids are considered to be the main active components of Shen-Fu decoction. However, no analytical methods have been used to quantitatively analyse both components in Shen-Fu decoction simultaneously. Results We successfully developed a rapid resolution liquid chromatography coupled with tandem mass spectrometry (RRLC-MS/MS) method for the simultaneous analysis of seven ginsenosides and three aconitum alkaloids in Shen-Fu decoction, the decoction of Radix ginseng and Fuzi (Radix Aconiti lateralis praeparata). Chromatogrpahic separation by RPLC was achieved using a reversed-phase column and a water/acetonitrile mobile phase, containing 0.05% formic acid and using a gradient system. The method was optimized to allow for simultaneous analysis of all analytes in 11minutes without the need for baseline resolution of the components. Furthermore, the separation demonstrated good linearity (r > 0.9882), repeatability (RSD < 7.01%), intra- and inter-day precisions (RSD < 5.06%) and high yields of recovery (91.13-111.97%) for ten major constituents, namely ginsenoside-Re, Rg1, Rb1, Rc, Rb2, Rd, Rf, aconitine, hypacoitine and mesaconitine. Conclusions The developed method could be used as a rapid and reliable approach for assessment of the quantity of the major constituents in Shen-Fu decoction. PMID:24107599

  10. Prescription Pattern of Chinese Herbal Products for Breast Cancer in Taiwan: A Population-Based Study

    PubMed Central

    Lai, Jung-Nien; Wu, Chien-Tung; Wang, Jung-Der

    2012-01-01

    Background. Chinese herbal products (CHPs) given as a therapy for symptom relief have gained widespread popularity among women with breast cancer. The aim of this study was to analyze the utilization of CHP among women with breast cancer in Taiwan. Methods. The usage, frequency of services, and CHP prescribed for breast cancer among women with breast cancer were evaluated, recruited from a randomly sampled cohort of 1,000,000 beneficiaries from the National Health Insurance Research Database. The logistic regression method was employed to estimate the odds ratios (ORs) for utilization of CHP. Results. 81.5 percent (N = 2, 236) of women with breast cancer utilized traditional Chinese medicine (TCM) and 18% of them sought TCM with the intent of treating their breast cancer. Jia-wei-xiao-yao-san (Augmented Rambling Powder) was the most frequently prescribed formula for treating breast cancer. Among the top 10 most frequently prescribed CHP for treating breast cancer, seven contained dang qui (Angelica sinensis-radix) and six contained ren shen (Panax ginseng-radix), which are reported to have potential beneficial synergistic effects on breast cancer cells. Conclusion. CHP containing dang qui (Angelica sinensis-radix) or ren shen (Panax ginseng-radix) are the most frequently prescribed for breast cancer and their effects should be taken into account by healthcare providers. PMID:22685488

  11. [Optimization of extraction technology from Paeoniae Radix Alba using response surface methodology].

    PubMed

    Jin, Lin; Zhao, Wan-shun; Guo, Qiao-sheng; Zhang, Wen-sheng; Ye, Zheng-liang

    2015-08-01

    To ensure the stability of chemistry components and the convenience of operation, ultrasound method was chosen to study in this investigation. As the total common peaks area in chromatograms was set to be evaluation index, the influence on the technology caused by extraction time, ethanol concentration and liquid-to-solid ratio was studied by using single factor methodology, and the extraction technology of Paeoniae Radix Alba was optimized by using response surface methodology. The results showed that the extracting results were most affected by ethanol concentration; liquid-to-solid ratio came the second and extraction time thirdly. The optimum ultrasonic-assisted extraction conditions were as follow: the ultrasonic extraction time was 20.06 min, the ethanol concentration in solvent was 72.04%, and the liquid-to-solid ratio was 53.38 mL · g(-1), the predicted value of total common peaks area was 2.1608 x 10(8). Under the extraction conditions after optimization, the total common peaks area was 2.1422 x 10(8), and the relative deviation between the measured and predicted value was 0.86%, so the optimized extraction technology for Paeoniae Radix Alba is suitable and feasible. Besides, for the purpose of extracting more sufficiently and completely, the optimized extraction technology had more advantages than the extraction method recorded in the monogragh of Paeoniae Radix Alba in Chinese Pharmacopoeia, which will come true the assessment and utilization comprehensively.

  12. Plant Phenolics Extraction from Flos Chrysanthemi: Response Surface Methodology Based Optimization and the Correlation Between Extracts and Free Radical Scavenging Activity.

    PubMed

    Wu, Yanfang; Wang, Xinsheng; Xue, Jintao; Fan, Enguo

    2017-11-01

    Huaiju is one of the most famous and widely used Flos Chrysanthemi (FC) for medicinal purposes in China. Although various investigations aimed at phenolics extraction from other FC have been reported, a thorough optimization of the phenolics extraction conditions from Huaiju has not been achieved. This work applied the widely used response surface methodology (RSM) to investigate the effects of 3 independent variables including ethanol concentration (%), extraction time (min), and solvent-to-material ratio (mL/g) on the ultrasound-assisted extraction (UAE) of phenolics from FC. The data suggested the optimal UAE condition was an ethanol concentration of 75.3% and extraction time of 43.5 min, whereas the ratio of solvent to material has no significant effect. When the free radical scavenging ability was used as an indicator for a successful extraction, a similar optimal extraction was achieved with an ethanol concentration of 72.8%, extraction time of 44.3 min, and the ratio of solvent to material was 29.5 mL/g. Furthermore, a moderate correlation between the antioxidant activity of TP extract and the content of extracted phenolic compounds was observed. Moreover, a well consistent of the experimental values under optimal conditions with those predicted values suggests RSM successfully optimized the UAE conditions for phenolics extraction from FC. The work of the research investigated the plant phenolics in Flos Chrysanthemi and antioxidant capacities. These results of this study can support the development of antioxidant additive and relative food. © 2017 The Authors. Journal of Food Science published by Wiley Periodicals, Inc. on behalf of Institute of Food Technologists.

  13. [Analysis of on medication rules for Qi-deficiency and blood-stasis syndrome of chronic heart failure based on data mining technology].

    PubMed

    Wang, Qian; Yao, Geng-Zhen; Pan, Guang-Ming; Huang, Jing-Yi; An, Yi-Pei; Zou, Xu

    2017-01-01

    To analyze the medication features and the regularity of prescriptions of traditional Chinese medicine in treating patients with Qi-deficiency and blood-stasis syndrome of chronic heart failure based on modern literature. In this article, CNKI Chinese academic journal database, Wanfang Chinese academic journal database and VIP Chinese periodical database were all searched from January 2000 to December 2015 for the relevant literature on traditional Chinese medicine treatment for Qi-deficiency and blood-stasis syndrome of chronic heart failure. Then a normalized database was established for further data mining and analysis. Subsequently, the medication features and the regularity of prescriptions were mined by using traditional Chinese medicine inheritance support system(V2.5), association rules, improved mutual information algorithm, complex system entropy clustering and other mining methods. Finally, a total of 171 articles were included, involving 171 prescriptions, 140 kinds of herbs, with a total frequency of 1 772 for the herbs. As a result, 19 core prescriptions and 7 new prescriptions were mined. The most frequently used herbs included Huangqi(Astragali Radix), Danshen(Salviae Miltiorrhizae Radix et Rhizoma), Fuling(Poria), Renshen(Ginseng Radix et Rhizoma), Tinglizi(Semen Lepidii), Baizhu(Atractylodis Macrocephalae Rhizoma), and Guizhi(Cinnamomum Ramulus). The core prescriptions were composed of Huangqi(Astragali Radix), Danshen(Salviae Miltiorrhizae Radix et Rhizoma) and Fuling(Poria), etc. The high frequent herbs and core prescriptions not only highlight the medication features of Qi-invigorating and blood-circulating therapy, but also reflect the regularity of prescriptions of blood-circulating, Yang-warming, and urination-promoting therapy based on syndrome differentiation. Moreover, the mining of the new prescriptions provide new reference and inspiration for clinical treatment of various accompanying symptoms of chronic heart failure. In conclusion, this article provides new reference for traditional Chinese medicine in the treatment of chronic heart failure. Copyright© by the Chinese Pharmaceutical Association.

  14. Pharmacological evaluation of insulin mimetic novel suppressors of PEPCK gene transcription from Paeoniae Rubra Radix.

    PubMed

    Juan, Yi-Chen; Chang, Chia-Chuan; Tsai, Wei-Jern; Lin, Yun-Lian; Hsu, Yi-Shin; Liu, Hui-Kang

    2011-09-01

    Paeoniae Rubra Radix (root of Paeonia lactiflora) has been frequently employed in Traditional Chinese Medicine (TCM) as and anti-diabetic therapy to enhance blood circulation and dissipate stasis. Previously, we identified a novel hypoglycemic action of a crude extract from Paeoniae Rubra Radix, which also suppressed phosphoenolpyruvate carboxykinase (PEPCK) gene transcription. Therefore, the current investigation intended to elucidate potential active bio-constituents of this herb and mechanisms of action. Glucocorticoid receptor (GR) nuclear localization, the PEPCK messenger (m)RNA level, pregnane X receptor (PXR) mRNA expression, cAMP-responsive element-binding protein (CREB) serine phosphorylation and DNA binding were evaluated in dexamethasone (Dex) and 8-bromo-cAMP (CA)-stimulated H4IIE cells, while efficacy of agents was assessed in a stable cell line containing a green fluorescent protein (GFP) reporter driven by the PEPCK promoter. HPLC profiling, colorimetric assays, and NMR analysis were employed for chemical characterization purpose. An extract of Paeoniae Rubra Radix lacking the insulin mimetic compound, 1,2,3,4,6-penta-O-galloyl-beta-d-glucose (PGG), and termed the non-PGG fraction (NPF), consisting of tannin polymers, suppressed PEPCK expression in the presence of an insulin receptor antagonist (HNMPA-AM(3)), suggesting the action of this fraction is independent of the insulin receptor. Furthermore, Dex-stimulated GR nuclear localization and transactivation were prevented by the NPF. Similarly, CA-stimulated CREB serine phosphorylation and DNA binding were also inhibited by the NPF in H4IIE cells. Hence NPF antagonizes both signaling pathways that induce PEPCK gene transcription. In conclusion, the current study proposes that the potent suppressive activity on PEPCK gene transcription observed with Paeoniae Rubra Radix extract, can be attributed to at least two distinct components, namely PGG and NPF. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  15. Mycosporine-like Amino Acids and Other Phytochemicals Directly Detected by High-Resolution NMR on Klamath (Aphanizomenon flos-aquae) Blue-Green Algae.

    PubMed

    Righi, Valeria; Parenti, Francesca; Schenetti, Luisa; Mucci, Adele

    2016-09-07

    This study describes for the first time the use of high-resolution nuclear magnetic resonance (NMR) on Klamath (Aphanizomenon flos-aquae, AFA) blue-green algae directly on powder suspension. These algae are considered to be a "superfood", due to their complete nutritional profile that has proved to have important therapeutic effects. The main advantage of NMR spectroscopy is that it permits the detection of a number of metabolites all at once. The Klamath alga metabolome was revealed to be quite complex, and the most peculiar phytochemicals that can be detected directly on algae by NMR are mycosporine-like amino acids (porphyra-334, P334; shinorine, Shi) and low molecular weight glycosides (glyceryl β-d-galactopyranoside, GalpG; glyceryl 6-amino-6-deoxy-α-d-glucopyranoside, ADG), all compounds with a high nutraceutical value. The presence of cis-3,4-DhLys was revealed for the first time. This molecule could be involved in the anticancer properties ascribed to AFA.

  16. Inhibitory effects of Aphanizomenon flos-aquae constituents on human UDP-glucose dehydrogenase activity.

    PubMed

    Scoglio, Stefano; Lo Curcio, Valeria; Catalani, Simona; Palma, Francesco; Battistelli, Serafina; Benedetti, Serena

    2016-12-01

    The purpose of this study was to investigate the in vitro inhibitory effects of the edible microalga Aphanizomenon flos-aquae (AFA) on human UDP-α-d-glucose 6-dehydrogenase (UGDH) activity, a cytosolic enzyme involved both in tumor progression and in phytochemical bioavailability. Both the hydrophilic and ethanolic AFA extracts as well as the constitutive active principles phycocyanin (PC), phycocyanobilin (PCB) and mycosporine-like amino acids (MAAs) were tested. Among AFA components, PCB presented the strongest inhibitory effect on UGDH activity, acting as a competitive inhibitor with respect to UDP-glucose and a non-competitive inhibitor with respect to NAD(+). In preliminary experiments, AFA PCB was also effective in reducing the colony formation capacity of PC-3 prostate cancer cells and FTC-133 thyroid cancer cells. Overall, these findings confirmed that AFA and its active principles are natural compounds with high biological activity. Further studies evaluating the effects of AFA PCB in reducing tumor cell growth and phytochemical glucuronidation are encouraged.

  17. A Comparative Evaluation of Mechanical Suturing of the Bronchial Stump with the UKB-25 and UKL-60 Apparatuses in Experimental Pneumonectomies

    DTIC Science & Technology

    1960-09-27

    carried out; the processing differed for each of the series» The first series comprised 25 experiments. After tying the vessels, the stitchers of...the exposure of the pulmonary radix pulmonis, the stitchers of the apparatus were placed on the radix pulmonis as close to the bi- furcation as...at the level of the stitchers , and the lung was removed„ The hermeticity was then checked and the stump was dusted with penicillin. Fifteen

  18. Snagging and Clearing for Flood Control, Snake River, Minnesota.

    DTIC Science & Technology

    1979-07-01

    buffaloberry (Shepherdia argentea), chokecherry (Prunus virginiana), honeysuckle (Lonicera tartarica),and multiflora rose (Rosa multiflora). The inner...prickly ash (Zanthoxylum americanum), dogwood (Cornus sp.), wolfberry (Symphori- carpos occidentalia), chokecherry , gooseberry (Ribes missouriensis...American plum, and black willow (Salix nigra). Further away from the river a shrub layer is present consisting of chokecherry , raspberry (Rubus strigosus

  19. Evolution of competitive ability within Lonicera japonica's invaded range

    Treesearch

    Gregory A. Evans; Francis F. Kilkenny; Laura F. Galloway

    2013-01-01

    Factors influencing invasive taxa may change during the course of an invasion. For example, intraspecific competition is predicted to be more important in areas with older stands of dense monospecific invaders than at the margins of an invaded range. We evaluated evolution in response to predicted changes in competition by comparing the intraspecific competitive...

  20. Adaptive divergence at the margin of an invaded range

    Treesearch

    Francis F. Kilkenny; Laura F. Galloway

    2012-01-01

    Invasive plant species threaten biological communities globally. However, relatively little is known about how evolutionary processes vary over the course of an invasion. To evaluate the importance of historical and adaptive drivers of range expansion, we compare the performance of North American populations of invasive Lonicera japonica from areas established 100-150...

  1. Rapid and quantitative determination of 10 major active components in Lonicera japonica Thunb. by ultrahigh pressure extraction-HPLC/DAD

    NASA Astrophysics Data System (ADS)

    Fan, Li; Lin, Changhu; Duan, Wenjuan; Wang, Xiao; Liu, Jianhua; Liu, Feng

    2015-01-01

    An ultrahigh pressure extraction (UPE)-high performance liquid chromatography (HPLC)/diode array detector (DAD) method was established to evaluate the quality of Lonicera japonica Thunb. Ten active components, including neochlorogenic acid, chlorogenic acid, 4-dicaffeoylquinic acid, caffeic acid, rutin, luteoloside, isochlorogenic acid B, isochlorogenic acid A, isochlorogenic acid C, and quercetin, were qualitatively evaluated and quantitatively determined. Scanning electron microscope images elucidated the bud surface microstructure and extraction mechanism. The optimal extraction conditions of the UPE were 60% methanol solution, 400 MPa of extraction pressure, 3 min of extraction time, and 1:30 (g/mL) solid:liquid ratio. Under the optimized conditions, the total extraction yield of 10 active components was 57.62 mg/g. All the components showed good linearity (r2 ≥ 0.9994) and recoveries. This method was successfully applied to quantify 10 components in 22 batches of L. japonica samples from different areas. Compared with heat reflux extraction and ultrasonic-assisted extraction, UPE can be considered as an alternative extraction technique for fast extraction of active ingredient from L. japonica.

  2. Inhibition of COX-2 and PGE2 in LPS-stimulated RAW264.7 cells by lonimacranthoide VI, a chlorogenic acid ester saponin

    PubMed Central

    GUAN, FUQIN; WANG, HAITING; SHAN, YU; CHEN, YU; WANG, MING; WANG, QIZHI; YIN, MIN; ZHAO, YOUYI; FENG, XU; ZHANG, JIANHUA

    2014-01-01

    Lonimacranthoide VI, first isolated from the flower buds of Lonicera macranthoides in our previous study, is a rare chlorogenic acid ester acylated at C-23 of hederagenin. In the present study, the anti-inflammatory effects of lonimacranthoide VI were studied. Lipopolysaccharides (LPS) induced an inflammatory response through the production of prostaglandin E2 (PGE2), and these levels were reduced when lonimacranthoide VI was pre-administered. Additionally, the mechanism of the anti-inflammatory effects of lonimacranthoide VI was investigated by measuring cyclooxygenase (COX) activity and mRNA expression. The results showed that lonimacranthoide VI inhibited mRNA expression and in vitro activity of COX-2 in a dose-dependent manner, whereas only the higher lonimacranthoide VI concentration possibly reduced COX-1 expression and in vitro activity. Taken together, these results indicate that lonimacranthoide VI is an important anti-inflammatory constituent of Lonicera macranthoides and that the anti-inflammatory effect is attributed to the inhibition of PGE2 production through COX activity and mRNA expression. PMID:25054024

  3. Degradation Dynamics and Dietary Risk Assessments of Two Neonicotinoid Insecticides during Lonicera japonica Planting, Drying, and Tea Brewing Processes.

    PubMed

    Fang, Qingkui; Shi, Yanhong; Cao, Haiqun; Tong, Zhou; Xiao, Jinjing; Liao, Min; Wu, Xiangwei; Hua, Rimao

    2017-03-01

    The degradation dynamics and dietary risk assessments of thiamethoxam and thiacloprid during Lonicera japonica planting, drying, and tea brewing processes were systematically investigated using high-performance liquid chromatography. The half-lives of thiamethoxam and thiacloprid were 1.0-4.1 d in the honeysuckle flowers and leaves, with degradation rate constants k ranging from -0.169 to -0.696. The safety interval time was 7 d. The sun- and oven-drying (70 °C) percent digestions were 59.4-81.0% for the residues, which were higher than the shade- and oven-drying percentages at lower temperatures (30, 40, 50, and 60 °C, which ranged from 37.7% to 57.0%). The percent transfers of thiamethoxam and thiacloprid were 0-48.4% and 0-25.2%, respectively, for the different tea brewing conditions. On the basis of the results of this study, abiding by the safety interval time is important, and using reasonable drying methods and tea brewing conditions can reduce the transfer of thiamethoxam and thiacloprid to humans.

  4. [Grades evaluation of Scutellariae Radix slices based on quality constant].

    PubMed

    Deng, Zhe; Zhang, Jun; Jiao, Meng-Jiao; Zhong, Wen; Cui, Wen-Jin; Cheng, Jin-Tang; Chen, Sha; Wang, Yue-Sheng; Liu, An

    2017-05-01

    By measuring the morphological indexes and the marker components content of 22 batches of Scutellariae Radix slices as well as calculating the quality constant, this research was aimed to establish a new method of evaluating the specifications and grades of Scutellariae Radix slices. The quality constants of these samples were in the range of 0.04-0.49, which can be divided into several grades based on the real requirement. If they were divided into three grades, the quality constant was ≥0.39 for the first grade, <0.39 but ≥0.24 for the second grade, and <0.24 for the third grade. This work indicated that the quality constants characterizing both apparent parameters and intrinsic quality can be used as a comprehensive evaluation index to classify the grades of traditional Chinese medicine quantitatively, clearly and objectively. The research results in this paper would provide new ideas and references for evaluating the specifications and grades of traditional Chinese medicines. Copyright© by the Chinese Pharmaceutical Association.

  5. Comparative pharmacokinetics study of three anthraquinones in rat plasma after oral administration of Radix et Rhei Rhizoma extract and Dahuang Fuzi Tang by high performance liquid chromatography-mass spectrometry.

    PubMed

    Li, Huan; Guo, Hui; Wu, Li; Zhang, Yongxin; Chen, Juan; Liu, Xiao; Cai, Hao; Zhang, Kewei; Cai, Baochang

    2013-03-25

    A specific and sensitive high performance liquid chromatography-mass spectrometric (HPLC-MS) method has been developed and validated for simultaneous determination of three anthraquinones of rhein, aloe-emodin and emodin in rat plasma after oral administration of Radix et Rhei Rhizoma extract and Dahuang Fuzi Tang. The analytes were separated on a Kromaisl(®) C(18) column within a total running time of 12min with a mobile phase of methanol:ammonium acetate (3mM) (75:25, v/v). The calibration curves for all the anthraquinones showed good linearity in the measured range with correlation coefficient (r) higher than 0.9978. The precision, accuracy, recovery and stability were deemed acceptable. The method was successfully applied to the comparative pharmacokinetics study of the anthraquinones in rat plasma after oral administration of Radix et Rhei Rhizoma extract and Dahuang Fuzi Tang. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Study on Quality Standard of Processed Curcuma Longa Radix

    PubMed Central

    Zhao, Yongfeng; Quan, Liang; Zhou, Haiting; Cao, Dong; Li, Wenbing; Yang, Zhuo

    2017-01-01

    To control the quality of Curcuma Longa Radix by establishing quality standards, this paper increased the contents of extract and volatile oil determination. Meanwhile, the curcumin was selected as the internal marker, and the relative correlation factors (RCFs) of demethoxycurcumin and bisdemethoxycurcumin were established by high performance liquid chromatography (HPLC). The contents of multicomponents were calculated based on their RCFs. The rationality and feasibility of the methods were evaluated by comparison of the quantitative results between external standard method (ESM) and quantitative analysis of multicomponents by single-marker (QAMS). Ethanol extracts ranged from 9.749 to 15.644% and the mean value was 13.473%. The volatile oil ranged from 0.45 to 0.90 mL/100 g and the mean value was 0.66 mL/100 g. This method was accurate and feasible and could provide a reference for further comprehensive and effective control of the quality standard of Curcuma Longa Radix and its processed products. PMID:29375640

  7. Distance Travelled: Outcomes and Evidence in Flexible Learning Options

    ERIC Educational Resources Information Center

    Thomas, Joseph; McGinty, Sue; te Riele, Kitty; Wilson, Kimberley

    2017-01-01

    Flexible learning options (FLOs) provide individualised learning pathways for disengaged young people with strong emphasis on inclusivity and wellbeing support. Amidst a rapid expansion of Australia's flexible learning sector, service providers are under increasing pressure to substantiate participant outcomes. This paper stems from a national…

  8. [Correspondence analysis between traditional commercial specifications and quantitative quality indices of Notopterygii Rhizoma et Radix].

    PubMed

    Jiang, Shun-Yuan; Sun, Hong-Bing; Sun, Hui; Ma, Yu-Ying; Chen, Hong-Yu; Zhu, Wen-Tao; Zhou, Yi

    2016-03-01

    This paper aims to explore a comprehensive assessment method combined traditional Chinese medicinal material specifications with quantitative quality indicators. Seventy-six samples of Notopterygii Rhizoma et Radix were collected on market and at producing areas. Traditional commercial specifications were described and assigned, and 10 chemical components and volatile oils were determined for each sample. Cluster analysis, Fisher discriminant analysis and correspondence analysis were used to establish the relationship between the traditional qualitative commercial specifications and quantitative chemical indices for comprehensive evaluating quality of medicinal materials, and quantitative classification of commercial grade and quality grade. A herb quality index (HQI) including traditional commercial specifications and chemical components for quantitative grade classification were established, and corresponding discriminant function were figured out for precise determination of quality grade and sub-grade of Notopterygii Rhizoma et Radix. The result showed that notopterol, isoimperatorin and volatile oil were the major components for determination of chemical quality, and their dividing values were specified for every grade and sub-grade of the commercial materials of Notopterygii Rhizoma et Radix. According to the result, essential relationship between traditional medicinal indicators, qualitative commercial specifications, and quantitative chemical composition indicators can be examined by K-mean cluster, Fisher discriminant analysis and correspondence analysis, which provide a new method for comprehensive quantitative evaluation of traditional Chinese medicine quality integrated traditional commodity specifications and quantitative modern chemical index. Copyright© by the Chinese Pharmaceutical Association.

  9. [Analysis of supercritical fluid extracts of Radix caulophylli with gas chromatography-mass spectrometry].

    PubMed

    Wang, Si-Cen; Chen, Qin-Hua; Wei, Yao-Yuan; Li, Han-Wen; He, Lang-Chong

    2007-05-01

    To analyze the constituents in supercritical fluid CO2 extraction (SFE-CO2) of Radix caulophylli, the Radix caulophylli was extracted with SFE-CO2, and analyzed by gas chromatography-mass spectrometry (GC-MS). The GC-MS analysis with a DB-5MS capillary column (30 mm x 0.32 mm ID, 0.25 microm film thickness) was used. The inlet temperature was maintained at 280 degrees C. The column oven was held at 80 degrees C for 2 min, then programmed from 80 to 280 degrees C at 5 degrees C x min(-1) and, finally, held for 4 min. Helium at a constant flow rate of 2.0 mL x min(-1) was used as the carrier gas. The mass spectrometry conditions were as follows: ionization energy, 70 eV; ion source temperature, 200 degrees C. The mass selective detector was operated in the TIC mode (m/z was from 40 - 500). For the first time 49 peaks were separated and identified, the compounds were quantitatively determined by normalization method, and the identified compounds represent 97.44% of total GC peak areas. Viz, n-hexadecanoic acid (31.4%), (E, E) -9, 12-octadecadienoic acid (26.54%), (Z)-7-tetradecenal (9.4%), hexadecenoic acid (3.23%), 10-undecenal (3.22%), octadecanoic acid (2.25%), and caulophylline (1.76%) etc. The results will provide important foundation for understanding the constituents and further exploitation of Radix caulophylli.

  10. The membrane permeability of Astragali Radix-derived formononetin and calycosin is increased by Angelicae Sinensis Radix in Caco-2 cells: a synergistic action of an ancient herbal decoction Danggui Buxue Tang.

    PubMed

    Zheng, Ken Yu-zhong; Choi, Roy Chi-yan; Guo, Ava Jiang-yang; Bi, Cathy Wen-chuan; Zhu, Kevin Yue; Du, Crystal Ying-qing; Zhang, Zhen-Xia; Lau, David Tai-wai; Dong, Tina Ting-xia; Tsim, Karl Wah-keung

    2012-11-01

    Danggui Buxue Tang (DBT), a herbal decoction contains Astragali Radix (AR) and Angelicae Sinensis Radix (ASR), has been used as a health food supplement in treating menopausal irregularity in women for more than 800 years in China. Several lines of evidence indicate that the synergistic actions of AR and ASR in this herbal decoction leading to a better pharmacological effect of DBT. Here, the role of different herbs in directing the transport of active ingredients of DBT was determined. A validated RRLC-QQQ-MS/MS method was applied to determinate the permeability of ingredients across the Caco-2 cell monolayer. AR-derived chemicals, including astragaloside IV, calycosin and formononetin, as well as ASR-derived chemicals, including ferulic acid and ligustilide, were determined by RRLC-QQQ-MS/MS. The pharmacokinetic results showed that the membrane permeabilities of calycosin and formononetin, two of the major flavonoids in AR, could be markedly increased in the presence of ASR extract: this induction effect could be mediated by ferulic acid deriving from ASR. In contrast, the extract of AR showed no effect on the chemical permeability. The current results suggested that the ingredients of ASR (such as ferulic acid) could enhance the membrane permeability of AR-derived formononetin and calycosin in cultured Caco-2 cells. The possibility of herb-drug synergy within DBT was proposed here. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. [Preparation of flavonoid reference standards from Scutellariae Radix under the guidance of high performance liquid chromatography-mass spectrometry analysis].

    PubMed

    Guo, Henan; Yang, Xuedong; Liu, Jun; Zheng, Wenfeng

    2012-07-01

    Flavonoid reference standards were targeted-prepared from Scutellariae Radix under the guidance of high performance liquid chromatography-mass spectrometry (HPLC-MS) analysis. With HPLC-MS analysis of Scutellariae Radix, 19 flavonoid components were identified by analyzing and comparing their retention times, ultraviolet spectra, and mass spectrometry data with literature. The separation and purification protocols of all targeted flavonoid reference standards were optimally designed according to the results of HPLC-MS analysis and related literature. The ethanol extract of Scutellariae Radix was suspended in water and extracted with petroleum ether, ethyl acetate, and n-butanol successively. The ethyl acetate extract and n-butanol extract were separately subjected to primary separation by low pressure reverse phase preparative chromatography. Then the fractions containing targeted compounds were further purified by low pressure reverse and normal phases preparative chromatography. Finally, baicalin and wogonoside reference standards were obtained from n-butanol extract; baicaelin, wogonin, and oroxylin A reference standards were obtained from ethyl acetate extract. The structures of the 5 reference standards were identified by mass spectrometry (MS) and 1H nuclear magnetic resonance (1H NMR) spectroscopy. The HPLC analytical results showed that the purities of the 5 reference standards were all above 98%. It is demonstrated that the rapid targeted-preparation method under the guidance of the HPLC-MS analysis is applicable for the isolation and preparation of chemical components in traditional Chinese medicines.

  12. Endodontic Management of a Mandibular First Molar with Radix Entomolaris and Conservative Post-endodontic Restoration with CAD/CAM Onlay: A Novel Clinical Technique

    PubMed Central

    De Ataide, Ida De Noronha; Fernandes, Marina; Lambor, Rajan; Alreja, Dalip

    2016-01-01

    This case report describes a novel technique of restoring endodontically treated teeth. Hidden caries causing irreversible pulpitis in a mandibular molar with Radix Entomolaris (RE) was evident. The intact occlusal surface anatomy was duplicated before preparing an access cavity to replicate the original occlusal surface in the post endodontic restoration using (Computer-Aided Design and Computer-Aided Manufacturing) CAD/CAM technique. This report highlights uniquely designed onlay utilizing the benefits of contemporary materials and advanced technology. PMID:28050515

  13. Chemical constituents of radix Ranunculus ternati.

    PubMed

    Zhao, Yun; Ruan, Jin-Lan; Wang, Jin-Hui; Cong, Yue; Song, Shuang; Cai, Ya-Ling; Fang, Wei; Zhou, Dao-Nian

    2008-02-15

    3 Beta-acetoxy-(20S, 22E)-dammaran-22-en-25-ol, a new triterpene, was isolated along with five known triterpenes (ursolic acid, oleanolic acid, betulinic acid, 3-epiocotillol acetate, and dimmarenediol II acetate), and alpha-D-glc and sucrose from Radix Ranunculus ternati All of them, except oleanolic acid and alpha-D-glc, were isolated from the family of Ranunculaceae for the very first time, and the NMR data of sucrose was first described. In addition, the absolute configurations of alpha-D-glc and the glucose component of sucrose were determined.

  14. Herbicide treatments for controlling invasive bush honeysuckle in a mature hardwood forest in West-Central Indiana

    Treesearch

    Ron Rathfon; Keith Ruble

    2007-01-01

    Asian bush honeysuckles (Lonicera maackii [Rupr.] Maxim, L. morrowii Gray, and L. tartarica L.) have proved extremely invasive in eastern hardwood forests. In addition to displacing native forest ground flora and associated fauna, these understory shrubs pose a threat to forest regeneration. Effective control strategies need to be...

  15. Evolution of marginal populations of an invasive vine increases the likelihood of future spread

    Treesearch

    Francis F. Kilkenny; Laura F. Galloway

    2015-01-01

    The prediction of invasion patterns may require an understanding of intraspecific differentiation in invasive species and its interaction with climate change. We compare Japanese honeysuckle (Lonicera japonica) plants from the core (100-150 yr old) and northern margin (< 65 yr old) of their North American invaded range to determine whether evolution...

  16. Snagging, Clearing, and Shelterbelt for Flood Control, Snake River, Minnesota.

    DTIC Science & Technology

    1982-01-01

    Allegheny blackberry (Rubus - allegheniensis), buffaloberry (Shepherdia argentea), chokecherry (Prunus virginiana), honeysuckle (Lonicera tartarica...wolfberry (Symphori- carpos occidentalis), chokecherry , gooseberry (Ribes missouriensis), and wild grape (Vitis sp.), as well as several others. 2.27...American plum, and black willow (Salix niara). Farther away from the river a shrub layer is present consisting of chokecherry , raspberry (Rubus

  17. Underplanting cherrybark oak (Quercus pagoda Raf.) seedlings on a bottomland site in the southern United States

    Treesearch

    Emile S. Gardiner; Jimmie L. Yeiser

    2006-01-01

    We initiated a study on a bottomland site in the southern United States to examine the effects of Japanese honeysuckle (Lonicera japonica Thunberg) control and seedlings of two root classes on survival and growth of underplanted cherrybark oak (Quercus pagoda Raf.) seedlings. Three honeysuckle control treatments were assigned to...

  18. Potential impacts of year-round sampling on monitoring presence- absence of invasive flora in the southern United States

    Treesearch

    Christopher M. Oswalt; Sonja N. Oswalt; W. Keith Moser

    2012-01-01

    Studies suggest that the southern United States is an area of primary concern with regards to the spread of nonnative invasive plant species. Recent data show that species such as Japanese honeysuckle (Lonicera japonica) and Nepalese browntop (Microstegium vimineum) are invading forests and displacing native species throughout the...

  19. ["Re-evaluation upon suspected event" is an approach for post-marketing clinical study: lessons from adverse drug events related to Bupleuri Radix preparations].

    PubMed

    Wu, Shu-Xin; Sun, Hong-Feng; Yang, Xiao-Hui; Long, Hong-Zhu; Ye, Zu-Guang; Ji, Shao-Liang; Zhang, Li

    2014-08-01

    We revisited the "Xiao Chaihu Decoction event (XCHDE)" occurred in late 1980s in Japan and the Bupleuri Radix related adverse drug reaction (ADR) reports in China After careful review, comparison, analysis and evaluation, we think the interstitial pneumonitis, drug induced Liver injury (DILI) and other severe adverse drug envents (ADEs) including death happened in Japan is probably results from multiple factors, including combinatory use of XCHDE with interferon, Kampo usage under modern medicine theory guidance, and use of XCHD on the basis of disease diagnosis instead of traditional Chinese syndrome complex differentiation. There are less ADE case reports related to XCHD preparation in China compared to Japan, mostly manifest with hypersensitivity responses of skin and perfuse perspiration. The symptoms of Radix Bupleuri injection related ADEs mainly manifest hypersensitivity-like response, 2 cases of intravenous infusion instead of intramuscular injection developed hypokalemia and renal failure. One case died from severe hypersensitivity shock. In Chinese literatures, there is no report of the interstitial pneumonitis and DILI associated with XCHDG in Japan. So far, there is no voluntary monitoring data and large sample clinical research data available. The author elaborated the classification of "reevaluation" and clarified "re-evaluation upon events" included the reaction to the suspected safety and efficacy events. Based on the current status of the clinical research on the Radix Bupleuri preparations, the author points out that post-marketing "re-evaluation upon suspected event" is not only a necessity of continuous evaluation of the safety, efficacy of drugs, it is also a necessity for providing objective clinical research data to share with the international and domestic drug administrations in the risk-benefit evaluation. It is also the unavoidable pathway to culture and push the excellent species and famous brands of TCM to the international market, in that it enhances the pharmaceutical manufactures the ability to control enterprise risk and eliminate the negative impact on traditional Chinese medicine. With the widely used and ADR report concentrated Radix Bupleuri injection as an example, the author provide a new approach to post-marketing clinical research.

  20. In vivo pharmacokinetic comparisons of ferulic acid and puerarin after oral administration of monomer, medicinal substance aqueous extract and Nao-De-Sheng to rats

    PubMed Central

    Ouyang, Zhen; Zhao, Ming; Tang, Jianming; Pan, Lulin

    2012-01-01

    Background: Nao-De-Sheng decoction (NDS), a traditional Chinese medicine (TCM) prescription containing Radix puerariae lobatae, Floscarthami, Radix et Rhizoma Notoginseng, Rhizoma chuanxiong and Fructus crataegi, is effective in the treatment of cerebral arteriosclerosis, ischemic cerebral stroke and apoplexy linger effect. Ferulic acid and puerarin are the main absorbed effective ingredients of NDS. Objective: To assess the affection of other components in medical material and compound recipe compatibility on the pharmacokinetics of ferulaic acid and puerarin, of ferulic acid from the monomer Rhizoma chuanxiong aqueous extract and NDS were studied. And pharmacokinetics comparisons of puerarin from the monomer Radix puerariae extract and NDS decoction were investigated simultaneously. Materials and Methods: At respective different time points after oral administration of the monomer, medicinal substance aqueous extract and NDS at the same dose in rats, plasma concentrations of ferulic acid and puerarin in rats were determined by RP-HPLC, and the main pharmacokinetic parameters were estimated with 3P97 software. Results: The plasma concentration-time curves of ferulaic acid and puerarin were both best fitted with a two-compartment model. AUC0−t, AUC0→∞, Tmax, and Cmax of ferulic acid in the monomer and NDS decoction were increased significantly (P < 0.05) compared with that in Rhizoma chuanxiong aqueous extract. And statistically significant increase (P < 0.05) in pharmacokinetic parameters of puerarin including AUC0−t, AUC0→∞, CL, Tmax and Cmax were obtained after oral administration of puerarin monomer compared with Radix puerariae extract. Although the changes of AUC0−t, AUC0→∞ and CL had no statistically significant, Cmax of puerarin in NDS was increased remarkably (P < 0.05) compared with that in single puerarin. Conclusions: Some ingredients of Rhizoma chuanxiong and Radix puerariae may be suggested to remarkably influence plasma concentrations of ferulaic acid and puerarin. Some ingredients in NDS may increase dissolution and absorption of ferulaic acid and puerarin, delay elimination, and subsequently enhance bioavailability of ferulaic acid and puerarin in rats after compatibility. PMID:24082627

  1. Comparative Analysis of Compatibility Effects on Invigorating Blood Circulation for Cyperi Rhizoma Series of Herb Pairs Using Untargeted Metabolomics

    PubMed Central

    Liu, Pei; Shang, Er-Xin; Zhu, Yue; Yu, Jin-Gao; Qian, Da-Wei; Duan, Jin-Ao

    2017-01-01

    The mutual-assistance compatibility of Cyperi Rhizoma (Xiangfu, XF) and Angelicae Sinensis Radix (Danggui, DG), Chuanxiong Rhizoma (Chuanxiong, CX), Paeoniae Radix Alba (Baishao, BS), or Corydalis Rhizoma (Yanhusuo, YH), found in a traditional Chinese medicine (TCM) named Xiang-Fu-Si-Wu Decoction (XFSWD), can produce synergistic and promoting blood effects. Nowadays, XFSWD has been proved to be effective in activating blood circulation and dissipating blood stasis. However, the role of the herb pairs synergistic effects in the formula were poorly understood. In order to quantitatively assess the compatibility effects of herb pairs, mass spectrometry-based untargeted metabolomics studies were performed. The plasma and urine metabolic profiles of acute blood stasis rats induced by adrenaline hydrochloride and ice water and administered with Cyperi Rhizoma—Angelicae Sinensis Radix (XD), Cyperi Rhizoma—Chuanxiong Rhizoma (XC), Cyperi Rhizoma—Paeoniae Radix Alba (XB), Cyperi Rhizoma—Corydalis Rhizoma (XY) were compared. Relative peak area of identified metabolites was calculated and principal component analysis (PCA) score plot from the potential markers was used to visualize the overall differences. Then, the metabolites results were used with biochemistry indicators and genes expression values as parameters to quantitatively evaluate the compatibility effects of XF series of herb pairs by PCA and correlation analysis. The collective results indicated that the four XF herb pairs regulated glycerophospholipid metabolism, steroid hormone biosynthesis and arachidonic acid metabolism pathway. XD was more prominent in regulating the blood stasis during the four XF herb pairs. This study demonstrated that metabolomics was a useful tool to efficacy evaluation and compatibility effects of TCM elucidation. PMID:29018346

  2. Identification and determination of flavonoids in astragali radix by high performance liquid chromatography coupled with DAD and ESI-MS detection.

    PubMed

    Lv, Yan-Wen; Hu, Wei; Wang, Yu-Ling; Huang, Lan-Fang; He, Yun-Biao; Xie, Xian-Zhen

    2011-03-09

    A method for the analysis of flavonoids in Astragali Radix by high-performance liquid chromatography (HPLC) combined with photodiode-array detection (DAD) and an electrospray ionization (ESI)--mass spectrometry (MS) was developed. After the samples were extracted with ethanol, the optimum separation conditions for these analytes were achieved using a gradient elution system and a 2.0 x 150 mm Shimadzu VP-ODS column. Eight flavonoids were identified to exist in Astragali Radix based on their characteristic UV data and mass spectra. The concentrations of three major components in this herb--ononin, calycosin and formononetin--were determined by LC/ESI-MS in positive selective ion monitoring (SIM) mode. The calibration curves were linear in the range of 0.9~180.0 μg·mL⁻¹ for ononin, 1.8~360.0 μg·mL⁻¹ for calycosin and 1.4~280 μg·mL⁻¹ for formononetin, respectively. The limits of quantification (LOQ) and detection (LOD) were 0.9 μg· mL⁻¹ and 0.2 μg mL⁻¹ for ononin, 1.8 μg mL⁻¹ and 0.5 μg·mL-1 for calycosin, 1.4 μg mL⁻¹ and 0.5 μg·mL⁻¹ for formononetin, respectively. The standard recoveries were between 95.4~104.7%. The developed method was proven to be useful for the quantitative and qualitative analysis of flavonoid constituents in various resources of Astragali Radix.

  3. Occurrence of chai hu (Bupleuri radix) in prescriptions of Chinese herbal medicine in Switzerland.

    PubMed

    Klein, Sabine D; Becker, Simon; Wolf, Ursula

    2012-01-01

    Chai hu (Bupleuri radix), one of the most frequently used herbs in Chinese herbal medicine, has 3 major functions, depending on dosage and combination with other herbs. The aim of this study was to investigate how chai hu is prescribed in everyday practice in Switzerland, and whether these prescription patterns reflect its various applications. A random sample of 1,053 prescriptions was drawn from the database of Lian Chinaherb AG, Wollerau, Switzerland, and analyzed regarding the most frequently used classical formulas containing chai hu, daily dosages and combinations with other herbs. 29.0% of all prescriptions contained chai hu, and 98.0% of these were in granular form. The most frequently used classical formulas were xiao yao san ('rambling powder'), jia wei xiao yao san ('augmented rambling powder') and chai hu shu gan san ('Bupleurum powder to spread the liver'). In more than half of the prescriptions, chai hu was combined with bai shao (Paeoniae Radix Alba), dang gui (Angelicae sinensis radix) or fu ling (Poria). 51.8% of the prescriptions contained a low daily dosage of chai hu, 24.9% a medium and 15.1% a high dosage. Chai hu was generally prescribed in classic combinations with other herbs and in a medium dosage. Due to the addition of supplementary herbs to classical formulas, its daily dose was often diminished from a high or medium dose to a low dose. This raises the question if chai hu would then still exert its desired function of, e.g., moving liver-qi in these prescriptions.

  4. Facilitated Visual Interpretation of Scores in Principal Component Analysis by Bioactivity-Labeling of 1H-NMR Spectra-Metabolomics Investigation and Identification of a New α-Glucosidase Inhibitor in Radix Astragali.

    PubMed

    Liu, Yueqiu; Nyberg, Nils T; Jäger, Anna K; Staerk, Dan

    2017-03-06

    Radix Astragali is a component of several traditional medicines used for the treatment of type 2 diabetes in China. Radix Astragali is known to contain isoflavones, which inhibit α-glucosidase in the small intestines, and thus lowers the blood glucose levels. In this study, 21 samples obtained from different regions of China were extracted with ethyl acetate, then the IC50-values were determined, and the crude extracts were analyzed by 1H-NMR spectroscopy. A principal component analysis of the 1H-NMR spectra labeled with their IC50-values, that is, bioactivity-labeled 1H-NMR spectra, showed a clear correlation between spectral profiles and the α-glucosidase inhibitory activity. The loading plot and LC-HRMS/NMR of microfractions indicated that previously unknown long chain ferulates could be partly responsible for the observed antidiabetic activity of Radix Astragali. Subsequent preparative scale isolation revealed a compound not previously reported, linoleyl ferulate (1), showing α-glucosidase inhibitory activity (IC50 0.5 mM) at a level comparable to the previously studied isoflavones. A closely related analogue, hexadecyl ferulate (2), did not show significant inhibitory activity, and the double bonds in the alcohol part of 1 seem to be important structural features for the α-glucosidase inhibitory activity. This proof of concept study demonstrates that bioactivity-labeling of the 1H-NMR spectral data of crude extracts allows global and nonselective identification of individual constituents contributing to the crude extract's bioactivity.

  5. Correlation between synergistic action of Radix Angelica dahurica extracts on analgesic effects of Corydalis alkaloid and plasma concentration of dl-THP.

