Lentiviral Vectors and Protocols for Creation of Stable hESC Lines for Fluorescent Tracking and Drug Resistance Selection of Cardiomyocytes

PubMed Central

Kita-Matsuo, Hiroko; Barcova, Maria; Prigozhina, Natalie; Salomonis, Nathan; Wei, Karen; Jacot, Jeffrey G.; Nelson, Brandon; Spiering, Sean; Haverslag, René; Kim, Changsung; Talantova, Maria; Bajpai, Ruchi; Calzolari, Diego; Terskikh, Alexey; McCulloch, Andrew D.; Price, Jeffrey H.; Conklin, Bruce R.; Chen, H. S. Vincent; Mercola, Mark

2009-01-01

Background Developmental, physiological and tissue engineering studies critical to the development of successful myocardial regeneration therapies require new ways to effectively visualize and isolate large numbers of fluorescently labeled, functional cardiomyocytes. Methodology/Principal Findings Here we describe methods for the clonal expansion of engineered hESCs and make available a suite of lentiviral vectors for that combine Blasticidin, Neomycin and Puromycin resistance based drug selection of pure populations of stem cells and cardiomyocytes with ubiquitous or lineage-specific promoters that direct expression of fluorescent proteins to visualize and track cardiomyocytes and their progenitors. The phospho-glycerate kinase (PGK) promoter was used to ubiquitously direct expression of histone-2B fused eGFP and mCherry proteins to the nucleus to monitor DNA content and enable tracking of cell migration and lineage. Vectors with T/Brachyury and α-myosin heavy chain (αMHC) promoters targeted fluorescent or drug-resistance proteins to early mesoderm and cardiomyocytes. The drug selection protocol yielded 96% pure cardiomyocytes that could be cultured for over 4 months. Puromycin-selected cardiomyocytes exhibited a gene expression profile similar to that of adult human cardiomyocytes and generated force and action potentials consistent with normal fetal cardiomyocytes, documenting these parameters in hESC-derived cardiomyocytes and validating that the selected cells retained normal differentiation and function. Conclusion/Significance The protocols, vectors and gene expression data comprise tools to enhance cardiomyocyte production for large-scale applications. PMID:19352491

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE PAGES

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...

2018-02-01

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

Expression of pH-sensitive green fluorescent protein in Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Moseyko, N.; Feldman, L. J.

2001-01-01

This is the first report on using green fluorescent protein (GFP) as a pH reporter in plants. Proton fluxes and pH regulation play important roles in plant cellular activity and therefore, it would be extremely helpful to have a plant gene reporter system for rapid, non-invasive visualization of intracellular pH changes. In order to develop such a system, we constructed three vectors for transient and stable transformation of plant cells with a pH-sensitive derivative of green fluorescent protein. Using these vectors, transgenic Arabidopsis thaliana and tobacco plants were produced. Here the application of pH-sensitive GFP technology in plants is described and, for the first time, the visualization of pH gradients between different developmental compartments in intact whole-root tissues of A. thaliana is reported. The utility of pH-sensitive GFP in revealing rapid, environmentally induced changes in cytoplasmic pH in roots is also demonstrated.

Spatiotemporal image correlation spectroscopy (STICS) theory, verification, and application to protein velocity mapping in living CHO cells.

PubMed

Hebert, Benedict; Costantino, Santiago; Wiseman, Paul W

2005-05-01

We introduce a new extension of image correlation spectroscopy (ICS) and image cross-correlation spectroscopy (ICCS) that relies on complete analysis of both the temporal and spatial correlation lags for intensity fluctuations from a laser-scanning microscopy image series. This new approach allows measurement of both diffusion coefficients and velocity vectors (magnitude and direction) for fluorescently labeled membrane proteins in living cells through monitoring of the time evolution of the full space-time correlation function. By using filtering in Fourier space to remove frequencies associated with immobile components, we are able to measure the protein transport even in the presence of a large fraction (>90%) of immobile species. We present the background theory, computer simulations, and analysis of measurements on fluorescent microspheres to demonstrate proof of principle, capabilities, and limitations of the method. We demonstrate mapping of flow vectors for mixed samples containing fluorescent microspheres with different emission wavelengths using space time image cross-correlation. We also present results from two-photon laser-scanning microscopy studies of alpha-actinin/enhanced green fluorescent protein fusion constructs at the basal membrane of living CHO cells. Using space-time image correlation spectroscopy (STICS), we are able to measure protein fluxes with magnitudes of mum/min from retracting lamellar regions and protrusions for adherent cells. We also demonstrate the measurement of correlated directed flows (magnitudes of mum/min) and diffusion of interacting alpha5 integrin/enhanced cyan fluorescent protein and alpha-actinin/enhanced yellow fluorescent protein within living CHO cells. The STICS method permits us to generate complete transport maps of proteins within subregions of the basal membrane even if the protein concentration is too high to perform single particle tracking measurements.

In Vitro Transcripts of Wild-Type and Fluorescent Protein-Tagged Triticum mosaic virus (Family Potyviridae) are Biologically Active in Wheat.

PubMed

Tatineni, Satyanarayana; McMechan, Anthony J; Bartels, Melissa; Hein, Gary L; Graybosch, Robert A

2015-11-01

Triticum mosaic virus (TriMV) (genus Poacevirus, family Potyviridae) is a recently described eriophyid mite-transmitted wheat virus. In vitro RNA transcripts generated from full-length cDNA clones of TriMV proved infectious on wheat. Wheat seedlings inoculated with in vitro transcripts elicited mosaic and mottling symptoms similar to the wild-type virus, and the progeny virus was efficiently transmitted by wheat curl mites, indicating that the cloned virus retained pathogenicity, movement, and wheat curl mite transmission characteristics. A series of TriMV-based expression vectors was constructed by engineering a green fluorescent protein (GFP) or red fluorescent protein (RFP) open reading frame with homologous NIa-Pro cleavage peptides between the P1 and HC-Pro cistrons. We found that GFP-tagged TriMV with seven or nine amino acid cleavage peptides efficiently processed GFP from HC-Pro. TriMV-GFP vectors were stable in wheat for more than 120 days and for six serial passages at 14-day intervals by mechanical inoculation and were transmitted by wheat curl mites similarly to the wild-type virus. Fluorescent protein-tagged TriMV was observed in wheat leaves, stems, and crowns. The availability of fluorescent protein-tagged TriMV will facilitate the examination of virus movement and distribution in cereal hosts and the mechanisms of cross protection and synergistic interactions between TriMV and Wheat streak mosaic virus.

Construction of fusion vectors of corynebacteria: expression of glutathione-S-transferase fusion protein in Corynebacterium acetoacidophilum ATCC 21476.

PubMed

Srivastava, Preeti; Deb, J K

2002-07-02

A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.

Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies

PubMed Central

Richie, Christopher T.; Whitaker, Leslie R.; Whitaker, Keith W.; Necarsulmer, Julie; Baldwin, Heather A.; Zhang, Yajun; Fortuno, Lowella; Hinkle, Josh J.; Koivula, Pyry; Henderson, Mark J.; Sun, Wenzhi; Wang, Kai; Smith, Jeffrey C.; Pickel, Jim; Ji, Na; Hope, Bruce T.; Harvey, Brandon K.

2017-01-01

Background The use of genetically-encoded fluorescent reporters is essential for the identification and observation of cells that express transgenic modulatory proteins. Near-infrared (NIR) fluorescent proteins have superior light penetration through biological tissue, but are not yet widely adopted. New Method Using the near-infrared fluorescent protein, iRFP713, improves the imaging resolution in thick tissue sections or the intact brain due to the reduced light-scattering at the longer, NIR wavelengths used to image the protein. Additionally, iRFP713 can be used to identify transgenic cells without photobleaching other fluorescent reporters or affecting opsin function. We have generated a set of adeno-associated vectors in which iRFP713 has been fused to optogenetic channels, and can be expressed constitutively or Cre-dependently. Results iRFP713 is detectable when expressed in neurons both in vitro and in vivo without exogenously supplied chromophore biliverdin. Neuronally-expressed iRFP713 has similar properties to GFP-like fluorescent proteins, including the ability to be translationally fused to channelrhodopsin or halorhodopsin, however, it shows superior photostability compared to EYFP. Furthermore, electrophysiological recordings from iRFP713-labeled cells compared to cells labeled with mCherry suggest that iRFP713 cells are healthier and therefore more stable and reliable in an ex vivo preparation. Lastly, we have generated a transgenic rat that expresses iRFP713 in a Cre-dependent manner. Conclusions Overall, we have demonstrated that iRFP713 can be used as a reporter in neurons without the use of exogenous biliverdin, with minimal impact on viability and function thereby making it feasible to extend the capabilities for imaging genetically-tagged neurons in slices and in vivo. PMID:28380331

A tetracycline inducible expression vector for Corynebacterium glutamicum allowing tightly regulable gene expression.

PubMed

Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland

2012-09-01

Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.

Insulated piggyBac vectors for insect transgenesis

PubMed Central

Sarkar, Abhimanyu; Atapattu, Asela; Belikoff, Esther J; Heinrich, Jörg C; Li, Xuelei; Horn, Carsten; Wimmer, Ernst A; Scott, Maxwell J

2006-01-01

Background Germ-line transformation of insects is now a widely used method for analyzing gene function and for the development of genetically modified strains suitable for pest control programs. The most widely used transposable element for the germ-line transformation of insects is piggyBac. The site of integration of the transgene can influence gene expression due to the effects of nearby transcription enhancers or silent heterochromatic regions. Position effects can be minimized by flanking a transgene with insulator elements. The scs/scs' and gypsy insulators from Drosophila melanogaster as well as the chicken β-globin HS4 insulator function in both Drosophila and mammalian cells. Results To minimize position effects we have created a set of piggyBac transformation vectors that contain either the scs/scs', gypsy or chicken β-globin HS4 insulators. The vectors contain either fluorescent protein or eye color marker genes and have been successfully used for germ-line transformation of Drosophila melanogaster. A set of the scs/scs' vectors contains the coral reef fluorescent protein marker genes AmCyan, ZsGreen and DsRed that have not been optimized for translation in human cells. These marker genes are controlled by a combined GMR-3xP3 enhancer/promoter that gives particularly strong expression in the eyes. This is also the first report of the use of the ZsGreen and AmCyan reef fluorescent proteins as transformation markers in insects. Conclusion The insulated piggyBac vectors should protect transgenes against position effects and thus facilitate fine control of gene expression in a wide spectrum of insect species. These vectors may also be used for transgenesis in other invertebrate species. PMID:16776846

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

PubMed

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

Knock-in of Enhanced Green Fluorescent Protein or/and Human Fibroblast Growth Factor 2 Gene into β-Casein Gene Locus in the Porcine Fibroblasts to Produce Therapeutic Protein.

PubMed

Lee, Sang Mi; Kim, Ji Woo; Jeong, Young-Hee; Kim, Se Eun; Kim, Yeong Ji; Moon, Seung Ju; Lee, Ji-Hye; Kim, Keun-Jung; Kim, Min-Kyu; Kang, Man-Jong

2014-11-01

Transgenic animals have become important tools for the production of therapeutic proteins in the domestic animal. Production efficiencies of transgenic animals by conventional methods as microinjection and retrovirus vector methods are low, and the foreign gene expression levels are also low because of their random integration in the host genome. In this study, we investigated the homologous recombination on the porcine β-casein gene locus using a knock-in vector for the β-casein gene locus. We developed the knock-in vector on the porcine β-casein gene locus and isolated knock-in fibroblast for nuclear transfer. The knock-in vector consisted of the neomycin resistance gene (neo) as a positive selectable marker gene, diphtheria toxin-A gene as negative selection marker, and 5' arm and 3' arm from the porcine β-casein gene. The secretion of enhanced green fluorescent protein (EGFP) was more easily detected in the cell culture media than it was by western blot analysis of cell extract of the HC11 mouse mammary epithelial cells transfected with EGFP knock-in vector. These results indicated that a knock-in system using β-casein gene induced high expression of transgene by the gene regulatory sequence of endogenous β-casein gene. These fibroblasts may be used to produce transgenic pigs for the production of therapeutic proteins via the mammary glands.

Knock-in of Enhanced Green Fluorescent Protein or/and Human Fibroblast Growth Factor 2 Gene into β-Casein Gene Locus in the Porcine Fibroblasts to Produce Therapeutic Protein

PubMed Central

Lee, Sang Mi; Kim, Ji Woo; Jeong, Young-Hee; Kim, Se Eun; Kim, Yeong Ji; Moon, Seung Ju; Lee, Ji-Hye; Kim, Keun-Jung; Kim, Min-Kyu; Kang, Man-Jong

2014-01-01

Transgenic animals have become important tools for the production of therapeutic proteins in the domestic animal. Production efficiencies of transgenic animals by conventional methods as microinjection and retrovirus vector methods are low, and the foreign gene expression levels are also low because of their random integration in the host genome. In this study, we investigated the homologous recombination on the porcine β-casein gene locus using a knock-in vector for the β-casein gene locus. We developed the knock-in vector on the porcine β-casein gene locus and isolated knock-in fibroblast for nuclear transfer. The knock-in vector consisted of the neomycin resistance gene (neo) as a positive selectable marker gene, diphtheria toxin-A gene as negative selection marker, and 5′ arm and 3′ arm from the porcine β-casein gene. The secretion of enhanced green fluorescent protein (EGFP) was more easily detected in the cell culture media than it was by western blot analysis of cell extract of the HC11 mouse mammary epithelial cells transfected with EGFP knock-in vector. These results indicated that a knock-in system using β-casein gene induced high expression of transgene by the gene regulatory sequence of endogenous β-casein gene. These fibroblasts may be used to produce transgenic pigs for the production of therapeutic proteins via the mammary glands. PMID:25358326

Vasculature-Specific Adenovirus Vectors for Gene Therapy of Prostate Cancer

DTIC Science & Technology

2007-02-01

reporter gene. To this end, a recombinant replication-deficient retrovirus vector containing an open reading frame of Renilla luciferase (hRLuc...dual-mode reporter gene ( Renilla luciferase and green fluorescent protein) has been designed and produced in a pan- tropic configuration. • Dual

Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming.

PubMed

Schmitt, Christopher E; Morales, Blanca M; Schmitz, Ellen M H; Hawkins, John S; Lizama, Carlos O; Zape, Joan P; Hsiao, Edward C; Zovein, Ann C

2017-06-05

Non-integrating episomal vectors have become an important tool for induced pluripotent stem cell reprogramming. The episomal vectors carrying the "Yamanaka reprogramming factors" (Oct4, Klf, Sox2, and L-Myc + Lin28) are critical tools for non-integrating reprogramming of cells to a pluripotent state. However, the reprogramming process remains highly stochastic, and is hampered by an inability to easily identify clones that carry the episomal vectors. We modified the original set of vectors to express spectrally separable fluorescent proteins to allow for enrichment of transfected cells. The vectors were then tested against the standard original vectors for reprogramming efficiency and for the ability to enrich for stoichiometric ratios of factors. The reengineered vectors allow for cell sorting based on reprogramming factor expression. We show that these vectors can assist in tracking episomal expression in individual cells and can select the reprogramming factor dosage. Together, these modified vectors are a useful tool for understanding the reprogramming process and improving induced pluripotent stem cell isolation efficiency.

Rainbow Vectors for Broad-Range Bacterial Fluorescence Labeling.

PubMed

Barbier, Mariette; Damron, F Heath

2016-01-01

Since their discovery, fluorescent proteins have been widely used to study protein function, localization or interaction, promoter activity and regulation, drug discovery or for non-invasive imaging. They have been extensively modified to improve brightness, stability, and oligomerization state. However, only a few studies have focused on understanding the dynamics of fluorescent proteins expression in bacteria. In this work, we developed a set plasmids encoding 12 fluorescent proteins for bacterial labeling to facilitate the study of pathogen-host interactions. These broad-spectrum plasmids can be used with a wide variety of Gram-negative microorganisms including Escherichia coli, Pseudomonas aeruginosa, Burkholderia cepacia, Bordetella bronchiseptica, Shigella flexneri or Klebsiella pneumoniae. For comparison, fluorescent protein expression and physical characteristics in Escherichia coli were analyzed using fluorescence microscopy, flow cytometry and in vivo imaging. Fluorescent proteins derived from the Aequorea Victoria family showed high photobleaching, while proteins form the Discosoma sp. and the Fungia coccina family were more photostable for microscopy applications. Only E2-Crimson, mCherry and mKeima were successfully detected for in vivo applications. Overall, E2-Crimson was the fastest maturing protein tested in E. coli with the best overall performance in the study parameters. This study provides a unified comparison and comprehensive characterization of fluorescent protein photostability, maturation and toxicity, and offers general recommendations on the optimal fluorescent proteins for in vitro and in vivo applications.

A potyvirus-based gene vector allows producing active human S-COMT and animal GFP, but not human sorcin, in vector-infected plants.

PubMed

Kelloniemi, Jani; Mäkinen, Kristiina; Valkonen, Jari P T

2006-05-01

Potato virus A (PVA), a potyvirus with a (+)ssRNA genome translated to a large polyprotein, was engineered and used as a gene vector for expression of heterologous proteins in plants. Foreign genes including jellyfish GFP (Aequorea victoria) encoding the green fluorescent protein (GFP, 27 kDa) and the genes of human origin (Homo sapiens) encoding a soluble resistance-related calcium-binding protein (sorcin, 22 kDa) and the catechol-O-methyltransferase (S-COMT; 25 kDa) were cloned between the cistrons for the viral replicase and coat protein (CP). The inserts caused no adverse effects on viral infectivity and virulence, and the inserted sequences remained intact in progeny viruses in the systemically infected leaves. The heterologous proteins were released from the viral polyprotein following cleavage by the main viral proteinase, NIa, at engineered proteolytic processing sites flanking the insert. Active GFP, as indicated by green fluorescence, and S-COMT with high levels of enzymatic activity were produced. In contrast, no sorcin was detected despite the expected equimolar amounts of the foreign and viral proteins being expressed as a polyprotein. These data reveal inherent differences between heterologous proteins in their suitability for production in plants.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2008-06-24

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S; Cabantous, Stephanie

2013-02-12

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2011-06-14

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S.; Cabantous, Stephanie

2013-04-16

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Generation of mammalian cells stably expressing multiple genes at predetermined levels.

PubMed

Liu, X; Constantinescu, S N; Sun, Y; Bogan, J S; Hirsch, D; Weinberg, R A; Lodish, H F

2000-04-10

Expression of cloned genes at desired levels in cultured mammalian cells is essential for studying protein function. Controlled levels of expression have been difficult to achieve, especially for cell lines with low transfection efficiency or when expression of multiple genes is required. An internal ribosomal entry site (IRES) has been incorporated into many types of expression vectors to allow simultaneous expression of two genes. However, there has been no systematic quantitative analysis of expression levels in individual cells of genes linked by an IRES, and thus the broad use of these vectors in functional analysis has been limited. We constructed a set of retroviral expression vectors containing an IRES followed by a quantitative selectable marker such as green fluorescent protein (GFP) or truncated cell surface proteins CD2 or CD4. The gene of interest is placed in a multiple cloning site 5' of the IRES sequence under the control of the retroviral long terminal repeat (LTR) promoter. These vectors exploit the approximately 100-fold differences in levels of expression of a retrovirus vector depending on its site of insertion in the host chromosome. We show that the level of expression of the gene downstream of the IRES and the expression level and functional activity of the gene cloned upstream of the IRES are highly correlated in stably infected target cells. This feature makes our vectors extremely useful for the rapid generation of stably transfected cell populations or clonal cell lines expressing specific amounts of a desired protein simply by fluorescent activated cell sorting (FACS) based on the level of expression of the gene downstream of the IRES. We show how these vectors can be used to generate cells expressing high levels of the erythropoietin receptor (EpoR) or a dominant negative Smad3 protein and to generate cells expressing two different cloned proteins, Ski and Smad4. Correlation of a biologic effect with the level of expression of the protein downstream of the IRES provides strong evidence for the function of the protein placed upstream of the IRES.

A stable RNA virus-based vector for citrus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

Over-expression of brain-derived neurotrophic factor in mesenchymal stem cells transfected with recombinant lentivirus BDNF gene.

PubMed

Zhang, X; Zhu, J; Zhang, K; Liu, T; Zhang, Z

2016-12-30

This study was aimed at investigating the expression of brain-derived neurotrophic factor (BDNF) in mesenchymal stem cells (MSCs) modified with recombinant lentivirus bearing BDNF gene. Lentivirus vectors bearing BDNF gene were constructed. MSCs were isolated from rats and cultured. The lentiviral vectors containing BDNF gene were transfected into the MSCs, and BDNF gene and protein expressions were monitored with enhanced green fluorescent protein (EGFP). RT-PCR and Western blot were used to measure gene and protein expressions, respectibvely in MSCs, MSCs-EGFP and MSCs-EGFP-BDNF groups. Green fluorescence assay confirmed successful transfection of BDNF gene recombinant lentivirus into MSCs. RT-PCR and Western blot revealed that BDNF gene and protein expressions in the MSCs-EGFP-BDNF group were significantly higher than that in MSCs group and MSCs-EGFP group. There were no statistically significant differences in gene expression between MSCs and MSCs-EGFP groups. MSCs can over-express BDNF when transfected with recombinant lentivirus bearing BDNF gene.

A Simple Method to Increase the Transduction Efficiency of Single-Stranded Adeno-Associated Virus Vectors In Vitro and In Vivo

PubMed Central

Ma, Wenqin; Li, Baozheng; Ling, Chen; Jayandharan, Giridhara R.; Byrne, Barry J.

2011-01-01

Abstract We have recently shown that co-administration of conventional single-stranded adeno-associated virus 2 (ssAAV2) vectors with self-complementary (sc) AAV2-protein phosphatase 5 (PP5) vectors leads to a significant increase in the transduction efficiency of ssAAV2 vectors in human cells in vitro as well as in murine hepatocytes in vivo. In the present study, this strategy has been further optimized by generating a mixed population of ssAAV2-EGFP and scAAV2-PP5 vectors at a 10:1 ratio to achieve enhanced green fluorescent protein (EGFP) transgene expression at approximately 5- to 10-fold higher efficiency, both in vitro and in vivo. This simple coproduction method should be adaptable to any ssAAV serotype vector containing transgene cassettes that are too large to be encapsidated in scAAV vectors. PMID:21219084

The establishment of Saccharomyces boulardii surface display system using a single expression vector.

PubMed

Wang, Tiantian; Sun, Hui; Zhang, Jie; Liu, Qing; Wang, Longjiang; Chen, Peipei; Wang, Fangkun; Li, Hongmei; Xiao, Yihong; Zhao, Xiaomin

2014-03-01

In the present study, an a-agglutinin-based Saccharomyces boulardii surface display system was successfully established using a single expression vector. Based on the two protein co-expression vector pSP-G1 built by Partow et al., a S. boulardii surface display vector-pSDSb containing all the display elements was constructed. The display results of heterologous proteins were confirmed by successfully displaying enhanced green fluorescent protein (EGFP) and chicken Eimeria tenella Microneme-2 proteins (EtMic2) on the S. boulardii cell surface. The DNA sequence of AGA1 gene from S. boulardii (SbAGA1) was determined and used as the cell wall anchor partner. This is the first time heterologous proteins have been displayed on the cell surface of S. boulardii. Because S. boulardii is probiotic and eukaryotic, its surface display system would be very valuable, particularly in the development of a live vaccine against various pathogenic organisms especially eukaryotic pathogens such as protistan parasites. Copyright © 2013 Elsevier Inc. All rights reserved.

Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.

PubMed

Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko

2014-05-01

Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Methods for engineering polypeptide variants via somatic hypermutation and polypeptide made thereby

DOEpatents

Tsien, Roger Y; Wang, Lei

2015-01-13

Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

P and M gene junction is the optimal insertion site in Newcastle disease virus vaccine vector for foreign gene expression

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...

The construction and use of versatile binary vectors carrying pyrG auxotrophic marker and fluorescent reporter genes for Agrobacterium-mediated transformation of Aspergillus oryzae.

PubMed

Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan

2016-12-01

Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.

A Novel System for Simultaneous or Sequential Integration of Multiple Gene-Loading Vectors into a Defined Site of a Human Artificial Chromosome

PubMed Central

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

PubMed

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus

PubMed Central

Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.

PubMed

Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.

Germ-line transformation of the Queensland fruit fly, Bactrocera tryoni, using a piggyBac vector in the presence of endogenous piggyBac elements

USDA-ARS?s Scientific Manuscript database

We report the stable genetic transformation of the Queensland fruit fly Bactrocera tryoni using a piggyBac vector marked with either the fluorescent protein DsRed or EGFP.A transformation frequency of 5–10% was obtained.Inheritance of the transgenes has remained stable over eight generations despite...

Murine Stem Cell-Based Retrovirus Production for Marking Primary Mouse Mammary Cells for Metastasis Studies.

PubMed

Beverly, Levi J; Podsypanina, Katrina

2016-02-01

Since the introduction of retroviral vector technology, permanent genetic marking of cells has considerably contributed to the understanding of different physiological and disease processes in vivo. Recent marking strategies aim to elucidate the contribution of cells on the clonal level, and the advent of fluorescent proteins has opened new avenues for the in vivo analysis of gene-marked cells. Gene-modified cells are easily identifiable (e.g., via the introduced fluorescent protein) within whole organ structures, allowing one to measure the contribution of transduced cells to malignant outgrowth. In our laboratory, we use the tetracycline-inducible system to study oncogene cooperation in metastatic progression. We use bicistronic retroviruses expressing the tetracycline transactivator (tTA) and the candidate gene (MIT-gene) or the tTA alone (MIT-Rx) to infect primary mammary cells from mice harboring tetracycline-inducible transgenes. This allows for constitutive expression of the candidate gene and tTA-dependent expression of the inducible oncogene. We also use MIG-based vectors, which allow for constitutive expression of the candidate gene and a green fluorescent protein. Here we describe how to produce retroviral particles carrying both MIT- and MIG-based vectors. Because of the fragility of the retroviral envelope, we do not attempt to concentrate the virus, and we directly use packaging cell media to infect primary epithelial cells (either normal or tumor). Infected cells can be transplanted into recipient mice to investigate metastatic colonization. © 2016 Cold Spring Harbor Laboratory Press.

Estimation of the size of genetic bottlenecks in cell-to-cell movement of soil-borne wheat mosaic virus and the possible role of the bottlenecks in speeding up selection of variations in trans-acting genes or elements.

PubMed

Miyashita, Shuhei; Kishino, Hirohisa

2010-02-01

Genetic bottlenecks facilitate the fixation and extinction of variants in populations, and viral populations are no exception to this theory. To examine the existence of genetic bottlenecks in cell-to-cell movement of plant RNA viruses, we prepared constructs for Soil-borne wheat mosaic virus RNA2 vectors carrying two different fluorescent proteins, yellow fluorescent protein (YFP) and cyan fluorescent protein (CFP). Coinoculation of host plant leaves with the two RNA2 vectors and the wild-type RNA1 showed separation of the two vector RNA2s, mostly within seven to nine cell-to-cell movements from individual initially coinfected cells. Our statistical analysis showed that the number of viral RNA genomes establishing infection in adjacent cells after the first cell-to-cell movement from an initially infected cell was 5.97 +/- 0.22 on average and 5.02 +/- 0.29 after the second cell-to-cell movement. These results indicate that plant RNA viruses may generally face narrow genetic bottlenecks in every cell-to-cell movement. Furthermore, our model suggests that, rather than suffering from fitness losses caused by the bottlenecks, the plant RNA viruses are utilizing the repeated genetic bottlenecks as an essential element of rapid selection of their adaptive variants in trans-acting genes or elements to respond to host shifting and changes in the growth conditions of the hosts.

Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

PubMed

Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

2001-04-01

Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

The fluorescent photobleaching properties of GFP expressed in human lung cancer cells

NASA Astrophysics Data System (ADS)

Jin, Ying; Xing, Da

2003-12-01

The characteristic properties of GFP make this protein a good candidate for use as a molecular reporter to monitor patterns of protein localization, gene expression, and intracellular protein trafficking in living cells. In this study, the dicistronic expression vector (pEGFP-C1) was used to transfected into human lung cancer cell line (ASTC-a-1) and a positive clone which stably expressed GFP in high level was obtained. After more than three months' passengers, the cells were also remained the strong fluorescence under fluorescent microscope. The results showed that the green fluorescent protein expressed in tumor cells was also photobleached under intense irradiation (approximately 488 nm) and the degree of photobleaching varied with the difference of the intensity of the excitation. Using different interdiction parcel (None, ND4, ND8, ND16), there were significant differences in photobleaching among the different excitation. The photobleaching was also affected by the time length of excitation, and the intensity of fluorescence was obviously decreased along with the increasing of excitation time, especially to stronger excitation.

Transduction of Human Primitive Repopulating Hematopoietic Cells With Lentiviral Vectors Pseudotyped With Various Envelope Proteins

PubMed Central

Kim, Yoon-Sang; Wielgosz, Matthew M; Hargrove, Phillip; Kepes, Steven; Gray, John; Persons, Derek A; Nienhuis, Arthur W

2010-01-01

Lentiviral vectors are useful for transducing primitive hematopoietic cells. We examined four envelope proteins for their ability to mediate lentiviral transduction of mobilized human CD34+ peripheral blood cells. Lentiviral particles encoding green fluorescent protein (GFP) were pseudotyped with the vesicular stomatitis virus envelope glycoprotein (VSV-G), the amphotropic (AMPHO) murine leukemia virus envelope protein, the endogenous feline leukemia viral envelope protein or the feline leukemia virus type C envelope protein. Because the relative amount of genome RNA per ml was similar for each pseudotype, we transduced CD34+ cells with a fixed volume of each vector preparation. Following an overnight transduction, CD34+ cells were transplanted into immunodeficient mice which were sacrificed 12 weeks later. The average percentages of engrafted human CD45+ cells in total bone marrow were comparable to that of the control, mock-transduced group (37–45%). Lenti-particles pseudotyped with the VSV-G envelope protein transduced engrafting cells two- to tenfold better than particles pseudotyped with any of the γ-retroviral envelope proteins. There was no correlation between receptor mRNA levels for the γ-retroviral vectors and transduction efficiency of primitive hematopoietic cells. These results support the use of the VSV-G envelope protein for the development of lentiviral producer cell lines for manufacture of clinical-grade vector. PMID:20372106

Construction of Various γ34.5 Deleted Fluorescent-Expressing Oncolytic herpes Simplex type 1 (oHSV) for Generation and Isolation of HSV-Based Vectors

PubMed

Abdoli, Shahriyar; Roohvand, Farzin; Teimoori-Toolabi, Ladan; Shokrgozar, Mohammad Ali; Bahrololoumi, Mina; Azadmanesh, Kayhan

2017-07-01

Oncolytic herpes simplex virus (oHSV)-based vectors lacking γ34.5 gene, are considered as ideal templates to construct efficient vectors for (targeted) cancer gene therapy. Herein, we reported the construction of three single/dually-flourescence labeled and γ34.5-deleted, recombinant HSV-1 vectors for rapid generation and easy selection/isolation of different HSV-Based vectors. Generation of recombinant viruses was performed with conventional homologous recombination methods using green fluorescent protein (GFP) and BleCherry harboring shuttle vectors. Viruses were isolated by direct fluorescence observation and standard plaque purifying methods and confirmed by PCR and sequencing and flow cytometry. XTT and plaque assay titration were performed on Vero, U87MG, and T98 GBM cell lines. We generated three recombinant viruses, HSV-GFP, HSV-GR (Green-Red), and HSV-Red. The HSV-GFP showed two log higher titer (1010 PFU) than wild type (108 PFU). In contrast, HSV-GR and HSV-Red showed one log lower titer (107 PFU) than parental HSV. Cytotoxicity analysis showed that HSV-GR and HSV-Red can lyse target tumor cells at multiplicity of infection of 10 and 1 (P<0.001). Moreover, HSV-GFP showed higher infection potency (98%) in comparison with HSV-GR (82%). Our oHSVs provide a simple and an efficient platform for construction and rapid isolation of 2nd and 3rd generation oHSVs by replacing the inserted dyes with transgenes and also for rapid identification via fluorescence activated cell sorting. These vectors can also be used for tracing the efficacy of therapeutic agents on target cells, imaging of neural or tumoral cells in vitro/in vivo and as oncolytic agents in cancer therapy.

Use of green fluorescent protein to monitor Lactobacillus plantarum in the gastrointestinal tract of goats.

PubMed

Han, Xufeng; Wang, Lei; Li, Wei; Li, Bibo; Yang, Yuxin; Yan, Hailong; Qu, Lei; Chen, Yulin

2015-01-01

The experiment aimed to specifically monitor the passage of lactobacilli in vivo after oral administration. The green fluorescent protein (GFP) gene was cloned downstream from the constitutive p32 promoter from L. lactis subsp. cremoris Wg2. The recombinant expression vector, pLEM415-gfp-p32, was electroporated into Lactobacillus plantarum (L. plantarum) isolated from goat. Green fluorescent protein (GFP) was successfully expressed in L. plantarum. After 2 h post-administration, transformed Lactobacillus could be detectable in all luminal contents. In the rumen, bacteria concentration initially decreased, reached the minimum at 42 h post-oral administration and then increased. However, this concentration decreased constantly in the duodenum. This result indicated that L. plantarum could colonize in the rumen but not in the duodenum.

Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector.

PubMed

Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo

2016-06-01

Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.

TRV-GFP: a modified Tobacco rattle virus vector for efficient and visualizable analysis of gene function.

PubMed

Tian, Ji; Pei, Haixia; Zhang, Shuai; Chen, Jiwei; Chen, Wen; Yang, Ruoyun; Meng, Yonglu; You, Jie; Gao, Junping; Ma, Nan

2014-01-01

Virus-induced gene silencing (VIGS) is a useful tool for functional characterization of genes in plants. Unfortunately, the efficiency of infection by Tobacco rattle virus (TRV) is relatively low for some non-Solanaceae plants, which are economically important, such as rose (Rosa sp.). Here, to generate an easy traceable TRV vector, a green fluorescent protein (GFP) gene was tagged to the 3' terminus of the coat protein gene in the original TRV2 vector, and the silencing efficiency of the modified TRV-GFP vector was tested in several plants, including Nicotiana benthamiana, Arabidopsis thaliana, rose, strawberry (Fragaria ananassa), and chrysanthemum (Dendranthema grandiflorum). The results showed that the efficiency of infection by TRV-GFP was equal to that of the original TRV vector in each tested plant. Spread of the modified TRV virus was easy to monitor by using fluorescent microscopy and a hand-held UV lamp. When TRV-GFP was used to silence the endogenous phytoene desaturase (PDS) gene in rose cuttings and seedlings, the typical photobleached phenotype was observed in 75-80% plants which were identified as GFP positive by UV lamp. In addition, the abundance of GFP protein, which represented the concentration of TRV virus, was proved to correlate negatively with the level of the PDS gene, suggesting that GFP could be used as an indicator of the degree of silencing of a target gene. Taken together, this work provides a visualizable and efficient tool to predict positive gene silencing plants, which is valuable for research into gene function in plants, especially for non-Solanaceae plants.

TRV–GFP: a modified Tobacco rattle virus vector for efficient and visualizable analysis of gene function

PubMed Central

Tian, Ji; Pei, Haixia; Ma, Nan

2014-01-01

Virus-induced gene silencing (VIGS) is a useful tool for functional characterization of genes in plants. Unfortunately, the efficiency of infection by Tobacco rattle virus (TRV) is relatively low for some non-Solanaceae plants, which are economically important, such as rose (Rosa sp.). Here, to generate an easy traceable TRV vector, a green fluorescent protein (GFP) gene was tagged to the 3’ terminus of the coat protein gene in the original TRV2 vector, and the silencing efficiency of the modified TRV–GFP vector was tested in several plants, including Nicotiana benthamiana, Arabidopsis thaliana, rose, strawberry (Fragaria ananassa), and chrysanthemum (Dendranthema grandiflorum). The results showed that the efficiency of infection by TRV–GFP was equal to that of the original TRV vector in each tested plant. Spread of the modified TRV virus was easy to monitor by using fluorescent microscopy and a hand-held UV lamp. When TRV–GFP was used to silence the endogenous phytoene desaturase (PDS) gene in rose cuttings and seedlings, the typical photobleached phenotype was observed in 75–80% plants which were identified as GFP positive by UV lamp. In addition, the abundance of GFP protein, which represented the concentration of TRV virus, was proved to correlate negatively with the level of the PDS gene, suggesting that GFP could be used as an indicator of the degree of silencing of a target gene. Taken together, this work provides a visualizable and efficient tool to predict positive gene silencing plants, which is valuable for research into gene function in plants, especially for non-Solanaceae plants. PMID:24218330

In vivo Clonal Tracking of Hematopoietic Stem and Progenitor Cells Marked by Five Fluorescent Proteins using Confocal and Multiphoton Microscopy

PubMed Central

Malide, Daniela; Métais, Jean-Yves; Dunbar, Cynthia E.

2014-01-01

We developed and validated a fluorescent marking methodology for clonal tracking of hematopoietic stem and progenitor cells (HSPCs) with high spatial and temporal resolution to study in vivo hematopoiesis using the murine bone marrow transplant experimental model. Genetic combinatorial marking using lentiviral vectors encoding fluorescent proteins (FPs) enabled cell fate mapping through advanced microscopy imaging. Vectors encoding five different FPs: Cerulean, EGFP, Venus, tdTomato, and mCherry were used to concurrently transduce HSPCs, creating a diverse palette of color marked cells. Imaging using confocal/two-photon hybrid microscopy enables simultaneous high resolution assessment of uniquely marked cells and their progeny in conjunction with structural components of the tissues. Volumetric analyses over large areas reveal that spectrally coded HSPC-derived cells can be detected non-invasively in various intact tissues, including the bone marrow (BM), for extensive periods of time following transplantation. Live studies combining video-rate multiphoton and confocal time-lapse imaging in 4D demonstrate the possibility of dynamic cellular and clonal tracking in a quantitative manner. PMID:25145579

Quantification of AAV particle titers by infrared fluorescence scanning of coomassie-stained sodium dodecyl sulfate-polyacrylamide gels.

PubMed

Kohlbrenner, Erik; Henckaerts, Els; Rapti, Kleopatra; Gordon, Ronald E; Linden, R Michael; Hajjar, Roger J; Weber, Thomas

2012-06-01

Adeno-associated virus (AAV)-based vectors have gained increasing attention as gene delivery vehicles in basic and preclinical studies as well as in human gene therapy trials. Especially for the latter two-for both safety and therapeutic efficacy reasons-a detailed characterization of all relevant parameters of the vector preparation is essential. Two important parameters that are routinely used to analyze recombinant AAV vectors are (1) the titer of viral particles containing a (recombinant) viral genome and (2) the purity of the vector preparation, most commonly assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by silver staining. An important, third parameter, the titer of total viral particles, that is, the combined titer of both genome-containing and empty viral capsids, is rarely determined. Here, we describe a simple and inexpensive method that allows the simultaneous assessment of both vector purity and the determination of the total viral particle titer. This method, which was validated by comparison with established methods to determine viral particle titers, is based on the fact that Coomassie Brilliant Blue, when bound to proteins, fluoresces in the infrared spectrum. Viral samples are separated by SDS-PAGE followed by Coomassie Brilliant Blue staining and gel analysis with an infrared laser-scanning device. In combination with a protein standard, our method allows the rapid and accurate determination of viral particle titers simultaneously with the assessment of vector purity.

Display of adenoregulin with a novel Pichia pastoris cell surface display system.

PubMed

Ren, Ren; Jiang, Zhengbing; Liu, Meiyun; Tao, Xinyi; Ma, Yushu; Wei, Dongzhi

2007-02-01

Two Pichia pastoris cell surface display vectors were constructed. The vectors consisted of the flocculation functional domain of Flo1p with its own secretion signal sequence or the alpha-factor secretion signal sequence, a polyhistidine (6xHis) tag for detection, an enterokinase recognition site, and the insertion sites for target proteins. Adenoregulin (ADR) is a 33-amino-acid antimicrobial peptide isolated from Phyllomedusa bicolor skin. The ADR was expressed and displayed on the Pichia pastoris KM71 cell surface with the system reported. The displayed recombinant ADR fusion protein was detected by fluorescence microscopy and confocal laser scanning microscopy (CLSM). The antimicrobial activity of the recombinant adenoregulin was detected after proteolytic cleavage of the fusion protein on cell surface. The validity of the Pichia pastoris cell surface display vectors was proved by the displayed ADR.

Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

PubMed

Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

2010-01-01

In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

A Split-GFP Gateway Cloning System for Topology Analyses of Membrane Proteins in Plants.

PubMed

Xie, Wenjun; Nielsen, Mads Eggert; Pedersen, Carsten; Thordal-Christensen, Hans

2017-01-01

To understand the function of membrane proteins, it is imperative to know their topology. For such studies, a split green fluorescent protein (GFP) method is useful. GFP is barrel-shaped, consisting of 11 β-sheets. When the first ten β-sheets (GFP1-10) and the 11th β-sheet (GFP11) are expressed from separate genes they will self-assembly and reconstitute a fluorescent GFP protein. However, this will only occur when the two domains co-localize in the same cellular compartment. We have developed an easy-to-use Gateway vector set for determining on which side of the membrane the N- and C-termini are located. Two vectors were designed for making N- and C-terminal fusions between the membrane proteins-of-interest and GFP11, while another three plasmids were designed to express GFP1-10 in either the cytosol, the endoplasmic reticulum (ER) lumen or the apoplast. We tested functionality of the system by applying the vector set for the transmembrane domain, CNXTM, of the ER membrane protein, calnexin, after transient expression in Nicotiana benthamiana leaves. We observed GFP signal from the ER when we reciprocally co-expressed GFP11-CNXTM with GFP1-10-HDEL and CNXTM-GFP with cytosolic GFP1-10. The opposite combinations did not result in GFP signal emission. This test using the calnexin ER-membrane domain demonstrated its C-terminus to be in the cytosol and its N-terminus in the ER lumen. This result confirmed the known topology of calnexin, and we therefore consider this split-GFP system highly useful for ER membrane topology studies. Furthermore, the vector set provided is useful for detecting the topology of proteins on other membranes in the cell, which we confirmed for a plasma membrane syntaxin. The set of five Ti-plasmids are easily and efficiently used for Gateway cloning and transient transformation of N. benthamiana leaves.

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Production of chimeric recombinant single domain antibody-green fluorescent fusion protein in Chinese hamster ovary cells.

PubMed

Bazl, M Rajabi; Rasaee, M J; Foruzandeh, M; Rahimpour, A; Kiani, J; Rahbarizadeh, F; Alirezapour, B; Mohammadi, M

2007-02-01

There is an increasing interest in the application of nanobodies such as VHH in the field of therapy and imaging. In the present study a stable genetically engineered cell line of Chinese hamster ovary (CHO) origin transfected using two sets of expression vectors was constructed in order to permit the cytoplasmic and extracellular expression of single domain antibody along with green fluorescent protein (GFP) as reporter gene. The quality of the constructs were examined both by the restriction map as well as sequence analysis. The gene transfection and protein expression was further examined by reverse transcription-polymerase chain reaction (RT-PCR). The transfected cells were grown in 200 microg/mL hygromycin containing media and the stable cell line obtained showed fluorescent activity for more than a period of 180 days. The production of fusion protein was also detected by fluorescent microscopy, fluorescent spectroscopy as well as by enzyme-linked immunosorbent assay (ELISA) analysis. This strategy allows a rapid production of recombinant fluobodies involving VHH, which can be used in various experiments such as imaging and detection in which a primary labeled antibody is required.

Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

PubMed

Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

2016-05-01

On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

Core labeling of adenovirus with EGFP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le, Long P.; Le, Helen N.; Nelson, Amy R.

2006-08-01

The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expressionmore » vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology.« less

A herpes simplex viral vector expressing green fluorescent protein can be used to visualize morphological changes in high-density neuronal culture

PubMed Central

Falk, Torsten; Strazdas, Lori A.; Borders, Rebecca S.; Kilani, Ramsey K.; Yool, Andrea J.

2010-01-01

High-density cultures of mammalian neurons offer a model system for studies of brain development, but the morphological features of individual neurons is difficult to ascertain. We show that a herpes virus vector expressing a bioluminescent protein allows detailed morphometric analyses of living neurons in complex culture environments. Expression of enhanced green fluorescent protein (eGFP) was constitutively driven in neurons using the herpes simplex virus amplicon system. This system allowed us to make novel observations regarding development in high-density cultures from rat hippocampus and cerebellum. After the phase of initial neurite outgrowth, maturing neurons continue to show rapid remodeling of the neurite branches (0.79 ± 0.11 μm/h per neurite; mean ± SEM, n=8), and displacement of the soma within the neurite arbor (1.35 ± 0.74 μm/h). These results demonstrate that a substantial capacity for morphological plasticity persists in maturing mammalian CNS neurons after cessation of net neurite outgrowth in early development. PMID:20811504

Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle

PubMed Central

Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

2013-01-01

Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×1010 –1 × 1011 particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 109 AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike. PMID:23591809

High-accuracy biodistribution analysis of adeno-associated virus variants by double barcode sequencing.

PubMed

Marsic, Damien; Méndez-Gómez, Héctor R; Zolotukhin, Sergei

2015-01-01

Biodistribution analysis is a key step in the evaluation of adeno-associated virus (AAV) capsid variants, whether natural isolates or produced by rational design or directed evolution. Indeed, when screening candidate vectors, accurate knowledge about which tissues are infected and how efficiently is essential. We describe the design, validation, and application of a new vector, pTR-UF50-BC, encoding a bioluminescent protein, a fluorescent protein and a DNA barcode, which can be used to visualize localization of transduction at the organism, organ, tissue, or cellular levels. In addition, by linking capsid variants to different barcoded versions of the vector and amplifying the barcode region from various tissue samples using barcoded primers, biodistribution of viral genomes can be analyzed with high accuracy and efficiency.

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

PubMed

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

PubMed Central

Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

2008-01-01

Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

A gene delivery system with a human artificial chromosome vector based on migration of mesenchymal stem cells towards human glioblastoma HTB14 cells.

PubMed

Kinoshita, Yusuke; Kamitani, Hideki; Mamun, Mahabub Hasan; Wasita, Brian; Kazuki, Yasuhiro; Hiratsuka, Masaharu; Oshimura, Mitsuo; Watanabe, Takashi

2010-05-01

Mesenchymal stem cells (MSCs) have been expected to become useful gene delivery vehicles against human malignant gliomas when coupled with an appropriate vector system, because they migrate towards the lesion. Human artificial chromosomes (HACs) are non-integrating vectors with several advantages for gene therapy, namely, no limitations on the size and number of genes that can be inserted. We investigated the migration of human immortalized MSCs bearing a HAC vector containing the herpes simplex virus thymidine kinase gene (HAC-tk-hiMSCs) towards malignant gliomas in vivo. Red fluorescence protein-labeled human glioblastoma HTB14 cells were implanted into a subcortical region in nude mice. Four days later, green fluorescence protein-labeled HAC-tk-hiMSCs were injected into a contralateral subcortical region (the HTB14/HAC-tk-hiMSC injection model). Tropism to the glioma mass and the route of migration were visualized by fluorescence microscopy and immunohistochemical staining. HAC-tk-hiMSCs began to migrate toward the HTB14 glioma area via the corpus callosum on day 4, and gathered around the HTB14 glioma mass on day 7. To test whether the delivered gene could effectively treat glioblastoma in vivo, HTB14/HAC-tk-hiMSC injected mice were treated with ganciclovir (GCV) or PBS. The HTB14 glioma mass was significantly reduced by GCV treatment in mice injected with HAC-tk-hiMSCs. It was confirmed that gene delivery by our HAC-hiMSC system was effective after migration of MSCs to the glioma mass in vivo. Therefore, MSCs containing HACs carrying an anticancer gene or genes may provide a new tool for the treatment of malignant gliomas and possibly of other tumor types.

A novel expression system for intracellular production and purification of recombinant affinity-tagged proteins in Aspergillus niger.

PubMed

Roth, Andreas H F J; Dersch, Petra

2010-03-01

A set of different integrative expression vectors for the intracellular production of recombinant proteins with or without affinity tag in Aspergillus niger was developed. Target genes can be expressed under the control of the highly efficient, constitutive pkiA promoter or the novel sucrose-inducible promoter of the beta-fructofuranosidase (sucA) gene of A. niger in the presence or absence of alternative carbon sources. All expression plasmids contain an identical multiple cloning sequence that allows parallel construction of N- or C-terminally His6- and StrepII-tagged versions of the target proteins. Production of two heterologous model proteins, the green fluorescence protein and the Thermobifida fusca hydrolase, proved the functionality of the vector system. Efficient production and easy detection of the target proteins as well as their fast purification by a one-step affinity chromatography, using the His6- or StrepII-tag sequence, was demonstrated.

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

Non-viral vectors based on magnetoplexes, lipoplexes and polyplexes for VEGF gene delivery into central nervous system cells.

PubMed

Villate-Beitia, Ilia; Puras, Gustavo; Soto-Sánchez, Cristina; Agirre, Mireia; Ojeda, Edilberto; Zarate, Jon; Fernández, Eduardo; Pedraz, José Luis

2017-04-15

Nanotechnology based non-viral vectors hold great promise to deliver therapeutic genes into the central nervous system (CNS) in a safe and controlled way. Vascular endothelial growth factor (VEGF) is a potential therapeutic gene candidate for CNS disorders due to its specific roles in brain angiogenesis and neuroprotection. In this work, we elaborated three different non-viral vectors based on magnetic, cationic lipid and polymeric nanoparticles complexed to the phVEGF165aIRESGFP plasmid, which codifies the VEGF protein -extracellular- and the green fluorescent protein (GFP) -intracellular-. Nanoparticles and corresponding nanoplexes -magnetoplexes, lipoplexes and polyplexes- were characterized in terms of size, zeta potential, polydispersity index, morphology and ability to bind, release and protect DNA. Transfection efficiencies of nanoplexes were measured in terms of percentage of GFP expressing cells, mean fluorescent intensity (MFI) and VEGF (ng/ml) production in HEK293, C6 and primary neuronal culture cells. Magnetoplexes showed the highest transfection efficiencies in C6, followed by lipoplexes, and in primary neuronal culture cells, followed by polyplexes. Lipoplexes were the most efficient in HEK293 cells, followed by magnetoplexes. The biological activity of VEGF was confirmed by its proliferative effect in HUVEC cells. Overall, these results provide new insights for VEGF gene delivery into CNS cells using non-viral vectors. Copyright © 2017. Published by Elsevier B.V.

Transformation with green fluorescent protein of Trichoderma harzianum 1051, a strain with biocontrol activity against Crinipellis perniciosa, the agent of witches'-broom disease of cocoa.

PubMed

Inglis, Peter W.; Queiroz, Paulo R.; Valadares-Inglis, M. Cléria

1999-04-01

A plasmid vector for fungal expression of an enhanced, red-shifted variant of the Aequoria victoriae green fluorescent protein was constructed by fusion of the EGFP gene to the highly expressed Aspergillus nidulans gpd promoter and the A. nidulans trpC terminator. This construction was introduced by cotransformation, using benomyl selection, into Trichoderma harzianum strain 1051, a strain being evaluated for the biological control of witches'-broom disease of cocoa caused by Crinipellis perniciosa. Epifluorescence microscopy was used to monitor germination and attachment of stable transformant conidia on the surface of C. perniciosa hyphae.

A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila.

PubMed

Wang, Ji-Wu; Beck, Erin S; McCabe, Brian D

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues.

MLF1-interacting protein is mainly localized in nucleolus through N-terminal bipartite nuclear localization signal.

PubMed

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Saito, Shinobu; Takeda, Nobuakira; Yamada, Hisashi; Horiguchi-Yamada, Junko

2007-01-01

The myelodysplasia/myeloid leukemia factor 1-interacting protein (MLF1LP, also called KLIP1 and CENP-50) is reported to localize in both the nucleus and the cytoplasm. To investigate the functions of MLF1IP, its subnuclear localization was studied. MLF1IP was tagged with green fluorescent protein (EGFP). Fibrillarin was tagged with red fluorescent protein (DsRed). EGFP-tagged MLF1IP deletion vectors were also constructed. Plasmid-constructs were transfected into human cervical adenocarcinoma HeLa cells or monkey kidney fibroblast COS-7 cells, and the localization was studied by either confocal fluorescence microscopy or fluorescence microscopy. Ectopically expressed MLF1IP was localized mainly in the nucleolus. In some cells, small dot-like particles of MLF1IP fluorescence were observed in the nucleoplasm. Co-staining of fibrillarin disclosed that MLF1IP was co-localized with fibrillarin in the nucleolus. Deletion mutants of MLF1IP revealed that the N-terminal bipartite nuclear localization signal (NLS) was responsible for nucleolar targeting. MLF1IP was localized mainly in the nucleolus through the N-terminal bipartite NLS and partly in the nucleoplasm featuring small dot-like particles. These findings suggest that MLF1IP may have multi-functions and its different localizations may contribute to carcinogenesis.

Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

PubMed

Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

2018-05-24

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

Deletion mapping of the Aequorea victoria green fluorescent protein.

PubMed

Dopf, J; Horiagon, T M

1996-01-01

Aequorea victoria green fluorescent protein (GFP) is a promising fluorescent marker which is active in a diverse array of prokaryotic and eukaryotic organisms. A key feature underlying the versatility of GFP is its capacity to undergo heterocyclic chromophore formation by cyclization of a tripeptide present in its primary sequence and thereby acquiring fluorescent activity in a variety of intracellular environments. In order to define further the primary structure requirements for chromophore formation and fluorescence in GFP, a series of N- and C-terminal GFP deletion variant expression vectors were created using the polymerase chain reaction. Scanning spectrofluorometric analyses of crude soluble protein extracts derived from eleven GFP expression constructs revealed that amino acid (aa) residues 2-232, of a total of 238 aa in the native protein, were required for the characteristic emission and absorption spectra of native GFP. Heterocyclic chromophore formation was assayed by comparing the absorption spectrum of GFP deletion variants over the 300-500-nm range to the absorption spectra of full-length GFP and GFP deletion variants missing the chromophore substrate domain from the primary sequence. GFP deletion variants lacking fluorescent activity showed no evidence of heterocyclic ring structure formation when the soluble extracts of their bacterial expression hosts were studied at pH 7.9. These observations suggest that the primary structure requirements for the fluorescent activity of GFP are relatively extensive and are compatible with the view that much of the primary structure serves an autocatalytic function.

[Establishment and identification of mouse lymphoma cell line EL4 expressing red fluorescent protein].

PubMed

Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin

2010-02-01

This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.

Identification of a functional nuclear export signal in the green fluorescent protein asFP499

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mustafa, Huseyin; Strasser, Bernd; Rauth, Sabine

2006-04-21

The green fluorescent protein (GFP) asFP499 from Anemonia sulcata is a distant homologue of the GFP from Aequorea victoria. We cloned the asFP499 gene into a mammalian expression vector and showed that this protein was expressed in the human lymphoblast cell line Ramos RA1 and in the embryonic kidney 293T cell line (HEK 293T). In HEK 293T cells, asFP499 was localized mainly in the cytoplasm, suggesting that the protein was excluded from the nucleus. We identified {sub 194}LRMEKLNI{sub 201} as a candidate nuclear export signal in asFP499 and mutated the isoleucine at position 201 to an alanine. Unlike the wildtypemore » form, the mutant protein was distributed throughout the cytoplasm and nucleus. This is First report of a GFP that contains a functional NES.« less

Real-time detecting gelatinases activity in living cells by FRET imaging

NASA Astrophysics Data System (ADS)

Yang, Jie; Zhang, Zhihong; Liu, Bifeng; Luo, Qingming

2006-01-01

Degradation of the extracellular matrix by Matrix metalloproteinases (MMPs) not only enhances tumor invasion, but also affects tumor cell behaviour and leads to cancer progression. To monitor gelatinases (contain MMP2 and MMP9) activity in living cells, we constructed a vector that encoded a gelatinases recognition site (GRS) between citrine (mutation of EYFP Q69M) in N terminal and ECFP in C terminal. Because Gelatinases are secretory proteins and act outside of cell, an expressing vector displayed the fusion protein on cellular surface was used for this FRET gene probe. On expression of YFP-GRS-ECFP in MCF-7 cells that expressed no gelatinases, we were able to observe the efficient transfer of energy from excited ECFP to YFP within the YFP-GRS-ECFP molecule. However, the fusion protein YFP-GRS-ECFP was expressed in MDA-MB 453s cell line with high secretory gelatinases, so YFP-GRS-ECFP was cleaved by gelatinases, no such transfer of energy was detected and fluorescence signal disappeared in YFP channel since YFP protein was cut down. Moreover, Doxycycline, a MMP inhibitor, could make FRET signal increase and fluorescence signal appeared in YFP channel. Thus, the FRET probe YFP-GRS-ECFP can sensitively and reliably monitor gelatinases activation in living cells and can be used for screening MMP inhibitors.

Antitumor HPV E7-specific CTL activity elicited by in vivo engineered exosomes produced through DNA inoculation.

PubMed

Di Bonito, Paola; Chiozzini, Chiara; Arenaccio, Claudia; Anticoli, Simona; Manfredi, Francesco; Olivetta, Eleonora; Ferrantelli, Flavia; Falcone, Emiliana; Ruggieri, Anna; Federico, Maurizio

2017-01-01

We recently proved that exosomes engineered in vitro to deliver high amounts of HPV E7 upon fusion with the Nef mut exosome-anchoring protein elicit an efficient anti-E7 cytotoxic T lymphocyte immune response. However, in view of a potential clinic application of this finding, our exosome-based immunization strategy was faced with possible technical difficulties including industrial manufacturing, cost of production, and storage. To overcome these hurdles, we designed an as yet unproven exosome-based immunization strategy relying on delivery by intramuscular inoculation of a DNA vector expressing Nef mut fused with HPV E7. In this way, we predicted that the expression of the Nef mut /E7 vector in muscle cells would result in a continuous source of endogenous (ie, produced by the inoculated host) engineered exosomes able to induce an E7-specific immune response. To assess this hypothesis, we first demonstrated that the injection of a Nef mut /green fluorescent protein-expressing vector led to the release of fluorescent exosomes, as detected in plasma of inoculated mice. Then, we observed that mice inoculated intramuscularly with a vector expressing Nef mut /E7 developed a CD8 + T-cell immune response against both Nef and E7. Conversely, no CD8 + T-cell responses were detected upon injection of vectors expressing either the wild-type Nef isoform of E7 alone, most likely a consequence of their inefficient exosome incorporation. The production of immunogenic exosomes in the DNA-injected mice was formally demonstrated by the E7-specific CD8 + T-cell immune response we detected in mice inoculated with exosomes isolated from plasma of mice inoculated with the Nef mut /E7 vector. Finally, we provide evidence that the injection of Nef mut /E7 DNA led to the generation of effective antigen-specific cytotoxic T lymphocytes whose activity was likely part of the potent, therapeutic antitumor effect we observed in mice implanted with TC-1 tumor cells. In summary, we established a novel method to generate immunogenic exosomes in vivo by the intramuscular inoculation of DNA vectors expressing the exosome-anchoring protein Nef mut and its derivatives.

Cellular Transfection to Deliver Alanine-Glyoxylate Aminotransferase to Hepatocytes: A Rational Gene Therapy for Primary Hyperoxaluria-1 (PH-1)

PubMed Central

Koul, Sweaty; Johnson, Thomas; Pramanik, Saroj; Koul, Hari

2005-01-01

Background: Primary hyperoxaluria-type 1 (PH-1) is a rare autosomal recessive disorder of glyoxalate metabolism caused by deficiency in the liver-specific peroxisomal enzyme alanine-glyoxalate transaminase 1 (AGT) resulting in the increased oxidation of glyoxalate to oxalate. Accumulation of oxalate in the kidney and other soft tissues results in loss of renal function and significant morbidity. The present treatment options offer some relief in the short term, but they are not completely successful. In the present study, we tested the feasibility of corrective gene therapy for this metabolic disorder. Methods: A cDNA library was made from HepG2 cells. PCR primers were designed for the AGT sequence with modifications to preclude mistargeting during gene delivery. Amplified AGT cDNA was cloned as a fusion protein with green fluorescent protein (GFP) using the vector EGFP-C1 (Clontech) for monitoring subcellular distribution. Sequence and expression of the fusion protein was verified. Fusion protein vectors were transfected into hepatocytes by liposomal transfection. AGT expression and subcellular distribution was monitored by GFP fluorescence. Results: HepG2 cells express full-length mRNA coding for AGT as confirmed by insert size as well as sequence determination. Selective primers allowed us to generate a modified recombinant GFP-AGT fusion protein. Cellular transfections with Lipofectamine resulted in transfection efficiencies of 60–90%. The recombinant AGT did localize to peroxisomes as monitored by GFP fluorescence. Conclusions: The results demonstrate preliminary in vitro feasibility data for AGT transfection into the hepatocytes. To the best of our knowledge, this is the first study to attempt recombinant AGT gene therapy for treatment of primary hyperoxaluria-1. PMID:15849465

[Experimental study on human periodontal ligament cells transfected with human amelogenin gene].

PubMed

Yu, Guang; Shu, Rong; Sun, Ying; Cheng, Lan; Song, Zhong-Chen; Zhang, Xiu-Li

2008-02-01

To construct the recombinant lentiviral vector of human amelogenin gene, infect human periodontal ligament cells with the recombinant lentivirus, and evaluate the feasibility of applying modified PDLCs as seeds for a further periodontal reconstruction. The mature peptide of hAm cDNA was cloned and linked into the vector plasmid, the recombinant plasmid FUAmW was confirmed by double enzyme digestion and sequence analysis. Recombinant lentivirus was prepared from 293T cells by polytheylenimine (PEI)-mediated transient cotransfection. The hPDLCs and 293T cells were infected with the generated lentivirus. The infection efficiency was analysed by detection of green fluorescence protein (GFP) with fluorescent microscope and flow cytometer 72 hours later. The expression of hAm gene was detected by reverse transcription polymerase chain reaction (RT-PCR). The sequence of inserted fragment in recombinant plasmid was identical to the hAm sequence reported in Genebank. Green fluorescence was visible under fluorescent microscope, FCM assay showed that positive percentage was 69.46% and 33.99% in 293T and hPDLCs, respectively. The targeted gene was obtained in the experimental groups by RT-PCR. The recombinan lentiviral vector of hAm gene is constructed successfully and it could be transfected into cultured hPDLCs. hAm gene and seed cells may be used for further study in the fields periodontal tissue engineering. Supported by National Natural Science Foundation of China (Grant No. 30672315).

Measurement of Instantaneous Velocity Vectors of Organelle Transport: Mitochondrial Transport and Bioenergetics in Hippocampal Neurons

PubMed Central

Gerencser, Akos A.; Nicholls, David G.

2008-01-01

Impaired transport of mitochondria, in dendrites and axons of neurons, and bioenergetic deficit are increasingly recognized to be of pathological importance in neurodegenerative diseases. To study the relationship between transport and bioenergetics, we have developed what to our knowledge is a novel technique to quantify organelle velocity in cultured cells. The aim was to combine measurement of motion and bioenergetic parameters while minimizing photodynamic oxidative artifacts evoked by fluorescence excitation. Velocity determination from sequential fluorescence images is not trivial, and here we describe an application of “optical flow”, the flow of gray values in grayscale images, to this problem. Based on the principles of photon shot noise occurring in low light level fluorescence microscopy, we describe and validate here an optical flow-based, robust method to measure velocity vectors for organelles expressing fluorescent proteins. This method features instantaneous velocity determination from a pair of images by detecting motion of edges, with no assumptions about the separation or shapes of the objects in the image. Optical flow was used in combination with single mitochondrion assay of mitochondrial thiol redox status by mitochondrially targeted redox-sensitive green fluorescent protein and measurement of mitochondrial membrane potential by tetramethylrhodamine methyl ester. Mitochondrial populations of resting cultured hippocampal neurons were analyzed. It was found that mitochondria with more oxidized thiol redox status have lower membrane potentials and are smaller in size. These mitochondria are more motile than the average; however, mitochondrial motility is only slightly dependent on the observed bioenergetic parameters and is correlated the best to the size of the mitochondria. PMID:18757564

An agmatine-inducible system for the expression of recombinant proteins in Enterococcus faecalis.

PubMed

Linares, Daniel M; Perez, Marta; Ladero, Victor; Del Rio, Beatriz; Redruello, Begoña; Martin, M Cruz; Fernandez, María; Alvarez, Miguel A

2014-12-04

Scientific interest in Enterococcus faecalis has increased greatly over recent decades. Some strains are involved in food fermentation and offer health benefits, whereas others are vancomycin-resistant and cause infections that are difficult to treat. The limited availability of vectors able to express cloned genes efficiently in E. faecalis has hindered biotechnological studies on the bacterium's regulatory and pathogenicity-related genes. The agmatine deiminase (AGDI) pathway of E. faecalis, involved in the conversion of agmatine into putrescine, is driven by a response inducer gene aguR. This study describes that the exposure to the induction factor (agmatine) results in the transcription of genes under the control of the aguB promoter, including the aguBDAC operon. A novel E. faecalis expression vector, named pAGEnt, combining the aguR inducer gene and the aguB promoter followed by a cloning site and a stop codon was constructed. pAGEnt was designed for the overexpression and purification of a protein fused to a 10-amino-acid His-tag at the C-terminus. The use of GFP as a reporter of gene expression in E. faecalis revealed that under induction with 60 mM agmatine, fluorescence reached 40 arbitrary units compared to 0 in uninduced cells. pAGEnt vector can be used for the overexpression of recombinant proteins under the induction of agmatine in E. faecalis, with a close correlation between agmatine concentration and fluorescence when GFP was used as reporter.

Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle.

PubMed

Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

2013-04-16

Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×10(10) -1 × 10(11) particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 10(9) AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike.Molecular Therapy - Nucleic Acids (2013) 2, e86; doi:10.1038/mtna.2013.16; published online 16 April 2013.

[The role of the serotonin system in the stress response of various cells

NASA Technical Reports Server (NTRS)

Belzhelarskaia, S. N.; Satton, F. F.; Sutton, F. (Principal Investigator)

2003-01-01

The recombinant mouse brain serotonin receptor (5HT1c) was used to study the response of plant cells and oocytes to a stress signal activated by the serotonin-serotonin receptor interaction and associated Ca2+ flow. Based on plant expression vectors, recombinant constructs were obtained to direct production of 5HT1c fused with the green fluorescent protein in plant cells. The mRNAs for hybrid proteins were synthesized in an in vitro transcription system. The expression and function of the hybrid protein and the function of the associated ion channels were electrophysiologically studied in Xenopus laevis oocytes injected with the hybrid mRNA. The hybrid protein was functional and changed the operation of the Ca2+ channel in oocytes. To study the expression of the hybrid constructs in plant cells, the in vitro transcription product was inoculated in tobacco leaves, which then fluoresced.

A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea

PubMed Central

Ford, Kathryn L.; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M.; Foster, Gary D.

2016-01-01

Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen. PMID:27384974

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

PubMed

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila

PubMed Central

Wang, Ji-Wu; Beck, Erin S.; McCabe, Brian D.

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues. PMID:22848718

Myocardial gene delivery using molecular cardiac surgery with recombinant adeno-associated virus vectors in vivo

PubMed Central

White, JD; Thesier, DM; Swain, JBD; Katz, MG; Tomasulo, C; Henderson, A; Wang, L; Yarnall, C; Fargnoli, A; Sumaroka, M; Isidro, A; Petrov, M; Holt, D; Nolen-Walston, R; Koch, WJ; Stedman, HH; Rabinowitz, J; Bridges, CR

2013-01-01

We use a novel technique that allows for closed recirculation of vector genomes in the cardiac circulation using cardiopulmonary bypass, referred to here as molecular cardiac surgery with recirculating delivery (MCARD). We demonstrate that this platform technology is highly efficient in isolating the heart from the systemic circulation in vivo. Using MCARD, we compare the relative efficacy of single-stranded (ss) adeno-associated virus (AAV)6, ssAAV9 and self-complimentary (sc)AAV6-encoding enhanced green fluorescent protein, driven by the constitutive cytomegalovirus promoter to transduce the ovine myocardium in situ. MCARD allows for the unprecedented delivery of up to 48 green fluorescent protein genome copies per cell globally in the sheep left ventricular (LV) myocardium. We demonstrate that scAAV6-mediated MCARD delivery results in global, cardiac-specific LV gene expression in the ovine heart and provides for considerably more robust and cardiac-specific gene delivery than other available delivery techniques such as intramuscular injection or intracoronary injection; thus, representing a potential, clinically translatable platform for heart failure gene therapy. PMID:21228882

A set of enhanced green fluorescent protein concatemers for quantitative determination of nuclear localization signal strength.

PubMed

Böhm, Jennifer; Thavaraja, Ramya; Giehler, Susanne; Nalaskowski, Marcus M

2017-09-15

Regulated transport of proteins between nucleus and cytoplasm is an important process in the eukaryotic cell. In most cases, active nucleo-cytoplasmic protein transport is mediated by nuclear localization signal (NLS) and/or nuclear export signal (NES) motifs. In this study, we developed a set of vectors expressing enhanced GFP (EGFP) concatemers ranging from 2 to 12 subunits (2xEGFP to 12xEGFP) for analysis of NLS strength. As shown by in gel GFP fluorescence analysis and αGFP Western blotting, EGFP concatemers are expressed as fluorescent full-length proteins in eukaryotic cells. As expected, nuclear localization of concatemeric EGFPs decreases with increasing molecular weight. By oligonucleotide ligation this set of EGFP concatemers can be easily fused to NLS motifs. After determination of intracellular localization of EGFP concatemers alone and fused to different NLS motifs we calculated the size of a hypothetic EGFP concatemer showing a defined distribution of EGFP fluorescence between nucleus and cytoplasm (n/c ratio = 2). Clear differences of the size of the hypothetic EGFP concatemer depending on the fused NLS motif were observed. Therefore, we propose to use the size of this hypothetic concatemer as quantitative indicator for comparing strength of different NLS motifs. Copyright © 2017 Elsevier Inc. All rights reserved.

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering

PubMed Central

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.

PubMed

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

An efficient method for visualization and growth of fluorescent Xanthomonas oryzae pv. oryzae in planta

PubMed Central

Han, Sang-Wook; Park, Chang-Jin; Lee, Sang-Won; Ronald, Pamela C

2008-01-01

Background Xanthomonas oryzae pv. oryzae, the causal agent of bacterial blight disease, is a serious pathogen of rice. Here we describe a fluorescent marker system to study virulence and pathogenicity of X. oryzae pv. oryzae. Results A fluorescent X. oryzae pv. oryzae Philippine race 6 strain expressing green fluorescent protein (GFP) (PXO99GFP) was generated using the gfp gene under the control of the neomycin promoter in the vector, pPneo-gfp. The PXO99GFPstrain displayed identical virulence and avirulence properties as the wild type control strain, PXO99. Using fluorescent microscopy, bacterial multiplication and colonization were directly observed in rice xylem vessels. Accurate and rapid determination of bacterial growth was assessed using fluoremetry and an Enzyme-Linked ImmunoSorbant Assay (ELISA). Conclusion Our results indicate that the fluorescent marker system is useful for assessing bacterial infection and monitoring bacterial multiplication in planta. PMID:18826644

Expanding the genetic toolbox for Leptospira species by generation of fluorescent bacteria.

PubMed

Aviat, Florence; Slamti, Leyla; Cerqueira, Gustavo M; Lourdault, Kristel; Picardeau, Mathieu

2010-12-01

Our knowledge of the genetics and molecular basis of the pathogenesis associated with Leptospira, in comparison to those of other bacterial species, is very limited. An improved understanding of pathogenic mechanisms requires reliable genetic tools for functional genetic analysis. Here, we report the expression of gfp and mRFP1 genes under the control of constitutive spirochetal promoters in both saprophytic and pathogenic Leptospira strains. We were able to reliably measure the fluorescence of Leptospira by fluorescence microscopy and a fluorometric microplate reader-based assay. We showed that the expression of the gfp gene had no significant effects on growth in vivo and pathogenicity in L. interrogans. We constructed an expression vector for L. biflexa that contains the lacI repressor, an inducible lac promoter, and gfp as the reporter, demonstrating that the lac system is functional in Leptospira. Green fluorescent protein (GFP) expression was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) in L. biflexa transformants harboring the expression vector. Finally, we showed that GFP can be used as a reporter to assess promoter activity in different environmental conditions. These results may facilitate further advances for studying the genetics of Leptospira spp.

[Establishment of RAW264.7 cell strain stably expressing RFP-GFP-LC3].

PubMed

Wang, Wan; Zhang, Qing; Zhao, Runpeng; Xu, Xuewei; Xing, Yingru; Zhang, Rongbo; Wu, Jing; Hu, Dong

2015-09-01

To establish murine macrophage RAW264.7 cell strain with stable expression of red fluorescent protein-green fluorescent protein-microtubule associated protein light chain 3 (RFP-GFP-LC3). A lentiviral vector containing RFP-GFP-LC3 gene was constructed and then packaged in HEK293T cells with the packaging plasmids. The viral supernatant was collected to infect RAW264.7 cells. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 was screened with puromycin and analyzed with flow cytometry and fluorescent microscopy for infection efficiency. The number of RFP-GFP-LC3 puncta was observed using florescence microscopy following starvation treatment. The recombinant lentivirus pLV-CMV-RFP-GFP-LC3 was successfully constructed. The RAW264.7 cells with stable expression of RFP-GFP-LC3 were obtained by viral infection and puromycin screening. Fluorescent microscopy and flow cytometry demonstrated the expression rates of RFP and GFP reached to 100%. The number of autophagic puncta significantly increased after starvation treatment. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 has been successfully constructed, which provides a reliable cellular platform for autophagy research.

Lactococcus lactis expressing either Staphylococcus aureus fibronectin-binding protein A or Listeria monocytogenes internalin A can efficiently internalize and deliver DNA in human epithelial cells.

PubMed

Innocentin, Silvia; Guimarães, Valeria; Miyoshi, Anderson; Azevedo, Vasco; Langella, Philippe; Chatel, Jean-Marc; Lefèvre, François

2009-07-01

Lactococci are noninvasive bacteria frequently used as protein delivery vectors and, more recently, as in vitro and in vivo DNA delivery vehicles. We previously showed that a functional eukaryotic enhanced green fluorescent protein (eGFP) expression plasmid vector was delivered in epithelial cells by Lactococcus lactis producing Listeria monocytogenes internalin A (L. lactis InlA(+)), but this strategy is limited in vivo to transgenic mice and guinea pigs. In this study, we compare the internalization ability of L. lactis InlA(+) and L. lactis producing either the fibronectin-binding protein A of Staphylococcus aureus (L. lactis FnBPA(+)) or its fibronectin binding domains C and D (L. lactis CD(+)). L. lactis FnBPA(+) and L. lactis InlA(+) showed comparable internalization rates in Caco-2 cells, while the internalization rate observed with L. lactis CD(+) was lower. As visualized by conventional and confocal fluorescence microscopy, large clusters of L. lactis FnBPA(+), L. lactis CD(+), and L. lactis InlA(+) were present in the cytoplasm of Caco-2 cells after internalization. Moreover, the internalization rates of Lactobacillus acidophilus NCFM and of an NCFM mutant strain with the gene coding for the fibronectin-binding protein (fbpA) inactivated were also evaluated in Caco-2 cells. Similar low internalization rates were observed for both wild-type L. acidophilus NCFM and the fbpA mutant, suggesting that commensal fibronectin binding proteins have a role in adhesion but not in invasion. L. lactis FnBPA(+), L. lactis CD(+), and L. lactis InlA(+) were then used to deliver a eukaryotic eGFP expression plasmid in Caco-2 cells: flow cytometry analysis showed that the highest percentage of green fluorescent Caco-2 cells was observed after coculture with either L. lactis FnBPA(+) or L. lactis InlA(+). Analysis of the in vivo efficiency of these invasive recombinant strains is currently in progress to validate their potential as DNA vaccine delivery vehicles.

A CGMMV genome-replicon vector with partial sequences of coat protein gene efficiently expresses GFP in Nicotiana benthamiana.

PubMed

Jailani, A Abdul Kader; Solanki, Vikas; Roy, Anirban; Sivasudha, T; Mandal, Bikash

2017-04-02

A highly infectious clone of Cucumber green mottle mosaic virus (CGMMV), a cucurbit-infecting tobamovirus was utilized for designing of gene expression vectors. Two versions of vector were examined for their efficacy in expressing the green fluorescent protein (GFP) in Nicotiana benthamiana. When the GFP gene was inserted at the stop codon of coat protein (CP) gene of the CGMMV genome without any read-through codon, systemic expression of GFP, as well as virion formation and systemic symptoms expression were obtained in N. benthamiana. The qRT-PCR analysis showed 23 fold increase of GFP over actin at 10days post inoculation (dpi), which increased to 45 fold at 14dpi and thereafter the GFP expression was significantly declined. Further, we show that when the most of the CP sequence is deleted retaining only the first 105 nucleotides, the shortened vector containing GFP in frame of original CP open reading frame (ORF) resulted in 234 fold increase of GFP expression over actin at 5dpi in N. benthamiana without the formation of virions and disease symptoms. Our study demonstrated that a simple manipulation of CP gene in the CGMMV genome while preserving the translational frame of CP resulted in developing a virus-free, rapid and efficient foreign protein expression system in the plant. The CGMMV based vectors developed in this study may be potentially useful for the production of edible vaccines in cucurbits. Copyright © 2017 Elsevier B.V. All rights reserved.

An integrated vector system for cellular studies of phage display-derived peptides.

PubMed

Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

2002-09-15

Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

[Novel bidirectional promoter from human genome].

PubMed

Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

2011-01-01

In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.

The strategy of fusion genes construction determines efficient expression of introduced transcription factors.

PubMed

Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin

2014-01-01

The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.

[Zinc-dependent metalloprotease 1 promotes apoptosis of RAW264.7 macrophages].

PubMed

Li, Peng; He, Yonglin; Zhang, Jiming; Fang, Chencheng

2015-12-01

To construct the eukaryotic expression vector of zinc-dependent metalloprotease 1 (zmp1) gene from Bacillus Calmette-Guerin (BCG) and investigate its impact on the apoptosis of RAW264.7 macrophages. Zmp1 gene was amplified from the genome of BCG by PCR. The zmp1 gene fragment was inserted into multiple cloning sites of pEGFP-N1 to construct the eukaryotic expression vector pEGFP-N1-zmp1. The constructed pEGFP-N1-zmp1 was transfected into RAW264.7 cells by Lipofectamine(TM) 2000. The expression of green fluorescent protein (GFP) was observed by fluorescence microscopy. The zmp1 mRNA was detected by quantitative real-time PCR (qR-PCR). The effect of Zmp1 protein on the apoptosis of RAW264.7 macrophages was detected by flow cytometry (FCM). With zmp1 gene amplified by PCR, we successfully constructed the recombinant vector pEGFP-N1-zmp1 as demonstrated by restriction enzyme analysis and sequencing. GFP was seen in RAW264.7 cells 24 hours after transfected with the recombinant plasmid. As qRT-PCR showed, the expression level of zmp1 mRNA was up-regulated. The early apoptotic rate increased 48 hours after transfection. The increased expression of Zmp1 in RAW264.7 cells promotes the apoptosis of RAW264.7 cells.

Enhancement or inhibition of PLCγ2 expression in rat hepatocytes by recombinant adenoviral vectors that contain full-length gene or siRNA.

PubMed

Chen, X G; Liu, Y M; Lv, Q X; Ma, J

2017-01-01

We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.

Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome

PubMed Central

Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio

2012-01-01

The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

PubMed Central

Kon, Tatsuya; Yoshikawa, Nobuyuki

2014-01-01

Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

PubMed

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

Construction of a Shuttle Vector for Heterologous Expression of a Novel Fungal α-Amylase Gene in Aspergillus oryzae.

PubMed

Yin, Yanchen; Mao, Youzhi; Yin, Xiaolie; Gao, Bei; Wei, Dongzhi

2015-07-01

The filamentous fungus Aspergillus oryzae is a well-known expression host used to express homologous and heterologous proteins in a number of industrial applications. To facilitate higher yields of proteins of interest, we constructed the pAsOP vector to express heterologous proteins in A. oryzae. pAsOP carries a selectable marker, pyrG, derived from Aspergillus nidulans, and a strong promoter and a terminator of the amyB gene derived from A. oryzae. pAsOP transformed A. oryzae efficiently via the PEG-CaCl2-mediated transformation method. As proof of concept, green fluorescent protein (GFP) was successfully expressed in A. oryzae transformed by pAsOP-GFP. Additionally, we identified a novel fungal α-amylase (PcAmy) gene from Penicillium sp. and cloned the gene into the vector. After transformation by pAsOPPcAmy, the α-amylase PcAmy from Penicillium sp. was successfully expressed in a heterologous host system for the first time. The α-amylase activity in the A. oryzae transformant was increased by 62.3% compared with the untransformed A. oryzae control. The PcAmy protein produced in the system had an optimum pH of 5.0 and optimum temperature of 30°C. As a cold-adapted enzyme, PcAmy shows potential value in industrial applications because of its high catalytic activity at low temperature. Furthermore, the expression vector reported in this study provides promising utility for further scientific research and biotechnological applications.

Gene Trapping Using Gal4 in Zebrafish

PubMed Central

Balciuniene, Jorune; Balciunas, Darius

2013-01-01

Large clutch size and external development of optically transparent embryos make zebrafish an exceptional vertebrate model system for in vivo insertional mutagenesis using fluorescent reporters to tag expression of mutated genes. Several laboratories have constructed and tested enhancer- and gene-trap vectors in zebrafish, using fluorescent proteins, Gal4- and lexA- based transcriptional activators as reporters 1-7. These vectors had two potential drawbacks: suboptimal stringency (e.g. lack of ability to differentiate between enhancer- and gene-trap events) and low mutagenicity (e.g. integrations into genes rarely produced null alleles). Gene Breaking Transposon (GBTs) were developed to address these drawbacks 8-10. We have modified one of the first GBT vectors, GBT-R15, for use with Gal4-VP16 as the primary gene trap reporter and added UAS:eGFP as the secondary reporter for direct detection of gene trap events. Application of Gal4-VP16 as the primary gene trap reporter provides two main advantages. First, it increases sensitivity for genes expressed at low expression levels. Second, it enables researchers to use gene trap lines as Gal4 drivers to direct expression of other transgenes in very specific tissues. This is especially pertinent for genes with non-essential or redundant functions, where gene trap integration may not result in overt phenotypes. The disadvantage of using Gal4-VP16 as the primary gene trap reporter is that genes coding for proteins with N-terminal signal sequences are not amenable to trapping, as the resulting Gal4-VP16 fusion proteins are unlikely to be able to enter the nucleus and activate transcription. Importantly, the use of Gal4-VP16 does not pre-select for nuclear proteins: we recovered gene trap mutations in genes encoding proteins which function in the nucleus, the cytoplasm and the plasma membrane. PMID:24121167

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

PubMed

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

PubMed Central

Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A.; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P.

2018-01-01

To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches. PMID:29423380

Biosensors to measure inositol 1,4,5-trisphosphate concentration in living cells with spatiotemporal resolution.

PubMed

Remus, Timothy P; Zima, Aleksey V; Bossuyt, Julie; Bare, Dan J; Martin, Jody L; Blatter, Lothar A; Bers, Donald M; Mignery, Gregory A

2006-01-06

Phosphoinositides participate in many signaling cascades via phospholipase C stimulation, which hydrolyzes phosphatidylinositol 4,5-bisphosphate, producing second messengers diacylglycerol and inositol 1,4,5-trisphosphate (InsP3). Destructive chemical approaches required to measure [InsP3] limit spatiotemporal understanding of subcellular InsP3 signaling. We constructed novel fluorescence resonance energy transfer-based InsP3 biosensors called FIRE (fluorescent InsP3-responsive element) by fusing plasmids encoding the InsP3-binding domain of InsP3 receptors (types 1-3) between cyan fluorescent protein and yellow fluorescent protein sequences. FIRE was expressed and characterized in COS-1 cells, cultured neonatal cardiac myocytes, and incorporated into an adenoviral vector for expression in adult cardiac ventricular myocytes. FIRE-1 exhibits an approximately 11% increase in the fluorescence ratio (F530/F480) at saturating [InsP3] (apparent K(d) = 31.3 +/- 6.7 nm InsP3). In COS-1 cells, neonatal rat cardiac myocytes and adult cat ventricular myocytes FIRE-1 exhibited comparable dynamic range and a 10% increase in donor (cyan fluorescent protein) fluorescence upon bleach of yellow fluorescent protein, indicative of fluorescence resonance energy transfer. In FIRE-1 expressing ventricular myocytes endothelin-1, phenylephrine, and angiotensin II all produced rapid and spatially resolved increases in [InsP3] using confocal microscopy (with free [InsP3] rising to approximately 30 nm). Local entry of intracellular InsP3 via membrane rupture by a patch pipette (containing InsP3)in myocytes expressing FIRE-1 allowed detailed spatiotemporal monitoring of intracellular InsP3 diffusion. Both endothelin-1-induced and direct InsP3 application (via pipette rupture) revealed that InsP3 diffusion into the nucleus occurs with a delay and blunted rise of [InsP3] versus cytosolic [InsP3]. These new biosensors allow studying InsP3 dynamics at high temporal and spatial resolution that will be powerful in under-standing InsP3 signaling in intact cells.

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

Transgenic-cloned pigs systemically expressing red fluorescent protein, Kusabira-Orange.

PubMed

Matsunari, Hitomi; Onodera, Masafumi; Tada, Norihiro; Mochizuki, Hideki; Karasawa, Satoshi; Haruyama, Erika; Nakayama, Naoki; Saito, Hitoshi; Ueno, Satoshi; Kurome, Mayuko; Miyawaki, Atsushi; Nagashima, Hiroshi

2008-09-01

Genetically engineered pigs with cell markers such as fluorescent proteins are highly useful in lines of research that include the tracking of transplanted cells or tissues. In this study, we produced transgenic-cloned pigs carrying a gene for the newly developed red fluorescent protein, humanized Kusabira-Orange (huKO), which was cloned from the coral stone Fungia concinna. The nuclear transfer embryos, reconstructed with fetal fibroblast cells that had been transduced with huKO cDNA using retroviral vector D Delta Nsap, developed efficiently in vitro into blastocysts (28.0%, 37/132). Nearly all (94.6%, 35/37) of the cloned blastocysts derived from the transduced cells exhibited clear huKO gene expression. A total of 429 nuclear transfer embryos were transferred to four recipients, all of which became pregnant and gave birth to 18 transgenic-cloned offspring in total. All of the pigs highly expressed huKO fluorescence in all of the 23 organs and tissues analyzed, including the brain, eyes, intestinal and reproductive organs, skeletal muscle, bone, skin, and hoof. Furthermore, such expression was also confirmed by histological analyses of various tissues such as pancreatic islets, renal corpuscles, neuronal and glial cells, the retina, chondrocytes, and hematopoietic cells. These data demonstrate that transgenic-cloned pigs exhibiting systemic red fluorescence expression can be efficiently produced by nuclear transfer of somatic cells retrovirally transduced with huKO gene.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

HCV core protein represses the apoptosis and improves the autophagy of human hepatocytes

PubMed Central

Liu, Changhong; Qu, Aihua; Han, Xiaochun; Wang, Yiguo

2015-01-01

Objectives: This study aims to investigate the influence on human hepatocytes apoptosis and autophagy by the hepatitis C virus (HCV) core protein. Methods: QSG-7701, a human-derived non-neoplastic liver cell line, was transfected with PIRES-core vector that was a eukaryotic vector to express HCV core protein. Fluorescence microscope was used to observe the changes of nuclei in apoptosis cells by Annex in V-FITC/PI double staining. Flow cytometry was applied to detect the rate of cell apoptosis. Western blotting was used to detect the expression of HCV core protein, transcription factor nuclear factor-kappa B (NF-κB), autophagic biomarker microtubule associated protein 1 light chain 3 (LC3), and Beclin-1. Results: The apoptosis rate was significantly lower (P < 0.05) in QSG7701/core group (transfected with PIRES-core vector, (1.34±0.07)%) than in QSG7701 group (no transfection, (2.35±0.11)%) and in QSG7701 QSG7701/pcDNA3.1 group (transfected with pcDNA3.1 vector, (2.58±0.1)%). NF-κB expression was up-expressed in QSG7701/core group than in QSG7701/pcDNA3.1 group and QSG7701 group (P < 0.05). LC3-II expression and Beclin-1 expression was significant higher in QSG7701/core group than in the QSG7701/pcDNA3.1 group and QSG7701 group (P < 0.05). Conclusion: HCV core protein can repress the apoptosis and improve the autophagy of QSG7701 through up-regulating NF-κB and Beclin-1 expression. PMID:26629077

A novel bicistronic sensor vector for detecting caspase-3 activation.

PubMed

Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah

2015-01-01

Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.

Gene Amplification by PCR and Subcloning into a GFP-Fusion Plasmid Expression Vector as a Molecular Biology Laboratory Course

ERIC Educational Resources Information Center

Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.

2004-01-01

A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…

Lentiviral Protein Transfer Vectors Are an Efficient Vaccine Platform and Induce a Strong Antigen-Specific Cytotoxic T Cell Response

PubMed Central

Uhlig, Katharina M.; Schülke, Stefan; Scheuplein, Vivian A. M.; Malczyk, Anna H.; Reusch, Johannes; Kugelmann, Stefanie; Muth, Anke; Koch, Vivian; Hutzler, Stefan; Bodmer, Bianca S.; Schambach, Axel; Buchholz, Christian J.; Waibler, Zoe; Scheurer, Stephan

2015-01-01

ABSTRACT To induce and trigger innate and adaptive immune responses, antigen-presenting cells (APCs) take up and process antigens. Retroviral particles are capable of transferring not only genetic information but also foreign cargo proteins when they are genetically fused to viral structural proteins. Here, we demonstrate the capacity of lentiviral protein transfer vectors (PTVs) for targeted antigen transfer directly into APCs and thereby induction of cytotoxic T cell responses. Targeting of lentiviral PTVs to APCs can be achieved analogously to gene transfer vectors by pseudotyping the particles with truncated wild-type measles virus (MV) glycoproteins (GPs), which use human SLAM (signaling lymphocyte activation molecule) as a main entry receptor. SLAM is expressed on stimulated lymphocytes and APCs, including dendritic cells. SLAM-targeted PTVs transferred the reporter protein green fluorescent protein (GFP) or Cre recombinase with strict receptor specificity into SLAM-expressing CHO and B cell lines, in contrast to broadly transducing vesicular stomatitis virus G protein (VSV-G) pseudotyped PTVs. Primary myeloid dendritic cells (mDCs) incubated with targeted or nontargeted ovalbumin (Ova)-transferring PTVs stimulated Ova-specific T lymphocytes, especially CD8+ T cells. Administration of Ova-PTVs into SLAM-transgenic and control mice confirmed the observed predominant induction of antigen-specific CD8+ T cells and demonstrated the capacity of protein transfer vectors as suitable vaccines for the induction of antigen-specific immune responses. IMPORTANCE This study demonstrates the specificity and efficacy of antigen transfer by SLAM-targeted and nontargeted lentiviral protein transfer vectors into antigen-presenting cells to trigger antigen-specific immune responses in vitro and in vivo. The observed predominant activation of antigen-specific CD8+ T cells indicates the suitability of SLAM-targeted and also nontargeted PTVs as a vaccine for the induction of cytotoxic immune responses. Since cytotoxic CD8+ T lymphocytes are a mainstay of antitumoral immune responses, PTVs could be engineered for the transfer of specific tumor antigens provoking tailored antitumoral immunity. Therefore, PTVs can be used as safe and efficient alternatives to gene transfer vectors or live attenuated replicating vector platforms, avoiding genotoxicity or general toxicity in highly immunocompromised patients, respectively. Thereby, the potential for easy envelope exchange allows the circumventing of neutralizing antibodies, e.g., during repeated boost immunizations. PMID:26085166

Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

PubMed

Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

2013-01-01

This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing malignant cell proliferation.

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

Towards efficient photosynthesis: overexpression of Zea mays phosphoenolpyruvate carboxylase in Arabidopsis thaliana.

PubMed

Kandoi, Deepika; Mohanty, Sasmita; Govindjee; Tripathy, Baishnab C

2016-12-01

Plants with C4 photosynthesis are efficient in carbon assimilation and have an advantage over C3 photosynthesis. In C4 photosynthesis, the primary CO 2 fixation is catalyzed by phosphoenolpyruvate carboxylase (PEPC). Here, we show that overexpression of Zea mays PEPC cDNA, under the control of 35 S promoter, in Arabidopsis thaliana resulted in ~7-10 fold higher protein abundance and ~7-10 fold increase in PEPC activity in the transgenic lines than that in the vector control. We suggest that overexpression of PEPC played an anaplerotic role to increase the supply of 4-carbon carboxylic acids, which provided carbon skeletons for increased amino acid and protein synthesis. Higher protein content must have been responsible for increased metabolic processes including chlorophyll biosynthesis, photosynthesis, and respiration. Consequently, the PEPC-overexpressed transgenic plants had higher chlorophyll content, enhanced electron transport rate (ETR), lower non-photochemical quenching (NPQ) of chlorophyll a fluorescence, and a higher performance index (PI) than the vector control. Consistent with these observations, the rate of CO 2 assimilation, the starch content, and the dry weight of PEPC-overexpressed plants increased by 14-18 %, 10-18 %, and 6.5-16 %, respectively. Significantly, transgenics were tolerant to salt stress as they had increased ability to synthesize amino acids, including the osmolyte proline. NaCl (150 mM)-treated transgenic plants had higher variable to maximum Chl a fluorescence (F v /F m ) ratio, higher PI, higher ETR, and lower NPQ than the salt-treated vector controls. These results suggest that expression of C4 photosynthesis enzyme(s) in a C3 plant can improve its photosynthetic capacity with enhanced tolerance to salinity stress.

Production of transgenic Korean native cattle expressing enhanced green fluorescent protein using a FIV-based lentiviral vector injected into MII oocytes.

PubMed

Xu, Yong-Nan; Uhm, Sang-Jun; Koo, Bon-Chul; Kwon, Mo-Sun; Roh, Ji-Yeol; Yang, Jung-Seok; Choi, Hyun-Yong; Heo, Young-Tae; Cui, Xiang-Shun; Yoon, Joon-Ho; Ko, Dae-Hwan; Kim, Teoan; Kim, Nam-Hyung

2013-01-20

The potential benefits of generating and using transgenic cattle range from improvements in agriculture to the production of large quantities of pharmaceutically relevant proteins. Previous studies have attempted to produce transgenic cattle and other livestock by pronuclear injection and somatic cell nuclear transfer, but these approaches have been largely ineffective; however, a third approach, lentivirus-mediated transgenesis, has successfully produced transgenic livestock. In this study, we generated transgenic (TG) Korean native cattle using perivitelline space injection of viral vectors, which expressed enhanced green fluorescent protein (EGFP) systemically. Two different types of lentiviral vectors derived from feline immunodeficiency virus (FIV) and human immunodeficiency virus (HIV) carrying EGFP were injected into the perivitelline space of MII oocytes. EGFP expression at 8-cell stage was significantly higher in the FIV group compared to the HIV group (47.5%±2.2% v.s. 22.9%±2.9%). Eight-cell embryos that expressed EGFP were cultured into blastocysts and then transferred into 40 heifers. Ten heifers were successfully impregnated and delivered 10 healthy calves. All of these calves expressed EGFP as detected by in vivo imaging, PCR and Southern blotting. In addition, we established an EGFP-expressing cell line from TG calves, which was followed by nuclear transfer (NT). Recloned 8-cell embryos also expressed EGFP, and there were no differences in the rates of fusion, cleavage and development between cells derived from TG and non-TG calves, which were subsequently used for NT. These results illustrate that FIV-based lentiviruses are useful for the production of TG cattle. Moreover, our established EGFP cell line can be used for additional studies that involve induced pluripotent stem cells. Copyright © 2013. Published by Elsevier Ltd.