    PubMed

    Liao, Zheng-Gen; Liang, Xin-Li; Zhu, Jing-Yun; Zhao, Guo-Wei; Yang, Ming; Wang, Guang-Fa; Jiang, Qie-Ying; Chen, Xu-Long

    2010-05-04

    Yuanhu Zhitong prescription that consists of Corydalis yanhusuo and Radix Angelicae dahuricae has been used for the treatment of gastralgia, costalgia, headache and dysmenorrhea in Traditional Chinese Medicine. Our previous studies demonstrated that Corydalis alkaloid (CA, derived from the root of Corydalis yanhusu) had potent analgesic properties, and the total coumarins of Angelica dahurica (Cou) and volatile oil (VO) that derived from the root of Radix Angelicae dahuricae all could increase the analgesic effect of CA. The major objective of this paper was to investigate the mechanism that leading the analgesia of CA increased by Cou and (or) VO. The relationship between analgesic effect of CA and the plasma concentration of Dl-tetrahydropalmatine (dl-THP, active component of CA) was assayed in mice writhing test. The CA (34, 68 and 134 mg/kg) reduced the nociception by acetic acid intraperitoneal injection in a dose-dependent manner, and there was a significant linear relationship between the analgesic effect of CA and the plasma concentration of dl-THP. Then the plasma concentration of dl-THP at different time intervals in rats after oral administration of CA, CA-Cou, CA-VO and CA-Cou-VO were examined by using HPLC. The results indicated that Cou and (or) VO raised the plasma concentration of dl-THP prominently. In conclusion, the reason that Radix Angelica dahurica extracts reinforced the analgesic effects of Corydalis alkaloid was related to the improvement of the plasma concentration of dl-THP. (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  6. Combined effects of fangchinoline from Stephania tetrandra Radix and formononetin and calycosin from Astragalus membranaceus Radix on hyperglycemia and hypoinsulinemia in streptozotocin-diabetic mice.

    PubMed

    Ma, Wenjie; Nomura, Masaaki; Takahashi-Nishioka, Tatsuo; Kobayashi, Shinjiro

    2007-11-01

    The anti-hyperglycemic action of Stephania tetrandra Radix (Stephania) is potentiated by Astragalus membranaceus BUNGE Radix (Astragali) in streptozotocin (STZ)-diabetic ddY mice (Tsutsumi et al., Biol. Pharm. Bull., 26, 313 (2003)). Fangchinoline (0.3-3 mg/kg), a main constituent of Stephania, decreased the high level of blood glucose and increased the low level of blood insulin in STZ-diabetic mice. Here, we investigated the combined effects of fangchinoline with isoflavone or isoflavonoid components (formononetin, calycosin and ononin) of Astragali on the hyperglycemia and hypoinsulinemia of STZ-diabetic mice. Formononetin, calycosin and ononin (0.03-0.1 mg/kg) alone did not affect the blood glucose or blood insulin level of the diabetic mice. Formononetin and calycosin (0.03-0.1 mg/kg) potentiated the anti-hyperglycemic action of fangchinoline (0.3 mg/kg), but ononin did not. Formononetin (0.1 mg/kg) facilitated the fangchinoline-induced insulin release, and calycosin (0.1 mg/kg) also facilitated it, though without statistical significance. In conclusion, the combined effect of fangchinoline with formononetin and calycosin on hyperglycemia in the diabetic mice accounted well for the therapeutic effect of the combination of Stephania with Astragali in Boi-ogi-to. The anti-hyperglycemic action of formononetin appeared to be due to its potentiating action on insulin release. Our strategy for studying combinations of crude drugs and their components in Kampo medicine has uncovered new potentiating effects of formononetin and calycosin on the anti-hyperglycemic action of fangchinoline in STZ-diabetic mice.

  7. Enhanced extraction of astragalosides from Radix Astragali by negative pressure cavitation-accelerated enzyme pretreatment.

    PubMed

    Yan, Ming-Ming; Chen, Cai-Yun; Zhao, Bao-Shan; Zu, Yuan-Gang; Fu, Yu-Jie; Liu, Wei; Efferth, Thomas

    2010-10-01

    The optimal conditions for extraction of astragalosides III and IV (AGs III and IV) in Radix Astragali by negative pressure cavitation-accelerated enzyme pretreatment were studied on the basis of a Box-Behnken design and response surface methodology. Experimental results showed that negative pressure, amount of enzyme and incubation temperature were the main factors governing the enzyme pretreatment of Radix Astragali. The optimum parameters were obtained as follows: negative pressure -0.08 Mpa, amount of enzyme 1.48% (w/w of materials) and incubation temperature 45 degrees C. Under the optimal conditions, the maximal extraction yields of AGs III and IV were 0.103 and 0.325 mg/g, which were 41.67% and 65.31% increased as compared to those without enzyme pretreatment, respectively. The effect of negative pressure cavitation and enzyme pretreatment on the structural changes of plant cells was observed by scanning electron microscopy. In conclusion, negative pressure cavitation-accelerated enzyme pretreatment was proved to be environment-friendly and economical, and could be used in secondary metabolites production. Copyright 2010 Elsevier Ltd. All rights reserved.

  8. Performance of Point and Range Queries for In-memory Databases using Radix Trees on GPUs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alam, Maksudul; Yoginath, Srikanth B; Perumalla, Kalyan S

    In in-memory database systems augmented by hardware accelerators, accelerating the index searching operations can greatly increase the runtime performance of database queries. Recently, adaptive radix trees (ART) have been shown to provide very fast index search implementation on the CPU. Here, we focus on an accelerator-based implementation of ART. We present a detailed performance study of our GPU-based adaptive radix tree (GRT) implementation over a variety of key distributions, synthetic benchmarks, and actual keys from music and book data sets. The performance is also compared with other index-searching schemes on the GPU. GRT on modern GPUs achieves some of themore » highest rates of index searches reported in the literature. For point queries, a throughput of up to 106 million and 130 million lookups per second is achieved for sparse and dense keys, respectively. For range queries, GRT yields 600 million and 1000 million lookups per second for sparse and dense keys, respectively, on a large dataset of 64 million 32-bit keys.« less

  9. Potential Beneficial Effects of Si-Wu-Tang on White Blood Cell Numbers and the Gastrointestinal Tract of γ-Ray Irradiated Mice

    PubMed Central

    Ni, Jin; Romero-Weaver, Ana L.; Kennedy, Ann R.

    2014-01-01

    Si-Wu-Tang (SWT) is a decoction consisting of a mixture of ingredients of Rehmanniae Radix, Angelica Radix, Chuanxiong Rhizoma and Paeoniae Radix. As a traditional Chinese herbal decoction, SWT has been widely used for the treatment of diseases characterized as blood and/or energy deficit. The present study was performed to evaluate the effects of SWT on the different populations of circulating white blood cells (WBCs) and gastrointestinal changes in γ-ray irradiated mice. Female mice were treated daily with orally administered SWT seven days before irradiation, until one day before irradiation or until one day before sample collection. WBC counts were determined from peripheral blood samples taken from the mice at different times post-irradiation. Hematoxylin and eosin (H&E) staining, as well as immunohistochemical analysis of fibrinogen, were utilized to evaluate the effects of SWT in the intestines of mice after radiation exposure. The results of the present studies demonstrate that SWT has protective effects against radiation damage to circulating WBCs, specifically to lymphocytes, and to the gastrointestinal tract of the irradiated animals. PMID:25324699

  10. Establishment of A431 cell membrane chromatography-RPLC method for screening target components from Radix Caulophylli.

    PubMed

    Hou, Xiaofang; Wang, Sicen; Hou, Jingjing; He, Langchong

    2011-03-01

    We describe here an analytical method of A431 cell membrane chromatography (A431/CMC) (CMC, cell membrane chromatography) combined with RPLC for recognition, separation, and identification of target components from traditional Chinese medicines (TCMs) Radix Caulophylli. The A431 cells with high expressed epidermal growth factor receptor (EGFR) were used to prepare the stationary phase in the CMC model. Retention fractions on the A431-CMC model were collected using an automated fraction collection and injection module (FC/I). Each fraction was analyzed by RPLC under the optimized conditions. Gefitinib and erlotinib were used as standard compounds to investigate the suitability and reliability of the A431 cell membrane chromatography-RPLC method prior to screening target component from Radix Caulophylli total alkaloids. The results indicated that caulophine and taspine were the target component acting on the epidermal growth factor receptor. This method could be an efficient way in drug discovery using natural medicinal herbs as a source of novel compounds. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Pilot study on control of phytoplankton by zooplankton coupling with filter-feeding fish in surface water.

    PubMed

    Ma, Hua; Cui, Fuyi; Liu, Zhiquan; Fan, Zhenqiang

    2009-01-01

    A pilot-scale facility was originally designed to control phytoplankton in algae-laden reservoir water characterized by summer cyanobacteria blooms (mainly Microcystis flos-aquae). The system made good use of the different food habits of Daphnia magna and silver carp. Zooplankton (Daphnia magna), filter-feeding fish (silver carp), and zooplankton (Daphnia magna) were stocked in three separated tanks in sequence, respectively. Thus, single-cell phytoplankton and some Microcystis flos-aquae in small size were first grazed by Daphnia magna in the first tank, and in the second tank phytoplankton larger than 10 microm were filtered by silver carp, and the concentration of the remaining phytoplankton was further reduced to a rather low level by Daphnia magna in the third tank. The results showed that the system had good removal efficiencies of phytoplankton and chlorophyll a, 86.85% and 59.41%, respectively, and permanganate consumption (COD(Mn)) and turbidity were lowered as well. A high phytoplankton removal efficiency and low cost indicated that the system had a good advantage in pre-treating algae-laden source water in drinking water works.

  12. Phosphorus fractionation in sediment cores collected in 2005 before and after onset of an Aphanizomenon flos-aquae bloom in upper Klamath Lake, OR, USA

    USGS Publications Warehouse

    Simon, N.S.; Lynch, D.; Gallaher, T.N.

    2009-01-01

    We tested the hypothesis that there would be measurable losses of phosphorus (P) from surficial sediments of Upper Klamath Lake (UKL), Oregon, if sediments were a source of P during an algal bloom. We compared concentrations of total and forms of P at various depths in cores collected before and after the onset of a large Aphanizomenon flos-aquae bloom. Concentrations of inorganic P were determined in extraction solutions of MgCl2 (1 M, pH 8), citrate-dithionite-bicarbonate, and 1 M HCl. Sediments below 2 cm were dominated by residual P which is defined as total P minus inorganic P. During the study period, data from the top 2-cm of sediment indicated (a) significant decrease in total P concentration, primarily associated with iron oxyhydroxides at one site, and (b) significant increase in total P concentration associated with residual P at a second site. Data from two other sites indicated no net changes in concentrations of total P. ?? 2009 US Government.

  13. The effect of emerald ash borer-caused tree mortality on the invasive shrub Amur honeysuckle and their combined effects on tree and shrub seedlings

    Treesearch

    Brian M. Hoven; David L. Gorchov; Kathleen S. Knight; Valerie E. Peters

    2017-01-01

    Invasive insects and plants are major threats to the health and viability of North American forests. Emerald ash borer (Agrilus planipennis) (EAB) may cause extensive changes to forest composition due to rapid ash (Fraxinus spp.) mortality. Invasive shrubs like Amur honeysuckle (Lonicera maackii) may...

  14. Invasibility and Effects of Amur Honeysuckle in Southwestern Ohio Forests

    Treesearch

    Todd F. Hutchinson; John L. Vankat; John L. Vankat

    1997-01-01

    The Asian exotic Amur honeysuckle (Lonicera maackii [Rupr.] Herder) has become the dominant shrub in many forests in southwestern Ohio and in some other locations in the eastern United States. Our research focused on the invasibility of forest communities and relationships of L. maackii to the abundance of tree seedlings and herbs. We surveyed 93 forest stands near...

  15. Identification and characterization of chlorogenic acids, chlorogenic acid glycosides and flavonoids from Lonicera henryi L. (Caprifoliaceae) leaves by LC-MSn.

    PubMed

    Jaiswal, Rakesh; Müller, Heiko; Müller, Anja; Karar, Mohamed Gamaleldin Elsadig; Kuhnert, Nikolai

    2014-12-01

    The chlorogenic acids, chlorogenic acid glycosides and flavonoids of the leaves of Lonicera henryi L. (Caprifoliaceae) were investigated qualitatively by liquid chromatography tandem mass spectrometry. Thirty-one chlorogenic acids and their glycosides were detected and characterized to their regioisomeric level on the basis of their unique fragmentation pattern in the negative ion mode tandem MS spectra. All of them were extracted for the first time from this source and thirteen of them were not reported previously in nature. For the positive identification of chlorogenic acid glycosides by LC-MS(n), multiple reaction monitoring and targeted MS(n) experiments were performed. We have developed an LC-MS(n) method for the systematic identification of chlorogenic acid glycosides and were also able to discriminate between chlorogenic acids and their isobaric glycosides. It was also possible to discriminate between 5-O-(3'-O-caffeoyl glucosyl)quinic acid and 5-O-(4'-O-caffeoyl glucosyl)quinic acid by LC-MS(n). This method can be applied for the rapid and positive identification of chlorogenic acids and their glycosides in plant materials, food and beverages. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. [Optimization of lime milk precipitation process of Lonicera Japonica aqueous extract based on quality by design concept].

    PubMed

    Shen, Jin-Jing; Gong, Xing-Chu; Pan, Jian-Yang; Qu, Hai-Bin

    2017-03-01

    Design space approach was applied in this study to optimize the lime milk precipitation process of Lonicera Japonica (Jinyinhua) aqueous extract. The evaluation indices for this process were total organic acid purity and amounts of 6 organic acids obtained from per unit mass of medicinal materials. Four critical process parameters (CPPs) including drop speed of lime milk, pH value after adding lime milk, settling time and settling temperature were identified by using the weighted standardized partial regression coefficient method. Quantitative models between process evaluation indices and CPPs were established by a stepwise regression analysis. A design space was calculated by a Monte-Carlo simulation method, and then verified. The verification test results showed that the operation within the design space can guarantee the stability of the lime milk precipitation process. The recommended normal operation space is as follows: drop speed of lime milk of 1.00-1.25 mL•min⁻¹, pH value of 11.5-11.7, settling time of 1.0-1.2 h, and settling temperature of 10-20 ℃.. Copyright© by the Chinese Pharmaceutical Association.

  17. Application of on-line and off-line heart-cutting LC in determination of secondary metabolites from the flowers of Lonicera caerulea cultivar varieties.

    PubMed

    Kula, Marta; Głód, Daniel; Krauze-Baranowska, Mirosława

    2016-11-30

    Lonicera caerulea is a shrub native to the Northen Hemisphere, with its fruits having a long tradition of being used in traditional medicine. The flowers, although a potential source of diverse phenolic compounds have not been studied in terms of phenolic content. In this paper, a 2D LC heart-cutting system, operating in both on-line and off-line modes, was developed and successfully employed in identification and quantification of secondary metabolites in the flowers of L. caerulea. A total of 51 compounds have been resolved and identified as either flavonoids, phenolic acids or iridoids. Flavonoids were the dominating group of compounds, alongside substantial levels of both phenolic acids and iridoids. A comparison between three varieties of L. caerulea flowers revealed that 'Wojtek' contained markedly more flavonols and phenolic acids than the remaining two varieties, whereas iridoids were at similar levels. Heart-cutting 2D LC method used in this study offers a convenient approach and an effective tool for secondary metabolite analysis in L. caerulea flowers, and possibly other species from the genus. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. [Study on seed quality test and quality standard of Lonicera macranthoides].

    PubMed

    Zhang, Ying; Xu, Jin; Li, Long-Yun; Cui, Guang-Lin; She, Yue-Hui

    2016-04-01

    Referring to the rules for agricultural seed testing (GB/T 3543-1995) issued by China, the test of sampling, purity, thousand seed weight, moisture, viability, relative conductivity and germination rate had been studied for seed quality test methods of Lonicera macranthoides. The seed quality from 38 different collection areas was measured to establish quality classification standard by K-means clustering. The results showed that at least 7.5 g seeds should be sampled, and passed 20-mesh sieve for purity analysis.The 500-seed method used to measure thousand seed weight. The moisture was determined by crushed seeds dried in high temperature (130±2) ℃ for 3 h.The viability determined by 25 ℃ 0.1% TTC stained 5h in dark. 1.0 g seeds soaked in 50 ml ultra pure water in 25 ℃ for 12 hours to determine the relative conductivity. The seed by 4 ℃stratification for 80 days were cultured on paper at 15 ℃. Quality of the seeds from different areas was divided into three grades. The primary seed quality classification standard was established.The I grade and II grade were recommend use in production. Copyright© by the Chinese Pharmaceutical Association.

  19. Effects of Antibiotics on the Growth and Physiology of Chlorophytes, Cyanobacteria, and a Diatom.

    PubMed

    Guo, Jiahua; Selby, Katherine; Boxall, Alistair B A

    2016-11-01

    The occurrence of antibiotics in surface waters has been reported worldwide with concentrations ranging from ng L -1 to low µg L -1 levels. During environmental risk assessments, effects of antibiotics on algal species are assessed using standard test protocols (e.g., the OECD 201 guideline), where the cell number endpoint is used as a surrogate for growth. However, the use of photosynthetic related endpoints, such as oxygen evolution rate, and the assessment of effects on algal pigments could help to inform our understanding of the impacts of antibiotics on algal species. This study explored the effects of three major usage antibiotics (tylosin, lincomycin, and trimethoprim) on the growth and physiology of two chlorophytes (Desmodesmus subspicatus and Pseudokirchneriella subcapitata), a cyanobacteria (Anabaena flos-aquae), and a diatom (Navicula pelliculosa) using a battery of parameters, including cell density, oxygen evolution rate, total chlorophyll content, carotenoids, and the irradiance-photosynthesis relationship. The results indicated that photosynthesis of chlorophytes was a more sensitive endpoint than growth (i.e., EC 50 derived based on the effects of tylosin on the growth of D. subspicatus was 38.27 µmol L -1 compared with an EC 50 of 17.6 µmol L -1 based on photosynthetic rate), but the situation was reversed when testing cyanobacteria and the diatom (i.e., EC 50 derived based on the effects of tylosin on the growth of A. flos-aquae was 0.06 µmol L -1 ; EC 50 0.33 µmol L -1 based on photosynthetic rate). The pigment contents of algal cells were affected by the three antibiotics for D. subspicatus. However, in some cases, pigment content was stimulated for P. subcapitata, N. pelliculosa, and A. flos-aquae. The light utilization efficiency of chlorophytes and diatom was decreased markedly in the presence of antibiotics. The results demonstrated that the integration of these additional endpoints into existing standardised protocols could provide useful insights into the impacts of antibiotics on algal species.

  20. Spatial and temporal dynamics of cyanotoxins and their relation to other water quality variables in Upper Klamath Lake, Oregon, 2007-09

    USGS Publications Warehouse

    Eldridge, Sara L. Caldwell; Wood, Tamara M.; Echols, Kathy R.

    2012-01-01

    Phytoplankton blooms dominated by cyanobacteria that occur annually in hypereutrophic Upper Klamath Lake, Oregon, produce microcystins at concentrations that may contribute to the decline in populations of endangered Lost River (Deltistes luxatus) and shortnose (Chasmistes brevirostris) suckers. During 2007–09, water samples were collected from Upper Klamath Lake to determine the presence and concentrations of microcystins and cylindrospermopsins and to relate the spatial and temporal occurrences of microcystins to water quality and other environmental variables. Samples were analyzed for intracellular (particulate) and extracellular (dissolved) microcystins and cylindrospermopsins using enzyme-linked immunosorbent assays (ELISA). Samples contained the highest and most variable concentrations of microcystins in 2009, the year in which an earlier and heavier Aphanizomenon flos-aquae-dominated phytoplankton bloom occurred. Concentrations were lowest in 2008 when the bloom was lighter, overall, and delayed by nearly 1 month. Microcystins occurred primarily in dissolved and large (> 63 μm) particulate forms in all years of the study, and overall, concentrations were highest at MDT (the deepest site in the study) and HDB, although HDB was sampled only in 2007 and MDT was not sampled in 2008. Comparisons among daily median total microcystin concentrations; chlorophyll a concentrations; total, dissolved, and particulate nutrient concentrations; and nutrient ratios measured in 2009 and between 2007 and 2009 indicate that microcystin concentrations generally increase following the decline of the first A. flos-aquae-dominated bloom of each season in response to an increase in bioavailable nitrogen and phosphorus. Nitrogen fixation by A. flos-aquae early in the sample season appears to provide new nitrogen for growth of toxigenic Microcystis aeruginosa, whereas, later in the season, these species appear to co-exist. Understanding the ecological interactions between these species may be important for predicting periods of elevated cyanotoxin concentrations and has important implications for management of this lake.

  1. HepG2 cells biospecific extraction and HPLC-ESI-MS analysis for screening potential antiatherosclerotic active components in Bupeuri radix.

    PubMed

    Liu, Shuqiang; Tan, Zhibin; Li, Pingting; Gao, Xiaoling; Zeng, Yuaner; Wang, Shuling

    2016-03-20

    HepG2 cells biospecific extraction method and high performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS) analysis was proposed for screening of potential antiatherosclerotic active components in Bupeuri radix, a well-known Traditional Chinese Medicine (TCM). The hypothesis suggested that when cells are incubated together with the extracts of TCM, the potential bioactive components in the TCM should selectively combine with the receptor or channel of HepG2 cells, then the eluate which contained biospecific component binding to HepG2 cells was identified using HPLC-ESI-MS analysis. The potential bioactive components of Bupeuri radix were investigated using the proposed approach. Five compounds in the saikosaponins of Bupeuri radix were detected as these components selectively combined with HepG2 cells, among these compounds, two potentially bioactive compounds namely saikosaponin b1 and saikosaponin b2 (SSb2) were identified by comparing with the chromatography of the standard sample and analysis of the structural clearance characterization of MS. Then SSb2 was used to assess the uptake of DiI-high density lipoprotein (HDL) in HepG2 cells for antiatherosclerotic activity. The results have showed that SSb2, with indicated concentrations (5, 15, 25, and 40 μM) could remarkably uptake dioctadecylindocarbocyanine labeled- (DiI) -HDL in HepG2 cells (Vs control group, *P<0.01). In conclusion, the application of HepG2 biospecific extraction coupled with HPLC-ESI-MS analysis is a rapid, convenient, and reliable method for screening potential bioactive components in TCM and SSb2 may be a valuable novel drug agent for the treatment of atherosclerosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Simultaneous determination of seventeen mycotoxins residues in Puerariae lobatae radix by liquid chromatography-tandem mass spectrometry.

    PubMed

    Wang, Shufang; Cheng, Ling; Ji, Shen; Wang, Ke

    2014-09-01

    This work reported an efficient and accurate liquid chromatography tandem mass spectrometry (LC-MS/MS) method for simultaneous determination of seventeen mycotoxins in Puerariae lobatae radix, a frequently used traditional Chinese medicine (TCM). The effects of four different clean-up methods, including TC-M160, TC-T220, Mycosep 227, and QuEChERS method, on the recoveries of mycotoxins were investigated and compared. Finally, TC-M160 was chosen for better recovery and repeatability for mycotoxins analysis. The analytes were separated on an Agilent ZORBAX SB C18 column (4.6mm×250mm, 5μm particle size), and eluted with a mobile phase consisting of (A) water containing 0.1% formic acid and (B) acetonitrile containing 0.1% formic acid at a flow rate of 0.6mL/min. The separated compounds were detected by a triple quadrupole mass spectrometer operating in positive electrospray ionization with multiple reaction monitoring (MRM) mode. The results of method validation accorded with the requirement of analytical method for mycotoxins in COMMISSION REGULATION (EC) No 401/2006. The developed method was successfully applied for determination of mycotoxins in seventeen batches of Puerariae lobatae radix collected from different provinces of China. Three batches of them were found with contamination of mycotoxins AFB1 at (0.751±0.176)μg/kg, T-2 at (1.10±0.01)μg/kg, and T-2 at (0.853±0.044)μg/kg, respectively. The results demonstrated that the proposed method was suitable for monitoring mycotoxins residues in Puerariae lobatae radix. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Flavones Isolated from Scutellariae radix Suppress Propionibacterium Acnes-Induced Cytokine Production In Vitro and In Vivo.

    PubMed

    Tsai, Po-Jung; Huang, Wen-Cheng; Hsieh, Ming-Chi; Sung, Ping-Jyun; Kuo, Yueh-Hsiung; Wu, Wen-Huey

    2015-12-24

    Scutellariae radix, the root of Scutellaria baicalensis, has long been applied in traditional formulations and modern herbal medications. Propionibacterium acnes (P. acnes) in follicles can trigger inflammation and lead to the symptom of inflammatory acnes vulgaris. This study was aimed at evaluating the effect of Scutellariae radix extract and purified components isolated from it on inflammation induced by P. acnes in vitro and in vivo. The results showed the ethyl acetate (EA) soluble fraction from the partition of crude ethanolic extract from Scutellariae radix inhibited P. acnes-induced interleukin IL-8 and IL-1β production in human monocytic THP-1 cells. Seven flavones were isolated from the EA fraction by repeated chromatographies, and identified as 5,7-dihydroxy-6-methoxyflavone (FL1, oroxylin), 5,7-dihydroxy-8-methoxyflavone (FL2, wogonin), 5-hydroxy-7,8-dimethoxyflavone (FL3, 7-O-methylwogonin), 5,6'-dihydroxy-6,7,8,2'-tetramethoxy flavone (FL4, skullcapflavone II), 5,7,4'-trihydroxy-8-methoxyflavone (FL5), 5,2',6'-trihydroxy-7,8-dimethoxyflavone (FL6, viscidulin II), and 5,7,2',5'-tetrahydroxy-8,6'-dimethoxyflavone (FL7, ganhuangenin). They all significantly suppressed P. acnes-induced IL-8 and IL-1β production in THP-1 cells, and FL2 exerted the strongest effect with half maximal inhibition (IC50) values of 8.7 and 4.9 μM, respectively. Concomitant intradermal injection of each of the seven flavones (20 μg) with P. acnes effectively attenuated P. acnes-induced ear swelling, and decreased the production of IL-6 and tumor necrosis factor-α in ear homogenates. Our results suggested that all the seven flavones can be potential therapeutic agents against P. acnes-induced skin inflammation.

  4. Rapid detection of aflatoxin B1 in medicinal materials of radix and rhizome by gold immunochromatographic assay.

    PubMed

    Hu, Shurong; Dou, Xiaowen; Zhang, Lei; Xie, Yanjun; Yang, Shihai; Yang, Meihua

    2018-05-22

    A rapid screening of the most toxic aflatoxin B 1 (AFB 1 ) in medicinal materials of radix and rhizome was performed by an immune chromatography method for the first time. The colloidal gold immunochromatographic strip was prepared after optimization of the conjugation of gold particles with monoclonal antibody, the test line and the control line. Under optimized conditions, the detection limit of the constructed test strip was as low as 0.1 ng mL -1 and the total analysis was conducted within 15 min by naked eyes. Four kinds of medicinal materials (Gastrodia elata, Poria cocos, Bletilla striata and Radix Angelicae Dahuricae) were investigated by the strip. Various complex matrixes pay a significant influence on the feasibility and effectiveness of the strip screening in medicinal materials. Aiming to the characteristics of selected medicinal materials, the screening was successfully proceeded with extraction by 70% methanol-water as well as three-fold dilution in Gastrodia elata and Radix Angelicae Dahuricae, 70% methanol-PBS as well as four-fold dilution in Poria cocos., and 60% methanol-water as well as four-fold dilution in Bletilla striata. Among the collected 40 samples, one was found to be positive of AFB 1 with level above 5 μg kg -1 . The result was in a good agreement with those obtained from LC-MS/MS determination (6.12 μg kg -1 ). The gold immunochromatographic strip was demonstrated as a rapid, cost-effective, reliable and on-site screening technique for mycotoxins in starch and polysaccharides-rich herbal medicines. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Establishment and Growth of Cherrybark Oak Seedlings Underplanted Beneath a Partial Overstory in a Minor Bottom of Southwestern Arkansas: First Year Results

    Treesearch

    Emile S. Gardiner; Jimmie L. Yeiser

    1999-01-01

    Advance regeneration is frequently inadequate to sufficiently restock the oak component of many bottomland stands, especially on productive sites with high levels of competition. We initiated a study near Beime, AR to examine the effects of pre-plant control of Japanese honeysuckle (Lonicera japonica Thunberg) and seedling quality on establishment...

  6. Pharmacognostic Specification, Chlorogenic Acid Content, and In vitro Antioxidant Activities of Lonicera japonica Flowering Bud.

    PubMed

    Chaowuttikul, Chayanon; Palanuvej, Chanida; Ruangrungsi, Nijsiri

    2017-01-01

    Lonicera japonica Thunb. or Japanese Honeysuckle has been widely used in traditional medicine for antipyretic. To establish the pharmacognostic specification of L. japonica flowering bud in Thailand and to determine its chlorogenic acid content and in vitro antioxidant activities. Dried L. japonica flowering bud from 15 various herbal drugstores throughout Thailand were investigated for pharmacognostic specification. Their chlorogenic acid contents were quantitatively analyzed by thin layer chromatography (TLC) densitometry with winCATS software. The mobile phase for TLC development consisted of ethyl acetate: formic acid: acetic acid: water (10:1.1:1.1:2.6). Antioxidant activities were investigated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging, ferric ion reducing antioxidant power assay, nitric oxide scavenging assay, and β-carotene bleaching assays. Qualified L. japonica flowering bud in Thailand was presented that the contents of loss on drying, total ash, acid-insoluble ash, and water should not be >10.11%, 6.59%, 1.14%, and 10.82% by weight, respectively. The ethanol and water soluble extractive values should not be < 16.46% and 28.88% by weight, respectively. Chlorogenic acid content in L. japonica flowering bud was found to be 2.24 ± 0.50 g/100 g of crude drug. L. japonica flowering bud showed DPPH and nitric oxide scavenging activities as well as reducing power property. This pharmacognostic specification with special reference to the chlorogenic acid content can be used for quality control of L. japonica flowering bud in Thailand. The potential antioxidant of this crude drug was demonstrated in vitro . Pharmacognostic specification of Lonicera japonica flowering bud in Thailand has been establishedThe chlorogenic acid content has been quantified by thin layer chromatography-densitometryThe ethanolic extract of L. japonica flowering bud showed antioxidation potential, especially on reducing power property. Abbreviations Used: TLC: Thin layer chromatography, DPPH: 2,2-diphenyl-1-picrylhydrazyl, FRAP: Ferric ion Reducing Antioxidant Power, WHO: World Health Organization, ICH: International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use; LOD: Limit of detection; LOQ: Limit of quantitation; BHT: Butylated hydroxytoluene; FeSO 4 : Iron(II) sulfate; DMSO: Dimethyl sulfoxide; TPTZ: 2,4,6-tripyridyl-s-triazine.

  7. [Preliminary Study of Lonicera hypoglauca on Germination Conditions of Sand Culture Seeds and Sterilization Method of Sand Culture Seedling Sterilization].

    PubMed

    Tan, Mu-xiu; Zeng, Wen-wen; Wei, Peng-xiao; Mo, Qiao-cheng; Pu, Zu-ning; Cen, Xiu-fen; Shi, Feng-hua

    2015-05-01

    To explore the germination conditions of Lonicera hypoglauca sand culture seeds and the effects of sand culture seedlings sterilization. 0.1% HgCl2 with different sterilization time, different illumination time and temperature culture condition were adopted to study the germination conditions of sand culture seeds. Different sterilization treatments and different hardening-seedling days were used to test the sterilization effect of sand culture seedlings. The sterilization effect of the combination of 75% ethanol 30 s + 0.1% HgCl2 5 min on Lonicera hypoglauca seeds was the optimum,with the average pollution rate of 15.56%, and the average germination rate reached 51.11%. The combination of varied temperature-room temperature under light for 12 h/d was the best, with the average germination rate peaked at 75.49%, and the average germination potential reached 68.36%. The treatment of detergent liquor scrub-tap water wash on the part above the hypocotyl, which was sand cultured under the opening condition and had no root, showed the best sterilization effect, with the average pollution rate was zero, and the average survival rate peaked at 100.00%. The sterilization effect of sand culture seedlings, which was disinfected after cleaning by detergent liquor scrub-tap water wash after hardening-seeding for 30 days, was the best, with the average pollution rate of 50.00%, and the average survival rate of 100.00%. The best sterilization effect is the combination of 75% ethanol 30 s + 0.1% HgCl2 5 min; Lighting for 12 h/d of varied temperature-room temperature is regarded as the optimum culture condition. The treatment of detergent liquor scrub-tap water wash treatment on the part above the hypocotyl,which is sand cultured under the opening condition and had no root, shows the best sterilization effect. For the sand culture seedlings, before inoculated in subculture medium, should be hardening-seedling for some days and sterilized after detergent liquor scrub-tap water wash.

  8. [Application of bioassay in quality control of Chinese materia medica-taking Radix Isatidis as an example].

    PubMed

    Yan, Dan; Ren, Yongshen; Luo, Jiaoyang; Li, Hanbing; Feng, Xue; Xiao, Xiaohe

    2010-10-01

    Bioassay, which construct the characteristics consistents with Chinese medical science, is the core mode and methods for the quality control of Chinese materia medica. Taking the bioassay of Radix Isatidis as an example, the contribution, status and application of bioassay in the quality control of Chinese materia medica were introduced in this article, and two key issue (the selection of reference and measurement methods) in the process of establishing bioassay were also explained. This article expects to provide a reference for the development and improvement of the bioassay of Chinese materia medica in a practical manipulation level.

  9. Fast quantum nD Fourier and radon transforms

    NASA Astrophysics Data System (ADS)

    Labunets, Valeri G.; Labunets-Rundblad, Ekaterina V.; Astola, Jaakko T.

    2001-07-01

    Fast Classical and quantum algorithms are introduced for a wide class of non-separable nD discrete unitary K- transforms(DKT)KNn. They require a number of 1D DKT Kn smaller than in the Cooley-Tukey radix-p FFT-type approach. The method utilizes a decomposition of the nDK- transform into a product of original nD discrete Radon Transform and of a family parallel/independ 1DK-transforms. If the nDK-transform has a separable kernel, that again in this case our approach leads to decrease of multiplicative complexity by factor of n compared to the tow/column separable Cooley-Tukey p-radix approach.

  10. Discrimination of Medicine Radix Astragali from Different Geographic Origins Using Multiple Spectroscopies Combined with Data Fusion Methods

    NASA Astrophysics Data System (ADS)

    Wang, Hai-Yan; Song, Chao; Sha, Min; Liu, Jun; Li, Li-Ping; Zhang, Zheng-Yong

    2018-05-01

    Raman spectra and ultraviolet-visible absorption spectra of four different geographic origins of Radix Astragali were collected. These data were analyzed using kernel principal component analysis combined with sparse representation classification. The results showed that the recognition rate reached 70.44% using Raman spectra for data input and 90.34% using ultraviolet-visible absorption spectra for data input. A new fusion method based on Raman combined with ultraviolet-visible data was investigated and the recognition rate was increased to 96.43%. The experimental results suggested that the proposed data fusion method effectively improved the utilization rate of the original data.

  11. Hair growth is promoted by BeauTop via expression of EGF and FGF-7

    PubMed Central

    Lee, Chien-Ying; Yang, Chi-Yu; Lin, Ching-Che; Yu, Min-Chien; Sheu, Shuenn-Jyi; Kuan, Yu-Hsiang

    2018-01-01

    Minoxidil and finasteride have been approved to treat hair loss by the Food and Drug Administration. However, the further elucidation of treatments for hair loss, including those using Chinese herbal medicine, remains important clinically. BeauTop (BT) is a health food supplement which contains Ginseng radix, Astragali radix, Radix Angelicae sinensis, Ligustri fructus, Rehmannia glutinosa and Eclipta prostrata (Linn). Susbsequent to oral administration of BT at 0.6 g/kg/day to wax/rosin-induced alopecia in C57BL/6 mice, BT significantly induced hair growth at day 8 compared with control treatment (P<0.05). The expression levels of epidermal growth factor (EGF), and fibroblast growth factor (FGF)-7 were increased compared with control animals on day 8. In contrast, levels of FGF-5 of the BT group were reduced compared with the control on day 12. There were no effects on the expression of insulin-like growth factor 1. The results demonstrated that the mechanism of BT improving alopecia is potentially associated with modulation of EGF and FGF-7 levels. Taken together, it is suggested that BT may have a potential effect of the promotion of hair growth. PMID:29693180

  12. Rapid characterization of the chemical constituents of Sijunzi decoction by UHPLC coupled with Fourier transform ion cyclotron resonance mass spectrometry.

    PubMed

    Guan, Zhibo; Wang, Miao; Cai, Yi; Yang, Hongmei; Zhao, Min; Zhao, Chunjie

    2018-06-01

    Sijunzi decoction, a renowned Chinese prescription has long been utilized to treat gastrointestinal problems. In the context of this research work, the use of Ultra high performance liquid chromatography combined with Fourier transform ion cyclotron resonance mass spectrometry was made to separate and characterize the components of Sijunzi decoction. The performance of Liquid chromatography was carried out on a C8 column (150 mm × 2.1 mm, 1.8 μm); moreover, the mobile phase were consisted of 0.2% formic acid (A) and acetonitrile (B). In accordance with the findings, characterization of 120 chemical compounds was performed by liquid chromatography with mass spectrometry. The key constituents among them included ginsenosides (in Radix Ginseng), 16 triterpene carboxylic acids (in Poria), sesquiterpenes (in Rhizoma Atractylodis Macrocephalae), triterpenesaponins (in Glycyrrhizae Radix et Rhizoma Praeparata Cum Melle) as well as flavonoids (in Glycyrrhizae Radix et Rhizoma Praeparata Cum Melle) in Sijunzi decoction. This research developed the bases for prospective research associated with Sijunzi decoction, together with being expected to be useful to rapidly extract and characterize the constituents in other Traditional Chinese herbal formulations. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Analysis of fingerprints features of infrared spectra of various processed products of Radix Aconiti kusnezoffii

    NASA Astrophysics Data System (ADS)

    Tu-ya; Yang, Ping; Sun, Su-qin; Zhou, Qun; Bao, Xiao-hua; Noda, Isao

    2010-06-01

    Fourier-transform infrared spectroscopy (FTIR) and two-dimensional correlation infrared spectroscopy (2D-IR)) are employed to analyze various processed products and ether extracts of Radix Aconiti kusnezoffii. There is a resemblance among the spectra of different processed products. The major difference lies in the absorption peak at 1641 cm -1 in the IR spectra, which reflects the transformation of raw aconite to the processed products. There are distinctive differences in the absorption peaks in the range of 1800-1500 cm -1 in the second derivative spectra, which has better resolution, of different processed products. 2D-IR spectra, which elevate the resolution further, can present even more differences among the products in the range of 1800-800 cm -1. Analysis of ether extracts of various processed products proves that there are alcohols, esters, carboxylic acids or ketones in all of them. However, their contents in different samples have obvious differences. With the advantages of high resolution, high-speed and convenience, IR can quickly and precisely distinguish various processed products of Radix A. kusnezoffii, and can be applied to predict the tendency of transformation of the complicated chemical mixture systems under heat perturbation.

  14. A Review of the Botany, Phytochemistry, Pharmacology and Toxicology of Rubiae Radix et Rhizoma.

    PubMed

    Shan, Mingqiu; Yu, Sheng; Yan, Hui; Chen, Peidong; Zhang, Li; Ding, Anwei

    2016-12-20

    Rubia cordifolia Linn (Rubiaceae) is a climbing perennial herbal plant, which is widely distributed in China and India. Its root and rhizome, Rubiae Radix et Rhizoma (called Qiancao in China and Indian madder in India), is a well known phytomedicine used for hematemesis, epistaxis, flooding, spotting, traumatic bleeding, amenorrhea caused by obstruction, joint impediment pain, swelling and pain caused by injuries from falls. In addition, it is a kind of pigment utilized as a food additive and a dye for wool or fiber. This review mainly concentrates on studies of the botany, phytochemistry, pharmacology and toxicology of this Traditional Chinese Medicine. The phytochemical evidences indicated that over a hundred chemical components have been found and isolated from the medicine, such as anthraquinones, naphthoquinones, triterpenoids, cyclic hexapeptides and others. These components are considered responsible for the various bioactivities of the herbal drug, including anti-oxidation, anti-inflammation, immunomodulation, antitumor, effects on coagulation-fibrinolysis system, neuroprotection and other effects. Additionally, based on these existing results, we also propose some interesting future research directions. Consequently, this review should help us to more comprehensively understand and to more fully utilize the herbal medicine Rubiae Radix et Rhizoma.

  15. Antioxidant effects of 14 Chinese traditional medicinal herbs against human low-density lipoprotein oxidation.

    PubMed

    Lin, Hsin-Hung; Charles, Albert Linton; Hsieh, Chang-Wei; Lee, Ya-Chi; Ciou, Jhih-Ying

    2015-01-01

    The relationship between the antioxidant activities and inhibitory effect of 14 Chinese medicinal herbs against oxidized low-density lipoprotein (LDL) formation was evaluated. Prolongation of the lag phase of LDL oxidation depended on the concentration of the herbs. The concentration of each herb that was able to prolong the lag time by about two-fold was calculated and expressed as doubling-time concentration. The lower the doubling-time concentration, the stronger the inhibitory effect exhibited toward LDL oxidation. Among them, Chrysanthemi Flos (Chrysanthemum morifolium ramat; gān jú huā), Crataegi Fructus (Crataegus pinnatifida Bge. var. major N.E.Br.; shān zhā), and Roselle (Hibiscus sabdariffa Linn.; luò shén) showed significant inhibitory effects. Correlation coefficients between doubling-time concentration and radical-scavenging activities were high; the total phenolic content was also high. In conclusion, phenolic compounds contributed not only to antioxidant activities, but also to the inhibitory effect against LDL oxidation. Chrysanthemi Flos, Crataegi Fructus, and H. sabdariffa, with lower doubling-time concentrations, could be potent phytochemical agents to reduce LDL oxidation and prevent the progression of atherosclerosis.

  16. The role of silicon in physiology of the medicinal plant (Lonicera japonica L.) under salt stress

    NASA Astrophysics Data System (ADS)

    Gengmao, Zhao; Shihui, Li; Xing, Sun; Yizhou, Wang; Zipan, Chang

    2015-08-01

    Silicon(Si) is the only element which can enhance the resistance to multiple stresses. However, the role of silicon in medicinal plants under salt stress is not yet understood. This experiment was conducted to study the effects of silicon addition on the growth, osmotic adjustments, photosynthetic characteristics, chloroplast ultrastructure and Chlorogenic acid (CGA) production of Honeysuckle plant (Lonicera japonica L.) under salt-stressed conditions. Salinity exerted an adverse effect on the plant fresh weight and dry weight, whilst 0.5 g L-1 K2SiO3·nH2O addition obviously improved the plant growth. Although Na+ concentration in plant organs was drastically increased with increasing salinity, higher levels of K+/Na+ ratio was obtained after K2SiO3·nH2O addition. Salinity stress induced the destruction of the chloroplast envelope; however, K2SiO3·nH2O addition counteracted the adverse effect by salinity on the structure of the photosynthetic apparatus. K2SiO3·nH2O addition also enhanced the activities of superoxide dismutase and catalase. To sum up, exogenous Si plays a key role in enhancing its resistance to salt stresses in physiological base, thereby improving the growth and CGA production of Honeysuckle plant.

  17. Antioxidant activities of aqueous extracts from 12 Chinese edible flowers in vitro and in vivo

    PubMed Central

    Wang, Feng; Miao, Miao; Xia, Hui; Yang, Li-Gang; Wang, Shao-Kang; Sun, Gui-Ju

    2017-01-01

    ABSTRACT The antioxidant function of edible flowers have attracted increasing interest. However, information is lacking on the impact of edible flowers on oxidative injury including hypoxia-re-oxygenation and hyperlipidemia. The antioxidant activities of aqueous extracts from 12 Chinese edible flowers were assessed in four different antioxidant models, including total antioxidant capacity (TAC), oxygen radical absorbance capacity (ORAC), scavenging hydroxyl radical capacity (SHRC) and scavenging superoxide anion radical capacity (SSARC). Subsequently, the potential antioxidant effects on rat cardiac microvascular endothelial cells (rCMEC) treated with hypoxia-re-oxygenation and hyperlipidemia rats induced by high-fat diet were also evaluated. The highest TAC, ORAC, SHRC and SSARC were Lonicera japonica Thunb., Rosa rugosa Thunb., Chrysanthemum indicum L. and Rosa rugosa Thunb., respectively. Most aqueous extracts of edible flowers exhibited good antioxidant effects on injury of rCMEC induced by hypoxia-re-oxygenation. In addition, the aqueous extracts of Lonicera japonica Thunb., Carthamus tinctorius L., Magnolia officinalis Rehd. et Wils., Rosmarinus officinalis L. and Chrysanthemum morifolium Ramat. could suppress the build-up of oxidative stress by increasing serum superoxide dismutase, glutathion peroxidase, and reducing malonaldehyde concentration in hyperlipidemia rats. These findings provided scientific support for screening edible flowers as natural antioxidants and preventative treatments for oxidative stress-related diseases. PMID:28326000

  18. Optimization of ultrasound-assisted extraction of anthocyanins from haskap berries (Lonicera caerulea L.) using Response Surface Methodology.

    PubMed

    Celli, Giovana Bonat; Ghanem, Amyl; Brooks, Marianne Su-Ling

    2015-11-01

    Haskap berries (Lonicera caerulea L.) are a rich source of bioactive molecules. As such, the extraction of anthocyanins is important for the development of many value-added products and functional food ingredients. In this paper, the ultrasound-assisted extraction (UAE) of anthocyanins from haskap berries was investigated. Significant independent variables were screened and optimized using Plackett-Burman (PB) and Box-Behnken (BB) designs, respectively. The mathematical model showed a high coefficient of determination (R(2)=0.9396) and the optimum conditions for the extraction were as follows: liquid/solid ratio 25:1 (mL/g), solvent composition of 80% ethanol, addition of 0.5% formic acid, ultrasound bath temperature of 35°C for 20 min. Under these conditions, the total anthocyanin content of 22.73 mg cyaniding 3-glucoside equivalents (C3G)/g dry weight (DW) was consistent with the predicted response of 22.45 mg C3G/g DW from the model (mean error of 1.28%). Five anthocyanins were identified in the optimized extract, namely cyanidin 3,5-diglucoside, cyanidin 3-glucoside, cyanidin 3-rutinoside, pelargonidin 3-glucoside, and peonidin 3-glucoside. Thus, UAE is a suitable technique for the extraction of anthocyanins from haskap berries. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Can arbuscular mycorrhizal fungi reduce Cd uptake and alleviate Cd toxicity of Lonicera japonica grown in Cd-added soils?

    NASA Astrophysics Data System (ADS)

    Jiang, Qiu-Yun; Zhuo, Feng; Long, Shi-Hui; Zhao, Hai-Di; Yang, Dan-Jing; Ye, Zhi-Hong; Li, Shao-Shan; Jing, Yuan-Xiao

    2016-02-01

    A greenhouse pot experiment was conducted to study the impact of arbuscular mycorrhizal fungi-Glomus versiforme (Gv) and Rhizophagus intraradices (Ri) on the growth, Cd uptake, antioxidant indices [glutathione reductase (GR), ascorbate peroxidase (APX), superoxide dismutase (SOD), catalase (CAT), ascorbate (ASA), glutathione (GSH) and malonaldehyde (MDA)] and phytochelatins (PCs) production of Lonicera japonica in Cd-amended soils. Gv and Ri significantly increased P acquisition, biomass of shoots and roots at all Cd treatments. Gv significantly decreased Cd concentrations in shoots and roots, and Ri also obviously reduced Cd concentrations in shoots but increased Cd concentrations in roots. Meanwhile, activities of CAT, APX and GR, and contents of ASA and PCs were remarkably higher in Gv/Ri-inoculated plants than those of uninoculated plants, but lower MDA and GSH contents in Gv/Ri-inoculated plants were found. In conclusion, Gv and Ri symbiosis alleviated Cd toxicity of L. japonica through the decline of shoot Cd concentrations and the improvement of P nutrition, PCs content and activities of GR, CAT, APX in inoculated plants, and then improved plant growth. The decrease of shoot Cd concentrations in L. japonica inoculated with Gv/Ri would provide a clue for safe production of this plant from Cd-contaminated soils.

  20. Characterization and Molecular Interpretation of the Photosynthetic Traits of Lonicera confusa in Karst Environment

    PubMed Central

    Gan, Lu; Fu, Chunhua; Zhang, Libin; Yu, Longjiang; Li, Maoteng

    2014-01-01

    Lonicera confusa was a medical plant which could adapt to the Ca-rich environment in the karst area of China. The photosynthesis, relative chlorophyll content,differentially expressed genes (DEGs) and differentially expressed proteins (DEPs) of L. confusa that cultivated in calcareous and sandstone soils were investigated. The results showed that the relative chlorophyll content and net photosynthesis rate of L. confusa in calcareous soil are much higher than that planted in sandstone soil, the higher content of calcium might play a role in keeping the chloroplast from harm and showed higher photosynthesis rate. The transpiration and stomata conductance were decreased in calcareous soil, which might result from the closure of stomata. The GeneFishing and proteomic results showed that the expression of DEGs and DEPs were critical for photosynthesis and stomata closure, such as RuBisCO, photosynthetic electron transfer c and malate dehydrogenase varied in the leaves of L. confusa that cultivated in different soils. These DEGs or DEPs were further found to be directly or indirectly regulated by calcium sensor proteins. This study enriched our knowledge of the molecular mechanism of high net photosynthesis rate and lower transpiration of L. confusa that cultivated in the calcareous soil in some degree. PMID:24959829

  1. [Impact of storage conditions and time on herb of Lonicera macranthoides].

    PubMed

    Ma, Peng; Li, Long-Yun; Zhang, Ying

    2014-03-01

    To study the effect of different storage conditions and storage time on herb quality of Lonicera macranthoides, different packaging materials including vacuum plastic bags, plastic bags, woven bags, sealed with endometrial bags, paper bags, sack bags were selected for the study under different storage conditions including room temperature, 5 degrees C refrigerator, low temperature of - 20 degrees C refrigerator and desiccator. Twenty-four batches of samples were used for the study, and active ingredients were determined. The experimental results showed that the ingredients in each storage group changed with the storage time, storage conditions (storage environment, packaging). Under the same storage time, the storage environment (temperature, humidity) had effect on the stability of herb quality. Low temperature had less effect on herb quality. The effect of packaging on herb quality was as following: plastic vacuum packaging > woven with endometrial sealed packaging > plastic bag > woven bag > sack bags > paper bags. Under the same storage conditions, with the increase of storage time, caffeic acid content increased slowly, and other five ingredients content decreased gradually. Storage time affected significantly on the intrinsic quality (chemical composition) and appearance of herb. It is suggested that low temperature (5 degrees C), dark and sealed storage are suitable for storage of L. macranthoides herb, the storage time should be not more than 24 months.

  2. Efficacy and mode of action of an immunomodulator herbal preparation containing Echinacea, wild indigo, and white cedar.

    PubMed

    Wüstenberg, P; Henneicke-von Zepelin, H H; Köhler, G; Stammwitz, U

    1999-01-01

    Using the example of an allopathic herbal combined preparation containing Echinacea root, wild indigo root, and white cedar leaf tips (Echinaceae radix + Baptisiae tinctoriae radix + Thujae occidentalis herba = Esberitox N), the efficacy and mode of action of a phytoimmunomodulator, or immune system enhancer, is described. Efficacy of the immunomodulator has been demonstrated in studies of acute viral respiratory tract infections and infections requiring antibiotic therapy. In a recent study compliant to GCP, the therapeutic superiority of the herbal immunomodulator over placebo was confirmed as statistically significant and clinically relevant. The present overview describes a model of the antigen-independent mode of action of phytoimmunomodulation ("immunobalancing").

  3. [Exploration of toxicity reducing mechanism of aconite alkaloids during decoction process using liquid chromatography-mass spectrometry].

    PubMed

    Chen, Ping; Chen, Yimin; Chen, Jia; Tong, Hongbin; Xu, Zhiliang

    2013-11-01

    A high performance liquid chromatography-electrospray ionization mass spectrometry method was developed for the determination of aconite alkaloids. It was used to investigate the degradation of alkaloids of Radix Aconiti Lateralis Preparata during decoction. Six alkaline degradation products were identified, and the degradation regularity of diester-diterpenoid alkaloids was confirmed during the test using standards. The dynamic changes of the amount of aconite alkaloids in the decoction of Radix Aconiti Lateralis Preparata were supervised. Along with the increase of decoction time, the concentrations of diester-diterpenoid alkaloids and lipo-alkaloid decreased significantly. The results can provide a scientific basis for the safety use of aconite.

  4. [Studies on ethyl acetate soluble constituents of Huanglian Jiedutang].

    PubMed

    Ma, Zhao-Tang; Yang, Xiu-Wei

    2008-09-01

    To study the ethyl acetate soluble constituents from the water extractive of Huanglian Jiedutang decoction, which are composed of Rhizoma Coptidis, Radix Scutellariae, Cortex Phellodendri and Fructus Gardeniae, and provide substances foundation for its pharmacokinetic and pharmacodynamic investigation. The chemical constituents were isolated by various column chromatographic methods and structurally elucidated by NMR and MS techniques. Thirty-five compounds were isolated, among which twenty compounds have been identified as beta-sitosterol (1), oroxylin A (2), wogonin (3), ursolic acid (4), skullcapflavone I (5), tenaxin I (6), skullcapflavone II (7), limonin (8), 5, 2'-dihydroxy-6, 7, 8, 3'-tetramethoxyflavone (9), chrysin (12), baicalein (17), tenaxin II (19), 5, 7, 2'-trihydroxy-6, 8-dimethoxyflavone (21), shihulimonin A (22), 6, 2'-dihydroxy-5, 7, 8, 6'-tetramethoxyflavone (26), viscidulin II (28), 5, 7, 4'-trihydroxy-8-methoxyflavone (29), 5, 7, 2', 6'-tetrahydroxyflavone (30), wogonin-7-O-beta-D-glucuronide methyl ester (31) and daucosterol (34). On the basis of reported results of the chemical constituents of Rhizoma Coptidis, Radix Scutellariae, Cortex Phellodendri and Fructus Gardeniae, it was estimated that all flavonoid compounds rised from the Radix Scutellariae, and compounds 8 and 22 rised from Cortex Phellodendri. Compound 22 was identified in the Cortex Phellodendri for the first time.

  5. Hair growth is promoted by BeauTop via expression of EGF and FGF‑7.

    PubMed

    Lee, Chien-Ying; Yang, Chi-Yu; Lin, Ching-Che; Yu, Min-Chien; Sheu, Shuenn-Jyi; Kuan, Yu-Hsiang

    2018-06-01

    Minoxidil and finasteride have been approved to treat hair loss by the Food and Drug Administration. However, the further elucidation of treatments for hair loss, including those using Chinese herbal medicine, remains important clinically. BeauTop (BT) is a health food supplement which contains Ginseng radix, Astragali radix, Radix Angelicae sinensis, Ligustri fructus, Rehmannia glutinosa and Eclipta prostrata (Linn). Susbsequent to oral administration of BT at 0.6 g/kg/day to wax/rosin‑induced alopecia in C57BL/6 mice, BT significantly induced hair growth at day 8 compared with control treatment (P<0.05). The expression levels of epidermal growth factor (EGF), and fibroblast growth factor (FGF)‑7 were increased compared with control animals on day 8. In contrast, levels of FGF‑5 of the BT group were reduced compared with the control on day 12. There were no effects on the expression of insulin‑like growth factor 1. The results demonstrated that the mechanism of BT improving alopecia is potentially associated with modulation of EGF and FGF‑7 levels. Taken together, it is suggested that BT may have a potential effect of the promotion of hair growth.

  6. Polysaccharide of radix pseudostellariae improves chronic fatigue syndrome induced by poly I:C in mice.

    PubMed

    Sheng, Rong; Xu, Xianxiang; Tang, Qin; Bian, Difei; Li, Ying; Qian, Cheng; He, Xin; Gao, Xinghua; Pan, Rong; Wang, Chong; Luo, Yubin; Xia, Yufeng; Dai, Yue

    2011-01-01

    Radix Pseudostellariae is used as a tonic drug in traditional Chinese medicine with immunomodulating and anti-fatigue activities, and the polysaccharide is considered as the main active component. The purpose of this study is to examine the effect of the polysaccharide isolated from Radix Pseudostellariae (PRP) on mouse chronic fatigue syndrome (CFS) induced by intraperitoneal injection of polyriboinosinic:polyribocytidylic acid (poly I:C), a double-stranded synthetic RNA. It has shown that the fatigue symptom of mice lasted at least 1 week as evaluated by forced swimming time. PRP (100, 200, 400 mg kg(-1)), orally administered 3 days before poly I:C injection, showed dose-dependent anti-fatigue effects. In addition, poly I:C led to evident alternations in neuroendocrine and immune systems of mice, such as reduced spontaneous activity and learning ability, declined serum level of corticosterone, increased weight indexes and T lymphocyte numbers in thymuses and spleens, and increased CD4(+)/CD8(+) ratio but decreased proliferation ability of T lymphocytes in spleens. PRP alleviated the abnormalities caused by poly I:C, and restored the function of hosts to normal conditions. The findings suggest that PRP is beneficial to CFS, and the underlying mechanisms of action involve neuroendocrine and immune systems.

  7. Onjisaponin B derived from Radix Polygalae enhances autophagy and accelerates the degradation of mutant α-synuclein and huntingtin in PC-12 cells.

    PubMed

    Wu, An-Guo; Wong, Vincent Kam-Wai; Xu, Su-Wei; Chan, Wai-Kit; Ng, Choi-In; Liu, Liang; Law, Betty Yuen-Kwan

    2013-11-15

    Emerging evidence indicates important protective roles being played by autophagy in neurodegenerative disorders through clearance of aggregate-prone or mutant proteins. In the current study, we aimed to identify autophagy inducers from Chinese medicinal herbs as a potential neuroprotective agent that enhances the clearance of mutant huntingtin and α-synuclein in PC-12 cells. Through intensive screening using the green fluorescent protein-light chain 3 (GFP-LC3) autophagy detection platform, we found that the ethanol extracts of Radix Polygalae (Yuan Zhi) were capable of inducing autophagy. Further investigation showed that among three single components derived from Radix Polygalae--i.e., polygalacic acid, senegenin and onjisaponin B--onjisaponin B was able to induce autophagy and accelerate both the removal of mutant huntingtin and A53T α-synuclein, which are highly associated with Huntington disease and Parkinson disease, respectively. Our study further demonstrated that onjisaponin B induces autophagy via the AMPK-mTOR signaling pathway. Therefore, findings in the current study provide detailed insights into the protective mechanism of a novel autophagy inducer, which is valuable for further investigation as a new candidate agent for modulating neurodegenerative disorders through the reduction of toxicity and clearance of mutant proteins in the cellular level.

  8. Onjisaponin B Derived from Radix Polygalae Enhances Autophagy and Accelerates the Degradation of Mutant α-Synuclein and Huntingtin in PC-12 Cells

    PubMed Central

    Wu, An-Guo; Wong, Vincent Kam-Wai; Xu, Su-Wei; Chan, Wai-Kit; Ng, Choi-In; Liu, Liang; Law, Betty Yuen-Kwan

    2013-01-01

    Emerging evidence indicates important protective roles being played by autophagy in neurodegenerative disorders through clearance of aggregate-prone or mutant proteins. In the current study, we aimed to identify autophagy inducers from Chinese medicinal herbs as a potential neuroprotective agent that enhances the clearance of mutant huntingtin and α-synuclein in PC-12 cells. Through intensive screening using the green fluorescent protein-light chain 3 (GFP-LC3) autophagy detection platform, we found that the ethanol extracts of Radix Polygalae (Yuan Zhi) were capable of inducing autophagy. Further investigation showed that among three single components derived from Radix Polygalae—i.e., polygalacic acid, senegenin and onjisaponin B—onjisaponin B was able to induce autophagy and accelerate both the removal of mutant huntingtin and A53T α-synuclein, which are highly associated with Huntington disease and Parkinson disease, respectively. Our study further demonstrated that onjisaponin B induces autophagy via the AMPK-mTOR signaling pathway. Therefore, findings in the current study provide detailed insights into the protective mechanism of a novel autophagy inducer, which is valuable for further investigation as a new candidate agent for modulating neurodegenerative disorders through the reduction of toxicity and clearance of mutant proteins in the cellular level. PMID:24248062

  9. [Textual research on adulteration of Chinese materia medica in ancient China].

    PubMed

    Xie, Jin; Wang, De-Qun

    2013-09-01

    By investigating the mainstream works of herbal classics of successive ages, it is found that adulteration of Chinese materia medica appeared early in ancient China. The main methods of adulteration was producing fraud medicines in the Northern-Southern Dynasties, fake medicines began to appear in the Tang Dynasty, and status of adulteration of Chinese materia medica ran unchecked since the Ming and Qing Dynasty. By statistics, there were 76 kinds of adulteration varieties before the Republican period. The main varieties were precious drugs, animal drugs and artifacts. Commonly methods used in the process included forging and adulterating, dealing with 11 kinds and 68 kinds respectively. Adulteration probably lead to the result of imposing the changes of the used medicinal parts of Herba Pogostemonis; Radix Aconiti Lateralis prepared by adding salt, Radix Angelica Sinensis processed by wine, and Radix Astragalis seu Hedysaris processed with bee honey. However, the root cause of adulteration in Chinese materia medica was the dissociation of professional physician and pharmacist, resulting in the ignorance of medical practitioners became unable to recognize Chinese materia medica; and the immorality of medicinal merchants. Besides, rating the quality of materia medica based on its producing areas without differentiating the false from the genuine may also contribute to this result passively.

  10. SEPARATION AND PURIFICATION OF TWO MINOR COMPOUNDS FROM RADIX ISATIDIS BY INTEGRATIVE MPLC AND HSCCC WITH PREPARATIVE HPLC.

    PubMed

    Liang, Zhenjie; Li, Bin; Liang, Yong; Su, Yaping; Ito, Yoichiro

    2015-01-01

    Radix isatidis has been widely used as a Chinese traditional medicine for its anti-virus and anticancer activities where the minor components may contribute to these beneficial pharmaceutical effects. In order to enrich the target minor compounds effectively and rapidly, extraction, medium-pressure liquid chromatography (MPLC), high-speed countercurrent chromatography (HSCCC) and preparative high-performance liquid chromatography (pre-HPLC) were integratively used for separation and purification of two target minor compounds indole-3-acetonitrile-6-O-β-D-glucopyranoside (target 1) and clemastanin B (target 2) in the present study. Radix isatidis was dried, pulverized and extracted with 50% methanol at room temperature, then concentrated and subjected to pretreatment with D-101 macroporous resin chromatography and extraction by MPLC. The first target compound was separated by MPLC at the purity raised to 70-80%, but without the second minor compounds which were irreversibly adsorbed by C18 solid support. Therefore, the second target compound in the crude extract was directly separated by HSCCC at purity of 80-90%. Finally these refined samples were further separated by pre-HPLC to obtain a high purity at 98-99%. The chemical structure identification of each target compound was carried out by IR, ESI-MS and 1 H NMR.

  11. Polydopamine-coated magnetic molecularly imprinted polymer for the selective solid-phase extraction of cinnamic acid, ferulic acid and caffeic acid from radix scrophulariae sample.

    PubMed

    Yin, Yuli; Yan, Liang; Zhang, Zhaohui; Wang, Jing; Luo, Ningjing

    2016-04-01

    We describe novel cinnamic acid polydopamine-coated magnetic imprinted polymers for the simultaneous selective extraction of cinnamic acid, ferulic acid and caffeic acid from radix scrophulariae sample. The novel magnetic imprinted polymers were synthesized by surface imprinting polymerization using magnetic multi-walled carbon nanotubes as the support material, cinnamic acid as the template and dopamine as the functional monomer. The magnetic imprinted polymers were characterized by transmission electron microscopy, scanning electron microscopy, Fourier transform infrared spectroscopy and vibrating sample magnetometry. The results revealed that the magnetic imprinted polymers had outstanding magnetic properties, high adsorption capacity, selectivity and fast kinetic binding toward cinnamic acid, ferulic acid and caffeic acid. Coupled with high-performance liquid chromatography, the extraction conditions of the magnetic imprinted polymers as a magnetic solid-phase extraction sorbent were investigated in detail. The proposed imprinted magnetic solid phase extraction procedure has been used for the purification and enrichment of cinnamic acid, ferulic acid and caffeic acid successfully from radix scrophulariae extraction sample with recoveries of 92.4-115.0% for cinnamic acid, 89.4-103.0% for ferulic acid and 86.6-96.0% for caffeic acid. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. An Integrated Strategy for Global Qualitative and Quantitative Profiling of Traditional Chinese Medicine Formulas: Baoyuan Decoction as a Case

    NASA Astrophysics Data System (ADS)

    Ma, Xiaoli; Guo, Xiaoyu; Song, Yuelin; Qiao, Lirui; Wang, Wenguang; Zhao, Mingbo; Tu, Pengfei; Jiang, Yong

    2016-12-01

    Clarification of the chemical composition of traditional Chinese medicine formulas (TCMFs) is a challenge due to the variety of structures and the complexity of plant matrices. Herein, an integrated strategy was developed by hyphenating ultra-performance liquid chromatography (UPLC), quadrupole time-of-flight (Q-TOF), hybrid triple quadrupole-linear ion trap mass spectrometry (Qtrap-MS), and the novel post-acquisition data processing software UNIFI to achieve automatic, rapid, accurate, and comprehensive qualitative and quantitative analysis of the chemical components in TCMFs. As a proof-of-concept, the chemical profiling of Baoyuan decoction (BYD), which is an ancient TCMF that is clinically used for the treatment of coronary heart disease that consists of Ginseng Radix et Rhizoma, Astragali Radix, Glycyrrhizae Radix et Rhizoma Praeparata Cum Melle, and Cinnamomi Cortex, was performed. As many as 236 compounds were plausibly or unambiguously identified, and 175 compounds were quantified or relatively quantified by the scheduled multiple reaction monitoring (sMRM) method. The findings demonstrate that the strategy integrating the rapidity of UNIFI software, the efficiency of UPLC, the accuracy of Q-TOF-MS, and the sensitivity and quantitation ability of Qtrap-MS provides a method for the efficient and comprehensive chemome characterization and quality control of complex TCMFs.

  13. Integration of magnetic solid phase fishing and off-line two-dimensional high-performance liquid chromatography-diode array detector-mass spectrometry for screening and identification of human serum albumin binders from Radix Astragali.

    PubMed

    Zhang, Yuping; Nie, Mingkun; Shi, Shuyun; You, Qingping; Guo, Junfang; Liu, Liangliang

    2014-03-01

    Radix Astragali is one of the most popular traditional medicinal herb and healthy dietary supplement. Isoflavonoids and astragalosides are the main bioactive ingredients. However, the systematic bioactive component analysis is inadequate so far. Then a facile method based on Fe3O4@SiO2-human serum albumin (Fe3O4@SiO2-HSA) magnetic solid phase fishing integrated with two-dimensional high-performance liquid chromatography-diode array detector-mass spectrometry (2D HPLC-DAD-MS(n)) was developed to fish out and identify HSA binders from Radix Astragali. The immobilized HSA displayed a high stability with 96.2% retained after ten consecutive cycles. 2D HPLC system (size exclusion chromatography×reversed phase chromatography, SEC×RP) were developed and optimised. Forty-seven bioactive compounds including thirty-four isoflavonoids and thirteen astragalosides were screened and identified or tentatively deduced based on their retention time, ultraviolet (UV), accurate molecular weight and diagnostic fragment ions. The results indicated that the integrated method could be widely applied for systematical fishing and identification of bioactive compounds, especially for low-abundance and overlapped compounds, from complex mixtures. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Dynamic variation of bioactive compounds and aflatoxins in contaminated Radix Astragali during extraction process.

    PubMed

    Hu, Yichen; Kong, Weijun; Luo, Hongli; Zhao, Lianhua; Yang, Meihua

    2016-03-30

    Although increasing attention has been paid to the health threat caused by mycotoxins in commodities such as food or medicines, mycotoxin transfer processes from crude material to products have raised little concern so far. Radix Astragali is a commonly used edible and medicinal herbal plant that is susceptible to contamination with aflatoxins from Aspergillus flavus. There have been no studies on mycotoxin transfer into pharmaceutical preparations or derivative products. To facilitate the aflatoxin reduction and bioactivity retention, the dynamic variations of aflatoxins as well as herbal compounds, namely calycosin-7-glucoside, astragaloside and formononetin, in Radix Astragali contaminated by A. flavus during water decoction and ethanol refluxing treatments were evaluated simultaneously by an ultra-fast liquid chromatography-triple quadrupole linear ion trap mass spectrometry method. After the extraction processes, although the amount of alfatoxins was reduced remarkably, aflatoxin residuals in preparation still exceed recommended limits, manifesting the great need to establish a limit for aflatoxins in herbal extractions or derivative products. Meanwhile, due to the hydrolysis of glucoside, water decoction period should be no longer than 4 h. This investigation would benefit from the determination of the dynamic variation of aflatoxins in infected herbs in preparation treatments, in order to further develop aflatoxin limits in herbal preparations. © 2015 Society of Chemical Industry.

  15. Comprehensive two-dimensional PC-3 prostate cancer cell membrane chromatography for screening anti-tumor components from Radix Sophorae flavescentis.

    PubMed

    Wang, Qiang; Xu, Junnan; Li, Xiang; Zhang, Dawei; Han, Yong; Zhang, Xu

    2017-07-01

    Radix Sophorae flavescentis is generally used for the treatment of different stages of prostate cancer in China. It has ideal effects when combined with surgical treatment and chemotherapy. However, its active components are still ambiguous. We devised a comprehensive two-dimensional PC-3 prostate cancer cell membrane chromatography system for screening anti-prostate cancer components in Radix Sophorae flavescentis. Gefitinib and dexamethasone were chosen as positive and negative drugs respectively for validation and optimization the selectivity and suitability of the comprehensive two-dimensional chromatographic system. Five compounds, sophocarpine, matrine, oxymatrine, oxysophocarpine, and xanthohumol were found to have significant retention behaviors on the PC-3 cell membrane chromatography and were unambiguously identified by time-of-flight mass spectrometry. Cell proliferation and apoptosis assays confirmed that all five compounds had anti-prostate cancer effects. Matrine and xanthohumol had good inhibitory effects, with half maximal inhibitory concentration values of 0.893 and 0.137 mg/mL, respectively. Our comprehensive two-dimensional PC-3 prostate cancer cell membrane chromatographic system promotes the efficient recognition and rapid analysis of drug candidates, and it will be practical for the discovery of prostate cancer drugs from complex traditional Chinese medicines. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. [Analysis of variation of monoterpene glycosides and polyhydroxy compounds in paeoniae radix alba during preliminary processing].

    PubMed

    Xu, Yuan; Liu, Pei; Yan, Hui; Qian, Da-Wei; Duan, Jin-Ao

    2014-05-01

    To investigate variation of monoterpene glycosides and polyhydroxy compounds in Paeoniae Radix Alba dried by different processing methods. The crude drugs were processed sequentially as washed, removed the head, tail, fine roots and dried. The samples were divided into eight groups by whether peeled and decocted or not. Each group was dried by 35, 45, 60, 80,100, 120 degrees C, sun-dried and shade-dried. HPLC-PDA method was adopted to determine the content of monoterpene glycosides compounds (paeoniflorin alibiflorin, oxypaeoniflorin and benzoylpaeoniflorin), polyhydroxy compounds (catechin and gallic acid) and benzoic acid. Chromatographic conditions: Phecad C18 column (250 mm x 4.6 mm, 5 microm). A principal component analysis (PCA) method was used subsequently to get data processed. The retained content of seven constituents decreased in those peeled crude drug, and after cooked, monoterpene glycosides and polyhydroxy compounds increased while the benzoic acid decreased. It was believed that rele- vant enzymes were inactivated while being cooked so that drying temperature showed little influence on the biotransformation. Contents of effective ingredients in Paeoniae Radix Alba are influenced by drying processing. The preferable method shows to be that crude drug should be cooked before being peeled and dried. As a matter of processing convtence, it is suggested to be peeled and sliced before being dried.

  17. Freshwater Cyanobacteria (Blue-Green Algae) Toxins: Isolation and Characterization

    DTIC Science & Technology

    1990-05-01

    Nostoc sp. from Finland, Oscillatoria sp. from Norway, Microcystis aeruainosa from China and Anabaena flos-aquae from Canada, Accesion For NTIS CRA&I...implicated in cyanobacteria poisonings only toxins from Anabaena, Anhanizomenon, Microcystis, Fiodulariq, Nostoc , and Oscillatoria have been isolated, at...Fig. 4 Structure of known Microcystin-LR homologues. **D-Asp = desmethyl aspartic acid *ADMAdda = acetyl’ADDA *Har = homoarginine * produced by Nostoc

  18. Chemometrics-based Approach in Analysis of Arnicae flos

    PubMed Central

    Zheleva-Dimitrova, Dimitrina Zh.; Balabanova, Vessela; Gevrenova, Reneta; Doichinova, Irini; Vitkova, Antonina

    2015-01-01

    Introduction: Arnica montana flowers have a long history as herbal medicines for external use on injuries and rheumatic complaints. Objective: To investigate Arnicae flos of cultivated accessions from Bulgaria, Poland, Germany, Finland, and Pharmacy store for phenolic derivatives and sesquiterpene lactones (STLs). Materials and Methods: Samples of Arnica from nine origins were prepared by ultrasound-assisted extraction with 80% methanol for phenolic compounds analysis. Subsequent reverse-phase high-performance liquid chromatography (HPLC) separation of the analytes was performed using gradient elution and ultraviolet detection at 280 and 310 nm (phenolic acids), and 360 nm (flavonoids). Total STLs were determined in chloroform extracts by solid-phase extraction-HPLC at 225 nm. The HPLC generated chromatographic data were analyzed using principal component analysis (PCA) and hierarchical clustering (HC). Results: The highest total amount of phenolic acids was found in the sample from Botanical Garden at Joensuu University, Finland (2.36 mg/g dw). Astragalin, isoquercitrin, and isorhamnetin 3-glucoside were the main flavonol glycosides being present up to 3.37 mg/g (astragalin). Three well-defined clusters were distinguished by PCA and HC. Cluster C1 comprised of the German and Finnish accessions characterized by the highest content of flavonols. Cluster C2 included the Bulgarian and Polish samples presenting a low content of flavonoids. Cluster C3 consisted only of one sample from a pharmacy store. Conclusion: A validated HPLC method for simultaneous determination of phenolic acids, flavonoid glycosides, and aglycones in A. montana flowers was developed. The PCA loading plot showed that quercetin, kaempferol, and isorhamnetin can be used to distinguish different Arnica accessions. SUMMARY A principal component analysis (PCA) on 13 phenolic compounds and total amount of sesquiterpene lactones in Arnicae flos collection tended to cluster the studied 9 accessions into three main groups. The profiles obtained demonstrated that the samples from Germany and Finland are characterized by greater amounts of phenolic derivatives than the Bulgarian and Polish ones. The PCA loading plot showed that quercetin, kaemferol and isorhamnetin can be used to distinguish different arnica accessions. PMID:27013791

  19. A Complex System of Glacial Sub-Refugia Drives Endemic Freshwater Biodiversity on the Tibetan Plateau.

    PubMed

    Clewing, Catharina; Albrecht, Christian; Wilke, Thomas

    2016-01-01

    Although only relatively few freshwater invertebrate families are reported from the Tibetan Plateau, the degree of endemism may be high. Many endemic lineages occur within permafrost areas, raising questions about the existence of isolated intra-plateau glacial refugia. Moreover, if such refugia existed, it might be instructive to learn whether they were associated with lakes or with more dynamic ecosystems such as ponds, wetlands, or springs. To study these hypotheses, we used pulmonate snails of the plateau-wide distributed genus Radix as model group and the Lake Donggi Cona drainage system, located in the north-eastern part of the plateau, as model site. First, we performed plateau-wide phylogenetic analyses using mtDNA data to assess the overall relationships of Radix populations inhabiting the Lake Donggi Cona system for revealing refugial lineages. We then conducted regional phylogeographical analyses applying a combination of mtDNA and nuclear AFLP markers to infer the local structure and demographic history of the most abundant endemic Radix clade for identifying location and type of (sub-)refugia within the drainage system. Our phylogenetic analysis showed a high diversity of Radix lineages in the Lake Donggi Cona system. Subsequent phylogeographical analyses of the most abundant endemic clade indicated a habitat-related clustering of genotypes and several Late Pleistocene spatial/demographic expansion events. The most parsimonious explanation for these patterns would be a scenario of an intra-plateau glacial refugium in the Lake Donggi Cona drainage system, which might have consisted of isolated sub-refugia. Though the underlying processes remain unknown, an initial separation of lake and watershed populations could have been triggered by lake-level fluctuations before and during the Last Glacial Maximum. This study inferred the first intra-plateau refugium for freshwater animals on the Tibetan Plateau. It thus sheds new light on the evolutionary history of its endemic taxa and provides important insights into the complex refugial history of a high-altitude ecosystem.

  20. [Effects of resolving phlegm method on fibrinolytic status in non-alcoholic steatohepatitis patients of phlegm and blood-stasis syndrome].

    PubMed

    Chen, Li; Jiang, Yang-Kun; Cai, Yan-Bo

    2006-12-01

    To observe the effect of resolving phlegm method (RPM) on fibrinolytic status in non-alcoholic steatohepatitis (NASH) patients of phlegm blood-stasis (PBS) syndrome type. Sixty-two patients were randomly assigned to 2 groups, namely the treated group (n = 34) treated with Chinese herbs for resolving phlegm and dampness, smoothing liver and gallbladder, promoting blood circulation and removing blood stasis (composition: Indigo Naturalis 10 g, Alumen 3 g, Semen Cassiae 15 g, Fructus Crataegi 15 g, vinegar prepared Radix Bupleuri 10 g, Radix Curcumae 10 g, Radix Salviae Miltiorrhizae 12 g, Herba Lycopi 12 g, talc 12 g and Radix Glycyrrhizae 2 g), one dose twice per day orally, and the control group (n = 28) with ursodeoxycholic acid tablet (UAT) 150 mg three times per day. The treatment course for both groups was 12 weeks. Liver function (ALT, AST, ALP), insulin resistance (IR) index represented by homeostasis model-IR (HOMA-IR) and insulin (Ins), levels of tissue plasminogen activator (t-PA) and plasminogen activator inhibitor-1 (PAI-1), as well as main symptoms and physical signs were assessed before and after treatment. (1) Compared with those before treatment, levels of ALT, AST, HOMA-IR, t-PA, PAl-1 and main symptoms were all improved in the treated group (P < 0.05 or P < 0.01); (2) There was significant difference in ALP, HOMA-IR, t-PA and PAI-1 between the treated group and the control group (P < 0.05 or P < 0.01); (3) The improvement in liver function related indexes in the control group was mainly the level of ALT, t-PA (P < 0.01), and also shown on HOMA-IR, Ins and PAI-1. RPM could effectively improve liver function and fibrinolytic status. Its effect was better than that of UAT.

  1. Simultaneous Determination of Multiple Components in Guanjiekang in Rat Plasma via the UPLC-MS/MS Method and Its Application in Pharmacokinetic Study.

    PubMed

    Wu, Jian; Xie, Ying; Xiang, Zheng; Wang, Canjian; Zhou, Hua; Liu, Liang

    2016-12-16

    Guanjiekang (GJK) that is formed by five medicinal herbs including Astragali Radix , Aconiti Lateralis Radix Praeparaia , Glycyrrhizae Radix et Rhizoma, Corydalis Rhizoma and Paeoniae Radix Alba was used for the treatment of rheumatoid arthritis (RA). However, the pharmacokinetic (PK) profile of active components in GJK remains unclear. This study aims to evaluate the pharmacokinetic behavior of seven representative active constituents in GJK (i.e., benzoylhypaconine, benzoylmesaconine, paeoniflorin, tetrahydropalmatine, calycosin-7-glucoside, formononetin and isoliquiritigenin) after oral administration of GJK in rats. A rapid, sensitive and reliable ultra-performance liquid chromatography-tandem mass spectrometer (UPLC-MS/MS) method has been successfully developed for the simultaneous determination of these seven constituents in rat plasma. Chromatographic separation was achieved on a C 18 column with a gradient elution program that consists of acetonitrile and water (containing 0.1% formic acid) at a flow rate of 0.35 mL/min. Detection was performed under the multiple reaction monitoring (MRM) in the positive electrospray ionization (ESI) mode. The calibration curves exhibited good linearity (R² > 0.99) over a wide concentration range for all constituents. The accuracies ranged from 92.9% to 107.8%, and the intra-day and inter-day precisions at three different levels were below 15%. Our PK results showed that these seven compounds were quickly absorbed after the administration of the GJK product, and T max ranged from 30 min to 189 min. The in vivo concentrations of paeoniflorin and isoliquiritigenin were significantly higher than the reported in vitro effective doses, indicating that they could partly contribute to the therapeutic effect of GJK. Therefore, we conclude that pharmacokinetic studies of representative bioactive chemicals after administration of complex herbal products are not only necessary but also feasible. Moreover, these seven compounds that were absorbed in vivo can be used as indicator standards for quality control and for determining pharmacokinetic behavior of herbal medicines in clinical studies.

  2. Stimulating effects of Bacillus subtilis natto-fermented Radix astragali on hyaluronic acid production in human skin cells.

    PubMed

    Hsu, Mei-Fang; Chiang, Been-Huang

    2009-09-25

    Radix astragali, a well-known Chinese herb, which has been traditionally used for skincare, and microbial fermentation is one of the conventional methods for processing Chinese herbs. This research studied the effects of non-fermented (HQNB) and fermented preparations (HQB) of Radix astragali on hyaluronic acid (HA) production in primary human skin cells. HQB and HQNB were prepared and added to the cultures of primary human skin cells. Hyaluronic acid content was determined using ELISA. Real-time RT-PCR was used to evaluate hyaluronan synthase gene expression. The bioactive compounds were analyzed by HPLC. The growth-stimulating effect of HQNB on both of keratinocytes and fibroblasts were significantly higher than that of HQB. Conversely, HQB, but not HQNB significantly stimulated HA production in both cultured primary human epidermal keratinocytes and human dermal fibroblasts in dose-dependent manners. In addition, HQB markedly and dose-dependently increased the expression of hyaluronan synthase 3 and hyaluronan synthase 2 mRNA in HaCaT cells and human fibroblasts, respectively. Therefore, HQB might be a promising candidate for preventing the age-dependent loss of HA content in aged human skin, and its effect on the enhancement of HA synthesis in skin cells is highly related to its effect on the expression of hyaluronan synthase genes. The three major active isoflavonoids in Radix astragali were identified as ononin, calycosin, and formononetin. After fermentation, all of these three compounds in HQB were significantly reduced. However, HQB still had significantly higher enhancement effect on the production of HA than HQNB. It appeared that isoflavonoid aglycones or other metabolites, converted from their primary isoflavones during fermentation, might be responsible for the skincare functions found in this study. This study demonstrated the low toxicity and the stimulating effects of HQB on HA synthesis, and suggests that HQB may play a promising role in anti-aging cosmetic applications.

  3. Effects of Chailong Jieyu Pill on Behavior, Monoamine Neurotransmitters, and Corticosteroid Receptors in a Rat Model of Anxiety Disorder.

    PubMed

    Feng, Guang-Kui; Ma, Xian-Jun; Chen, Yin-Yi; Bian, Guang-Rong; Yang, Chao; Gu, Bao-Dong

    2018-01-01

    Chailong Jieyu Pill (CJP) is composed of Radix Bupleuri, Radix Scutellariae, Rhizoma Pinelliae Preparata, Radix Codonopsis, Radix Glycyrrhizae preparata , keel, Concha Ostreae, Concha Margaritifera Usta, Rhizoma Zingiberis Recens , and Fructus Jujubae . CJP has shown good clinical effects on improving anxiety disorders. However, as the mechanism underlying such benefits remains unclear, the aim of this study was to investigate the mechanism of action for CJP on anxiety-related behaviors in a rat model of anxiety disorder. After establishing a rat model of anxiety disorder using uncertain empty bottle stimulation, rats were divided into control, model, citalopram, low-dose CJP, and high-dose CJP groups. After 1 month of administration, effects of treatments on rat appearance, body weight, and open-field test scores were observed. In addition, hippocampal monoamine neurotransmitter (5-hydroxytryptamine, dopamine, and norepinephrine) contents were measured with an enzyme-linked immunosorbent assay, and mRNA expression of mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) were measured with reverse transcription-polymerase chain reaction. CJP increased rat weight, and this effect was increased in the high-dose CJP group compared with the citalopram group ( P < 0.05). CJP also elevated open-field test scores compared with the citalopram group ( P < 0.05). While CJP decreased monoamine neurotransmitter contents in rat hippocampus, the regulatory effect of CJP on 5-hydroxytryptamine was reduced compared with citalopram ( P < 0.01). CJP upregulated GR mRNA expression in both low-dose ( P < 0.05) and high-dose ( P < 0.01) CJP groups, but only the latter significantly downregulated MR mRNA expression and showed enhanced effects compared with citalopram ( P < 0.05). Thus, CJP likely exerted its significant antianxiety effect by diminishing monoamine neurotransmitters and regulating mRNA expression of MR and GR in the hippocampus of our rat model of anxiety disorder.

  4. Nonnative invasive plants in South Carolina: combining phase-2 with phase-3 vegetation structure and diversity pilot data to enhance our understanding of forest health issues

    Treesearch

    Sonja N. Oswalt

    2006-01-01

    Studies suggest that the Southeast is an area of primary concern with regards to the spread of alien plant species (Miller 2003, Stapanian and others 1998). Data collected by Stapanian and others in 1998 showed that Japanese honeysuckle (Lonicera japonica) occurred over 2 million acres in the Southeast, invading forests and displacing native species. Among the most...

  5. Nonnative Invasive Plants in South Carolina: Combining Phase-2 with Phase-3 Vegetation Structure and Diversity Pilot Data to Enhance our Understanding of Forest Health Issues

    Treesearch

    Sonja N. Oswalt

    2006-01-01

    Studies suggest that the Southeast is an area of primary concern with regards to the spread of alien plant species (Miller 2003, Stapanian and others 1998). Data collected by Stapanian and others in 1998 showed that Japanese honeysuckle (Lonicera japonica) occurred over 2 million acres in the Southeast, invading forests and displacing native species...

  6. Processing of waste material of radix physochlainae for preparation of fine chemicals after extraction

    NASA Astrophysics Data System (ADS)

    He, A.; Yohannes, A.; Feng, X. T.; Yao, S.

    2017-02-01

    Waste residues of Chinese traditional medicine radix physochlainae (Huashanshen) contain a large amount of hemicelluloses after extraction. After the removal of the cellulose and lignin, main components of the solution are different degree of hydrolysis products of hemicelluloses. In the degradation process, hemicelluloses firstly become pentose, and then pentose loses 3 molecules of water and turns into furfural. This study explored a series of conditions of the method; finally the yield of furfural can reach 8.5% (calculated with the weight of raw residues) under the condition of pH of 0.2-0.3, temperature of 104-106°C, hydrolysis duration for 10 minutes. Furfural can be further processed to be resin materials.

  7. Pharmacognostic Specification, Chlorogenic Acid Content, and In vitro Antioxidant Activities of Lonicera japonica Flowering Bud

    PubMed Central

    Chaowuttikul, Chayanon; Palanuvej, Chanida; Ruangrungsi, Nijsiri

    2017-01-01

    Background: Lonicera japonica Thunb. or Japanese Honeysuckle has been widely used in traditional medicine for antipyretic. Objective: To establish the pharmacognostic specification of L. japonica flowering bud in Thailand and to determine its chlorogenic acid content and in vitro antioxidant activities. Materials and Methods: Dried L. japonica flowering bud from 15 various herbal drugstores throughout Thailand were investigated for pharmacognostic specification. Their chlorogenic acid contents were quantitatively analyzed by thin layer chromatography (TLC) densitometry with winCATS software. The mobile phase for TLC development consisted of ethyl acetate: formic acid: acetic acid: water (10:1.1:1.1:2.6). Antioxidant activities were investigated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging, ferric ion reducing antioxidant power assay, nitric oxide scavenging assay, and β-carotene bleaching assays. Results: Qualified L. japonica flowering bud in Thailand was presented that the contents of loss on drying, total ash, acid-insoluble ash, and water should not be >10.11%, 6.59%, 1.14%, and 10.82% by weight, respectively. The ethanol and water soluble extractive values should not be < 16.46% and 28.88% by weight, respectively. Chlorogenic acid content in L. japonica flowering bud was found to be 2.24 ± 0.50 g/100 g of crude drug. L. japonica flowering bud showed DPPH and nitric oxide scavenging activities as well as reducing power property. Conclusion: This pharmacognostic specification with special reference to the chlorogenic acid content can be used for quality control of L. japonica flowering bud in Thailand. The potential antioxidant of this crude drug was demonstrated in vitro. SUMMARY Pharmacognostic specification of Lonicera japonica flowering bud in Thailand has been establishedThe chlorogenic acid content has been quantified by thin layer chromatography-densitometryThe ethanolic extract of L. japonica flowering bud showed antioxidation potential, especially on reducing power property. Abbreviations Used: TLC: Thin layer chromatography, DPPH: 2,2-diphenyl-1-picrylhydrazyl, FRAP: Ferric ion Reducing Antioxidant Power, WHO: World Health Organization, ICH: International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use; LOD: Limit of detection; LOQ: Limit of quantitation; BHT: Butylated hydroxytoluene; FeSO4: Iron(II) sulfate; DMSO: Dimethyl sulfoxide; TPTZ: 2,4,6-tripyridyl-s-triazine. PMID:28539735

  8. SEPARATION OF THE MINOR FLAVONOLS FROM FLOS GOSSYPII BY HIGH-SPEED COUNTERCURRENT CHROMATOGRAPHY

    PubMed Central

    Yang, Yi; Zhao, Yongxin; Gu, Dongyu; Ayupbek, Amatjan; Huang, Yun; Dou, Jun; Ito, Yoichiro; Zhang, Tianyou; Aisa, Haji Akber

    2010-01-01

    An effective high-speed countercurrent chromatography (HSCCC) method was established for further separation and purification of four minor flavonols in addition to five major flavonols which were reported by our previous study from extracts of Flos Gossypii. HSCCC was performed with three two-phase solvent systems composed of n-hexane-ethyl acetate-methanol-water (7.5:15:6:7, v/v), (2.5:15:2:7, v/v) and (0:1:0:1, v/v). The separation was repeated 3 times, and 3.8 mg of 8-methoxyl-kaempferol-7-O-β-D-rhamnoside (HPLC purity 98.27%), 6.7 mg of astragalin (HPLC purity 94.18%), 3.3 mg of 4′-methoxyl-quercetin-7-O-β-D-glucoside (HPLC purity 94.30%) and 8.2 mg of hyperoside (HPLC purity 93.48%) were separated from 150 mg of the crude sample. The chemical structures of the flavonols were confirmed by MS, 1H NMR and 13C NMR. Meanwhile, the results indicated that the target compound with smaller K value (<0.5) can be separated by increasing column length of HSCCC. And four separation rules of flavonols according to the present study and references were summarized, which can be used as a useful guide for separation of flavonols by HSCCC. PMID:21494318

  9. Development of an on-line mixed-mode gel liquid chromatography×reversed phase liquid chromatography method for separation of water extract from Flos Carthami.