High-Throughput Protein Expression Using a Combination of Ligation-Independent Cloning (LIC) and Infrared Fluorescent Protein (IFP) Detection

PubMed Central

Dortay, Hakan; Akula, Usha Madhuri; Westphal, Christin; Sittig, Marie; Mueller-Roeber, Bernd

2011-01-01

Protein expression in heterologous hosts for functional studies is a cumbersome effort. Here, we report a superior platform for parallel protein expression in vivo and in vitro. The platform combines highly efficient ligation-independent cloning (LIC) with instantaneous detection of expressed proteins through N- or C-terminal fusions to infrared fluorescent protein (IFP). For each open reading frame, only two PCR fragments are generated (with three PCR primers) and inserted by LIC into ten expression vectors suitable for protein expression in microbial hosts, including Escherichia coli, Kluyveromyces lactis, Pichia pastoris, the protozoon Leishmania tarentolae, and an in vitro transcription/translation system. Accumulation of IFP-fusion proteins is detected by infrared imaging of living cells or crude protein extracts directly after SDS-PAGE without additional processing. We successfully employed the LIC-IFP platform for in vivo and in vitro expression of ten plant and fungal proteins, including transcription factors and enzymes. Using the IFP reporter, we additionally established facile methods for the visualisation of protein-protein interactions and the detection of DNA-transcription factor interactions in microtiter and gel-free format. We conclude that IFP represents an excellent reporter for high-throughput protein expression and analysis, which can be easily extended to numerous other expression hosts using the setup reported here. PMID:21541323

Atomic force microscopy for cellular level manipulation: imaging intracellular structures and DNA delivery through a membrane hole.

PubMed

Afrin, Rehana; Zohora, Umme Salma; Uehara, Hironori; Watanabe-Nakayama, Takahiro; Ikai, Atsushi

2009-01-01

The atomic force microscope (AFM) is a versatile tool for imaging, force measurement and manipulation of proteins, DNA, and living cells basically at the single molecular level. In the cellular level manipulation, extraction, and identification of mRNA's from defined loci of a cell, insertion of plasmid DNA and pulling of membrane proteins, for example, have been reported. In this study, AFM was used to create holes at defined loci on the cell membrane for the investigation of viability of the cells after hole creation, visualization of intracellular structure through the hole and for targeted gene delivery into living cells. To create large holes with an approximate diameter of 5-10 microm, a phospholipase A(2) coated bead was added to the AFM cantilever and the bead was allowed to touch the cell surface for approximately 5-10 min. The evidence of hole creation was obtained mainly from fluorescent image of Vybrant DiO labeled cell before and after the contact with the bead and the AFM imaging of the contact area. In parallel, cells with a hole were imaged by AFM to reveal intracellular structures such as filamentous structures presumably actin fibers and mitochondria which were identified with fluorescent labeling with rhodamine 123. Targeted gene delivery was also attempted by inserting an AFM probe that was coated with the Monster Green Fluorescent Protein phMGFP Vector for transfection of the cell. Following targeted transfection, the gene expression of green fluorescent protein (GFP) was observed and confirmed by the fluorescence microscope. Copyright (c) 2009 John Wiley & Sons, Ltd.

Transfection using hydroxyapatite nanoparticles in the inner ear via an intact round window membrane in chinchilla

NASA Astrophysics Data System (ADS)

Wu, Xuewen; Ding, Dalian; Jiang, Haiyan; Xing, Xiaowei; Huang, Suping; Liu, Hong; Chen, Zhedong; Sun, Hong

2012-01-01

Hydroxyapatite nanoparticles (nHAT) are known to have excellent biocompatibility, and have attracted increasing attention as new candidates of non-viral vectors for gene therapy. In our previous studies, nHAT carrying a therapeutic gene and a reporter gene were successfully transfected into the spiral ganglion neurons in the inner ear of guinea pigs in vivo as well as in the cultured cell lines, although the transfection efficiencies were never higher than 30%. In this study, the surface modification of nHAT with polyethylenimine (PEI) was made (PEI-nHAT, diameter = 73.09 ± 27.32 nm) and a recombinant plasmid carrying enhanced green fluorescent protein (EGFP) gene and neurotrophin-3 (NT-3) gene was constructed as pEGFPC2-NT3. The PEI modified nHAT and the recombinant plasmid was then connected to form the nHAT-based vector-gene complex (PEI-nHAT-pEGFPC2-NT3). This complex was then placed onto the intact round window membranes of the chinchillas for inner ear transfection. Auditory brainstem response (ABR) was tested to evaluate auditory function. Green fluorescence of EGFP was observed using confocal microscopy 48 h after administering vector-gene complexes. There was no significant threshold shift in tone burst-evoked ABR at any tested frequency. Abundant, condensed green fluorescence was found in dark cells on both sides of the crista and around the macula of the utricle. Scattered EGFP signals were also detected in vestibular hair cells, some Schwann cells in the cochlear spiral ganglion region, some outer pillar cells in the organ of Corti, and a few cells in the stria vascularis. The density of green fluorescence-marked cells was obviously higher in the vestibular dark cell area than in other areas of the inner ear, suggesting that vestibular dark cells may have the ability to actively engulf the nHAT-based vector-gene complexes. Considering the high transfection efficiency in the vestibular system, PEI-nHAT may be a potential vector for gene therapy of inner ear diseases, especially vestibular disorders, and deserves further study.

Use of the mCherry Fluorescent Protein To Study Intestinal Colonization by Enterococcus mundtii ST4SA and Lactobacillus plantarum 423 in Mice

PubMed Central

van Zyl, Winschau F.; Deane, Shelly M.

2015-01-01

Lactic acid bacteria (LAB) are natural inhabitants of the gastrointestinal tract (GIT) of humans and animals, and some LAB species receive considerable attention due to their health benefits. Although many papers have been published on probiotic LAB, only a few reports have been published on the migration and colonization of the cells in the GIT. This is due mostly to the lack of efficient reporter systems. In this study, we report on the application of the fluorescent mCherry protein in the in vivo tagging of the probiotic strains Enterococcus mundtii ST4SA and Lactobacillus plantarum 423. The mCherry gene, encoding a red fluorescent protein (RFP), was integrated into a nonfunctional region on the genome of L. plantarum 423 by homologous recombination. In the case of E. mundtii ST4SA, the mCherry gene was cloned into the pGKV223D LAB/Escherichia coli expression vector. Expression of the mCherry gene did not alter the growth rate of the two strains and had no effect on bacteriocin production. Both strains colonized the cecum and colon of mice. PMID:26116681

'Green mice' display limitations in enhanced green fluorescent protein expression in retina and optic nerve cells.

PubMed

Caminos, Elena; Vaquero, Cecilia F; García-Olmo, Dolores C

2014-12-01

Characterization of retinal cells, cell transplants and gene therapies may be helped by pre-labeled retinal cells, such as those transfected with vectors for green fluorescent protein expression. The aim of this study was to analyze retinal cells and optic nerve components from transgenic green mice (GM) with the 'enhanced' green fluorescent protein (EGFP) gene under the control of the CAG promoter (a chicken β-actin promoter and a cytomegalovirus enhancer). The structural analysis and electroretinography recordings showed a normal, healthy retina. Surprisingly, EGFP expression was not ubiquitously located in the retina and optic nerve. Epithelial cells, photoreceptors and bipolar cells presented high green fluorescence levels. In contrast, horizontal cells, specific amacrine cells and ganglion cells exhibited a null EGFP expression level. The synaptic terminals of rod bipolar cells displayed a high green fluorescence level when animals were kept in the dark. Immature retinas exhibited different EGFP expression patterns to those noted in adults. Axons and glial cells in the optic nerve revealed a specific regional EGFP expression pattern, which correlated with the presence of myelin. These results suggest that EGFP expression might be related to the activity of both the CAG promoter and β-actin in mature retinal neurons and oligodendrocytes. Moreover, EGFP expression might be regulated by light in both immature and adult animals. Since GM are used in numerous retina bioassays, it is essential to know the differential EGFP expression in order to select cells of interest for each study.

Digital optical imaging of green fluorescent proteins for tracking vascular gene expression: feasibility study in rabbit and human cell models.

PubMed

Yang, X; Liu, H; Li, D; Zhou, X; Jung, W C; Deans, A E; Cui, Y; Cheng, L

2001-04-01

To investigate the feasibility of using a sensitive digital optical imaging technique to detect green fluorescent protein (GFP) expressed in rabbit vasculature and human arterial smooth muscle cells. A GFP plasmid was transfected into human arterial smooth muscle cells to obtain a GFP-smooth muscle cell solution. This solution was imaged in cell phantoms by using a prototype digital optical imaging system. For in vivo validation, a GFP-lentivirus vector was transfected during surgery into the carotid arteries of two rabbits, and GFP-targeted vessels were harvested for digital optical imaging ex vivo. Optical imaging of cell phantoms resulted in a spatial resolution of 25 microm/pixel. Fluorescent signals were detected as diffusely distributed bright spots. At ex vivo optical imaging of arterial tissues, the average fluorescent signal was significantly higher (P <.05) in GFP-targeted tissues (mean +/- SD, 9,357.3 absolute units of density +/- 1,001.3) than in control tissues (5,633.7 absolute units of density +/- 985.2). Both fluorescence microscopic and immunohistochemical findings confirmed these differences between GFP-targeted and control vessels. The digital optical imaging system was sensitive to GFPs and may potentially provide an in vivo imaging tool to monitor and track vascular gene transfer and expression in experimental investigations.

Establishment and characterization of CAG/EGFP transgenic rabbit line.

PubMed

Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

2007-02-01

Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

Development of fiber optic spectroscopy for in-vitro and in-planta detection of fluorescent proteins

NASA Astrophysics Data System (ADS)

Liew, Oi Wah; Chen, Jun-Wei; Asundi, Anand K.

2001-10-01

The objective of this project is to apply photonics technology to bio-safety management of genetically modified (GM) plants. The conventional method for screening GM plants is through selection using antibiotic resistance markers. There is public concern with such approaches and these are associated with food safety issues, escape of antibiotic resistance genes to pathogenic microorganisms and interference with antibiotic therapy. Thus, the strategy taken in this project is to replace antibiotic resistance markers with fluorescent protein markers that allow for rapid and non-invasive optical screening of genetically modified plants. In this paper, fibre optic spectroscopy was developed to detect and quantify recombinant green (EGFP) and red (DsRED) fluorescent proteins in vitro and in planta. In vitro detection was first carried out to optimize the sensitivity of the optical system. The bacterial expression vectors carrying the coding regions of EGFP and DsRED were introduced into Escherichia coli host cells and fluorescent proteins were produced following induction with IPTG. Soluble EGFP and DsRED proteins were isolated from lysed bacterial cells and serially diluted for quantitative analysis by fibre optic spectroscopy using different light sources, namely, blue LED (475 nm), tungsten halogen (350 - 1000 nm) and double frequency Nd:YAG green laser (532 nm). Fluorescence near the expected emission wavelengths could be detected up to 320X dilution for EGFP and DsRED with blue LED and 532 nm green laser, respectively, as the excitation source. Tungsten halogen was found to be unsuitable for excitation of both EGFP and DsRED. EGFP was successfully purified by size separation under non-denaturing electrophoretic conditions and quantified. The minimum concentration of EGFP detectable with blue LED excitation was 5 mg/ml. To determine the capability of spectroscopy detection in planta, transgenic potato hairy roots and whole modified plant lines expressing the fluorescent markers were regenerated. T

Development and validation of a high-content bimolecular fluorescence complementation assay for small-molecule inhibitors of HIV-1 Nef dimerization.

PubMed

Poe, Jerrod A; Vollmer, Laura; Vogt, Andreas; Smithgall, Thomas E

2014-04-01

Nef is a human immunodeficiency virus 1 (HIV-1) accessory factor essential for viral pathogenesis and AIDS progression. Many Nef functions require dimerization, and small molecules that block Nef dimerization may represent antiretroviral drug leads. Here we describe a cell-based assay for Nef dimerization inhibitors based on bimolecular fluorescence complementation (BiFC). Nef was fused to nonfluorescent, complementary fragments of yellow fluorescent protein (YFP) and coexpressed in the same cell population. Dimerization of Nef resulted in juxtaposition of the YFP fragments and reconstitution of the fluorophore. For automation, the Nef-YFP fusion proteins plus a monomeric red fluorescent protein (mRFP) reporter were expressed from a single vector, separated by picornavirus "2A" linker peptides to permit equivalent translation of all three proteins. Validation studies revealed a critical role for gating on the mRFP-positive subpopulation of transfected cells, as well as use of the mRFP signal to normalize the Nef-BiFC signal. Nef-BiFC/mRFP ratios resulting from cells expressing wild-type versus dimerization-defective Nef were very clearly separated, with Z factors consistently in the 0.6 to 0.7 range. A fully automated pilot screen of the National Cancer Institute Diversity Set III identified several hit compounds that reproducibly blocked Nef dimerization in the low micromolar range. This BiFC-based assay has the potential to identify cell-active small molecules that directly interfere with Nef dimerization and function.

UMG Lenti: Novel Lentiviral Vectors for Efficient Transgene- and Reporter Gene Expression in Human Early Hematopoietic Progenitors

PubMed Central

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183

Fusions between green fluorescent protein and beta-glucuronidase as sensitive and vital bifunctional reporters in plants.

PubMed

Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P

1998-07-01

By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.

Fusions between green fluorescent protein and beta-glucuronidase as sensitive and vital bifunctional reporters in plants.

PubMed

Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P

1998-11-01

By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.

Retrovirally mediated correction of bone marrow-derived mesenchymal stem cells from patients with mucopolysaccharidosis type I.

PubMed

Baxter, Melissa A; Wynn, Robert F; Deakin, Jonathan A; Bellantuono, Ilaria; Edington, Kirsten G; Cooper, Alan; Besley, Guy T N; Church, Heather J; Wraith, J Ed; Carr, Trevor F; Fairbairn, Leslie J

2002-03-01

We have investigated the utility of bone marrow-derived mesenchymal stem cells (MSCs) as targets for gene therapy of the autosomal recessive disorder mucopolysaccharidosis type IH (MPS-IH, Hurler syndrome). Cultures of MSCs were initially exposed to a green fluorescent protein-expressing retrovirus. Green fluorescent protein-positive cells maintained their proliferative and differentiation capacity. Next we used a vector encoding alpha-L-iduronidase (IDUA), the enzyme that is defective in MPS-IH. Following transduction, MPS-IH MSCs expressed high levels of IDUA and secreted supernormal levels of this enzyme into the extracellular medium. Exogenous IDUA expression led to a normalization of glycosaminoglycan storage in MPS-IH cells, as evidenced by a dramatic decrease in the amount of (35)SO(4) sequestered within the heparan sulfate and dermatan sulfate compartments of these cells. Finally, gene-modified MSCs were able to cross-correct the enzyme defect in untransduced MPS-IH fibroblasts via protein transfer.

Expression of human factor IX gene in murine plasma through lentiviral vector-infected haematopoietic stem cells.

PubMed

Chen, Haoming; Yao, Hengmei; Huang, Lu; Shen, Qi; Jia, William; Xue, Jinglun

2006-12-01

1. Haematopoietic stem cells (HSC) are an attractive target for gene therapy. Gene transfer to HSC can provide a potential cure for many inherited diseases. Moreover, recombinant lentiviral vectors can transfer genes efficiently to HSC. In the present study, we used the recombinant lentiviruses FUGW (Flip, ubiquitin promoter, GFP and WRE vector) and FUXW (Flip, ubiquitin promoter, F IX and WRE vector), which carry the enhanced green fluorescent protein (EGFP) and human factor IX (hFIX) gene, respectively, to infect HSC. 2. High titres of recombinant lentivirus were prepared from 293T cells by calcium phosphate-mediated transient cotransfection. Murine mononuclear cells (MNC) separated from murine bone marrow and HSC separated by magnetic cell sorting were cultured in vitro. Cells they were infected by the recombinant lentiviruses FUGW and FUXW. The expression of EGFP was observed under a fluorescent microscope and was analysed by fluorescence-activated cell sorting, whereas the expression of hFIX was detected by ELISA. 3. The results show that the lentiviral vectors can efficiently infect murine HSC in vitro and that transduction was more efficient following cytokine treatment with interleukin (IL)-3, IL-6 and stem cell factor. 4. Haematopoietic stem cells infected with lentivirus FUXW were transplanted into [(60)Co]-irradiated non-obese diabetic/severe combined immunodeficiency (NOD-SCID) mice. The expression of hFIX in the blood plasma of the transplanted mice reached a peak of 44.9 +/- 7.6 ng/mL on Day 7. An assay of transaminase levels and a histological study of the liver showed that there was no significant damage following HSC transplantation to mice. 5. The results of the present study suggest that transplantation of HSC results in the persistant expression of hFIX in mice, which may be useful in haemophilia B gene therapy.

Efficacy and safety of a clinically relevant foamy vector design in human hematopoietic repopulating cells.

PubMed

Everson, Elizabeth M; Hocum, Jonah D; Trobridge, Grant D

2018-06-23

Previous studies have shown that foamy viral (FV) vectors are a promising alternative to gammaretroviral and lentiviral vectors and insulators can improve FV vector safety. However, in a previous analysis of insulator effects on FV vector safety, strong viral promoters were used to elicit genotoxic events. Here we developed and analyzed the efficacy and safety of a high-titer, clinically relevant FV vector driven by the housekeeping promoter elongation factor-1α and insulated with an enhancer blocking A1 insulator (FV-EGW-A1). Human CD34 + cord blood cells were exposed to an enhanced green fluorescent protein expressing vector, FV-EGW-A1, at a multiplicity of infection of 10 and then maintained in vitro or transplanted into immunodeficient mice. Flow cytometry was used to measure engraftment and marking in vivo. FV vector integration sites were analyzed to assess safety. FV-EGW-A1 resulted in high-marking, multi-lineage engraftment of human repopulating cells with no evidence of silencing. Engraftment was highly polyclonal with no clonal dominance and a promising safety profile based on integration site analysis. An FV vector with an elongation factor-1α promoter and an A1 insulator is a promising vector design for use in the clinic. This article is protected by copyright. All rights reserved.

Zinc finger protein designed to target 2-long terminal repeat junctions interferes with human immunodeficiency virus integration.

PubMed

Sakkhachornphop, Supachai; Barbas, Carlos F; Keawvichit, Rassamee; Wongworapat, Kanlaya; Tayapiwatana, Chatchai

2012-09-01

Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine-adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future.

Protein-Protein Interaction Assays with Effector-GFP Fusions in Nicotiana benthamiana.

PubMed

Petre, Benjamin; Win, Joe; Menke, Frank L H; Kamoun, Sophien

2017-01-01

Plant parasites secrete proteins known as effectors into host tissues to manipulate host cell structures and functions. One of the major goals in effector biology is to determine the host cell compartments and the protein complexes in which effectors accumulate. Here, we describe a five-step pipeline that we routinely use in our lab to achieve this goal, which consists of (1) Golden Gate assembly of pathogen effector-green fluorescent protein (GFP) fusions into binary vectors, (2) Agrobacterium-mediated heterologous protein expression in Nicotiana benthamiana leaf cells, (3) laser-scanning confocal microscopy assay, (4) anti-GFP coimmunoprecipitation-liquid chromatography-tandem mass spectrometry (coIP/MS) assay, and (5) anti-GFP western blotting. This pipeline is suitable for rapid, cost-effective, and medium-throughput screening of pathogen effectors in planta.

[Construction and expression of six deletion mutants of human astrovirus C-terminal nsP1a/4 protein].

PubMed

Zhao, Wei; Niu, Ke; Zhao, Jian; Jin, Yi-ming; Sui, Ting-ting; Wang, Wen

2013-09-01

Human astrovirus (HAstV) is one of the leading causes of actue virual diarrhea in infants. HAstV-induced epithdlial cell apoptosis plays an important role in the pathogenesis of HAstV infection. Our previous study indicated that HAstV non-structural protein nsPla C-terminal protein nsPla/4 was the major apoptosis functional protein and probably contained the main apoptosis domains. In order to screen for astrovirus encoded apoptotic protien, nsPla/4 and six turncated proteins, which possessed nsPla/4 protein different function domain ,were cloned into green fluorescent protein (GFP) vector pEG-FP-N3. After 24-72 h transfection, the fusion protein expression in BHK21 cells, was analysis by fluorescence microscope and Western blot. The results indicated seven fusion proteins were observed successfully in BHK21 cell after transfected for 24 h. Western blot analysis showed that the level of fusion protein expressed in BHK21 cells was increased significantly at 72h compared to 48h in transfected cells. The successful expression of deletion mutants of nsPla/4 protein was an important foundation to gain further insights into the function of apoptosis domains of nsPla/4 protein and it would also provide research platform to further confirm the molecule pathogenic mechanism of human astrovirus.

Induction of Immune Tolerance to Foreign Protein via Adeno-Associated Viral Vector Gene Transfer in Mid-Gestation Fetal Sheep

PubMed Central

Davey, Marcus G.; Riley, John S.; Andrews, Abigail; Tyminski, Alec; Limberis, Maria; Pogoriler, Jennifer E.; Partridge, Emily; Olive, Aliza; Hedrick, Holly L.; Flake, Alan W.; Peranteau, William H.

2017-01-01

A major limitation to adeno-associated virus (AAV) gene therapy is the generation of host immune responses to viral vector antigens and the transgene product. The ability to induce immune tolerance to foreign protein has the potential to overcome this host immunity. Acquisition and maintenance of tolerance to viral vector antigens and transgene products may also permit repeat administration thereby enhancing therapeutic efficacy. In utero gene transfer (IUGT) takes advantage of the immunologic immaturity of the fetus to induce immune tolerance to foreign antigens. In this large animal study, in utero administration of AAV6.2, AAV8 and AAV9 expressing green fluorescent protein (GFP) to ~60 day fetal sheep (term: ~150 days) was performed. Transgene expression and postnatal immune tolerance to GFP and viral antigens were assessed. We demonstrate 1) hepatic expression of GFP 1 month following in utero administration of AAV6.2.GFP and AAV8.GFP, 2) in utero recipients of either AAV6.2.GFP or AAV8.GFP fail to mount an anti-GFP antibody response following postnatal GFP challenge and lack inflammatory cellular infiltrates at the intramuscular site of immunization, 3) a serotype specific anti-AAV neutralizing antibody response is elicited following postnatal challenge of in utero recipients of AAV6.2 or AAV8 with the corresponding AAV serotype, and 4) durable hepatic GFP expression was observed up to 6 months after birth in recipients of AAV8.GFP but expression was lost between 1 and 6 months of age in recipients of AAV6.2.GFP. The current study demonstrates, in a preclinical large animal model, the potential of IUGT to achieve host immune tolerance to the viral vector transgene product but also suggests that a single exposure to the vector capsid proteins at the time of IUGT is inadequate to induce tolerance to viral vector antigens. PMID:28141818

Purification of adenoviral vectors by combined anion exchange and gel filtration chromatography.

PubMed

Eglon, Marc N; Duffy, Aoife M; O'Brien, Timothy; Strappe, Padraig M

2009-11-01

Adenoviral vectors are used extensively in human gene therapy trials and in vaccine development. Large-scale GMP production requires a downstream purification process, and liquid chromatography is emerging as the most powerful mode of purification, enabling the production of vectors at a clinically relevant scale and quality. The present study describes the development of a two-step high-performance liquid chromatography (HPLC) process combining anion exchange (AIEX) and gel filtration (GF) in comparison with the caesium chloride density gradient method. HEK-293 cells were cultured in ten-layer CellStacks() and infected with 10 pfu/cell of adenoviral vector expressing green fluorescent protein (Ad5-GFP). Cell-bound virus was harvested and benzonase added to digest DNA, crude lysate was clarified by centrifugation and filtration prior to HPLC. Chromatography fractions were added to HEK-293 cells and GFP expression measured using a fluorescent plate reader. Using AIEX then GF resulted in an adenoviral vector with purity comparable to Ad5-GFP purified by CsCl, whereas the reverse process (GF-AIEX) showed a reduced purity by electrophoresis and required further buffer exchange of the product. The optimal process (AIEX-GF) resulted in a vector yield of 2.3 x 10(7) pfu/cm(2) of cell culture harvested compared to 3.3 x 10(7) pfu/cm(2) for CsCl. The process recovery for the HPLC process was 36% compared to 27.5% for CsCl and total virion to infectious particle ratios of 18 and 11, respectively, were measured. We present a simple two-step chromatography process that is capable of producing high-quality adenovirus at a titre suitable for scale-up and clinical translation.

Adenovirus Vectors Target Several Cell Subtypes of Mammalian Inner Ear In Vivo

PubMed Central

Li, Wenyan; Shen, Jun

2016-01-01

Mammalian inner ear harbors diverse cell types that are essential for hearing and balance. Adenovirus is one of the major vectors to deliver genes into the inner ear for functional studies and hair cell regeneration. To identify adenovirus vectors that target specific cell subtypes in the inner ear, we studied three adenovirus vectors, carrying a reporter gene encoding green fluorescent protein (GFP) from two vendors or with a genome editing gene Cre recombinase (Cre), by injection into postnatal days 0 (P0) and 4 (P4) mouse cochlea through scala media by cochleostomy in vivo. We found three adenovirus vectors transduced mouse inner ear cells with different specificities and expression levels, depending on the type of adenoviral vectors and the age of mice. The most frequently targeted region was the cochlear sensory epithelium, including auditory hair cells and supporting cells. Adenovirus with GFP transduced utricular supporting cells as well. This study shows that adenovirus vectors are capable of efficiently and specifically transducing different cell types in the mammalian inner ear and provides useful tools to study inner ear gene function and to evaluate gene therapy to treat hearing loss and vestibular dysfunction. PMID:28116172

Incorporation of adenylate cyclase into membranes of giant liposomes using membrane fusion with recombinant baculovirus-budded virus particles.

PubMed

Mori, Takaaki; Kamiya, Koki; Tomita, Masahiro; Yoshimura, Tetsuro; Tsumoto, Kanta

2014-06-01

Recombinant transmembrane adenylate cyclase (AC) was incorporated into membranes of giant liposomes using membrane fusion between liposomes and baculovirus-budded virus (BV). AC genes were constructed into transfer vectors in a form fused with fluorescent protein or polyhistidine at the C-terminus. The recombinant BVs were collected by ultracentrifugation and AC expression was verified using western blotting. The BVs and giant liposomes generated using gentle hydration were fused under acidic conditions; the incorporation of AC into giant liposomes was demonstrated by confocal laser scanning microscopy through the emission of fluorescence from their membranes. The AC-expressing BVs were also fused with liposomes containing the substrate (ATP) with/without a specific inhibitor (SQ 22536). An enzyme immunoassay on extracts of the sample demonstrated that cAMP was produced inside the liposomes. This procedure facilitates direct introduction of large transmembrane proteins into artificial membranes without solubilization.

Efficient expression of green fluorescent protein (GFP) mediated by a chimeric promoter in Chlamydomonas reinhardtii

NASA Astrophysics Data System (ADS)

Wu, Jinxia; Hu, Zhangli; Wang, Chaogang; Li, Shuangfei; Lei, Anping

2008-08-01

To improve the expression efficiency of exogenous genes in Chlamydomonas reinhardtii, a high efficient expression vector was constructed. Green fluorescent protein (GFP) was expressed in C. reinhardtii under the control of promoters: RBCS2 and HSP70A-RBCS2. Efficiency of transformation and expression were compared between two transgenic algae: RBCS2 mediated strain Tran-I and HSP70A-RBCS2 mediated strain Tran-II. Results show that HSP70A-RBCS2 could improve greatly the transformation efficiency by approximately eightfold of RBCS2, and the expression efficiency of GFP in Tran-II was at least double of that in Tran-I. In addition, a threefold increase of GFP in Tran-II was induced by heat shock at 40°C. All of the results demonstrated that HSP70A-RBCS2 was more efficient than RBCS2 in expressing exogenous gene in C. reinhardtii.

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

Design, modelling and preliminary characterisation of microneedle-based electrodes for tissue electroporation in vivo

NASA Astrophysics Data System (ADS)

O'Mahony, Conor; Houlihan, Ruth; Grygoryev, Konstantin; Ning, Zhenfei; Williams, John; Moore, Tom

2016-10-01

We analysed the use of microneedle-based electrodes to enhance electroporation of mouse testis with DNA vectors for production of transgenic mice. Different microneedle formats were developed and tested, and we ultimately used electrodes based on arrays of 500 μm tall microneedles. In a series of experiments involving injection of a DNA vector expressing Green Fluorescent Protein (GFP) and electroporation using microneedle electrodes and a commercially available voltage supply, we compared the performance of flat and microneedle electrodes by measuring GFP expression at various timepoints after electroporation. Our main finding, supported by both experimental and simulated data, is that needles significantly enhanced electroporation of testis.

Recombinant adeno-associated virus targets passenger gene expression to cones in primate retina

NASA Astrophysics Data System (ADS)

Mancuso, Katherine; Hendrickson, Anita E.; Connor, Thomas B., Jr.; Mauck, Matthew C.; Kinsella, James J.; Hauswirth, William W.; Neitz, Jay; Neitz, Maureen

2007-05-01

Recombinant adeno-associated virus (rAAV) is a promising vector for gene therapy of photoreceptor-based diseases. Previous studies have demonstrated that rAAV serotypes 2 and 5 can transduce both rod and cone photoreceptors in rodents and dogs, and it can target rods, but not cones in primates. Here we report that using a human cone-specific enhancer and promoter to regulate expression of a green fluorescent protein (GFP) reporter gene in an rAAV-5 vector successfully targeted expression of the reporter gene to primate cones, and the time course of GFP expression was able to be monitored in a living animal using the RetCam II digital imaging system.

Production of transgenic cloned pigs expressing the far-red fluorescent protein monomeric Plum.

PubMed

Watanabe, Masahito; Kobayashi, Mirina; Nagaya, Masaki; Matsunari, Hitomi; Nakano, Kazuaki; Maehara, Miki; Hayashida, Gota; Takayanagi, Shuko; Sakai, Rieko; Umeyama, Kazuhiro; Watanabe, Nobuyuki; Onodera, Masafumi; Nagashima, Hiroshi

2015-01-01

Monomeric Plum (Plum), a far-red fluorescent protein with photostability and photopermeability, is potentially suitable for in vivo imaging and detection of fluorescence in body tissues. The aim of this study was to generate transgenic cloned pigs exhibiting systemic expression of Plum using somatic cell nuclear transfer (SCNT) technology. Nuclear donor cells for SCNT were obtained by introducing a Plum-expression vector driven by a combination of the cytomegalovirus early enhancer and chicken beta-actin promoter into porcine fetal fibroblasts (PFFs). The cleavage and blastocyst formation rates of reconstructed SCNT embryos were 81.0% (34/42) and 78.6% (33/42), respectively. At 36-37 days of gestation, three fetuses systemically expressing Plum were obtained from one recipient to which 103 SCNT embryos were transferred (3/103, 2.9%). For generation of offspring expressing Plum, rejuvenated PFFs were established from one cloned fetus and used as nuclear donor cells. Four cloned offspring and one stillborn cloned offspring were produced from one recipient to which 117 SCNT embryos were transferred (5/117, 4.3%). All offspring exhibited high levels of Plum fluorescence in blood cells, such as lymphocytes, monocytes and granulocytes. In addition, the skin, heart, kidney, pancreas, liver and spleen also exhibited Plum expression. These observations demonstrated that transfer of the Plum gene did not interfere with the development of porcine SCNT embryos and resulted in the successful generation of transgenic cloned pigs that systemically expressed Plum. This is the first report of the generation and characterization of transgenic cloned pigs expressing the far-red fluorescent protein Plum.

Versatile approach for functional analysis of human proteins and efficient stable cell line generation using FLP-mediated recombination system

PubMed Central

Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej

2018-01-01

Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189

A novel approach to investigate the uptake and internalization of Escherichia coli O157:H7 in spinach cultivated in soil and hydroponic media

USDA-ARS?s Scientific Manuscript database

Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. A Tn7-based plasmid vector was used to insert the green fluorescent protein (gfp) gene into the attTn7 site in the E. coli chromosome. Three gfp-labeled E. coli inocula, O157:H7 strains ...

High degree of correlation between Ebola virus BSL-4 neutralization assays and pseudotyped VSV BSL-2 fluorescence reduction neutralization test.

PubMed

Konduru, Krishnamurthy; Shurtleff, Amy C; Bavari, Sina; Kaplan, Gerardo

2018-04-01

Ebola virus (EBOV), classified as a category A agent by the CDC and NIH, requires BSL-4 containment and induces high morbidity and mortality in humans. The 2013-2015 epidemic in West Africa underscored the urgent need to develop vaccines and therapeutics to prevent and treat EBOV disease. Neutralization assays are needed to evaluate the efficacy of EBOV vaccines and antibody therapies. Pseudotyped viruses based on nonpathogenic or attenuated vectors reduce the risks involved in the evaluation of neutralizing antibodies against highly pathogenic viruses. Selectable markers, fluorescent proteins, and luciferase have been introduced into pseudotyped viruses for detection and quantitation purposes. The current study describes the development of a BSL-2 fluorescence reduction neutralization test (FRNT) using a recombinant vesicular stomatitis virus (VSV) in which the VSV-G envelope gene was replaced with the EBOV glycoprotein (GP) and green fluorescent protein (GFP) genes (rVSV-EBOVgp-GFP). Cells infected with rVSV-EBOVgp-GFP express GFP. Anti-GP neutralizing monoclonal and polyclonal antibodies blocked rVSV-EBOVgp-GFP infection preventing or reducing GFP fluorescence. The high degree of correlation between the EBOV BSL-2 FRNT and the BSL-4 plaque reduction neutralization test (PRNT), the accepted standard of EBOV neutralization tests, supports the use of the EBOV BSL-2 FRNT to evaluate neutralizing antibodies in clinical trials. Published by Elsevier B.V.

Green Fluorescent Protein as a Novel Indicator of Antimicrobial Susceptibility in Aureobasidium pullulans

PubMed Central

Webb, Jeremy S.; Barratt, Sarah R.; Sabev, Hristo; Nixon, Marianne; Eastwood, Ian M.; Greenhalgh, Malcolm; Handley, Pauline S.; Robson, Geoffrey D.

2001-01-01

Presently there is no method available that allows noninvasive and real-time monitoring of fungal susceptibility to antimicrobial compounds. The green fluorescent protein (GFP) of the jellyfish Aequoria victoria was tested as a potential reporter molecule for this purpose. Aureobasidium pullulans was transformed to express cytosolic GFP using the vector pTEFEGFP (A. J. Vanden Wymelenberg, D. Cullen, R. N. Spear, B. Schoenike, and J. H. Andrews, BioTechniques 23:686–690, 1997). The transformed strain Ap1 gfp showed bright fluorescence that was amenable to quantification using fluorescence spectrophotometry. Fluorescence levels in Ap1 gfp blastospore suspensions were directly proportional to the number of viable cells determined by CFU plate counts (r2 > 0.99). The relationship between cell viability and GFP fluorescence was investigated by adding a range of concentrations of each of the biocides sodium hypochlorite and 2-n-octylisothiozolin-3-one (OIT) to suspensions of Ap1 gfp blastospores (pH 5 buffer). These biocides each caused a rapid (<25-min) loss of fluorescence of greater than 90% when used at concentrations of 150 μg of available chlorine ml−1 and 500 μg ml−1, respectively. Further, loss of GFP fluorescence from A. pullulans cells was highly correlated with a decrease in the number of viable cells (r2 > 0.92). Losses of GFP fluorescence and cell viability were highly dependent on external pH; maximum losses of fluorescence and viability occurred at pH 4, while reduction of GFP fluorescence was absent at pH 8.0 and was associated with a lower reduction in viability. When A. pullulans was attached to the surface of plasticized poly(vinylchloride) containing 500 ppm of OIT, fluorescence decreased more slowly than in cell suspensions, with >95% loss of fluorescence after 27 h. This technique should have broad applications in testing the susceptibility of A. pullulans and other fungal species to antimicrobial compounds. PMID:11722914

Gene therapy for human glioblastoma using neurotropic JC virus-like particles as a gene delivery vector.

PubMed

Chao, Chun-Nun; Yang, Yu-Hsuan; Wu, Mu-Sheng; Chou, Ming-Chieh; Fang, Chiung-Yao; Lin, Mien-Chun; Tai, Chien-Kuo; Shen, Cheng-Huang; Chen, Pei-Lain; Chang, Deching; Wang, Meilin

2018-02-02

Glioblastoma multiforme (GBM), the most common malignant brain tumor, has a short period of survival even with recent multimodality treatment. The neurotropic JC polyomavirus (JCPyV) infects glial cells and oligodendrocytes and causes fatal progressive multifocal leukoencephalopathy in patients with AIDS. In this study, a possible gene therapy strategy for GBM using JCPyV virus-like particles (VLPs) as a gene delivery vector was investigated. We found that JCPyV VLPs were able to deliver the GFP reporter gene into tumor cells (U87-MG) for expression. In an orthotopic xenograft model, nude mice implanted with U87 cells expressing the near-infrared fluorescent protein and then treated by intratumoral injection of JCPyV VLPs carrying the thymidine kinase suicide gene, combined with ganciclovir administration, exhibited significantly prolonged survival and less tumor fluorescence during the experiment compared with controls. Furthermore, JCPyV VLPs were able to protect and deliver a suicide gene to distal subcutaneously implanted U87 cells in nude mice via blood circulation and inhibit tumor growth. These findings show that metastatic brain tumors can be targeted by JCPyV VLPs carrying a therapeutic gene, thus demonstrating the potential of JCPyV VLPs to serve as a gene therapy vector for the far highly treatment-refractory GBM.

Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity

PubMed Central

Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.

2011-01-01

Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252

Construction of a novel shuttle vector for use in Gluconobacter oxydans.

PubMed

Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming

2010-11-01

A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.

Stable and Efficient Gene Transfer into the Retina Using an HIV-Based Lentiviral Vector

NASA Astrophysics Data System (ADS)

Miyoshi, Hiroyuki; Takahashi, Masayo; Gage, Fred H.; Verma, Inder M.

1997-09-01

The development of methods for efficient gene transfer to terminally differentiated retinal cells is important to study the function of the retina as well as for gene therapy of retinal diseases. We have developed a lentiviral vector system based on the HIV that can transduce terminally differentiated neurons of the brain in vivo. In this study, we have evaluated the ability of HIV vectors to transfer genes into retinal cells. An HIV vector containing a gene encoding the green fluorescent protein (GFP) was injected into the subretinal space of rat eyes. The GFP gene under the control of the cytomegalovirus promoter was efficiently expressed in both photoreceptor cells and retinal pigment epithelium. However, the use of the rhodopsin promoter resulted in expression predominantly in photoreceptor cells. Most successfully transduced eyes showed that photoreceptor cells in >80% of the area of whole retina expressed the GFP. The GFP expression persisted for at least 12 weeks with no apparent decrease. The efficient gene transfer into photoreceptor cells by HIV vectors will be useful for gene therapy of retinal diseases such as retinitis pigmentosa.

Zinc Finger Protein Designed to Target 2-Long Terminal Repeat Junctions Interferes with Human Immunodeficiency Virus Integration

PubMed Central

Sakkhachornphop, Supachai; Barbas, Carlos F.; Keawvichit, Rassamee; Wongworapat, Kanlaya

2012-01-01

Abstract Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine–adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future. PMID:22429108

An infectious recombinant equine arteritis virus expressing green fluorescent protein from its replicase gene.

PubMed

van den Born, Erwin; Posthuma, Clara C; Knoops, Kèvin; Snijder, Eric J

2007-04-01

Thus far, systems developed for heterologous gene expression from the genomes of nidoviruses (arteriviruses and coronaviruses) have relied mainly on the translation of foreign genes from subgenomic mRNAs, whose synthesis is a key feature of the nidovirus life cycle. In general, such expression vectors often suffered from relatively low and unpredictable expression levels, as well as genome instability. In an attempt to circumvent these disadvantages, the possibility to express a foreign gene [encoding enhanced green fluorescent protein (eGFP)] from within the nidovirus replicase gene, which encodes two large polyproteins that are processed proteolytically into the non-structural proteins (nsps) required for viral RNA synthesis, has now been explored. A viable recombinant of the arterivirus Equine arteritis virus, EAV-GFP2, was obtained, which contained the eGFP insert at the site specifying the junction between the two most N-proximal replicase-cleavage products, nsp1 and nsp2. EAV-GFP2 replication could be launched by transfection of cells with either in vitro-generated RNA transcripts or a DNA launch plasmid. EAV-GFP2 displayed growth characteristics similar to those of the wild-type virus and was found to maintain the insert stably for at least eight passages. It is proposed that EAV-GFP2 has potential for arterivirus vector development and as a tool in inhibitor screening. It can also be used for fundamental studies into EAV replication, which was illustrated by the fact that the eGFP signal of EAV-GFP2, which largely originated from an eGFP-nsp2 fusion protein, could be used to monitor the formation of the membrane-bound EAV replication complex in real time.

Stable integration and expression of heterologous genes in several lactobacilli using an integration vector constructed from the integrase and attP sequences of phage ΦAT3 isolated from Lactobacillus casei ATCC 393.

PubMed

Lin, Chao-Fen; Lo, Ta-Chun; Kuo, Yang-Cheng; Lin, Thy-Hou

2013-04-01

An integration vector capable of stably integrating and maintaining in the chromosomes of several lactobacilli over hundreds of generations has been constructed. The major integration machinery used is based on the ΦAT3 integrase (int) and attP sequences determined previously. A novel core sequence located at the 3' end of the tRNA(leu) gene is identified in Lactobacillus fermentum ATCC 14931 as the integration target by the integration vector though most of such sequences found in other lactobacilli are similar to that determined previously. Due to the lack of an appropriate attB site in Lactococcus lactis MG1363, the integration vector is found to be unable to integrate into the chromosome of the strain. However, such integration can be successfully restored by cotransforming the integration vector with a replicative one harboring both attB and erythromycin resistance sequences into the strain. Furthermore, the integration vector constructed carries a promoter region of placT from the chromosome of Lactobacillus rhamnosus TCELL-1 which is used to express green fluorescence and luminance protein genes in the lactobacilli studied.

In vivo imaging of the dynamics of different variants of EGFR in glioblastomas.

PubMed

Shah, Khalid

2011-01-01

A number of altered pathways in cancer cells depend on growth factor receptors. The amplification/alteration of the epidermal growth factor receptor (EGFR) has been shown to play a significant role in enhancing tumor burden in a number of tumors, including malignant glioblastomas (GBM). To dissect the role of EGFR expression in tumor progression in mouse models of cancer and ultimately evaluate targeted therapies, it is necessary to visualize the dynamics of EGFR in real time in vivo. Non-invasive imaging based on quantitative and qualitative changes in light emission by fluorescent and bioluminescent markers offers a huge potential to facilitate drug development. Multiple approaches could be used to follow a molecular target or pathway with the fusion of a bioluminescent-fluorescent marker. This unit describes a protocol for simultaneously imaging EGFR activity and progression of GBM in a mouse model. Human glioma cells transduced with lentiviral vectors bearing different combinations of fluorescent and bioluminescent proteins either fused to EGFR or expressed alone can be grown as monolayers and maintained over several passages. The unit begins with a method for transducing glioma cells with lentiviral vectors for stable expression of these fluorescent and bioluminescent markers in vitro, followed by transplantation of engineered glioma cells in mice, and, finally, sequential bioluminescent imaging of EGFR expression and GBM progression in mice. The protocol details characterization of engineered glioma cells in culture, surgical preparation, craniotomy, cell implantation, animal recovery, and imaging procedures to study kinetics of EGFR expression and GBM progression.

Gene Transfer to Chicks Using Lentiviral Vectors Administered via the Embryonic Chorioallantoic Membrane

PubMed Central

Hen, Gideon; Yosefi, Sara; Shinder, Dmitry; Or, Adi; Mygdal, Sivan; Condiotti, Reba; Galun, Eithan; Bor, Amir; Sela-Donenfeld, Dalit; Friedman-Einat, Miriam

2012-01-01

The lack of affordable techniques for gene transfer in birds has inhibited the advancement of molecular studies in avian species. Here we demonstrate a new approach for introducing genes into chicken somatic tissues by administration of a lentiviral vector, derived from the feline immunodeficiency virus (FIV), into the chorioallantoic membrane (CAM) of chick embryos on embryonic day 11. The FIV-derived vectors carried yellow fluorescent protein (YFP) or recombinant alpha-melanocyte-stimulating hormone (α-MSH) genes, driven by the cytomegalovirus (CMV) promoter. Transgene expression, detected in chicks 2 days after hatch by quantitative real-time PCR, was mostly observed in the liver and spleen. Lower expression levels were also detected in the brain, kidney, heart and breast muscle. Immunofluorescence and flow cytometry analyses confirmed transgene expression in chick tissues at the protein level, demonstrating a transduction efficiency of ∼0.46% of liver cells. Integration of the viral vector into the chicken genome was demonstrated using genomic repetitive (CR1)-PCR amplification. Viability and stability of the transduced cells was confirmed using terminal deoxynucleotidyl transferase (dUTP) nick end labeling (TUNEL) assay, immunostaining with anti-proliferating cell nuclear antigen (anti-PCNA), and detection of transgene expression 51 days post transduction. Our approach led to only 9% drop in hatching efficiency compared to non-injected embryos, and all of the hatched chicks expressed the transgenes. We suggest that the transduction efficiency of FIV vectors combined with the accessibility of the CAM vasculature as a delivery route comprise a new powerful and practical approach for gene delivery into somatic tissues of chickens. Most relevant is the efficient transduction of the liver, which specializes in the production and secretion of proteins, thereby providing an optimal target for prolonged study of secreted hormones and peptides. PMID:22606269

Solid lipid nanoparticle-based vectors intended for the treatment of X-linked juvenile retinoschisis by gene therapy: In vivo approaches in Rs1h-deficient mouse model.

PubMed

Apaolaza, P S; Del Pozo-Rodríguez, A; Torrecilla, J; Rodríguez-Gascón, A; Rodríguez, J M; Friedrich, U; Weber, B H F; Solinís, M A

2015-11-10

X-linked juvenile retinoschisis (XLRS), which results from mutations in the gene RS1 that encodes the protein retinoschisin, is a retinal degenerative disease affecting between 1/5000 and 1/25,000 people worldwide. Currently, there is no cure for this disease and the treatment is based on the application of low-vision aids. The aim of the present work was the in vitro and in vivo evaluation of two different non-viral vectors based on solid lipid nanoparticles (SLNs), protamine and two anionic polysaccharides, hyaluronic acid (HA) or dextran (DX), for the treatment of XLRS. First, the vectors containing a plasmid which encodes both the reporter green fluorescent protein (GFP) and the therapeutic protein retinoschisin, under the control of CMV promoters, were characterized in vitro. Then, the vectors were subretinally or intravitreally administrated to C57BL/6 wild type mice. One week later, GFP was detected in all treated mice and in all retinal layers except in the Outer Nuclear Layer (ONL) and the Inner Nuclear Layer (INL), regardless of the administration route and the vector employed. Finally, two weeks after subretinal or intravitreal injection to Rs1h-deficient mice, GFP and retinoschisin expression was detected in all retinal layers, except in the ONL, which was maintained for at least two months after subretinal administration. The structural analysis of the treated Rs1h-deficient eyes showed a partial recovery of the retina related to the production of retinoschisin. This work shows for the first time a successful RS1 gene transfer to Rs1h-deficient animals using non-viral nanocarriers, with promising results that point to non-viral gene therapy as a feasible future therapeutic tool for retinal disorders.

Polarized fluorescence for skin cancer diagnostic with a multi-aperture camera

NASA Astrophysics Data System (ADS)

Kandimalla, Haripriya; Ramella-Roman, Jessica C.