    PubMed

    Wang, Yu-Qing; Tang, Xu; Li, Jia-Fu; Wu, Yun-Long; Sun, Yu-Ying; Fang, Mei-Juan; Wu, Zhen; Wang, Xiu-Min; Qiu, Ying-Kun

    2017-10-13

    A novel on-line comprehensive two-dimensional liquid chromatography (2D-LC) method by coupling mixed-mode gel liquid chromatography (MMG-LC) with reversed phase liquid chromatography (RPLC) was developed. A mixture of 17 reference compounds was used to study the separation mechanism. A crude water extract of Flos Carthami was applied to evaluate the performance of the novel 2D-LC system. In the first dimension, the extract was eluted with a gradient of water/methanol over a cross-linked dextran gel Sephadex LH-20 column. Meanwhile, the advantages of size exclusion, reversed phase partition and adsorption separation mechanism were exploited before further on-line reversed phase purification on the second dimension. This novel on-line mixed-mode Sephadex LH-20×RPLC method provided higher peak resolution, sample processing ability (2.5mg) and better orthogonality (72.9%) versus RPLC×RPLC and hydrophilic interaction liquid chromatography (HILIC)×RPLC. To the best of our knowledge, this is the first report of a mixed-mode Sephadex LH-20×RPLC separation method with successful applications in on-line mode, which might be beneficial for harvesting targets from complicated medicinal plants. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Cyanobacteria reduce quagga mussel (Dreissena rostriformis bugensis) spawning and fertilization success

    USGS Publications Warehouse

    Boegehold, Anna G; Johnson, Nicholas; Ran, Jeffrey L; Kashian, Donna R

    2018-01-01

    exposure to cyanobacteria can inhibit quagga mussel spawning and fertilization. We assessed spawning in the presence of serotonin, a known spawning inducer, where adult quagga mussels placed in individual vials were exposed to 13 cyanobacteria cultures and purified algal toxin (microcystin-LR) with artificial lake water as the control. Fertilization success was evaluated by combining eggs with sperm in conjunction with cyanobacteria, and enumerating zygote formation marked by cellular cleavage. Several cyanobacterial strains reduced spawning and fertilization success, but microcystin-LR had no effect. Fertilization was more sensitive to cyanobacteria than gamete release. Only 1 culture, Aphanizomenon flos-aquae, inhibited spawning, whereas 6 cultures consisting of Anabaena flos-aquae, Dolichospermum lemmermanii, Gloeotrichia echinulata, Lyngbya wollei, and 2 Microcystis aeruginosa isolates reduced fertilization rates by up to 44%. The effects of cyanobacteria on reproduction in invasive freshwater mussels in the wild have not yet been identified. However, our laboratory studies show that concentrations of cyanobacteria that are possible during bloom conditions probably limit reproduction. Reproductive consequences on wild populations may become more prevalent as cyanobacteria blooms occur earlier in the year, making overlap between blooms and mussel spawning more common. Describing the mechanism by which cyanobacteria inhibit spawning and fertilization could reveal novel control methods to limit reproduction of this invasive species.

  11. Flambeau Mining Corporation, Ladysmith, Rusk County, Wisconsin. Proposed Open Pit Copper Mine and Waste Containment Area, Draft Environmental Impact Statement.

    DTIC Science & Technology

    1976-08-01

    American elm Lonicera tatarica - tartarian honeysuckle Ulmus rubra - slippery elm Siiibucus canadenis - common elder Ulmus thoiii~sii - cork elm ...community borders the marshes and swamps. 2.060 The predominant species are the trembling aspen (Populus tremuloides), red maple (Acer rubrum), the elms ...succession. The most numerous trees (in descending order) are: white birch, red maple, aspen, sugar maple, black ash, basswood, elm (Ulmus sp.), hemlock

  12. An Efficient Method for the Preparative Isolation and Purification of Flavonoid Glycosides and Caffeoylquinic Acid Derivatives from Leaves of Lonicera japonica Thunb. Using High Speed Counter-Current Chromatography (HSCCC) and Prep-HPLC Guided by DPPH-HPLC Experiments.

    PubMed

    Wang, Daijie; Du, Ning; Wen, Lei; Zhu, Heng; Liu, Feng; Wang, Xiao; Du, Jinhua; Li, Shengbo

    2017-02-02

    In this work, the n-butanol extract from leaves of Lonicera japonica Thunb. (L. japonica) was reacted with DPPH and subjected to a HPLC analysis for the guided screening antioxidants (DPPH-HPLC experiments). Then, nine antioxidants, including flavonoid glycosides and caffeoylquinic acid derivatives, were isolated and purified from leaves of L. japonica using high speed counter-current chromatography (HSCCC) and prep-HPLC. The n-butanol extract was firstly isolated by HSCCC using methyl tert-butyl ether/n-butanol/acetonitrile/water (0.5% acetic acid) (2:2:1:5, v/v), yielding five fractions F1, F2 (rhoifolin), F3 (luteoloside), F4 and F5 (collected from the column after the separation). The sub-fractions F1, F4 and F5 were successfully separated by prep-HPLC. Finally, nine compounds, including chlorogenic acid (1), lonicerin (2), rutin (3), rhoifolin (4), luteoloside (5), 3,4-Odicaffeoylquinic acid (6), hyperoside (7), 3,5-O-dicaffeoylquinic acid (8), and 4,5-O-dicaffeoylquinic acid (9) were obtained, respectively, with the purities over 94% as determined by HPLC. The structures were identified by electrospray ionization mass spectrometry (ESI-MS), 1H- and 13C-NMR. Antioxidant activities were tested, and the isolated compounds showed strong antioxidant activities.

  13. Electrochemical Determination of the Antioxidant Potential of Some Less Common Fruit Species

    PubMed Central

    Gazdik, Zbynek; Krska, Boris; Adam, Vojtech; Saloun, Jan; Pokorna, Tunde; Reznicek, Vojtech; Horna, Ales; Kizek, Rene

    2008-01-01

    Various berries and fruit types of less common fruit species are known to contain antioxidants. Consumption of high amounts of antioxidant flavonoids, which display a variety of biological properties, including antiproliferative and anti-inflammatory activity, may have a positive impact on human health, particularly for the prevention of cancer and other inflammatory diseases. In these studies, based on the hypothesis that the fruit extract with the highest content would possess significantly higher health benefits, flavonoid-rich extracts were obtained from some less common fruit species – Blue Honeysuckles (Lonicera Kamtschatica and Lonicera edulis, Turcz. ex. Freyn), Saskatoon berry (Amelanchier alnifolia Nutt.) and Chinese Hawthorn (Crataegus pinnatifida BUNGE) – grown from germplasm held at the Mendel University of Agriculture and Forestry in Brno, Czech Republic and then characterized in terms of biological value based on the results from a relative antioxidant capacity assessment. The antioxidant content evaluation was based on the total flavonoid amount, determined by liquid chromatography with electrochemical detection (HPLC-ED). A DPPH• test was applied as a reference. The antioxidant content measured in Chinese Hawthorn fruit extract identified it as a potent source of flavonoid antioxidants, with a content 9-fold higher than that seen in Amelanchier fruit. The multifunctional HPLC-ED array method coupled with a DPPH• reference appears to be the optimal analytical progress, accurately reflecting the nutritive-therapeutic properties of a fruit. PMID:27873945

  14. Effects of inhalable microparticle of flower of Lonicera japonica in a mouse model of COPD.

    PubMed

    Park, Yang-Chun; Jin, Mirim; Kim, Seung-Hyung; Kim, Min-Hee; Namgung, Uk; Yeo, Yoon

    2014-01-01

    Flower of Lonicera japonica (FLJ) is a traditional herbal medicine widely used in East Asia as an anti-inflammatory and anti-oxidative agent. The purpose of this study is to develop an inhalable powder formulation of FLJ and to evaluate its biological effects in a mouse model of chronic obstructive pulmonary disease (COPD). Inhalable dry powder containing FLJ was produced by spray-drying with leucine as an excipient. Its aerodynamic properties and anti-inflammatory activities were evaluated using the Anderson cascade impactor (ACI) and a mouse model of COPD, respectively. FLJ microparticle (FLJmp) had a hollow spherical shape in electron microscopy and showed aerodynamic properties suitable for inhalation (fine particle fraction of 54.0 ± 4.68% and mass median aerodynamic diameter of 4.6 ± 0.34μm). FLJmp decreased TNF-α and IL-6 expression in RAW264.7 cells activated by lipopolysaccharide (LPS). In mice challenged with LPS and cigarette smoke solution (CSS) to develop COPD, FLJmp decreased the levels of TNF-α and IL-6 in bronchoalveolar fluidas well as the number of inflammatory cells including neutrophils in peripheral blood. In addition, FLJmp induced recovery of elastin and collagen distribution, reduction of caspase-3 expression in lung tissues of COPD mice. Inhalational delivery of FLJ using a microparticle system is a promising strategy for the treatment of COPD. © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Selective extraction and determination of chlorogenic acids as combined quality markers in herbal medicines using molecularly imprinted polymers based on a mimic template.

    PubMed

    Ji, Wenhua; Zhang, Mingming; Yan, Huijiao; Zhao, Hengqiang; Mu, Yan; Guo, Lanping; Wang, Xiao

    2017-12-01

    We describe a solid-phase extraction adsorbent based on molecularly imprinted polymers (MIPs), prepared with use of a mimic template. The MIPs were used for the selective extraction and determination of three chlorogenic acids as combined quality markers for Lonicera japonica and Lianhua qingwen granules. The morphologies and surface groups of the MIPs were assessed by scanning electron microscopy, Brunauer-Emmett-Teller surface area analysis, and Fourier transform infrared spectroscopy. The adsorption isotherms, kinetics, and selectivity of the MIPs were systematically compared with those of non-molecularly imprinted polymers. The MIPs showed high selectivity toward three structurally similar chlorogenic acids (chlorogenic acid, cryptochlorogenic acid, and neochlorogenic acid). A procedure using molecularly imprinted solid-phase extraction coupled with high-performance liquid chromatography was established for the determination of three chlorogenic acids from Lonicera japonica and Lianhua qingwen granules. The recoveries of the chlorogenic acids ranged from 93.1% to 101.4%. The limits of detection and limits of quantification for the three chlorogenic acids were 0.003 mg g -1 and 0.01 mg g -1 , respectively. The newly developed method is thus a promising technique for the enrichment and determination of chlorogenic acids from herbal medicines. Graphical Abstract Mimic molecularly imprinted polymers for the selective extraction of chlorogenic acids.

  16. Phenolic metabolites in leaves of the invasive shrub, Lonicera maackii, and their potential phytotoxic and anti-herbivore effects.

    PubMed

    Cipollini, Don; Stevenson, Randall; Enright, Stephanie; Eyles, Alieta; Bonello, Pierluigi

    2008-02-01

    Lonicera maackii is an invasive shrub in North America for which allelopathic effects toward other plants or herbivores have been suspected. We characterized the major phenolic metabolites present in methanol extracts of L. maackii leaves. In addition, we examined the effects of methanol-water extracts of L. maackii leaves on seed germination of a target plant species and on feeding preference and growth rate of a generalist insect herbivore. A total of 13 individual major and minor compounds were detected in crude leaf extracts by high-performance liquid chromatography coupled to electronspray ionization-tandem mass spectrometry (ESI-MS/MS). Extracts were dominated by two major flavones, apigenin and luteolin, and their glucoside derivatives, apigenin-7-glucoside and luteolin-7-glucoside. Quantities of these compounds, along with chlorogenic acid, varied between two sampling points. Leaf extracts that contained these compounds were inhibitory to seed germination of Arabidopsis thaliana. In addition, treatment of artificial diet with leaf extracts deterred feeding of the generalist herbivore, Spodoptera exigua, in choice experiments but had no effect on growth rate in short-term no-choice bioassays. Purified apigenin tended to deter feeding by S. exigua and inhibited seed germination of A. thaliana. We conclude that leaves of L. maackii contain phenolic compounds, including apigenin and chlorogenic acid, capable of having biological effects on other plants and insects.

  17. Quality evaluation of Radix Astragali through a simultaneous determination of six major active isoflavonoids and four main saponins by high-performance liquid chromatography coupled with diode array and evaporative light scattering detectors.

    PubMed

    Qi, Lian-Wen; Yu, Qing-Tao; Li, Ping; Li, Song-Lin; Wang, Yu-Xia; Sheng, Liang-Hong; Yi, Ling

    2006-11-17

    A method, high-performance liquid chromatography coupled with diode array and evaporative light scattering detectors (HPLC-DAD-ELSD), was developed to evaluate the quality of Radix Astragali through a simultaneous determination of six major active isoflavonoids and four main saponins. The wavelength at 280 nm was chosen to determine six isoflavonoids: calycosin-7-O-beta-D-glucoside (1), ononin (2), (6alphaR, 11alphaR)-9,10-dimethoxypterocarpan-3-O-beta-D-glucoside (3), (3R)-2'-hydroxy-3',4'-dimethoxyisoflavan-7-O-beta-D-glucoside (4), calycosin (5), and formononetin (6); and ELSD connected after DAD was employed to determine four saponins: astragaloside IV (7), astragaloside II (8), astragaloside I (9), and acetylastragaloside I (10). This assay was fully validated with respect to precision, repeatability and accuracy. The proposed method was successfully applied to quantify the ten components in eleven samples from different localities in China; significant variations were demonstrated in the content of these compounds in the samples from different areas. This simple, rapid, low-cost and reliable HPLC-DAD-ELSD method is suitable for routine quantitative analysis and quality control of traditional Chinese medicines (TCMs) consisting of bioactive multi-components with different structures such as Radix Astragali.

  18. Rapid simultaneous determination of isoflavones in Radix puerariae using high-performance liquid chromatography-triple quadrupole mass spectrometry with novel shell-type column.

    PubMed

    Du, Gang; Zhao, Haiyu; Song, Yuelin; Zhang, Qingwen; Wang, Yitao

    2011-10-01

    A high-performance liquid chromatography (HPLC) coupled with triple quadrupole mass spectrometry (MS/MS) method was developed for rapid determination of 13 isoflavones in Radix puerariae. A novel shell-type column, namely Kinetex core-shell C(18) column (50 mm×2.1 mm id, 2.6 μm), and gradient elution were used during the analysis. The chromatographic peaks of 13 investigated compounds were identified by comparing their retention time and MS data with the related reference compounds. Multiple-reaction monitoring (MRM) was employed for the quantitative analysis with negative ionization mode. All calibration curves showed good linearity (r(2)>0.9990) within test ranges. The LOD and LOQ were lower than 0.017 and 0.873 μg/mL on column, respectively. The intra- and inter-day precisions for 13 analytes were <1.17 and 2.17%, respectively, and the recoveries were 93.1-104.4%. The validated method was applied for quantitative analysis of 13 isoflavones in 7 species of Radix puerariae. The result demonstrated that HPLC-MS/MS system with Kinetex column could be a promising analytical tool for the determination of isoflavones in traditional Chinese medicines, which is helpful for comprehensive evaluation of quality of R. puerariae. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. The influence of compatibility of traditional Chinese medicine on the pharmacokinetic of main components in Fructus aurantii.

    PubMed

    Zhang, Jingze; Gao, Wenyuan; Hu, Xiao; Liu, Zhen; Liu, Changxiao

    2012-11-21

    Fructus Aurantii is one of the commonly used traditional Chinese medicines and the compatibility of Fructus Aurantii, Radix et Rhizoma Rhei and Semen Crotonis Pulveratum were the main components in a Chinese traditional patent medicine Weichang'an pill. Naringin and neohesperidin are two main flavonoid glycosides in the extract of Fructus Aurantii. The pharmacokinetics of naringin and neohesperidin, as the main marker constituents were analysis by a simple and accurate method. In the present study, pharmacokinetic differences of two flavonoid glycosides were detected after oral administration of the extract of single herb and different compatibility of Fructus Aurantii, Radix et Rhizoma Rhei and Semen Crotonis Pulveratum which at doses of approximately 700 mg/kg naringin and 300 mg/kg neohesperidin. It indicated that the pharmacokinetic process of naringin and neohesperidin in four groups were demonstrated bimodal phenomenon after oral administration. Comparing to pharmacokinetic parameters of the single herbs administration, there were no significant difference after the compatibility of Fructus Aurantii and Radix et Rhizoma Rhei. However, the absorption of two flavonoid glycosides was increased dramatically after the compatibility of Fructus Aurantii or Semen Crotonis Pulveratum. The same results were attained after co-administration of the extract of three herbs. Some components in the extract of Semen Crotonis Pulveratum promoted the absorption of naringin and neohesperidin. Crown Copyright © 2012. Published by Elsevier Ireland Ltd. All rights reserved.

  20. Treatment of Radix Dipsaci extract prevents long bone loss induced by modeled microgravity in hindlimb unloading rats.

    PubMed

    Niu, Yinbo; Li, Chenrui; Pan, Yalei; Li, Yuhua; Kong, Xianghe; Wang, Shuo; Zhai, YuanKun; Wu, Xianglong; Fan, Wutu; Mei, Qibing

    2015-01-01

    Radix Dipsaci is a kidney tonifying herbal medicine with a long history of safe use for treatment of bone fractures and joint diseases in China. Previous studies have shown that Radix Dipsaci extract (RDE) could prevent bone loss in ovariectomized rats. This study investigates the effect of RDE against bone loss induced by simulated microgravity. A hindlimb unloading rat model was established to determine the effect of RDE on bone mineral density and bone microarchitecture. Twenty-four male Sprague-Dawley rats were divided into four groups (n = 6 per group): control (CON), hindlimb unloading with vehicle (HLU), hindlimb unloading treated with alendronate (HLU-ALN, 2.0 mg/kg/d), and hindlimb unloading treated with RDE (HLU-RDE, 500 mg/kg/d). RDE or ALN was administrated orally for 4 weeks. Treatment with RDE had a positive effect on mechanical strength, BMD, BMC, bone turnover markers, and the changes in urinary calcium and phosphorus excretion. MicroCT analysis showed that RDE significantly prevented the reduction of the bone volume fraction, connectivity density, trabecular number, thickness, tissue mineral density, and tissue mineral content as well as improved the trabecular separation and structure model index. RDE was demonstrated to prevent the loss of bone mass induced by HLU treatment, which suggests the potential application of RDE in the treatment of microgravity-induced bone loss.

  1. A feasible, economical, and accurate analytical method for simultaneous determination of six alkaloid markers in Aconiti Lateralis Radix Praeparata from different manufacturing sources and processing ways.

    PubMed

    Zhang, Yi-Bei; DA, Juan; Zhang, Jing-Xian; Li, Shang-Rong; Chen, Xin; Long, Hua-Li; Wang, Qiu-Rong; Cai, Lu-Ying; Yao, Shuai; Hou, Jin-Jun; Wu, Wan-Ying; Guo, De-An

    2017-04-01

    Aconiti Lateralis Radix Praeparata (Fuzi) is a commonly used traditional Chinese medicine in clinic for its potency in restoring yang and rescuing from collapse. Aconiti alkaloids, mainly including monoester-diterpenoidaconitines (MDAs) and diester-diterpenoidaconitines (DDAs), are considered to act as both bioactive and toxic constituents. In the present study, a feasible, economical, and accurate HPLC method for simultaneous determination of six alkaloid markers using the Single Standard for Determination of Multi-Components (SSDMC) method was developed and fully validated. Benzoylmesaconine was used as the unique reference standard. This method was proven as accurate (recovery varying between 97.5%-101.8%, RSD < 3%), precise (RSD 0.63%-2.05%), and linear (R > 0.999 9) over the concentration ranges, and subsequently applied to quantitative evaluation of 62 batches of samples, among which 45 batches were from good manufacturing practice (GMP) facilities and 17 batches from the drug market. The contents were then analyzed by principal component analysis (PCA) and homogeneity test. The present study provided valuable information for improving the quality standard of Aconiti Lateralis Radix Praeparata. The developed method also has the potential in analysis of other Aconitum species, such as Aconitum carmichaelii (prepared parent root) and Aconitum kusnezoffii (prepared root). Copyright © 2017 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  2. Microwave-assisted extraction with water for fast extraction and simultaneous RP-HPLC determination of phenolic acids in radix Salviae Miltiorrhizae.

    PubMed

    Fang, Xinsheng; Wang, Jianhua; Zhou, Hongying; Jiang, Xingkai; Zhu, Lixiang; Gao, Xin

    2009-07-01

    An optimized microwave-assisted extraction method using water (MAE-W) as the extractant and an efficient HPLC analysis method were first developed for the fast extraction and simultaneous determination of D(+)-(3,4-dihydroxyphenyl) lactic acid (Dla), salvianolic acid B (SaB), and lithospermic acid (La) in radix Salviae Miltiorrhizae. The key parameters of MAE-W were optimized. It was found that the degradation of SaB was inhibited when using the optimized MAE-W and the stable content of Dla, La, and SaB in danshen was obtained. Furthermore, compared to the conventional extraction methods, the proposed MAE-W is a more rapid method with higher yield and lower solvent consumption with a reproducibility (RSD <6%). In addition, using water as extractant is safe and helpful for environment protection, which could be referred to as green extraction. The separation and quantitative determination of the three compounds was carried out by a developed reverse-phase high-performance liquid chromatographic (RP-HPLC) method with UV detection. Highly efficient separation was obtained using gradient solvent system. The optimized HPLC analysis method was validated to have specificity, linearity, precision, and accuracy. The results indicated that MAE-W followed by HPLC-UV determination is an appropriate alternative to previously proposed method for quality control of radix Salviae Miltiorrhizae.

  3. A pre-classification strategy based on UPLC-Triple-TOF/MS for metabolic screening and identification of Radix glehniae in rats.

    PubMed

    Wang, Shuang; Qi, Pengcheng; Zhou, Na; Zhao, Minmin; Ding, Weijing; Li, Song; Liu, Minyan; Wang, Qiao; Jin, Shumin

    2016-10-01

    Traditional Chinese Medicines (TCMs) have gained increasing popularity in modern society. However, the profiles of TCMs in vivo are still unclear owing to their complexity and low level in vivo. In this study, UPLC-Triple-TOF techniques were employed for data acquiring, and a novel pre-classification strategy was developed to rapidly and systematically screen and identify the absorbed constituents and metabolites of TCMs in vivo using Radix glehniae as the research object. In this strategy, pre-classification for absorbed constituents was first performed according to the similarity of their structures. Then representative constituents were elected from every class and analyzed separately to screen non-target absorbed constituents and metabolites in biosamples. This pre-classification strategy is basing on target (known) constituents to screen non-target (unknown) constituents from the massive data acquired by mass spectrometry. Finally, the screened candidate compounds were interpreted and identified based on a predicted metabolic pathway, well - studied fragmentation rules, a predicted metabolic pathway, polarity and retention time of the compounds, and some related literature. With this method, a total of 111 absorbed constituents and metabolites of Radix glehniae in rats' urine, plasma, and bile samples were screened and identified or tentatively characterized successfully. This strategy provides an idea for the screening and identification of the metabolites of other TCMs.

  4. Enrichment and purification of six Aconitum alkaloids from Aconiti kusnezoffii radix by macroporous resins and quantification by HPLC-MS.

    PubMed

    Liu, Jingjing; Li, Qing; Liu, Ran; Yin, Yidi; Chen, Xiaohui; Bi, Kaishun

    2014-06-01

    Aconitine, mesaconitine, hypaconitine, benzoylaconine, benzoylmesaconine and benzoylhypaconine are six main Aconitum alkaloids from traditional Chinese medicine, Aconiti kusnezoffii radix, which possess highly bioactive as well as highly toxic character for medicinal use. In the present study, for the purpose of better utilizing the toxic herbal material, the performance characteristics of NKA-II, D101, X-5, AB-8, S-8, HPD722 and HPD750 macroporous resins for the enrichment and purification of these six Aconitum alkaloids were critically evaluated. Results showed that NKA-II offered the best adsorption and desorption capacities for six Aconitum alkaloids among the seven macroporous resins tested, which were affected significantly by the pH value. Subsequently, dynamic adsorption and desorption experiments had been carried out with the column packed by NKA-II resin to optimize the separation process of six Aconitum alkaloids. After one run treatment with NKA-II resin, the content of total six Aconitum alkaloids were increased from 5.87% to 60.3%, the recovery was 75.8%. Meanwhile, a validated HPLC-MS method had been developed to qualitative and quantitative these six Aconitum alkaloids. This method would provide scientific references to the large-scale production of six Aconitum alkaloids from Aconiti kusnezoffii radix or other plants and might also expand the secure application of these highly toxic components for pharmacy. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. [Analysis of hot spots and trend of molecular pharmacognosy research based on project supported by National Natural Science Foundation of 1995-2014].

    PubMed

    Wang, Jun-Wen; Liu, Yang; Tong, Yuan-Yuan; Yang, Ce; Li, Hai-Yan

    2016-05-01

    This study collected 1995-2014 molecular pharmacognosy study, a total of 595 items, funded by Natural Science Foundation of China (NSFC). TDA and Excel software were used to analyze the data of the projects about general situation, hot spots of research with rank analytic and correlation analytic methods. Supported by NSFC molecular pharmacognosy projects and funding a gradual increase in the number of, the proportion of funds for pharmaceutical research funding tends to be stable; mainly supported by molecular biology methods of genuine medicinal materials, secondary metabolism and Germplasm Resources Research; hot drugs including Radix Salviae Miltiorrhizae, Radix Rehmanniae, Cordyceps sinensis, hot contents including tanshinone biosynthesis, Rehmannia glutinosa continuous cropping obstacle. Copyright© by the Chinese Pharmaceutical Association.

  6. Synthesis of a Temperature-Sensitive Matrine-Imprinted Polymer and Its Potential Application for the Selective Extraction of Matrine from Radix Sophorae Tonkinensis

    PubMed Central

    Jiang, Minjie; Wang, Lisheng; Liu, Xu; Yang, Hua; Ren, Fan; Gan, Lizhen; Jiang, Weizhe

    2015-01-01

    A temperature-sensitive matrine-imprinted polymer was prepared in chloroform by free-radical cross-linking copolymerization of methacrylic acid at 60 °C in the presence of ethylene glycol dimethacrylate as the cross-linker, N-isopropyl acrylamide as the temperature-responsive monomer and matrine as the template molecule. Binding experiments and Scatchard analyses revealed that two classes of binding sites were formed on molecular imprinted polymer (MIP) at 50 °C. Additionally, the thermoresponsive MIP was tested for its application as a sorbent material for the selective separation of matrine from Chinese medicinal plant radix Sophorae tonkinensis. It was shown that the thermoresponsive MIP displayed different efficiency in clean-up and enrichments using the SPE protocol at different temperatures. PMID:25658797

  7. Simultaneous Determination and Pharmacokinetic Comparisons of Multi-Ingredients after Oral Administration of Radix Salviae Miltiorrhizae Extract, Hawthorn Extract, and a Combination of Both Extracts to Rats

    PubMed Central

    Liu, Yu-Qiang; Cai, Qian; Liu, Chang; Bao, Feng-Wei; Zhang, Zhen-Qiu

    2014-01-01

    A simple and sensitive HPLC method was developed for simultaneous determination of danshensu (DSS), rosmarinic acid (RA), lithospermic acid (LA), salvianolic acid B (SAB), and hyperoside (HP) in rat plasma. This method validated was successfully applied to the pharmacokinetic study of the main active ingredients after oral administration of Radix Salviae Miltiorrhizae extract (SME), hawthorn extract (HTE), and a combination of both extracts (2.5 : 1) to rats. The results indicated that there have been great differences in pharmacokinetics between a single extract and a combination of both extracts. A combination of both extracts can enhance their bioavailabilities and delay the elimination of SAB and DSS in rats. PMID:24660090

  8. [Differences between cold and hot natures of processed Radix ginseng rubra and Panax quinquefolius L. based upon mice temperature tropism].

    PubMed

    Zhang, Xue-Ru; Zhao, Yan-Ling; Wang, Jia-Bo; Zhou, Can-Ping; Liu, Ta-Si; Zhao, Hai-Ping; Ren, Yong-Shen; Yan, Dan; Xiao, Xiao-He

    2009-07-28

    To establish an objective method to estimate the disparity between the cold and hot natures on the basis of an intrinsic correlation between temperature tropism of mice and the cold and hot natures of Chinese medicines. Male KM mice were randomly divided into 7 groups of 6 each, namely the normal group (NM), the weak model group (WM), the strong model group (SM), the weak model plus Radix ginseng rubra group (WM + RG), the weak model plus Panax quinquefolius L. group (WM + PQ), the strong model plus Radix ginseng rubra group (SM + RG) and the strong model plus Panax quinquefolius L. group (SM +PQ). The specific herbal drugs were administered intragastricly. To induce the weak model, mice were fed with a limited supply of feed and forced to swim in cold water until almost drowning while the strong model induced by feeding a high-protein diet with an unlimited feed access. The doses of Radix ginseng rubra and Panax quinquefolius L. were 35 mg/g of body weight per day (counted by the quantity of crude material) and lasting for seven days. The NM and model groups without dosing were intragastricly administered with physiological saline of the same volume to the dosing groups. The percentage of the remaining time of mouse on a high temperature (40 degrees C) pad to the total monitoring time was recorded by a self-designed intelligent animal behavior monitoring system. Meanwhile, the drinking volume of mice in each group was measured. Immediately after experiment, the activities of Na(+)K(+)-ATPase and superoxide dismutase (SOD) in liver tissue were measured by assay kits of phosphorus and xanthine oxidase methods respectively. The features of deficient and cold symptom, such as fatigue, stagnant weight growth, decreased water intake, cold limbs and tail etc, were observed in WM group. And the features of heat symptom, such as increased weight and water intake, hyperactivity etc, were observed in SM group. The percentage of time that the mouse remained on 40 degrees C pad of the WM group within the seven days experiment was significantly higher than that of the normal group (70.6% +/- 21.3% vs 52.1% +/- 6.5%, P < 0.05). While the value of SM group (45.7% +/- 4.6% ) was significantly lower than that of the normal group (P < 0.05); the value of WM + RG group and WM + PQ group were 65.6% +/- 7.8% and 75.3% +/- 13.0% respectively (both P < 0.05 compared with WM group); the values of SM + RG group and SM + PQ group were 36.1% +/- 15.5% and 55.5% +/- 7.7% respectively (both P < 0.05 compared with SM group). The activities of Na(+)K(+)-ATPase and SOD of WM mice treated with either Radix ginseng rubra or Panax quinquefolius L. were found to have a significant up-regulation (P < 0.05) as compared with untreated WM mice. But only the Panax quinquefolius L. showed an up-regulating effect upon Na(+)K(+) ATPase and SOD in SM mice. The external cold and hot natures of Radix ginseng rubra and Panax quinquefolius L. can be represented in an ethological way by the changes of animal's temperature tropism. And such a tropism may be internally regulated by body's energy metabolism.

  9. An Efficient High-performance Liquid Chromatography Combined with Electrospray Ionization Tandem Mass Spectrometry Method to Elaborate the Changes of Components Between the Raw and Processed Radix Aconitum kusnezoffii

    PubMed Central

    Wang, Beibei; Ji, Jiaojiao; Zhao, Shuang; Dong, Jie; Tan, Peng; Na, Shengsang; Liu, Yonggang

    2016-01-01

    Background: Crude radix Aconitum kusnezoffii (RAK) has great toxicity. Traditional Chinese medicine practice proved that processing may decrease its toxicity. In our previous study, we had established a new method of RAK processing (Paozhi). However, the mechanism is yet not perfect. Objective: To explore the related mechanism of processing through comparing the chemical contents. Materials and Methods: A new processing method of RAK named stoving (Hong Zhi) was used. In particular, RAK was stored at 110°C for 8 h, and then high performance liquid chromatography combined with electrospray ionization tandem mass spectrometry (HPLC-ESI-MSn) was developed for the detection of the alkaloids of the crude and processed RAK decoction pieces. Results: Thirty components of the crude RAK were discovered, among which, 23 alkaloids were identified. Meanwhile, 23 ingredients were detected in the processed RAK decoction pieces, among which, 20 alkaloids were determined yet. By comparison, eight alkaloids were found in both crude and processed RAK decoction pieces, 15 alkaloids were not found in the crude RAK, however, 10 new constituents yield after processing, which are 10-OH-hypaconine, 10-OH-mesaconine, isomer of bullatine A, 14-benzoyl-10-OH-mesaconine, 14-benzoyl-10-OH-aconine, 14-benzoyl-10-OH-hypaconine, dehydrated aconitine, 14-benzoylaconine, chuanfumine, dehydrated mesaconitine. Conclusion: The present study showed that significant change of alkaloids was detected in RAK before and after processing. Among them, the highly toxic diester alkaloids decreased and the less toxic monoester alkaloids increased. Moreover, the concentration changes significantly. HPLC-ESI-MSn are Efficient to elaborate the mechanism of reduction of toxicity and enhancement efficacy after processing. SUMMARY Stoving is a simple and effective method for the processing of radix Aconitum kusnezoffii.In the positive mode, the characteristic fragmentations of Aconitum alkaloids were obtained.The highly toxic alkaloids have decreased, and the new constituents appeared, which has explained successfully the processing mechanism of radix Aconitum kusnezoffii in chemistry. PMID:27019554

  10. Post-marketing safety monitoring of shenqifuzheng injection: a solution made of dangshen (Radix Codonopsis) and huangqi (Radix Astragali Mongolici).

    PubMed

    Ai, Qinghua; Zhang, Wen; Xie, Yanming; Huang, Wenhua; Liang, Hong; Cao, Hui

    2014-08-01

    To identify the potential risk factors associated with Shenqifuzheng injection (SFI), a solution made of Dangshen (Radix Codonopsis) and Huangqi (Radix Astragali Mongolici), for the timely provision of information to regulatory authorities. A comprehensive analysis of the production process, quality standards, pharmacology, post-marketing clinical studies, and safety evaluation using the primary literature of adverse reactions (ADR), case analyses, and systematic reviews, intensive hospital safety monitoring of post-marketing drugs, and data provided by the hospital information system (HIS). Sub-acute toxicity tests suggesting that a dose of 15 mL/kg (concentrated solution) had specific biological effects, whereas a smaller dose engendered no observable effects. Long-term toxicity testing in domestic rabbits showed that after SFI was administered for 90 days, the animals in each dosing group showed no chronic toxic reactions. Among 20 100 cases observed, the incidence of an ADR was 1.85 per thousand. From March to November 2013, of the leading institutions and 22 sub-centers involved in the post-marketing clinical safety intensive hospital monitoring, 21 units completed 8484 cases of monitoring, and reported 23 cases of adverse reactions. No damage to renal function was found using SFI at a dosage and a treatment course larger and longer than that recommended for the adjuvant treatment of tumors. This could reduce the mortality rate of admitted patients based on the analysis of the data provided by the HIS. A total of 16 clinical case reports of adverse reactions related to SFI in 1999-2012 were obtained through literature retrieval. These reports contained information concerning 17 cases, with adverse reaction symptoms including thrombocytopenia, rash, chills, feeling cold, palpitation, dyspnea, edema of a lower extremity, palpebral edema, and superficial vein inflammation, among others. This study introduces "get full access" to the flow of information on medicines regarding their ADR incidence rate and characteristics and factors. It supports the safety of SFI for clinical, research,and production uses based on objective, reliable, and scientific information to provide safe medication.

  11. Assessment of genotoxicity of herbal medicinal products: application of the "bracketing and matrixing" concept using the example of Valerianae radix (valerian root).

    PubMed

    Kelber, Olaf; Wegener, Tankred; Steinhoff, Barbara; Staiger, Christiane; Wiesner, Jacqueline; Knöss, Werner; Kraft, Karin

    2014-01-01

    An assessment of genotoxicity is a precondition for marketing authorization respectively registration of herbal medicinal products (HMPs), as well as for inclusion into the 'Community list of herbal substances, preparations and combinations thereof for use in traditional herbal medicinal products' established by the European Commission in accordance with Directive 2001/83/EC as amended, and based on proposals from the Committee on Herbal Medicinal Products (HMPC). In the 'Guideline on the assessment of genotoxicity of herbal substances/preparations' (EMEA/HMPC/107079/2007) HMPC has described a stepwise approach for genotoxicity testing, according to which the Ames test is a sufficient base for the assessment of genotoxicity in case of an unequivocally negative result. For reducing efforts for testing of individual herbal substances/preparations, HMPC has also developed the 'guideline on selection of test materials for genotoxicity testing for traditional herbal medicinal products/herbal medicinal products' (EMEA/HMPC/67644/2009) with the aim to allow testing of a standard range of test materials which could be considered representative of the commonly used preparations from a specific herbal drug according to a 'bracketing/matrixing' approach. The purpose of this paper is to provide data on the practical application of this bracketing and matrixing concept using the example of Valerianae radix, with the intention of facilitating its inclusion in the "Community list". Five extraction solvents, representing the extremes of the polarity range and including also mid-range extraction solvents, were used, covering the entire spectrum of phytochemical constituents of Valerianae radix, thereby including polar and non-polar constituents. Extracts were tested in the Ames test according to all relevant guidelines. Results were unequivocally negative for all extracts. A review of the literature showed that this result is in accordance with the available data, thus demonstrating the lack of a genotoxic potential. In conclusion the two guidelines on genotoxicity provide a practically applicable concept. Valerianae radix has no genotoxic potential, supporting its use in HMPs and its inclusion in the Community list. Copyright © 2014 The Authors. Published by Elsevier GmbH.. All rights reserved.

  12. Akinetes May Be Representative of Past Nostocalean Blooms: a Case Study of Their Benthic Spatiotemporal Distribution and Potential for Germination in a Eutrophic Lake

    PubMed Central

    Le Jeune, Anne-Hélène; Colombet, Jonathan; Thouvenot, Antoine; Latour, Delphine

    2017-01-01

    ABSTRACT Monitoring of water and surface sediment in a French eutrophic lake (Lake Aydat) was carried out over a 2-year period in order to determine whether akinetes in sediment could be representative of the most recent bloom and to estimate their germination potential. Sediment analysis revealed two akinete species, Dolichospermum macrosporum and Dolichospermum flos-aquae, present in the same proportions as observed for the pelagic populations. Moreover, similar spatial patterns observed for vegetative cells in the water column and akinete distributions in the sediment suggest that akinetes in the sediment may be representative of the previous bloom. However, the relationship between akinetes in the sediment and vegetative cells in the water column was not linear, and other factors may interfere. For example, our results highlighted horizontal transport of akinetes during the winter. The benthic overwinter phase did not seem to influence the percentages of intact akinetes, which remained stable at approximately 7% and 60% for D. macrosporum and D. flos-aquae, respectively. These percentages may thus be the result of processes that occurred in the water column. The intact overwintering akinetes showed germination rates of up to 90% after 72 h for D. flos-aquae or 144 h for D. macrosporum. The difference in akinete germination rates between these two species demonstrates different ecological strategies, which serve to expand the window for germination in time and space and thus optimize colonization of the water column by nostocalean cyanobacteria. IMPORTANCE Cyanobacteria have the ability to proliferate and to form blooms. These blooms can then affect the local ecology, health, and economy. The akinete, a resistant cell type that persists in sediment, is an important intermediate phase between previous and future blooms. We monitored the water column and the surface sediment of a French eutrophic lake (Lake Aydat) to investigate the relationship between vegetative cells in the water column and akinetes in the sediment. This study focused on the characterization of spatiotemporal akinete distributions, cellular integrity, and germination potential. Species-specific ecological strategies were highlighted and may partly explain the temporal succession of species in the water column. Akinetes may also be used to understand past nostocalean blooms and to predict future ones. PMID:28970224

  13. Radix Stellariae extract prevents high-fat-diet-induced obesity in C57BL/6 mice by accelerating energy metabolism

    PubMed Central

    Li, Yin; Liu, Xin; Fan, Yu

    2017-01-01

    Stellaria dichotoma L. is widely distributed in Ningxia and surrounding areas in northwestern China. Its root, Radix Stellariae (RS), has been used in herbal formulae for treating asthenic-fever, infection, malaria, dyspepsia in children and several other symptoms. This study investigated whether the RS extract (RSE) alleviates metabolic disorders. The results indicated that RSE significantly inhibited body weight gain in high-fat (HF)-diet-fed C57BL/6 mice, reduced fasting glucose levels, and improved insulin tolerance. Moreover, RSE increased the body temperature of the mice and the expression of uncoupling proteins and peroxisome proliferator-activated receptors in the white adipose tissue. Thus, RSE alleviated metabolic disorders in HF-diet-fed C57BL/6 mice by potentially activating UCP and PPAR signaling. PMID:28507819

  14. [Interfering effects of radix Salviae miltiorrhizae and lingustrazine on mm-LDL activating BKCa in ECV304 cell].

    PubMed

    Lin, L; Zheng, Y F; Qu, J H; Bao, G H

    2001-08-01

    To observe the action of minimally modified low density lipoprotein (mm-LDL) on BKCa in ECV304 cell and the interfering effects of radix salviae miltiorrhizae extract powder 764-3 (30 micrograms/ml) and lingustrazine (200 micrograms/ml) on this action. The cell-attached configuration of patch clamp technique was applied. mm-LDL (100 micrograms/ml) potentiated the activity of BKCa in ECV304. While 764-3 and lingustrazine abolished it. mm-LDL acted on vascular endothelial cell ECV304 could rapidly activate the activity of BKCa and might result in the increase of electro-chemical gradient for the resting Ca2+ influx, thus resting cytoplasmic concentration of calcium could be elevated and endothelial dysfunction would be induced. 764-3 and lingustrazine might have the protective action through decreasing the activity of BKCa.

  15. Radix Distolingualis: A Case Report, Review and Endodontic Treatment Guidelines

    PubMed Central

    Subbiya, Arunajatesan; Banu, Sherin; Malarvizhi, Dhakshinamoorthy

    2017-01-01

    Variation in the root and canal morphology of maxillary second molars is quite common. The most common configuration is three roots and three or four canals. But the presence of an additional palatal root is rather uncommon and has been reported to have an incidence of 1.4%. The extra root is located mesiolingual or distolingual to the primary palatal root. This is a unique case report that describes the successful endodontic management of a maxillary second molar with Radix Distolingualis (RDL). Identification of this variation was done through clinical examination, multi-angled radiographs, surgical operating microscope and an accurate assessment of this morphology was made with the help of Cone Beam Computed Tomography (CBCT) imaging. In addition, this article also discusses the literature review, guidelines for diagnosis and treatment of RDL. PMID:28764306

  16. Taspine isolated from Radix et Rhizoma Leonticis inhibits proliferation and migration of endothelial cells as well as chicken chorioallantoic membrane neovascularisation.

    PubMed

    Zhang, Yanmin; He, Langchong; Meng, Liang; Luo, Wenjuan

    2008-01-01

    The aim of the present study was to investigate an anti-angiogenic effect of taspine isolated from Radix et Rhizoma Leonticsi. Taspine was screened for the first time, using cell membrane chromatography (CMC). The anti-angiogeneic activity of taspine was tested by using the chicken chorioallantoic membrane (CAM) neovascularisation model in vivo and the HUVEC proliferation and migration models in vitro, respectively. The results showed that taspine could inhibit CAM angiogenesis significantly within the concentration range of 0.5-2 mug/egg, proliferation and migration of endothelial cells in a dose-dependent manner. The CAM histomorphology results indicated that taspine could inhibit blood vessels sprouts and proliferation of vascular endothelial cell. These findings suggest that taspine is a promising candidate for use as an angiogenesis inhibitor.

  17. [Isolation and preparation of an imidazole alkaloid from radix radix of Aconitum pendulum Busch by semi-preparative high-speed counter-current chromatography].