2008-02-01

Polarized fluorescence has shown some promising results in assessment of skin cancer margins. Researchers have used tetracycline and cross polarization imaging for nonmelanoma skin cancer demarcation as well as investigating endogenous skin polarized fluorescence. In this paper we present a new instrument for polarized fluorescence imaging, able to calculate the full fluorescence Stokes vector in one snapshot. The core of our system is a multi-aperture camera constructed with a two by two lenslet array. Three of the lenses have polarizing elements in front of them, oriented at 0°, + 45°and 90° with respect to light source polarization. A flash lamp combined with a polarizer parallel to the source-camera-sample plane and a UV filter is used as an excitation source. A blue filter in front of the camera system is used to collect only the fluorescent emission of interest and filter out the incident light. In-vitro tests of endogenous and exogenous polarized fluorescence on collagen rich material like bovine tendon were performed and Stokes vector of polarized fluorescence calculated. The system has the advantage of eliminating moving artifacts with the collection of different polarization states and stoke vector in a single snap shot.

Development and Characterization of a Green Fluorescent Protein-Based Bacterial Biosensor for Bioavailable Toluene and Related Compounds†

PubMed Central

Stiner, Lawrence; Halverson, Larry J.

2002-01-01

A green fluorescent protein-based Pseudomonas fluorescens strain A506 biosensor was constructed and characterized for its potential to measure benzene, toluene, ethylbenzene, and related compounds in aqueous solutions. The biosensor is based on a plasmid carrying the toluene-benzene utilization (tbu) pathway transcriptional activator TbuT from Ralstonia pickettii PKO1 and a transcriptional fusion of its promoter PtbuA1 with a promoterless gfp gene on a broad-host-range promoter probe vector. TbuT was not limiting, since it was constitutively expressed by being fused to the neomycin phosphotransferase (nptII) promoter. The biosensor cells were readily induced, and fluorescence emission after induction periods of 3 h correlated well with toluene, benzene, ethylbenzene, and trichloroethylene concentrations. Our experiments using flow cytometry show that intermediate levels of gfp expression in response to toluene reflect uniform induction of cells. As the toluene concentration increases, the level of gfp expression per cell increases until saturation kinetics of the TbuT-PtbuA1 system are observed. Each inducer had a unique minimum concentration that was necessary for induction, with Kapp values that ranged from 3.3 ± 1.8 μM for toluene to 35.6 ± 16.6 μM for trichloroethylene (means ± standard errors of the means), and maximal fluorescence response. The fluorescence response was specific for alkyl-substituted benzene derivatives and branched alkenes (di- and trichloroethylene, 2-methyl-2-butene). The biosensor responded in an additive fashion to the presence of multiple inducers and was unaffected by the presence of compounds that were not inducers, such as those present in gasoline. Flow cytometry revealed that, in response to toxic concentrations of gasoline, there was a small uninduced population and another larger fully induced population whose levels of fluorescence corresponded to the amount of effectors present in the sample. These results demonstrate the potential for green fluorescent protein-based bacterial biosensors to measure environmental contaminants. PMID:11916719

Facile Construction of Random Gene Mutagenesis Library for Directed Evolution Without the Use of Restriction Enzyme in Escherichia coli.

PubMed

Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival

2016-09-01

A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Use of Adenovirus Dodecahedron in the Delivery of an Enzymatic Activity in the Cell

PubMed Central

Sumarheni; Gallet, Benoit; Fender, Pascal

2016-01-01

Penton-dodecahedron (Pt-Dd) derived from adenovirus type 3 is a symmetric complex of pentameric penton base plus fiber which can be produced in the baculovirus system at a high concentration. The size of Pt-Dd is smaller than the virus, but this virus-like particle (VLP) has the major proteins recognized by specific receptors on the surface of almost all types of cell. In this study, by direct observation with fluorescence microscopy on a fixed and living cell, the intracellular trafficking and localization of Pt-Dd labeled with fluorescence dyes in the cytoplasm of HeLa Tub-GFP showed a rapid internalization characteristic. Subsequently, the linkage of horseradish peroxidase (HRP) with Pt-Dd as the vector demonstrated an efficient system to deliver this enzyme into the cell without interfering its enzymatic activity as shown by biochemical and cellular experiments. These results were supported by additional studies using Bs-Dd or free form of the HRP used as the control. Overall, this study strengthens the potential role of Pt-Dd as an alternative vector for delivering therapeutic agents. PMID:27242929

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism.

PubMed

Zhang, Zhenyu; Zhao, Wei; Li, Deshan; Yang, Jinlong; Zsak, Laszlo; Yu, Qingzhong

2015-08-01

In the present study, we developed a novel approach for foreign gene expression by Newcastle disease virus (NDV) from a second ORF through an internal ribosomal entry site (IRES). Six NDV LaSota strain-based recombinant viruses vectoring the IRES and a red fluorescence protein (RFP) gene behind the nucleocapsid (NP), phosphoprotein (P), matrix (M), fusion (F), haemagglutinin-neuraminidase (HN) or large polymerase (L) gene ORF were generated using reverse genetics technology. The insertion of the second ORF slightly attenuated virus pathogenicity, but did not affect ability of the virus to grow. Quantitative measurements of RFP expression in virus-infected DF-1 cells revealed that the abundance of viral mRNAs and red fluorescence intensity were positively correlated with the gene order of NDV, 3'-NP-P-M-F-HN-L-5', proving the sequential transcription mechanism for NDV. The results herein suggest that the level of foreign gene expression could be regulated by selecting the second ORF insertion site to maximize the efficacy of vaccine and gene therapy.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abraitiene, Asta; US Department of Agriculture, Agricultural Research Service, Molecular Plant Pathology Laboratory, Room 214 Building 004 BARC-West, 10300 Baltimore Avenue, Beltsville, MD 20705; Zhao Yan

Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequentmore » GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus.« less

Development of a Reverse Genetic System for Infectious Salmon Anemia Virus: Rescue of Recombinant Fluorescent Virus by Using Salmon Internal Transcribed Spacer Region 1 as a Novel Promoter

PubMed Central

Toro-Ascuy, Daniela; Tambley, Carolina; Beltran, Carolina; Mascayano, Carolina; Sandoval, Nicolas; Olivares, Eduardo; Medina, Rafael A.; Spencer, Eugenio

2014-01-01

Infectious salmon anemia (ISA) is a serious disease of marine-farmed Atlantic salmon (Salmo salar) caused by ISA virus (ISAV), belonging to the genus Isavirus, family Orthomyxoviridae. There is an urgent need to understand the virulence factors and pathogenic mechanisms of ISAV and to develop new vaccine approaches. Using a recombinant molecular biology approach, we report the development of a plasmid-based reverse genetic system for ISAV, which includes the use of a novel fish promoter, the Atlantic salmon internal transcribed spacer region 1 (ITS-1). Salmon cells cotransfected with pSS-URG-based vectors expressing the eight viral RNA segments and four cytomegalovirus (CMV)-based vectors that express the four proteins of the ISAV ribonucleoprotein complex allowed the generation of infectious recombinant ISAV (rISAV). We generated three recombinant viruses, wild-type rISAV901_09 and rISAVrS6-NotI-HPR containing a NotI restriction site and rISAVS6/EGFP-HPR harboring the open reading frame of enhanced green fluorescent protein (EGFP), both within the highly polymorphic region (HPR) of segment 6. All rescued viruses showed replication activity and cytopathic effect in Atlantic salmon kidney-infected cells. The fluorescent recombinant viruses also showed a characteristic cytopathic effect in salmon cells, and the viruses replicated to a titer of 6.5 × 105 PFU/ml, similar to that of the wild-type virus. This novel reverse genetics system offers a powerful tool to study the molecular biology of ISAV and to develop a new generation of ISAV vaccines to prevent and mitigate ISAV infection, which has had a profound effect on the salmon industry. PMID:25480750

Assembly and Functional Analysis of an S/MAR Based Episome with the Cystic Fibrosis Transmembrane Conductance Regulator Gene.

PubMed

De Rocco, Davide; Pompili, Barbara; Castellani, Stefano; Morini, Elena; Cavinato, Luca; Cimino, Giuseppe; Mariggiò, Maria A; Guarnieri, Simone; Conese, Massimo; Del Porto, Paola; Ascenzioni, Fiorentina

2018-04-17

Improving the efficacy of gene therapy vectors is still an important goal toward the development of safe and efficient gene therapy treatments. S/MAR (scaffold/matrix attached region)-based vectors are maintained extra-chromosomally in numerous cell types, which is similar to viral-based vectors. Additionally, when established as an episome, they show a very high mitotic stability. In the present study we tested the idea that addition of an S/MAR element to a CFTR (cystic fibrosis transmembrane conductance regulator) expression vector, may allow the establishment of a CFTR episome in bronchial epithelial cells. Starting from the observation that the S/MAR vector pEPI-EGFP (enhanced green fluorescence protein) is maintained as an episome in human bronchial epithelial cells, we assembled the CFTR vector pBQ-S/MAR. This vector, transfected in bronchial epithelial cells with mutated CFTR , supported long term wt CFTR expression and activity, which in turn positively impacted on the assembly of tight junctions in polarized epithelial cells. Additionally, the recovery of intact pBQ-S/MAR, but not the parental vector lacking the S/MAR element, from transfected cells after extensive proliferation, strongly suggested that pBQ-S/MAR was established as an episome. These results add a new element, the S/MAR, that can be considered to improve the persistence and safety of gene therapy vectors for cystic fibrosis pulmonary disease.

Efficient construction of producer cell lines for a SIN lentiviral vector for SCID-X1 gene therapy by concatemeric array transfection

PubMed Central

Throm, Robert E.; Ouma, Annastasia A.; Zhou, Sheng; Chandrasekaran, Anantharaman; Lockey, Timothy; Greene, Michael; De Ravin, Suk See; Moayeri, Morvarid; Malech, Harry L.; Sorrentino, Brian P.

2009-01-01

Retroviral vectors containing internal promoters, chromatin insulators, and self-inactivating (SIN) long terminal repeats (LTRs) may have significantly reduced genotoxicity relative to the conventional retroviral vectors used in recent, otherwise successful clinical trials. Large-scale production of such vectors is problematic, however, as the introduction of SIN vectors into packaging cells cannot be accomplished with the traditional method of viral transduction. We have derived a set of packaging cell lines for HIV-based lentiviral vectors and developed a novel concatemeric array transfection technique for the introduction of SIN vector genomes devoid of enhancer and promoter sequences in the LTR. We used this method to derive a producer cell clone for a SIN lentiviral vector expressing green fluorescent protein, which when grown in a bioreactor generated more than 20 L of supernatant with titers above 107 transducing units (TU) per milliliter. Further refinement of our technique enabled the rapid generation of whole populations of stably transformed cells that produced similar titers. Finally, we describe the construction of an insulated, SIN lentiviral vector encoding the human interleukin 2 receptor common γ chain (IL2RG) gene and the efficient derivation of cloned producer cells that generate supernatants with titers greater than 5 × 107 TU/mL and that are suitable for use in a clinical trial for X-linked severe combined immunodeficiency (SCID-X1). PMID:19286997

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoo, Masako; Fujita, Ryosuke; Innate Immunity Laboratory, Graduate School of Life Science and Creative Research Institution, Hokkaido University, Sapporo 001-0021

Highlights: •The baculovirus vector infiltrates the cells of economic important fishes. •Drosophila Mos1 transposase expressed in fish cells maintains its ability to localize to the nucleus. •The baculoviral vector carrying Mos1 is a useful tool to stably transform fish cells. -- Abstract: Drosophila Mos1 belongs to the mariner family of transposons, which are one of the most ubiquitous transposons among eukaryotes. We first determined nuclear transportation of the Drosophila Mos1-EGFP fusion protein in fish cell lines because it is required for a function of transposons. We next constructed recombinant baculoviral vectors harboring the Drosophila Mos1 transposon or marker genes locatedmore » between Mos1 inverted repeats. The infectivity of the recombinant virus to fish cells was assessed by monitoring the expression of a fluorescent protein encoded in the viral genome. We detected transgene expression in CHSE-214, HINAE, and EPC cells, but not in GF or RTG-2 cells. In the co-infection assay of the Mos1-expressing virus and reporter gene-expressing virus, we successfully transformed CHSE-214 and HINAE cells. These results suggest that the combination of a baculovirus and Mos1 transposable element may be a tool for transgenesis in fish cells.« less

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

PubMed

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Transgene traceability in transgenic mice: a bioanalytical approach for potential gene-doping analysis.

PubMed

Bogani, Patrizia; Spiriti, Maria Michela; Lazzarano, Stefano; Arcangeli, Annarosa; Buiatti, Marcello; Minunni, Maria

2011-11-01

The World Anti-Doping Agency fears the use of gene doping to enhance athletic performances. Thus, a bioanalytical approach based on end point PCR for detecting markers' of transgenesis traceability was developed. A few sequences from two different vectors using an animal model were selected and traced in different tissues and at different times. In particular, enhanced green fluorescent protein gene and a construct-specific new marker were targeted in the analysis. To make the developed detection approach open to future routine doping analysis, matrices such as urine and tears as well blood were also tested. This study will have impact in evaluating the vector transgenes traceability for the detection of a gene doping event by non-invasive sampling.

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

PubMed Central

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

PubMed

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

Guinea pig adenovirus infection does not inhibit cochlear transfection with human adenoviral vectors in a model of hearing loss.

PubMed

Hankenson, F Claire; Wathen, Asheley B; Eaton, Kathryn A; Miyazawa, Toru; Swiderski, Donald L; Raphael, Yehoash

2010-04-01

Routine surveillance of guinea pigs maintained within a barrier facility detected guinea pig adenovirus (GPAdV) in sentinel animals. These guinea pigs served as models of induced hearing loss followed by regeneration of cochlear sensory (hair) cells through transdifferentiation of nonsensory cells by using human adenoviral (hAV) gene therapy. To determine whether natural GPAdV infection affected the ability of hAV vectors to transfect inner ear cells, adult male pigmented guinea pigs (n = 7) were enrolled in this study because of their prolonged exposure to GPAdV-seropositive conspecifics. Animals were deafened chemically (n = 2), received an hAV vector carrying the gene for green fluorescent protein (hAV-GFP) surgically without prior deafening (n = 2), or were deafened chemically with subsequent surgical inoculation of hAV-GFP (n = 3). Cochleae were evaluated by using fluorescence microscopy, and GFP expression in supporting cells indicated that the hAV-GFP vector was able to transfect inner ears in GPAdV-seropositive guinea pigs that had been chemically deafened. Animals had histologic evidence of interstitial pneumonia, attributable to prior infection with GPAdV. These findings confirmed that the described guinea pigs were less robust animal models with diminished utility for the overall studies. Serology tests confirmed that 5 of 7 animals (71%) were positive for antibodies against GPAdV at necropsy, approximately 7 mo after initial detection of sentinel infection. Control animals (n = 5) were confirmed to be seronegative for GPAdV with clinically normal pulmonary tissue. This study is the first to demonstrate that natural GPAdV infection does not negatively affect transfection with hAV vectors into guinea pig inner ear cells, despite the presence of other health complications attributed to the viral infection.

AAV-mediated targeting of gene expression to the peri-infarct region in rat cortical stroke model.

PubMed

Mätlik, Kert; Abo-Ramadan, Usama; Harvey, Brandon K; Arumäe, Urmas; Airavaara, Mikko

2014-10-30

For stroke patients the recovery of cognitive and behavioral functions is often incomplete. Functional recovery is thought to be mediated largely by connectivity rearrangements in the peri-infarct region. A method for manipulating gene expression in this region would be useful for identifying new recovery-enhancing treatments. We have characterized a way of targeting adeno-associated virus (AAV) vectors to the peri-infarct region of cortical ischemic lesion in rats 2days after middle cerebral artery occlusion (MCAo). We used magnetic resonance imaging (MRI) to show that the altered properties of post-ischemic brain tissue facilitate the spreading of intrastriatally injected nanoparticles toward the infarct. We show that subcortical injection of green fluorescent protein-encoding dsAAV7-GFP resulted in transduction of cells in and around the white matter tract underlying the lesion, and in the cortex proximal to the lesion. A similar result was achieved with dsAAV7 vector encoding the cerebral dopamine neurotrophic factor (CDNF), a protein with therapeutic potential. Viral vector-mediated intracerebral gene delivery has been used before in rodent models of ischemic injury. However, the method of targeting gene expression to the peri-infarct region, after the initial phase of ischemic cell death, has not been described before. We demonstrate a straightforward and robust way to target AAV vector-mediated over-expression of genes to the peri-infarct region in a rat stroke model. This method will be useful for studying the action of specific proteins in peri-infarct region during the recovery process. Copyright © 2014 Elsevier B.V. All rights reserved.

Dual-Color Fluorescence Imaging to Monitor CYP3A4 and CYP3A7 Expression in Human Hepatic Carcinoma HepG2 and HepaRG Cells

PubMed Central

Kubiura, Musashi; Hayashi, Ayaka; Ohbayashi, Tetsuya; Kazuki, Yasuhiro; Chesné, Christophe; Oshimura, Mitsuo; Tada, Masako

2014-01-01

Human adult hepatocytes expressing CYP3A4, a major cytochrome P450 enzyme, are required for cell-based assays to evaluate the potential risk of drug-drug interactions caused by transcriptional induction of P450 enzymes in early-phase drug discovery and development. However, CYP3A7 is preferentially expressed in premature hepatoblasts and major hepatic carcinoma cell lines. The human hepatocellular carcinoma cell line HepaRG possesses a high self-renewal capacity and can differentiate into hepatic cells similar to human adult hepatocytes in vitro. Transgenic HepaRG cells, in which the expression of fluorescent reporters is regulated by 35 kb regulatory elements of CYP3A4, have a distinct advantage over human hepatocytes isolated by collagenase perfusion, which are unstable in culture. Thus, we created transgenic HepaRG and HepG2 cells by replacing the protein-coding regions of human CYP3A4 and CYP3A7 with enhanced green fluorescent protein (EGFP) and DsRed reporters, respectively, in a bacterial artificial chromosome vector that included whole regulatory elements. The intensity of DsRed fluorescence was initially high during the proliferation of transgenic HepaRG cells. However, most EGFP-positive cells were derived from those in which DsRed fluorescence was extinguished. Comparative analyses in these transgenic clones showed that changes in the total fluorescence intensity of EGFP reflected fold changes in the mRNA level of endogenous CYP3A4. Moreover, CYP3A4 induction was monitored by the increase in EGFP fluorescence. Thus, this assay provides a real-time evaluation system for quality assurance of hepatic differentiation into CYP3A4-expressing cells, unfavourable CYP3A4 induction, and fluorescence-activated cell sorting-mediated enrichment of CYP3A4-expressing hepatocytes based on the total fluorescence intensities of fluorescent reporters, without the need for many time-consuming steps. PMID:25101946

Dual-color fluorescence imaging to monitor CYP3A4 and CYP3A7 expression in human hepatic carcinoma HepG2 and HepaRG cells.

PubMed

Tsuji, Saori; Kawamura, Fumihiko; Kubiura, Musashi; Hayashi, Ayaka; Ohbayashi, Tetsuya; Kazuki, Yasuhiro; Chesné, Christophe; Oshimura, Mitsuo; Tada, Masako

2014-01-01

Human adult hepatocytes expressing CYP3A4, a major cytochrome P450 enzyme, are required for cell-based assays to evaluate the potential risk of drug-drug interactions caused by transcriptional induction of P450 enzymes in early-phase drug discovery and development. However, CYP3A7 is preferentially expressed in premature hepatoblasts and major hepatic carcinoma cell lines. The human hepatocellular carcinoma cell line HepaRG possesses a high self-renewal capacity and can differentiate into hepatic cells similar to human adult hepatocytes in vitro. Transgenic HepaRG cells, in which the expression of fluorescent reporters is regulated by 35 kb regulatory elements of CYP3A4, have a distinct advantage over human hepatocytes isolated by collagenase perfusion, which are unstable in culture. Thus, we created transgenic HepaRG and HepG2 cells by replacing the protein-coding regions of human CYP3A4 and CYP3A7 with enhanced green fluorescent protein (EGFP) and DsRed reporters, respectively, in a bacterial artificial chromosome vector that included whole regulatory elements. The intensity of DsRed fluorescence was initially high during the proliferation of transgenic HepaRG cells. However, most EGFP-positive cells were derived from those in which DsRed fluorescence was extinguished. Comparative analyses in these transgenic clones showed that changes in the total fluorescence intensity of EGFP reflected fold changes in the mRNA level of endogenous CYP3A4. Moreover, CYP3A4 induction was monitored by the increase in EGFP fluorescence. Thus, this assay provides a real-time evaluation system for quality assurance of hepatic differentiation into CYP3A4-expressing cells, unfavourable CYP3A4 induction, and fluorescence-activated cell sorting-mediated enrichment of CYP3A4-expressing hepatocytes based on the total fluorescence intensities of fluorescent reporters, without the need for many time-consuming steps.

Production of recombinant protein by a novel oxygen-induced system in Escherichia coli.

PubMed

Baez, Antonino; Majdalani, Nadim; Shiloach, Joseph

2014-04-07

The SoxRS regulon of E. coli is activated in response to elevated dissolved oxygen concentration likely to protect the bacteria from possible oxygen damage. The soxS expression can be increased up to 16 fold, making it a possible candidate for recombinant protein expression. Compared with the existing induction approaches, oxygen induction is advantageous because it does not involve addition or depletion of growth factors or nutrients, addition of chemical inducers or temperature changes that can affect growth and metabolism of the producing bacteria. It also does not affect the composition of the growth medium simplifying the recovery and purification processes. The soxS promoter was cloned into the commercial pGFPmut3.1 plasmid creating pAB49, an expression vector that can be induced by increasing oxygen concentration. The efficiency and the regulatory properties of the soxS promoter were characterized by measuring the GFP expression when the culture dissolved oxygen concentration was increased from 30% to 300% air saturation. The expression level of recombinant GFP was proportional to the oxygen concentration, demonstrating that pAB49 is a controllable expression vector. A possible harmful effect of elevated oxygen concentration on the recombinant product was found to be negligible by determining the protein-carbonyl content and its specific fluorescence. By performing high density growth in modified LB medium, the cells were induced by increasing the oxygen concentration. After 3 hours at 300% air saturation, GFP fluorescence reached 109000 FU (494 mg of GFP/L), representing 3.4% of total protein, and the cell concentration reached 29.1 g/L (DW). Induction of recombinant protein expression by increasing the dissolved oxygen concentration was found to be a simple and efficient alternative expression strategy that excludes the use of chemical, nutrient or thermal inducers that have a potential negative effect on cell growth or the product recovery.

The role of green fluorescent protein (GFP) in transgenic plants to reduce gene silencing phenomena.

PubMed

El-Shemy, Hany A; Khalafalla, Mutasim M; Ishimoto, Masao

2009-01-01

The green fluorescent protein (GFP) of jellyfish (Aequorea victoria) has significant advantages over other reporter genes, because expression can be detected in living cells without any substrates. Recently, epigenetic phenomena are important to consider in plant biotechnology experiments for elucidate unknown mechanism. Therefore, soybean immature cotyledons were generated embryogenesis cells and engineered with two different gene constructs (pHV and pHVS) using gene gun method. Both constructs contain a gene conferring resistance to hygromycin (hpt) as a selective marker and a modified glycinin (11S globulin) gene (V3-1) as a target. However, sGFP(S65T) as a reporter gene was used only in pHVS as a reporter gene for study the relation between using sGFP(S65T) and gene silencing phenomena. Fluorescence microscopic was used for screening after the selection of hygromycin, identified clearly the expression of sGFP(S65T) in the transformed soybean embryos bombarded with the pHVS construct. Protein analysis was used to detect gene expression overall seeds using SDS-PAGE. Percentage of gene down regulation was highly in pHV construct compared with pHVS. Thus, sGFP(S65T ) as a reporter gene in vector system may be play useful role for transgenic evaluation and avoid gene silencing in plants for the benefit of plant transformation system.

A potyvirus vector efficiently targets recombinant proteins to chloroplasts, mitochondria and nuclei in plant cells when expressed at the amino terminus of the polyprotein.

PubMed

Majer, Eszter; Navarro, José-Antonio; Daròs, José-Antonio

2015-09-01

Plant virus-based expression systems allow quick and efficient production of recombinant proteins in plant biofactories. Among them, a system derived from tobacco etch virus (TEV; genus potyvirus) permits coexpression of equimolar amounts of several recombinant proteins. This work analyzed how to target recombinant proteins to different subcellular localizations in the plant cell using this system. We constructed TEV clones in which green fluorescent protein (GFP), with a chloroplast transit peptide (cTP), a nuclear localization signal (NLS) or a mitochondrial targeting peptide (mTP) was expressed either as the most amino-terminal product or embedded in the viral polyprotein. Results showed that cTP and mTP mediated efficient translocation of GFP to the corresponding organelle only when present at the amino terminus of the viral polyprotein. In contrast, the NLS worked efficiently at both positions. Viruses expressing GFP in the amino terminus of the viral polyprotein produced milder symptoms. Untagged GFPs and cTP and NLS tagged amino-terminal GFPs accumulated to higher amounts in infected tissues. Finally, viral progeny from clones with internal GFPs maintained the extra gene better. These observations will help in the design of potyvirus-based vectors able to coexpress several proteins while targeting different subcellular localizations, as required in plant metabolic engineering. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Human transport protein carrier for controlled photoactivation of antitumor prodrug and real-time intracellular tumor imaging.

PubMed

Li, Xi; Mu, Jing; Liu, Fang; Tan, Eddy Wei Ping; Khezri, Bahareh; Webster, Richard D; Yeow, Edwin Kok Lee; Xing, Bengang

2015-05-20

Current anticancer chemotherapy often suffers from poor tumor selectivity and serious drug resistance. Proper vectors for targeted delivery and controlled drug release play crucial roles in improving the therapeutic selectivity to tumor areas and also overcoming the resistance of cancer cells. In this work, we developed a novel human serum albumin (HSA) protein-based nanocarrier system, which combines the photoactivatable Pt(IV) antitumor prodrug for realizing the controlled release and fluorescent light-up probe for evaluations of drug action and efficacy. The constructed Pt(IV)-probe@HSA platform can be locally activated by light irradiation to release the active Pt species, which results in enhanced cell death at both drug-sensitive A2780 and cisplatin-resistant A2780cis cell lines when compared to the free prodrug molecules. Simultaneously, the cytotoxicity caused by light controlled drug release would further lead to the cellular apoptosis and trigger the activation of caspases 3, one crucial protease enzyme in apoptotic process, which could cleave the recognition peptide moiety (DEVD) with a flanking fluorescent resonance energy transfer (FRET) pair containing near-infrared (NIR) fluorophore Cy5 and quencher Qsy21 on the HSA nanocarrier surface. The turn-on fluorescence in response to caspase-3 could be assessed by fluorescence microscopy and flow cytometry analysis. Our results supported the hypothesis that such a unique design may present a successful platform for multiple roles: (i) a biocompatible protein-based nanocarrier for drug delivery, (ii) the controlled drug release with strengthened therapeutic effects, (iii) real-time monitoring of antitumor drug efficacy at the earlier stage.

Three-dimensional cell organization leads to almost immediate HRE activity as demonstrated by molecular imaging of MG-63 spheroids using two-photon excitation microscopy.

PubMed

Indovina, Paola; Collini, Maddalena; Chirico, Giuseppe; Santini, Maria Teresa

2007-02-20

Hypoxia through HRE (hypoxia-responsive element) activity in MG-63 human osteosarcoma cells grown in monolayer and as very small, three-dimensional tumor spheroids was investigated using molecular imaging techniques. MG-63 cells were stably transfected with a vector constructed with multiple copies of the HRE sequence of the human vascular endothelial growth factor (VEGF) gene and with the enhanced green fluorescent protein (EGFP) coding sequence. During hypoxia when HIF-1alpha (hypoxia-inducible factor-1alpha) is stabilized, the binding of HIF-1 to the HRE sequences of the vector allows the transcription of EGFP and the appearance of fluorescence. Transfected monolayer cells were characterized by flow cytometric analysis in response to various hypoxic conditions and HIF-1alpha expression in these cells was assessed by Western blotting. Two-photon excitation (TPE) microscopy was then used to examine both MG-63-transfected monolayer cells and spheroids at 2 and 5 days of growth in normoxic conditions. Monolayer cells reveal almost no fluorescence, whereas even very small spheroids (<100 microm) after 2 days of growth contain regions of high fluorescence. For the first time in the literature, at least to our knowledge, it is demonstrated, using highly sensitive and non-perturbing molecular imaging techniques, that three-dimensional cell organization leads to almost immediate HRE activation. This activation of the HRE sequences, which control a wide variety of genes, suggests that monolayer cells and spheroids of the MG-63 cell line have different genes activated and thus diverse functional activities.

Transducing Airway Basal Cells with a Helper-Dependent Adenoviral Vector for Lung Gene Therapy.

PubMed

Cao, Huibi; Ouyang, Hong; Grasemann, Hartmut; Bartlett, Claire; Du, Kai; Duan, Rongqi; Shi, Fushan; Estrada, Marvin; Seigel, Kyle E; Coates, Allan L; Yeger, Herman; Bear, Christine E; Gonska, Tanja; Moraes, Theo J; Hu, Jim

2018-06-01

A major challenge in developing gene-based therapies for airway diseases such as cystic fibrosis (CF) is sustaining therapeutic levels of transgene expression over time. This is largely due to airway epithelial cell turnover and the host immunogenicity to gene delivery vectors. Modern gene editing tools and delivery vehicles hold great potential for overcoming this challenge. There is currently not much known about how to deliver genes into airway stem cells, of which basal cells are the major type in human airways. In this study, helper-dependent adenoviral (HD-Ad) vectors were delivered to mouse and pig airways via intranasal delivery, and direct bronchoscopic instillation, respectively. Vector transduction was assessed by immunostaining of lung tissue sections, which revealed that airway basal cells of mice and pigs can be targeted in vivo. In addition, efficient transduction of primary human airway basal cells was verified with an HD-Ad vector expressing green fluorescent protein. Furthermore, we successfully delivered the human CFTR gene to airway basal cells from CF patients, and demonstrated restoration of CFTR channel activity following cell differentiation in air-liquid interface culture. Our results provide a strong rationale for utilizing HD-Ad vectors to target airway basal cells for permanent gene correction of genetic airway diseases.

Foamy virus–mediated gene transfer to canine repopulating cells

PubMed Central

Kiem, Hans-Peter; Allen, James; Trobridge, Grant; Olson, Erik; Keyser, Kirsten; Peterson, Laura; Russell, David W.

2007-01-01

Foamy virus (FV) vectors are particularly attractive gene-transfer vectors for stem-cell gene therapy because they form a stable transduction intermediate in quiescent cells and can efficiently transduce hematopoietic stem cells. Here, we studied the use of FV vectors to transduce long-term hematopoietic repopulating cells in the dog, a clinically relevant large animal model. Mobilized canine peripheral blood (PB) CD34+ cells were transduced with an enhanced green fluorescent protein (EGFP)–expressing FV vector in an 18-hour transduction protocol. All 3 dogs studied had rapid neutrophil engraftment to greater than 500/μL with a median of 10 days. Transgene expression was detected in all cell lineages (B cells, T cells, granulocytes, red blood cells, and platelets), indicating multilineage engraftment of transduced cells. Up to 19% of blood cells were EGFP+, and this was confirmed at the DNA level by real-time polymerase chain reaction (PCR) and Southern blot analysis. These transduction rates were higher than the best results we obtained previously with lentiviral vectors in a similar transduction protocol. Integration site analysis also demonstrated polyclonal repopulation and the transduction of multipotential hematopoietic repopulating cells. These data suggest that FV vectors should be useful for stem-cell gene therapy, particularly for applications in which short transduction protocols are critical. PMID:16968897

Multiplexing clonality: combining RGB marking and genetic barcoding

PubMed Central

Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris

2014-01-01

RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916

One-plasmid tunable coexpression for mycobacterial protein–protein interaction studies

PubMed Central

Chang, Yong; Mead, David; Dhodda, Vinay; Brumm, Phil; Fox, Brian G

2009-01-01

A single plasmid that allows controlled coexpression has been developed for use in mycobacteria. The tetracycline inducible promoter, PtetO, was used to provide tetracycline-dependent induction of one gene, while the Psmyc, Pimyc, or Phsp promoters were used to provide three different levels of constitutive expression of a second gene. The functions of these four individual promoters were established using green fluorescent protein (GFP) and a newly identified red fluorescence inducible protein from Geobacillus sterothermophilus strain G1.13 (RFIP) as reporters. The tandem use of GFP and RFIP as reporter genes allowed optimization of the tunable coexpression in Mycobacterium smegmatis; either time at a fixed inducer concentration or changes in inducer concentration could be used to control the protein:protein ratio. This single vector system was used to coexpress the two-protein Mycobacterium tuberculosis stearoyl-CoA Δ9 desaturase complex (integral membrane desaturase Rv3229c and NADPH oxidoreductase Rv3230c) in M. smegmatis. The catalytic activity was found to increase in a manner corresponding to increasing the level of Rv3230c relative to a fixed level of Rv3229c. This system, which can yield finely tuned coexpression of the fatty acid desaturase complex in mycobacteria, may be useful for study of other multicomponent complexes. Furthermore, the tunable coexpression strategy used herein should also be applicable in other species with minor modifications. PMID:19760663

Green fluorescent protein is lighting up fungal biology

USGS Publications Warehouse

Lorang, J.M.; Tuori, R.P; Martinez, J.P; Sawyer, T.L.; Redman, R.S.; Rollins, J. A.; Wolpert, T.J.; Johnson, K.B.; Rodriguez, R.J.; Dickman, M. B.; Ciuffetti, L.M.

2001-01-01

Expression of gfp in filamentous fungi requires agfp variant that is efficiently translated in fungi, a transformation system, and a fungal promoter that satisfies the requirements of a given experimental objective. Transformation of fungi has recently been reviewed by Gold et al. (26). Robinson and Sharon (44) suggest that GFP can actually be used to optimize transformation protocols. In addition to reporting the construction of a new fungal transformation vector that expressesSGFP under the control of the ToxA gene promoter from Pyrenophora tritici-repentis (12) and demonstrating its use in plant pathogens belonging to eight different genera of filamentous fungi (Fusarium, Botrytis, Pyrenophora, Alternaria, Cochliobolus, Sclerotinia, Colletotrichum, andVerticillium), in this review we also enumerate and describe a comprehensive list of vectors for expressing GFP in fungi.

Direct Imaging of ER Calcium with Targeted-Esterase Induced Dye Loading (TED)

PubMed Central

Samtleben, Samira; Jaepel, Juliane; Fecher, Caroline; Andreska, Thomas; Rehberg, Markus; Blum, Robert

2013-01-01

Visualization of calcium dynamics is important to understand the role of calcium in cell physiology. To examine calcium dynamics, synthetic fluorescent Ca2+ indictors have become popular. Here we demonstrate TED (= targeted-esterase induced dye loading), a method to improve the release of Ca2+ indicator dyes in the ER lumen of different cell types. To date, TED was used in cell lines, glial cells, and neurons in vitro. TED bases on efficient, recombinant targeting of a high carboxylesterase activity to the ER lumen using vector-constructs that express Carboxylesterases (CES). The latest TED vectors contain a core element of CES2 fused to a red fluorescent protein, thus enabling simultaneous two-color imaging. The dynamics of free calcium in the ER are imaged in one color, while the corresponding ER structure appears in red. At the beginning of the procedure, cells are transduced with a lentivirus. Subsequently, the infected cells are seeded on coverslips to finally enable live cell imaging. Then, living cells are incubated with the acetoxymethyl ester (AM-ester) form of low-affinity Ca2+ indicators, for instance Fluo5N-AM, Mag-Fluo4-AM, or Mag-Fura2-AM. The esterase activity in the ER cleaves off hydrophobic side chains from the AM form of the Ca2+ indicator and a hydrophilic fluorescent dye/Ca2+ complex is formed and trapped in the ER lumen. After dye loading, the cells are analyzed at an inverted confocal laser scanning microscope. Cells are continuously perfused with Ringer-like solutions and the ER calcium dynamics are directly visualized by time-lapse imaging. Calcium release from the ER is identified by a decrease in fluorescence intensity in regions of interest, whereas the refilling of the ER calcium store produces an increase in fluorescence intensity. Finally, the change in fluorescent intensity over time is determined by calculation of ΔF/F0. PMID:23685703

Direct imaging of ER calcium with targeted-esterase induced dye loading (TED).

PubMed

Samtleben, Samira; Jaepel, Juliane; Fecher, Caroline; Andreska, Thomas; Rehberg, Markus; Blum, Robert

2013-05-07

Visualization of calcium dynamics is important to understand the role of calcium in cell physiology. To examine calcium dynamics, synthetic fluorescent Ca(2+) indictors have become popular. Here we demonstrate TED (= targeted-esterase induced dye loading), a method to improve the release of Ca(2+) indicator dyes in the ER lumen of different cell types. To date, TED was used in cell lines, glial cells, and neurons in vitro. TED bases on efficient, recombinant targeting of a high carboxylesterase activity to the ER lumen using vector-constructs that express Carboxylesterases (CES). The latest TED vectors contain a core element of CES2 fused to a red fluorescent protein, thus enabling simultaneous two-color imaging. The dynamics of free calcium in the ER are imaged in one color, while the corresponding ER structure appears in red. At the beginning of the procedure, cells are transduced with a lentivirus. Subsequently, the infected cells are seeded on coverslips to finally enable live cell imaging. Then, living cells are incubated with the acetoxymethyl ester (AM-ester) form of low-affinity Ca(2+) indicators, for instance Fluo5N-AM, Mag-Fluo4-AM, or Mag-Fura2-AM. The esterase activity in the ER cleaves off hydrophobic side chains from the AM form of the Ca(2+) indicator and a hydrophilic fluorescent dye/Ca(2+) complex is formed and trapped in the ER lumen. After dye loading, the cells are analyzed at an inverted confocal laser scanning microscope. Cells are continuously perfused with Ringer-like solutions and the ER calcium dynamics are directly visualized by time-lapse imaging. Calcium release from the ER is identified by a decrease in fluorescence intensity in regions of interest, whereas the refilling of the ER calcium store produces an increase in fluorescence intensity. Finally, the change in fluorescent intensity over time is determined by calculation of ΔF/F0.

Fluorescence Spectral Properties of All4261 Binding with Phycocyanobilin in E.Coli

NASA Astrophysics Data System (ADS)

Ma, Q.; Zheng, X. J.; Zhou, Z.; Zhou, N.; Zhao, K. H.; Zhou, M.

2014-07-01

Cyanobacteriochromes (CBCRs) are chromophorylated proteins that acting as sensory photoreceptors in cyanobacteria. Based on the bioinformatics of All4261 in Nostoc sp. PCC7120, All4261 is a CBCR apoprotein composed of GAF domains in the N-terminal region. Via polymerase chain reaction with specific primers, All4261 was amplified with genome DNA of Nostoc sp. PCC7120 as template and then subcloned into the expression vector pET30(a+). To survey the fluorescence spectral properties, All4261 was coexpressed with the plasmid that catalyzes phycocyanobilin (PCB) biosynthesis, pACYC-ho1-pcyA, in E.coli BL21. Fluorescence emission spectra and excitation spectra showed that chromophorylated cells containing All4261-PCB had a fluorescence emission peak at 645 nm and a fluorescence excitation peak at 550 nm, but no reversible photoconversion. In order to identify the binding site of PCB in All4261, we obtained three variants All4261(C296L), All4261(C328A), and All4261(C339L), via sitedirected mutagenesis. The binding site was identified as C339 based on the lack of PCB binding of All4261(C339L).

[Tripartite motif-containing protein 34 (TRIM34) colocalized with micronuclei chromosome and hampers its movement to equatorial plate during the metaphase stage of mitosis].

PubMed

Sun, Dakang; An, Xinye; Ji, Bing; Cheng, Yanli; Gao, Honglian; Tian, Mingming

2016-06-01

Objective To examine whether tripartite motif-containing protein 34 (TRIM34) is colocalized with micronuclei and investigate the influence on the movement of micronuclei chromosome in mitosis. Methods The eukaryotic expression vector TRIM34-pEGFP-N3 was constructed, identified and then transfected into HEK293T cells. With 4', 6-diamidino-2-phenylindole 2HCI (DAPI) staining, the colocalization between TRIM34 and micronuclei was observed under a fluorescence microscope. Moreover, MitoTracker(R)Deep Red was used to identify the colocalization between the complex of TRIM34-micronulei and mitochondria under a confocal microscope. Finally, the effect of TRIM34 on the movement of micronuclei chromosome in mitosis was examined. Results DNA sequencing confirmed that the vector TRIM34-pEGFP-N3 was constructed successfully. A fluorescence microscope revealed that TRIM34 could be colocalized with micronuclei in HEK293T cells transfected with TRIM34-pEGFP-N3. In the same manner, a confocal microscope distinctly showed that TRIM34 was colocalized with micronuclei similarly in appearance. However, there was no distinguished colocalization relationship between the complex of TRIM34-micronulei and mitochondria. Interestingly, the micronuclei chromosome conjugated with TRIM34 was hardly transferred to equatorial plate during the metaphase stage of mitosis. Conclusion TRIM34 is colocalized with micronuclei chromosome and hampers its movement to equatorial plate in mitosis.

Useful Bicistronic Reporter System for Studying Poly(A) Site-Defining cis Elements and Regulation of Alternative Polyadenylation.

PubMed

Deng, Zhongyuan; Zhang, Shen; Gu, Shaohua; Ni, Xinzhi; Zeng, Wenxian; Li, Xianchun

2018-01-17

The link between polyadenylation (pA) and various biological, behavioral, and pathological events of eukaryotes underlines the need to develop in vivo polyadenylation assay methods for characterization of the cis -acting elements, trans -acting factors and environmental stimuli that affect polyadenylation efficiency and/or relative usage of two alternative polyadenylation (APA) sites. The current protein-based CAT or luciferase reporter systems can measure the polyadenylation efficiency of a single pA site or candidate cis element but not the choice of two APA sites. To address this issue, we developed a set of four new bicistronic reporter vectors that harbor either two luciferase or fluorescence protein open reading frames connected with one Internal Ribosome Entry Site (IRES). Transfection of single or dual insertion constructs of these vectors into mammalian cells demonstrated that they could be utilized not only to quantify the strength of a single candidate pA site or cis element, but also to accurately measure the relative usage of two APA sites at both the mRNA (qRT-PCR) and protein levels. This represents the first reporter system that can study polyadenylation efficiency of a single pA site or element and regulation of two APA sites at both the mRNA and protein levels.

On Relevance of Codon Usage to Expression of Synthetic and Natural Genes in Escherichia coli

PubMed Central

Supek, Fran; Šmuc, Tomislav

2010-01-01

A recent investigation concluded that codon bias did not affect expression of green fluorescent protein (GFP) variants in Escherichia coli, while stability of an mRNA secondary structure near the 5′ end played a dominant role. We demonstrate that combining the two variables using regression trees or support vector regression yields a biologically plausible model with better support in the GFP data set and in other experimental data: codon usage is relevant for protein levels if the 5′ mRNA structures are not strong. Natural E. coli genes had weaker 5′ mRNA structures than the examined set of GFP variants and did not exhibit a correlation between the folding free energy of 5′ mRNA structures and protein expression. PMID:20421604

Ex Vivo Adenoviral Vector Gene Delivery Results in Decreased Vector-associated Inflammation Pre- and Post–lung Transplantation in the Pig

PubMed Central

Yeung, Jonathan C; Wagnetz, Dirk; Cypel, Marcelo; Rubacha, Matthew; Koike, Terumoto; Chun, Yi-Min; Hu, Jim; Waddell, Thomas K; Hwang, David M; Liu, Mingyao; Keshavjee, Shaf

2012-01-01

Acellular normothermic ex vivo lung perfusion (EVLP) is a novel method of donor lung preservation for transplantation. As cellular metabolism is preserved during perfusion, it represents a potential platform for effective gene transduction in donor lungs. We hypothesized that vector-associated inflammation would be reduced during ex vivo delivery due to isolation from the host immune system response. We compared ex vivo with in vivo intratracheal delivery of an E1-, E3-deleted adenoviral vector encoding either green fluorescent protein (GFP) or interleukin-10 (IL-10) to porcine lungs. Twelve hours after delivery, the lung was transplanted and the post-transplant function assessed. We identified significant transgene expression by 12 hours in both in vivo and ex vivo delivered groups. Lung function remained excellent in all ex vivo groups after viral vector delivery; however, as expected, lung function decreased in the in vivo delivered adenovirus vector encoding GFP (AdGFP) group with corresponding increases in IL-1β levels. Transplanted lung function was excellent in the ex vivo transduced lungs and inferior lung function was seen in the in vivo group after transplantation. In summary, ex vivo delivery of adenoviral gene therapy to the donor lung is superior to in vivo delivery in that it leads to less vector-associated inflammation and provides superior post-transplant lung function. PMID:22453765

Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki

Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS,more » and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.« less

TITER AND PRODUCT AFFECTS THE DISTRIBUTION OF GENE EXPRESSION AFTER INTRAPUTAMINAL CONVECTION-ENHANCED DELIVERY

PubMed Central

Emborg, Marina E.; Hurley, Samuel A.; Joers, Valerie; Tromp, Do P.M.; Swanson, Christine R.; Ohshima-Hosoyama, Sachiko; Bondarenko, Viktorya; Cummisford, Kyle; Sonnemans, Marc; Hermening, Stephan; Blits, Bas; Alexander, Andrew L.

2014-01-01

Background Efficacy and safety of intracerebral gene therapy for brain disorders, like Parkinson’s disease, depends on appropriate distribution of gene expression. Objectives To assess if the distribution of gene expression is affected by vector titer and protein type. Methods Four adult macaque monkeys seronegative for adeno-associated virus 5 (AAV5) received in the right and left ventral postcommisural putamen 30μl inoculation of a high or low titer suspension of AAV5 encoding glial derived neurotrophic factor (GDNF) or green fluorescent protein (GFP). Inoculations were performed using convection enhanced delivery and intraoperative MRI (IMRI). Results IMRI confirmed targeting and infusion cloud irradiating from the catheter tip into surrounding area. Postmortem analysis six weeks after surgery revealed GFP and GDNF expression ipsilateral to the injection side that had a titer-dependent distribution. GFP and GDNF expression was also observed in fibers in the Substantia Nigra (SN) pars reticulata (pr), demonstrating anterograde transport. Few GFP-positive neurons were present in the SN pars compacta (pc), possibly by direct retrograde transport of the vector. GDNF was present in many SNpc and SNpr neurons. Conclusions After controlling for target and infusate volume, intracerebral distribution of gene product is affected by vector titer and product biology. PMID:24943657

A Noninvasive In Vitro Monitoring System Reporting Skeletal Muscle Differentiation.

PubMed

Öztürk-Kaloglu, Deniz; Hercher, David; Heher, Philipp; Posa-Markaryan, Katja; Sperger, Simon; Zimmermann, Alice; Wolbank, Susanne; Redl, Heinz; Hacobian, Ara

2017-01-01

Monitoring of cell differentiation is a crucial aspect of cell-based therapeutic strategies depending on tissue maturation. In this study, we have developed a noninvasive reporter system to trace murine skeletal muscle differentiation. Either a secreted bioluminescent reporter (Metridia luciferase) or a fluorescent reporter (green fluorescent protein [GFP]) was placed under the control of the truncated muscle creatine kinase (MCK) basal promoter enhanced by variable numbers of upstream MCK E-boxes. The engineered pE3MCK vector, coding a triple tandem of E-Boxes and the truncated MCK promoter, showed twentyfold higher levels of luciferase activation compared with a Cytomegalovirus (CMV) promoter. This newly developed reporter system allowed noninvasive monitoring of myogenic differentiation in a straining bioreactor. Additionally, binding sequences of endogenous microRNAs (miRNAs; seed sequences) that are known to be downregulated in myogenesis were ligated as complementary seed sequences into the reporter vector to reduce nonspecific signal background. The insertion of seed sequences improved the signal-to-noise ratio up to 25% compared with pE3MCK. Due to the highly specific, fast, and convenient expression analysis for cells undergoing myogenic differentiation, this reporter system provides a powerful tool for application in skeletal muscle tissue engineering.