    PubMed

    Liu, Yongling; Chen, Tao; Chen, Chen; Zou, Denglang; Li, Yulin

    2014-05-01

    Aconitum pendulum Busch is rich C19 diterpenoid alkaloids, but there is no report of imidazole alkaloid in Aconitum pendulum Busch. In this study, an imidazole alkaloid named 1H-imidazole-2-carboxylic acid, butyl ester (ICABE) was successfully separated from Aconitum pendulum Busch with semi-preparative high-speed counter-current chromatography (HSCCC). The partition coefficient was measured by HPLC to select the solvent systems for ICABE separation by HSCCC. The separation was performed with a two-phase solvent system composed of n-hexane-chloroform-ethanol-water (10:1 : 13:2, v/v/v/v). The upper phase was used as the stationary phase and the lower phase as the mobile phase. It was operated at a flow rate of 1.8 mL/min. The apparatus was rotated at 850 r/min, and the detection wavelength was set at 230 nm. Under the selected conditions, a high efficiency separation of HSCCC was achieved, and 7.5 mg of ICABE was obtained from 100 mg of the crude sample of Aconitum pendulum in one-step separation within 350 min. The HPLC analysis showed that the purity of the compound was over 98%. The chemical structure was confirmed by UV, 1H-NMR and 13C-NMR. The established method is simple, highly efficient and suitable for large scale separation of ICABE from radix of Aconitum pendulum Busch.

  18. Antiviral Decoction of Isatidis Radix (板藍根 bǎn lán gēn) Inhibited Influenza Virus Adsorption on MDCK Cells by Cytoprotective Activity

    PubMed Central

    Ke, Lijing; Wen, Teng; Bradshaw, Jeremy P; Zhou, Jianwu; Rao, Pingfan

    2012-01-01

    The aim of this study is to elucidate how the Isatidis Radix (板藍根 bǎn lán gēn) tonic, as an aqueous mixture of hundreds of compositions, interrupts the infection of influenza viruses to their host cells. The efficacy of the tonic was evaluated and expressed as cell proliferation rate and plaque reduction rate in Madin-Darby Canine Kidney (MDCK) cells, against 3 strains of influenza A and B viruses. This boiling water (at 100°C) extract of Isatidis Radix (RIE) showed antiviral activity against influenza virus A and B. The concentration for 50% inhibition of influenza virus A replication (IC50) in MDCK cell was 12.6 mg/mL with a therapeutic index >8. When cells were incubated with RIE prior to virus adsorption, the numbers of viable cell were at least doubled compared to the numbers of virus control, RIE incubation after virus adsorption and RIE incubation with virus prior to adsorption, in both influenza virus A and B. Moreover, much less virus particles were spotted by scanning electron microscope (SEM) in the RIE pre-treated cells than the cells without RIE treatment. These results indicate the antiviral activity of RIE is mainly attributed to its host cell protection effect but not actions on virus or post-virus-adsorption interruption. Cell, but not virus, is more likely to be the action target of RIE. PMID:24716114

  19. [Effects of three traditional Chinese medicine with pungent-flavor, warm-nature and meridian tropism in lung on lung-yang deficiency rats induced by compound factors].

    PubMed

    Chen, Suhong; Lv, Guiyuan; Huang, Mincong; Su, Jie; Fang, Hui; Mou, Xiuhua

    2011-06-01

    To observe the effects of three traditional Chinese medicine (TCM) such as Amomi Fructus Rotundus, Perillae Folium and Angelicae Dahuricae Radix on lung-yang deficiency rats induced by compound factors. Lung-yang deficiency rats were established with three-factor combination, such as smoking (exogenous evil effect on lung), swimming in common and ice water (cold body and exhaustoin) and drinking ice water (inhale cold). Meanwhile, rats were given water extracts of the three TCM by intragastric administration for 24 days everyday. Indexes such as general behavior, weight, rectal temperature, back temperature and grip strength were observed. Blood was collected to determine NO, IgG in blood serum. Lung and heart were dissected to measure organs index. The water extracts of Amomi Fructrs Rotundus, Perillae Folium and Angelicae Dahuricae Radix could markedly heighten weight, back temperature, grip strength, content of IgG in blood serum, reduce content of NO in blood serum, lung index and heart index. The water extracts of Amomi Fructrs Rotundus and Perillae Folium could heighten rectal temperature. Amomi Fructrs Rotundus, Perillae Folium and Angelicae Dahuricae Radix were TCM with pungent-flavor, warm-nature and meridian tropism in lung, which could improve the symptoms of physique emaciation, aversion to cold of the back, weary and acratia and so on. It provides an important reference for the regularity of the properties theories about pungent-flavor, warm-nature and meridian tropism in lung.

  20. Prescription profile of potentially aristolochic acid containing Chinese herbal products: an analysis of National Health Insurance data in Taiwan between 1997 and 2003.

    PubMed

    Hsieh, Shu-Ching; Lin, I-Hsin; Tseng, Wei-Lum; Lee, Chang-Hsing; Wang, Jung-Der

    2008-10-23

    Some Chinese herbal products (CHPs) may contain aristolochic acid (AA) or may be adulterated by the herbs suspected of containing AA which is nephrotoxic and carcinogenic. This study aims to identify the risk and the prescription profile of AA-containing CHPs (AA-CHPs) in Taiwan. A longitudinal analysis was conducted on a randomly sampled cohort of 200,000 patients using the data from the National Health Insurance (NHI) in Taiwan between 1997 and 2003. During the 7-year study period, 78,644 patients were prescribed with AA-CHPs; most patients were females, or middle-aged, or both. A total of 526,867 prescriptions were made to use 1,218 licensed AA-CHPs. Over 85% of the AA-exposed patients took less than 60 g of AA-herbs; however, about 7% were exposed to a cumulated dose of over 100 g of Radix et Rhizoma Asari (Xixin), Caulis Akebiae (Mutong) or Fructus Aristolochiae (Madouling). Patients of respiratory and musculoskeletal diseases received most of the AA-CHP prescriptions. The most frequently prescribed AA-CHPs Shujing Huoxie Tang, Chuanqiong Chadiao San and Longdan Xiegan Tang, containing Radix Stephaniae Tetrandrae, Radix et Rhizoma Asari and Caulis Akebiae, respectively. About one-third of people in Taiwan have been prescribed with AA-CHPs between 1997 and 2003. Although the cumulated doses were not large, further actions should be carried out to ensure the safe use of AA-CHPs.

  1. Prescription profile of potentially aristolochic acid containing Chinese herbal products: an analysis of National Health Insurance data in Taiwan between 1997 and 2003

    PubMed Central

    Hsieh, Shu-Ching; Lin, I-Hsin; Tseng, Wei-Lum; Lee, Chang-Hsing; Wang, Jung-Der

    2008-01-01

    Background Some Chinese herbal products (CHPs) may contain aristolochic acid (AA) or may be adulterated by the herbs suspected of containing AA which is nephrotoxic and carcinogenic. This study aims to identify the risk and the prescription profile of AA-containing CHPs (AA-CHPs) in Taiwan. Methods A longitudinal analysis was conducted on a randomly sampled cohort of 200,000 patients using the data from the National Health Insurance (NHI) in Taiwan between 1997 and 2003. Results During the 7-year study period, 78,644 patients were prescribed with AA-CHPs; most patients were females, or middle-aged, or both. A total of 526,867 prescriptions were made to use 1,218 licensed AA-CHPs. Over 85% of the AA-exposed patients took less than 60 g of AA-herbs; however, about 7% were exposed to a cumulated dose of over 100 g of Radix et Rhizoma Asari (Xixin), Caulis Akebiae (Mutong) or Fructus Aristolochiae (Madouling). Patients of respiratory and musculoskeletal diseases received most of the AA-CHP prescriptions. The most frequently prescribed AA-CHPs Shujing Huoxie Tang, Chuanqiong Chadiao San and Longdan Xiegan Tang, containing Radix Stephaniae Tetrandrae, Radix et Rhizoma Asari and Caulis Akebiae, respectively. Conclusion About one-third of people in Taiwan have been prescribed with AA-CHPs between 1997 and 2003. Although the cumulated doses were not large, further actions should be carried out to ensure the safe use of AA-CHPs. PMID:18945373

  2. Plant Natural Products Calycosin and Gallic Acid Synergistically Attenuate Neutrophil Infiltration and Subsequent Injury in Isoproterenol-Induced Myocardial Infarction: A Possible Role for Leukotriene B4 12-Hydroxydehydrogenase?

    PubMed Central

    Cheng, Yuanyuan; Tse, Hung Fat; Le, X. Chris; Rong, Jianhui

    2015-01-01

    Leukotriene B4 12-hydroxydehydrogenase (LTB4DH) catalyzes the oxidation of proinflammatory LTB4 into less bioactive 12-oxo-LTB4. We recently discovered that LTB4DH was induced by two different natural products in combination. We previously isolated gallic acid from Radix Paeoniae through a bioactivity-guided fractionation procedure. The purpose of this study is to test the hypothesis that LTB4DH inducers may suppress neutrophil-mediated inflammation in myocardial infarction. We first isolated the active compound(s) from another plant, Radix Astragali, by the similar strategy. By evaluating LTB4DH induction, we identified calycosin and formononetin from Radix Astragali by HPLC-ESI-MS technique. We confirmed that gallic acid and commercial calycosin or formononetin could synergistically induce LTB4DH expression in HepG2 cells and human neutrophils. Moreover, calycosin and gallic acid attenuated the effects of LTB4 on the survival and chemotaxis of neutrophil cell culture. We further demonstrated that calycosin and gallic acid synergistically suppressed neutrophil infiltration and protected cardiac integrity in the isoproterenol-induced mice model of myocardial infarction. Calycosin and gallic acid dramatically suppressed isoproterenol-induced increase in myeloperoxidase (MPO) activity and malondialdehyde (MDA) level. Collectively, our results suggest that LTB4DH inducers (i.e., calycosin and gallic acid) may be a novel combined therapy for the treatment of neutrophil-mediated myocardial injury. PMID:26265982

  3. Determination of Cu Environments in the Cyanobacterium Anabaena flos-aquae by X-Ray Absorption Spectroscopy

    PubMed Central

    Kretschmer, X. C.; Meitzner, G.; Gardea-Torresdey, J. L.; Webb, R.

    2004-01-01

    Whole cells and peptidoglycan isolated from cell walls of the cyanobacterium Anabaena flos-aquae were lyophilized and used at pH 2 and pH 5 in Cu(II) binding studies. X-ray absorption spectra measured at the Cu K-edge were used to determine the oxidation states and chemical environments of Cu species in the whole-cell and peptidoglycan samples. In the whole-cell samples, most of the Cu retained at both pH values was coordinated by phosphate ligands. The whole-cell fractions contained significant concentrations of Cu(I) as well as Cu(II). An X-ray absorption near-edge spectrum analysis suggested that Cu(I) was coordinated by amine and thiol ligands. An analysis of the peptidoglycan fractions found that more Cu was adsorbed by the peptidoglycan fraction prepared at pH 5, due to increased chelation by amine and carboxyl ligands. The peptidoglycan fractions, also referred to as the cell wall fractions, contained little or no Cu(I). The Cu loading level was 30 times higher in the cell wall sample prepared at pH 5 than in the sample prepared at pH 2. Amine and bidentate carboxyl ligands had similar relative levels of importance in cell wall peptidoglycan samples prepared at both pH values, but phosphate coordination was insignificant. PMID:14766554

  4. Contamination by Microcystis and microcystins of blue-green algae food supplements (BGAS) on the Italian market and possible risk for the exposed population.

    PubMed

    Vichi, Susanna; Lavorini, Paolo; Funari, Enzo; Scardala, Simona; Testai, Emanuela

    2012-12-01

    Blue green algae supplements (BGAS) are generally proposed as health-promoting natural products for their purported beneficial effects. Spirulina spp. and Aphanizomenon flos aquae are mainly used in BGAS production. They are usually collected from the natural environment, where other potentially toxic cyanobacteria can be present, making possible BGAS contamination by cyanotoxins, with potential risk for human health. In this work we apply a combined approach, by using chemical and molecular techniques, on BGAS of 17 brands available in Italy. Samples containing Spirulina-only were free of contamination. The Aphanizomenon flos aquae-based samples were contaminated by highly variable levels of microcystins (MC-LR and MC-LA congeners), up to 5.2 μg MC-LR equivalents per gram product. The highest variability (up to 50 fold) was among batches of the same brand, although intra-batch differences were also evidenced. PCR analyses were positive only for the presence of Microcystis sp., identified as the toxin-producing species responsible for contamination. At the maximum contamination levels found, a risk for consumers can be expected following chronic or sub-chronic exposure to a reasonable daily BGAS consumption of 4 g. The need for a strict monitoring by producers and Health Authority to assure an adequate protection for consumers is underscored. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Alteration of the gastrointestinal microbiota of mice by edible blue-green algae.

    PubMed

    Rasmussen, H E; Martínez, I; Lee, J Y; Walter, J

    2009-10-01

    To characterize the effect of edible blue-green algae (cyanobacteria) on the gastrointestinal microbiota of mice. C57BL/6J mice were fed a diet supplemented with 0% or 5% dried Nostoc commune, Spirulina platensis or Afanizominon flos-aquae (w/w) for 4 weeks. Molecular fingerprinting of the colonic microbiota using denaturing gradient gel electrophoresis revealed that administration of N. commune induced major alterations in colonic microbiota composition, while administration of S. platensis or A. flos-aquae had a more subtle impact. Community profile analysis revealed that administration of N. commune did not reduce microbial diversity indices of the colonic microbiota. Despite its pronounced effects on the bacterial composition in the colon, total bacterial numbers in the gut of mice fed N. commune were not reduced as assessed by quantitative real-time PCR and bacteriological culture. The results presented here show that administration of blue-green algae, and especially N. commune, alters colonic microbiota composition in mice with limited effects on total bacterial numbers or microbial diversity. Blue-green algae are consumed in many countries as a source of nutrients and to promote health, and they are intensively studied for their pharmaceutical value. Given the importance of the gut microbiota for many host functions, the effects of blue-green algae on gut microbial ecology revealed during this study should be considered when using them as food supplements or when studying their pharmaceutical properties.

  6. Flos Albiziae aqueous extract and its active constituent quercetin potentiate the hypnotic effect of pentobarbital via the serotonergic system

    PubMed Central

    YE, MENG-FEI; LIU, ZHENG; LOU, SHU-FANG; CHEN, ZHEN-YONG; YU, AI-YUE; LIU, CHUN-YAN; YU, CHAO-YANG; ZHANG, HUA-FANG; ZHANG, JIAN

    2015-01-01

    Flos albiziae (FA) is reportedly used for treatment of insomnia and anxiety in traditional medicine. The hypnotic effect of an extract of FA (FAE) and its constituent quercetin [2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-4H-chromen-4-one, QR] was examined in mice. QR is a widely distributed natural flavonoid abundant in FA flowers and other tissues. The possible mechanisms underlying the hypnotic effects of FAE and QR were investigated using behavioral pharmacology. FAE and QR significantly potentiated pentobarbital-induced [50 mg/kg, intraperitoneal (ip)] sleep (prolonged sleeping time; shortened sleep latency) in a dose-dependent manner, and these effects were augmented by administration of 5-hydroxytryptophan (5-HTP), a precursor of 5-hydroxytryptamine. With a sub-hypnotic dose of pentobarbital (28 mg/kg, ip), FAE and QR significantly increased the rate of sleep onset and were synergistic with 5-HTP (2.5 mg/kg, ip). Pretreatment with p-chlorophenylalanine, an inhibitor of tryptophan hydroxylase, significantly decreased sleeping time and prolonged sleep latency in pentobarbital-treated mice, whereas FAE and QR significantly reversed this effect. Data show that FAE and QR have hypnotic activity, possibly mediated by the serotonergic system. The present study offers a rationale for the use of FA in treating sleep disorders associated with serotonin system dysfunction. PMID:26623026

  7. Variations of metabolites and proteome in Lonicera japonica Thunb. buds and flowers under UV radiation.

    PubMed

    Zhu, Wei; Zheng, Wen; Hu, Xingjiang; Xu, Xiaobao; Zhang, Lin; Tian, Jingkui

    2017-04-01

    Lonicera japonica Thunb., also known as Jin Yin Hua and Japanese honeysuckle, is used as a herbal medicine in Asian countries. Its flowers have been used in folk medicine in the clinic and in making food or healthy beverages for over 1500years in China. To investigate the molecular processes involved in L. japonica development from buds to flowers exposed to UV radiation, a comparative proteomics analysis was performed. Fifty-four proteins were identified as differentially expressed, including 42 that had increased expression and 12 that had decreased expression. The levels of the proteins related to glycolysis, TCA/organic acid transformation, major carbohydrate metabolism, oxidative pentose phosphate, stress, secondary metabolism, hormone, and mitochondrial electron transport were increased during flower opening process after exposure to UV radiation. Six metabolites in L. japonica buds and flowers were identified and relatively quantified using LC-MS/MS. The antioxidant activity was performed using a 1,1-diphenyl-2-picrylhydrazyl assay, which revealed that L. japonica buds had more activity than the UV irradiated flowers. This suggests that UV-B radiation induces production of endogenous ethylene in L. japonica buds, thus facilitating blossoming of the buds and activating the antioxidant system. Additionally, the higher metabolite contents and antioxidant properties of L. japonica buds indicate that the L. japonica bud stage may be a more optimal time to harvest than the flower stage when using for medicinal properties. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression.

    PubMed

    Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

    2017-01-01

    The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5'-UTR of phenylalanine ammonia-lyase 2 ( PAL2 ). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5'-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica .

  9. DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression

    PubMed Central

    Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

    2017-01-01

    The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica. PMID:28740500

  10. [Study on influence factors of seed germination and seeding growth of Lonicera macranthoides].

    PubMed

    Xu, Jin; Zhang, Ying; Cui, Guang-Lin; She, Yue-Hui; Li, Long-Yun

    2016-01-01

    In order to improve reproductive efficiency and quality standard, the influence factors of seed germination and seeding growth of Lonicera macranthoides werew studied. The fruit and seed morphological characteristics of L. macranthoides were observed, the seed water absorbing capacity was determined, and different wet sand stratification time, temperature and germination bed treatment were set up. The effects of the parameters on seed germination and seedling growth were analysed. There was no obstacles of water absorption on L. macranthoides seed, quantity for 22 h water absorption was close to saturation. In the first 80 d, with the increase of the stratification time, seed initial germination time was shortened, germination rate and germination potential was improved. Stratification for 100 d, germination rate decreased. At 15 ℃, seed germination and seedling growth indicators were the best. The seedling cotyledon width in light was significantly higher than that in dark. Seeds on the top of paper and top of sand germination rate, germination potential, and germination index was significantly higher than that of other germination bed and mildew rate is low. The optimal conditions of seeds germination test was stratified in 4 ℃ wet sand for 80 d, 15 ℃ illuminate culture on the top of paper or top of sand. The first seeding counting time was the 4th day after beginning the test, the final time was the 23th day. The germination potential statistical time was the 13th day after beginning the test. Copyright© by the Chinese Pharmaceutical Association.

  11. Fast algorithm for computing complex number-theoretic transforms

    NASA Technical Reports Server (NTRS)

    Reed, I. S.; Liu, K. Y.; Truong, T. K.

    1977-01-01

    A high-radix FFT algorithm for computing transforms over FFT, where q is a Mersenne prime, is developed to implement fast circular convolutions. This new algorithm requires substantially fewer multiplications than the conventional FFT.

  12. Urine and plasma metabonomics coupled with UHPLC-QTOF/MS and multivariate data analysis on potential biomarkers in anemia and hematinic effects of herb pair Gui-Hong.

    PubMed

    Li, Shujiao; Lin, Hang; Qu, Cheng; Tang, Yuping; Shen, Juan; Li, Weixia; Yue, Shijun; Kai, Jun; Shang, Guanxiong; Zhu, Zhenhua; Zhang, Changbin; Liu, Pei; Yan, Hui; Zhang, Li; Qian, Li; Qian, Dawei; Duan, Jin-ao

    2015-07-21

    The compatibility of Angelicae Sinensis Radix (Danggui) and Carthami Flos (Honghua), a famous herb pair Gui-Hong, can produce synergistic and complementary hematinic effects. Our previous studies have indicated that Gui-Hong has therapeutic potential treatment in hemolytic and aplastic anemia (HAA). The present study aimed to investigate the hematinic effects of Danggui, Honghua and Gui-Hong on HAA rats induced by acetyl phenylhydrazine (APH) and cyclophosphamide (CP) and to explore the underlying hematinic regulation mechanisms. Rats were divided into 5 groups, and drugs were administered by oral gavage one time each day for continuous 7 days from the experiment began. Urine and plasma were analyzed by ultra-high-performance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UHPLC-QTOF/MS). Partial least-squares discriminate analysis (PLS-DA) models were built to evaluate the therapeutic effects of Danggui, Honghua and Gui-Hong. Pearson correlation matrix analysis method was used to discover the correlations between potential biomarkers and biochemical indicators of HAA rats. Seven potential biomarkers contribute to the separation of model group and control group were tentatively identified. The levels of l-kynurenine, phenylalanine, nicotinic acid and sphingosine increased significantly (P<0.05) in HAA rats, while the levels of l-isoleucine, l-tyrosine and serotonin decreased significantly (P<0.05) in comparison with control rats. Those endogenous metabolites were chiefly involved in phenylalanine, tyrosine and tryptophan biosynthesis, valine, leucine and isoleucine biosynthesis, tryptophan metabolism and tyrosine metabolism. The metabolic deviations could be regulated closer to normal level after Danggui, Honghua and Gui-Hong intervention. In term of hematinic effects, Gui-Hong was the most effective as shown by the relative distance in PLS-DA score plots and relative intensity of potential biomarkers. The result reflected the synergic action between Danggui and Honghua. The above results were found to be reasonable in explaining the hematinic effects mechanism of Gui-Hong. The results of routine blood, urinary metabolic pattern and plasma metabolic pattern show the Danggui, Honghua and Gui-Hong groups are moving toward the control group and the HAA was being prevented and alleviated. The effect of Gui-Hong group is more remarkable than Danggui and Honghua groups. Some potential biomarkers like l-kynurenine, phenylalanine, l-isoleucine, l-tyrosine, serotonin, nicotinic acid and sphingosine have been found and identified. The work shows that the metabonomics method is a promising tool in the efficacy and mechanism research of traditional Chinese medicines. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Antiinflammatory activity of an herbal preparation (HemoHIM) in rats.

    PubMed

    Jo, Sung Kee; Lee, Hae June; Kim, Se Ra; Kim, Jong Choon; Bae, Chun Sik; Jung, Uhee; Park, Hae Ran; Jang, Jong Sik; Kim, Sung Ho

    2007-07-01

    This study evaluated a new herbal preparation, HemoHIM, for its antiinflammatory activity against carrageenan-induced edema, the formation of granulation tissues by cotton pellet and experimental colitis by 2,4,6-trinitrobenzene sulfonic acid (TNBS). The HemoHIM was prepared by adding its ethanol-insoluble polysaccharide fraction to the total water extract of Angelica Radix, Cnidii Rhizoma and Paeonia Radix. The preparation (4 mg of solids/mL of drinking water, p.o., 50-100 mg/kg of body weight, i.p.) produced a dose-related inhibition of carrageenan-induced paw edema and cotton pellet-induced granuloma in rats. In addition, HemoHIM also reduced the degree of TNBS-induced colitis and improved the gross and histological changes such as thickening, dilatation, ulceration, and infiltration by polymorphonuclear leukocytes and multiple erosive lesions. These results demonstrate that the HemoHIM has a potent antiinflammatory effect. Copyright 2007 John Wiley & Sons, Ltd.

  14. Micronutrients and Natural Compounds Status and Their Effects on Wound Healing in the Diabetic Foot Ulcer.

    PubMed

    Kulprachakarn, Kanokwan; Ounjaijean, Sakaewan; Wungrath, Jukkrit; Mani, Raj; Rerkasem, Kittipan

    2017-12-01

    The diabetic foot ulcer (DFU) is an invariably common complication of diabetes mellitus, it is also a significant cause of amputation as well as extended hospitalization. As most patients with DFU suffer from malnutrition, which has been related to improper metabolic micronutrients status, alterations can affect impaired wound healing process. Micronutrients and herbal remedies applications present a wide range of health advantages to patients with DFU. The purpose of this review is to provide current evidence on the potential effect of dietary supplementations such as vitamins A, C, D, E, magnesium, zinc, copper, iron, boron, and such naturally occurring compounds as Aloe vera, Naringin, and Radix Astragali (RA) and Radix Rehmanniae (RR) in the administration of lower extremity wounds, especially in DFU, and to present some insights for applications in the treatment of DFU patients in the future.

  15. Rapid characterisation and identification of compounds in Saposhnikoviae Radix by high-performance liquid chromatography coupled with electrospray ionisation quadrupole time-of-flight mass spectrometry.

    PubMed

    Chen, Luxiao; Chen, Xiangyang; Su, Lei; Jiang, Yanyan; Liu, Bin

    2018-04-01

    Saposhnikoviae Radix (SR), the dried root of Saposhnikovia divaricata (Turcz.) Schischk. (Umbelliferae), is commonly used as a traditional Chinese medicine. In this study, a rapid and accurate method was firstly, developed for the qualitative analysis of SR by high-performance liquid chromatography coupled with electrospray ionisation quadrupole time-of-flight mass spectrometry (HPLC-ESI-Q-TOF-MS/MS). A total of 45 compounds were identified or tentatively characterised, including 13 chromones, 28 coumarins and four others. Among them, 16 compounds were identified from SR for the first time. In addition, six chromones reference standards, including two isolated compounds of 3'-O-angeloylhamaudol and norcimifugin from the extraction of SR, were used to study the fragmentation pathways of chromones. The developed method was effective for characterising the compounds of SR, and the results of the study enriched the understanding of the chemical connotation.

  16. Rapid Characterization and Identification of Flavonoids in Radix Astragali by Ultra-High-Pressure Liquid Chromatography Coupled with Linear Ion Trap-Orbitrap Mass Spectrometry.

    PubMed

    Zhang, Jing; Xu, Xiao-Jie; Xu, Wen; Huang, Juan; Zhu, Da-yuan; Qiu, Xiao-Hui

    2015-07-01

    A simple and effective method was established for separation and characterization of flavonoid constituents in Radix Astragali (RA) by combination of ultra-high-pressure liquid chromatography with LTQ-Orbitrap tandem mass spectrometry (u-HPLC-LTQ-Orbitrap-MS(n)). For three major structural types of flavonoids, the proposed fragmentation pathways and major diagnostic fragment ions of isoflavones, pterocarpans and isoflavans were investigated to trace isoflavonoid derivatives in crude plant extracts. Based on the systematic identification strategy, 48 constituents were rapidly detected and characterized or tentatively identified, many of which were first reported in RA. The u-PHLC-LTQ-Orbitrap MS(n) platform was proved as an effective tool for rapid qualitative analysis of secondary metabolite productions from natural resources. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Asymmetry in mesial root number and morphology in mandibular second molars: a case report

    PubMed Central

    Shetty, Shashit; Shekhar, Rhitu

    2014-01-01

    Ambiguity in the root morphology of the mandibular second molars is quite common. The most common root canal configuration is 2 roots and 3 canals, nonetheless other possibilities may still exist. The presence of accessory roots is an interesting example of anatomic root variation. While the presence of radix entomolaris or radix paramolaris is regarded as a typical clinical finding of a three-rooted mandibular second permanent molar, the occurrence of an additional mesial root is rather uncommon and represents a possibility of deviation from the regular norms. This case report describes successful endodontic management of a three-rooted mandibular second molar presenting with an unusual accessory mesial root, which was identified with the aid of multiangled radiographs and cone-beam computed tomography imaging. This article also discusses the prevalence, etiology, morphological variations, clinical approach to diagnosis, and significance of supernumerary roots in contemporary clinical dentistry. PMID:24516829

  18. Efficient Sorting on the Tilera Manycore Architecture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morari, Alessandro; Tumeo, Antonino; Villa, Oreste

    e present an efficient implementation of the radix sort algo- rithm for the Tilera TILEPro64 processor. The TILEPro64 is one of the first successful commercial manycore processors. It is com- posed of 64 tiles interconnected through multiple fast Networks- on-chip and features a fully coherent, shared distributed cache. The architecture has a large degree of flexibility, and allows various optimization strategies. We describe how we mapped the algorithm to this architecture. We present an in-depth analysis of the optimizations for each phase of the algorithm with respect to the processor’s sustained performance. We discuss the overall throughput reached by ourmore » radix sort implementation (up to 132 MK/s) and show that it provides comparable or better performance-per-watt with respect to state-of-the art implemen- tations on x86 processors and graphic processing units.« less

  19. Aberration in the palatal root of the maxillary first molar

    PubMed Central

    Rajalbandi, Sandeep; Shingte, Sandhya Narayan; Sundaresh, K J; Mallikarjuna, Rachappa

    2013-01-01

    Thorough knowledge of root canal morphology is essential for the endodontic therapy. Variations in the root and root canal morphology, especially in multirooted teeth, are a constant challenge for diagnosis and management. The dentist needs to be familiar with the various root canal configurations and their variations for successful endodontic therapy. There are rare variations in canal number and configuration in maxillary molars, which could affect treatment outcome. Two lingual root structures are occasionally found on human permanent maxillary molars. One of these is the normal lingual root, which is always present, the other is a supernumerary structure which can be located either mesiolingually (radix mesiolingualis) or distolingually (radix distolingualis). The purpose of this paper is to review the literature and to demonstrate a case report which describes the successful non-surgical endodontic management of an unusual maxillary first molar with four separate roots and four canals. PMID:23632609

  20. Comprehensive Quantitative Analysis of 32 Chemical Ingredients of a Chinese Patented Drug Sanhuang Tablet.

    PubMed

    Fung, Hau-Yee; Lang, Yan; Ho, Hing-Man; Wong, Tin-Long; Ma, Dik-Lung; Leung, Chung-Hang; Han, Quan-Bin

    2017-01-12

    Sanhuang Tablet (SHT) is a Chinese patented drug commonly used for the treatment of inflammations of the respiratory tract, gastrointestinal tract, and skin. It contains a special medicinal composition including the single compound berberine hydrochloride, extracts of Scutellariae Radix and Rhei Radix et Rhizoma, as well as the powder of Rhei Radix et Rhizoma. Despite advances in analytical techniques, quantitative evaluation of a Chinese patented drug like SHT remains a challenge due to the complexity of its chemical profile. In this study, ultra-high performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UHPLC-Q-TOF-MS) was used to simultaneously quantify 29 non-sugar small molecule components of SHT (11 flavonoids, two isoflavonoids, one flavanone, five anthraquinones, two dianthranones, five alkaloids, two organic acids and one stilbene). Three major saccharide components, namely fructose, glucose, and sucrose, were also quantitatively determined using high performance liquid chromatography-charged aerosol detector (HPLC-CAD) on an Asahipak NH₂P-50 4E amino column. The established methods were validated in terms of linearity, sensitivity, precision, accuracy, and stability, and then successfully applied to analyze 27 batches of commercial SHT products. A total of up to 57.61% ( w / w ) of SHT could be quantified, in which the contents of the determined non-saccharide small molecules varied from 5.91% to 16.83% ( w / w ) and three saccharides accounted for 4.41% to 48.05% ( w / w ). The results showed that the quality of the commercial products was inconsistent, and only four of those met Chinese Pharmacopoeia criteria.

  1. Polygalae Radix Extract Prevents Axonal Degeneration and Memory Deficits in a Transgenic Mouse Model of Alzheimer’s Disease

    PubMed Central

    Kuboyama, Tomoharu; Hirotsu, Keisuke; Arai, Tetsuya; Yamasaki, Hiroo; Tohda, Chihiro

    2017-01-01

    Memory impairments in Alzheimer’s disease (AD) occur due to degenerated axons and disrupted neural networks. Since only limited recovery is possible after the destruction of neural networks, preventing axonal degeneration during the early stages of disease progression is necessary to prevent AD. Polygalae Radix (roots of Polygala tenuifolia; PR) is a traditional herbal medicine used for sedation and amnesia. In this study, we aimed to clarify and analyze the preventive effects of PR against memory deficits in a transgenic AD mouse model, 5XFAD. 5XFAD mice demonstrated memory deficits at the age of 5 months. Thus, the water extract of Polygalae Radix (PR extract) was orally administered to 4-month-old 5XFAD mice that did not show signs of memory impairment. After consecutive administrations for 56 days, the PR extract prevented cognitive deficit and axon degeneration associated with the accumulation of amyloid β (Aβ) plaques in the perirhinal cortex of the 5XFAD mice. PR extract did not influence the formation of Aβ plaques in the brain of the 5XFAD mice. In cultured neurons, the PR extract prevented axonal growth cone collapse and axonal atrophy induced by Aβ. Additionally, it prevented Aβ-induced endocytosis at the growth cone of cultured neurons. Our previous study reported that endocytosis inhibition was enough to prevent Aβ-induced growth cone collapse, axonal degeneration, and memory impairments. Therefore, the PR extract possibly prevented axonal degeneration and memory impairment by inhibiting endocytosis. PR is the first preventive drug candidate for AD that inhibits endocytosis in neurons. PMID:29184495

  2. [Resveratrol derived from rhizoma et radix polygoni cuspidati and its liposomal form protect nigral cells of Parkinsonian rats].

    PubMed

    Wang, Yanchun; Xu, Hanlin; Fu, Qin; Ma, Rong; Xiang, Jizhou

    2011-04-01

    Oxidative stress is a hallmark in the pathogenesis of Parkinson disease (PD), which involves the selective loss of nigral dopaminergic neurons in PD. Resveratrol (3,5,4'-trihydroxy-trans-stilbene) is well known for its powerful antioxidant property and a wide range of other biological effects. In this study, we investigated the protective effect of resveratrol derived from Rhizoma Et Radix Polygoni Cuspidati and its liposomal form on the nigral cells of PD rats induced by unilateral microinjection of 6-hydroxy dopamine in the striatum. The results showed that after 14 days gavage of resveratrol and resveratrol liposome respectively (20 mg x kg(-1) WB per day), the abnormal rotational behavior of PD rats were deceased evidently, the numbers of total nigral cells, total nigral neurons and TH immuno-positive neurons were more than that of PD rats without given resveratrol or resveratrol liposome, simultaneously, the number of apoptotic nigral cells were decreased obviously. The results also showed that resveratrol and resveratrol liposome could decrease the total ROS activity, increase the total antioxidant capability of the nigral tissues. All the data indicated that resveratrol liposome performed stronger effects than resveratrol except for behavioral improvement. Our study confirmed that resveratrol derived from Rhizoma Et Radix Polygoni Cuspidati and its liposomal form could inhibit the loss of dopaminergic neurons of PD rats, the underlying mechanism may be attributed to their radical scavenging effect and antioxidant property. Due to presumably increased bioavailability, resveratrol liposome possesses the stronger therapeutic effect and may become a better clinical agent for the treatment of PD than free resveratrol.

  3. [Study on anti-hyperlipidemia mechanism of high frequency herb pairs by molecular docking method].

    PubMed

    Jiang, Lu-di; He, Yu-su; Chen, Xi; Tao, Ou; Li, Gong-Yu; Zhang, Yan-ling

    2015-06-01

    Traditional Chinese medicine (TCM) has definitely clinical effect in treating hyperlipidemia, but the action mechanism still need to be explored. Based on consulting Chinese Pharmacopoeia (2010), all the lipid-lowering Chinese patent medicines were analyzed by associated rules data mining method to explore high frequency herb pairs. The top three couplet medicines with high support degree were Puerariae Lobatae Radix-Crataegi Fructus, Salviae Miltiorrhizae Radix et Rhizoma-Crataegi Fructus, and Polygoni Multiflori Radix-Crataegi Fructus. The 20 main ingredients were selected from the herb pairs and docked with 3 key hyperlipidemia targets, namely 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoA reductase), peroxisome proliferator activated receptor-α (PPAR-α ) and niemann-pick C1 like 1 (NPC1L1) to further discuss the molecular mechanism of the high frequency herb pairs, by using the docking program, LibDock. To construct evaluation rules for the ingredients of herb pairs, the root-mean-square deviation (RMSD) value between computed and initial complexes was first calculated to validate the fitness of LibDock models. Then, the key residues were also confirmed by analyzing the interactions of those 3 proteins and corresponding marketed drugs. The docking results showed that hyperin, puerarin, salvianolic acid A and polydatin can interact with two targets, and the other five compounds may be potent for at least one of the three targets. In this study, the multi-target effect of high frequency herb pairs for lipid-lowering was discussed on the molecular level, which can help further researching new multi-target anti-hyperlipidemia drug.

  4. A metabolic profiling analysis of the acute hepatotoxicity and nephrotoxicity of Zhusha Anshen Wan compared with cinnabar in rats using (1)H NMR spectroscopy.

    PubMed

    Wang, Haifeng; Bai, Jiao; Chen, Gang; Li, Wen; Xiang, Rongwu; Su, Guangyue; Pei, Yuehu

    2013-03-27

    Zhusha Anshen Wan (ZSASW), a traditional Chinese medicine (TCM) prescription, composed of cinnabar (cinnabaris), Coptidis Rhizoma (Coptis chinensis French.), Angelicae Sinensis Radix (Angelica sinensis (oliv.) Diels), uncooked Rehmanniae Radix (Rehmannia glutinosa Libosch.), honey fried Glycyrrhizae Radix Et Rhizoma (Glycyrrhiza uralensis Fisch.), has been widely used for sedative therapy. Cinnabar, the chief component of ZSASW, has been proved to possess the toxicities. In this study, a metabonomics approach based on high-resolution (1)H nuclear magnetic resonance spectroscopy was applied to investigate the protective effects of ZSASW on the toxic effects induced by cinnabar alone. Male Wistar rats were divided into three groups: control group, ZSASW group and cinnabar group. Partial least squares-discriminant analysis (PLS-DA) was performed to identify different metabolic profiles of urine and serum from rats. Liver and kidney histopathology examinations and serum clinical chemistry analysis were also performed. The significant difference in metabolic profiling of urine and serum of the rats was observed between cinnabar treated group, control group, and the changes of endogenous metabolites related to the toxicities were identified. The results were also certified by the liver and kidney histopathology examinations and biochemical analysis of blood. Our results suggested that the four combined herbal medicines of ZSASW had the effects of protecting from the toxicity induced by cinnabar alone. This work showed that the NMR-based metabonomics approach might be a promising approach to study detoxification of Chinese medicines and reasonable combination of TCM prescriptions. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. [Bile-resistant Gram-negative bacteria effect of different kinds of root decoction pieces].

    PubMed

    Deng, Yan; Wang, Ya-Ke; Han, Xiao-Yu; Wang, Ya-Qi; Jiang, Zhen-Yu; Yu, Zhi-Jun; Deng, Hai-Ying

    2017-11-01

    To investigate the microbial contamination in Chinese herbal decoction pieces with different functional types by studying the total aerobic microbial count (TAMC), and total yeast and mould count (TYMC) in 40 samples of 8 types of root decoction pieces; further evaluate the contamination load of bile-resistant Gram-negative bacteria, and identify the Gram-negative bacteria by using biochemical identification system for Gram-negative bacteria. Our results showed that the TAMC value was more than 1 000 CFU•g⁻¹ in 85% (34/40) samples, and was more than 100 CFU•g⁻¹ in 30% (12/40) samples; the contamination of bile-resistant Gram-negative bacteria was detected in 45% (18/40) of the samples. The bile-resistant Gram-negative bacteria load of seven batches of samples was N>1 000 MPN•g⁻¹. Sixteen bacterium strains including Serratia plymouthensis, Cedecea neteri, Escherichia vulneris, Klebsiella oxytoca, Enterobacter amnigenus, E. cloacae, E. sakazakii, Proteus penneri and E. gergoviae were obtained and identified. E. cloacae was the predominant bacterium that was isolated from Salviae Miltiorrhizae Radix et Rhizoma, while E. amnigenus, Yersinia pseudotuberculosis was the typical bacterium of Ophiopogonis Radix and Codonopsis Radix, respectively. All these suggested that the contamination of bile-resistant Gram-negative bacteria was severe for the root decoction pieces in Wuhan city. Microbial species have certain selection specificity for medicinal ingredients, so the type and limit of control bacteria for detection should be formulated according to the pollution type and quantity of bile-resistant Gram-negative bacteria. Copyright© by the Chinese Pharmaceutical Association.

  6. Traditional Chinese Medicine herbs for stopping bleeding from haemorrhoids.

    PubMed

    Gan, Tao; Liu, Yue-Dong; Wang, Yiping; Yang, Jinlin

    2010-10-06

    Haemorrhoids is a common perianal disease, which often causes haematochezia. Besides a surgical operation or minimally invasive treatment, a variety of traditional Chinese medicinal herbs (TCMHs) have been used to treat bleeding haemorrhoids. To assess the effectiveness of traditional Chinese medicinal herbs for stopping bleeding from haemorrhoids and the adverse effects caused by these herbs. We searched the Cochrane Colorectal Cancer Group Trials Register, Cochrane Central Register of Contolled Trials (CENTRAL) (The Cochrane Library), MEDLINE, EMBASE, CMCD (Chinese Medicine Conference Disc) and CBMD (Chinese Bio-Medicine Disc). All randomised clinical trials (RCTs) of Chinese herbs for bleeding haemorrhoids were included. Two authors independently extracted the data, which were analysed using RevMan 5.0 software. We estimated the relative risk for dichotomous data and calculated the weighted mean difference for continuous data. Nine trials involving 1822 patients with bleeding haemorrhoids were identified. The included trials were generally not of high quality and used one TCMH preparation compared with another TCMH preparation (Type I) (five trials) or western medicines (Type II) (four trials). We could not pool the data to perform a meta-analysis as only two of the included trials used the same intervention or comparison.In the nine trials, TCMHs showed a statistically significant difference for the improvement in the general curative effects or total grade of symptoms in six trials (P < 0.05; P < 0.01), of hematochezia in three trials (P < 0.05; P < 0.001), and of inflammation of perianal mucosa in one trial (P < 0.05). The adverse effects reported were not serious and were scarce. This review did not provide strong evidence concerning the effectiveness of TCMHs for stopping bleeding from haemorrhoids. Most of the included studies were of low quality and there was a scarcity of eligible trials and numbers of participants. Limited, weak evidence showed that some herbal formulae, when including Radix Sanguisorbae, Radix Rehmanniae, Fructus Sophorae, Radix Angelicae Sinensis, Radix Scutellariae, etc., may alleviate some symptoms caused by haemorrhoids. These include hematochezia, congestive haemorrhoidal cushions and inflammation of perianal mucosa in the short term. Well-designed clinical trials are required urgently before any confident conclusions can be drawn about the value of TCMHs for stopping bleeding from haemorrhoids.At present, the evidence is not enough that clinical practice should be changed immediately on the basis of these results.

  7. Species discrimination of Radix Bupleuri through the simultaneous determination of ten saikosaponins by high performance liquid chromatography with evaporative light scattering detection and electrospray ionization mass spectrometry.

    PubMed

    Lee, Jaehyun; Yang, Dong-Hyug; Suh, Joon Hyuk; Kim, Unyong; Eom, Han Young; Kim, Junghyun; Lee, Mi Young; Kim, Jinwoong; Han, Sang Beom

    2011-12-15

    A simple, rapid and robust high performance liquid chromatography-evaporative light scattering detection (HPLC-ELSD) method was established for the species discrimination and quality evaluation of Radix Bupleuri through the simultaneous determination of ten saikosaponins, namely saikosaponin-a, -b(1), -b(2), -b(3), -b(4), -c, -d, -g, -h, and -i. These compounds were chromatographed on an Ascentis(®) Express C18 column with a gradient elution of acetonitrile and water containing 0.1% acetic acid at a flow rate of 1.0 mL/min. Saikosaponins were monitored by ELSD, which was operated at a 50°C drift tube temperature and 3.0 bar nebulizer gas (N(2)) pressure. The developed method was validated with respect to linearity, intra- and inter-day accuracy and precision, limit of quantification (LOQ), recovery, robustness and stability, thereby showing good precision and accuracy, with intra- and inter-assay coefficients of variation less than 15% at all concentrations. Furthermore, a high performance liquid chromatography-electrospray ionization mass spectrometry (HPLC-ESI-MS) method was developed to certify the existence of ten saikosaponins, as well as to confirm the reliability of ELSD. The extraction conditions of saikosaponins from Radix Bupleuri were also optimized by investigating the effect of extraction methods (sonication, reflux and maceration) and various solvents on the extraction efficiencies for saikosaponins. Sonication with 70% methanol for 40 min was found to be simple and effective for extraction of major saikosaponins. This analytical method was applied to determine saikosaponin profiles in 20 real samples consisting of four Bupleurum species, namely B. falcatum, B. chinense, B. sibiricum and the poisonous B. longiradiatum. It was found that three major saikosaponin-a, -c and -d were the major constituents in B. falcatum, B. chinense, and B. longiradiatum, while one major saikosaponin (saikosaponin-c) was not identified from B. sibiricum. In addition, no saikosaponin-b(3) was detected in B. longiradiatum samples, indicating that the toxic B. longiradiatum may be tentatively distinguished from officially listed Bupleurum species (B. falcatum and B. chinense) based on their saikosaponin profiles. Overall the simultaneous determination of ten saikosaponins in Radix Bupleuri was shown to be a promising tool to adopt for the discrimination and quality control of closely related Bupleurum species. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Synergistic interaction between Astragali Radix and Rehmanniae Radix in a Chinese herbal formula to promote diabetic wound healing.

    PubMed

    Lau, Kit-Man; Lai, Kwok-Kin; Liu, Cheuk-Lun; Tam, Jacqueline Chor-Wing; To, Ming-Ho; Kwok, Hin-Fai; Lau, Ching-Po; Ko, Chun-Hay; Leung, Ping-Chung; Fung, Kwok-Pui; Poon, Simon Kar-Sing; Lau, Clara Bik-San

    2012-05-07

    Astragali Radix (AR) and Rehmanniae Radix (RR) are two traditional Chinese medicines widely used in China for treating diabetes mellitus and its complications, such as diabetic foot ulcer. In our previous study, a herbal formula NF3 comprising AR and RR in the ratio of 2:1 was found effective in enhancing diabetic wound healing in rats through the actions of tissue regeneration, angiogenesis promotion and inflammation inhibition. The aims of the present study were to investigate the herb-herb interaction (or the possible synergistic effect) between AR and RR in NF3 to promote diabetic wound healing and to identify the principal herb in the formula by evaluating the potencies of individual AR and RR in different mechanistic studies. A chemically induced diabetic foot ulcer rat model was used to examine the wound healing effect of NF3 and its individual herbs AR and RR. For mechanistic studies, murine macrophage cell (RAW 264.7) inflammation, human fibroblast (Hs27) proliferation and human endothelial cell (HMEC-1) migration assays were adopted to investigate the anti-inflammatory, granulation formation and angiogenesis-promoting activities of the herbal extracts, respectively. In the foot ulcer animal model, neither AR nor RR at clinical relevant dose (0.98g/kg) promoted diabetic wound healing. However, when they were used in combination as NF3, synergistic interaction was demonstrated, of which NF3 could significantly reduce the wound area of rats when compared to water group (p<0.01). For anti-inflammation and granulation formation, AR was more effective than RR in inhibiting lipopolysaccharide (LPS)-induced nitric oxide production from RAW 264.7 cells and promoting Hs27 fibroblast proliferation. In the aspect of angiogenesis promotion, only NF3 promoted cell migration of HMEC-1 cells. AR plays a preeminent role in the anti-inflammatory and fibroblast-proliferating activities of NF3. The inclusion of RR, however, is crucial for NF3 to exert its overall wound-healing as well as the underlying angiogenesis-promoting effects. The results of present study justified the combined usage of AR and RR in the ratio of 2:1 as NF3 to treat diabetic foot ulcer and illustrated that AR is the principal herb in this herbal formula. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. A metabolic profiling analysis of the acute toxicological effects of the realgar (As₂S₂) combined with other herbs in Niuhuang Jiedu Tablet using ¹H NMR spectroscopy.

    PubMed

    Xu, Wenfeng; Wang, Haifeng; Chen, Gang; Li, Wen; Xiang, Rongwu; Zhang, Xiaoli; Pei, Yuehu

    2014-05-14

    Niuhuang Jiedu Tablet (NJT), composed of Realgar (As₂S₂), Bovis Calculus Artificialis, Borneolum Synthcticum, Gypsum Fibrosum, Rhei Radix et Rhizoma (RR), Scutellariae Radix (SR), Platycodonis Radix (PR) and Glycyrrhizae Radix et Rhizoma (GR), is an effective formula of traditional Chinese medicine (TCM) used in treating acute tonsillitis, pharyngitis, periodontitis and mouth ulcer. In the formula, significant level of realgar (As₂S₂) as a potentially toxic element is contained. In our pervious experiments, NJT was significantly less toxic than realgar (As₂S₂), and the material bases of toxicity alleviation effect to realgar (As₂S₂) were RR, SR, PR and GR. However, the toxicity alleviation effect of each above mentioned four herbs to realgar (As₂S₂) and their synergistic detoxification effects to realgar (As₂S₂) were still obscure. Male Wistar rats were divided into 11 groups: control, group R (treated with Realgar), group RRSPG (treated with Realgar, RR, SR, PR and GR), group RRSP (treated with Realgar, RR, SR and PR), group RRSG (treated with Realgar, RR, SR and GR), group RRPG (treated with Realgar, RR, PR and GR), group RSPG (treated with Realgar, SR, PR and GR), group RR (treated with Realgar and RR), group RS (treated with Realgar and SR), group RP (treated with Realgar and PR) and group RG (treated with Realgar and GR). Based on (1)H NMR spectra of urine and serum from rats, PCA and PLS-DA were performed to identify different metabolic profiles. Liver and kidney histopathology examinations and serum clinical chemistry analysis were also performed. The metabolic profiles of groups RR, RS, RP and RG were similar to those of group R, while the metabolic profiles of groups RRSPG, RRSP, RRSG, RRPG and RSPG were almost in line with those of control group. Statistics results were confirmed by the histopathological examination and biochemical assay. The present work suggested that the toxicity alleviation effects of RR, SR, PR and GR to realgar (As₂S₂) were not obvious when combined with realgar (As₂S₂) respectively, but they had synergistic detoxification effects on realgar (As₂S₂) mutually. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Potassium Salts Inhibit Growth of the Cyanobacteria Microcystis spp. in Pond Water and Defined Media: Implications for Control of Microcystin-Producing Aquatic Blooms.

    PubMed

    Parker, D L; Kumar, H D; Rai, L C; Singh, J B

    1997-06-01

    Ten metals were assayed in 21 Indian ponds which comprised three groups: (i) eutrophic alkaline ponds containing <2.5 mM potassium and thick growths of Microcystis aeruginosa or Microcystis flos-aquae during most of the year, (ii) equally eutrophic alkaline ponds containing >2.8 mM potassium and no detectable Microcystis growth, and (iii) oligo- or mesotrophic ponds with various potassium and hydrogen ion concentrations and no persistent Microcystis blooms. The effects of potassium on Microcystis growth were examined in filter-sterilized pond water and in defined culture media. A 50% reduction in the 10-day yield of cultured M. aeruginosa was observed in DP medium and pond water supplemented with 1 and 3 mM KCl, respectively. In contrast, the addition of 2 to 30 mM NaCl did not suppress the growth of M. aeruginosa in either DP medium or pond water. Both 5 mM KCl and 20 mM KHCO(inf3) in J medium strongly inhibited the growth of M. flos-aquae C3-9, whereas 5 to 30 mM NaCl had no effect and 20 mM NaHCO(inf3) was stimulatory. For pond water cultured with a mixture of M. aeruginosa and the duckweed Wolffia arrhiza, M. aeruginosa dominated in unsupplemented water and W. arrhiza dominated in water supplemented with 4.8 mM KCl. Implications for the ecology and control of Microcystis blooms are discussed.

  11. Toxicity of the fluoroquinolone antibiotics enrofloxacin and ciprofloxacin to photoautotrophic aquatic organisms.

    PubMed

    Ebert, Ina; Bachmann, Jean; Kühnen, Ute; Küster, Anette; Kussatz, Carola; Maletzki, Dirk; Schlüter, Christoph

    2011-12-01

    The present study investigated the growth inhibition effect of the fluoroquinolone antibiotics enrofloxacin and ciprofloxacin on four photoautotrophic aquatic species: the freshwater microalga Desmodesmus subspicatus, the cyanobacterium Anabaena flos-aquae, the monocotyledonous macrophyte Lemna minor, and the dicotyledonous macrophyte Myriophyllum spicatum. Both antibiotics, which act by inhibiting the bacterial DNA gyrase, demonstrated high toxicity to A. flos-aquae and L. minor and moderate to slight toxicity to D. subspicatus and M. spicatum. The cyanobacterium was the most sensitive species with median effective concentration (EC50) values of 173 and 10.2 µg/L for enrofloxacin and ciprofloxacin, respectively. Lemna minor proved to be similarly sensitive, with EC50 values of 107 and 62.5 µg/L for enrofloxacin and ciprofloxacin, respectively. While enrofloxacin was more toxic to green algae, ciprofloxacin was more toxic to cyanobacteria. Calculated EC50s for D. subspicatus were 5,568 µg/L and >8,042 µg/L for enrofloxacin and ciprofloxacin, respectively. These data, as well as effect data from the literature, were compared with predicted and reported environmental concentrations. For two of the four species, a risk was identified at ciprofloxacin concentrations found in surface waters, sewage treatment plant influents and effluents, as well as in hospital effluents. For ciprofloxacin the results of the present study indicate a risk even at the predicted environmental concentration. In contrast, for enrofloxacin no risk was identified at predicted and measured concentrations. Copyright © 2011 SETAC.

  12. [Determination of chlorogenic acid, caffeic acid and linarin in Flos Chrysanthemi Indici from different places by RP-hPLC].

    PubMed

    Guo, Qiaosheng; Fang, Hailing; Shen, Haijin

    2010-05-01

    To evaluate the quality of Flos Chrysanthemi Indici which produced in twenty-two different producing places. Chlorogenic acid and caffeic acid were analyzed on a Shim-pack C8 colunm (4.6 mm x 250 mm, 5 microm) eluted with the mobile phase consisted of acetonitrile-0.5% phosphoric acid( 19:81). The detection wavelength was set at 326 nm. Linarin were eluted with the mobile phase consisted of methanol-water-acetic acid(26: 23: 1). The detection wavelength was set at 334 nm. The column temperature was 25 degrees C. The flow rate was 1.0 mL x min . The linear response ranged within 2.5-50 microg for chlorogenic acid (r = 0.998), 2.5-25 microg for caffeic acid (r = 0.998) and 4.97-41.47 microg for linarin (r = 0.999), respectively. Recoveries were 100.8% with RSD 2.1% for chlorogenic acid, 96.2% with RSD 2.3% for caffeic acid and 103.7% with RSD 1.8% for linarin. There was a significant difference in the content of chlorogenic acid, caffeic acid, linarin among the samples. The content of chlorogenic in the sample from Fengdou Chongqing city was the highest in those from other places. The content of caffeic acid in the all samples is very low. The content of linarin in the samples from Jiangsu province and Anhui province almost reached the national standard in pharmacopoeia.

  13. Potassium Salts Inhibit Growth of the Cyanobacteria Microcystis spp. in Pond Water and Defined Media: Implications for Control of Microcystin-Producing Aquatic Blooms

    PubMed Central

    Parker, D. L.; Kumar, H. D.; Rai, L. C.; Singh, J. B.

    1997-01-01

    Ten metals were assayed in 21 Indian ponds which comprised three groups: (i) eutrophic alkaline ponds containing <2.5 mM potassium and thick growths of Microcystis aeruginosa or Microcystis flos-aquae during most of the year, (ii) equally eutrophic alkaline ponds containing >2.8 mM potassium and no detectable Microcystis growth, and (iii) oligo- or mesotrophic ponds with various potassium and hydrogen ion concentrations and no persistent Microcystis blooms. The effects of potassium on Microcystis growth were examined in filter-sterilized pond water and in defined culture media. A 50% reduction in the 10-day yield of cultured M. aeruginosa was observed in DP medium and pond water supplemented with 1 and 3 mM KCl, respectively. In contrast, the addition of 2 to 30 mM NaCl did not suppress the growth of M. aeruginosa in either DP medium or pond water. Both 5 mM KCl and 20 mM KHCO(inf3) in J medium strongly inhibited the growth of M. flos-aquae C3-9, whereas 5 to 30 mM NaCl had no effect and 20 mM NaHCO(inf3) was stimulatory. For pond water cultured with a mixture of M. aeruginosa and the duckweed Wolffia arrhiza, M. aeruginosa dominated in unsupplemented water and W. arrhiza dominated in water supplemented with 4.8 mM KCl. Implications for the ecology and control of Microcystis blooms are discussed. PMID:16535629

  14. Antioxidant properties of a novel phycocyanin extract from the blue-green alga Aphanizomenon flos-aquae.

    PubMed

    Benedetti, Serena; Benvenuti, Francesca; Pagliarani, Silvia; Francogli, Sonia; Scoglio, Stefano; Canestrari, Franco

    2004-09-24

    Aphanizomenon flos-aquae (AFA) is a fresh water unicellular blue-green alga (cyanophyta) rich in phycocyanin (PC), a photosynthetic pigment with antioxidant and anti-inflammatory properties. The purpose of this study was to evaluate the ability of a novel natural extract from AFA enriched with PC to protect normal human erythrocytes and plasma samples against oxidative damage in vitro. In red blood cells, oxidative hemolysis and lipid peroxidation induced by the aqueous peroxyl radical generator [2,2'-Azobis (2-amidinopropane) dihydrochloride, AAPH] were significantly lowered by the AFA extract in a time- and dose-dependent manner; at the same time, the depletion of cytosolic glutathione was delayed. In plasma samples, the natural extract inhibited the extent of lipid oxidation induced by the pro-oxidant agent cupric chloride (CuCl2); a concomitant increase of plasma resistance to oxidation was observed as evaluated by conjugated diene formation. The involvement of PC in the antioxidant protection of the AFA extract against the oxidative damage was demonstrated by investigating the spectral changes of PC induced by AAPH or CuCl2. The incubation of the extract with the oxidizing agents led to a significant decrease in the absorption of PC at 620 nm accompanied with disappearance of its blue color, thus indicating a rapid oxidation of the protein. In the light of these in vitro results, the potential clinical applications of this natural compound are under investigation.

  15. Transcriptome Analysis Reveals the Mechanism Underlying the Production of a High Quantity of Chlorogenic Acid in Young Leaves of Lonicera macranthoides Hand.-Mazz

    PubMed Central

    Chen, Zexiong; Tang, Ning; You, Yuming; Lan, Jianbin; Liu, Yiqing; Li, Zhengguo

    2015-01-01

    Lonicera macranthoides Hand.-Mazz (L. macranthoides) is a medicinal herb that is widely distributed in southern China. The biosynthetic and metabolic pathways for a core secondary metabolite in L. macranthoides, chlorogenic acid (CGA), have been elucidated in many species. However, the mechanisms of CGA biosynthesis and the related gene regulatory network in L. macranthoides are still not well understood. In this study, CGA content was quantified by high performance liquid chromatography (HPLC), and CGA levels differed significantly among three tissues; specifically, the CGA content in young leaves (YL) was greater than that in young stems (YS), which was greater than that in mature flowers (MF). Transcriptome analysis of L. macranthoides yielded a total of 53,533,014 clean reads (average length 90 bp) and 76,453 unigenes (average length 703 bp). A total of 3,767 unigenes were involved in biosynthesis pathways of secondary metabolites. Of these unigenes, 80 were possibly related to CGA biosynthesis. Furthermore, differentially expressed genes (DEGs) were screened in different tissues including YL, MF and YS. In these tissues, 24 DEGs were found to be associated with CGA biosynthesis, including six phenylalanine ammonia lyase (PAL) genes, six 4-coumarate coenzyme A ligase (4CL) genes, four cinnamate 4-Hydroxylase (C4H) genes, seven hydroxycinnamoyl transferase/hydroxycinnamoyl-CoA quinate transferase HCT/HQT genes and one coumarate 3-hydroxylase (C3H) gene.These results further the understanding of CGA biosynthesis and the related regulatory network in L. macranthoides. PMID:26381882

  16. Wild Lonicera caerulea berry polyphenol extract reduces cholesterol accumulation and enhances antioxidant capacity in vitro and in vivo.

    PubMed

    Liu, Suwen; You, Lu; Zhao, Yuhua; Chang, Xuedong

    2018-05-01

    The hypocholesterolemic effect of Lonicera caerulea berry extract rich in polyphenols (LCBP) on high cholesterol-induced hypercholesterolemia and lipoprotein metabolite changes was examined in Caco-2 cells and rats. Cyanidin-3-glucoside, catechin, and chlorogenic acid are the major phenolic components of LCBP. The cholesterol-reducing effect and antioxidant capacity of these components were compared in Caco-2 cells. LCBP (80 μg/mL) and cyanidin-3-glucoside, catechin, and chlorogenic acid (50 μM) were found to be effective (p < 0.05). Rats were fed a high cholesterol diet (HCD) with or without LCBP supplementation (75, 150, and 300 mg/kg body weight intragastrically once daily) for 12 weeks. Compared with the HCD control group, LCBP supplementation at 150 and 300 mg/kg decreased the levels of TC, TG, and LDL-C, but increased that of HDL-C. LCBP treatment promoted greater neutral and acidic sterol excretion (p < 0.05) and improved the antioxidant capacity of the colon tissue, colon contents, and blood. Moreover, trimethylamine N-oxide (TMAO) levels were decreased in serum (p < 0.05). NPC1L1, ACAT2, and MTP mRNA and protein expression were reduced and ABCG5/8 expression was increased (p < 0.05) after LCBP treatment. Our results suggest that LCBP could be used as a functional food for the prevention and treatment of diseases related to excessive cholesterol accumulation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Use of acoustic backscatter and vertical velocity to estimate concentration and dynamics of suspended solids in Upper Klamath Lake, south-central Oregon: Implications for Aphanizomenon flos-aquae

    USGS Publications Warehouse

    Wood, Tamara M.; Gartner, Jeffrey W.

    2010-01-01

    Vertical velocity and acoustic backscatter measurements by acoustic Doppler current profilers were used to determine seasonal, subseasonal (days to weeks), and diel variation in suspended solids in a freshwater lake where massive cyanobacterial blooms occur annually. During the growing season, the suspended material in the lake is dominated by the buoyancy-regulating cyanobacteria, Aphanizomenon flos-aquae. Measured variables (water velocity, relative backscatter [RB], wind speed, and air and water temperatures) were averaged over the deployment season at each sample time of day to determine average diel cycles. Phase shifts between diel cycles in RB and diel cycles in wind speed, vertical water temperature differences (delta T(degree)), and horizontal current speeds were found by determining the lead or lag that maximized the linear correlation between the respective diel cycles. Diel cycles in RB were more in phase with delta T(degree) cycles, and, to a lesser extent, wind cycles, than to water current cycles but were out of phase with the cycle that would be expected if the vertical movement of buoyant cyanobacteria colonies was controlled primarily by light. Clear evidence of a diel cycle in vertical velocity was found only at the two deepest sites in the lake. Cycles of vertical velocity, where present, were out of phase with expected vertical motion of cyanobacterial colonies based on the theoretical cycle for light-driven vertical movement. This suggests that water column stability and turbulence were more important factors in controlling vertical distribution of colonies than light. Variations at subseasonal time scales were determined by filtering data to pass periods between 1.2 and 15 days. At subseasonal time scales, correlations between RB and currents or air temperature were consistent with increased concentration of cyanobacterial colonies near the surface when water column stability increased (higher air temperatures or weaker currents) and dispersal of colonies throughout the water column when the water column mixed more easily. RB was used to estimate suspended solids concentrations (SSC). Correlations of depth-integrated SSC with currents or air temperatures suggest that depth-integrated water column mass decreased under conditions of greater water column stability and weaker currents. Results suggest that the use of measured vertical velocity and acoustic backscatter as a surrogate for suspended material has the potential to contribute significant additional insight into dynamics of Aphanizomenon flos-aquae colonies in Upper Klamath Lake, south-central Oregon.

  18. A new fast algorithm for computing a complex number: Theoretic transforms

    NASA Technical Reports Server (NTRS)

    Reed, I. S.; Liu, K. Y.; Truong, T. K.

    1977-01-01

    A high-radix fast Fourier transformation (FFT) algorithm for computing transforms over GF(sq q), where q is a Mersenne prime, is developed to implement fast circular convolutions. This new algorithm requires substantially fewer multiplications than the conventional FFT.

  19. [Study on transport mechanism of baicalin in Scutellariae radix extracts and effect of Angelica dahurica extracts on transport of baicalin by Caco-2 cell monolayer model].

    PubMed

    Liang, Xin-Li; Zhu, Meng-Liang; Zhao, Li-Jun; Zhao, Guo-Wei; Liao, Zheng-Gen; Cao, Yun-Chao; Yang, Ming

    2013-07-01

    To study the transport mechanism of baicalin of Scutellariae Radix extracts and the effect of Angelica dahurica extracts on the intestinal absorption of baicalin by using Caco-2 cell monolayer model, in order to analyze the effect mechanism of Angelica dahurica extracts on the intestinal absorption of baicalin. The Caco-2 cell monolayer model was established with human colonic adenocarcinoma cells, and used to study the effect of pH, time, drug concentration and temperature on the transport of baicalin in Scutellariae Radix extracts, the effect of P-gp and MRP protein-dedicated inhibitors on the bidirectional transport of baicalin in Caco-2 cell model, and the effect of angelica root extracts on baicalin absorption and transport. Baicalin was absorbed well at 37 degrees C and under pH 7.4 condition and concentration dependent. Its proteins became inactive at 4 degrees C, with a low transport. The bi-drectional transfer PDR was 0. 54. After P-gp inhibitor verapamil and MRP inhibitor probenecid were added, the value of PappBL-AP of baicalin decreased, but without any difference in PDR. The transport of baicalin was improved by 2.34, 3.31 and 3.13 times, after A. dahurica extract coumarin, volatile oil, and mixture of coumarin and volatile oil. The transport mechanism of baicalin is mainly passive transfer and supplemented with efflux proteins involved. A. dahurica extracts can enhance the absorption of baicalin, which may be related to the passive transfer merchanism of baicalin. A. dahurica extracts' effect in opening the close junction among cells may be related to its expression or function in inhibiting efflux proteins.

  20. [Pollution prevention and control of aqueous extract of astragali radix processed with ZrO2 inorganic ceramic membrane micro-filtration].

    PubMed

    Pan, Lin-Men; Huang, Min-Yan; Guo, Li-Wei

    2012-11-01

    To study the measures for preventing and controlling the pollution of aqueous extract of Astragali Radix proceeded with inorganic ceramic membrane micro-filtration, in order to find effective measures for preventing and controlling the membrane pollution. The resistance distribution, polymer removal and changes in physical and chemical parameters of the zirconium oxide film of different pore diameters were determined to analyze the state or location of pollutants as well as the regularity of formation. Meanwhile, recoil and ultrasonic physical measures were adopted to strengthen the membrane process, in order to explore the methods for preventing and controlling the membrane pollution. When 0.2 microm of ZrO2 micro-filtrated aqueous extract of Astragali Radix, the rate of pollution was as high as 44.9%. The hole blocking resistance and the concentration polarization resistance were the main filtration resistances, while the surface deposit resistance decreased with the increase in the membrane's hold diameter; after micro-filtration, the liquid turbidity significantly reduced, with slight changes in both pH and viscosity. The 0.2 microm ZrO2 micro-filtration membrane performed better than the 0.05 microm pore size membrane in terms of conductivity. The 0. 2 microm and 0.05 microm pore diameter membranes showed better performance in the removal of pectin. The ultrasonic measure to strengthen membranes is more suitable to this system, with a flux rate up by 41.7%. The membrane optimization process adopts appropriate measures for preventing and controlling the membrane pollution, in order to reduce the membrane pollution, recover membrane performance and increase filtration efficiency.

  1. Traditional Japanese medicines inhibit compound action potentials in the frog sciatic nerve.

    PubMed

    Matsushita, Akitomo; Fujita, Tsugumi; Ohtsubo, Sena; Kumamoto, Eiichi

    2016-02-03

    Traditional Japanese (Kampo) medicines have a variety of clinical effects including pain alleviation, but evidence for a mechanism for their pain relief has not yet been elucidated fully. Considering that Kampo medicine contains many plant-derived chemicals having an ability to inhibit nerve action potential conduction, it is possible that this medicine inhibits nerve conduction. The purpose of the present study was to know how various Kampo medicines affect nerve conduction. We examined the effects of Kampo and crude medicines on compound action potentials (CAPs) recorded from the frog sciatic nerve by using the air-gap method. Daikenchuto, rikkosan, kikyoto, rikkunshito, shakuyakukanzoto and kakkonto concentration-dependently reduced the peak amplitude of the CAP. Among the Kampo medicines, daikenchuto was the most effective in inhibiting CAPs. Daikenchuto is composed of three kinds of crude medicine, Japanese pepper, processed ginger and ginseng radix. When the crude medicines were tested, Japanese pepper and processed ginger reduced CAP peak amplitudes, while ginseng radix hardly affected CAPs. Moreover, there was an interaction between the Japanese pepper and processed ginger activities in such that one medicine at low but not high concentrations increased the extent of the inhibition by the other one that was co-applied. Kampo medicines have an ability to inhibit nerve conduction. This action of daikenchuto is due to Japanese pepper and processed ginger but not ginseng radix, probably through an interaction between Japanese pepper and processed ginger in a manner dependent on their concentrations. Nerve conduction inhibition could contribute to at least a part of Kampo medicine's clinical effects such as pain alleviation. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Chemical and biological comparison of raw and vinegar-baked Radix Bupleuri.

    PubMed

    Li, Zhen-Yu; Sun, Hui-Min; Xing, Jie; Qin, Xue-Mei; Du, Guan-Hua

    2015-05-13

    Radix Bupleuri (RB) is a commonly used herbal drug in Traditional Chinese Medicine (TCM), and it can be baked with vinegar to afford vinegar-baked Radix Bupleuri (VBRB), which is used in TCM for liver diseases treatment. In this study, the chemical compositions and biological effects between raw and two processed RBs by different vinegars were systematically compared. The chemical compositions of raw and two processed RBs were analyzed by (1)H NMR spectroscopy coupled with multivariate analysis. Two different extraction procedures were used, including direct extraction and liquid-liquid partition. Then HPLC was applied to determine the changes of saikosaponin contents. In addition, their liver protective effects against CCl4 induced liver injury were also investigated, and the biochemical parameters and histopathology were measured after treatment of mice with raw RB and two processed RBs (5 g/kg/day) for 14 days. Multivariate analysis showed clear differences between the raw and the two processed RBs, and the vinegar-baking process induced elevated contents of ssb1, ssb2, acetic acid, malic acid, citric acid, 5-HMF, and ligustrazine, as well as the decreased contents of ssa, ssd, sucrose, glycine, succinic acid etc. In addition, both raw and processed RBs showed liver protective effects against CCl4 induced liver injury, and the vinegar-baked RBs showed better effects than that of raw RB. The raw and vinegar-baked RBs differed not only in the chemical compositions but also in the pharmacological effects. And two processed RBs also showed chemical differences, suggesting that the type of vinegar had an important effect on vinegar baking. In order to ensure the therapeutic effect and safety of TCM, the effect of different vinegars on processing of herbal drugs should be further studied. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. [Quality control of Guci tablets using UPLC-ELSD fingerprint analysis coupled with chemometrics].

    PubMed

    Wang, Ya-Dan; Dai, Zhong; Sun, Cai-Lin; Wu, Xian-Fu; Ma, Shuang-Cheng

    2018-03-01

    Ultra-performance liquid chromatography-evaporative light scattering detection (UPLC-ELSD) fingerprint analysis method was established for quality control of Guci tablets. Chromatographic separation was performed on Waters Acquity UPLC BEH C₁₈ column (2.1 mm×100 mm, 1.7 μm) at 30 °C of column temperature. Acetonitrile-0.1% formic acid solution was adopted as mobile phase for gradient elution. The flow rate was set at 0.3 mL·min⁻¹, and the injection volume was 3 μL. Detection was carried out on an ELSD with a nitrogen pressure of 0.28 MPa, drift tube temperature of 60 °C, and gain of 400. A total of 39 batches of samples produced by six manufacturers were measured by using the above method and the data were analyzed by ChemPattern software. The peak present in more than 75% of the samples was defined as a common peak, and 30 common peaks were determined. Among them, 19 peaks were identified by rapid resolution liquid chromatography/tandem mass spectrometry (RRLC-MS/MS) method, 16 of which were confirmed by reference substances. The similarity of the tested samples was 0.47-0.98, suggesting that the quality of the samples from different manufacturers varied greatly. Furthermore, principal component analysis (PCA) and hierarchical analysis (HCA) were performed to clarify the main different components in samples. The results indicated that there might be some feeding problems about Paeoniae Radix Alba, Notoginseng Radix et Rhizoma, and Clematidis Radix et Rhizoma in a few manufacturers. This study provided some evidences for the overall quality control of Guci tablets, as well as its quality standard improvements. Copyright© by the Chinese Pharmaceutical Association.

  4. Fingerprint analysis of Radix Aconiti using ultra-performance liquid chromatography-electrospray ionization/ tandem mass spectrometry (UPLC-ESI/MS n) combined with stoichiometry.

    PubMed

    Zhu, Hongbin; Wang, Chunyan; Qi, Yao; Song, Fengrui; Liu, Zhiqiang; Liu, Shuying

    2013-01-15

    A fingerprinting approach was developed by means of UPLC-ESI/MS(n) (ultra-performance liquid chromatography-electrospray ionization/mass spectrometry) for the quality control of processed Radix Aconiti, a widely used toxic traditional herbal medicine. The present fingerprinting approach was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity and ensuring the clinical therapeutic efficacy. Similarity evaluation, hierarchical cluster analysis and principal component analysis were performed to evaluate the similarity and variation of the samples. The results showed that the well processed, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to the contents of their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines. Finally, the UPLC-UV and UPLC-ESI/MS(n) characteristic fingerprints were established according to the well processed and purchased qualified samples. At the same time, a complementary quantification method of six Aconitine-type alkaloids was developed using UPLC-UV and UPLC-ESI/MS. The average recovery of the monoester diterpenoid aconitines was 95.4-99.1% and the average recovery of the diester diterpenoid aconitines was 103-112%. The proposed combined quantification method by UPLC-UV and UPLC-ESI/MS allows the samples analyzed in a wide concentration range. Therefore, the established fingerprinting approach in combination with chemometric analysis provides a flexible and reliable method for quality assessment of toxic herbal medicine. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Simultaneous determination of five bioactive components in radix glycyrrhizae by pressurised liquid extraction combined with UPLC-PDA and UPLC/ESI-QTOF-MS confirmation.

    PubMed

    Zhou, Shujun; Cao, Jiliang; Qiu, Feng; Kong, Weijun; Yang, Shihai; Yang, Meihua

    2013-01-01

    Glycyrrhizae species are popular ingredients of herbal medicine in most traditional Chinese medicine prescriptions, and they mainly contain flavonoids and triterpene saponins. The contents of these bioactive compounds may vary in different batches and affect the therapeutic effects. Thus comprehensive quality control and monitoring of their herbal formulation are of paramount concern. To establish a rapid, effective pressurised liquid extraction (PLE) and ultra-performance liquid chromatography coupled with photodiode array (UPLC-PDA) method to evaluate the quality of Glycyrrhizae species. Radix Glycyrrhizae was extracted by PLE using 70% ethanol at 100°C for 15 min during three static extraction cycles. Separation was performed using an UPLC system to quantify five bioactive compounds, namely liquiritin apioside, liquiritin, liquiritigenin, glycyrrhizic acid and glycyrrhetinic acid, in 12 batches of samples of different origins in China. Furthermore, the samples were analysed using an ultra-performance liquid chromatography coupled with electrospray ionisation and time-of-flight mass spectrometry (UPLC/ESI-QTOF-MS) system to confirm the results. The calibration curves of all five analytes showed good linearity (R(2)  > 0.9997). Accuracy, precision and repeatability were all within required limits. The mean recoveries measured at the three concentrations were higher than 93.7% with RSDs lower than < 3.33% for the targets. The established PLE and UPLC-PDA method could serve as a rapid and effective method for quality evaluation of Radix Glycyrrhizae. The UPLC technique can be considered as an attractive alternative to HPLC in routine quality control of Chinese medicine, especially in situations where high sample throughput and fast analytical speed are required. Copyright © 2013 John Wiley & Sons, Ltd.

  6. Selenium speciation in radix puerariae using ultrasonic assisted extraction combined with reversed phase high performance liquid chromatography-inductively coupled plasma-mass spectrometry after magnetic solid-phase extraction with 5-sulfosalicylic acid functionalized magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Cao, Yupin; Yan, Lizhen; Huang, Hongli; Deng, Biyang

    2016-08-01

    A new method for determination of selenium species in radix puerariae was described. The method consists of sample enrichment with 5-sulfosalicylic acid (SSA)-functionalized silica-coated magnetic nanoparticles (SMNPs), high performance liquid chromatography (HPLC) separation, and online detection using inductively coupled plasma mass spectrometry (ICP-MS). The selenium species were extracted using ultrasonic extraction system with a mixture of protease K and lipase. The SSA-SMNPs were used to enrich trace amounts of selenite [Se(IV)], selenate [Se(VI)], selenomethionine (SeMet), and selenocystine (SeCys2) from lower selenium containing samples. Under the optimal conditions, the limits of detection (3σ) for SeCys2, Se(IV), SeMet and Se(VI) were observed as 0.0023, 0.0015, 0.0043, and 0.0016 ng mL- 1, respectively. The RSD values (n = 6) of method for intraday were observed between 0.5% and 0.9%. The RSD values of method for interday were less than 1.3%. The linear concentration ranges for SeCys2, Se(IV), SeMet and Se(VI) were 0.008-1000, 0.005-200, 0.015-500 and 0.006-200 ng mL- 1, respectively. The detection limits of this method were improved by 10 times due to the enrichment with the SSA-SMNP extraction. The contents of SeCys2, Se(IV), SeMet, and Se(VI) in radix puerariae were determined as 0.0140, 0.171, 0.0178, and 0.0344 μg g- 1, respectively. The recoveries were in the range of 95.6%-99.4% and the RSDs (n = 6) of recoveries were less than 1.5%.

  7. Polygalasaponin XXXII, a triterpenoid saponin from Polygalae Radix, attenuates scopolamine-induced cognitive impairments in mice.

    PubMed

    Zhou, Heng; Xue, Wei; Chu, Shi-Feng; Wang, Zhen-Zhen; Li, Chuang-Jun; Jiang, Yi-Na; Luo, Lin-Ming; Luo, Piao; Li, Gang; Zhang, Dong-Ming; Chen, Nai-Hong

    2016-08-01

    Recent studies show that the extract of a Chinese herb Polygalae Radix exerts cognition-enhancing actions in rats and humans. The aim of this study was to characterize the pharmacological profiles of active compounds extracted from Polygalae Radix. Two fractions P3 and P6 and two compounds PTM-15 and polygalasaponin XXXII (PGS32) were prepared. Neuroprotective effects were evaluated in primary cortical neurons exposed to high concentration glutamate, serum deficiency or H2O2. Anti-dementia actions were assessed in scopolamine-induced amnesia in mice using step-through avoidance tests and channel water maze tests. After conducting the channel water maze tests, TrkB phosphorylation in mouse hippocampus was detected using Western blotting. Long-term potentiation (LTP) was induced in the dentate gyrus in adult rats; PGS32 (5 μL 400 μmol/L) was injected into the lateral cerebral ventricle 20 min after high frequency stimulation (HFS). Compared to the fraction P6, the fraction P3 showed more prominent neuroprotective effects in vitro and cognition-enhancing effects in scopolamine-induced amnesia in mice. One active compound PGS32 in the fraction P3 exerted potent cognition-enhancing action: oral administration of PGS32 (0.125 mg·kg(-1)·d(-1)) for 19 days abolished scopolamine-induced memory impairment in mice. Furthermore, PGS32 (0.5 and 2 mg·kg(-1)·d(-1)) significantly stimulated the phosphorylation of TrkB in the hippocampus. Intracerebroventricular injection of PGS32 significantly enhanced HFS-induced LTP in the dentate gyrus of rats. PGS32 attenuates scopolamine-induced cognitive impairments in mice, suggesting that it has a potential for the treatment of cognitive dysfunction and dementia.

  8. Polygalasaponin XXXII, a triterpenoid saponin from Polygalae Radix, attenuates scopolamine-induced cognitive impairments in mice

    PubMed Central

    Zhou, Heng; Xue, Wei; Chu, Shi-feng; Wang, Zhen-zhen; Li, Chuang-jun; Jiang, Yi-na; Luo, Lin-ming; Luo, Piao; Li, Gang; Zhang, Dong-ming; Chen, Nai-hong

    2016-01-01

    Aim: Recent studies show that the extract of a Chinese herb Polygalae Radix exerts cognition-enhancing actions in rats and humans. The aim of this study was to characterize the pharmacological profiles of active compounds extracted from Polygalae Radix. Methods: Two fractions P3 and P6 and two compounds PTM-15 and polygalasaponin XXXII (PGS32) were prepared. Neuroprotective effects were evaluated in primary cortical neurons exposed to high concentration glutamate, serum deficiency or H2O2. Anti-dementia actions were assessed in scopolamine-induced amnesia in mice using step-through avoidance tests and channel water maze tests. After conducting the channel water maze tests, TrkB phosphorylation in mouse hippocampus was detected using Western blotting. Long-term potentiation (LTP) was induced in the dentate gyrus in adult rats; PGS32 (5 μL 400 μmol/L) was injected into the lateral cerebral ventricle 20 min after high frequency stimulation (HFS). Results: Compared to the fraction P6, the fraction P3 showed more prominent neuroprotective effects in vitro and cognition-enhancing effects in scopolamine-induced amnesia in mice. One active compound PGS32 in the fraction P3 exerted potent cognition-enhancing action: oral administration of PGS32 (0.125 mg·kg−1·d−1) for 19 days abolished scopolamine-induced memory impairment in mice. Furthermore, PGS32 (0.5 and 2 mg·kg−1·d−1) significantly stimulated the phosphorylation of TrkB in the hippocampus. Intracerebroventricular injection of PGS32 significantly enhanced HFS-induced LTP in the dentate gyrus of rats. Conclusion: PGS32 attenuates scopolamine-induced cognitive impairments in mice, suggesting that it has a potential for the treatment of cognitive dysfunction and dementia. PMID:27180981

  9. Pharmacological Effects of Active Components of Chinese Herbal Medicine in the Treatment of Alzheimer's Disease: A Review.

    PubMed

    Wang, Zhi-Yong; Liu, Jian-Gang; Li, Hao; Yang, Hui-Ming

    2016-01-01

    Alzheimer's disease (AD), the most common neurodegenerative disorder associated with dementia, not only severely decreases the quality of life for its victims, but also brings a heavy economic burden to the family and society. Unfortunately, few chemical drugs designed for clinical applications have reached the expected preventive or therapeutic effect so far, and combined with their significant side-effects, there is therefore an urgent need for new strategies to be developed for AD treatment. Traditional Chinese Medicine has accumulated many experiences in the treatment of dementia during thousands of years of practice; modern pharmacological studies have confirmed the therapeutic effects of many active components derived from Chinese herbal medicines (CHM). Ginsenoside Rg1, extracted from Radix Ginseng, exerts a [Formula: see text]-secretase inhibitor effect so as to decrease A[Formula: see text] aggregation. It can also inhibit the apoptosis of neuron cells. Tanshinone IIA, extracted from Radix Salviae miltiorrhizae, and baicalin, extracted from Radix Scutellariae[Formula: see text] can inhibit the oxidative stress injury in neuronal cells. Icariin, extracted from Epimedium brevicornum, can decrease A[Formula: see text] levels and the hyperphosphorylation of tau protein, and can also inhibit oxidative stress and apoptosis. Huperzine A, extracted from Huperzia serrata, exerts a cholinesterase inhibitor effect. Evodiamine, extracted from Fructus Evodiae, and curcumin, extracted from Rhizoma Curcumae Longae, exert anti-inflammatory actions. Curcumin can act on A[Formula: see text] and tau too. Due to the advantages of multi-target effects and fewer side effects, Chinese medicine is more appropriate for long-term use. In this present review, the pharmacological effects of commonly used active components derived from Chinese herbal medicines in the treatment of AD are discussed.

  10. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    PubMed

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  11. Highland cattle and Radix labiata, the hosts of Fascioloides magna

    PubMed Central

    2014-01-01

    Background Fascioloides magna is a pathogenic fluke introduced to Europe ca 140 years ago. As it is spreading over the continent, new intermediate and definitive hosts might be involved in transmission of the parasite. In Europe, several studies reported potential new intermediate snail hosts (Radix spp.) for F. magna, and also several cases of fascioloidosis of wild and domestic animals were published. However, the data based on molecular and histological analyses confirming these findings remained unreported. This study aims to refer to unique findings of F. magna in European snails and domestic animals (the first observation in the Czech Republic in the last 30 years) and demonstrate the use of molecular techniques in determination of F. magna. Results Two snails of R. labiata naturally infected with F. magna were found; mature cercariae and daughter rediae were observed. Maturity of cercariae was checked by histological methods, however, their ability to encyst was not confirmed. Co-infection of F. magna and Fasciola hepatica in the liver of two highland cattle bulls was proved. Adult fasciolid flukes producing eggs were found in the liver pseudocysts (F. magna) and the bile ducts (F. hepatica). Identification of intermediate hosts, intramolluscan stages, adult flukes and eggs was performed by sequencing the ITS2 region. Connection of F. magna pseudocysts with the gut (via the bile ducts) was not confirmed by means of histological and coprological examinations. Conclusions For the first time, Radix labiata was confirmed as the snail host for F. magna under natural conditions and, together with the finding of F. magna infection in cattle, we can expect further transmission of F. magna from wildlife to livestock in localities shared by these hosts. PMID:24517409

  12. Chemical Composition and Antimigraine Activity of Essential Oil of Angelicae dahuricae Radix.

    PubMed

    Sun, Jingbo; Li, He; Sun, Jinghui; Liu, Huimin; Chen, Jianguang; Wang, Chunmei

    2017-08-01

    The aim of this study was to explore the chemical composition and the effect of essential oil of Angelicae dahuricae radix on a nitroglycerin (NTG)-induced rat model of migraine. The CO 2 supercritical fluid extraction method was optimized for the extraction of essential oil of A. dahuricae radix (EOAD) and its chemical composition was determined. The migraine model was established by subcutaneous injection of NTG (10 mg/kg) 1 h after the last administration of EOAD. The therapeutic effect of EOAD and its underlying mechanism were assessed by monitoring behavioral changes, levels of nitric oxide (NO) in serum and brain tissues, plasma levels of calcitonin gene-related peptide (CGRP) and endothelin (ET), and ET/NO ratio. The optimal conditions for CO 2 supercritical fluid extraction of EOAD, as determined by orthogonal test [L 9 (3 4 )], were as follows: 2 h extraction time, 20 MPa pressure, 40°C temperature, and 30 mesh. The yield of EOAD was 1.8%. On gas chromatography-mass spectrometry, 45 peaks were found in EOAD, and 22 compounds were identified and quantified. The main constituents of EOAD were 1-dodecanol (13.71%), elemene (7.54%), palmitic acid ethyl ester (7.32%), α-pinene (6.25%), and 1-pentadecanol (6.08%). Compared with rat migraine model controls, EOAD (35, 70, and 140 mg/kg) significantly reduced the number of head shaking, head scratching, and hind leg shooting events, decreased serum and brain NO levels, decreased plasma CGRP, and increased ET levels in rats. ET/NO ratio was elevated to 28.68 in the EOAD high-dose group. EOAD ameliorates NTG-induced migraine in rats likely by modulating the levels of vasoactive substances.

  13. Traditional Chinese Nootropic Medicine Radix Polygalae and Its Active Constituent Onjisaponin B Reduce β-Amyloid Production and Improve Cognitive Impairments

    PubMed Central

    Li, Xiaohang; Cui, Jin; Yu, Yang; Li, Wei; Hou, Yujun; Wang, Xin; Qin, Dapeng; Zhao, Cun; Yao, Xinsheng; Zhao, Jian; Pei, Gang

    2016-01-01

    Decline of cognitive function is the hallmark of Alzheimer’s disease (AD), regardless of the pathological mechanism. Traditional Chinese medicine has been used to combat cognitive impairments and has been shown to improve learning and memory. Radix Polygalae (RAPO) is a typical and widely used herbal medicine. In this study, we aimed to follow the β-amyloid (Aβ) reduction activity to identify active constituent(s) of RAPO. We found that Onjisaponin B of RAPO functioned as RAPO to suppress Aβ production without direct inhibition of β-site amyloid precursor protein cleaving enzyme 1 (BACE1) and γ-secretase activities. Our mechanistic study showed that Onjisaponin B promoted the degradation of amyloid precursor protein (APP). Further, oral administration of Onjisaponin B ameliorated Aβ pathology and behavioral defects in APP/PS1 mice. Taken together, our results indicate that Onjisaponin B is effective against AD, providing a new therapeutic agent for further drug discovery. PMID:26954017

  14. Smart Soup, a Traditional Chinese Medicine Formula, Ameliorates Amyloid Pathology and Related Cognitive Deficits

    PubMed Central

    Li, Xiaohang; Cui, Jin; Ding, Jianqing; Wang, Ying; Zeng, Xianglu; Ling, Yun; Shen, Xiaoheng; Chen, Shengdi; Huang, Chenggang; Pei, Gang

    2014-01-01

    Alzheimer’s disease (AD) is a progressive neurodegenerative disease that causes substantial public health care burdens. Intensive efforts have been made to find effective and safe disease-modifying treatment and symptomatic intervention alternatives against AD. Smart Soup (SS), a Chinese medicine formula composed of Rhizoma Acori Tatarinowii (AT), Poria cum Radix Pini (PRP) and Radix Polygalae (RP), is a typical prescription against memory deficits. Here, we assessed the efficacy of SS against AD. Oral administration of SS ameliorated the cognitive impairment of AD transgenic mice, with reduced Aβ levels, retarded Aβ amyloidosis and reduced Aβ-induced gliosis and neuronal loss in the brains of AD mice. Consistently, SS treatment reduced amyloid-related locomotor dysfunctions and premature death of AD transgenic Drosophila. Mechanistic studies showed that RP reduced Aβ generation, whereas AT and PRP exerted neuroprotective effects against Aβ. Taken together, our study indicates that SS could be effective against AD, providing a practical therapeutic strategy against the disease. PMID:25386946

  15. Lithospermi radix extract inhibits histamine release and production of inflammatory cytokine in mast cells.

    PubMed

    Kim, Eun Kyoung; Kim, Eun-Young; Moon, Phil-Dong; Um, Jae-Young; Kim, Hyung-Min; Lee, Hyun-Sam; Sohn, Youngjoo; Park, Seong Kyu; Jung, Hyuk-Sang; Sohn, Nak-Won

    2007-12-01

    Lithospermi radix (LR, Borraginaceae, the root of Lithospermum erythrorhizon Siebold. et Zuccarinii) is used in herbal medicine to treat such conditions as eczema, skin burns and frostbite. This study investigates the effects of LR on the anti-allergy mechanism. LR inhibited the release of histamine from rat peritoneal mast cells by compound 48/80 in a dose-dependent manner. LR orally administered at 6.59 mg/100 g also inhibited the anti-DNP IgE-induced passive cutaneous anaphylaxis reaction. LR inhibited the PMA plus A23187-induced increase in IL-6, IL-8, and TNF-alpha expression in HMC-1 cells. In addition, LR also inhibited nuclear factor-kappa B (NF-kappaB) activation and I kappaB-alpha degradation. These results show that LR had an inhibitory effect on the atopic allergic reaction. Furthermore, the in vivo and in vitro anti-allergic effect of LR suggests possible therapeutic applications of this agent for inflammatory allergic diseases.