Generation of a non-transmissive Borna disease virus vector lacking both matrix and glycoprotein genes.

PubMed

Fujino, Kan; Yamamoto, Yusuke; Daito, Takuji; Makino, Akiko; Honda, Tomoyuki; Tomonaga, Keizo

2017-09-01

Borna disease virus (BoDV), a prototype of mammalian bornavirus, is a non-segmented, negative strand RNA virus that often causes severe neurological disorders in infected animals, including horses and sheep. Unique among animal RNA viruses, BoDV transcribes and replicates non-cytopathically in the cell nucleus, leading to establishment of long-lasting persistent infection. This striking feature of BoDV indicates its potential as an RNA virus vector system. It has previously been demonstrated by our team that recombinant BoDV (rBoDV) lacking an envelope glycoprotein (G) gene develops persistent infections in transduced cells without loss of the viral genome. In this study, a novel non-transmissive rBoDV, rBoDV ΔMG, which lacks both matrix (M) and G genes in the genome, is reported. rBoDV-ΔMG expressing green fluorescence protein (GFP), rBoDV ΔMG-GFP, was efficiently generated in Vero/MG cells stably expressing both BoDV M and G proteins. Infection with rBoDV ΔMG-GFP was persistently maintained in the parent Vero cells without propagation within cell culture. The optimal ratio of M and G for efficient viral particle production by transient transfection of M and G expression plasmids into cells persistently infected with rBoDV ΔMG-GFP was also demonstrated. These findings indicate that the rBoDV ΔMG-based BoDV vector may provide an extremely safe virus vector system and could be a novel strategy for investigating the function of M and G proteins and the host range of bornaviruses. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Virus vector-mediated genetic modification of brain tumor stromal cells after intravenous delivery.

PubMed

Volak, Adrienn; LeRoy, Stanley G; Natasan, Jeya Shree; Park, David J; Cheah, Pike See; Maus, Andreas; Fitzpatrick, Zachary; Hudry, Eloise; Pinkham, Kelsey; Gandhi, Sheetal; Hyman, Bradley T; Mu, Dakai; GuhaSarkar, Dwijit; Stemmer-Rachamimov, Anat O; Sena-Esteves, Miguel; Badr, Christian E; Maguire, Casey A

2018-05-16

The malignant primary brain tumor, glioblastoma (GBM) is generally incurable. New approaches are desperately needed. Adeno-associated virus (AAV) vector-mediated delivery of anti-tumor transgenes is a promising strategy, however direct injection leads to focal transgene spread in tumor and rapid tumor division dilutes out the extra-chromosomal AAV genome, limiting duration of transgene expression. Intravenous (IV) injection gives widespread distribution of AAV in normal brain, however poor transgene expression in tumor, and high expression in non-target cells which may lead to ineffective therapy and high toxicity, respectively. Delivery of transgenes encoding secreted, anti-tumor proteins to tumor stromal cells may provide a more stable and localized reservoir of therapy as they are more differentiated than fast-dividing tumor cells. Reactive astrocytes and tumor-associated macrophage/microglia (TAMs) are stromal cells that comprise a large portion of the tumor mass and are associated with tumorigenesis. In mouse models of GBM, we used IV delivery of exosome-associated AAV vectors driving green fluorescent protein expression by specific promoters (NF-κB-responsive promoter and a truncated glial fibrillary acidic protein promoter), to obtain targeted transduction of TAMs and reactive astrocytes, respectively, while avoiding transgene expression in the periphery. We used our approach to express the potent, yet toxic anti-tumor cytokine, interferon beta, in tumor stroma of a mouse model of GBM, and achieved a modest, yet significant enhancement in survival compared to controls. Noninvasive genetic modification of tumor microenvironment represents a promising approach for therapy against cancers. Additionally, the vectors described here may facilitate basic research in the study of tumor stromal cells in situ.

Efficient production of human acidic fibroblast growth factor in pea (Pisum sativum L.) plants by agroinfection of germinated seeds

PubMed Central

2011-01-01

Background For efficient and large scale production of recombinant proteins in plants transient expression by agroinfection has a number of advantages over stable transformation. Simple manipulation, rapid analysis and high expression efficiency are possible. In pea, Pisum sativum, a Virus Induced Gene Silencing System using the pea early browning virus has been converted into an efficient agroinfection system by converting the two RNA genomes of the virus into binary expression vectors for Agrobacterium transformation. Results By vacuum infiltration (0.08 Mpa, 1 min) of germinating pea seeds with 2-3 cm roots with Agrobacteria carrying the binary vectors, expression of the gene for Green Fluorescent Protein as marker and the gene for the human acidic fibroblast growth factor (aFGF) was obtained in 80% of the infiltrated developing seedlings. Maximal production of the recombinant proteins was achieved 12-15 days after infiltration. Conclusions Compared to the leaf injection method vacuum infiltration of germinated seeds is highly efficient allowing large scale production of plants transiently expressing recombinant proteins. The production cycle of plants for harvesting the recombinant protein was shortened from 30 days for leaf injection to 15 days by applying vacuum infiltration. The synthesized aFGF was purified by heparin-affinity chromatography and its mitogenic activity on NIH 3T3 cells confirmed to be similar to a commercial product. PMID:21548923

Effect of poly and mono-unsaturated fatty acids on stability and structure of recombinant S100A8/A9.

PubMed

Asghari, Hamideh; Chegini, Koorosh Goodarzvand; Amini, Abbas; Gheibi, Nematollah

2016-03-01

Recombinant pET 15b vectors containing the coding sequences S100A8 and S100A9 are expressed in Escherichia coli BL21 (DE3) and purified using Ni-NTA affinity chromatography. The structural changes of S100A8/A9 complex are analyzed upon interaction with poly/mono-unsaturated fatty acids (UFAs). The thermodynamic values, Gibbs free energy and the protein melting point, are obtained through thermal denaturation of protein both with and without UFAs by thermal scanning of protein emission using the fluorescence spectroscopy technique. The far-ultraviolet circular dichroism spectra show that all studied unsaturated fatty acids, including arachidonic, linoleic, alpha-linolenic and oleic acids, induce changes in the secondary structure of S100A8/A9 by reducing the α-helix and β-sheet structures. The tertiary structure of S100A8/A9 has fluctuations in the fluorescence emission spectra after the incubation of protein with UFAs. The blue-shift of emission maximum wavelength and the increase in fluorescence intensity of anilino naphthalene-8-sulfonic acid confirm that the partial unfolding is caused by the conformational changes in the tertiary structure in the presence of UFAs. The structural changes in S100A8/A9 and its lower stability in the presence of UFAs may be necessary for S100A8/A9 to play a biological role in the inflammatory milieu. Copyright © 2015 Elsevier B.V. All rights reserved.

Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

PubMed Central

2013-01-01

Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702

Characterization of the cryptic plasmid pOfk55 from Legionella pneumophila and construction of a pOfk55-derived shuttle vector.

PubMed

Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa

2017-03-01

In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.

Transcriptome analysis of a tau overexpression model in rats implicates an early pro-inflammatory response

PubMed Central

Wang, David B.; Dayton, Robert D.; Zweig, Richard M.; Klein, Ronald L.

2010-01-01

Neurofibrillary tangles comprised of the microtubule-associated protein tau are pathological features of Alzheimer's disease and several other neurodegenerative diseases, such as progressive supranuclear palsy. We previously overexpressed tau in the substantia nigra of rats and mimicked some of the neurodegenerative sequelae that occur in humans such as tangle formation, loss of dopamine neurons, and microgliosis. To study molecular changes involved in the tau-induced disease state, we used DNA microarrays at an early stage of the disease process. A range of adeno-associated virus (AAV9) vector doses for tau were injected in groups of rats with a survival interval of two weeks. Specific decreases in messages for dopamine related genes validated the technique with respect to the dopaminergic cell loss observed. Of the mRNAs upregulated, there was a dose-dependent effect on multiple genes involved in immune response such as chemokines, interferon-inducible genes and leukocyte markers, only in the tau vector groups and not in dose-matched controls of either transgene-less empty vector or control green fluorescent protein vector. Histological staining for dopamine neurons and microglia matched the loss of dopaminergic markers and upregulation of immune response mRNAs in the microarray data, respectively. RT-PCR for selected markers confirmed the microarray results, with similar changes found by either technique. The mRNA data correlate well with previous findings, and underscore microgliosis and immune response in the degenerative process following tau overexpression. PMID:20346943

Evaluation of the reversal of multidrug resistance by MDR1 ribonucleic acid interference in a human colon cancer model using a Renilla luciferase reporter gene and coelenterazine.

PubMed

Jeon, Yong Hyun; Bae, Seon-ae; Lee, Yong Jin; Lee, You La; Lee, Sang-Woo; Yoon, Ghil-Suk; Ahn, Byeong-Cheol; Ha, Jeoung-Hee; Lee, Jaetae

2010-12-01

The reversal effect of multidrug resistance (MDR1) gene expression by adenoviral vector-mediated MDR1 ribonucleic acid interference was assessed in a human colon cancer animal model using bioluminescent imaging with Renilla luciferase (Rluc) gene and coelenterazine, a substrate for Rluc or MDR1 gene expression. A fluorescent microscopic examination demonstrated an increased green fluorescent protein signal in Ad-shMDR1- (recombinant adenovirus that coexpressed MDR1 small hairpin ribonucleic acid [shRNA] and green fluorescent protein) infected HCT-15/Rluc cells in a virus dose-dependent manner. Concurrently, with an increasing administered virus dose (0, 15, 30, 60, and 120 multiplicity of infection), Rluc activity was significantly increased in Ad-shMDR1-infected HCT-15/Rluc cells in a virus dose-dependent manner. In vivo bioluminescent imaging showed about 7.5-fold higher signal intensity in Ad-shMDR1-infected tumors than in control tumors (p < .05). Immunohistologic analysis demonstrated marked reduction of P-glycoprotein expression in infected tumor but not in control tumor. In conclusion, the reversal of MDR1 gene expression by MDR1 shRNA was successfully evaluated by bioluminescence imaging with Rluc activity using an in vivo animal model with a multidrug resistance cancer xenograft.

Transformation of Beauveria bassiana to produce EGFP in Tenebrio molitor for use as animal feed additives.

PubMed

Kim, Jae Su; Choi, Jae Young; Lee, Se Jin; Lee, Ju Hyun; Fu, Zhenli; Skinner, Margaret; Parker, Bruce L; Je, Yeon Ho

2013-07-01

Efforts are underway to develop more effective and safer animal feed additives. Entomopathogenic fungi can be considered practical expression platforms of functional genes within insects which have been used as animal feed additives. In this work, as a model, the enhanced green fluorescent protein (egfp) gene was expressed in yellow mealworms, Tenebrio molitor by highly infective Beauveria bassiana ERL1170. Among seven test isolates, ERL1170 treatment showed 57.1% and 98.3% mortality of mealworms 2 and 5 days after infection, respectively. The fungal transformation vector, pABeG containing the egfp gene, was inserted into the genomic DNA of ERL1170 using the restriction enzyme-mediated integration method. This resulted in the generation of the transformant, Bb-egfp#3, which showed the highest level of fluorescence. Bb-egfp#3-treated mealworms gradually turned dark brown, and in 7-days mealworm sections showed a strong fluorescence. This did not occur in the wild-type strain. This work suggests that further valuable proteins can be efficiently produced in this mealworm-based fungal expression platform, thereby increasing the value of mealworms in the animal feed additive industry. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Efficient Transduction of Human and Rhesus Macaque Primary T Cells by a Modified Human Immunodeficiency Virus Type 1-Based Lentiviral Vector.

PubMed

He, Huan; Xue, Jing; Wang, Weiming; Liu, Lihong; Ye, Chaobaihui; Cong, Zhe; Kimata, Jason T; Qin, Chuan; Zhou, Paul

2017-03-01

Human immunodeficiency virus type 1 (HIV-1)-based lentiviral vectors efficiently transduce genes to human, but not rhesus, primary T cells and hematopoietic stem cells (HSCs). The poor transduction of HIV-1 vectors to rhesus cells is mainly due to species-specific restriction factors such as rhesus TRIM5α. Previously, several strategies to modify HIV-1 vectors were developed to overcome rhesus TRIM5α restriction. While the modified HIV-1 vectors efficiently transduce rhesus HSCs, they remain suboptimal for rhesus primary T cells. Recently, HIV-1 variants that encode combinations of LNEIE mutations in capsid (CA) protein and SIVmac239 Vif were found to replicate efficiently in rhesus primary T cells. Thus, the present study tested whether HIV-1 vectors packaged by a packaging construct containing these CA substitutions could efficiently transduce both human and rhesus primary CD4 T cells. To accomplish this, LNEIE mutations were made in the packaging construct CEMΔ8.9, and recombinant HIV-1 vectors packaged by Δ8.9 WT or Δ8.9 LNEIE were generated. Transduction rates, CA stability, and vector integration in CEMss-CCR5 and CEMss-CCR5-rhTRIM5α/green fluorescent protein cells, as well as transduction rates in human and rhesus primary CD4 T cells by Δ8.9 WT or Δ8.9 LNEIE-packaged HIV-1 vectors, were compared. Finally, the influence of rhesus TRIM5α variations in transduction rates to primary CD4 T cells from a cohort of 37 Chinese rhesus macaques was studied. While it maintains efficient transduction for human T-cell line and primary CD4 T cells, Δ8.9 LNEIE-packaged HIV-1 vector overcomes rhesus TRIM5α-mediated CA degradation, resulting in significantly higher transduction efficiency of rhesus primary CD4 T cells than Δ8.9 WT-packaged HIV-1 vector. Rhesus TRIM5α variations strongly influence transduction efficiency of rhesus primary CD4 T cells by both Δ8.9 WT or Δ8.9 LNEIE-packaged HIV-1 vectors. Thus, it is concluded that Δ8.9 LNEIE-packaged HIV-1 vector overcomes rhesus TRIM5α restriction and efficiently transduces both human and rhesus primary T cells.

Efficient Transduction of Human and Rhesus Macaque Primary T Cells by a Modified Human Immunodeficiency Virus Type 1–Based Lentiviral Vector

PubMed Central

He, Huan; Xue, Jing; Wang, Weiming; Liu, Lihong; Ye, Chaobaihui; Cong, Zhe; Kimata, Jason T.; Qin, Chuan; Zhou, Paul

2017-01-01

Human immunodeficiency virus type 1 (HIV-1)-based lentiviral vectors efficiently transduce genes to human, but not rhesus, primary T cells and hematopoietic stem cells (HSCs). The poor transduction of HIV-1 vectors to rhesus cells is mainly due to species-specific restriction factors such as rhesus TRIM5α. Previously, several strategies to modify HIV-1 vectors were developed to overcome rhesus TRIM5α restriction. While the modified HIV-1 vectors efficiently transduce rhesus HSCs, they remain suboptimal for rhesus primary T cells. Recently, HIV-1 variants that encode combinations of LNEIE mutations in capsid (CA) protein and SIVmac239 Vif were found to replicate efficiently in rhesus primary T cells. Thus, the present study tested whether HIV-1 vectors packaged by a packaging construct containing these CA substitutions could efficiently transduce both human and rhesus primary CD4 T cells. To accomplish this, LNEIE mutations were made in the packaging construct CEMΔ8.9, and recombinant HIV-1 vectors packaged by Δ8.9 WT or Δ8.9 LNEIE were generated. Transduction rates, CA stability, and vector integration in CEMss-CCR5 and CEMss-CCR5-rhTRIM5α/green fluorescent protein cells, as well as transduction rates in human and rhesus primary CD4 T cells by Δ8.9 WT or Δ8.9 LNEIE-packaged HIV-1 vectors, were compared. Finally, the influence of rhesus TRIM5α variations in transduction rates to primary CD4 T cells from a cohort of 37 Chinese rhesus macaques was studied. While it maintains efficient transduction for human T-cell line and primary CD4 T cells, Δ8.9 LNEIE-packaged HIV-1 vector overcomes rhesus TRIM5α-mediated CA degradation, resulting in significantly higher transduction efficiency of rhesus primary CD4 T cells than Δ8.9 WT-packaged HIV-1 vector. Rhesus TRIM5α variations strongly influence transduction efficiency of rhesus primary CD4 T cells by both Δ8.9 WT or Δ8.9 LNEIE-packaged HIV-1 vectors. Thus, it is concluded that Δ8.9 LNEIE-packaged HIV-1 vector overcomes rhesus TRIM5α restriction and efficiently transduces both human and rhesus primary T cells. PMID:28042947

Paratransgenesis to control malaria vectors: a semi-field pilot study.

PubMed

Mancini, Maria Vittoria; Spaccapelo, Roberta; Damiani, Claudia; Accoti, Anastasia; Tallarita, Mario; Petraglia, Elisabetta; Rossi, Paolo; Cappelli, Alessia; Capone, Aida; Peruzzi, Giulia; Valzano, Matteo; Picciolini, Matteo; Diabaté, Abdoulaye; Facchinelli, Luca; Ricci, Irene; Favia, Guido

2016-03-10

Malaria still remains a serious health burden in developing countries, causing more than 1 million deaths annually. Given the lack of an effective vaccine against its major etiological agent, Plasmodium falciparum, and the growing resistance of this parasite to the currently available drugs repertoire and of Anopheles mosquitoes to insecticides, the development of innovative control measures is an imperative to reduce malaria transmission. Paratransgenesis, the modification of symbiotic organisms to deliver anti-pathogen effector molecules, represents a novel strategy against Plasmodium development in mosquito vectors, showing the potential to reduce parasite development. However, the field application of laboratory-based evidence of paratransgenesis imposes the use of more realistic confined semi-field environments. Large cages were used to evaluate the ability of bacteria of the genus Asaia expressing green fluorescent protein (Asaia (gfp)), to diffuse in Anopheles stephensi and Anopheles gambiae target mosquito populations. Asaia (gfp) was introduced in large cages through the release of paratransgenic males or by sugar feeding stations. Recombinant bacteria transmission was directly detected by fluorescent microscopy, and further assessed by molecular analysis. Here we show the first known trial in semi-field condition on paratransgenic anophelines. Modified bacteria were able to spread at high rate in different populations of An. stephensi and An. gambiae, dominant malaria vectors, exploring horizontal ways and successfully colonising mosquito midguts. Moreover, in An. gambiae, vertical and trans-stadial diffusion mechanisms were demonstrated. Our results demonstrate the considerable ability of modified Asaia to colonise different populations of malaria vectors, including pecies where its association is not primary, in large environments. The data support the potential to employ transgenic Asaia as a tool for malaria control, disclosing promising perspective for its field application with suitable effector molecules.

Membrane Topology Mapping of the Na+-Pumping NADH: Quinone Oxidoreductase from Vibrio cholerae by PhoA- Green Fluorescent Protein Fusion Analysis▿

PubMed Central

Duffy, Ellen B.; Barquera, Blanca

2006-01-01

The membrane topologies of the six subunits of Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from Vibrio cholerae were determined by a combination of topology prediction algorithms and the construction of C-terminal fusions. Fusion expression vectors contained either bacterial alkaline phosphatase (phoA) or green fluorescent protein (gfp) genes as reporters of periplasmic and cytoplasmic localization, respectively. A majority of the topology prediction algorithms did not predict any transmembrane helices for NqrA. A lack of PhoA activity when fused to the C terminus of NqrA and the observed fluorescence of the green fluorescent protein C-terminal fusion confirm that this subunit is localized to the cytoplasmic side of the membrane. Analysis of four PhoA fusions for NqrB indicates that this subunit has nine transmembrane helices and that residue T236, the binding site for flavin mononucleotide (FMN), resides in the cytoplasm. Three fusions confirm that the topology of NqrC consists of two transmembrane helices with the FMN binding site at residue T225 on the cytoplasmic side. Fusion analysis of NqrD and NqrE showed almost mirror image topologies, each consisting of six transmembrane helices; the results for NqrD and NqrE are consistent with the topologies of Escherichia coli homologs YdgQ and YdgL, respectively. The NADH, flavin adenine dinucleotide, and Fe-S center binding sites of NqrF were localized to the cytoplasm. The determination of the topologies of the subunits of Na+-NQR provides valuable insights into the location of cofactors and identifies targets for mutagenesis to characterize this enzyme in more detail. The finding that all the redox cofactors are localized to the cytoplasmic side of the membrane is discussed. PMID:17041063

Amplified and persistent immune responses generated by single-cycle replicating adenovirus vaccines.

PubMed

Crosby, Catherine M; Nehete, Pramod; Sastry, K Jagannadha; Barry, Michael A

2015-01-01

Replication-competent adenoviral (RC-Ad) vectors generate exceptionally strong gene-based vaccine responses by amplifying the antigen transgenes they carry. While they are potent, they also risk causing adenovirus infections. More common replication-defective Ad (RD-Ad) vectors with deletions of E1 avoid this risk but do not replicate their transgene and generate markedly weaker vaccine responses. To amplify vaccine transgenes while avoiding production of infectious progeny viruses, we engineered "single-cycle" adenovirus (SC-Ad) vectors by deleting the gene for IIIa capsid cement protein of lower-seroprevalence adenovirus serotype 6. In mouse, human, hamster, and macaque cells, SC-Ad6 still replicated its genome but prevented genome packaging and virion maturation. When used for mucosal intranasal immunization of Syrian hamsters, both SC-Ad and RC-Ad expressed transgenes at levels hundreds of times higher than that of RD-Ad. Surprisingly, SC-Ad, but not RC-Ad, generated higher levels of transgene-specific antibody than RD-Ad, which notably climbed in serum and vaginal wash samples over 12 weeks after single mucosal immunization. When RD-Ad and SC-Ad were tested by single sublingual immunization in rhesus macaques, SC-Ad generated higher gamma interferon (IFN-γ) responses and higher transgene-specific serum antibody levels. These data suggest that SC-Ad vectors may have utility as mucosal vaccines. This work illustrates the utility of our recently developed single-cycle adenovirus (SC-Ad6) vector as a new vaccine platform. Replication-defective (RD-Ad6) vectors produce low levels of transgene protein, which leads to minimal antibody responses in vivo. This study shows that replicating SC-Ad6 produces higher levels of luciferase and induces higher levels of green fluorescent protein (GFP)-specific antibodies than RD in a permissive Syrian hamster model. Surprisingly, although a replication-competent (RC-Ad6) vector produces more luciferase than SC-Ad6, it does not elicit comparable levels of anti-GFP antibodies in permissive hamsters. When tested in the larger rhesus macaque model, SC-Ad6 induces higher transgene-specific antibody and T cell responses. Together, these data suggest that SC-Ad6 could be a more effective platform for developing vaccines against more relevant antigens. This could be especially beneficial for developing vaccines for pathogens for which traditional replication-defective adenovirus vectors have not been effective. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Three-Dimensional Imaging of the Intracellular Fate of Plasmid DNA and Transgene Expression: ZsGreen1 and Tissue Clearing Method CUBIC Are an Optimal Combination for Multicolor Deep Imaging in Murine Tissues.

PubMed

Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru

2016-01-01

Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.

Functional expression of Ca²⁺ dependent mammalian transmembrane gap junction protein Cx43 in slime mold Dictyostelium discoideum.

PubMed

Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu

2012-03-09

In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms. Copyright © 2012 Elsevier Inc. All rights reserved.

Direct Evidence of Egestion and Salivation of Xylella fastidiosa Suggests Sharpshooters Can Be "Flying Syringes".

PubMed

Backus, Elaine A; Shugart, Holly J; Rogers, Elizabeth E; Morgan, J Kent; Shatters, Robert

2015-05-01

Xylella fastidiosa is unique among insect-transmitted plant pathogens because it is propagative but noncirculative, adhering to and multiplying on the cuticular lining of the anterior foregut. Any inoculation mechanism for X. fastidiosa must explain how bacterial cells exit the vector's stylets via the food canal and directly enter the plant. A combined egestion-salivation mechanism has been proposed to explain these unique features. Egestion is the putative outward flow of fluid from the foregut via hypothesized bidirectional pumping of the cibarium. The present study traced green fluorescent protein-expressing X. fastidiosa or fluorescent nanoparticles acquired from artificial diets by glassy-winged sharpshooters, Homalodisca vitripennis, as they were egested into simultaneously secreted saliva. X. fastidiosa or nanoparticles were shown to mix with gelling saliva to form fluorescent deposits and salivary sheaths on artificial diets, providing the first direct, conclusive evidence of egestion by any hemipteran insect. Therefore, the present results strongly support an egestion-salivation mechanism of X. fastidiosa inoculation. Results also support that a column of fluid is transiently held in the foregut without being swallowed. Evidence also supports (but does not definitively prove) that bacteria were suspended in the column of fluid during the vector's transit from diet to diet, and were egested with the held fluid. Thus, we hypothesize that sharpshooters could be true "flying syringes," especially when inoculation occurs very soon after uptake of bacteria, suggesting the new paradigm of a nonpersistent X. fastidiosa transmission mechanism.

Development of canine herpesvirus based antifertility vaccines for foxes using bacterial artificial chromosomes.

PubMed

Strive, Tanja; Hardy, Christopher M; French, Nigel; Wright, John D; Nagaraja, Nitin; Reubel, Gerhard H

2006-02-13

Using bacterial artificial chromosome (BAC) technology, a canine herpesvirus (CHV)-based recombinant vaccine vector was produced for the development of an antifertility vaccine for foxes. Infectious viruses were recovered following transfection of canid cells with a BAC plasmid carrying the complete CHV genome. In vitro growth characteristics of BAC-derived viruses were similar to that of wildtype (wt)-CHV. Two recombinant antigens, fox zona pellucida protein subunit 3 (fZPC) and enhanced green fluorescent protein (EGFP) as control antigen, were inserted into thymidine kinase (TK) locus of the CHV genome and shown to be efficiently expressed in vitro. Inoculation of foxes with transgenic CHVs induced CHV specific antibodies, but was innocuous and failed to elicit transgene-specific antibody responses. Infectious virus or viral DNA was not detected in mucosal secretions or tissues of vaccinated foxes. The CHV-BAC system proved to be a quick and reliable method to manipulate the CHV genome. It will help to readily apply changes in the vector design in order to improve virus replication in vivo.

The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

PubMed

Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

2012-12-01

The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

Restoration of visual response in aged dystrophic RCS rats using AAV-mediated channelopsin-2 gene transfer.

PubMed

Tomita, Hiroshi; Sugano, Eriko; Yawo, Hiromu; Ishizuka, Toru; Isago, Hitomi; Narikawa, Satoko; Kügler, Sebastian; Tamai, Makoto

2007-08-01

To investigate whether the channelopsin-2 (Chop2) gene would restore visual responses in 10-month-old dystrophic Royal College of Surgeons (aged RCS; rdy/rdy) rats, the authors transferred the Chop2 gene into the retinal cells of aged RCS rats using the adenoassociated virus (AAV) vector. The N-terminal fragment (residues 1-315) of Chop2 was fused to a fluorescent protein, Venus, in frame at the end of the Chop2 coding fragment. The viral vector construct (AAV-Chop2V) for the expression of the Chop2V in the retina was made by subcloning into an adenoassociated virus vector, including the CAG promoter. To evaluate the expression profile of Chop2V in the retina, the rats were killed and the eyes were removed and fixed with 4% paraformaldehyde in 0.1 M phosphate-buffered saline. Retinal wholemount specimens and cryosections were made. Under anesthetized conditions, electrodes for the recording of visually evoked potentials (VEPs) were implanted onto the visual cortex in aged-RCS (rdy/rdy) rats. AAV-Chop2V vectors were then injected into the vitreous cavity of the left eyes. As a control, AAV-Venus vectors were applied to the right eyes. VEPs were evoked by the flash of a blue, white, or red light-emitting diode (LED) and were recorded from the visual cortex of the rats at various time points after the AAV vector injection. Chop2V fluorescence was predominantly observed in retinal ganglion cells (RGCs). Some fluorescence was observed in the inner nuclear layer and the inner plexiform layer neurites. A tendency of recovery was observed in the VEPs of aged RCS (rdy/rdy) rats after the AAV-Chop2V injection but not after the AAV-Venus injection. The visual response of AAV-Chop2V-injected aged RCS (rdy/rdy) rats was less sensitive to the blue LED flash than that of nondystrophic RCS (+/+) rats. The AAV-Chop2V-injected aged RCS (rdy/rdy) rats were insensitive to the red LED flash, which evoked a robust VEP in the RCS (+/+) rats. The visual response of aged RCS (rdy/rdy) rats was partially restored by transduction of the Chop2 gene through AAV into the inner retinal neurons, mainly RGCs. These results suggest that the transduction of Chop2 would provide a new strategy to treat some retinitis pigmentosa (RP) symptoms independent of their etiology.

Real-time functional imaging for monitoring miR-133 during myogenic differentiation.

PubMed

Kato, Yoshio; Miyaki, Shigeru; Yokoyama, Shigetoshi; Omori, Shin; Inoue, Atsushi; Horiuchi, Machiko; Asahara, Hiroshi

2009-11-01

MicroRNAs (miRNAs) are a class of non-coding small RNAs that act as negative regulators of gene expression through sequence-specific interactions with the 3' untranslated regions (UTRs) of target mRNA and play various biological roles. miR-133 was identified as a muscle-specific miRNA that enhanced the proliferation of myoblasts during myogenic differentiation, although its activity in myogenesis has not been fully characterized. Here, we developed a novel retroviral vector system for monitoring muscle-specific miRNA in living cells by using a green fluorescent protein (GFP) that is connected to the target sequence of miR-133 via the UTR and a red fluorescent protein for normalization. We demonstrated that the functional promotion of miR-133 during myogenesis is visualized by the reduction of GFP carrying the miR-133 target sequence, suggesting that miR-133 specifically down-regulates its targets during myogenesis in accordance with its expression. Our cell-based miRNA functional assay monitoring miR-133 activity should be a useful tool in elucidating the role of miRNAs in various biological events.

Emission spectra profiling of fluorescent proteins in living plant cells

PubMed Central

2013-01-01

Background Fluorescence imaging at high spectral resolution allows the simultaneous recording of multiple fluorophores without switching optical filters, which is especially useful for time-lapse analysis of living cells. The collected emission spectra can be used to distinguish fluorophores by a computation analysis called linear unmixing. The availability of accurate reference spectra for different fluorophores is crucial for this type of analysis. The reference spectra used by plant cell biologists are in most cases derived from the analysis of fluorescent proteins in solution or produced in animal cells, although these spectra are influenced by both the cellular environment and the components of the optical system. For instance, plant cells contain various autofluorescent compounds, such as cell wall polymers and chlorophyll, that affect the spectral detection of some fluorophores. Therefore, it is important to acquire both reference and experimental spectra under the same biological conditions and through the same imaging systems. Results Entry clones (pENTR) of fluorescent proteins (FPs) were constructed in order to create C- or N-terminal protein fusions with the MultiSite Gateway recombination technology. The emission spectra for eight FPs, fused C-terminally to the A- or B-type cyclin dependent kinases (CDKA;1 and CDKB1;1) and transiently expressed in epidermal cells of tobacco (Nicotiana benthamiana), were determined by using the Olympus FluoView™ FV1000 Confocal Laser Scanning Microscope. These experimental spectra were then used in unmixing experiments in order to separate the emission of fluorophores with overlapping spectral properties in living plant cells. Conclusions Spectral imaging and linear unmixing have a great potential for efficient multicolor detection in living plant cells. The emission spectra for eight of the most commonly used FPs were obtained in epidermal cells of tobacco leaves and used in unmixing experiments. The generated set of FP Gateway entry vectors represents a valuable resource for plant cell biologists. PMID:23552272

A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo

PubMed Central

White, Melanie D.; Milne, Ruth V. J.; Nolan, Matthew F.

2011-01-01

We introduce a molecular toolbox for manipulation of neuronal gene expression in vivo. The toolbox includes promoters, ion channels, optogenetic tools, fluorescent proteins, and intronic artificial microRNAs. The components are easily assembled into adeno-associated virus (AAV) or lentivirus vectors using recombination cloning. We demonstrate assembly of toolbox components into lentivirus and AAV vectors and use these vectors for in vivo expression of inwardly rectifying potassium channels (Kir2.1, Kir3.1, and Kir3.2) and an artificial microRNA targeted against the ion channel HCN1 (HCN1 miRNA). We show that AAV assembled to express HCN1 miRNA produces efficacious and specific in vivo knockdown of HCN1 channels. Comparison of in vivo viral transduction using HCN1 miRNA with mice containing a germ line deletion of HCN1 reveals similar physiological phenotypes in cerebellar Purkinje cells. The easy assembly and re-usability of the toolbox components, together with the ability to up- or down-regulate neuronal gene expression in vivo, may be useful for applications in many areas of neuroscience. PMID:21772812

Optimization of the transductional efficiency of lentiviral vectors: effect of sera and polycations

PubMed Central

Denning, Warren; Das, Suvendu; Guo, Siqi; Xu, Jun; Kappes, John C.; Hel, Zdenek

2012-01-01

Lentiviral vectors are widely used as effective gene-delivery vehicles. Optimization of the conditions for efficient lentiviral transduction is of a high importance for a variety of research applications. Presence of positively-charged polycations reduces the electrostatic repulsion forces between a negatively-charged cell and an approaching enveloped lentiviral particle resulting in an increase in the transduction efficiency. Although a variety of polycations are commonly used to enhance the transduction with retroviruses, the relative effect of various types of polycations on the efficiency of transduction and on the potential bias in the determination of titer of lentiviral vectors is not fully understood. Here we present data suggesting that DEAE-dextran provides superior results in enhancing lentiviral transduction of most tested cell lines and primary cell cultures. Specific type and source of serum affects the efficiency of transduction of target cell populations. Non-specific binding of enhanced green fluorescent protein (EGFP)-containing membrane aggregates in the presence of DEAE-dextran does not significantly affect the determination of the titer of EGFP-expressing lentiviral vectors. In conclusion, various polycations and types of sera should be tested when optimizing lentiviral transduction of target cell populations. PMID:22407723

Optimization of the transductional efficiency of lentiviral vectors: effect of sera and polycations.

PubMed

Denning, Warren; Das, Suvendu; Guo, Siqi; Xu, Jun; Kappes, John C; Hel, Zdenek

2013-03-01

Lentiviral vectors are widely used as effective gene-delivery vehicles. Optimization of the conditions for efficient lentiviral transduction is of a high importance for a variety of research applications. Presence of positively charged polycations reduces the electrostatic repulsion forces between a negatively charged cell and an approaching enveloped lentiviral particle resulting in an increase in the transduction efficiency. Although a variety of polycations are commonly used to enhance the transduction with retroviruses, the relative effect of various types of polycations on the efficiency of transduction and on the potential bias in the determination of titer of lentiviral vectors is not fully understood. Here, we present data suggesting that DEAE-dextran provides superior results in enhancing lentiviral transduction of most tested cell lines and primary cell cultures. Specific type and source of serum affects the efficiency of transduction of target cell populations. Non-specific binding of enhanced green fluorescent protein (EGFP)-containing membrane aggregates in the presence of DEAE-dextran does not significantly affect the determination of the titer of EGFP-expressing lentiviral vectors. In conclusion, various polycations and types of sera should be tested when optimizing lentiviral transduction of target cell populations.

Conditional Cytotoxic Anti-HIV Gene Therapy for Selectable Cell Modification

PubMed Central

Garg, Himanshu; Joshi, Anjali

2016-01-01

Gene therapy remains one of the potential strategies to achieve a cure for HIV infection. One of the major limitations of anti-HIV gene therapy concerns recovering an adequate number of modified cells to generate an HIV-proof immune system. Our study addresses this issue by developing a methodology that can mark conditional vector-transformed cells for selection and subsequently target HIV-infected cells for elimination by treatment with ganciclovir (GCV). We used the herpes simplex virus thymidine kinase (TK) mutant SR39, which is highly potent at killing cells at low GCV concentrations. This gene was cloned into a conditional HIV vector, pNL-GFPRRESA, which expresses the gene of interest as well as green fluorescent protein (GFP) in the presence of HIV Tat protein. We show here that TK-SR39 was more potent that wild-type TK (TK-WT) at eliminating infected cells at lower concentrations of GCV. As the vector expresses GFP in the presence of Tat, transient expression of Tat either by Tat RNA transfection or transduction by a nonintegrating lentiviral (NIL) vector marked the cells with GFP for selection. In cells selected by this strategy, TK-SR39 was more potent at limiting virus replication than TK-WT. Finally, in Jurkat cells modified and selected by this approach, infection with CXCR4-tropic Lai virus could be suppressed by treatment with GCV. GCV treatment limited the number of HIV-infected cells, virus production, as well as virus-induced cytopathic effects in this model. We provide proof of principle that TK-SR39 in a conditional HIV vector can provide a safe and effective anti-HIV strategy. PMID:26800572

Conditional Cytotoxic Anti-HIV Gene Therapy for Selectable Cell Modification.

PubMed

Garg, Himanshu; Joshi, Anjali

2016-05-01

Gene therapy remains one of the potential strategies to achieve a cure for HIV infection. One of the major limitations of anti-HIV gene therapy concerns recovering an adequate number of modified cells to generate an HIV-proof immune system. Our study addresses this issue by developing a methodology that can mark conditional vector-transformed cells for selection and subsequently target HIV-infected cells for elimination by treatment with ganciclovir (GCV). We used the herpes simplex virus thymidine kinase (TK) mutant SR39, which is highly potent at killing cells at low GCV concentrations. This gene was cloned into a conditional HIV vector, pNL-GFPRRESA, which expresses the gene of interest as well as green fluorescent protein (GFP) in the presence of HIV Tat protein. We show here that TK-SR39 was more potent that wild-type TK (TK-WT) at eliminating infected cells at lower concentrations of GCV. As the vector expresses GFP in the presence of Tat, transient expression of Tat either by Tat RNA transfection or transduction by a nonintegrating lentiviral (NIL) vector marked the cells with GFP for selection. In cells selected by this strategy, TK-SR39 was more potent at limiting virus replication than TK-WT. Finally, in Jurkat cells modified and selected by this approach, infection with CXCR4-tropic Lai virus could be suppressed by treatment with GCV. GCV treatment limited the number of HIV-infected cells, virus production, as well as virus-induced cytopathic effects in this model. We provide proof of principle that TK-SR39 in a conditional HIV vector can provide a safe and effective anti-HIV strategy.

[Transient expression and characterization of intracellular single chain Fv against the nucleocapsid protein of Hantavirus].

PubMed

Bai, Wen-tao; Xu, Zhi-kai; Zhang, Fang-lin; Luo, Wen; Liu, Yong; Wu, Xing-an; Yan, Yan

2004-11-01

To transiently express an intracellular single chain Fv of monoclonal antibody 1A8 against nucleocapsid protein of Hantavirus and characterize the immunological activities of the expressed products. COS-7 cells were transfected with mammalian expression vector 1A8-scFv-Ckappa/pCI-neo via lipofectin. The expressed product was identified by indirect immunofluorescence and immunoprecipitation. A diffuse pattern fluorescence was observed in less than 1% cytoplasm of transfected COS-7 cells. The binding of intracellular antibody fragments to NP antigen was confirmed by immunoprecipitation analysis. Transiently expressed single chain intrabodies can effectively target NP antigen in the cytoplasm. The present study may provide a new approach for treatment of Hantavirus.

Transient Expression and Cellular Localization of Recombinant Proteins in Cultured Insect Cells.

PubMed

Fabrick, Jeffrey A; Hull, J Joe

2017-04-20

Heterologous protein expression systems are used for the production of recombinant proteins, the interpretation of cellular trafficking/localization, and the determination of the biochemical function of proteins at the sub-organismal level. Although baculovirus expression systems are increasingly used for protein production in numerous biotechnological, pharmaceutical, and industrial applications, nonlytic systems that do not involve viral infection have clear benefits but are often overlooked and underutilized. Here, we describe a method for generating nonlytic expression vectors and transient recombinant protein expression. This protocol allows for the efficient cellular localization of recombinant proteins and can be used to rapidly discern protein trafficking within the cell. We show the expression of four recombinant proteins in a commercially available insect cell line, including two aquaporin proteins from the insect Bemisia tabaci, as well as subcellular marker proteins specific for the cell plasma membrane and for intracellular lysosomes. All recombinant proteins were produced as chimeras with fluorescent protein markers at their carboxyl termini, which allows for the direct detection of the recombinant proteins. The double transfection of cells with plasmids harboring constructs for the genes of interest and a known subcellular marker allows for live cell imaging and improved validation of cellular protein localization.

Sleeping Beauty transposon-based system for rapid generation of HBV-replicating stable cell lines.

PubMed

Wu, Yong; Zhang, Tian-Ying; Fang, Lin-Lin; Chen, Zi-Xuan; Song, Liu-Wei; Cao, Jia-Li; Yang, Lin; Yuan, Quan; Xia, Ning-Shao

2016-08-01

The stable HBV-replicating cell lines, which carry replication-competent HBV genome stably integrated into the genome of host cell, are widely used to evaluate the effects of antiviral agents. However, current methods to generate HBV-replicating cell lines, which are mostly dependent on random integration of foreign DNA via plasmid transfection, are less-efficient and time-consuming. To address this issue, we constructed an all-in-one Sleeping Beauty transposon system (denoted pTSMP-HBV vector) for robust generation of stable cell lines carrying replication-competent HBV genome of different genotype. This vector contains a Sleeping Beauty transposon containing HBV 1.3-copy genome with an expression cassette of the SV40 promoter driving red fluorescent protein (mCherry) and self-cleaving P2A peptide linked puromycin resistance gene (PuroR). In addition, a PGK promoter-driven SB100X hyperactive transposase cassette is placed in the outside of the transposon in the same plasmid.The HBV-replicating stable cells could be obtained from pTSMP-HBV transfected HepG2 cells by red fluorescence-activated cell sorting and puromycin resistant cell selection within 4-week. Using this system, we successfully constructed four cell lines carrying replication-competent HBV genome of genotypes A-D. The replication and viral protein expression profiles of these cells were systematically characterized. In conclusion, our study provides a high-efficiency strategy to generate HBV-replicating stable cell lines, which may facilitate HBV-related virological study. Copyright © 2016. Published by Elsevier B.V.

Quantum dot coating of baculoviral vectors enables visualization of transduced cells and tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Ying; Lo, Seong Loong; Zheng, Yuangang

2013-04-26

Highlights: •The use of quantum dot (QD)-labeled viral vectors for in vivo imaging is not well investigated. •A new method to label enveloped baculovirus with glutathione-capped CdTe QDs is developed. •The labeling enables the identification of transduced, cultured cells based on fluorescence. •The labeling also allows evaluation of viral transduction in a real-time manner in living mice. •The method has the potential to assess viral vector-based gene therapy protocols in future. -- Abstract: Imaging of transduced cells and tissues is valuable in developing gene transfer vectors and evaluating gene therapy efficacy. We report here a simple method to use brightmore » and photostable quantum dots to label baculovirus, an emerging gene therapy vector. The labeling was achieved through the non-covalent interaction of glutathione-capped CdTe quantum dots with the virus envelope, without the use of chemical conjugation. The quantum dot labeling was nondestructive to viral transduction function and enabled the identification of baculoviral vector-transduced, living cells based on red fluorescence. When the labeled baculoviral vectors were injected intravenously or intraventricularly for in vivo delivery of a transgene into mice, quantum dot fluorescence signals allow us monitor whether or not the injected tissues were transduced. More importantly, using a dual-color whole-body imaging technology, we demonstrated that in vivo viral transduction could be evaluated in a real-time manner in living mice. Thus, our method of labeling a read-to-use gene delivery vector with quantum dots could be useful towards the improvement of vector design and will have the potential to assess baculovirus-based gene therapy protocols in future.« less

A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa

PubMed Central

Jinda, Worapoj; Poungvarin, Naravat; Taylor, Todd D.; Suzuki, Yutaka; Thongnoppakhun, Wanna; Limwongse, Chanin; Lertrit, Patcharee; Suriyaphol, Prapat

2016-01-01

Purpose Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations characterized by progressive loss of photoreceptor cells and RPE functions. More than 70 causative genes are known to be responsible for RP. This study aimed to identify the causative gene in a patient from a consanguineous family with childhood-onset severe retinal dystrophy. Methods To identify the defective gene, whole exome sequencing was performed. Candidate causative variants were selected and validated using Sanger sequencing. Segregation analysis of the causative gene was performed in additional family members. To verify that the mutation has an effect on protein synthesis, an expression vector containing the first ten amino acids of the mutant protein fused with the DsRed2 fluorescent protein was constructed and transfected into HEK293T cells. Expression of the fusion protein in the transfected cells was measured using fluorescence microscopy. Results By filtering against public variant databases, a novel homozygous missense mutation (c.3G>A) localized in the start codon of the MERTK gene was detected as a potentially pathogenic mutation for autosomal recessive RP. The c.3G>A mutation cosegregated with the disease phenotype in the family. No expression of the first ten amino acids of the MerTK mutant fused with the DsRed2 fluorescent protein was detected in HEK293T cells, indicating that the mutation affects the translation initiation site of the gene that may lead to loss of function of the MerTK signaling pathway. Conclusions We report a novel missense mutation (c.3G>A, p.0?) in the MERTK gene that causes severe vision impairment in a patient. Taken together with previous reports, our results expand the spectrum of MERTK mutations and extend our understanding of the role of the MerTK protein in the pathogenesis of retinitis pigmentosa. PMID:27122965

A Laboratory Exercise for Visible Gel Filtration Chromatography Using Fluorescent Proteins

ERIC Educational Resources Information Center

Zhang, Wenqiang; Cao, Yibin; Xu, Lishan; Gong, Jufang; Sun, Meihao

2015-01-01

Gel filtration chromatography (GFC) separates molecules according to size and is one of the most widely used methods for protein purification. Here, red fluorescent protein (RFP), green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), and/or their fusion proteins were prokaryotically expressed, purified,…

Flow Cytometric Analysis of Bimolecular Fluorescence Complementation: A High Throughput Quantitative Method to Study Protein-protein Interaction

PubMed Central

Wang, Li; Carnegie, Graeme K.

2013-01-01

Among methods to study protein-protein interaction inside cells, Bimolecular Fluorescence Complementation (BiFC) is relatively simple and sensitive. BiFC is based on the production of fluorescence using two non-fluorescent fragments of a fluorescent protein (Venus, a Yellow Fluorescent Protein variant, is used here). Non-fluorescent Venus fragments (VN and VC) are fused to two interacting proteins (in this case, AKAP-Lbc and PDE4D3), yielding fluorescence due to VN-AKAP-Lbc-VC-PDE4D3 interaction and the formation of a functional fluorescent protein inside cells. BiFC provides information on the subcellular localization of protein complexes and the strength of protein interactions based on fluorescence intensity. However, BiFC analysis using microscopy to quantify the strength of protein-protein interaction is time-consuming and somewhat subjective due to heterogeneity in protein expression and interaction. By coupling flow cytometric analysis with BiFC methodology, the fluorescent BiFC protein-protein interaction signal can be accurately measured for a large quantity of cells in a short time. Here, we demonstrate an application of this methodology to map regions in PDE4D3 that are required for the interaction with AKAP-Lbc. This high throughput methodology can be applied to screening factors that regulate protein-protein interaction. PMID:23979513

Flow cytometric analysis of bimolecular fluorescence complementation: a high throughput quantitative method to study protein-protein interaction.

PubMed

Wang, Li; Carnegie, Graeme K

2013-08-15

Among methods to study protein-protein interaction inside cells, Bimolecular Fluorescence Complementation (BiFC) is relatively simple and sensitive. BiFC is based on the production of fluorescence using two non-fluorescent fragments of a fluorescent protein (Venus, a Yellow Fluorescent Protein variant, is used here). Non-fluorescent Venus fragments (VN and VC) are fused to two interacting proteins (in this case, AKAP-Lbc and PDE4D3), yielding fluorescence due to VN-AKAP-Lbc-VC-PDE4D3 interaction and the formation of a functional fluorescent protein inside cells. BiFC provides information on the subcellular localization of protein complexes and the strength of protein interactions based on fluorescence intensity. However, BiFC analysis using microscopy to quantify the strength of protein-protein interaction is time-consuming and somewhat subjective due to heterogeneity in protein expression and interaction. By coupling flow cytometric analysis with BiFC methodology, the fluorescent BiFC protein-protein interaction signal can be accurately measured for a large quantity of cells in a short time. Here, we demonstrate an application of this methodology to map regions in PDE4D3 that are required for the interaction with AKAP-Lbc. This high throughput methodology can be applied to screening factors that regulate protein-protein interaction.