  16. Effect of Lithospermi Radix on Contact Dermatitis Induced by Dinitrofluorobenzene in Mice

    PubMed Central

    Kim, Han-Na; Kim, Mi-Young; Choi, Chan-Hun; Kim, Byung-Joo; Kim, Kyung-Yoon; Kim, Gye-Yeop; Jeong, Hyun-Woo; Kim, Hyung-Woo

    2012-01-01

    Objective: The root of Lithospermum erythrorhizon Sieb. et Zucc. (Lithospermi Radix, LR) is a kind of heat clearing and blood cooling medicinal herbs. It can clear away heat and cool the blood, reduce toxins and disperse maculae. LR has long been used as efficacious therapy for inflammation, burns, frostbite and skin diseases such as eczema and psoriasis. Methods: In the present study, we investigate anti-allergic and anti-inflammatory effects of LR by using the 1-fluoro-2, 4- dinitrofluorobenzene (DNFB)-induced contact dermatitis mouse model. Results: Topical application of 10 mg/mL of LR effectively inhibited skin lesions induced by repeated paintings with DNFB. Topical application of LR also inhibited hyperplasia, edema, spongiosis and infiltrations of mononuclear cells. In addition, production levels of total immunoglobulin and IgG1 in serum were decreased by using LR in vivo. Conclusion: These data suggest that LR acts as an antiinflammatory agent, improving skin lesions in CD mice. PMID:25780635

  17. Traditional Chinese Nootropic Medicine Radix Polygalae and Its Active Constituent Onjisaponin B Reduce β-Amyloid Production and Improve Cognitive Impairments.

    PubMed

    Li, Xiaohang; Cui, Jin; Yu, Yang; Li, Wei; Hou, Yujun; Wang, Xin; Qin, Dapeng; Zhao, Cun; Yao, Xinsheng; Zhao, Jian; Pei, Gang

    2016-01-01

    Decline of cognitive function is the hallmark of Alzheimer's disease (AD), regardless of the pathological mechanism. Traditional Chinese medicine has been used to combat cognitive impairments and has been shown to improve learning and memory. Radix Polygalae (RAPO) is a typical and widely used herbal medicine. In this study, we aimed to follow the β-amyloid (Aβ) reduction activity to identify active constituent(s) of RAPO. We found that Onjisaponin B of RAPO functioned as RAPO to suppress Aβ production without direct inhibition of β-site amyloid precursor protein cleaving enzyme 1 (BACE1) and γ-secretase activities. Our mechanistic study showed that Onjisaponin B promoted the degradation of amyloid precursor protein (APP). Further, oral administration of Onjisaponin B ameliorated Aβ pathology and behavioral defects in APP/PS1 mice. Taken together, our results indicate that Onjisaponin B is effective against AD, providing a new therapeutic agent for further drug discovery.

  18. Numerical computation of spherical harmonics of arbitrary degree and order by extending exponent of floating point numbers

    NASA Astrophysics Data System (ADS)

    Fukushima, Toshio

    2012-04-01

    By extending the exponent of floating point numbers with an additional integer as the power index of a large radix, we compute fully normalized associated Legendre functions (ALF) by recursion without underflow problem. The new method enables us to evaluate ALFs of extremely high degree as 232 = 4,294,967,296, which corresponds to around 1 cm resolution on the Earth's surface. By limiting the application of exponent extension to a few working variables in the recursion, choosing a suitable large power of 2 as the radix, and embedding the contents of the basic arithmetic procedure of floating point numbers with the exponent extension directly in the program computing the recurrence formulas, we achieve the evaluation of ALFs in the double-precision environment at the cost of around 10% increase in computational time per single ALF. This formulation realizes meaningful execution of the spherical harmonic synthesis and/or analysis of arbitrary degree and order.

  19. Effect of Echinostoma friedi (Trematoda: Echinostomatidae) experimental infection on longevity, growth and fecundity of juvenile Radix peregra (Gastropoda: Lymnaeidae) and Biomphalaria glabrata (Gastropoda: Planorbidae) snails.

    PubMed

    Muñoz-Antoli, Carla; Marín, Antoni; Toledo, Rafael; Esteban, José-Guillermo

    2007-11-01

    The effect of Echinostoma friedi experimental infection on longevity, growth and fecundity of two susceptible first intermediate host snails, Radix peregra and Biomphalaria glabrata, was studied to contrast the level of compatibility. 120 R. peregra and 150 B. glabrata snails were used exposed to one, three or five miracidia and divided in three categories: INF (snails exposed and infected); ENI (exposed but not infected) and C (control or not miracidial-exposed snails). R. peregra INF snails' death process starts sooner, but in a prolonged extension, while B. glabrata INF snails have a much shorter life span. The infection and the miracidial exposure are able to reduce R. peregra normal development (stunting). B. glabrata INF snails' growth exceeds that of C snails (gigantism). E. friedi produces a total parasitic castration of R. peregra and B. glabrata INF snails. R. peregra would be considered as the required snail host, while B. glabrata only as an adequate snail host.

  20. Separation and purification of triterpene saponins from roots of Radix phytolaccae by high-speed countercurrent chromatography coupled with evaporative light scattering detection

    PubMed Central

    Ma, Jie; Chen, Qianliang; Lai, Daowan; Sun, Wenji; Zhang, Tianyou; Ito, Yoichiro

    2009-01-01

    Coupled with evaporative light scattering detection, high-speed countercurrent chromatography was successfully applied for the first time to separation and purification of four triterpene saponins including esculentoside A, B, C and D from roots of Radix Phytolaccae. The separation was performed with an optimized two-phase solvent system composed of chloroform-methanol-water (4:4:2, v/v) using the lower phase as the mobile phase at a flow rate of 1.5 ml/min,. From 150 mg of crude extract 46.3 mg of esculentoside A, 21.8 mg of esculentoside B, 7.3 mg of esculentoside C, and 13.6 mg of esculentoside D were obtained at purities of 96.7%, 99.2%, 96.5% and 97.8%, respectively, as determined by HPLC analysis. The structures of the four triterpene saponins were identified by ESI-MS,1H NMR and 13C NMR. PMID:20454595

  1. Multistate Memristive Tantalum Oxide Devices for Ternary Arithmetic

    PubMed Central

    Kim, Wonjoo; Chattopadhyay, Anupam; Siemon, Anne; Linn, Eike; Waser, Rainer; Rana, Vikas

    2016-01-01

    Redox-based resistive switching random access memory (ReRAM) offers excellent properties to implement future non-volatile memory arrays. Recently, the capability of two-state ReRAMs to implement Boolean logic functionality gained wide interest. Here, we report on seven-states Tantalum Oxide Devices, which enable the realization of an intrinsic modular arithmetic using a ternary number system. Modular arithmetic, a fundamental system for operating on numbers within the limit of a modulus, is known to mathematicians since the days of Euclid and finds applications in diverse areas ranging from e-commerce to musical notations. We demonstrate that multistate devices not only reduce the storage area consumption drastically, but also enable novel in-memory operations, such as computing using high-radix number systems, which could not be implemented using two-state devices. The use of high radix number system reduces the computational complexity by reducing the number of needed digits. Thus the number of calculation operations in an addition and the number of logic devices can be reduced. PMID:27834352

  2. An Annotated Draft Genome for Radix auricularia (Gastropoda, Mollusca)

    PubMed Central

    Feldmeyer, Barbara; Schmidt, Hanno; Greshake, Bastian; Tills, Oliver; Truebano, Manuela; Rundle, Simon D.; Paule, Juraj; Ebersberger, Ingo; Pfenninger, Markus

    2017-01-01

    Molluscs are the second most species-rich phylum in the animal kingdom, yet only 11 genomes of this group have been published so far. Here, we present the draft genome sequence of the pulmonate freshwater snail Radix auricularia. Six whole genome shotgun libraries with different layouts were sequenced. The resulting assembly comprises 4,823 scaffolds with a cumulative length of 910 Mb and an overall read coverage of 72×. The assembly contains 94.6% of a metazoan core gene collection, indicating an almost complete coverage of the coding fraction. The discrepancy of ∼690 Mb compared with the estimated genome size of R. auricularia (1.6 Gb) results from a high repeat content of 70% mainly comprising DNA transposons. The annotation of 17,338 protein coding genes was supported by the use of publicly available transcriptome data. This draft will serve as starting point for further genomic and population genetic research in this scientifically important phylum. PMID:28204581

  3. Multistate Memristive Tantalum Oxide Devices for Ternary Arithmetic.

    PubMed

    Kim, Wonjoo; Chattopadhyay, Anupam; Siemon, Anne; Linn, Eike; Waser, Rainer; Rana, Vikas

    2016-11-11

    Redox-based resistive switching random access memory (ReRAM) offers excellent properties to implement future non-volatile memory arrays. Recently, the capability of two-state ReRAMs to implement Boolean logic functionality gained wide interest. Here, we report on seven-states Tantalum Oxide Devices, which enable the realization of an intrinsic modular arithmetic using a ternary number system. Modular arithmetic, a fundamental system for operating on numbers within the limit of a modulus, is known to mathematicians since the days of Euclid and finds applications in diverse areas ranging from e-commerce to musical notations. We demonstrate that multistate devices not only reduce the storage area consumption drastically, but also enable novel in-memory operations, such as computing using high-radix number systems, which could not be implemented using two-state devices. The use of high radix number system reduces the computational complexity by reducing the number of needed digits. Thus the number of calculation operations in an addition and the number of logic devices can be reduced.

  4. [Studies on chemical protectors against radiation. XXXII. Protective effects of methanol extracts of various Taiwan crude drugs on radiation injuries].

    PubMed

    Wang, C M; Ohta, S; Shinoda, M

    1990-11-01

    This study is to investigate radioprotective effects of 23 Taiwan crude drugs on X-ray induced bone marrow death and skin injury in mice. Each methanol extract of these Taiwan crude drugs was injected intraperitoneally into ICR male mice at 6 weeks of age before irradiation. Mice were whole-body irradiated with a soft X-ray generator. Radiation factors of the two screening tests used were as follows: 70 kVp, 10 mA, 10 mm acrylate filter, 70R/min, 2100R for survival test, and 30 kVp, 10 mA, 190R/min, 1100R for protective test on skin injury. As a result of these studies, the survival effect was recognized in Solani Incani Herba and Orthosiphi Aristati Herba. On the other hand, Mimosae Herba, Canarii Radix, Bombacis Radix, Arecae Fructus, Hedyotidis Diffusae Herba and Cynomorii Caulis were shown to have significant protective potency on skin injury.

  5. Paeoniae alba Radix Promotes Peripheral Nerve Regeneration

    PubMed Central

    Huang, Kun-Shan; Lin, Jaung-Geng; Lee, Han-Chung; Tsai, Fuu-Jen; Bau, Da-Tian; Huang, Chih-Yang; Yao, Chun-Hsu; Chen, Yueh-Sheng

    2011-01-01

    The present study provides in vitro and in vivo evaluation of Paeoniae alba Radix (PR) on peripheral nerve regeneration. In the in vitro study, we found the PR caused a marked enhancement of the nerve growth factor-mediated neurite outgrowth from PC12 cells as well as their expression of growth associated protein 43 and synapsin I. In the in vivo study, silicone rubber chambers filled with the PR water extract were used to bridge a 10-mm sciatic nerve defect in rats. At the conclusion of 8 weeks, regenerated nerves in the PR groups, especially at 1.25 mg ml−1 had a higher rate of successful regeneration across the wide gap, relatively larger mean values of total nerve area, myelinated axon count and blood vessel number, and a significantly larger nerve conductive velocity compared to the control group (P  <  .05). These results suggest that the PR extract can be a potential nerve growth-promoting factor, being salutary in aiding the growth of injured peripheral nerve. PMID:19687191

  6. Multistate Memristive Tantalum Oxide Devices for Ternary Arithmetic

    NASA Astrophysics Data System (ADS)

    Kim, Wonjoo; Chattopadhyay, Anupam; Siemon, Anne; Linn, Eike; Waser, Rainer; Rana, Vikas

    2016-11-01

    Redox-based resistive switching random access memory (ReRAM) offers excellent properties to implement future non-volatile memory arrays. Recently, the capability of two-state ReRAMs to implement Boolean logic functionality gained wide interest. Here, we report on seven-states Tantalum Oxide Devices, which enable the realization of an intrinsic modular arithmetic using a ternary number system. Modular arithmetic, a fundamental system for operating on numbers within the limit of a modulus, is known to mathematicians since the days of Euclid and finds applications in diverse areas ranging from e-commerce to musical notations. We demonstrate that multistate devices not only reduce the storage area consumption drastically, but also enable novel in-memory operations, such as computing using high-radix number systems, which could not be implemented using two-state devices. The use of high radix number system reduces the computational complexity by reducing the number of needed digits. Thus the number of calculation operations in an addition and the number of logic devices can be reduced.

  7. [Clinical observation on effect of shaogen decoction for the prevention and treatment of acute radiation esophagitis].

    PubMed

    Zhang, Jie; Zhang, Li; Wang, Jun

    2010-12-01

    To observe the effect of Shaogen Decoction (SGD) for the prevention and treatment of acute radiation esophagitis (ARE). Sixty patients with breast tumor receiving chemo/radiotherapy were assigned to two groups, the SGD group and the control group. The patients in the SGD group were administered with SGD, a Chinese preparation consisted of Radix Sophorae tonkinensis 10 g, Radix Paeoniae Alba 30 g, Radix Scrophulariae 15 g, Rhizoma Bletillae 15 g, Radix Notoginseng 3 g, etc., starting from the initial day of radiotherapy, 10 mL, thrice a day, while in case of 2nd or over 2nd grade ARE occurred, it was changed to 10 mL, every 2 h, medicated by keeping in mouth and slowly swallowed followed with 5-min forbiddance of food and water. The patients in the control group were treated, in case of 2nd or over 2nd grade ARE occurred, with antibiotic drugs (such as cefuroxime 4.5 g) and hormone (dexamethasone 5 mg) by intravenous infusion for 7 days. The incidence, happening time, and retaining time of ARE, therapeutic effect on it, as well as the proportion of patients for whom antibiotics and hormone were used in the two groups were observed. The incidence of 2nd or over 2nd grade ARE in the SGD group and the control group was 33.33% and 63.33%, respectively, that in the former was significantly lower (chi2 = 5.406, P<0.05). Different degrees of acute esophageal toxic response occurred in both groups, initially presenting at 19.8 +/- 7.4 days in the SGD group and at 20.2 +/- 9.6 days in the control group after radiotherapy, that was delayed in the former (t=2.130, P<0.05). Clinical symptom of ARE retained for 56.4 +/- 19.5 days and 58.2 +/- 15.0 days in the two groups, respectively, it was shorter in the SGD groups (t=2.441, P<0.05). Moreover, the proportion of patients for whom antibiotics and hormone were used in the SGD group was less. SGD acted, in coordinating with chemo-radiotherapy, to reduce the incidence, retard the happening and shorten the retaining time of 2nd or over 2nd grade ARE, and reduce the proportion of patients needing antibiotics and hormone treatment as well, showing equivalent efficacy in treating ARE as Western drugs.

  8. Chitosan as coagulant on cyanobacteria in lake restoration management may cause rapid cell lysis.

    PubMed

    Mucci, Maíra; Noyma, Natalia Pessoa; de Magalhães, Leonardo; Miranda, Marcela; van Oosterhout, Frank; Guedes, Iamê Alves; Huszar, Vera L M; Marinho, Marcelo Manzi; Lürling, Miquel

    2017-07-01

    Combining coagulant and ballast to remove cyanobacteria from the water column is a promising restoration technique to mitigate cyanobacterial nuisance in surface waters. The organic, biodegradable polymer chitosan has been promoted as a coagulant and is viewed as non-toxic. In this study, we show that chitosan may rapidly compromise membrane integrity and kill certain cyanobacteria leading to release of cell contents in the water. A strain of Cylindrospermopsis raciborskii and one strain of Planktothrix agardhii were most sensitive. A 1.3 h exposure to a low dose of 0.5 mg l -1 chitosan already almost completely killed these cultures resulting in release of cell contents. After 24 h, reductions in PSII efficiencies of all cyanobacteria tested were observed. EC50 values varied from around 0.5 mg l -1 chitosan for the two sensitive strains, via about 5 mg l -1 chitosan for an Aphanizomenon flos-aquae strain, a toxic P. agardhii strain and two Anabaena cylindrica cultures, to more than 8 mg l -1 chitosan for a Microcystis aeruginosa strain and another A. flos-aquae strain. Differences in sensitivity to chitosan might be related to polymeric substances that surround cyanobacteria. Rapid lysis of toxic strains is likely and when chitosan flocking and sinking of cyanobacteria is considered in lake restoration, flocculation efficacy studies should be complemented with investigation on the effects of chitosan on the cyanobacteria assemblage being targeted. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Selective monoamine oxidase B inhibition by an Aphanizomenon flos-aquae extract and by its constitutive active principles phycocyanin and mycosporine-like amino acids.

    PubMed

    Scoglio, Stefano; Benedetti, Yanina; Benvenuti, Francesca; Battistelli, Serafina; Canestrari, Franco; Benedetti, Serena

    2014-06-15

    Aphanizomenon flos-aquae (AFA) is a fresh water unicellular blue-green alga that has been traditionally used for over 25 years for its health-enhancing properties. Recent studies have shown the ability of a proprietary AFA extract (Klamin(®)) to improve mood, counteract anxiety, and enhance attention and learning. Aim of this study was to test the monoamine oxidase (MAO) inhibition activity of the same AFA extract and of its constituents phycocyanin (AFA-PC) and mycosporine-like aminoacids (AFA-MAAs). All compounds showed a dose-dependent selective inhibition of MAO-B activity as compared to MAO-A. The IC50 values of the AFA extract (concentration 10 mg/ml), AFA-PC and AFA-MAAs were 6.4 μl/ml, 1.33 μM and 1.98 μM, respectively, evidencing a mixed-type of inhibition for the AFA extract (Ki 0.99 μl/ml), a non-competitive inhibition for AFA-PC (Ki 1.06 μM) and a competitive inhibition for AFA-MAAs (Ki 0.585 μM). These results are important to explain the neuromodulating properties of the AFA extract Klamin(®), which is rich in phenylethylamine, a general neuromodulator, that would nevertheless rapidly destroyed by MAO-B enzymes without the inhibitory activity of the synergic active principles AFA-PC and AFA-MAAs. The present investigation thus proposes the extract as potentially relevant in clinical areas such as mood disorders and neurodegenerative diseases. Copyright © 2014 Elsevier GmbH. All rights reserved.

  10. Effects of ultrahigh pressure extraction on yield and antioxidant activity of chlorogenic acid and cynaroside extracted from flower buds of Lonicera japonica.

    PubMed

    Hu, Wen; Guo, Ting; Jiang, Wen-Jun; Dong, Guang-Li; Chen, Da-Wei; Yang, Shi-Lin; Li, He-Ran

    2015-06-01

    The present study was designed to establish and optimize a new method for extracting chlorogenic acid and cynaroside from Lonicera japonica Thunb. through orthogonal experimental designl. A new ultrahigh pressure extraction (UPE) technology was applied to extract chlorogenic acid and cynaroside from L. japonica. The influential factors, including solvent type, ethanol concentration, extraction pressure, time, and temperature, and the solid/liquid ratio, have been studied to optimize the extraction process. The optimal conditions for the UPE were developed by quantitative analysis of the extraction products by HPLC-DAD in comparison with standard samples. In addition, the microstructures of the medicinal materials before and after extraction were studied by scanning electron microscopy (SEM). Furthermore, the extraction efficiency of different extraction methods and the 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activities of the extracts were investigated. The optimal conditions for extracting chlorogenic acid and cynaroside were as follows: ethanol concentration, 60%; extraction pressure, 400 MPa; extraction time, 2 min; extraction temperature, 30 °C; and the solid/liquid ratio, 1 : 50. Under these conditions, the yields of chlorogenic acid and cynaroside were raised to 4.863% and 0.080%, respectively. Compared with other extraction methods, such as heat reflux extraction (HRE), ultrasonic extraction (UE), and Sohxlet extraction (SE), the UPE method showed several advantages, including higher extraction yield, shorter extraction time, lower energy consumption, and higher purity of the extracts. This study could help better utilize L. japonica flower buds as a readily accessible source of natural antioxidants in food and pharmaceutical industries. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  11. De novo transcriptome assembly and characterization of nine tissues of Lonicera japonica to identify potential candidate genes involved in chlorogenic acid, luteolosides, and secoiridoid biosynthesis pathways.

    PubMed

    Rai, Amit; Kamochi, Hidetaka; Suzuki, Hideyuki; Nakamura, Michimi; Takahashi, Hiroki; Hatada, Tomoki; Saito, Kazuki; Yamazaki, Mami

    2017-01-01

    Lonicera japonica is one of the most important medicinal plants with applications in traditional Chinese and Japanese medicine for thousands of years. Extensive studies on the constituents of L. japonica extracts have revealed an accumulation of pharmaceutically active metabolite classes, such as chlorogenic acid, luteolin and other flavonoids, and secoiridoids, which impart characteristic medicinal properties. Despite being a rich source of pharmaceutically active metabolites, little is known about the biosynthetic enzymes involved, and their expression profile across different tissues of L. japonica. In this study, we performed de novo transcriptome assembly for L. japonica, representing transcripts from nine different tissues. A total of 22 Gbps clean RNA-seq reads from nine tissues of L. japonica were used, resulting in 243,185 unigenes, with 99,938 unigenes annotated based on a homology search using blastx against the NCBI-nr protein database. Unsupervised principal component analysis and correlation studies using transcript expression data from all nine tissues of L. japonica showed relationships between tissues, explaining their association at different developmental stages. Homologs for all genes associated with chlorogenic acid, luteolin, and secoiridoid biosynthesis pathways were identified in the L. japonica transcriptome assembly. Expression of unigenes associated with chlorogenic acid was enriched in stems and leaf-2, unigenes from luteolin were enriched in stems and flowers, while unigenes from secoiridoid metabolic pathways were enriched in leaf-1 and shoot apex. Our results showed that different tissues of L. japonica are enriched with sets of unigenes associated with specific pharmaceutically important metabolic pathways and, therefore, possess unique medicinal properties. The present study will serve as a resource for future attempts for functional characterization of enzyme coding genes within key metabolic processes.

  12. Polyphenols from Lonicera caerulea L. Berry Inhibit LPS-Induced Inflammation through Dual Modulation of Inflammatory and Antioxidant Mediators.

    PubMed

    Wu, Shusong; Yano, Satoshi; Chen, Jihua; Hisanaga, Ayami; Sakao, Kozue; He, Xi; He, Jianhua; Hou, De-Xing

    2017-06-28

    Lonicera caerulea L. berry polyphenols (LCBP) are considered as major components for bioactivity. This study aimed to clarify the molecular mechanisms by monitoring inflammatory and antioxidant mediator actions in lipopolysaccharide (LPS)-induced mouse paw edema and macrophage cell model. LCBP significantly attenuated LPS-induced paw edema (3.0 ± 0.1 to 2.8 ± 0.1 mm, P < 0.05) and reduced (P < 0.05) serum levels of monocyte chemotactic protein-1 (MCP-1, 100.9 ± 2.3 to 58.3 ± 14.5 ng/mL), interleukin (IL)-10 (1596.1 ± 424.3 to 709.7 ± 65.7 pg/mL), macrophage inflammatory protein (MIP)-1α (1761.9 ± 208.3 to 1369.1 ± 56.4 pg/mL), IL-6 (1262.8 ± 71.7 to 499.0 ± 67.1 pg/mL), IL-4 (93.3 ± 25.7 to 50.7 ± 12.5 pg/mL), IL-12(p-70) (580.4 ± 132.0 to 315.2 ± 35.1 pg/mL), and tumor necrosis factor-α (TNF-α, 2045.5 ± 264.9 to 1270.7 ± 158.6 pg/mL). Cell signaling analysis revealed that LCBP inhibited transforming growth factor β activated kinase-1 (TAK1)-mediated mitogen-activated protein kinase (MAPK) and nuclear factor-κB (NF-κB) pathways, and enhanced the expression of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and manganese-dependent superoxide dismutase (MnSOD) in earlier response. Moreover, cyanidin 3-glucoside (C3G) and (-)-epicatechin (EC), two major components of LCBP, directly bound to TAK1. These data demonstrated that LCBP might inhibit LPS-induced inflammation by modulating both inflammatory and antioxidant mediators.

  13. Wound repair and anti-inflammatory potential of Lonicera japonica in excision wound-induced rats.

    PubMed

    Chen, Wei-Cheng; Liou, Shorong-Shii; Tzeng, Thing-Fong; Lee, Shiow-Ling; Liu, I-Min

    2012-11-23

    Lonicera japonica Thunb. (Caprifoliaceae), a widely used traditional Chinese medicinal plant, is used to treat some infectious diseases and it may have uses as a healthy food and applications in cosmetics and as an ornamental groundcover. The ethanol extract of the flowering aerial parts of L. japonica (LJEE) was investigated for its healing efficiency in a rat excision wound model. Excision wounds were inflicted upon three groups of eight rats each. Healing was assessed by the rate of wound contraction in skin wound sites in rats treated with simple ointment base, 10% (w/w) LJEE ointment, or the reference standard drug, 0.2% (w/w) nitrofurazone ointment. The effects of LJEE on the contents of hydroxyproline and hexosamine during healing were estimated. The antimicrobial activity of LJEE against microorganisms was also assessed. The in vivo anti-inflammatory activity of LJEE was investigated to understand the mechanism of wound healing. LJEE exhibited significant antimicrobial activity against Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Candida albicans, and Candida tropicalis. The ointment formulation prepared with 10% (w/w) LJEE exhibited potent wound healing capacity as evidenced by the wound contraction in the excision wound model. The contents of hydroxyproline and hexosamine also correlated with the observed healing pattern. These findings were supported by the histopathological characteristics of healed wound sections, as greater tissue regeneration, more fibroblasts, and angiogenesis were observed in the 10% (w/w) LJEE ointment-treated group. The results also indicated that LJEE possesses potent anti-inflammatory activity, as it enhanced the production of anti-inflammatory cytokines that suppress proinflammatory cytokine production. The results suggest that the antimicrobial and anti-inflammatory activities of LJEE act synergistically to accelerate wound repair.

  14. Wound repair and anti-inflammatory potential of Lonicera japonica in excision wound-induced rats

    PubMed Central

    2012-01-01

    Background Lonicera japonica Thunb. (Caprifoliaceae), a widely used traditional Chinese medicinal plant, is used to treat some infectious diseases and it may have uses as a healthy food and applications in cosmetics and as an ornamental groundcover. The ethanol extract of the flowering aerial parts of L. japonica (LJEE) was investigated for its healing efficiency in a rat excision wound model. Methods Excision wounds were inflicted upon three groups of eight rats each. Healing was assessed by the rate of wound contraction in skin wound sites in rats treated with simple ointment base, 10% (w/w) LJEE ointment, or the reference standard drug, 0.2% (w/w) nitrofurazone ointment. The effects of LJEE on the contents of hydroxyproline and hexosamine during healing were estimated. The antimicrobial activity of LJEE against microorganisms was also assessed. The in vivo anti-inflammatory activity of LJEE was investigated to understand the mechanism of wound healing. Results LJEE exhibited significant antimicrobial activity against Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Candida albicans, and Candida tropicalis. The ointment formulation prepared with 10% (w/w) LJEE exhibited potent wound healing capacity as evidenced by the wound contraction in the excision wound model. The contents of hydroxyproline and hexosamine also correlated with the observed healing pattern. These findings were supported by the histopathological characteristics of healed wound sections, as greater tissue regeneration, more fibroblasts, and angiogenesis were observed in the 10% (w/w) LJEE ointment-treated group. The results also indicated that LJEE possesses potent anti-inflammatory activity, as it enhanced the production of anti-inflammatory cytokines that suppress proinflammatory cytokine production. Conclusions The results suggest that the antimicrobial and anti-inflammatory activities of LJEE act synergistically to accelerate wound repair. PMID:23173654

  15. Prophylactic effects of Lonicera japonica extract on dextran sulphate sodium-induced colitis in a mouse model by the inhibition of the Th1/Th17 response.

    PubMed

    Park, Jae-Woo; Bae, Hyunsu; Lee, Gihyun; Hong, Beom-Gi; Yoo, Hye Hyun; Lim, Sung-Jig; Lee, Kyungjin; Kim, Jinsung; Ryu, Bongha; Lee, Beom-Joon; Bae, Jinhyun; Lee, Hyejung; Bu, Youngmin

    2013-01-28

    Inflammatory bowel diseases (IBD) are chronically relapsing inflammatory disorders of the intestine. Although some therapeutic agents, including steroids, are available for the treatment of IBD, these agents have limited use. Therefore, dietary supplements have emerged as possible interventions for IBD. Japanese honeysuckle flower, the flower of Lonicera japonica, is a well-known dietary supplement and has been used to prevent or treat various inflammatory diseases. In the present study, we investigated the effects of L. japonica on experimental murine colitis. Colitis was induced by 5 % dextran sulphate sodium (DSS) in Balb/c mice. The water extract of L. japonica (LJE) at doses of 20, 100 or 500 mg/kg was orally administered to mice twice per day for 7 d. Body weight, colon length and a histological damage score were assessed to determine the effects on colitis. Cytokine profiles were assessed to examine the effects on helper T (Th) cell-related immunological responses. In addition, CD4⁺CD25⁺Foxp3⁺T cells were analysed in vivo and in vitro for investigating the effects on regulatory T (Treg) cells. LJE showed dose-dependent inhibitory effects against colon shortening, weight loss and histological damage. LJE down-regulated IL-1β, TNF-α, interferon-γ, IL-6, IL-12 and IL-17. However, LJE did not show any significant effects on IL-10, IL-23, transforming growth factor-β1 and Treg cell populations. In conclusion, LJE showed protective effects against DSS-induced colitis via the Th1/Th17 pathway and not via Treg cell-related mechanisms.

  16. High-Pressure Liquid Chromatography: Quantitative Analysis of Chinese Herbal Medicine

    ERIC Educational Resources Information Center

    Chan, W. F.; Lin, C. W.

    2007-01-01

    An HPLC undergraduate experiment on the analysis of traditional Chinese medicine (TCM) has been developed. Two commonly used herbs ("glycyrrhizae radix" and "cinnamomi ramulus") are studied. Glycyrrhizin, cinnamic acid, and cinnamaldehyde are chosen as markers for the herbs. The dried herbs in their natural state and a TCM…

  17. Partners in Character: Building a Moral Culture.

    ERIC Educational Resources Information Center

    Sudeck, Maria; Dinovi, Raymond; Gehringer, Christine; Tonia, Rachael; Wuillermin, Monica

    This paper describes the professional partnership between Rowan University, New Jersey, and Radix Elementary School, emphasizing the building of a moral culture in the learning community. The partnership is a driving force behind the movement to promote character education within the school community. This is being accomplished by facilitating…

  18. The theory and implementation of SRT Division. Report No. 230

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Atkins, III, Daniel E.

    1967-06-01

    To a large extent, this report has been directed to the designer faced with the task of implementing digital division. The author also hopes that this report will support exploration into development of higher radix quotient selection models, which can select 8 quotients bits in parallel.

  19. Effect of retorted-oil shale leachate on a blue-green alga (Anabaena flos-aquae)

    USGS Publications Warehouse

    McKnight, Diane M.; Pereira, Wilfred E.; Rostad, Colleen E.; Stiles, Eric A.

    1983-01-01

    In the event of the development of the large oil shale reserves of Colorado, Utah, and Wyoming, one of the main environmental concerns will be disposal of retorted-oil shale which will be generated in greater volume than the original volume oI the mined oil shale. Investigators have found that leachates of retorted-oil shale are alkaline and have large concentrations of dissolved solids, molybdenum, boron, and fluoride (STOLLENWERK & RUNNELS 1981). STOLLENWERK & RUNNELS (1981) concluded that drainage from waste shale piles could have deleterious effects on the water quality of streams in northwestern Colorado.

  20. Detection of Poisonous Herbs by Terahertz Time-Domain Spectroscopy

    NASA Astrophysics Data System (ADS)

    Zhang, H.; Li, Z.; Chen, T.; Liu, J.-J.

    2018-03-01

    The aim of this paper is the application of terahertz (THz) spectroscopy combined with chemometrics techniques to distinguish poisonous and non-poisonous herbs which both have a similar appearance. Spectra of one poisonous and two non-poisonous herbs (Gelsemium elegans, Lonicera japonica Thunb, and Ficus Hirta Vahl) were obtained in the range 0.2-1.4 THz by using a THz time-domain spectroscopy system. Principal component analysis (PCA) was used for feature extraction. The prediction accuracy of classification is between 97.78 to 100%. The results demonstrate an efficient and applicative method to distinguish poisonous herbs, and it may be implemented by using THz spectroscopy combined with chemometric algorithms.

  1. Convenient, Sensitive and High-Throughput Method for Screening Botanic Origin

    NASA Astrophysics Data System (ADS)

    Yuan, Yuan; Jiang, Chao; Liu, Libing; Yu, Shulin; Cui, Zhanhu; Chen, Min; Lin, Shufang; Wang, Shu; Huang, Luqi

    2014-06-01

    In this work, a rapid (within 4-5 h), sensitive and visible new method for assessing botanic origin is developed by combining loop-mediated isothermal amplification with cationic conjugated polymers. The two Chinese medicinal materials (Jin-Yin-Hua and Shan-Yin-Hua) with similar morphology and chemical composition were clearly distinguished by gene SNP genotyping assays. The identification of plant species in Patented Chinese drugs containing Lonicera buds is successfully performed using this detection system. The method is also robust enough to be used in high-throughput screening. This new method is very helpful to identify herbal materials, and is beneficial for detecting safety and quality of botanic products.

  2. The Molecular Basis of Wound Healing Processes Induced by Lithospermi Radix: A Proteomics and Biochemical Analysis

    PubMed Central

    Hsiao, Chia-Yen; Tsai, Tung-Hu; Chak, Kin-Fu

    2012-01-01

    Lithospermi Radix (LR) is an effective traditional Chinese herb in various types of wound healing; however, its mechanism of action remains unknown. A biochemical and proteomic platform was generated to explore the biological phenomena associated with LR and its active component shikonin. We found that both LR ethanol extracts and shikonin are able to promote cell proliferation by up to 25%. The results of proteomic analysis revealed that twenty-two differentially expressed proteins could be identified when fibroblast cells were treated with LR or shikonin. The functions of those proteins are associated with antioxidant activity, antiapoptosis activity, the regulation of cell mobility, the secretion of collagen, the removal of abnormal proteins, and the promotion of cell proliferation, indicating that the efficacy of LR in wound healing may be derived from a synergistic effect on a number of factors induced by the herbal medicine. Furthermore, an animal model confirmed that LR is able to accelerate wound healing on the flank back of the SD rats. Together these findings help to pinpoint the molecular basis of wound healing process induced by LR. PMID:23024692

  3. Hydrolysis of Glycosidic Flavonoids during the Preparation of Danggui Buxue Tang: An Outcome of Moderate Boiling of Chinese Herbal Mixture

    PubMed Central

    Zhang, Wendy Li; Chen, Jian-Ping; Lam, Kelly Yin-Ching; Zhan, Janis Ya-Xian; Yao, Ping; Dong, Tina Ting-Xia; Tsim, Karl Wah-Keung

    2014-01-01

    Chemical change during boiling of herbal mixture is a puzzle. By using Danggui Buxue Tang (DBT), a herbal decoction that contains Astragali Radix (AR) and Angelicae Sinensis Radix (ASR), we developed a model in analyzing the hydrolysis of flavonoid glycosides during the boiling of herbal mixture in water. A proper preparation of DBT is of great benefit to the complete extraction of bioactive ingredients. Boiling of DBT in water increased the solubility of AR-derived astragaloside IV, calycosin, formononetin, calycosin-7-O-β-D-glucoside, and ononin in a time- and temperature-dependent manner: the amounts of these chemicals reached a peak at 2 h. The glycosidic resides of AR, calycosin-7-O-β-D-glucoside, and ononin could be hydrolyzed during the moderate boiling process to form calycosin and formononetin, respectively. The hydrolysis efficiency was strongly affected by pH, temperature, and amount of herbs. Interestingly, the preheated herbs were not able to show this hydrolytic activity. The current results supported the rationality of ancient preparation of DBT in boiling water by moderate heat. PMID:24744813

  4. Effects of Scutellariae radix and Aloe vera gel extracts on immunoglobulin E and cytokine levels in atopic dermatitis NC/Nga mice.

    PubMed

    Kim, Jinkyung; Lee, In seok; Park, Soojin; Choue, Ryowon

    2010-11-11

    The present study aimed to investigate the effects of Scutellariae radix (SR) and Aloe vera gel (AV), alone or in combination, on levels of immunoglobulin E (IgE) and inflammatory cytokines in spontaneous atopic dermatitis(AD)-like skin lesions. After spontaneous AD-like skin lesion was developed by adaptation to conventional conditions, mice were randomly assigned to control, SR (50 mg/kg, p.o.), AV (0.8 mg/kg, p.o.) and SRAV (50 mg of SR and 0.8 mg of AV/kg, p.o.) groups, and were treated for 6 weeks. SR and SRAV suppressed IL-5 levels compared with control, but had no effects on IgE levels (P<0.05). AV increased IgE levels, but decreased both IL-5 and IL-10 compared with control (P<0.05). These results suggest that SR and AV modulate immunological responses in AD, mainly through influencing IL-5 or IL-10 levels. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  5. Encapsulation of Aconitine in Self-Assembled Licorice Protein Nanoparticles Reduces the Toxicity In Vivo

    NASA Astrophysics Data System (ADS)

    Ke, Li-jing; Gao, Guan-zhen; Shen, Yong; Zhou, Jian-wu; Rao, Ping-fan

    2015-11-01

    Many herbal medicines and compositions are clinically effective but challenged by its safety risks, i.e., aconitine (AC) from aconite species. The combined use of Radix glycyrrhizae (licorice) with Radix aconite L. effectively eliminates toxicity of the later while increasing efficacy. In this study, a boiling-stable 31-kDa protein (namely GP) was purified from licorice and self-assembled into nanoparticles (206.2 ± 2.0 nm) at pH 5.0, 25 °C. The aconitine-encapsulated GP nanoparticles (238.2 ± 1.2 nm) were prepared following the same procedure and tested for its toxicity by intraperitoneal injection on ICR mouse ( n = 8). Injection of GP-AC nanoparticles and the mixed licorice-aconite decoction, respectively, caused mild recoverable toxic effects and no death, while the aconitine, particle-free GP-AC mixture and aconite decoction induced sever toxic effects and 100 % death. Encapsulation of poisonous alkaloids into self-assembled herbal protein nanoparticles contributes to toxicity attenuation of combined use of herbs, implying a prototype nanostructure and a universal principle for the safer clinical applications of herbal medicines.

  6. Chemical composition of the leaf and stem essential oil of Adenophorae Radix

    NASA Astrophysics Data System (ADS)

    Lan, Weijie; Lin, Shang; Li, Xindan; Zhang, Qing; Qin, Wen

    2017-03-01

    The chemical composition of the essential oil extracted from leaves and stems of Adenophorae Radix was determined for the first time in this study. Twenty-six compounds were identified by gas chromatography coupled to mass spectrometry (GC-MS). n-Hexadecanoic acid (29.14%), 9,12-octadecadienoic acid (Z,Z)- (17.22%), hexadecanoic acid, methyl ester(8.98%), 9-octadecenoic acid, methyl ester, (E)- (7.03%), 9,12-octadecadienoic acid (Z,Z)-, methyl ester (5.93%), phytol (5.50%), and estradiol (4.43%) were measured as the major compounds in stem oil. The leaf essential oil was dominated by n-hexadecanoic acid (50.78%), 9-octadecenoic acid, methyl ester, (E)- (9.04%), phytol (8.47%), d-mannitol (5.81%), 9,12,15-octadecatrienoic acid, methyl ester, (Z,Z,Z)- (4.31%), hexadecanoic acid, methyl ester (2.19%) and 9,12-octadecadienoic acid (Z,Z)-(1.7%). The leaves yield was 0.12% (v/w) and the stems yield showed only 0.073% (v/w). The results might provide reference basis for further exploration of its application value.

  7. Discrimination of Radix Polygoni Multiflori from different geographical areas by UPLC-QTOF/MS combined with chemometrics.

    PubMed

    Tang, Jin-Fa; Li, Wei-Xia; Zhang, Fan; Li, Yu-Hui; Cao, Ying-Jie; Zhao, Ya; Li, Xue-Lin; Ma, Zhi-Jie

    2017-01-01

    Nowadays, Radix Polygoni Multiflori (RPM, Heshouwu in Chinese) from different geographical origins were used in clinic. In order to characterize the chemical profiles of different geographical origins of RPM samples, ultra-high performance liquid chromatography quadrupole time of flight mass spectrometry (UPLC-QTOF/MS) combined with chemometrics (partial least squared discriminant analysis, PLS‑DA) method was applied in the present study. The chromatography, chemical composition and MS information of RPM samples from 18 geographical origins were acquired and profiled by UPLC-QTOF/MS. The chemical markers contributing the differentiation of RPM samples were observed and characterized by supervised PLS‑DA method of chemometrics. The chemical composition differences of RPM samples derived from 18 different geographical origins were observed. Nine chemical markers were tentatively identified which could be used as specific chemical markers for the differentiation of geographical RPM samples. UPLC-QTOF/MS method coupled with chemometrics analysis has potential to be used for discriminating different geographical TCMs. Results will help to develop strategies for conservation and utilization of RPM samples.

  8. Endodontic treatment of mandibular molars with atypical root canal anatomy: reports of 4 cases.

    PubMed

    Chauhan, Raju; Singh, Shweta

    2015-01-01

    The variations in root canal anatomy of multirooted teeth represent a continuous challenge to endodontic diagnosis and treatment. Although the most common configuration of mandibular molars is one containing 2 roots and 3 root canals, there are many different combinations. Very rarely, an additional third (supernumerary) root is seen. When it is located distolingually to the main distal root, this third root is called radix entomolaris (RE), and when it is located mesiobuccally to the mesial root, it is called radix paramolaris (RP). Variations of root canal systems need not always be in the form of extra roots or extra canals. Single roots with single canals can also occur. A general dentist should be aware of these unusual root canal morphologies in mandibular molars for the success of endodontic treatment. These case reports describe the root canal treatment of a case of RE in the mandibular first molar, 2 rare cases of RP (1 each in the mandibular first and second molars), and a mandibular second molar with a single root and root canal.

  9. Mixed Phenolic Acids Mediated Proliferation of Pathogens Talaromyces helicus and Kosakonia sacchari in Continuously Monocultured Radix pseudostellariae Rhizosphere Soil

    PubMed Central

    Wu, Hongmiao; Wu, Linkun; Wang, Juanying; Zhu, Quan; Lin, Sheng; Xu, Jiahui; Zheng, Cailiang; Chen, Jun; Qin, Xianjin; Fang, Changxun; Zhang, Zhixing; Azeem, Saadia; Lin, Wenxiong

    2016-01-01

    Radix pseudostellariae L. is a common and popular Chinese medication. However, continuous monoculture has increased its susceptibility to severe diseases. We identified two pathogenic microorganisms, Talaromyces helicus M. (KU355274) and Kosakonia sacchari W. (KU324465), and their antagonistic bacterium, Bacillus pumilus Z. in rhizosphere soil of continuously monocultured R. pseudostellariae. Nine types of phenolic acids were identified both in the rhizosphere soil and in culture medium under sterile conditions. A syringic acid and phenolic acid mixture significantly promoted the growth of T. helicus and K. sacchari. T. helicus could utilize eight types of phenolic acids, whereas K. sacchari could only use four phenolic acids. K. sacchari produced protocatechuic acid when consuming vanillin. Protocatechuic acid negatively affected the growth of B. pumilus. The 3A-DON toxin produced by T. helicus promoted the growth of K. sacchari and inhibited growth of B. pumilus at low concentrations. These data help explain why phenolic exudates mediate a microflora shift and structure disorder in the rhizosphere soil of continuously monocultured R. pseudostellariae and lead to increased replanting disease incidence. PMID:27014250

  10. Taspine isolated from Radix et Rhizoma Leonticis inhibits growth of human umbilical vein endothelial cell (HUVEC) by inducing its apoptosis.