Sulfurtransferase and thioredoxin specifically interact as demonstrated by bimolecular fluorescence complementation analysis and biochemical tests.

PubMed

Henne, Melina; König, Nicolas; Triulzi, Tiziana; Baroni, Sara; Forlani, Fabio; Scheibe, Renate; Papenbrock, Jutta

2015-01-01

Sulfurtransferases (Strs) and thioredoxins (Trxs) are members of large protein families. Trxs are disulfide reductases and play an important role in redox-related cellular processes. They interact with a broad range of proteins. Strs catalyze the transfer of a sulfur atom from a suitable sulfur donor to nucleophilic sulfur acceptors in vitro, but the physiological roles of these enzymes are not well defined. Several studies in different organisms demonstrate protein-protein interactions of Strs with members of the Trx family. We are interested in investigating the specificity of the interaction between Str and Trx isoforms. In order to use the bimolecular fluorescence complementation (BiFC), several Str and Trx sequences from Arabidopsis thaliana were cloned into the pUC-SPYNE and pUC-SPYCE split-YFP vectors, respectively. Each couple of plasmids containing the sequences for the putative interaction partners were transformed into Arabidopsis protoplasts and screened using a confocal laser scanning microscope. Compartment- and partner-specific interactions could be observed in transformed protoplasts. Replacement of cysteine residues in the redox-active site of Trxs abolished the interaction signal. Therefore, the redox site is not only involved in the redox reaction but also responsible for the interaction with partner proteins. Biochemical assays support a specific interaction among Strs and certain Trxs. Based on the results obtained, the interaction of Strs and Trxs indicates a role of Strs in the maintenance of the cellular redox homeostasis.

Next generation tools for high-throughput promoter and expression analysis employing single-copy knock-ins at the Hprt1 locus.

PubMed

Yang, G S; Banks, K G; Bonaguro, R J; Wilson, G; Dreolini, L; de Leeuw, C N; Liu, L; Swanson, D J; Goldowitz, D; Holt, R A; Simpson, E M

2009-03-01

We have engineered a set of useful tools that facilitate targeted single copy knock-in (KI) at the hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1) locus. We employed fine scale mapping to delineate the precise breakpoint location at the Hprt1(b-m3) locus allowing allele specific PCR assays to be established. Our suite of tools contains four targeting expression vectors and a complementing series of embryonic stem cell lines. Two of these vectors encode enhanced green fluorescent protein (EGFP) driven by the human cytomegalovirus immediate-early enhancer/modified chicken beta-actin (CAG) promoter, whereas the other two permit flexible combinations of a chosen promoter combined with a reporter and/or gene of choice. We have validated our tools as part of the Pleiades Promoter Project (http://www.pleiades.org), with the generation of brain-specific EGFP positive germline mouse strains.

Design of magnetic polyplexes taken up efficiently by dendritic cell for enhanced DNA vaccine delivery.

PubMed

Nawwab Al-Deen, F M; Selomulya, C; Kong, Y Y; Xiang, S D; Ma, C; Coppel, R L; Plebanski, M

2014-02-01

Dendritic cells (DC) targeting vaccines require high efficiency for uptake, followed by DC activation and maturation. We used magnetic vectors comprising polyethylenimine (PEI)-coated superparamagnetic iron oxide nanoparticles, with hyaluronic acid (HA) of different molecular weights (<10 and 900 kDa) to reduce cytotoxicity and to facilitate endocytosis of particles into DCs via specific surface receptors. DNA encoding Plasmodium yoelii merozoite surface protein 1-19 and a plasmid encoding yellow fluorescent gene were added to the magnetic complexes with various % charge ratios of HA: PEI. The presence of magnetic fields significantly enhanced DC transfection and maturation. Vectors containing a high-molecular-weight HA with 100% charge ratio of HA: PEI yielded a better transfection efficiency than others. This phenomenon was attributed to their longer molecular chains and higher mucoadhesive properties aiding DNA condensation and stability. Insights gained should improve the design of more effective DNA vaccine delivery systems.

Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

PubMed

Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

2018-04-18

An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

In ovo electroporation of miRNA-based plasmids in the developing neural tube and assessment of phenotypes by DiI injection in open-book preparations.

PubMed

Wilson, Nicole H; Stoeckli, Esther T

2012-10-16

Commissural dI1 neurons have been extensively studied to elucidate the mechanisms underlying axon guidance during development(1,2). These neurons are located in the dorsal spinal cord and send their axons along stereotyped trajectories. Commissural axons initially project ventrally towards and then across the floorplate. After crossing the midline, these axons make a sharp rostral turn and project longitudinally towards the brain. Each of these steps is regulated by the coordinated activities of attractive and repulsive guidance cues. The correct interpretation of these cues is crucial to the guidance of axons along their demarcated pathway. Thus, the physiological contribution of a particular molecule to commissural axon guidance is ideally investigated in the context of the living embryo. Accordingly, gene knockdown in vivo must be precisely controlled in order to carefully distinguish axon guidance activities of genes that may play multiple roles during development. Here, we describe a method to knockdown gene expression in the chicken neural tube in a cell type-specific, traceable manner. We use novel plasmid vectors(3) harboring cell type-specific promoters/enhancers that drive the expression of a fluorescent protein marker, followed directly by a miR30-RNAi transcript(4) (located within the 3'-UTR of the cDNA encoding the fluorescent protein) (Figure 1). When electroporated into the developing neural tube, these vectors elicit efficient downregulation of gene expression and express bright fluorescent marker proteins to enable direct tracing of the cells experiencing knockdown(3). Mixing different RNAi vectors prior to electroporation allows the simultaneous knockdown of two or more genes in independent regions of the spinal cord. This permits complex cellular and molecular interactions to be examined during development, in a manner that is fast, simple, precise and inexpensive. In combination with DiI tracing of commissural axon trajectories in open-book preparations(5), this method is a useful tool for in vivo studies of the cellular and molecular mechanisms of commissural axon growth and guidance. In principle, any promoter/enhancer could be used, potentially making the technique more widely applicable for in vivo studies of gene function during development(6). This video first demonstrates how to handle and window eggs, the injection of DNA plasmids into the neural tube and the electroporation procedure. To investigate commissural axon guidance, the spinal cord is removed from the embryo as an open-book preparation, fixed, and injected with DiI to enable axon pathways to be traced. The spinal cord is mounted between coverslips and visualized using confocal microscopy.

New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters.

PubMed

Kanno, Alex I; Goulart, Cibelly; Rofatto, Henrique K; Oliveira, Sergio C; Leite, Luciana C C; McFadden, Johnjoe

2016-04-01

The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovisBCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. Copyright © 2016 Kanno et al.

A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum

PubMed Central

Shaner, Nathan C.; Lambert, Gerard G.; Chammas, Andrew; Ni, Yuhui; Cranfill, Paula J.; Baird, Michelle A.; Sell, Brittney R.; Allen, John R.; Day, Richard N.; Israelsson, Maria; Davidson, Michael W.; Wang, Jiwu

2013-01-01

Despite the existence of fluorescent proteins spanning the entire visual spectrum, the bulk of modern imaging experiments continue to rely on variants of the green fluorescent protein derived from Aequorea victoria. Meanwhile, a great deal of recent effort has been devoted to engineering and improving red fluorescent proteins, and relatively little attention has been given to green and yellow variants. Here we report a novel monomeric yellow-green fluorescent protein, mNeonGreen, which is derived from a tetrameric fluorescent protein from the cephalochordate Branchiostoma lanceolatum. This fluorescent protein is the brightest monomeric green or yellow fluorescent protein yet described, performs exceptionally well as a fusion tag for traditional imaging as well as stochastic single-molecule superresolution imaging, and is an excellent FRET acceptor for the newest generation of cyan fluorescent proteins. PMID:23524392

Intrinsic protein fluorescence interferes with detection of tear glycoproteins in SDS-polyacrylamide gels using extrinsic fluorescent dyes.

PubMed

Zhao, Zhenjun; Aliwarga, Yulina; Willcox, Mark D P

2007-12-01

Intrinsic protein fluorescence may interfere with the visualization of proteins after SDS-polyacrylamide electrophoresis. In an attempt to analyze tear glycoproteins in gels, we ran tear samples and stained the proteins with a glycoprotein-specific fluorescent dye. The fluorescence detected was not limited to glycoproteins. There was strong intrinsic fluorescence of proteins normally found in tears after soaking the gels in 40% methanol plus 1-10% acetic acid and, to a lesser extent, in methanol or acetic acid alone. Nanograms of proteins gave visible native fluorescence and interfere with extrinsic fluorescent dye detection. Poly-L-lysine, which does not contain intrinsically fluorescent amino acids, did not fluoresce.

Intrinsic Protein Fluorescence Interferes with Detection of Tear Glycoproteins in SDS-Polyacrylamide Gels Using Extrinsic Fluorescent Dyes

PubMed Central

Zhao, Zhenjun; Aliwarga, Yulina; Willcox, Mark DP

2007-01-01

Intrinsic protein fluorescence may interfere with the visualization of proteins after SDS-polyacrylamide electrophoresis. In an attempt to analyze tear glycoproteins in gels, we ran tear samples and stained the proteins with a glycoprotein-specific fluorescent dye. The fluorescence detected was not limited to glycoproteins. There was strong intrinsic fluorescence of proteins normally found in tears after soaking the gels in 40% methanol plus 1–10% acetic acid and, to a lesser extent, in methanol or acetic acid alone. Nanograms of proteins gave visible native fluorescence and interfere with extrinsic fluorescent dye detection. Poly-L-lysine, which does not contain intrinsically fluorescent amino acids, did not fluoresce. PMID:18166676

Localization of human T-cell lymphotropic virus type II Tax protein is dependent upon a nuclear localization determinant in the N-terminal region.

PubMed

Turci, Marco; Romanelli, Maria Grazia; Lorenzi, Pamela; Righi, Paola; Bertazzoni, Umberto

2006-01-03

Human T-cell lymphotropic viruses (HTLV) types I and II are closely related oncogenic retroviruses that have been associated with lymphoproliferative and neurological disorders. The proviral genome encodes a trans-regulatory Tax protein that activates viral genes and upregulates various cellular genes involved in both cell growth and transformation. Tax proteins of HTLV-I (Tax-I) and HTLV-II (Tax-II) exhibit more than 77% aa homology and expression of either Tax-I or Tax-II is sufficient for immortalization of cultured T lymphocytes. Tax-I shuttles from the nucleus to the cytoplasm and accumulates within the nucleus, whereas Tax-II is found mainly in the cytoplasm. In the present study we have used recombinant vectors to analyze the size and structure of the nuclear localization domain within the Tax-II protein sequence. The Tax-II protein was expressed in HeLa cells either as the complete protein, or regions thereof, that were individually fused to the green fluorescent protein (GFP). Immunoblot analysis of the fused Tax-II products confirmed their expression and size. Fluorescence microscopy studies indicated that the complete Tax-II as well as N-truncated forms presented a punctuate cytoplasmic distribution and that a nuclear localization determinant is confined to within the first 60 aa of Tax-II. Accordingly, site directed mutagenesis and deletion of specific sequences within the first 60 aa showed that the nuclear determinant lies within the first 41 residues of Tax-II. These results point to a direct involvement of the amino-terminal residues of Tax-II protein in determining its nuclear functionality.

FRET Imaging of Diatoms Expressing a Biosilica-Localized Ribose Sensor

PubMed Central

Marshall, Kathryn E.; Robinson, Errol W.; Hengel, Shawna M.; Paša-Tolić, Ljiljana; Roesijadi, Guritno

2012-01-01

Future materials are envisioned to include bio-assembled, hybrid, three-dimensional nanosystems that incorporate functional proteins. Diatoms are amenable to genetic modification for localization of recombinant proteins in the biosilica cell wall. However, the full range of protein functionalities that can be accommodated by the modified porous biosilica has yet to be described. Our objective was to functionalize diatom biosilica with a reagent-less sensor dependent on ligand-binding and conformational change to drive FRET-based signaling capabilities. A fusion protein designed to confer such properties included a bacterial periplasmic ribose binding protein (R) flanked by CyPet (C) and YPet (Y), cyan and yellow fluorescent proteins that act as a FRET pair. The structure and function of the CRY recombinant chimeric protein was confirmed by expression in E. coli prior to transformation of the diatom Thalassiosira pseudonana. Mass spectrometry of the recombinant CRY showed 97% identity with the deduced amino acid sequence. CRY with and without an N-terminal Sil3 tag for biosilica localization exhibited characteristic ribose-dependent changes in FRET, with similar dissociation constants of 123.3 µM and 142.8 µM, respectively. The addition of the Sil3 tag did not alter the affinity of CRY for the ribose substrate. Subsequent transformation of T. pseudonana with a vector encoding Sil3-CRY resulted in fluorescence localization in the biosilica and changes in FRET in both living cells and isolated frustules in response to ribose. This work demonstrated that the nano-architecture of the genetically modified biosilica cell wall was able to support the functionality of the relatively complex Sil3-CyPet-RBP-YPet fusion protein with its requirement for ligand-binding and conformational change for FRET-signal generation. PMID:22470473

FRET imaging of diatoms expressing a biosilica-localized ribose sensor.

PubMed

Marshall, Kathryn E; Robinson, Errol W; Hengel, Shawna M; Paša-Tolić, Ljiljana; Roesijadi, Guritno

2012-01-01

Future materials are envisioned to include bio-assembled, hybrid, three-dimensional nanosystems that incorporate functional proteins. Diatoms are amenable to genetic modification for localization of recombinant proteins in the biosilica cell wall. However, the full range of protein functionalities that can be accommodated by the modified porous biosilica has yet to be described. Our objective was to functionalize diatom biosilica with a reagent-less sensor dependent on ligand-binding and conformational change to drive FRET-based signaling capabilities. A fusion protein designed to confer such properties included a bacterial periplasmic ribose binding protein (R) flanked by CyPet (C) and YPet (Y), cyan and yellow fluorescent proteins that act as a FRET pair. The structure and function of the CRY recombinant chimeric protein was confirmed by expression in E. coli prior to transformation of the diatom Thalassiosira pseudonana. Mass spectrometry of the recombinant CRY showed 97% identity with the deduced amino acid sequence. CRY with and without an N-terminal Sil3 tag for biosilica localization exhibited characteristic ribose-dependent changes in FRET, with similar dissociation constants of 123.3 µM and 142.8 µM, respectively. The addition of the Sil3 tag did not alter the affinity of CRY for the ribose substrate. Subsequent transformation of T. pseudonana with a vector encoding Sil3-CRY resulted in fluorescence localization in the biosilica and changes in FRET in both living cells and isolated frustules in response to ribose. This work demonstrated that the nano-architecture of the genetically modified biosilica cell wall was able to support the functionality of the relatively complex Sil3-CyPet-RBP-YPet fusion protein with its requirement for ligand-binding and conformational change for FRET-signal generation.

HIV-1-based defective lentiviral vectors efficiently transduce human monocytes-derived macrophages and suppress replication of wild-type HIV-1

PubMed Central

Zeng, Lingbing; Planelles, Vicente; Sui, Ziye; Gartner, Suzanne; Maggirwar, Sanjay B.; Dewhurst, Stephen; Ye, Linbai; Nerurkar, Vivek R.; Yanagihara, Richard; Lu, Yuanan

2010-01-01

Background Human monocytes play an important role in mediating human immunodeficiency virus type 1 (HIV-1) infection of the central nervous system (CNS), and monocytes-derived macrophages (MDM) represent a major viral reservoir within the brain and other target organs. Current gene transduction of MDM is hindered by a limited efficiency. In this study we established a lentiviral vector-based technique for improved gene transfer into human MDM cultures in vitro and demonstrated significant protection of transduced MDM from super-infection with wild-type HIV-1. Methods HIV-1-based lentiviral vector stocks were prepared in 293T cells by the established calcium phosphate transfection method. Human monocytes were isolated from donors' blood by Ficoll-Paque separation and cultured in vitro. To establish an effective technique for vector-mediated gene transfer, primary cultures of human MDM were transduced at varying multiplicities of infection (MOI) and at a range of time points following initial isolation of cells (time-in-culture). Transduced cells were then examined for transgene (green fluorescent protein (GFP)) expression by fluorescent microscopy and reverse transcription polymerase chain reaction (RT-PCR). These cultures were then exposed to wild-type HIV-1, and viral replication was quantitated by p24 assay; production of neurotoxic effector molecules by the transduced MDM was also examined, using indicator neurons. Results We have demonstrated that primary human MDM could be efficiently transduced (>50%) with concentrated HIV-1-based defective lentiviral vectors (DLV). Furthermore, DLV-mediated gene transduction was stable, and the transduced cells exhibited no apparent difference from normal MDM in terms of their morphology, viability and neurotoxin secretion. Challenge of DLV-transduced MDM cultures with HIV-1Ba-L revealed a 4- to 5-fold reduction in viral replication, as measured by p24 antigen production. This effect was associated with the mobilization of the GFP-expressing DLV construct by the wild-type virus. Conclusions These data demonstrate the inhibition of HIV-1 replication in primary MDM, by a DLV vector that lacks any anti-HIV-1 transgene. These findings lay the initial groundwork for future studies on the ability of DLV-modified monocytes to introduce anti-HIV-1 genes into the CNS. Lentiviral vector-mediated gene delivery to the CNS by monocytes/macrophages is a promising, emerging strategy for treating neuro-AIDS. PMID:16142830

AAV vector-mediated secretion of chondroitinase provides a sensitive tracer for axonal arborisations.

PubMed

Alves, João Nuno; Muir, Elizabeth M; Andrews, Melissa R; Ward, Anneliese; Michelmore, Nicholas; Dasgupta, Debayan; Verhaagen, Joost; Moloney, Elizabeth B; Keynes, Roger J; Fawcett, James W; Rogers, John H

2014-04-30

As part of a project to express chondroitinase ABC (ChABC) in neurons of the central nervous system, we have inserted a modified ChABC gene into an adeno-associated viral (AAV) vector and injected it into the vibrissal motor cortex in adult rats to determine the extent and distribution of expression of the enzyme. A similar vector for expression of green fluorescent protein (GFP) was injected into the same location. For each vector, two versions with minor differences were used, giving similar results. After 4 weeks, the brains were stained to show GFP and products of chondroitinase digestion. Chondroitinase was widely expressed, and the AAV-ChABC and AAV-GFP vectors gave similar expression patterns in many respects, consistent with the known projections from the directly transduced neurons in vibrissal motor cortex and adjacent cingulate cortex. In addition, diffusion of vector to deeper neuronal populations led to labelling of remote projection fields which was much more extensive with AAV-ChABC than with AAV-GFP. The most notable of these populations are inferred to be neurons of cortical layer 6, projecting widely in the thalamus, and neurons of the anterior pole of the hippocampus, projecting through most of the hippocampus. We conclude that, whereas GFP does not label the thinnest axonal branches of some neuronal types, chondroitinase is efficiently secreted from these arborisations and enables their extent to be sensitively visualised. After 12 weeks, chondroitinase expression was undiminished. Copyright © 2014 Elsevier B.V. All rights reserved.

In vivo imaging of induction of heat-shock protein-70 gene expression with fluorescence reflectance imaging and intravital confocal microscopy following brain ischaemia in reporter mice.

PubMed

de la Rosa, Xavier; Santalucía, Tomàs; Fortin, Pierre-Yves; Purroy, Jesús; Calvo, Maria; Salas-Perdomo, Angélica; Justicia, Carles; Couillaud, Franck; Planas, Anna M

2013-02-01

Stroke induces strong expression of the 72-kDa heat-shock protein (HSP-70) in the ischaemic brain, and neuronal expression of HSP-70 is associated with the ischaemic penumbra. The aim of this study was to image induction of Hsp-70 gene expression in vivo after brain ischaemia using reporter mice. A genomic DNA sequence of the Hspa1b promoter was used to generate an Hsp70-mPlum far-red fluorescence reporter vector. The construct was tested in cellular systems (NIH3T3 mouse fibroblast cell line) by transient transfection and examining mPlum and Hsp-70 induction under a challenge. After construct validation, mPlum transgenic mice were generated. Focal brain ischaemia was induced by transient intraluminal occlusion of the middle cerebral artery and the mice were imaged in vivo with fluorescence reflectance imaging (FRI) with an intact skull, and with confocal microscopy after opening a cranial window. Cells transfected with the Hsp70-mPlum construct showed mPlum fluorescence after stimulation. One day after induction of ischaemia, reporter mice showed a FRI signal located in the HSP-70-positive zone within the ipsilateral hemisphere, as validated by immunohistochemistry. Live confocal microscopy allowed brain tissue to be visualized at the cellular level. mPlum fluorescence was observed in vivo in the ipsilateral cortex 1 day after induction of ischaemia in neurons, where it is compatible with penumbra and neuronal viability, and in blood vessels in the core of the infarction. This study showed in vivo induction of Hsp-70 gene expression in ischaemic brain using reporter mice. The fluorescence signal showed in vivo the induction of Hsp-70 in penumbra neurons and in the vasculature within the ischaemic core.

Quantitative Whole Body Biodistribution of Fluorescent-Labeled Agents by Non-Invasive Tomographic Imaging

PubMed Central

Vasquez, Kristine O.; Casavant, Chelsea; Peterson, Jeffrey D.

2011-01-01

When small molecules or proteins are injected into live animals, their physical and chemical properties will significantly affect pharmacokinetics, tissue penetration, and the ultimate routes of metabolism and clearance. Fluorescence molecular tomography (FMT) offers the ability to non-invasively image and quantify temporal changes in fluorescence throughout the major organ systems of living animals, in a manner analogous to traditional approaches with radiolabeled agents. This approach is best used with biotherapeutics (therapeutic antibodies, or other large proteins) or large-scaffold drug-delivery vectors, that are minimally affected by low-level fluorophore conjugation. Application to small molecule drugs should take into account the significant impact of fluorophore labeling on size and physicochemical properties, however, the presents studies show that this technique is readily applied to small molecule agents developed for far-red (FR) or near infrared (NIR) imaging. Quantification by non-invasive FMT correlated well with both fluorescence from tissue homogenates as well as with planar (2D) fluorescence reflectance imaging of excised intact organs (r2 = 0.996 and 0.969, respectively). Dynamic FMT imaging (multiple times from 0 to 24 h) performed in live mice after the injection of four different FR/NIR-labeled agents, including immunoglobulin, 20–50 nm nanoparticles, a large vascular imaging agent, and a small molecule integrin antagonist, showed clear differences in the percentage of injected dose per gram of tissue (%ID/g) in liver, kidney, and bladder signal. Nanoparticles and IgG1 favored liver over kidney signal, the small molecule integrin-binding agent favored rapid kidney and bladder clearance, and the vascular agent, showed both liver and kidney clearance. Further assessment of the volume of distribution of these agents by fluorescent volume added information regarding their biodistribution and highlighted the relatively poor extravasation into tissue by IgG1. These studies demonstrate the ability of quantitative FMT imaging of FR/NIR agents to non-invasively visualize and quantify the biodistribution of different agents over time. PMID:21731618

Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes.

PubMed

Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan

2008-04-01

The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.

Advances in engineering of fluorescent proteins and photoactivatable proteins with red emission.

PubMed

Piatkevich, Kiryl D; Verkhusha, Vladislav V

2010-02-01

Monomeric fluorescent proteins of different colors are widely used to study behavior and targeting of proteins in living cells. Fluorescent proteins that irreversibly change their spectral properties in response to light irradiation of a specific wavelength, or photoactivate, have become increasingly popular to image intracellular dynamics and superresolution protein localization. Until recently, however, no optimized monomeric red fluorescent proteins and red photoactivatable proteins have been available. Furthermore, monomeric fluorescent proteins, which change emission from blue to red simply with time, so-called fluorescent timers, were developed to study protein age and turnover. Understanding of chemical mechanisms of the chromophore maturation or photoactivation into a red form will further advance engineering of fluorescent timers and photoactivatable proteins with enhanced and novel properties. 2009 Elsevier Ltd. All rights reserved.

Assessment of brain metabolite correlates of adeno-associated virus-mediated over-expression of human alpha-synuclein in cortical neurons by in vivo (1) H-MR spectroscopy at 9.4 T.

PubMed

Cuellar-Baena, Sandra; Landeck, Natalie; Sonnay, Sarah; Buck, Kerstin; Mlynarik, Vladimir; In 't Zandt, René; Kirik, Deniz

2016-06-01

In this study, we used proton-localized spectroscopy ((1) H-MRS) for the acquisition of the neurochemical profile longitudinally in a novel rat model of human wild-type alpha-synuclein (α-syn) over-expression. Our goal was to find out if the increased α-syn load in this model could be linked to changes in metabolites in the frontal cortex. Animals injected with AAV vectors encoding for human α-syn formed the experimental group, whereas green fluorescent protein expressing animals were used as the vector-treated control group and a third group of uninjected animals were used as naïve controls. Data were acquired at 2, 4, and 8 month time points. Nineteen metabolites were quantified in the MR spectra using LCModel software. On the basis of 92 spectra, we evaluated any potential gender effect and found that lactate (Lac) levels were lower in males compared to females, while the opposite was observed for ascorbate (Asc). Next, we assessed the effect of age and found increased levels of GABA, Tau, and GPC+PCho. Finally, we analyzed the effect of treatment and found that Lac levels (p = 0.005) were specifically lower in the α-syn group compared to the green fluorescent protein and control groups. In addition, Asc levels (p = 0.05) were increased in the vector-injected groups, whereas glucose levels remained unchanged. This study indicates that the metabolic switch between glucose-lactate could be detectable in vivo and might be modulated by Asc. No concomitant changes were found in markers of neuronal integrity (e.g., N-acetylaspartate) consistent with the fact that α-syn over-expression in cortical neurons did not result in neurodegeneration in this model. We acquired the neurochemical profile longitudinally in a rat model of human wild-type alpha-synuclein (α-syn) over-expression in cortical neurons. We found that Lactate levels were reduced in the α-syn group compared to the control groups and Ascorbate levels were increased in the vector-injected groups. No changes were found in markers of neuronal integrity consistent with the fact that α-syn over-expression did not result in frank neurodegeneration. © 2016 International Society for Neurochemistry.

Insulin-like growth factor-I gene delivery to astrocytes reduces their inflammatory response to lipopolysaccharide

PubMed Central

2011-01-01

Background Insulin-like growth factor-I (IGF-I) exerts neuroprotective actions in the central nervous system that are mediated at least in part by control of activation of astrocytes. In this study we have assessed the efficacy of exogenous IGF-I and IGF-I gene therapy in reducing the inflammatory response of astrocytes from cerebral cortex. Methods An adenoviral vector harboring the rat IGF-I gene and a control adenoviral vector harboring a hybrid gene encoding the herpes simplex virus type 1 thymidine kinase fused to Aequorea victoria enhanced green fluorescent protein were used in this study. Primary astrocytes from mice cerebral cortex were incubated for 24 h or 72 h with vehicle, IGF-I, the IGF-I adenoviral vector, or control vector; and exposed to bacterial lipopolysaccharide to induce an inflammatory response. IGF-I levels were measured by radioimmunoassay. Levels of interleukin 6, tumor necrosis factor-α, interleukin-1β and toll-like receptor 4 mRNA were assessed by quantitative real-time polymerase chain reaction. Levels of IGF-I receptor and IGF binding proteins 2 and 3 were assessed by western blotting. The subcellular distribution of nuclear factor κB (p65) was assessed by immunocytochemistry. Statistical significance was assessed by one way analysis of variance followed by the Bonferroni pot hoc test. Results IGF-I gene therapy increased IGF-I levels without affecting IGF-I receptors or IGF binding proteins. Exogenous IGF-I, and IGF-I gene therapy, decreased expression of toll-like receptor 4 and counteracted the lipopolysaccharide-induced inflammatory response of astrocytes. In addition, IGF-I gene therapy decreased lipopolysaccharide-induced translocation of nuclear factor κB (p65) to the cell nucleus. Conclusion These findings demonstrate efficacy of exogenous IGF-I and of IGF-I gene therapy in reducing the inflammatory response of astrocytes. IGF-I gene therapy may represent a new approach to reduce inflammatory reactions in glial cells. PMID:21371294

Fluorescence quantum yield measurements of fluorescent proteins: a laboratory experiment for a biochemistry or molecular biophysics laboratory course.

PubMed

Wall, Kathryn P; Dillon, Rebecca; Knowles, Michelle K

2015-01-01

Fluorescent proteins are commonly used in cell biology to assess where proteins are within a cell as a function of time and provide insight into intracellular protein function. However, the usefulness of a fluorescent protein depends directly on the quantum yield. The quantum yield relates the efficiency at which a fluorescent molecule converts absorbed photons into emitted photons and it is necessary to know for assessing what fluorescent protein is the most appropriate for a particular application. In this work, we have designed an upper-level, biochemistry laboratory experiment where students measure the fluorescence quantum yields of fluorescent proteins relative to a standard organic dye. Four fluorescent protein variants, enhanced cyan fluorescent protein (ECFP), enhanced green fluorescent protein (EGFP), mCitrine, and mCherry, were used, however the methods described are useful for the characterization of any fluorescent protein or could be expanded to fluorescent quantum yield measurements of organic dye molecules. The laboratory is designed as a guided inquiry project and takes two, 4 hr laboratory periods. During the first day students design the experiment by selecting the excitation wavelength, choosing the standard, and determining the concentration needed for the quantum yield experiment that takes place in the second laboratory period. Overall, this laboratory provides students with a guided inquiry learning experience and introduces concepts of fluorescence biophysics into a biochemistry laboratory curriculum. © 2014 The International Union of Biochemistry and Molecular Biology.

Construction of baculovirus expression vector of miRNAs and its expression in insect cells.

PubMed

Huang, Yong; Zou, Quan; Shen, Xing Jia; Yu, Xue Li; Wang, Zhan Bin; Cheng, Xiang Chao

2012-01-01

MicroRNAs (miRNAs) are endogenous small non-protein coding RNAs that play important regulatory roles in animals and plants by binding to target transcripts for cleavage or translational repression. The miR-9a is very conservative in animals from flies to humans. Studies indicated that miR-9a is involved in the regulation of neurogenesis in animals. In our study, the baculovirus expression system was used to transcribe a recombinant vector containing miR-9a for further analysis the function ofmiR-9a. The sequence ofpre-miR-9a from silkworm DNA was first cloned into the donor pFastBac. The enhanced green fluorescent protein (EGFP) was used as reporter gene. The recombinant donor plasmid pFastBac-miR-9a was transformed into E.coli DH10Bac/AcNPV forming Bacmid-9a which was transfected into insect cells with cational lipofectin. The transcription of mature miR-9a was detected by Real-time PCR. The results show the recombinant Bacmid-9a was successfully constructed and effectively transcribed miR-9a in infected Sf21 insect cells.

Hairy Root Transformation Using Agrobacterium rhizogenes as a Tool for Exploring Cell Type-Specific Gene Expression and Function Using Tomato as a Model1[W][OPEN

PubMed Central

Ron, Mily; Kajala, Kaisa; Pauluzzi, Germain; Wang, Dongxue; Reynoso, Mauricio A.; Zumstein, Kristina; Garcha, Jasmine; Winte, Sonja; Masson, Helen; Inagaki, Soichi; Federici, Fernán; Sinha, Neelima; Deal, Roger B.; Bailey-Serres, Julia; Brady, Siobhan M.

2014-01-01

Agrobacterium rhizogenes (or Rhizobium rhizogenes) is able to transform plant genomes and induce the production of hairy roots. We describe the use of A. rhizogenes in tomato (Solanum spp.) to rapidly assess gene expression and function. Gene expression of reporters is indistinguishable in plants transformed by Agrobacterium tumefaciens as compared with A. rhizogenes. A root cell type- and tissue-specific promoter resource has been generated for domesticated and wild tomato (Solanum lycopersicum and Solanum pennellii, respectively) using these approaches. Imaging of tomato roots using A. rhizogenes coupled with laser scanning confocal microscopy is facilitated by the use of a membrane-tagged protein fused to a red fluorescent protein marker present in binary vectors. Tomato-optimized isolation of nuclei tagged in specific cell types and translating ribosome affinity purification binary vectors were generated and used to monitor associated messenger RNA abundance or chromatin modification. Finally, transcriptional reporters, translational reporters, and clustered regularly interspaced short palindromic repeats-associated nuclease9 genome editing demonstrate that SHORT-ROOT and SCARECROW gene function is conserved between Arabidopsis (Arabidopsis thaliana) and tomato. PMID:24868032

Directed molecular evolution to design advanced red fluorescent proteins.

PubMed

Subach, Fedor V; Piatkevich, Kiryl D; Verkhusha, Vladislav V

2011-11-29

Fluorescent proteins have become indispensable imaging tools for biomedical research. Continuing progress in fluorescence imaging, however, requires probes with additional colors and properties optimized for emerging techniques. Here we summarize strategies for development of red-shifted fluorescent proteins. We discuss possibilities for knowledge-based rational design based on the photochemistry of fluorescent proteins and the position of the chromophore in protein structure. We consider advances in library design by mutagenesis, protein expression systems and instrumentation for high-throughput screening that should yield improved fluorescent proteins for advanced imaging applications.

Tyrosine Mutation in AAV9 Capsid Improves Gene Transfer to the Mouse Lung.

PubMed

Martini, Sabrina V; Silva, Adriana L; Ferreira, Debora; Rabelo, Rafael; Ornellas, Felipe M; Gomes, Karina; Rocco, Patricia R M; Petrs-Silva, Hilda; Morales, Marcelo M

2016-01-01

Adeno-associated virus (AAV) vectors are being increasingly used as the vector of choice for in vivo gene delivery and gene therapy for many pulmonary diseases. Recently, it was shown that phosphorylation of surface-exposed tyrosine residues from AAV capsid targets the viral particles for ubiquitination and proteasome-mediated degradation, and mutations of these tyrosine residues lead to highly efficient vector transduction in vitro and in vivo in different organs. In this study, we evaluated the pulmonary transgene expression efficacy of AAV9 vectors containing point mutations in surface-exposed capsid tyrosine residues. Eighteen C57BL/6 mice were randomly assigned into three groups: (1) a control group (CTRL) animals underwent intratracheal (i.t.) instillation of saline, (2) the wild-type AAV9 group (WT-AAV9, 1010 vg), and (3) the tyrosine-mutant Y731F AAV9 group (M-AAV9, 1010 vg), which received (i.t.) self-complementary AAV9 vectors containing the DNA sequence of enhanced green fluorescence protein (eGFP). Four weeks after instillation, lung mechanics, morphometry, tissue cellularity, gene expression, inflammatory cytokines, and growth factor expression were analyzed. No significant differences were observed in lung mechanics and morphometry among the experimental groups. However, the number of polymorphonuclear cells was higher in the WT-AAV9 group than in the CTRL and M-AAV9 groups, suggesting that the administration of tyrosine-mutant AAV9 vectors was better tolerated. Tyrosine-mutant AAV9 vectors significantly improved transgene delivery to the lung (30%) compared with their wild-type counterparts, without eliciting an inflammatory response. Our results provide the impetus for further studies to exploit the use of AAV9 vectors as a tool for pulmonary gene therapy. © 2016 The Author(s) Published by S. Karger AG, Basel.

Essential and Dispensable Virus-Encoded Replication Elements Revealed by Efforts To Develop Hypoviruses as Gene Expression Vectors

PubMed Central

Suzuki, Nobuhiro; Geletka, Lynn M.; Nuss, Donald L.

2000-01-01

We have investigated whether hypoviruses, viral agents responsible for virulence attenuation (hypovirulence) of the chestnut blight fungus Cryphonectria parasitica, could serve as gene expression vectors. The infectious cDNA clone of the prototypic hypovirus CHV1-EP713 was modified to generate 20 different vector candidates. Although transient expression was achieved for a subset of vectors that contained the green fluorescent protein gene from Aequorea victoria, long-term expression (past day 8) was not observed for any vector construct. Analysis of viral RNAs recovered from transfected fungal colonies revealed that the foreign genes were readily deleted from the replicating virus, although small portions of foreign sequences were retained by some vectors after months of replication. However, the results of vector viability and progeny characterization provided unexpected new insights into essential and dispensable elements of hypovirus replication. The N-terminal portion (codons 1 to 24) of the 5′-proximal open reading frame (ORF), ORF A, was found to be required for virus replication, while the remaining 598 codons of this ORF were completely dispensable. Substantial alterations were tolerated in the pentanucleotide UAAUG that contains the ORF A termination codon and the overlapping putative initiation codon of the second of the two hypovirus ORFs, ORF B. Replication competence was maintained following either a frameshift mutation that caused a two-codon extension of ORF A or a modification that produced a single-ORF genomic organization. These results are discussed in terms of determinants of hypovirus replication, the potential utility of hypoviruses as gene expression vectors, and possible mechanisms by which hypoviruses recognize and delete foreign sequences. PMID:10906211

[New strategy for RNA vectorization in mammalian cells. Use of a peptide vector].

PubMed

Vidal, P; Morris, M C; Chaloin, L; Heitz, F; Divita, G

1997-04-01

A major barrier for gene delivery is the low permeability of nucleic acids to cellular membranes. The development of antisenses and gene therapy has focused mainly on improving methods of oligonucleotide or gene delivery to the cell. In this report we described a new strategy for RNA cell delivery, based on a short single peptide. This peptide vector is derived from both the fusion domain of the gp41 protein of HIV and the nuclear localization sequence of the SV40 large T antigen. This peptide vector localizes rapidly to the cytoplasm then to the nucleus of human fibroblasts (HS-68) within a few minutes and exhibits a high affinity for a single-stranded mRNA encoding the p66 subunit of the HIV-1 reverse transcriptase (in a 100 nM range). The peptide/RNA complex formation involves mainly electrostatic interactions between the basic residues of the peptide and the charges on the phosphate group of the RNA. In the presence of the peptide-vector fluorescently-labelled mRNA is delivered into the cytoplasm of mammalian cells (HS68 human fibroblasts) in less than 1 h with a relatively high efficiency (80%). This new concept based on a peptide-derived vector offers several advantages compared to other compounds commonly used in gene delivery. This vector is highly soluble and exhibits no cytotoxicity at the concentrations used for optimal gene delivery. This result clearly supports the fact that this peptide vector is a powerful tool and that it can be used widely, as much for laboratory research as for new applications and development in gene and/or antisense therapy.

Fluorescent Protein Approaches in Alpha Herpesvirus Research

PubMed Central

Hogue, Ian B.; Bosse, Jens B.; Engel, Esteban A.; Scherer, Julian; Hu, Jiun-Ruey; del Rio, Tony; Enquist, Lynn W.

2015-01-01

In the nearly two decades since the popularization of green fluorescent protein (GFP), fluorescent protein-based methodologies have revolutionized molecular and cell biology, allowing us to literally see biological processes as never before. Naturally, this revolution has extended to virology in general, and to the study of alpha herpesviruses in particular. In this review, we provide a compendium of reported fluorescent protein fusions to herpes simplex virus 1 (HSV-1) and pseudorabies virus (PRV) structural proteins, discuss the underappreciated challenges of fluorescent protein-based approaches in the context of a replicating virus, and describe general strategies and best practices for creating new fluorescent fusions. We compare fluorescent protein methods to alternative approaches, and review two instructive examples of the caveats associated with fluorescent protein fusions, including describing several improved fluorescent capsid fusions in PRV. Finally, we present our future perspectives on the types of powerful experiments these tools now offer. PMID:26610544

Stable chloroplast transformation of immature scutella and inflorescences in wheat (Triticum aestivum L.).

PubMed

Cui, Cuiju; Song, Fei; Tan, Yi; Zhou, Xuan; Zhao, Wen; Ma, Fengyun; Liu, Yunyi; Hussain, Javeed; Wang, Yuesheng; Yang, Guangxiao; He, Guangyuan

2011-04-01

Chloroplast transformation in wheat was achieved by bombardment of scutella from immature embryos and immature inflorescences, respectively. A wheat chloroplast site-specific expression vector, pBAGNRK, was constructed by placing an expression cassette containing neomycin phosphotransferase II (nptII) and green fluorescent protein (gfp) as selection and reporter genes, respectively, in the intergenic spacer between atpB and rbcL of wheat chloroplast genome. Integration of gfp gene in the plastome was identified by polymerase chain reaction (PCR) analysis and Southern blotting using gfp gene as a probe. Expression of GFP protein was examined by western blot. Three positive transformants were obtained and the Southern blot of partial fragment of atpB and rbcL (targeting site) probes verified that one of them was homoplasmic. Stable expression of GFP fluorescence was confirmed by confocal microscopy in the leaf tissues from T(1) progeny seedlings. PCR analysis of gfp gene also confirmed the inheritance of transgene in the T(1) progeny. These results strengthen the feasibility of wheat chloroplast transformation and also give a novel method for the introduction of important agronomic traits in wheat through chloroplast transformation.

Agrobacterium tumefasciens-mediated transformation of the aquatic fungus Blastocladiella emersonii.

PubMed

Vieira, André L G; Camilo, César M

2011-08-01

Agrobacterium tumefaciens is widely used for plant DNA transformation and more recently, has also been used to transform yeast, filamentous fungi and even human cells. Using this technique, we developed the first transformation protocol for the saprobic aquatic fungus Blastocladiella emersonii, a Blastocladiomycete localized at the base of fungal phylogenetic tree, which has been shown as a promising and interesting model of study of cellular function and differentiation. We constructed binary T-DNA vectors containing hygromycin phosphotransferase (hph) or enhanced green fluorescent protein (egfp) genes, under the control of Aspergillus nidulans trpC promoter and terminator sequences. 24 h of co-cultivation in induction medium (IM) agar plates, followed by transfer to PYG-agar plates containing cefotaxim to kill Agrobacterium tumefsciens and hygromycin to select transformants, resulted in growth and sporulation of resistant transformants. Genomic DNA from the pool o resistant zoospores were shown to contain T-DNA insertion as evidenced by PCR amplification of hph gene. Using a similar protocol we could also evidence the expression of enhanced green fluorescent protein (EGFP) in zoospores derived from transformed cells. This protocol can also open new perspectives for other non-transformable closely related fungi, like the Chytridiomycete class. Copyright © 2011 Elsevier Inc. All rights reserved.

Water-soluble fullerene (C60) derivatives as nonviral gene-delivery vectors.

PubMed

Sitharaman, Balaji; Zakharian, Tatiana Y; Saraf, Anita; Misra, Preeti; Ashcroft, Jared; Pan, Su; Pham, Quynh P; Mikos, Antonios G; Wilson, Lon J; Engler, David A

2008-01-01

A new class of water-soluble C60 transfecting agents has been prepared using Hirsch-Bingel chemistry and assessed for their ability to act as gene-delivery vectors in vitro. In an effort to elucidate the relationship between the hydrophobicity of the fullerene core, the hydrophilicity of the water-solubilizing groups, and the overall charge state of the C60 vectors in gene delivery and expression, several different C60 derivatives were synthesized to yield either positively charged, negatively charged, or neutral chemical functionalities under physiological conditions. These fullerene derivatives were then tested for their ability to transfect cells grown in culture with DNA carrying the green fluorescent protein (GFP) reporter gene. Statistically significant expression of GFP was observed for all forms of the C60 derivatives when used as DNA vectors and compared to the ability of naked DNA alone to transfect cells. However, efficient in vitro transfection was only achieved with the two positively charged C60 derivatives, namely, an octa-amino derivatized C60 and a dodeca-amino derivatized C60 vector. All C60 vectors showed an increase in toxicity in a dose-dependent manner. Increased levels of cellular toxicity were observed for positively charged C60 vectors relative to the negatively charged and neutral vectors. Structural analyses using dynamic light scattering and optical microscopy offered further insights into possible correlations between the various derivatized C60 compounds, the C60 vector/DNA complexes, their physical attributes (aggregation, charge) and their transfection efficiencies. Recently, similar Gd@C60-based compounds have demonstrated potential as advanced contrast agents for magnetic resonance imaging (MRI). Thus, the successful demonstration of intracellular DNA uptake, intracellular transport, and gene expression from DNA using C60 vectors suggests the possibility of developing analogous Gd@C60-based vectors to serve simultaneously as both therapeutic and diagnostic agents.

Mouse mammary tumor virus-based vector transduces non-dividing cells, enters the nucleus via a TNPO3-independent pathway and integrates in a less biased fashion than other retroviruses.

PubMed

Konstantoulas, Constantine James; Indik, Stanislav

2014-04-30

Mouse mammary tumor virus (MMTV) is a complex, milk-born betaretrovirus, which preferentially infects dendritic cells (DC) in the gastrointestinal tract and then spreads to T and B lymphocytes and finally to the mammary gland. It is not clear how the prototypic betaretrovirus infects mucosal DCs and naïve lymphocytes as these cells are considered to be non-proliferative. Studies of MMTV biology have been hampered by the difficulty of obtaining sufficient virus/vector titers after transfection of a molecular clone in cultured cells. To surmount this barrier we developed a novel MMTV-based vector system with a split genome design containing potent posttranscriptional regulatory functions. Using this system, vector particles were produced to markedly greater titers (>1000-fold) than those obtained previously. The titers (>106 transduction units /ml) were comparable to those achieved with lentiviral or gammaretroviral vectors. Importantly, the vector transduced the enhanced green fluorescence protein gene into the chromosomes of non-dividing cells, such as cells arrested at the G2/M phase of the cell cycle and unstimulated hematopoietic progenitor cells, at an efficiency similar to that obtained with the HIV-1-based vector. In contrast to HIV-1, MMTV transductions were not affected by knocking down the expression of a factor involved in nuclear import of the HIV-1 pre-integration complexes, TNPO3. In contrast to HIV-1, the MMTV-based vector did not preferentially integrate in transcription units. Additionally, no preference for integration near transcription start sites, the regions preferentially targeted by gammaretroviral vectors, was observed. The vector derived from MMTV exhibits a random integration pattern. Overall, the betaretroviral vector system should facilitate molecular virology studies of the prototypic betaretrovirus as well as studies attempting to elucidate fundamental cellular processes such as nuclear import pathways. Random integration in cycling and non-cycling cells may be applicable in unbiased gene delivery.

Expression of red-shifted green fluorescent protein by Escherichia coli O157:H7 as a marker for the detection of cells on fresh produce.

PubMed

Takeuchi, K; Frank, J F

2001-03-01

Escherichia coli O157:H7 was transformed with a plasmid vector red-shifted green fluorescence protein (pEGFP) to express red-shifted green fluorescence protein (EGFP) from Aequorea victoria. The EGFP expression among total cells and nonviable cells was determined at the cellular level by microscopic observation of immunostained and membrane-impermeable, dye-stained cultures, respectively. E. coli O157:H7 retained pEGFP during frozen storage at -80 degrees C. The percentage of EGFP expression was improved by repeated subculturing, reaching 83.4 +/- 0.1%, although the fluorescence intensity varied among cells. A low percentage of EGFP-expressing cells was nonviable. The percentage of EGFP decreased when the culture plate was kept at 4 degrees C, suggesting that some cells lost pEGFP during refrigeration. The storage of the culture suspension in sterile deionized water at 4 degrees C for 24 h reduced the percentage of EGFP expression, indicating that some EGFP was denatured. The application of EGFP as a marker for E. coli O157:H7 on green leaf lettuce, cauliflower, and tomato was evaluated using confocal scanning laser microscopy. EGFP-transformed cells were readily visible under confocal scanning laser microscopy on all produce types. The numbers of E. coli O157:H7 cells detected with EGFP were equivalent to those detected with immunostaining for green leaf lettuce and cauliflower but less for tomato. E. coli O157:H7 attached preferentially to damaged tissues of green leaf lettuce and tomato over intact tissue surfaces and to flowerets of cauliflower than to stem surfaces. EGFP can serve as a marker to characterize E. coli O157:H7 attachment on green leaf lettuce and cauliflower but may not be suitable on tomato.