    PubMed

    Zhang, Yanmin; He, Langchong; Zhou, Yali

    2008-01-01

    The present study was to evaluate the effects of taspine isolated from Radix et Rhizoma Leonticsi on the growth and apoptosis of human umbilical vein endothelial cell (HUVEC) line by MTT and flow cytometer, respectively. At the same time, a series of changes were observed in HUVEC treated by taspine, including microstructure, protein expression of bax, bcl-2 and VEGF. The change of microstructure was observed by transmission electron microscope (TEM). The protein expression of bax and bcl-2 was detected by immunohistochemistry (IHC), and VEGF protein secreted was determined by enzyme-linked immunosorbent assay (ELISA). The results showed taspine could inhibit growth and induce apoptosis of HUVEC in a dose-dependent manner. Cell cycle was significantly stopped at the S phase. Under electronic microscope, the morphology of HUVEC treated with taspine showed nuclear karyopycnosis, chromatin agglutination and typical apoptotic body. Bcl-2 and VEGF expressions were decreased and bax expression was increased. All these results demonstrate that taspine has an inhibitory effect on growth of HUVEC and can induce its apoptosis.

  11. Cyanobacteria reduce quagga mussel (Dreissena rostriformis bugensis) spawning and fertilization success

    USGS Publications Warehouse

    Boegehold, Anna G.; Johnson, Nicholas; Ran, Jeffrey L.; Kashian, Donna R.

    2018-01-01

    Quagga mussels (Dreissena rostriformis bugensis) are highly fecund broadcast spawners invasive to freshwaters of North America and western Europe. We hypothesized that environmental cues from phytoplankton can trigger gamete release in quagga mussels. Nutritious algae may stimulate dreissenid spawning, but less palatable food, such as bloom-forming cyanobacteria, could be a hindrance. The objective of our study was to test whether exposure to cyanobacteria can inhibit quagga mussel spawning and fertilization. We assessed spawning in the presence of serotonin, a known spawning inducer, where adult quagga mussels placed in individual vials were exposed to 13 cyanobacteria cultures and purified algal toxin (microcystin-LR) with artificial lake water as the control. Fertilization success was evaluated by combining eggs with sperm in conjunction with cyanobacteria, and enumerating zygote formation marked by cellular cleavage. Several cyanobacterial strains reduced spawning and fertilization success, but microcystin-LR had no effect. Fertilization was more sensitive to cyanobacteria than gamete release. Only 1 culture, Aphanizomenon flos-aquae, inhibited spawning, whereas 6 cultures consisting of Anabaena flos-aquae, Dolichospermum lemmermanii, Gloeotrichia echinulata, Lyngbya wollei, and 2 Microcystis aeruginosa isolates reduced fertilization rates by up to 44%. The effects of cyanobacteria on reproduction in invasive freshwater mussels in the wild have not yet been identified. However, our laboratory studies show that concentrations of cyanobacteria that are possible during bloom conditions probably limit reproduction. Reproductive consequences on wild populations may become more prevalent as cyanobacteria blooms occur earlier in the year, making overlap between blooms and mussel spawning more common. Describing the mechanism by which cyanobacteria inhibit spawning and fertilization could reveal novel control methods to limit reproduction of this invasive species.

  12. Protective effect of Flos puerariae extract following acute alcohol intoxication in mice.

    PubMed

    Chen, Xiao; Cai, Fei; Guo, Shuang; Ding, Fang; He, Yi; Wu, Jiliang; Liu, Chao

    2014-07-01

    The effect of Flos Puerariae extract (FPE) on alcohol metabolism, hepatic injury, and memory impairment was assessed following acute ethanol (EtOH) intoxication in mice. The model of acute EtOH intoxication was established by intragastric administration with 8 g/kg EtOH in mice. FPE was orally administrated (gavage) once a day for 7 consecutive days. Mice were randomly divided into 4 groups: control group, model group, and FPE groups (100, 200 mg/kg). Alcohol tolerance and intoxication time, blood alcohol concentration, the activities of alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) in liver, aspartate amino transferase (AST) and alanine amino transferase (ALT) in serum, superoxide dismutase (SOD), glutathione peroxidase (GSH-px), catalase and the formation of malondialdehyde (MDA) in both liver and brain, as well as memory ability were determined after acute alcohol exposure. Compared with model group, pretreatment with FPE significantly prolonged alcohol tolerance time and shortened intoxication time, which is accompanied by decreased blood alcohol concentration and elevated activities of ADH and ALDH in liver. Moreover, the index of hepatic injury, ALT, and AST activities in serum was markedly decreased by pretreatment with FPE. Additionally, decreased MDA level, enhanced GSH-px and catalase activities in liver, as well as enhanced SOD and catalase activities in brain were found in FPE pretreated mice after acute exposure to EtOH. Furthermore, FPE pretreated mice showed markedly relieved memory disruption following acute EtOH intoxication. This study suggests that FPE pretreatment could enhance alcohol metabolism, prevent hepatic injury, and relieve memory impairment after acute alcohol intoxication and that this effect is likely related to its modulation on the alcohol metabolizing and antioxidant enzymes. Copyright © 2014 by the Research Society on Alcoholism.

  13. A novel approach to rapidly explore analytical markers for quality control of Radix Salviae Miltiorrhizae extract granules by robust principal component analysis with ultra-high performance liquid chromatography-ultraviolet-quadrupole time-of-flight mass spectrometry.

    PubMed

    Song, Jing-Zheng; Li, Song-Lin; Zhou, Yan; Qiao, Chun-Feng; Chen, Shi-Lin; Xu, Hong-Xi

    2010-11-02

    In a well-controlled experiment, outliers discriminated by robust principal component analysis (RPCA) represent contents in samples which are of particular quality distinguishable from the rest of the others, therefore chemical constituents in a natural product causing discrimination between outliers and the majority of samples could be considered as analytical markers for quality control. Based on this strategy, a novel approach for rapidly exploring characteristic analytical markers was proposed for the quality control of extract granules of Radix Salviae Miltiorrhizae (EGRSM). In this study, large sizes of samples were analyzed via high-throughput ultra-high performance liquid chromatography-ultraviolet-quadrupole time-of-flight mass spectrometry (UHPLC-UV-Q-Tof MS). RPCA was first performed on the three groups of samples: RSM (the raw material), the in-house prepared aqueous extract of Radix Salviae Miltiorrhizae (AERSM) and commercial product of EGRSM, to determine the variation of specific constituents between raw material and the final products as well as the effect of manufacturing process on the overall quality. Then RPCA was performed on the commercial products of EGRSM to explore the applicability of identified characteristic markers for the quality control of EGRSM. Candidate markers were extracted by RPCA, and their molecular formulae were determined by high resolution electrospray ionization-mass spectrometric (ESI-MS) analysis. The suitability of identified markers was then evaluated by determining the relationship between quantities of the identified markers with their antioxidant activities biologically, and further confirmed in a variety of samples. In conclusion, the combination of RPCA with UHPLC-UV-Q-Tof MS is a reliable means to identify chemical markers for evaluating quality of herbal medicines. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  14. Vasodilatory effects of ethanol extract of Radix Paeoniae Rubra and its mechanism of action in the rat aorta.

    PubMed

    Jin, Song Nan; Wen, Jin Fu; Wang, Ting Ting; Kang, Dae Gill; Lee, Ho Sub; Cho, Kyung Woo

    2012-06-26

    Radix Paeoniae Rubra (RPR) is an important traditional Chinese medicine (TCM) commonly used in clinic for a long history in China. RPR is the radix of either Paeonia lactiflora Pall. or Paeonia veitchii Lynch. RPR has a wide variety of pharmacological actions such as anti-thrombus, anti-coagulation, and anti-atherosclerotic properties, protecting heart and liver. However, the mechanisms involved are to be defined. The aim of the present study was to define the effect of Paeonia lactiflora Pall. extracts on vascular tension and responsible mechanisms in rat thoracic aortic rings. Ethanol extract of Paeonia lactiflora Pall. (EPL) was examined for their vascular relaxant effects in isolated phenylephrine-precontracted rat thoracic aorta. EPL induced relaxation of the phenylephrine-precontracted aortic rings in a concentration-dependent manner. Vascular relaxation induced by EPL was significantly inhibited by removal of the endothelium or pretreatment of the rings with N(G)-nitro-L-arginine methylester (L-NAME) or 1H-[1,2,4]-oxadiazolo-[4,3-α]-quinoxalin-1-one (ODQ). Extracellular Ca²⁺ depletion or diltiazem significantly attenuated EPL-induced vasorelaxation. Modulators of the store-operated Ca²⁺ entry (SOCE), thapsigargin, 2-aminoethyl diphenylborinate and Gd³⁺, and an inhibitor of Akt, wortmannin, markedly attenuated the EPL-induced vasorelaxation. Further, the EPL-induced vasorelaxation was significantly attenuated by pretreatment with tetraethylammonium, a non-selective K(Ca) channels blocker, or glibenclamide, an ATP-sensitive K⁺ channels inhibitor, respectively. Inhibition of cyclooxygenases with indomethacin, and adrenergic and muscarinic receptors blockade had no effects on the EPL-induced vasorelaxation. The present study suggests that EPL relaxes vascular smooth muscle via endothelium-dependent and Akt- and SOCE-eNOS-cGMP-mediated pathways through activation of both K(Ca) and K(ATP) channels and inhibition of L-type Ca²⁺ channels. Copyright © 2012. Published by Elsevier Ireland Ltd.

  15. Association of traditional Chinese medicine therapy and the risk of dementia in patients with hypertension: a nationwide population-based cohort study.

    PubMed

    Chen, Kuen-Hau; Yeh, Ming-Hsien; Livneh, Hanoch; Chen, Bor-Chyuan; Lin, I-Hsin; Lu, Ming-Chi; Tsai, Tzung-Yi; Yeh, Chia-Chou

    2017-03-29

    Patients with hypertension (HTN) reportedly have a higher risk of developing dementia. However, it remains unclear if use of Traditional Chinese Medicine (TCM), the most common form of complementary and alternative medicine, can help lower the risk of dementia for these patients. So the aim of the study was to investigate the effects of TCM on dementia risk among patients with hypertension. This longitudinal cohort study used the Taiwanese National Health Insurance Research Database (NHIRD) to identify 143,382 newly diagnosed hypertension patients aged 20-90 years who received treatment between 1998 and 2007. Among them, 52,365 (36.52%) had received TCM after the onset of hypertension (TCM users), and the remaining 91,017 patients (63.48%) were designated as a control group (non-TCM users). All enrollees were followed until the end of 2012 to record the incidence of dementia. A Cox proportional hazards regression model was used to compute the hazard ratio (HR) of dementia in patients who received TCM. During the 15-year follow-up, 3933 TCM users and 10,316 non-TCM users developed dementia, representing an incidence rate of 8.41 and 11.55%, respectively, per 1000 person-years. TCM users had a significantly reduced risk of dementia compared to non-TCM users (adjusted HR = 0.76; 95% confidence interval [CI] = 0.74-0.81). The predominant effect was observed among those treated with TCM longer than 180 days (adjusted HR = 0.65; 95% CI = 0.62-0.69). Among the commonly used TCM products, Tian-Ma-Gou-Teng-Yin, Dan-Shen (Radix Salviae Miltiorrhizae), Chuan-Niu-Xi (Radix Cyathulae), Ge-Gen (Radix Puerariae), Jia-Wei-Xiao-Yao-San, and Jue-Ming-Zi (Semen Cassiae) were significantly associated with a lower risk of dementia. Results from this population-based study support the effects of TCM on reducing dementia risk, which may provide a reference for dementia prevention strategies.

  16. [Study on compatibility of Salviae Miltiorrhizae Radix et Rhizoma and Chuanxiong Rhizoma based on pharmacokinetics of effective components salvianolic acid B and ferulic acid in rat plasma].

    PubMed

    Zhang, Cui-ying; Zhang, Hong; Dong, Yu; Ren, Wei-guang; Chen, Heng-wen

    2015-04-01

    A study was made on the pharmacokinetic regularity of effective components salvianolic acid B and ferulic acid in Salviae Miltiorrhizae Radix et Rhizoma (SMRR) and Chuanxiong Rhizoma(CR) in rats, so as to discuss the compatibility mechanism of Salviae Miltiorrhizae Radix et Rhizoma and Chuanxiong Rhizoma. Rats were randomly divided into three groups and intravenously injected with 50 mg x kg(-1) salvianolic acid B for the single SMRR extracts group, 0.5 mg x kg(-1) ferulic acid for the single CR extracts group and 50 mg x kg(-1) salvianolic acid B + 0.5 mg x kg(-1) ferulic acid for the SMRR and CR combination group. The blood samples were collected at different time points and purified by liquid-liquid extraction with ethyl acetate. With chloramphenicol as internal standard (IS), UPLC was adopted to determine concentrations of salvianolic acid B and ferulic acid. The pharmacokinetic parameters of salvianolic acid B and ferulic acid were calculated with WinNonlin 6.2 software and analyzed by SPSS 19.0 statistical software. The UPLC analysis method was adopted to determine salvianolic acid B and ferulic acid in rat plasma, including linear equation, stability, repeatability, precision and recovery. The established sample processing and analysis methods were stable and reliable, with significant differences in major pharmacokinetic parameters, e.g., area under the curve (AUC), mean residence time (MRT) and terminal half-life (t(1/2)). According to the experimental results, the combined application of SMRR and CR can significantly impact the pharmacokinetic process of their effective components in rats and promote the wide distribution, shorten the action time and prolong the in vivo action time of salvianolic acid B and increase the blood drug concentration and accelerate the clearance of ferulic acid in vivo.

  17. Comparison of two extraction methods for the determination of 135 pesticides in Corydalis Rhizoma, Chuanxiong Rhizoma and Angelicae Sinensis Radix by liquid chromatography-triple quadrupole-mass spectrometry. Application to the roots and rhizomes of Chinese herbal medicines.

    PubMed

    Liu, Jie; Tong, Ling; Li, Dongxiang; Meng, Wenting; Sun, Wanyang; Zhao, Yunli; Yu, Zhiguo

    2016-04-01

    In this study, two simple pretreatment methods were comprehensively evaluated for the determination of 135 pesticide residues in roots and rhizomes of Chinese herbal medicines (CHMs). The studied methodologies are (a) solid-phase extraction (SPE) and (b) Quick, Easy, Cheap, Effective, Rugged and Safe (QuEChERS). For SPE, extraction solvents, SPE cartridges and types and volume of eluent were accessed and optimized. For QuEChERS, different versions, acetic acid concentration and dispersive solid-phase extraction (dSPE) sorbent materials were tested. SPE and QuEChERS were estimated in recovery range, the number of pesticides that were recovered ranging from 90% to 110% and expenses in Corydalis Rhizoma, Chuanxiong Rhizoma and Angelicae Sinensis Radix. QuEChERS method showed better performance than SPE. The method showed good linearity over the range assayed 0.9986-0.9999 (1-80ng/mL for 124 pesticides, 1-50ng/mL for 10 pesticides, 1-20ng/mL for satisfar). The matrix effect was compensated by matrix-based calibration curves with internal standard. The average recoveries of all pesticides were ranging from 70% to 120% at three levels of 10, 50 and 100ng/g with relative standard deviations less than 20%. The limits of quantification of the 135 pesticides in three matrices were 1-5ng/g, which were below the maximum residue levels (MRLs) established by the European Union. The verified QuEChERS method was successfully applied to the analysis of 65 actual samples from eight different types of roots and rhizomes of CHMs. Angelicae Sinensis Radix was the most susceptible to pesticides among these samples, and the most frequently detected pesticide was carbendazim with levels below MRLs. Metalaxyl, phorate, atrazine, diniconazole, coumaphos and paclobutrazol were also detected in some samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Lilac and honeysuckle phenology data 1956-2014.

    PubMed

    Rosemartin, Alyssa H; Denny, Ellen G; Weltzin, Jake F; Lee Marsh, R; Wilson, Bruce E; Mehdipoor, Hamed; Zurita-Milla, Raul; Schwartz, Mark D

    2015-01-01

    The dataset is comprised of leafing and flowering data collected across the continental United States from 1956 to 2014 for purple common lilac (Syringa vulgaris), a cloned lilac cultivar (S. x chinensis 'Red Rothomagensis') and two cloned honeysuckle cultivars (Lonicera tatarica 'Arnold Red' and L. korolkowii 'Zabeli'). Applications of this observational dataset range from detecting regional weather patterns to understanding the impacts of global climate change on the onset of spring at the national scale. While minor changes in methods have occurred over time, and some documentation is lacking, outlier analyses identified fewer than 3% of records as unusually early or late. Lilac and honeysuckle phenology data have proven robust in both model development and climatic research.

  19. An annotated checklist of the scale insects of Iran (Hemiptera, Sternorrhyncha, Coccoidea) with new records and distribution data

    PubMed Central

    Moghaddam, Masumeh

    2013-01-01

    Abstract A list of scale insects (Hemiptera: Sternorrhyncha: Coccoidea) of Iran is present based mainly on the literature records since 1902. In total, 13 families and 275 species have been recorded and these are listed along with their locality data and host plants. The families are as follows: Asterolecaniidae, Cerococcidae, Coccidae, Diaspididae, Eriococcidae, Kermesidae, Margarodidae, Monophlebidae, Ortheziidae, Phoenicococcidae, Pseudococcidae, Putoidae and Rhizoecidae. The following ten species are recorded for the first time from Iran: Diaspidiotus lenticularis (Lindinger), Diaspidiotus wuenni (Lindinger), Fiorinia proboscidaria Green, Koroneaspis lonicerae Borchsenius, Eriococcus cingulatus Kiritchenko, Eriococcus pamiricus (Bazarov), Eriococcus reynei Schmutterer, Eriococcus sanguinairensis Goux and Eriococcus saxidesertus (Borchsenius) and Porphyrophora victoriae Jashenko. PMID:24163586

  20. Convenient, sensitive and high-throughput method for screening botanic origin.

    PubMed

    Yuan, Yuan; Jiang, Chao; Liu, Libing; Yu, Shulin; Cui, Zhanhu; Chen, Min; Lin, Shufang; Wang, Shu; Huang, Luqi

    2014-06-23

    In this work, a rapid (within 4-5 h), sensitive and visible new method for assessing botanic origin is developed by combining loop-mediated isothermal amplification with cationic conjugated polymers. The two Chinese medicinal materials (Jin-Yin-Hua and Shan-Yin-Hua) with similar morphology and chemical composition were clearly distinguished by gene SNP genotyping assays. The identification of plant species in Patented Chinese drugs containing Lonicera buds is successfully performed using this detection system. The method is also robust enough to be used in high-throughput screening. This new method is very helpful to identify herbal materials, and is beneficial for detecting safety and quality of botanic products.

  1. Structures and Activity of New Anabaenopeptins Produced by Baltic Sea Cyanobacteria.

    PubMed

    Spoof, Lisa; Błaszczyk, Agata; Meriluoto, Jussi; Cegłowska, Marta; Mazur-Marzec, Hanna

    2015-12-30

    Anabaenopeptins, bioactive cyclic hexapeptides, were isolated by preparative reversed-phase high performance liquid chromatography from an extract of Baltic Sea cyanobacterial bloom material composed of Nodularia spumigena (50%), Aphanizomenon flos-aquae (40%) and Dolichospermum spp. (10%). Five new anabaenopeptins and nine previously known anabaenopeptins were isolated, and their putative structures were determined by tandem mass spectrometry. The activity of the peptides against carboxypeptidase A and protein phosphatase 1 as well as chymotrypsin, trypsin and thrombin was tested. All anabaenopeptins inhibited carboxypeptidase A (apart from one anabaenopeptin variant) and protein phosphatase 1 with varying potency, but no inhibition against chymotrypsin, trypsin and thrombin was observed.

  2. Environmental Assessment of Perimeter Road Maintenance at Buckley Air Force Base, Colorado

    DTIC Science & Technology

    2008-05-01

    species include northern prairie lizard (Sceloporus undulatues garmani), bullsnake (Pituophis catenifer), western hog-nosed snake (Heterodon nasicus...plains garter snake (Thamnophis radix), and prairie rattlesnake (Crotalus viridis) (BAFB 2004a). Threatened, Endangered, and Other Sensitive Species...facilities, and poisoning of black-tailed prairie dogs in critical areas. Burrowing Owl. Burrowing owls are listed as threatened in Colorado but also

  3. JPRS Report, China.

    DTIC Science & Technology

    1989-11-03

    also diligently organize the gathering, processing and purchasing of Chinese medicinal herbs such as licorice root [Radix Geycyrrhizae], rhizome of...wind-weed [Rhizoma Ane- marrhenae], and Chinese caterpillar fungus [Cordyceps chinensis], as well as wild growing cash crops to increase the masses...unchanged for com- modities including grain and edible oil, sugar, coal, matches, soap, and washing powder supplies rationed to city and town residents

  4. Auraptenol attenuates vincristine-induced mechanical hyperalgesia through serotonin 5-HT1A receptors

    PubMed Central

    Wang, Yunfei; Cao, Shu-e; Tian, Jianmin; Liu, Guozhe; Zhang, Xiaoran; Li, Pingfa

    2013-01-01

    Common chemotherapeutic agents such as vincristine often cause neuropathic pain during cancer treatment in patients. Such neuropathic pain is refractory to common analgesics and represents a challenging clinical issue. Angelicae dahuricae radix is an old traditional Chinese medicine with demonstrated analgesic efficacy in humans. However, the active component(s) that attribute to the analgesic action have not been identified. This work described the anti-hyperalgesic effect of one coumarin component, auraptenol, in a mouse model of chemotherapeutic agent vincristine-induced neuropathic pain. We reported that auraptenol dose-dependently reverted the mechanical hyperalgesia in mice within the dose range of 0.05–0.8 mg/kg. In addition, the anti-hyperalgesic effect of auraptenol was significantly blocked by a selective serotonin 5-HT1A receptor antagonist WAY100635 (1 mg/kg). Within the dose range studied, auraptenol did not significantly alter the general locomotor activity in mice. Taken together, this study for the first time identified an active component from the herbal medicine angelicae dahuricae radix that possesses robust analgesic efficacy in mice. These data support further studies to assess the potential of auraptenol as a novel analgesic for the management of neuropathic pain. PMID:24287473

  5. Potential of Pseudoshikonin I Isolated from Lithospermi Radix as Inhibitors of MMPs in IL-1β-Induced SW1353 Cells.

    PubMed

    Lee, Dae Young; Choi, Soo-Im; Han, Se Hee; Lee, Ye-Joo; Choi, Jong-Gil; Lee, Young-Seob; Choi, Je Hun; Lee, Seung-Eun; Kim, Geum-Soog

    2016-08-18

    Pseudoshikonin I, the new bioactive constituent of Lithospermi radix, was isolated from this methanol extract by employing reverse-phase medium-pressure liquid chromatography (MPLC) using acetonitrile/water solvent system as eluents. The chemical structure was determined based on spectroscopic techniques, including 1D NMR (¹H, (13)C, DEPT), 2D NMR (gCOSY, gHMBC, gHMQC), and QTOF/MS data. In this study, we demonstrated the effect of pseudoshikonin I on matrix-metalloproteinase (MMPs) activation and expression in interleukin (IL)-1β-induced SW1353 chondrosarcoma cells. MMPs are considered important for the maintenance of the extracellular matrix. Following treatment with PS, active MMP-1, -2, -3, -9, -13 and TIMP-2 were quantified in the SW1353 cell culture supernatants using a commercially available ELISA kit. The mRNA expression of MMPs in SW1353 cells was measured by RT-PCR. Pseudoshikonin I treatment effectively protected the activation on all tested MMPs in a dose-dependent manner. TIMP-2 mRNA expression was significantly upregulated by pseudoshikonin I treatment. Overall, we elucidated the inhibitory effect of pseudoshikonin on MMPs, and we suggest its use as a potential novel anti-osteoarthritis agent.

  6. Pueraria thunbergiana inhibits cisplatin-induced damage of HEI-OC1 auditory cells through scavenging free radicals.

    PubMed

    Yu, Hyeon-Hee; Jung, Su-Young; Shin, Mee-Kyung; Park, Raekil; So, Hong-Seob; You, Yong-Ouk

    2010-06-01

    The radix of Pueraria thunbergiana (P. thunbergiana) is traditionally prescribed to attenuate the clinical manifestation of inner ear dysfunction and various clinical situations including fevers, gastrointestinal disorders, skin problems, migraine headaches, lowering cholesterol, and treating chronic alcoholism in oriental medicine. In the present study, we examined the protective effect of ethanol extract of the radix of P. thunbergiana (RPT) on cisplatin-induced damage of HEI-OC1 auditory hair cells. When the cells were cultured in the medium containing 5-100 microg/mL of RPT, RPT showed protective effect against the cisplatin-induced HEI-OC1 cell damage. We also measured the effects of RPT on lipid peroxidation of cisplatin-treated cells as well as scavenging activities against superoxide radical, hydroxyl radical, hydrogen peroxide, and DPPH radical. RPT reduced cisplatin-induced lipid peroxidation in a dose-dependent manner. Furthermore, RPT showed strong scavenging activity against superoxide radical, hydroxyl radical, hydrogen peroxide, and DPPH radical. These results indicate that RPT protects cisplatin-induced HEI-OC1 cell damage through inhibition of lipid peroxidation and scavenging activities of free radials. (c) 2009 John Wiley & Sons, Ltd.

  7. Polysaccharide enhances Radix Saposhnikoviae efficacy through inhibiting chromones decomposition in intestinal tract.

    PubMed

    Yang, Jing-Ming; Jiang, Hua; Dai, Hong-Liang; Wang, Zi-Wei; Jia, Gui-Zhi; Meng, Xiang-Cai

    2016-09-06

    Vegetative but not reproductive stage of Saposhnikovia divaricate (Turxz.) schischk possesses pharmacological activities. However, our recent study showed that reproductive S. divaricate supplemented with polysaccharide showed evidently elevated pharmacological activities and increased cimifugin content in rat serum. The aims of present study were to assess the influence of polysaccharides on the chromones pharmacological activities in Radix Saposhnikoviae (RS), the dried root of vegetative stage of S. divaricate, and to explore the underlying mechanisms. Only cimifugin was detected in the plasma of chromone treated animals and RS polysaccharide significantly increased the plasma content of cimifugin. It was shown that neither cimifugin absorption nor glycoside components transformation in simulated digestive fluid was affected by RS polysaccharide. However, a significant promotion of transformation of cimifugin to more stable prime-O-glucosylcimifugin (PGCN) by RS polysaccharide, and a protective effect of polysaccharide on chromone components were observed in small intestine solutions. Meanwhile, RS polysaccharide produced a significant elevation of cimifugin and PGCN concentration in vivo. Based on these findings, we concluded that RS polysaccharide could greatly increase the content of cimifugin, which might be related to its degradation-proof effect on cimifugin, via transforming cimifugin to comparatively more stable PGCN and spatial structure protection.

  8. Scutellaria radix Extract as a Natural UV Protectant for Human Skin.

    PubMed

    Seok, Jin Kyung; Kwak, Jun Yup; Choi, Go Woon; An, Sang Mi; Kwak, Jae-Hoon; Seo, Hyeong-Ho; Suh, Hwa-Jin; Boo, Yong Chool

    2016-03-01

    Ultraviolet (UV) radiation induces oxidative injury and inflammation in human skin. Scutellaria radix (SR, the root of Scutellaria baicalensis Georgi) contains flavonoids with high UV absorptivity and antioxidant properties. The purpose of this study was to examine the potential use of SR extract as an additive in cosmetic products for UV protection. SR extract and its butanol (BuOH) fraction strongly absorbed UV radiation and displayed free radical scavenging activity against 2,2-diphenyl-1-picrylhydrazyl radials and 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) radicals. They also attenuated the UV-induced death of HaCaT cells. Sunscreen creams, with or without supplementation of SR extract BuOH fraction, were tested in vivo in human trials to evaluate potential skin irritation and determine the sun protection factor (SPF). Both sunscreen creams induced no skin irritation. A sunscreen cream containing 24% ZnO showed an SPF value of 17.8, and it increased to 22.7 when supplemented with 5% SR extract BuOH fraction. This study suggests that SR-derived materials are useful as safe cosmetic additives that provide UV protection. Copyright © 2015 John Wiley & Sons, Ltd.

  9. [Effects of steaming and baking on content of alkaloids in Aconite Lateralis Radix (Fuzi)].

    PubMed

    Yang, Chang-lin; Huang, Zhi-fang; Zhang, Yi-han; Liu, Yu-hong; Liu, Yun-huan; Chen, Yan; Yi, Jin-hai

    2014-12-01

    To study the effect of steaming and baking process on contents of alkaloids in Aconite Lateralis Radix (Fuzi), 13 alkaloids were analyzed by UPLC-MS/MS equipped with ESI ion source in MRM mode. In steaming process, the contents of diester-diterpenoid alkaloids decreased rapidly, the contents of monoester-diterpenoid alkaloids firstly increased, reached the peak at 40 min, and then deceased gradually. The contents of aconine alkaloids (mesaconine, aconine and hypaconine) increased all the time during processing, while the contents of fuziline, songorine, karacoline, salsolionl were stable or slightly decreased. In baking process, dynamic variations of alkaloids were different from that in the steaming process. Diester-diterpenoid alkaloids were degraded slightly slower than in steaming process. Monoester-diterpenoid alkaloids, aconine alkaloids and the total alkaloids had been destroyed at different degrees, their contents were significantly lower than the ones in steaming Fuzi at the same processing time. This experiment revealed the dynamic variations of alkaloids in the course of steaming and baking. Two processing methods which can both effectively remove the toxic ingredients and retain the active ingredients are simple and controllable, and are valuable for popularization and application.

  10. Screening anti-allergic components of Astragali Radix using LAD2 cell membrane chromatography coupled online with UHPLC-ESI-MS/MS method.

    PubMed

    Lv, Yanni; Sun, Yueming; Fu, Jia; Kong, Liyun; Han, Shengli

    2017-02-01

    Huangqi (Astragali Radix), a traditional Chinese herb, is widely used in clinical therapy in China. In addition, an anti-allergic effect of constituents in Huangqi has been reported in the scientific literature. In the present study, cell membrane chromatography coupled online with UHPLC-ESI-MS/MS method was developed to screen, analyze and identify the anti-allergic components of Huangqi. The Laboratory of Allergic Disease 2 (LAD2) cell was used to establish cell membrane chromatography, which was combined with UHPLC-ESI-MS/MS. The coupled system was then used to screen anti-allergic components from Huangqi. Effects of active components were verified by histamine release assay. A component retained on the LAD2 cell membrane chromatography was identified as formononetin. Bioactivity of formononetin was investigated by histamine release assay in LAD2 cells, and it was found that formononetin could inhibit histamine release in a dose-dependent manner from 1 to 100 μm. The LAD2 cell membrane chromatography online with UHPLC-ESI-MS/MS method is an effective technique for screening the anti-allergic components of Huangqi. Copyright © 2016 John Wiley & Sons, Ltd.

  11. [Comparison of two algorithms for development of design space-overlapping method and probability-based method].

    PubMed

    Shao, Jing-Yuan; Qu, Hai-Bin; Gong, Xing-Chu

    2018-05-01

    In this work, two algorithms (overlapping method and the probability-based method) for design space calculation were compared by using the data collected from extraction process of Codonopsis Radix as an example. In the probability-based method, experimental error was simulated to calculate the probability of reaching the standard. The effects of several parameters on the calculated design space were studied, including simulation number, step length, and the acceptable probability threshold. For the extraction process of Codonopsis Radix, 10 000 times of simulation and 0.02 for the calculation step length can lead to a satisfactory design space. In general, the overlapping method is easy to understand, and can be realized by several kinds of commercial software without coding programs, but the reliability of the process evaluation indexes when operating in the design space is not indicated. Probability-based method is complex in calculation, but can provide the reliability to ensure that the process indexes can reach the standard within the acceptable probability threshold. In addition, there is no probability mutation in the edge of design space by probability-based method. Therefore, probability-based method is recommended for design space calculation. Copyright© by the Chinese Pharmaceutical Association.

  12. An optimized high-performance liquid chromatography (HPLC) method for benzoylmesaconine determination in Radix Aconiti Lateralis Preparata (Fuzi, aconite roots) and its products

    PubMed Central

    Xie, Ying; Zhou, Hua; Wong, Yuen Fan; Liu, Zhongqiu; Xu, Hongxi; Jiang, Zhihong; Liu, Liang

    2008-01-01

    Background Benzoylmesaconine (BMA) is the main Aconitum alkaloid in Radix Aconiti Lateralis Preparata (Fuzi, aconite roots) with potent pharmacological activities, such as analgesia and anti-inflammation. The present study developed a simple and reliable method using BMA as a marker compound for the quality control of processed aconite roots and their products. Methods After extraction, a high-performance liquid chromatography (HPLC) determination of BMA was conducted on a RP-C18 column by gradient elution with acetonitrile and aqueous phase, containing 0.1% phosphoric acid adjusted with triethylamine to pH 3.0. Results A distinct peak profile was obtained and separation of BMA was achieved. Method validation showed that the relative standard deviations (RSDs) of the precision of BMA in all intra-day and inter-day assays were less than 1.36%, and that the average recovery rate was 96.95%. Quantitative analysis of BMA showed that the content of BMA varied significantly in processed aconite roots and their products. Conclusion This HPLC method using BMA as a marker compound is applicable to the quality control of processed aconite roots and their products. PMID:18513409

  13. Clinical efficacy of aconitum-containing traditional Chinese medicine for diabetic peripheral neuropathic pain.

    PubMed

    Feng, Ling; Liu, Wen-Ke; Deng, Lan; Tian, Jia-Xing; Tong, Xiao-Lin

    2014-01-01

    Diabetic peripheral neuropathy is a common chronic complication of diabetes. Routine clinical management uses analgesics to relieve pain in combination with drugs for nerve repair. The drugs are often not effective for the severe pain cases, and these western medications also have side effects. We report a more effective treatment of diabetic peripheral neuropathic pain using a high dose of a traditional Chinese medicine, aconitum (including both Radix aconite preparata and Radix aconite kusnezoffii), in combination with Huangqi Guizhi Wuwu Tang (i.e., astragalus, cassia twig, white peony root, and spatholobi). In order to achieve stronger analgesic effects, we increased the clinical dosage of aconitum from 15 to 120 g. The aconitum was boiled for 6-8 hours, and licorice was also used to reduce potential toxicities of aconitum. In the four reported cases, the patients' neuropathic pain was remarkably reduced and the EMG profile was also improved with this treatment regimen. Adverse reactions were not observed during the therapy. Thus, aconitum represents a promising and safe treatment for the well-being of patients and their diabetic peripheral neuropathic pain. Future controlled clinical trials using traditional Chinese medicines containing aconitum in treating the neuropathic pain are warranted.

  14. Rapid determination of yunaconitine and related alkaloids in aconites and aconite-containing drugs by ultra high-performance liquid chromatography-tandem mass spectrometry.

    PubMed

    Song, Long; Zhang, Hong; Liu, Xin; Zhao, Zhi-Li; Chen, Shi-Lin; Wang, Zheng-Tao; Xu, Hong-Xi

    2012-12-01

    Yunaconitine (YAC) is a toxic aconite alkaloid that is considered to be a hidden aconite poison since it is frequently found in body fluids from aconite poisoning patients, but has not been well studied in commonly used herbal drugs. In this paper, a rapid and sensitive ultra high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) detection combined with microwave-assisted extraction (MAE) was developed for high throughput simultaneous determination of YAC and six other toxic aconite alkaloids in 31 samples of crude, processed aconites and aconite-containing drugs. The optimized method showed excellent linearity, precision, accuracy and recovery for all target compounds with short run time. YAC was detected in some samples with contents from 0.015 to 10.41 mg/g. This is the first report on the determination of YAC in Radix Aconiti, Radix Aconiti Kusnezoffii and aconite-containing drugs. This newly developed method facilitates the rapid screening of YAC and related toxic aconite alkaloids and allows YAC to be used as a chemical marker for the quality control of aconites and aconite-containing drugs. Copyright © 2012 John Wiley & Sons, Ltd.

  15. Morphological and molecular characterization of lymnaeid snails and their potential role in transmission of Fasciola spp. in Vietnam.

    PubMed

    Dung, Bui Thi; Doanh, Pham Ngoc; The, Dang Tat; Loan, Ho Thi; Losson, Bertrand; Caron, Yannick

    2013-12-01

    Freshwater snails of the family Lymnaeidae play an important role in the transmission of fascioliasis worldwide. In Vietnam, 2 common lymnaeid species, Lymnaea swinhoei and Lymnaea viridis, can be recognized on the basis of morphology, and a third species, Lymnaea sp., is known to exist. Recent studies have raised controversy about their role in transmission of Fasciola spp. because of confusion in identification of the snail hosts. The aim of this study is, therefore, to clarify the identities of lymnaeid snails in Vietnam by a combination of morphological and molecular approaches. The molecular analyses using the second internal transcribed spacer (ITS2) of the nuclear ribosomal DNA clearly showed that lymnaeids in Vietnam include 3 species, Austropeplea viridis (morphologically identified as L. viridis), Radix auricularia (morphologically identified as L. swinhoei) and Radix rubiginosa (morphologically identified as Lymnaea sp.). R. rubiginosa is a new record for Vietnam. Among them, only A. viridis was found to be infected with Fasciola spp. These results provide a new insight into lymnaeid snails in Vietnam. Identification of lymnaeid snails in Vietnam and their role in the liver fluke transmission should be further investigated.

  16. Morphological and Molecular Characterization of Lymnaeid Snails and Their Potential Role in Transmission of Fasciola spp. in Vietnam

    PubMed Central

    Doanh, Pham Ngoc; The, Dang Tat; Loan, Ho Thi; Losson, Bertrand; Caron, Yannick

    2013-01-01

    Freshwater snails of the family Lymnaeidae play an important role in the transmission of fascioliasis worldwide. In Vietnam, 2 common lymnaeid species, Lymnaea swinhoei and Lymnaea viridis, can be recognized on the basis of morphology, and a third species, Lymnaea sp., is known to exist. Recent studies have raised controversy about their role in transmission of Fasciola spp. because of confusion in identification of the snail hosts. The aim of this study is, therefore, to clarify the identities of lymnaeid snails in Vietnam by a combination of morphological and molecular approaches. The molecular analyses using the second internal transcribed spacer (ITS2) of the nuclear ribosomal DNA clearly showed that lymnaeids in Vietnam include 3 species, Austropeplea viridis (morphologically identified as L. viridis), Radix auricularia (morphologically identified as L. swinhoei) and Radix rubiginosa (morphologically identified as Lymnaea sp.). R. rubiginosa is a new record for Vietnam. Among them, only A. viridis was found to be infected with Fasciola spp. These results provide a new insight into lymnaeid snails in Vietnam. Identification of lymnaeid snails in Vietnam and their role in the liver fluke transmission should be further investigated. PMID:24516270

  17. Assessment of metal contamination in the Hun River, China, and evaluation of the fish Zacco platypus and the snail Radix swinhoei as potential biomonitors.

    PubMed

    Wu, Xing; Wang, Shaofeng; Chen, Hongxing; Jiang, Zhiqiang; Chen, Hongwei; Gao, Mi; Bi, Ran; Klerks, Paul L; Wang, He; Luo, Yongju; Xie, Lingtian

    2017-03-01

    The Hun River is a major tributary of the Liao River in the northeast area of China and provides drinking water for 23 million local residents. This study was designed to assess the severity of metal contamination in the Hun River and the potential use of indigenous organisms (the fish Zacco platypus and the snail Radix swinhoei) as biomonitors of metal contamination. Water, sediment, and the native fish and snails were collected at four sampling sites that differed in their physicochemical characteristics and their contamination levels. The samples were analyzed for Cd, Cr, Cu, Ni, Pb, and Zn by ICP-MS. The results showed that although the overall potential ecological risks of the metals were low at our sampling sites, Cd posed a noteworthy ecological risk. Strong correlations were obtained between Cd concentrations in the organisms and in the environment. The results indicated that Z. platypus and R. swinhoei can be useful biomonitoring species for assessing Cd contamination. Biomonitoring with the snail may be most effective when focused on the gonad/digestive tissue (because of the high metal accumulation there), but further work is needed to confirm this.

  18. Conversion of salvianolic acid B into salvianolic acid A in tissues of Radix Salviae Miltiorrhizae using high temperature, high pressure and high humidity.

    PubMed

    Xia, Hongrui; Sun, Longru; Lou, Hongxiang; Rahman, M Mukhlesur

    2014-05-15

    Salvianolic acid A (Sal A), an important constituent of Radix Salviae Miltiorrhizae (RSM), is effective for the treatment of myocardial infarction (MI) and coronary heart disease due to its potential in the improvement of acute myocardial ischemia. However, its content is very low in RSM. So it is obvious to find a rich source of Sal A or to improve its content by conversion of other related components into Sal A modifying reaction conditions. In this research we focused on the conversion of Sal B into Sal A in aqueous solutions of RSM by using different reaction conditions including pH, temperature, pressure and humidity. During the reactions, the contents of Sal A, Sal B and danshensu in the RSM were analyzed by high-performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (LCMS). The results indicated that the conversion of Sal B into Sal A in RSM tissues under the conditions of a high temperature, high pressure and high humidity was efficient and thereby, was readily utilized to prepare rich Sal A materials in practice. Copyright © 2014 Elsevier GmbH. All rights reserved.

  19. Profiling of the Major Phenolic Compounds and Their Biosynthesis Genes in Sophora flavescens Aiton.

    PubMed

    Lee, Jeongyeo; Jung, Jaeeun; Son, Seung-Hyun; Kim, Hyun-Bi; Noh, Young-Hee; Min, Sung Ran; Park, Kun-Hyang; Kim, Dae-Soo; Park, Sang Un; Lee, Haeng-Soon; Kim, Cha Young; Kim, Hyun-Soon; Lee, Hyeong-Kyu; Kim, HyeRan

    2018-01-01

    Sophorae Radix ( Sophora flavescens Aiton) has long been used in traditional medicine in East Asia due to the various biological activities of its secondary metabolites. Endogenous contents of phenolic compounds (phenolic acid, flavonol, and isoflavone) and the main bioactive compounds of Sophorae Radix were analyzed based on the qualitative HPLC analysis and evaluated in different organs and at different developmental stages. In total, 11 compounds were detected, and the composition of the roots and aerial parts (leaves, stems, and flowers) was significantly different. trans-Cinnamic acid and p -coumaric acid were observed only in the aerial parts. Large amounts of rutin and maackiain were detected in the roots. Four phenolic acid compounds (benzoic acid, caffeic acid, ferulic acid, and chlorogenic acid) and four flavonol compounds (kaempferol, catechin hydrate, epicatechin, and rutin) were higher in aerial parts than in roots. To identify putative genes involved in phenolic compounds biosynthesis, a total of 41 transcripts were investigated. Expression patterns of these selected genes, as well as the multiple isoforms for the genes, varied by organ and developmental stage, implying that they are involved in the biosynthesis of various phenolic compounds both spatially and temporally.

  20. Application of Scutellariae radix, Gardeniae fructus, and Probiotics to Prevent Salmonella enterica Serovar Choleraesuis Infection in Swine

    PubMed Central

    Chang, Chiung-Hung; Chen, Yueh-Sheng; Chiou, Ming-Tang; Su, Chiu-Hsian; Chen, Daniel S.; Tsai, Chin-En; Yu, Bi; Hsu, Yuan-Man

    2013-01-01

    Salmonella enterica serovar Choleraesuis, a host-adapted pathogen of swine, usually causes septicemia. Lactic acid bacteria (LAB) strains have been widely studied in recent years for their probiotic properties. In this study, a mouse infection model first screened for potential agents against infection, then a pig infection model evaluated effects of LAB strains and herbal plants against infection. Scutellariae radix (SR) and Gardeniae fructus (GF) showed abilities to reduce bacteria shedding and suppressing serum level of TNF-α induced by infection in swine. Bioactivities of SR and GF were enhanced by combining with LAB strains, which alone could speed up the bacteria elimination time in feces and boost immunity of infected pigs. Baicalein and genipin exhibited stronger cytotoxicity than baicalin and geniposide did, as well as prevent Salmonella from invading macrophages. Our study suggests LAB strains as exhibiting multiple functions: preventing infection, enhancing immunity to prepare host defenses against further infection, and adjusting intestinal microbes' enzymatic activity in order to convert herbal compounds to active compounds. The SR/GF-LAB strain mixture holds potential infection-prevention agents supplied as feed additives. PMID:23533497

Top