ReAsH/FlAsH labeling and image analysis of tetracysteine sensor proteins in cells.

PubMed

Irtegun, Sevgi; Ramdzan, Yasmin M; Mulhern, Terrence D; Hatters, Danny M

2011-08-31

Fluorescent proteins and dyes are essential tools for the study of protein trafficking, localization and function in cells. While fluorescent proteins such as green fluorescence protein (GFP) have been extensively used as fusion partners to proteins to track the properties of a protein of interest, recent developments with smaller tags enable new functionalities of proteins to be examined in cells such as conformational change and protein-association. One small tag system involves a tetracysteine motif (CCXXCC) genetically inserted into a target protein, which binds to biarsenical dyes, ReAsH (red fluorescent) and FlAsH (green fluorescent), with high specificity even in live cells. The TC/biarsenical dye system offers far less steric constraints to the host protein than fluorescent proteins which has enabled several new approaches to measure conformational change and protein-protein interactions. We recently developed a novel application of TC tags as sensors of oligomerization in cells expressing mutant huntingtin, which when mutated aggregates in neurons in Huntington disease. Huntingtin was tagged with two fluorescent dyes, one a fluorescent protein to track protein location, and the second a TC tag which only binds biarsenical dyes in monomers. Hence, changes in colocalization between protein and biarsenical dye reactivity enabled submicroscopic oligomer content to be spatially mapped within cells. Here, we describe how to label TC-tagged proteins fused to a fluorescent protein (Cherry, GFP or CFP) with FlAsH or ReAsH in live mammalian cells and how to quantify the two color fluorescence (Cherry/FlAsH, CFP/FlAsH or GFP/ReAsH combinations).

Viral vectors for gene modification of plants as chem/bio sensors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manginell, Monica; Harper, Jason C.; Arango, Dulce C.

2006-11-01

Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport.more » We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing platforms. Detection of the chem/bio agent reporter (GFP) can be detected only at a specific wavelength.« less

Fluorescence Quantum Yield Measurements of Fluorescent Proteins: A Laboratory Experiment for a Biochemistry or Molecular Biophysics Laboratory Course

ERIC Educational Resources Information Center

Wall, Kathryn P.; Dillon, Rebecca; Knowles, Michelle K.

2015-01-01

Fluorescent proteins are commonly used in cell biology to assess where proteins are within a cell as a function of time and provide insight into intracellular protein function. However, the usefulness of a fluorescent protein depends directly on the quantum yield. The quantum yield relates the efficiency at which a fluorescent molecule converts…

Genetically fluorescent melanoma bone and organ metastasis models.

PubMed

Yang, M; Jiang, P; An, Z; Baranov, E; Li, L; Hasegawa, S; Al-Tuwaijri, M; Chishima, T; Shimada, H; Moossa, A R; Hoffman, R M

1999-11-01

We report here the establishment and metastatic properties of bright, highly stable, green fluorescent protein (GFP) expression transductants of the B16 mouse malignant melanoma cell line and the LOX human melanoma line. The highly fluorescent malignant melanoma cell lines allowed the visualization of skeletal and multiorgan metastases after i.v. injection of B16 cells in C57BL/6 mice and intradermal injection of LOX cells in nude mice. The melanoma cell lines were transduced with the pLEIN expression retroviral vector containing the GFP and neomycin resistance genes. Stable B16F0 and LOX clones expressing high levels of GFP were selected stepwise in vitro in levels of G418 of up to 800 microg/ml. Extensive bone and bone marrow metastases of B16F0 were visualized by GFP expression when the animals were sacrificed 3 weeks after cell implantation. Metastases for both cell lines were visualized in many organs, including the brain, lung, pleural membrane, liver, kidney, adrenal gland, lymph nodes, skeleton, muscle, and skin by GFP fluorescence. This is the first observation of experimental skeletal metastases of melanoma, which was made possible by GFP expression. These models should facilitate future studies of the mechanism and therapy of bone and multiorgan metastasis of melanoma.

A versatile microsatellite instability reporter system in human cells.

PubMed

Koole, Wouter; Schäfer, Henning S; Agami, Reuven; van Haaften, Gijs; Tijsterman, Marcel

2013-09-01

Here, we report the investigation of microsatellite instability (MSI) in human cells with a newly developed reporter system based on fluorescence. We composed a vector into which microsatellites of different lengths and nucleotide composition can be introduced between a functional copy of the fluorescent protein mCherry and an out-of-frame copy of EGFP; in vivo frameshifting will lead to EGFP expression, which can be quantified by fluorescence activated cell sorting (FACS). Via targeted recombineering, single copy reporters were introduced in HEK293 and MCF-7 cells. We found predominantly -1 and +1 base pair frameshifts, the levels of which are kept in tune by mismatch repair. We show that tract length and composition greatly influences MSI. In contrast, a tracts' potential to form a G-quadruplex structure, its strand orientation or its transcriptional status is not affecting MSI. We further validated the functionality of the reporter system for screening microsatellite mutagenicity of compounds and for identifying modifiers of MSI: using a retroviral miRNA expression library, we identified miR-21, which targets MSH2, as a miRNA that induces MSI when overexpressed. Our data also provide proof of principle for the strategy of combining fluorescent reporters with next-generation sequencing technology to identify genetic factors in specific pathways.

Herpes simplex virus vector-mediated gene delivery of glutamic acid decarboxylase reduces detrusor overactivity in spinal cord injured rats

PubMed Central

Miyazato, Minoru; Sugaya, Kimio; Goins, William F.; Goss, James R.; Chancellor, Michael B.; de Groat, William C.; Glorioso, Joseph C.; Yoshimura, Naoki

2010-01-01

We examined whether replication-defective herpes simplex virus (HSV) vectors encoding the 67 Kd form of the glutamic acid decarboxylase (GAD67) gene product, the gamma-aminobutyric acid (GABA) synthesis enzyme, can suppress detrusor overactivity (DO) in spinal cord injury (SCI) rats. One week after spinalization, HSV vectors expressing GAD and green fluorescent protein (GFP) (HSV-GAD) were injected into the bladder wall. SCI rats without HSV injection (HSV-untreated) and those injected with lacZ-encoding reporter gene HSV vectors (HSV-LacZ) were used as controls. Three weeks after viral injection, continuous cystometry was performed under awake conditions in all three groups. In the HSV-GAD group, the number and amplitude of non-voiding contractions (NVCs) were significantly decreased (40–45% and 38–40%, respectively) along with an increase in voiding efficiency, compared with HSV-untreated and HSV-LacZ groups, but micturition pressure was not different among the three groups. Intrathecal application of bicuculline partly reversed the decreased number and amplitude of NVCs, and decreased voiding efficiency in the HSV-GAD group. In the HSV-GAD group, GAD67 mRNA and protein levels were significantly increased in L6-S1 dorsal root ganglia (DRG) compared with the HSV-LacZ group while 57% of DRG cells were GFP-positive, and these neurons showed increased GAD67-like immunoreactivity compared with the HSV-LacZ group. These results indicate that GAD gene therapy effectively suppresses DO following SCI predominantly via activation of spinal GABAA receptors. Thus, HSV-based GAD gene transfer to bladder afferent pathways may represent a novel approach for the treatment of neurogenic DO. PMID:19225548

[EFFECT OF RECOMBINANT ADENOVIRUS-BONE MORPHOGENETIC PROTEIN 12 TRANSFECTION ON DIFFERENTIATION OF PERIPHERAL BLOOD MESENCHYMAL STEM CELLS INTO TENDON/LIGAMENT CELLS].

PubMed

Fu, Weili; Chen, Gang; Tang, Xin; Li, Qi; Ll, Jian

2015-04-01

To research the effect of recombinant adenovirus-bone morphogenetic protein 12 (Ad-BMP-12) transfection on the differentiation of peripheral blood mesenchymal stem cells (MSCs) into tendon/ligament cells. Peripheral blood MSCs were isolated from New Zealand rabbits (3-4 months old) and cultured in vitro until passage 3. The recombinant adenoviral vector system was prepared using AdEasy system, then transfected into MSCs at passage 3 (transfected group); untransfected MSCs served as control (untransfected group). The morphological characteristics and growth of transfected cells were observed under inverted phase contrast microscope. The transfection efficiency and green fluorescent protein (GFP) expression were detected by flow cytometry (FCM) and fluorescence microscopy. After cultured for 14 days in vitro, the expressions of tendon/ligament-specific markers were determined by immunohistochemistry and real-time fluorescent quantitative PCR. GFP expression could be observed in peripheral blood MSCs at 8 hours after transfection. At 24 hours after transfection, the cells had clear morphology and grew slowly under inverted phase contrast microscope and almost all expressed GFP at the same field under fluorescence microscopy. FCM analysis showed that the transfection efficiency of the transfected group was 99.57%, while it was 2.46% in the untransfected group. The immunohistochemistry showed that the expression of collagen type I gradually increased with culture time in vitro. Real-time fluorescent quantitative PCR results showed that the mRNA expressions of the tendon/ligament-specific genes (Tenomodulin, Tenascin-C, and Decorin) in the transfected group were significantly higher than those in untransfected group (0.061+/- 0.013 vs. 0.004 +/- 0.002, t = -7.700, P=0.031; 0.029 +/- 0.008 vs. 0.003 +/- 0.001, t = -5.741, P=0.020; 0.679 +/- 0.067 vs. 0.142 +/- 0.024, t = -12.998, P=0.000). Ad-BMP-12 can significantly promote differentiation of peripheral blood MSCs into tendon/ligament fibroblasts and enhance the expressions of tendon/ligament-specific phenotypic differentiation, which would provide the evidence for peripheral blood MSCs applied for tendon/ligament regeneration.

Application of eGFP to label human periodontal ligament stem cells in periodontal tissue engineering.

PubMed

Wen, Yong; Lan, Jing; Huang, Haiyun; Yu, Meijiao; Cui, Jun; Liang, Jin; Jiang, Baoqi; Xu, Xin

2012-09-01

To establish human periodontal ligament stem cells (hPDLSC) with high and stable expression of enhanced green fluorescent protein (eGFP) and to obtain an ideal vector expression system that suitable for gene therapy in periodontal tissue engineering. hPDLSCs were transfected with eGFP for 48h via different MOI (25, 50, 100, 200 and 400) by lentiviral vector, the transfection efficiency was evaluated by fluorescent microscopy and flow cytometry, and transfected hPDLSCs proliferation was evaluated by MTT. Pluripotent, differentiation capacity and ALP expression status were determined further. Osteoblast-associated genes expressions for osteogenesis were evaluated by quantitative-PCR. In addition, rat molar periodontal fenestration defect model was used for evaluating periodontal tissue engineering. The transfection efficiency after 48h were 44.7%, 60.9%, 71.7%, 85.8%, and 86.9% respectively. There was no significant effect of transfection (at different MOI levels of 25, 50, 100, and 200) on the proliferation of hPDLSCs (designated as eGFP-hPDLSCs) compared with hPDLSCs (P>0.05). However, proliferation of eGFP hPDLSCs at MOI 400 became slower (P<0.05). Both eGFP hPDLSCs and hPDLSCs were able to differentiate into osteocytes and adipocytes under certain conditioned media. At 7 days, expression levels of COL-1, RUNX2 in hPDLSCS were higher than those in eGFP hPDLSCs (P<0.05); expression levels of ALP and OPN in eGFP hPDLSCs were similar to those in hPDLSCs (P>0.05). Newly regenerated bone formation was observed in the defect model used. Among the transfection conditions, 48h transfection at MOI 200 is optimal for labelling hPDLSCs with eGFP in a lentiviral vector. There is no change in capability of the eGFP hPDLSCs osteogenesis. The lentiviral vector with eGFP is an appropriate expression vector system and hPDLSCs are ideal seeding cells for gene therapy in periodontal tissue engineering. Copyright © 2012 Elsevier Ltd. All rights reserved.

Different levels of immunogenicity of two strains of Fowlpox virus as recombinant vaccine vectors eliciting T-cell responses in heterologous prime-boost vaccination strategies.

PubMed

Cottingham, Matthew G; van Maurik, Andre; Zago, Manola; Newton, Angela T; Anderson, Richard J; Howard, M Keith; Schneider, Jörg; Skinner, Michael A

2006-07-01

The FP9 strain of F has been described as a more immunogenic recombinant vaccine vector than the Webster FPV-M (FPW) strain (R. J. Anderson et al., J. Immunol. 172:3094-3100, 2004). This study expands the comparison to include two separate recombinant antigens and multiple, rather than single, independent viral clones derived from the two strains. Dual-poxvirus heterologous prime-boost vaccination regimens using individual clones of recombinant FP9 or FPW in combination with recombinant modified V Ankara expressing the same antigen were evaluated for their ability to elicit T-cell responses against recombinant antigens from Plasmodium berghei (circumsporozoite protein) or human immunodeficiency virus type 1 (a Gag-Pol-Nef fusion protein). Gamma interferon enzyme-linked immunospot assay and fluorescence-activated cell sorting assays of the responses to specific epitopes confirmed the approximately twofold-greater cellular immunogenicity of FP9 compared to FPW, when given as the priming or boosting immunization. Equality of transgene expression in mouse cells infected with the two strains in vitro was verified by Western blotting. Directed partial sequence analysis and PCR analysis of FPW and comparison to available whole-genome sequences revealed that many loci that are mutated in the highly attenuated and culture-adapted FP9 strain are wild type in FPW, including the seven multikilobase deletions. These "passage-specific" alterations are hypothesized to be involved in determining the immunogenicity of fowlpox virus as a recombinant vaccine vector.

Ectopic ERK Expression Induces Phenotypic Conversion of C10 Cells and Alters DNA Methyltransferase Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sontag, Ryan L.; Weber, Thomas J.

2012-05-04

In some model systems constitutive extracellular signal regulated kinase (ERK) activation is sufficient to promote an oncogenic phenotype. Here we investigate whether constitutive ERK expression influences phenotypic conversion in murine C10 type II alveolar epithelial cells. C10 cells were stably transduced with an ERK1-green fluorescent protein (ERK1-GFP) chimera or empty vector and ectopic ERK expression was associated with the acquisition of soft agar focus-forming potential in late passage, but not early passage cells. Late passage ERK1-GFP cells exhibited a significant increase in the expression of DNA methyl transferases (DNMT1 and 3b) and a marked increase in sensitivity to 5-azacytidine (5-azaC)-mediatedmore » toxicity, relative to early passage ERK1-GFP cells and vector controls. The expression of xeroderma pigmentosum complementation group A (XPA) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) were significantly increased in late passage cells, suggesting enhanced DNA damage recognition and repair activity which we interpret as a reflection of genomic instability. Phospho-ERK levels were dramatically decreased in late passage ERK1-GFP cells, relative to early passage and vector controls, and phospho-ERK levels were restored by treatment with sodium orthovanadate, indicating a role for phosphatase activity in this response. Collectively these observations suggest that ectopic ERK expression promotes phenotypic conversion of C10 cells that is associated with latent effects on epigenetic programming and phosphatase activities.« less

PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

PubMed

Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

2016-05-01

To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

Impact of age and vector construct on striatal and nigral transgene expression

PubMed Central

Polinski, Nicole K; Manfredsson, Fredric P; Benskey, Matthew J; Fischer, D Luke; Kemp, Christopher J; Steece-Collier, Kathy; Sandoval, Ivette M; Paumier, Katrina L; Sortwell, Caryl E

2016-01-01

Therapeutic protein delivery using viral vectors has shown promise in preclinical models of Parkinson’s disease (PD) but clinical trial success remains elusive. This may partially be due to a failure to include advanced age as a covariate despite aging being the primary risk factor for PD. We investigated transgene expression following intracerebral injections of recombinant adeno-associated virus pseudotypes 2/2 (rAAV2/2), 2/5 (rAAV2/5), 2/9 (rAAV2/9), and lentivirus (LV) expressing green fluorescent protein (GFP) in aged versus young adult rats. Both rAAV2/2 and rAAV2/5 yielded lower GFP expression following injection to either the aged substantia nigra or striatum. rAAV2/9-mediated GFP expression was deficient in the aged striatonigral system but displayed identical transgene expression between ages in the nigrostriatal system. Young and aged rats displayed equivalent GFP levels following LV injection to the striatonigral system but LV-delivered GFP was deficient in delivering GFP to the aged nigrostriatal system. Notably, age-related transgene expression deficiencies revealed by protein quantitation were poorly predicted by GFP-immunoreactive cell counts. Further, in situ hybridization for the viral CβA promoter revealed surprisingly limited tropism for astrocytes compared to neurons. Our results demonstrate that aging is a critical covariate to consider when designing gene therapy approaches for PD. PMID:27933309

Overexpression of neurofilament H disrupts normal cell structure and function

NASA Technical Reports Server (NTRS)

Szebenyi, Gyorgyi; Smith, George M.; Li, Ping; Brady, Scott T.

2002-01-01

Studying exogenously expressed tagged proteins in live cells has become a standard technique for evaluating protein distribution and function. Typically, expression levels of experimentally introduced proteins are not regulated, and high levels are often preferred to facilitate detection. However, overexpression of many proteins leads to mislocalization and pathologies. Therefore, for normative studies, moderate levels of expression may be more suitable. To understand better the dynamics of intermediate filament formation, transport, and stability in a healthy, living cell, we inserted neurofilament heavy chain (NFH)-green fluorescent protein (GFP) fusion constructs in adenoviral vectors with tetracycline (tet)-regulated promoters. This system allows for turning on or off the synthesis of NFH-GFP at a selected time, for a defined period, in a dose-dependent manner. We used this inducible system for live cell imaging of changes in filament structure and cell shape, motility, and transport associated with increasing NFH-GFP expression. Cells with low to intermediate levels of NFH-GFP were structurally and functionally similar to neighboring, nonexpressing cells. In contrast, overexpression led to pathological alterations in both filament organization and cell function. Copyright 2002 Wiley-Liss, Inc.

The possibilities of improvement in the sensitivity of cancer fluorescence diagnostics by computer image processing

NASA Astrophysics Data System (ADS)

Ledwon, Aleksandra; Bieda, Robert; Kawczyk-Krupka, Aleksandra; Polanski, Andrzej; Wojciechowski, Konrad; Latos, Wojciech; Sieron-Stoltny, Karolina; Sieron, Aleksander

2008-02-01

Background: Fluorescence diagnostics uses the ability of tissues to fluoresce after exposition to a specific wavelength of light. The change in fluorescence between normal and progression to cancer allows to see early cancer and precancerous lesions often missed by white light. Aim: To improve by computer image processing the sensitivity of fluorescence images obtained during examination of skin, oral cavity, vulva and cervix lesions, during endoscopy, cystoscopy and bronchoscopy using Xillix ONCOLIFE. Methods: Function of image f(x,y):R2 --> R 3 was transformed from original color space RGB to space in which vector of 46 values refers to every point labeled by defined xy-coordinates- f(x,y):R2 --> R 46. By means of Fisher discriminator vector of attributes of concrete point analalyzed in the image was reduced according to two defined classes defined as pathologic areas (foreground) and healthy areas (background). As a result the highest four fisher's coefficients allowing the greatest separation between points of pathologic (foreground) and healthy (background) areas were chosen. In this way new function f(x,y):R2 --> R 4 was created in which point x,y corresponds with vector Y, H, a*, c II. In the second step using Gaussian Mixtures and Expectation-Maximisation appropriate classificator was constructed. This classificator enables determination of probability that the selected pixel of analyzed image is a pathologically changed point (foreground) or healthy one (background). Obtained map of probability distribution was presented by means of pseudocolors. Results: Image processing techniques improve the sensitivity, quality and sharpness of original fluorescence images. Conclusion: Computer image processing enables better visualization of suspected areas examined by means of fluorescence diagnostics.

Chromophore photophysics and dynamics in fluorescent proteins of the GFP family

NASA Astrophysics Data System (ADS)

Nienhaus, Karin; Nienhaus, G. Ulrich

2016-11-01

Proteins of the green fluorescent protein (GFP) family are indispensable for fluorescence imaging experiments in the life sciences, particularly of living specimens. Their essential role as genetically encoded fluorescence markers has motivated many researchers over the last 20 years to further advance and optimize these proteins by using protein engineering. Amino acids can be exchanged by site-specific mutagenesis, starting with naturally occurring proteins as templates. Optical properties of the fluorescent chromophore are strongly tuned by the surrounding protein environment, and a targeted modification of chromophore-protein interactions requires a profound knowledge of the underlying photophysics and photochemistry, which has by now been well established from a large number of structural and spectroscopic experiments and molecular-mechanical and quantum-mechanical computations on many variants of fluorescent proteins. Nevertheless, such rational engineering often does not meet with success and thus is complemented by random mutagenesis and selection based on the optical properties. In this topical review, we present an overview of the key structural and spectroscopic properties of fluorescent proteins. We address protein-chromophore interactions that govern ground state optical properties as well as processes occurring in the electronically excited state. Special emphasis is placed on photoactivation of fluorescent proteins. These light-induced reactions result in large structural changes that drastically alter the fluorescence properties of the protein, which enables some of the most exciting applications, including single particle tracking, pulse chase imaging and super-resolution imaging. We also present a few examples of fluorescent protein application in live-cell imaging experiments.

Lipid nanoparticle vectorization of indocyanine green improves fluorescence imaging for tumor diagnosis and lymph node resection.

PubMed

Navarro, Fabrice P; Berger, Michel; Guillermet, Stéphanie; Josserand, Véronique; Guyon, Laurent; Neumann, Emmanuelle; Vinet, Françoise; Texier, Isabelle

2012-10-01

Fluorescence imaging is opening a new era in image-guided surgery and other medical applications. The only FDA approved contrast agent in the near infrared is IndoCyanine Green (ICG), which despites its low toxicity, displays poor chemical and optical properties for long-term and sensitive imaging applications in human. Lipid nanoparticles are investigated for improving ICG optical properties and in vivo fluorescence imaging sensitivity. 30 nm diameter lipid nanoparticles (LNP) are loaded with ICG. Their characterization and use for tumor and lymph node imaging are described. Nano-formulation benefits dye optical properties (6 times improved brightness) and chemical stability (>6 months at 4 degrees C in aqueous buffer). More importantly, LNP vectorization allows never reported sensitive and prolonged (>1 day) labeling of tumors and lymph nodes. Composed of human-use approved ingredients, this novel ICG nanometric formulation is foreseen to expand rapidly the field of clinical fluorescence imaging applications.

ReAsH/FlAsH Labeling and Image Analysis of Tetracysteine Sensor Proteins in Cells

PubMed Central

Irtegun, Sevgi; Ramdzan, Yasmin M.; Mulhern, Terrence D.; Hatters, Danny M.

2011-01-01

Fluorescent proteins and dyes are essential tools for the study of protein trafficking, localization and function in cells. While fluorescent proteins such as green fluorescence protein (GFP) have been extensively used as fusion partners to proteins to track the properties of a protein of interest1, recent developments with smaller tags enable new functionalities of proteins to be examined in cells such as conformational change and protein-association 2, 3. One small tag system involves a tetracysteine motif (CCXXCC) genetically inserted into a target protein, which binds to biarsenical dyes, ReAsH (red fluorescent) and FlAsH (green fluorescent), with high specificity even in live cells 2. The TC/biarsenical dye system offers far less steric constraints to the host protein than fluorescent proteins which has enabled several new approaches to measure conformational change and protein-protein interactions 4-7. We recently developed a novel application of TC tags as sensors of oligomerization in cells expressing mutant huntingtin, which when mutated aggregates in neurons in Huntington disease 7. Huntingtin was tagged with two fluorescent dyes, one a fluorescent protein to track protein location, and the second a TC tag which only binds biarsenical dyes in monomers. Hence, changes in colocalization between protein and biarsenical dye reactivity enabled submicroscopic oligomer content to be spatially mapped within cells. Here, we describe how to label TC-tagged proteins fused to a fluorescent protein (Cherry, GFP or CFP) with FlAsH or ReAsH in live mammalian cells and how to quantify the two color fluorescence (Cherry/FlAsH, CFP/FlAsH or GFP/ReAsH combinations). PMID:21897361

A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

PubMed

Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

2009-03-13

Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

Easy preparation of a large-size random gene mutagenesis library in Escherichia coli.

PubMed

You, Chun; Percival Zhang, Y-H

2012-09-01

A simple and fast protocol for the preparation of a large-size mutant library for directed evolution in Escherichia coli was developed based on the DNA multimers generated by prolonged overlap extension polymerase chain reaction (POE-PCR). This protocol comprised the following: (i) a linear DNA mutant library was generated by error-prone PCR or shuffling, and a linear vector backbone was prepared by regular PCR; (ii) the DNA multimers were generated based on these two DNA templates by POE-PCR; and (iii) the one restriction enzyme-digested DNA multimers were ligated to circular plasmids, followed by transformation to E. coli. Because the ligation efficiency of one DNA fragment was several orders of magnitude higher than that of two DNA fragments for typical mutant library construction, it was very easy to generate a mutant library with a size of more than 10(7) protein mutants per 50 μl of the POE-PCR product. Via this method, four new fluorescent protein mutants were obtained based on monomeric cherry fluorescent protein. This new protocol was simple and fast because it did not require labor-intensive optimizations in restriction enzyme digestion and ligation, did not involve special plasmid design, and enabled constructing a large-size mutant library for directed enzyme evolution within 1 day. Copyright © 2012 Elsevier Inc. All rights reserved.

Development and applications of transgenesis in the yellow fever mosquito, Aedes aegypti.

PubMed

Adelman, Zachary N; Jasinskiene, Nijole; James, Anthony A

2002-04-30

Transgenesis technology has been developed for the yellow fever mosquito, Aedes aegypti. Successful integration of exogenous DNA into the germline of this mosquito has been achieved with the class II transposable elements, Hermes, mariner and piggyBac. A number of marker genes, including the cinnabar(+) gene of Drosophila melanogaster, and fluorescent protein genes, can be used to monitor the insertion of these elements. The availability of multiple elements and marker genes provides a powerful set of tools to investigate basic biological properties of this vector insect, as well as the materials for developing novel, genetics-based, control strategies for the transmission of disease.

In vivo bacterial imaging without engineering; A novel probe-based strategy facilitated by endogenous nitroreductase enzymes.

PubMed

Stanton, Michael; Cronin, Michelle; Lehouritis, Panos; Tangney, Mark

2015-01-01

The feasibility of utilising bacteria as vectors for gene therapy is becoming increasingly recognised. This is primarily due to a number of intrinsic properties of bacteria such as their tumour targeting capabilities, their ability to carry large genetic or protein loads and the availability of well-established genetic engineering tools for a range of common lab strains. However, a number of issues relating to the use of bacteria as vectors for gene therapy need to be addressed in order for the field to progress. Amongst these is the need for the development of non-invasive detection/imaging systems for bacteria within a living host. In vivo optical imaging has advanced preclinical research greatly, and typically involves engineering of bacteria with genetic expression constructs for luminescence (e.g. the lux operon) or fluorescent proteins (GFP etc.). This requirement for genetic modification can be restrictive, where engineering is not experimentally appropriate or technologically feasible (e.g. due to lack of suitable engineering tools). We describe a novel strategy exploiting endogenous bacterial enzymatic activity to specifically activate an exogenously administered fluorescent imaging probe. The red shifted, quenched fluorophore CytoCy5S is reduced to a fluorescent form by bacterial-specific nitroreductase (NTR) enzymes. NTR enzymes are present in a wide range of bacterial genera and absent in mammalian systems, permitting highly specific detection of Gram-negative and Gram-positive bacteria in vivo. In this study, dose-responsive bacterial-specific signals were observed in vitro from all genera examined - E. coli, Salmonella, Listeria, Bifidobacterium and Clostridium difficile. Examination of an NTR-knockout strain validated the enzyme specificity of the probe. In vivo whole-body imaging permitted specific, dose-responsive monitoring of bacteria over time in various infection models, and no toxicity to bacteria or host was observed. This study demonstrates the concept of exploiting innate NTR activity as a reporting strategy for wild-type bacteria using optical imaging, while the concept may also be extended to NTR-specific probes for use with other imaging modalities.

Genetic alteration of Mycobacterium smegmatis to improve mycobacterium-mediated transfer of plasmid DNA into mammalian cells and DNA immunization.

PubMed

Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J

2007-10-01

Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.

A defective retroviral vector encoding human interferon-alpha2 can transduce human leukemic cell lines.

PubMed

Austruy, E; Bagnis, C; Carbuccia, N; Maroc, C; Birg, F; Dubreuil, P; Mannoni, P; Chabannon, C

1998-01-01

Using the LXSN backbone, a defective retroviral vector (LISN) was constructed that encodes the human interferon (IFN)-alpha2 (hIFN-alpha2) gene and the neomycin resistance gene; the hIFN-alpha2 gene was cloned from human placental genomic DNA. High titers of the LISN retrovirus were produced by the amphotropic packaging cell line GP+envAM12. LISN is able to infect three human hematopoietic and leukemic cell lines: K562, LAMA-84, and TF-1. G418-resistant cells were detected in a similar proportion after infection with either the LISN retroviral vector or the LnLSN retroviral vector (encoding the nlsLacZ gene instead of hIFN-alpha2), suggesting that hIFN-alpha2 does not inhibit (or only partially inhibits) the production of retroviral particles by the packaging cell line and the infection of human cells. LISN-infected cells express and secrete hIFN-alpha2 as demonstrated by Northern blot analysis of poly(A)+ RNA, detection of the intracellular protein by fluorescence-activated cell sorter analysis, and detection of secreted hIFN-alpha in cell supernatants using an enzyme-linked immunosorbent assay. Retrovirally produced hIFN-alpha2 is biologically active, as demonstrated by the partial inhibition of the growth of K562 and TF-1, the modulation of the expression of cell surface antigens, the induction of the (2'-5') oligoadenylate synthetase, and, for LAMA-84, the down-modulation of the BCR-ABL protein. We conclude that the infection of human leukemic cell lines with a retroviral vector encoding hIFN-alpha2 is feasible and induces the expected biological effects. This experimental model will be useful in investigating the possibility of transducing normal and leukemic cells and hematopoietic progenitors and in determining the consequences of the autocrine production of hIFN-alpha2 on the behavior of these cells.

CellSort: a support vector machine tool for optimizing fluorescence-activated cell sorting and reducing experimental effort.

PubMed

Yu, Jessica S; Pertusi, Dante A; Adeniran, Adebola V; Tyo, Keith E J

2017-03-15

High throughput screening by fluorescence activated cell sorting (FACS) is a common task in protein engineering and directed evolution. It can also be a rate-limiting step if high false positive or negative rates necessitate multiple rounds of enrichment. Current FACS software requires the user to define sorting gates by intuition and is practically limited to two dimensions. In cases when multiple rounds of enrichment are required, the software cannot forecast the enrichment effort required. We have developed CellSort, a support vector machine (SVM) algorithm that identifies optimal sorting gates based on machine learning using positive and negative control populations. CellSort can take advantage of more than two dimensions to enhance the ability to distinguish between populations. We also present a Bayesian approach to predict the number of sorting rounds required to enrich a population from a given library size. This Bayesian approach allowed us to determine strategies for biasing the sorting gates in order to reduce the required number of enrichment rounds. This algorithm should be generally useful for improve sorting outcomes and reducing effort when using FACS. Source code available at http://tyolab.northwestern.edu/tools/ . k-tyo@northwestern.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

A convenient method of preparing gene vector for real time monitoring transfection process based on the quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong

2012-11-15

Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less

Fluorescence turn-on responses of anionic and cationic conjugated polymers toward proteins: effect of electrostatic and hydrophobic interactions.

PubMed

Pu, Kan-Yi; Liu, Bin

2010-03-11

Cationic and anionic poly(fluorenyleneethynylene-alt-benzothiadiazole)s (PFEBTs) are designed and synthesized via Sonagashira coupling reaction to show light-up signatures toward proteins. Due to the charge transfer character of the excited states, the fluorescence of PFEBTs is very weak in aqueous solution, while their yellow fluorescence can be enhanced by polymer aggregation. PFEBTs show fluorescence turn-on rather than fluorescence quenching upon complexation with proteins. Both electrostatic and hydrophobic interactions between PFEBTs and proteins are found to improve the polymer fluorescence, the extent of which is dependent on the nature of the polymer and the protein. Changes in solution pH adjust the net charges of proteins, providing an effective way to manipulate electrostatic interactions and in turn the increment in the polymer fluorescence. In addition, the effect of protein digestion on the fluorescence of polymer/protein complexes is probed. The results indicate that electrostatic interaction induced polymer fluorescence increase cannot be substantially reduced through cleaving protein into peptide fragments. In contrast, hydrophobic interactions, mainly determined by the hydrophobicity of proteins, can be minimized by digestion, imparting a light-off signature for the polymer/protein complexes. This study thus not only highlights the opportunities of exerting nonspecific interactions for protein sensing but also reveals significant implications for biosensor design.

Development and Validation of a High-Content Bimolecular Fluorescence Complementation Assay for Small Molecule Inhibitors of HIV-1 Nef Dimerization

PubMed Central

Poe, Jerrod A.; Vollmer, Laura; Vogt, Andreas; Smithgall, Thomas E.

2014-01-01

Nef is an HIV-1 accessory factor essential for viral pathogenesis and AIDS progression. Many Nef functions require dimerization, and small molecules that block Nef dimerization may represent antiretroviral drug leads. Here we describe a cell-based assay for Nef dimerization inhibitors based on bimolecular fluorescence complementation (BiFC). Nef was fused to non-fluorescent, complementary fragments of YFP and co-expressed in the same cell population. Dimerization of Nef resulted in juxtaposition of the YFP fragments and reconstitution of the fluorophore. For automation, the Nef-YFP fusion proteins plus an mRFP reporter were expressed from a single vector, separated by picornavirus ‘2A’ linker peptides to permit equivalent translation of all three proteins. Validation studies revealed a critical role for gating on the mRFP-positive subpopulation of transfected cells, as well as use of the mRFP signal to normalize the Nef-BiFC signal. Nef-BiFC/mRFP ratios resulting from cells expressing wild-type vs. dimerization-defective Nef were very clearly separated, with Z-factors consistently in the 0.6–0.7 range. A fully automated pilot screen of the NIH Diversity Set III identified several hit compounds that reproducibly blocked Nef dimerization in the low micromolar range. This BiFC-based assay has the potential to identify cell-active small molecules that directly interfere with Nef dimerization and function. PMID:24282155

Linked Production of Pyroglutamate-Modified Proteins via Self-Cleavage of Fusion Tags with TEV Protease and Autonomous N-Terminal Cyclization with Glutaminyl Cyclase In Vivo

PubMed Central

Shih, Yan-Ping; Chou, Chi-Chi; Chen, Yi-Ling; Huang, Kai-Fa; Wang, Andrew H.- J.

2014-01-01

Overproduction of N-terminal pyroglutamate (pGlu)-modified proteins utilizing Escherichia coli or eukaryotic cells is a challenging work owing to the fact that the recombinant proteins need to be recovered by proteolytic removal of fusion tags to expose the N-terminal glutaminyl or glutamyl residue, which is then converted into pGlu catalyzed by the enzyme glutaminyl cyclase. Herein we describe a new method for production of N-terminal pGlu-containing proteins in vivo via intracellular self-cleavage of fusion tags by tobacco etch virus (TEV) protease and then immediate N-terminal cyclization of passenger target proteins by a bacterial glutaminyl cyclase. To combine with the sticky-end PCR cloning strategy, this design allows the gene of target proteins to be efficiently inserted into the expression vector using two unique cloning sites (i.e., SnaB I and Xho I), and the soluble and N-terminal pGlu-containing proteins are then produced in vivo. Our method has been successfully applied to the production of pGlu-modified enhanced green fluorescence protein and monocyte chemoattractant proteins. This design will facilitate the production of protein drugs and drug target proteins that possess an N-terminal pGlu residue required for their physiological activities. PMID:24733552

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

The Major Antigenic Membrane Protein of “Candidatus Phytoplasma asteris” Selectively Interacts with ATP Synthase and Actin of Leafhopper Vectors

PubMed Central

Galetto, Luciana; Bosco, Domenico; Balestrini, Raffaella; Genre, Andrea; Fletcher, Jacqueline; Marzachì, Cristina

2011-01-01

Phytoplasmas, uncultivable phloem-limited phytopathogenic wall-less bacteria, represent a major threat to agriculture worldwide. They are transmitted in a persistent, propagative manner by phloem-sucking Hemipteran insects. Phytoplasma membrane proteins are in direct contact with hosts and are presumably involved in determining vector specificity. Such a role has been proposed for phytoplasma transmembrane proteins encoded by circular extrachromosomal elements, at least one of which is a plasmid. Little is known about the interactions between major phytoplasma antigenic membrane protein (Amp) and insect vector proteins. The aims of our work were to identify vector proteins interacting with Amp and to investigate their role in transmission specificity. In controlled transmission experiments, four Hemipteran species were identified as vectors of “Candidatus Phytoplasma asteris”, the chrysanthemum yellows phytoplasmas (CYP) strain, and three others as non-vectors. Interactions between a labelled (recombinant) CYP Amp and insect proteins were analysed by far Western blots and affinity chromatography. Amp interacted specifically with a few proteins from vector species only. Among Amp-binding vector proteins, actin and both the α and β subunits of ATP synthase were identified by mass spectrometry and Western blots. Immunofluorescence confocal microscopy and Western blots of plasma membrane and mitochondrial fractions confirmed the localisation of ATP synthase, generally known as a mitochondrial protein, in plasma membranes of midgut and salivary gland cells in the vector Euscelidius variegatus. The vector-specific interaction between phytoplasma Amp and insect ATP synthase is demonstrated for the first time, and this work also supports the hypothesis that host actin is involved in the internalization and intracellular motility of phytoplasmas within their vectors. Phytoplasma Amp is hypothesized to play a crucial role in insect transmission specificity. PMID:21799902

Local Delivery of Gene Vectors From Bare-Metal Stents by Use of a Biodegradable Synthetic Complex Inhibits In-Stent Restenosis in Rat Carotid Arteries

PubMed Central

Fishbein, Ilia; Alferiev, Ivan; Bakay, Marina; Stachelek, Stanley J.; Sobolewski, Peter; Lai, Meizan; Choi, Hoon; Chen, I.-W.; Levy, Robert J.

2012-01-01

Background Local drug delivery from polymer-coated stents has demonstrated efficacy for preventing in-stent restenosis; however, both the inflammatory effects of polymer coatings and concerns about late outcomes of drug-eluting stent use indicate the need to investigate innovative approaches, such as combining localized gene therapy with stent angioplasty. Thus, we investigated the hypothesis that adenoviral vectors (Ad) could be delivered from the bare-metal surfaces of stents with a synthetic complex for reversible vector binding. Methods and Results We synthesized the 3 components of a gene vector binding complex: (1) A polyallylamine bisphosphonate with latent thiol groups (PABT), (2) a polyethyleneimine (PEI) with pyridyldithio groups for amplification of attachment sites [PEI(PDT)], and (3) a bifunctional (amine- and thiol-reactive) cross-linker with a labile ester bond (HL). HL-modified Ad attached to PABT/PEI(PDT)-treated steel surfaces demonstrated both sustained release in vitro over 30 days and localized green fluorescent protein expression in rat arterial smooth muscle cell cultures, which were not sensitive to either inhibition by neutralizing anti-Ad antibodies or inactivation after storage at 37°C. In rat carotid studies, deployment of steel stents configured with PABT/PEI(PDT)/HL-tethered adenoviral vectors demonstrated both site-specific arterial AdGFP expression and adenovirus-luciferase transgene activity per optical imaging. Rat carotid stent delivery of adenovirus encoding inducible nitric oxide synthase resulted in significant inhibition of restenosis. Conclusions Reversible immobilization of adenovirus vectors on the bare-metal surfaces of endovascular stents via a synthetic complex represents an efficient, tunable method for sustained release of gene vectors to the vasculature. PMID:18413497

Adaptive Evolution of Eel Fluorescent Proteins from Fatty Acid Binding Proteins Produces Bright Fluorescence in the Marine Environment.

PubMed

Gruber, David F; Gaffney, Jean P; Mehr, Shaadi; DeSalle, Rob; Sparks, John S; Platisa, Jelena; Pieribone, Vincent A

2015-01-01

We report the identification and characterization of two new members of a family of bilirubin-inducible fluorescent proteins (FPs) from marine chlopsid eels and demonstrate a key region of the sequence that serves as an evolutionary switch from non-fluorescent to fluorescent fatty acid-binding proteins (FABPs). Using transcriptomic analysis of two species of brightly fluorescent Kaupichthys eels (Kaupichthys hyoproroides and Kaupichthys n. sp.), two new FPs were identified, cloned and characterized (Chlopsid FP I and Chlopsid FP II). We then performed phylogenetic analysis on 210 FABPs, spanning 16 vertebrate orders, and including 163 vertebrate taxa. We show that the fluorescent FPs diverged as a protein family and are the sister group to brain FABPs. Our results indicate that the evolution of this family involved at least three gene duplication events. We show that fluorescent FABPs possess a unique, conserved tripeptide Gly-Pro-Pro sequence motif, which is not found in non-fluorescent fatty acid binding proteins. This motif arose from a duplication event of the FABP brain isoforms and was under strong purifying selection, leading to the classification of this new FP family. Residues adjacent to the motif are under strong positive selection, suggesting a further refinement of the eel protein's fluorescent properties. We present a phylogenetic reconstruction of this emerging FP family and describe additional fluorescent FABP members from groups of distantly related eels. The elucidation of this class of fish FPs with diverse properties provides new templates for the development of protein-based fluorescent tools. The evolutionary adaptation from fatty acid-binding proteins to fluorescent fatty acid-binding proteins raises intrigue as to the functional role of bright green fluorescence in this cryptic genus of reclusive eels that inhabit a blue, nearly monochromatic, marine environment.

Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

PubMed

Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

2012-04-01

The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

Dependence of fluorescent protein brightness on protein concentration in solution and enhancement of it

PubMed Central

Morikawa, Takamitsu J.; Fujita, Hideaki; Kitamura, Akira; Horio, Takashi; Yamamoto, Johtaro; Kinjo, Masataka; Sasaki, Akira; Machiyama, Hiroaki; Yoshizawa, Keiko; Ichimura, Taro; Imada, Katsumi; Nagai, Takeharu; Watanabe, Tomonobu M.

2016-01-01

Fluorescent proteins have been widely used in biology because of their compatibility and varied applications in living specimens. Fluorescent proteins are often undesirably sensitive to intracellular conditions such as pH and ion concentration, generating considerable issues at times. However, harnessing these intrinsic sensitivities can help develop functional probes. In this study, we found that the fluorescence of yellow fluorescent protein (YFP) depends on the protein concentration in the solution and that this dependence can be enhanced by adding a glycine residue in to the YFP; we applied this finding to construct an intracellular protein-crowding sensor. A Förster resonance energy transfer (FRET) pair, involving a cyan fluorescent protein (CFP) insensitive to protein concentration and a glycine-inserted YFP, works as a genetically encoded probe to evaluate intracellular crowding. By measuring the fluorescence of the present FRET probe, we were able to detect dynamic changes in protein crowding in living cells. PMID:26956628

A Family of LIC Vectors for High-Throughput Cloning and Purification of Proteins1

PubMed Central

Eschenfeldt, William H.; Stols, Lucy; Millard, Cynthia Sanville; Joachimiak, Andrzej; Donnelly, Mark I.

2009-01-01

Summary Fifteen related ligation-independent cloning vectors were constructed for high-throughput cloning and purification of proteins. The vectors encode a TEV protease site for removal of tags that facilitate protein purification (his-tag) or improve solubility (MBP, GST). Specialized vectors allow coexpression and copurification of interacting proteins, or in vivo removal of MBP by TVMV protease to improve screening and purification. All target genes and vectors are processed by the same protocols, which we describe here. PMID:18988021

In vitro and in vivo documentation of quantum dots labeled Trypanosoma cruzi--Rhodnius prolixus interaction using confocal microscopy.

PubMed

Feder, Denise; Gomes, Suzete A O; de Thomaz, André A; Almeida, Diogo B; Faustino, Wagner M; Fontes, Adriana; Stahl, Cecília V; Santos-Mallet, Jacenir R; Cesar, Carlos L

2009-12-01

Semiconductor quantum dots (QDs) are highly fluorescent nanocrystals markers that allow long photobleaching and do not destroy the parasites. In this paper, we used fluorescent core shell quantum dots to perform studies of live parasite-vector interaction processes without any observable effect on the vitality of parasites. These nanocrystals were synthesized in aqueous medium and physiological pH, which is very important for monitoring live cells activities, and conjugated with molecules such as lectins to label specific carbohydrates involved on the parasite-vector interaction. These QDs were successfully used for the study of in vitro and in vivo interaction of Trypanosoma cruzi and the triatomine Rhodnius prolixus. These QDs allowed us to acquire real time confocal images sequences of live T. cruzi-R. prolixus interactions for an extended period, causing no damage to the cells. By zooming to the region of interest, we have been able to acquire confocal images at the three to four frames per second rate. Our results show that QDs are physiological fluorescent markers capable to label living parasites and insect vector cells. QDs can be functionalized with lectins to specifically mark surface carbohydrates on perimicrovillar membrane of R. prolixus to follow, visualize, and understand interaction between vectors and its parasites in real-time.

Mechanisms of Formation and Structure of Chromophores of Fluorescent Proteins from Anthoza Species

DTIC Science & Technology

2005-03-01

green fluorescent protein (GFP) from the jellyfish Aequorea victoria ...investigate chemical structures and mechanisms of formation of chromophores within proteins of Green Fluorescent Protein (GFP) family. The project... structure . In this part of work we have shown that a fluorescent protein from Dendronephthya sp. transforms from the green - to the red-emitting

Cracks in the beta-can: fluorescent proteins from Anemonia sulcata (Anthozoa, Actinaria).

PubMed

Wiedenmann, J; Elke, C; Spindler, K D; Funke, W

2000-12-19

We characterize two green fluorescent proteins (GFPs), an orange fluorescent protein, and a nonfluorescent red protein isolated from the sea anemone Anemonia sulcata. The orange fluorescent protein and the red protein seem to represent two different states of the same protein. Furthermore, we describe the cloning of a GFP and a nonfluorescent red protein. Both proteins are homologous to the GFP from Aequorea victoria. The red protein is significantly smaller than other GFP homologues, and the formation of a closed GFP-like beta-can is not possible. Nevertheless, the primary structure of the red protein carries all features necessary for orange fluorescence. We discuss a type of beta-can that could be formed in a multimerization process.

Cracks in the β-can: Fluorescent proteins from Anemonia sulcata (Anthozoa, Actinaria)

PubMed Central

Wiedenmann, Jörg; Elke, Carsten; Spindler, Klaus-Dieter; Funke, Werner

2000-01-01

We characterize two green fluorescent proteins (GFPs), an orange fluorescent protein, and a nonfluorescent red protein isolated from the sea anemone Anemonia sulcata. The orange fluorescent protein and the red protein seem to represent two different states of the same protein. Furthermore, we describe the cloning of a GFP and a nonfluorescent red protein. Both proteins are homologous to the GFP from Aequorea victoria. The red protein is significantly smaller than other GFP homologues, and the formation of a closed GFP-like β-can is not possible. Nevertheless, the primary structure of the red protein carries all features necessary for orange fluorescence. We discuss a type of β-can that could be formed in a multimerization process. PMID:11121018

Low cost and open source multi-fluorescence imaging system for teaching and research in biology and bioengineering.

PubMed

Nuñez, Isaac; Matute, Tamara; Herrera, Roberto; Keymer, Juan; Marzullo, Timothy; Rudge, Timothy; Federici, Fernán

2017-01-01

The advent of easy-to-use open source microcontrollers, off-the-shelf electronics and customizable manufacturing technologies has facilitated the development of inexpensive scientific devices and laboratory equipment. In this study, we describe an imaging system that integrates low-cost and open-source hardware, software and genetic resources. The multi-fluorescence imaging system consists of readily available 470 nm LEDs, a Raspberry Pi camera and a set of filters made with low cost acrylics. This device allows imaging in scales ranging from single colonies to entire plates. We developed a set of genetic components (e.g. promoters, coding sequences, terminators) and vectors following the standard framework of Golden Gate, which allowed the fabrication of genetic constructs in a combinatorial, low cost and robust manner. In order to provide simultaneous imaging of multiple wavelength signals, we screened a series of long stokes shift fluorescent proteins that could be combined with cyan/green fluorescent proteins. We found CyOFP1, mBeRFP and sfGFP to be the most compatible set for 3-channel fluorescent imaging. We developed open source Python code to operate the hardware to run time-lapse experiments with automated control of illumination and camera and a Python module to analyze data and extract meaningful biological information. To demonstrate the potential application of this integral system, we tested its performance on a diverse range of imaging assays often used in disciplines such as microbial ecology, microbiology and synthetic biology. We also assessed its potential use in a high school environment to teach biology, hardware design, optics, and programming. Together, these results demonstrate the successful integration of open source hardware, software, genetic resources and customizable manufacturing to obtain a powerful, low cost and robust system for education, scientific research and bioengineering. All the resources developed here are available under open source licenses.

Low cost and open source multi-fluorescence imaging system for teaching and research in biology and bioengineering

PubMed Central

Herrera, Roberto; Keymer, Juan; Marzullo, Timothy; Rudge, Timothy

2017-01-01

The advent of easy-to-use open source microcontrollers, off-the-shelf electronics and customizable manufacturing technologies has facilitated the development of inexpensive scientific devices and laboratory equipment. In this study, we describe an imaging system that integrates low-cost and open-source hardware, software and genetic resources. The multi-fluorescence imaging system consists of readily available 470 nm LEDs, a Raspberry Pi camera and a set of filters made with low cost acrylics. This device allows imaging in scales ranging from single colonies to entire plates. We developed a set of genetic components (e.g. promoters, coding sequences, terminators) and vectors following the standard framework of Golden Gate, which allowed the fabrication of genetic constructs in a combinatorial, low cost and robust manner. In order to provide simultaneous imaging of multiple wavelength signals, we screened a series of long stokes shift fluorescent proteins that could be combined with cyan/green fluorescent proteins. We found CyOFP1, mBeRFP and sfGFP to be the most compatible set for 3-channel fluorescent imaging. We developed open source Python code to operate the hardware to run time-lapse experiments with automated control of illumination and camera and a Python module to analyze data and extract meaningful biological information. To demonstrate the potential application of this integral system, we tested its performance on a diverse range of imaging assays often used in disciplines such as microbial ecology, microbiology and synthetic biology. We also assessed its potential use in a high school environment to teach biology, hardware design, optics, and programming. Together, these results demonstrate the successful integration of open source hardware, software, genetic resources and customizable manufacturing to obtain a powerful, low cost and robust system for education, scientific research and bioengineering. All the resources developed here are available under open source licenses. PMID:29140977

BiFCROS: A Low-Background Fluorescence Repressor Operator System for Labeling of Genomic Loci.

PubMed

Milbredt, Sarah; Waldminghaus, Torsten

2017-06-07

Fluorescence-based methods are widely used to analyze elementary cell processes such as DNA replication or chromosomal folding and segregation. Labeling DNA with a fluorescent protein allows the visualization of its temporal and spatial organization. One popular approach is FROS (fluorescence repressor operator system). This method specifically labels DNA in vivo through binding of a fusion of a fluorescent protein and a repressor protein to an operator array, which contains numerous copies of the repressor binding site integrated into the genomic site of interest. Bound fluorescent proteins are then visible as foci in microscopic analyses and can be distinguished from the background fluorescence caused by unbound fusion proteins. Even though this method is widely used, no attempt has been made so far to decrease the background fluorescence to facilitate analysis of the actual signal of interest. Here, we present a new method that greatly reduces the background signal of FROS. BiFCROS (Bimolecular Fluorescence Complementation and Repressor Operator System) is based on fusions of repressor proteins to halves of a split fluorescent protein. Binding to a hybrid FROS array results in fluorescence signals due to bimolecular fluorescence complementation. Only proteins bound to the hybrid FROS array fluoresce, greatly improving the signal to noise ratio compared to conventional FROS. We present the development of BiFCROS and discuss its potential to be used as a fast and single-cell readout for copy numbers of genetic loci. Copyright © 2017 Milbredt and Waldminghaus.

BiFCROS: A Low-Background Fluorescence Repressor Operator System for Labeling of Genomic Loci

PubMed Central

Milbredt, Sarah; Waldminghaus, Torsten

2017-01-01

Fluorescence-based methods are widely used to analyze elementary cell processes such as DNA replication or chromosomal folding and segregation. Labeling DNA with a fluorescent protein allows the visualization of its temporal and spatial organization. One popular approach is FROS (fluorescence repressor operator system). This method specifically labels DNA in vivo through binding of a fusion of a fluorescent protein and a repressor protein to an operator array, which contains numerous copies of the repressor binding site integrated into the genomic site of interest. Bound fluorescent proteins are then visible as foci in microscopic analyses and can be distinguished from the background fluorescence caused by unbound fusion proteins. Even though this method is widely used, no attempt has been made so far to decrease the background fluorescence to facilitate analysis of the actual signal of interest. Here, we present a new method that greatly reduces the background signal of FROS. BiFCROS (Bimolecular Fluorescence Complementation and Repressor Operator System) is based on fusions of repressor proteins to halves of a split fluorescent protein. Binding to a hybrid FROS array results in fluorescence signals due to bimolecular fluorescence complementation. Only proteins bound to the hybrid FROS array fluoresce, greatly improving the signal to noise ratio compared to conventional FROS. We present the development of BiFCROS and discuss its potential to be used as a fast and single-cell readout for copy numbers of genetic loci. PMID:28450375

Comparative assessment of fluorescent proteins for in vivo imaging in an animal model system.

PubMed

Heppert, Jennifer K; Dickinson, Daniel J; Pani, Ariel M; Higgins, Christopher D; Steward, Annette; Ahringer, Julie; Kuhn, Jeffrey R; Goldstein, Bob

2016-11-07

Fluorescent protein tags are fundamental tools used to visualize gene products and analyze their dynamics in vivo. Recent advances in genome editing have expedited the precise insertion of fluorescent protein tags into the genomes of diverse organisms. These advances expand the potential of in vivo imaging experiments and facilitate experimentation with new, bright, photostable fluorescent proteins. Most quantitative comparisons of the brightness and photostability of different fluorescent proteins have been made in vitro, removed from biological variables that govern their performance in cells or organisms. To address the gap, we quantitatively assessed fluorescent protein properties in vivo in an animal model system. We generated transgenic Caenorhabditis elegans strains expressing green, yellow, or red fluorescent proteins in embryos and imaged embryos expressing different fluorescent proteins under the same conditions for direct comparison. We found that mNeonGreen was not as bright in vivo as predicted based on in vitro data but is a better tag than GFP for specific kinds of experiments, and we report on optimal red fluorescent proteins. These results identify ideal fluorescent proteins for imaging in vivo in C. elegans embryos and suggest good candidate fluorescent proteins to test in other animal model systems for in vivo imaging experiments. © 2016 Heppert et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Intrinsic fluorescence of protein in turbid media using empirical relation based on Monte Carlo lookup table

NASA Astrophysics Data System (ADS)

Einstein, Gnanatheepam; Udayakumar, Kanniyappan; Aruna, Prakasarao; Ganesan, Singaravelu

2017-03-01

Fluorescence of Protein has been widely used in diagnostic oncology for characterizing cellular metabolism. However, the intensity of fluorescence emission is affected due to the absorbers and scatterers in tissue, which may lead to error in estimating exact protein content in tissue. Extraction of intrinsic fluorescence from measured fluorescence has been achieved by different methods. Among them, Monte Carlo based method yields the highest accuracy for extracting intrinsic fluorescence. In this work, we have attempted to generate a lookup table for Monte Carlo simulation of fluorescence emission by protein. Furthermore, we fitted the generated lookup table using an empirical relation. The empirical relation between measured and intrinsic fluorescence is validated using tissue phantom experiments. The proposed relation can be used for estimating intrinsic fluorescence of protein for real-time diagnostic applications and thereby improving the clinical interpretation of fluorescence spectroscopic data.

Cytotoxic T lymphocyte antigen 4 decreases humoral and cellular immunity by adenovirus to enhance target GFP gene transfer in C57BL/6 mice.

PubMed

Bai, Dou; Zhu, Wei; Zhang, Yu; Long, Ling; Zhu, Naishuo

2015-01-01

Adenoviruses (Ad) are once potential and promising vectors for gene delivery, but the immunogenicity attenuates its transfer efficiency. Cytotoxic T lymphocyte antigen 4 (CTLA-4) can inhibit T cell immunity. Thus, we aimed to study the effect of CTLA-4 in the process of Ad-mediated gene transfer. The C57BL/6 mice were injected by Ad vectors at twice, and CTLA-4 was administrated after the first Ad injection. Then, the CD3(+)CD4(+) T cells and circulating levels of IL-2, IL-4, and anti-Ad IgG were decreased by CTLA-4, while Ad generated immune responses. The green fluorescence protein (GFP) expressions of tissues were enhanced by CTLA-4 till injection of Ad at twice. Our results indicate that CTLA-4 can inhibit humoral and cellular immunity by adenovirus generation to enhance GFP delivery, and provide a potential way to assist in Ad-mediated gene transfer.

Plasmid Vectors and Molecular Building Blocks for the Development of Genetic Manipulation Tools for Trypanosoma cruzi

PubMed Central

Bouvier, León A.; Cámara, María de los Milagros; Canepa, Gaspar E.; Miranda, Mariana R.; Pereira, Claudio A.

2013-01-01

The post genomic era revealed the need for developing better performing, easier to use and more sophisticated genetic manipulation tools for the study of Trypanosoma cruzi, the etiological agent of Chagas disease. In this work a series of plasmids that allow genetic manipulation of this protozoan parasite were developed. First of all we focused on useful tools to establish selection strategies for different strains and which can be employed as expression vectors. On the other hand molecular building blocks in the form of diverse selectable markers, modifiable fluorescent protein and epitope-tag coding sequences were produced. Both types of modules were harboured in backbone molecules conceived to offer multiple construction and sub-cloning strategies. These can be used to confer new properties to already available genetic manipulation tools or as starting points for whole novel designs. The performance of each plasmid and building block was determined independently. For illustration purposes, some simple direct practical applications were conducted. PMID:24205392

Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene

NASA Technical Reports Server (NTRS)

Jackson, Jacquelyn; Egnin, Marceline; Xue, Qi-Han; Prakash, C. S.

1997-01-01

Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.

Characterization of Fluorescent Proteins for Three- and Four-Color Live-Cell Imaging in S. cerevisiae.

PubMed

Higuchi-Sanabria, Ryo; Garcia, Enrique J; Tomoiaga, Delia; Munteanu, Emilia L; Feinstein, Paul; Pon, Liza A

2016-01-01

Saccharomyces cerevisiae are widely used for imaging fluorescently tagged protein fusions. Fluorescent proteins can easily be inserted into yeast genes at their chromosomal locus, by homologous recombination, for expression of tagged proteins at endogenous levels. This is especially useful for incorporation of multiple fluorescent protein fusions into a single strain, which can be challenging in organisms where genetic manipulation is more complex. However, the availability of optimal fluorescent protein combinations for 3-color imaging is limited. Here, we have characterized a combination of fluorescent proteins, mTFP1/mCitrine/mCherry for multicolor live cell imaging in S. cerevisiae. This combination can be used with conventional blue dyes, such as DAPI, for potential four-color live cell imaging.

Rapid detection of Wuchereria bancrofti and Brugia malayi in mosquito vectors (Diptera: Culicidae) using a real-time fluorescence resonance energy transfer multiplex PCR and melting curve analysis.

PubMed

Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Maleewong, Wanchai

2009-01-01

We developed a single-step real-time fluorescence resonance energy transfer (FRET) multiplex polymerase chain reaction (PCR) merged with melting curve analysis for the detection of Wuchereria bancrofti and Brugia malayi DNA in blood-fed mosquitoes. Real-time FRET multiplex PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two families of repeated DNA elements: the 188 bp SspI repeated sequence, specific to W. bancrofti, and the 153-bp HhaI repeated sequence, specific to the genus Brugia and two pairs of specific fluorophore-labeled probes. Both W. bancrofti and B. malayi can be differentially detected in infected vectors by this process through their different fluorescence channel and melting temperatures. The assay could distinguish both human filarial DNAs in infected vectors from the DNAs of Dirofilaria immitis- and Plasmodium falciparum-infected human red blood cells and noninfected mosquitoes and human leukocytes. The technique showed 100% sensitivity and specificity and offers a rapid and reliable procedure for differentially identifying lymphatic filariasis. The introduced real-time FRET multiplex PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The test can be used to screen mosquito vectors in endemic areas and therefore should be a useful diagnostic tool for the evaluation of infection rate of the mosquito populations and for xenomonitoring in the community after eradication programs such as the Global Program to Eliminate Lymphatic Filariasis.

Application of a haematopoetic progenitor cell-targeted adeno-associated viral (AAV) vector established by selection of an AAV random peptide library on a leukaemia cell line

PubMed Central

Stiefelhagen, Marius; Sellner, Leopold; Kleinschmidt, Jürgen A; Jauch, Anna; Laufs, Stephanie; Wenz, Frederik; Zeller, W Jens; Fruehauf, Stefan; Veldwijk, Marlon R

2008-01-01

Background For many promising target cells (e.g.: haematopoeitic progenitors), the susceptibility to standard adeno-associated viral (AAV) vectors is low. Advancements in vector development now allows the generation of target cell-selected AAV capsid mutants. Methods To determine its suitability, the method was applied on a chronic myelogenous leukaemia (CML) cell line (K562) to obtain a CML-targeted vector and the resulting vectors tested on leukaemia, non-leukaemia, primary human CML and CD34+ peripheral blood progenitor cells (PBPC); standard AAV2 and a random capsid mutant vector served as controls. Results Transduction of CML (BV173, EM3, K562 and Lama84) and AML (HL60 and KG1a) cell lines with the capsid mutants resulted in an up to 36-fold increase in CML transduction efficiency (K562: 2-fold, 60% ± 2% green fluorescent protein (GFP)+ cells; BV173: 9-fold, 37% ± 2% GFP+ cells; Lama84: 36-fold, 29% ± 2% GFP+ cells) compared to controls. For AML (KG1a, HL60) and one CML cell line (EM3), no significant transduction (<1% GFP+ cells) was observed for any vector. Although the capsid mutant clone was established on a cell line, proof-of-principle experiments using primary human cells were performed. For CML (3.2-fold, mutant: 1.75% ± 0.45% GFP+ cells, p = 0.03) and PBPC (3.5-fold, mutant: 4.21% ± 3.40% GFP+ cells) a moderate increase in gene transfer of the capsid mutant compared to control vectors was observed. Conclusion Using an AAV random peptide library on a CML cell line, we were able to generate a capsid mutant, which transduced CML cell lines and primary human haematopoietic progenitor cells with higher efficiency than standard recombinant AAV vectors. PMID:18789140

Ichthyophthirius multifiliis as a potential vector of Edwardsiella ictaluri in channel catfish.

PubMed

Xu, De-Hai; Shoemaker, Craig A; Klesius, Phillip H

2012-04-01

There is limited information on whether parasites act as vectors to transmit bacteria in fish. In this trial, we used Ichthyophthirius multifiliis and fluorescent Edwardsiella ictaluri as a model to study the interaction between parasite, bacterium, and fish. The percentage (23-39%) of theronts fluorescing after exposure to E. ictaluri was significantly higher than control theronts (~ 6%) using flow cytometry. Theronts exposed to E. ictaluri at 4 × 10(7)  CFU mL(-1) showed a higher percentage (~ 60%) of fluorescent theronts compared to those (42%) exposed to 4 × 10(3)  CFU mL(-1) at 4 h. All tomonts (100%) carried the bacterium after exposure to E. ictaluri. Edwardsiella ictaluri survived and replicated during tomont division. Confocal microscopy demonstrated that E. ictaluri was associated with the tomont surface. Among theronts released from tomonts exposed to E. ictaluri, 31-66% were observed with attached E. ictaluri. Sixty percent of fish exposed to theronts treated with 5 × 10(7) E. ictaluri mL(-1) were positive for E. ictaluri at 4 h as determined by qPCR or fluorescent microscopy. Fluorescent E. ictaluri were observed on trophonts in skin and gill wet mounts of dead fish. This study demonstrated that Ich could vector E. ictaluri to channel catfish. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Biochemical and biophysical characterization of the major outer surface protein, OSP-A from North American and European isolates of Borrelia burgdorferi

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGrath, B.C.; Dunn, J.J.; France, L.L.

1995-12-31

Lyme borreliosis, caused by the spirochete Borrelia burgdorferi, is the most common vector-borne disease in North America and Western Europe. As the major delayed immune response in humans, a better understanding of the major outer surface lipoproteins OspA and OspB are of much interest. These proteins have been shown to exhibit three distinct phylogenetic genotypes based on their DNA sequences. This paper describes the cloning of genomic DNA for each variant and amplification of PCR. DNA sequence data was used to derive computer driven phylogenetic analysis and deduced amino acid sequences. Overproduction of variant OspAs was carried out in E.more » coli using a T7-based expression system. Circular dichroism and fluorescence studies was carried out on the recombinant B31 PspA yielding evidence supporting a B31 protein containing 11% alpha-helix, 34% antiparallel beta-sheet, 12% parallel beta sheet.« less

Dilution of protein-surfactant complexes: a fluorescence study.

PubMed

Azadi, Glareh; Chauhan, Anuj; Tripathi, Anubhav

2013-09-01

Dilution of protein-surfactant complexes is an integrated step in microfluidic protein sizing, where the contribution of free micelles to the overall fluorescence is reduced by dilution. This process can be further improved by establishing an optimum surfactant concentration and quantifying the amount of protein based on the fluorescence intensity. To this end, we study the interaction of proteins with anionic sodium dodecyl sulfate (SDS) and cationic hexadecyl trimethyl ammonium bromide (CTAB) using a hydrophobic fluorescent dye (sypro orange). We analyze these interactions fluourometrically with bovine serum albumin, carbonic anhydrase, and beta-galactosidase as model proteins. The fluorescent signature of protein-surfactant complexes at various dilution points shows three distinct regions, surfactant dominant, breakdown, and protein dominant region. Based on the dilution behavior of protein-surfactant complexes, we propose a fluorescence model to explain the contribution of free and bound micelles to the overall fluorescence. Our results show that protein peak is observed at 3 mM SDS as the optimum dilution concentration. Furthermore, we study the effect of protein concentration on fluorescence intensity. In a single protein model with a constant dye quantum yield, the peak height increases with protein concentration. Finally, addition of CTAB to the protein-SDS complex at mole fractions above 0.1 shifts the protein peak from 3 mM to 4 mM SDS. The knowledge of protein-surfactant interactions obtained from these studies provides significant insights for novel detection and quantification techniques in microfluidics. © 2013 The Protein Society.

Localizing Proteins in Fixed Giardia lamblia and Live Cultured Mammalian Cells by Confocal Fluorescence Microscopy.

PubMed

Nyindodo-Ogari, Lilian; Schwartzbach, Steven D; Skalli, Omar; Estraño, Carlos E

2016-01-01

Confocal fluorescence microscopy and electron microscopy (EM) are complementary methods for studying the intracellular localization of proteins. Confocal fluorescence microscopy provides a rapid and technically simple method to identify the organelle in which a protein localizes but only EM can identify the suborganellular compartment in which that protein is present. Confocal fluorescence microscopy, however, can provide information not obtainable by EM but required to understand the dynamics and interactions of specific proteins. In addition, confocal fluorescence microscopy of cells transfected with a construct encoding a protein of interest fused to a fluorescent protein tag allows live cell studies of the subcellular localization of that protein and the monitoring in real time of its trafficking. Immunostaining methods for confocal fluorescence microscopy are also faster and less involved than those for EM allowing rapid optimization of the antibody dilution needed and a determination of whether protein antigenicity is maintained under fixation conditions used for EM immunogold labeling. This chapter details a method to determine by confocal fluorescence microscopy the intracellular localization of a protein by transfecting the organism of interest, in this case Giardia lamblia, with the cDNA encoding the protein of interest and then processing these organisms for double label immunofluorescence staining after chemical fixation. Also presented is a method to identify the organelle targeting information in the presequence of a precursor protein, in this case the presequence of the precursor to the Euglena light harvesting chlorophyll a/b binding protein of photosystem II precursor (pLHCPII), using live cell imaging of mammalian COS7 cells transiently transfected with a plasmid encoding a pLHCPII presequence fluorescent protein fusion and stained with organelle-specific fluorescent dyes.

Preclinical correction of human Fanconi anemia complementation group A bone marrow cells using a safety-modified lentiviral vector.

PubMed

Becker, P S; Taylor, J A; Trobridge, G D; Zhao, X; Beard, B C; Chien, S; Adair, J; Kohn, D B; Wagner, J E; Shimamura, A; Kiem, H-P

2010-10-01

One of the major hurdles for the development of gene therapy for Fanconi anemia (FA) is the increased sensitivity of FA stem cells to free radical-induced DNA damage during ex vivo culture and manipulation. To minimize this damage, we have developed a brief transduction procedure for lentivirus vector-mediated transduction of hematopoietic progenitor cells from patients with Fanconi anemia complementation group A (FANCA). The lentiviral vector FancA-sW contains the phosphoglycerate kinase promoter, the FANCA cDNA, and a synthetic, safety-modified woodchuck post transcriptional regulatory element (sW). Bone marrow mononuclear cells or purified CD34(+) cells from patients with FANCA were transduced in an overnight culture on recombinant fibronectin peptide CH-296, in low (5%) oxygen, with the reducing agent, N-acetyl-L-cysteine (NAC), and a combination of growth factors, granulocyte colony-stimulating factor (G-CSF), Flt3 ligand, stem cell factor, and thrombopoietin. Transduced cells plated in methylcellulose in hypoxia with NAC showed increased colony formation compared with 21% oxygen without NAC (P<0.03), showed increased resistance to mitomycin C compared with green fluorescent protein (GFP) vector-transduced controls (P<0.007), and increased survival. Thus, combining short transduction and reducing oxidative stress may enhance the viability and engraftment of gene-corrected cells in patients with FANCA.

Synthesis and optimization of cholesterol-based diquaternary ammonium Gemini Surfactant (Chol-GS) as a new gene delivery vector.

PubMed

Kim, Bieong-Kil; Doh, Kyung-Oh; Bae, Yun-Ui; Seu, Young-Bae

2011-01-01

Amongst a number of potential nonviral vectors, cationic liposomes have been actively researched, with both gemini surfactants and bola amphiphiles reported as being in possession of good structures in terms of cell viability and in vitro transfection. In this study, a cholesterol-based diquaternary ammonium gemini surfactant (Chol-GS) was synthesized and assessed as a novel nonviral gene vector. Chol-GS was synthesized from cholesterol by way of four reaction steps. The optimal efficiency was found to be at a weight ratio of 1:4 of lipid:DOPE (1,2-dioleoyl-L-alpha- glycero-3-phosphatidylethanolamine), and at a ratio of between 10:1~15:1 of liposome:DNA. The transfection efficiency was compared with commercial liposomes and with Lipofectamine, 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE-C), and N-[1-(2,3-dioleoyloxy)propyl]- N,N,N-trimethylammonium chloride (DOTAP). The results indicate that the efficiency of Chol-GS is greater than that of all the tested commercial liposomes in COS7 and Huh7 cells, and higher than DOTAP and Lipofectamine in A549 cells. Confirmation of these findings was observed through the use of green fluorescent protein expression. Chol-GS exhibited a moderate level of cytotoxicity, at optimum concentrations for efficient transfection, indicating cell viability. Hence, the newly synthesized Chol-GS liposome has the potential of being an excellent nonviral vector for gene delivery.

Analysis of protein function in clinical C. albicans isolates

PubMed Central

Gerami-Nejad, Maryam; Forche, Anja; McClellan, Mark; Berman, Judith

2012-01-01

Clinical isolates are prototrophic and hence are not amenable to genetic manipulation using nutritional markers. Here we describe a new set of plasmids carrying the NAT1 (nourseothricin) drug resistance marker (Shen et al., 2005) that can be used both in clinical isolates and in laboratory strains. We constructed novel plasmids containing HA-NAT1 or MYC-NAT1 cassettes to facilitate PCR-mediated construction of strains with C-terminal epitope-tagged proteins and a NAT1-pMet3-GFP plasmid to enable conditional expression of proteins with or without the green fluorescent protein fused at the N-terminus. Furthermore, for proteins that require both the endogenous N- and C-termini for function, we have constructed a GF-NAT1-FP cassette carrying truncated alleles that facilitate insertion of an intact, single copy of GFP internal to the coding sequence. In addition, GFP-NAT1, RFP-NAT1, and M-Cherry-NAT1 plasmids were constructed expressing two differently labeled gene products for the study of protein co-expression and co-localization in vivo. Together, these vectors provide a useful set of genetic tools for studying diverse aspects of gene function in C. albicans clinical as well as laboratory strains. PMID:22777821

Screening and large-scale expression of membrane proteins in mammalian cells for structural studies.

PubMed

Goehring, April; Lee, Chia-Hsueh; Wang, Kevin H; Michel, Jennifer Carlisle; Claxton, Derek P; Baconguis, Isabelle; Althoff, Thorsten; Fischer, Suzanne; Garcia, K Christopher; Gouaux, Eric

2014-11-01

Structural, biochemical and biophysical studies of eukaryotic membrane proteins are often hampered by difficulties in overexpression of the candidate molecule. Baculovirus transduction of mammalian cells (BacMam), although a powerful method to heterologously express membrane proteins, can be cumbersome for screening and expression of multiple constructs. We therefore developed plasmid Eric Gouaux (pEG) BacMam, a vector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target protein. In this protocol, we show how to use small-scale transient transfection and fluorescence-detection size-exclusion chromatography (FSEC) experiments using a GFP-His8-tagged candidate protein to screen for monodispersity and expression level. Once promising candidates are identified, we describe how to generate baculovirus, transduce HEK293S GnTI(-) (N-acetylglucosaminyltransferase I-negative) cells in suspension culture and overexpress the candidate protein. We have used these methods to prepare pure samples of chicken acid-sensing ion channel 1a (cASIC1) and Caenorhabditis elegans glutamate-gated chloride channel (GluCl) for X-ray crystallography, demonstrating how to rapidly and efficiently screen hundreds of constructs and accomplish large-scale expression in 4-6 weeks.

Screening and large-scale expression of membrane proteins in mammalian cells for structural studies

PubMed Central

Goehring, April; Lee, Chia-Hsueh; Wang, Kevin H.; Michel, Jennifer Carlisle; Claxton, Derek P.; Baconguis, Isabelle; Althoff, Thorsten; Fischer, Suzanne; Garcia, K. Christopher; Gouaux, Eric

2014-01-01

Structural, biochemical and biophysical studies of eukaryotic membrane proteins are often hampered by difficulties in over-expression of the candidate molecule. Baculovirus transduction of mammalian cells (BacMam), although a powerful method to heterologously express membrane proteins, can be cumbersome for screening and expression of multiple constructs. We therefore developed plasmid Eric Gouaux (pEG) BacMam, a vector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target protein. In this protocol we show how to use small-scale transient transfection and fluorescence-detection, size-exclusion chromatography (FSEC) experiments using a GFP-His8 tagged candidate protein to screen for monodispersity and expression level. Once promising candidates are identified, we describe how to generate baculovirus, transduce HEK293S GnTI− (N-acetylglucosaminyltransferase I-negative) cells in suspension culture, and over-express the candidate protein. We have used these methods to prepare pure samples of chicken acid-sensing ion channel 1a (cASIC1) and Caenorhabditis elegans glutamate-gated chloride channel (GluCl), for X-ray crystallography, demonstrating how to rapidly and efficiently screen hundreds of constructs and accomplish large-scale expression in 4-6 weeks. PMID:25299155

The use of a viral 2A sequence for the simultaneous over-expression of both the vgf gene and enhanced green fluorescent protein (eGFP) in vitro and in vivo

PubMed Central

Lewis, Jo E.; Brameld, John M.; Hill, Phil; Barrett, Perry; Ebling, Francis J.P.; Jethwa, Preeti H.

2015-01-01

Introduction The viral 2A sequence has become an attractive alternative to the traditional internal ribosomal entry site (IRES) for simultaneous over-expression of two genes and in combination with recombinant adeno-associated viruses (rAAV) has been used to manipulate gene expression in vitro. New method To develop a rAAV construct in combination with the viral 2A sequence to allow long-term over-expression of the vgf gene and fluorescent marker gene for tracking of the transfected neurones in vivo. Results Transient transfection of the AAV plasmid containing the vgf gene, viral 2A sequence and eGFP into SH-SY5Y cells resulted in eGFP fluorescence comparable to a commercially available reporter construct. This increase in fluorescent cells was accompanied by an increase in VGF mRNA expression. Infusion of the rAAV vector containing the vgf gene, viral 2A sequence and eGFP resulted in eGFP fluorescence in the hypothalamus of both mice and Siberian hamsters, 32 weeks post infusion. In situ hybridisation confirmed that the location of VGF mRNA expression in the hypothalamus corresponded to the eGFP pattern of fluorescence. Comparison with old method The viral 2A sequence is much smaller than the traditional IRES and therefore allowed over-expression of the vgf gene with fluorescent tracking without compromising viral capacity. Conclusion The use of the viral 2A sequence in the AAV plasmid allowed the simultaneous expression of both genes in vitro. When used in combination with rAAV it resulted in long-term over-expression of both genes at equivalent locations in the hypothalamus of both Siberian hamsters and mice, without any adverse effects. PMID:26300182

RNA aptamers that functionally interact with green fluorescent protein and its derivatives

PubMed Central

Shui, Bo; Ozer, Abdullah; Zipfel, Warren; Sahu, Nevedita; Singh, Avtar; Lis, John T.; Shi, Hua; Kotlikoff, Michael I.

2012-01-01

Green Fluorescent Protein (GFP) and related fluorescent proteins (FPs) have been widely used to tag proteins, allowing their expression and subcellular localization to be examined in real time in living cells and animals. Similar fluorescent methods are highly desirable to detect and track RNA and other biological molecules in living cells. For this purpose, we have developed a group of RNA aptamers that bind GFP and related proteins, which we term Fluorescent Protein-Binding Aptamers (FPBA). These aptamers bind GFP, YFP and CFP with low nanomolar affinity and binding decreases GFP fluorescence, whereas slightly augmenting YFP and CFP brightness. Aptamer binding results in an increase in the pKa of EGFP, decreasing the 475 nm excited green fluorescence at a given pH. We report the secondary structure of FPBA and the ability to synthesize functional multivalent dendrimers. FPBA expressed in live cells decreased GFP fluorescence in a valency-dependent manner, indicating that the RNA aptamers function within cells. The development of aptamers that bind fluorescent proteins with high affinity and alter their function, markedly expands their use in the study of biological pathways. PMID:22189104

Mass flow and velocity profiles in Neurospora hyphae: partial plug flow dominates intra-hyphal transport.

PubMed

Abadeh, Aryan; Lew, Roger R

2013-11-01

Movement of nuclei, mitochondria and vacuoles through hyphal trunks of Neurospora crassa were vector-mapped using fluorescent markers and green fluorescent protein tags. The vectorial movements of all three were strongly correlated, indicating the central role of mass (bulk) flow in cytoplasm movements in N. crassa. Profiles of velocity versus distance from the hyphal wall did not match the parabolic shape predicted by the ideal Hagen-Poiseuille model of flow at low Reynolds number. Instead, the profiles were flat, consistent with a model of partial plug flow due to the high concentration of organelles in the flowing cytosol. The intra-hyphal pressure gradients were manipulated by localized external osmotic treatments to demonstrate the dependence of velocity (and direction) on pressure gradients within the hyphae. The data support the concept that mass transport, driven by pressure gradients, dominates intra-hyphal transport. The transport occurs by partial plug flow due to the organelles in the cytosol.

Siderophore production by pathogenic mucorales and uptake of deferoxamine B.

PubMed

Larcher, Gérald; Dias, Marylène; Razafimandimby, Bienvenue; Bomal, Danielle; Bouchara, Jean-Philippe

2013-12-01

Clinical reports have established that mucormycosis, mainly caused by Rhizopus spp., frequently occurs in patients treated with deferoxamine B (DFO, Desferal(®)) which is misappropriated by these fungi. Siderophore production by twenty mucoralean isolates was therefore investigated using a commercial iron-depleted culture medium. Siderophore production was detected for most of the isolates. Our experiments confirmed that feroxamine B (iron chelate of DFO) promoted in vitro growth of Rhizopus arrhizus. Electrophoretic analysis of somatic extracts revealed iron-regulated proteins of 60 and 32 kDa which were lacking in iron-depleted culture conditions. Using a fluorescent derivative of deferoxamine B, we showed by fluorescence microscopy the entry of the siderophore within the fungal cells, thus suggesting a shuttle mechanism encompassing the uptake of the entire siderophore-ion complex into the cell. This useful tool renders possible a better understanding of iron metabolism in Mucorales which could lead to the development of new diagnostic method or new antifungal therapy using siderophores as imaging contrast agents or active drug vectors.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

"Sizing" the oligomers of Azami Green fluorescent protein with FCS and antibunching

NASA Astrophysics Data System (ADS)

Temirov, Jamshid; Werner, James H.; Goodwin, Peter M.; Bradbury, Andrew R. M.

2012-02-01

Fluorescent proteins are invaluable molecules in fluorescence microscopy and spectroscopy. The size and brightness of fluorescent proteins often dictates the application they may be used for. While a monomeric protein may be the least perturbative structure for labeling a protein in a cell, often oligomers (dimers and tetramers) of fluorescent proteins can be more stable. However, from a quantitative microscopy standpoint, it is important to realize the photophysical properties of monomers do not necessarily multiply by their number when they form oligomers. In this work we studied oligomerization states of the Azami Green (AG) protein with fluorescence correlation spectroscopy (FCS) and photon antibunching or photon pair correlation spectroscopy (PPCS). FCS was used to measure the hydrodynamic size of the oligomers, whereas antibunching was used to count the number of fluorescent emitters in the oligomers. The results exhibited that the dimers of AG were single emitters and the tetramers were dual-emitters, indicative of dipole-dipole interactions and energy transfer between the monomeric units. We also used these methods to estimate the number of fluorescent proteins displayed on T7 phage molecules.

Direct bone morphogenetic protein 2 and Indian hedgehog gene transfer for articular cartilage repair using bone marrow coagulates.

PubMed

Sieker, J T; Kunz, M; Weißenberger, M; Gilbert, F; Frey, S; Rudert, M; Steinert, A F

2015-03-01

Bone morphogenetic protein 2 (BMP-2, encoded by BMP2) and Indian hedgehog protein (IHH, encoded by IHH) are well known regulators of chondrogenesis and chondrogenic hypertrophy. Despite being a potent chondrogenic factor BMP-2 was observed to induce chondrocyte hypertrophy in osteoarthritis (OA), growth plate cartilage and adult mesenchymal stem cells (MSCs). IHH might induce chondrogenic differentiation through different intracellular signalling pathways without inducing subsequent chondrocyte hypertrophy. The primary objective of this study is to test the efficacy of direct BMP2 and IHH gene delivery via bone marrow coagulates to influence histological repair cartilage quality in vivo. Vector-laden autologous bone marrow coagulates with 10(11) adenoviral vector particles encoding BMP2, IHH or the Green fluorescent protein (GFP) were delivered to 3.2 mm osteochondral defects in the trochlea of rabbit knees. After 13 weeks the histological repair cartilage quality was assessed using the ICRS II scoring system and the type II collagen positive area. IHH treatment resulted in superior histological repair cartilage quality than GFP controls in all of the assessed parameters (with P < 0.05 in five of 14 assessed parameters). Results of BMP2 treatment varied substantially, including severe intralesional bone formation in two of six joints after 13 weeks. IHH gene transfer is effective to improve repair cartilage quality in vivo, whereas BMP2 treatment, carried the risk intralesional bone formation. Therefore IHH protein can be considered as an attractive alternative candidate growth factor for further preclinical research and development towards improved treatments for articular cartilage defects. Copyright © 2014 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Nano-fEM: protein localization using photo-activated localization microscopy and electron microscopy.

PubMed

Watanabe, Shigeki; Richards, Jackson; Hollopeter, Gunther; Hobson, Robert J; Davis, Wayne M; Jorgensen, Erik M

2012-12-03

Mapping the distribution of proteins is essential for understanding the function of proteins in a cell. Fluorescence microscopy is extensively used for protein localization, but subcellular context is often absent in fluorescence images. Immuno-electron microscopy, on the other hand, can localize proteins, but the technique is limited by a lack of compatible antibodies, poor preservation of morphology and because most antigens are not exposed to the specimen surface. Correlative approaches can acquire the fluorescence image from a whole cell first, either from immuno-fluorescence or genetically tagged proteins. The sample is then fixed and embedded for electron microscopy, and the images are correlated (1-3). However, the low-resolution fluorescence image and the lack of fiducial markers preclude the precise localization of proteins. Alternatively, fluorescence imaging can be done after preserving the specimen in plastic. In this approach, the block is sectioned, and fluorescence images and electron micrographs of the same section are correlated (4-7). However, the diffraction limit of light in the correlated image obscures the locations of individual molecules, and the fluorescence often extends beyond the boundary of the cell. Nano-resolution fluorescence electron microscopy (nano-fEM) is designed to localize proteins at nano-scale by imaging the same sections using photo-activated localization microscopy (PALM) and electron microscopy. PALM overcomes the diffraction limit by imaging individual fluorescent proteins and subsequently mapping the centroid of each fluorescent spot (8-10). We outline the nano-fEM technique in five steps. First, the sample is fixed and embedded using conditions that preserve the fluorescence of tagged proteins. Second, the resin blocks are sectioned into ultrathin segments (70-80 nm) that are mounted on a cover glass. Third, fluorescence is imaged in these sections using the Zeiss PALM microscope. Fourth, electron dense structures are imaged in these same sections using a scanning electron microscope. Fifth, the fluorescence and electron micrographs are aligned using gold particles as fiducial markers. In summary, the subcellular localization of fluorescently tagged proteins can be determined at nanometer resolution in approximately one week.

Development and application of a fluorescence protein microarray for detecting serum alpha-fetoprotein in patients with hepatocellular carcinoma.

PubMed

Zhang, Aiying; Yin, Chengzeng; Wang, Zhenshun; Zhang, Yonghong; Zhao, Yuanshun; Li, Ang; Sun, Huanqin; Lin, Dongdong; Li, Ning

2016-12-01

Objective To develop a simple, effective, time-saving and low-cost fluorescence protein microarray method for detecting serum alpha-fetoprotein (AFP) in patients with hepatocellular carcinoma (HCC). Method Non-contact piezoelectric print techniques were applied to fluorescence protein microarray to reduce the cost of prey antibody. Serum samples from patients with HCC and healthy control subjects were collected and evaluated for the presence of AFP using a novel fluorescence protein microarray. To validate the fluorescence protein microarray, serum samples were tested for AFP using an enzyme-linked immunosorbent assay (ELISA). Results A total of 110 serum samples from patients with HCC ( n = 65) and healthy control subjects ( n = 45) were analysed. When the AFP cut-off value was set at 20 ng/ml, the fluorescence protein microarray had a sensitivity of 91.67% and a specificity of 93.24% for detecting serum AFP. Serum AFP quantified via fluorescence protein microarray had a similar diagnostic performance compared with ELISA in distinguishing patients with HCC from healthy control subjects (area under receiver operating characteristic curve: 0.906 for fluorescence protein microarray; 0.880 for ELISA). Conclusion A fluorescence protein microarray method was developed for detecting serum AFP in patients with HCC.

Development and application of a fluorescence protein microarray for detecting serum alpha-fetoprotein in patients with hepatocellular carcinoma

PubMed Central

Zhang, Aiying; Yin, Chengzeng; Wang, Zhenshun; Zhang, Yonghong; Zhao, Yuanshun; Li, Ang; Sun, Huanqin; Lin, Dongdong

2016-01-01

Objective To develop a simple, effective, time-saving and low-cost fluorescence protein microarray method for detecting serum alpha-fetoprotein (AFP) in patients with hepatocellular carcinoma (HCC). Method Non-contact piezoelectric print techniques were applied to fluorescence protein microarray to reduce the cost of prey antibody. Serum samples from patients with HCC and healthy control subjects were collected and evaluated for the presence of AFP using a novel fluorescence protein microarray. To validate the fluorescence protein microarray, serum samples were tested for AFP using an enzyme-linked immunosorbent assay (ELISA). Results A total of 110 serum samples from patients with HCC (n = 65) and healthy control subjects (n = 45) were analysed. When the AFP cut-off value was set at 20 ng/ml, the fluorescence protein microarray had a sensitivity of 91.67% and a specificity of 93.24% for detecting serum AFP. Serum AFP quantified via fluorescence protein microarray had a similar diagnostic performance compared with ELISA in distinguishing patients with HCC from healthy control subjects (area under receiver operating characteristic curve: 0.906 for fluorescence protein microarray; 0.880 for ELISA). Conclusion A fluorescence protein microarray method was developed for detecting serum AFP in patients with HCC. PMID:27885040

Comparison of the proliferation and excretion of Bartonella quintana between body and head lice following oral challenge.

PubMed

Kim, J H; Previte, D J; Yoon, K S; Murenzi, E; Koehler, J E; Pittendrigh, B R; Lee, S H; Clark, J M

2017-06-01

Human body and head lice are highly related haematophagous ectoparasites but only the body louse has been shown to transmit Bartonella quintana, the causative agent of trench fever. The mechanisms by which body lice became a vector for B. quintana, however, are poorly understood. Following oral challenge, green fluorescent protein-expressing B. quintana proliferated over 9 days postchallenge with the number of bacteria being significantly higher in whole body vs. head lice. The numbers of B. quintana detected in faeces from infected lice, however, were approximately the same in both lice. Nevertheless, the viability of B. quintana was significantly higher in body louse faeces. Comparison of immune responses in alimentary tract tissues revealed that basal transcription levels of peptidoglycan recognition protein and defensins were lower in body lice and the transcription of defensin 1 was up-regulated by oral challenge with wild-type B. quintana in head but not in body lice. In addition, the level of cytotoxic reactive oxygen species generated by epithelial cells was significantly lower in body lice. Although speculative at this time, the reduced immune response is consistent with the higher vector competence seen in body vs. head lice in terms of B. quintana infection. © 2017 The Royal Entomological Society.

Effects of Ghrelin miRNA on Inflammation and Calcium Pathway in Pancreatic Acinar Cells of Acute Pancreatitis.

PubMed

Tang, Xiping; Tang, Guodu; Liang, Zhihai; Qin, Mengbin; Fang, Chunyun; Zhang, Luyi

The study investigated the effects of endogenous targeted inhibition of ghrelin gene on inflammation and calcium pathway in an in vitro pancreatic acinar cell model of acute pancreatitis. Lentiviral expression vector against ghrelin gene was constructed and transfected into AR42J cells. The mRNA and protein expression of each gene were detected by reverse transcription polymerase chain reaction, Western blotting, or enzyme-linked immunosorbent assay. The concentration of intracellular calcium ([Ca]i) was determined by calcium fluorescence mark probe combined with laser scanning confocal microscopy. Compared with the control group, cerulein could upregulate mRNA and protein expression of inflammatory factors, calcium pathway, ghrelin, and [Ca]i. mRNA and protein expression of inflammatory factors increased significantly in cells transfected with ghrelin miRNA compared with the other groups. Intracellular calcium and expression of some calcium pathway proteins decreased significantly in cells transfected with ghrelin miRNA compared with the other groups. Targeted inhibition of ghrelin gene in pancreatic acinar cells of acute pancreatitis can upregulate the expression of the intracellular inflammatory factors and alleviate the intracellular calcium overload.

Structure-guided wavelength tuning in far-red fluorescent proteins

PubMed Central

Ng, Ho-Leung; Lin, Michael Z.

2017-01-01

In recent years, protein engineers have succeeded in tuning the excitation spectra of natural fluorescent proteins from green wavelengths into orange and red wavelengths, resulting in the creation of a series of fluorescent proteins with emission in the far-red portions of the optical spectrum. These results have arisen from the synergistic combination of structural knowledge of fluorescent proteins, chemical intuition, and high-throughput screening methods. Here we review structural features found in autocatalytic far-red fluorescent proteins, and discuss how they add to our understanding of the biophysical mechanisms of wavelength tuning in biological chromophores. PMID:27468111

Characterization of Fluorescent Proteins for Three- and Four-Color Live-Cell Imaging in S. cerevisiae

PubMed Central

Higuchi-Sanabria, Ryo; Garcia, Enrique J.; Tomoiaga, Delia; Munteanu, Emilia L.; Feinstein, Paul; Pon, Liza A.

2016-01-01

Saccharomyces cerevisiae are widely used for imaging fluorescently tagged protein fusions. Fluorescent proteins can easily be inserted into yeast genes at their chromosomal locus, by homologous recombination, for expression of tagged proteins at endogenous levels. This is especially useful for incorporation of multiple fluorescent protein fusions into a single strain, which can be challenging in organisms where genetic manipulation is more complex. However, the availability of optimal fluorescent protein combinations for 3-color imaging is limited. Here, we have characterized a combination of fluorescent proteins, mTFP1/mCitrine/mCherry for multicolor live cell imaging in S. cerevisiae. This combination can be used with conventional blue dyes, such as DAPI, for potential four-color live cell imaging. PMID:26727004

Fluorescence probe techniques to monitor protein adsorption-induced conformation changes on biodegradable polymers.

PubMed

Benesch, Johan; Hungerford, Graham; Suhling, Klaus; Tregidgo, Carolyn; Mano, João F; Reis, Rui L

2007-08-15

The study of protein adsorption and any associated conformational changes on interaction with biomaterials is of great importance in the area of implants and tissue constructs. This study aimed to evaluate some fluorescent techniques to probe protein conformation on a selection of biodegradable polymers currently under investigation for biomedical applications. Because of the fluorescence emanating from the polymers, the use of monitoring intrinsic protein fluorescence was precluded. A highly solvatochromic fluorescent dye, Nile red, and a well-known protein label, fluorescein isothiocyanate, were employed to study the adsorption of serum albumin to polycaprolactone and to some extent also to two starch-containing polymer blends (SPCL and SEVA-C). A variety of fluorescence techniques, steady state, time resolved, and imaging were employed. Nile red was found to leach from the protein, while fluorescein isothiocyanate proved useful in elucidating a conformational change in the protein and the observation of protein aggregates adsorbed to the polymer surface. These effects were seen by making use of the phenomenon of energy migration between the fluorescent tags to monitor interprobe distance and the use of fluorescence lifetime imaging to ascertain the surface packing of the protein on polymer.

High yield production of extracellular recombinant levansucrase by Bacillus megaterium.

PubMed

Korneli, Claudia; Biedendieck, Rebekka; David, Florian; Jahn, Dieter; Wittmann, Christoph

2013-04-01

In this study, a high yield production bioprocess with recombinant Bacillus megaterium for the production of the extracellular enzyme levansucrase (SacB) was developed. For basic optimization of culture parameters and nutrients, a recombinant B. megaterium reporter strain that produced green fluorescent protein under control of a vector-based xylose-inducible promoter was used. It enabled efficient microtiter plate-based screening via fluorescence analysis. A pH value of pH 6, 20 % of dissolved oxygen, 37 °C, and elevated levels of biotin (100 μg L(-1)) were found optimal with regard to high protein yield and reduced overflow metabolism. Among the different compounds tested, fructose and glycerol were identified as the preferred source of carbon. Subsequently, the settings were transferred to a B. megaterium strain recombinantly producing levansucrase SacB based on the plasmid-located xylose-inducible expression system. In shake flask culture under the optimized conditions, the novel strain already secreted the target enzyme in high amounts (14 U mL(-1) on fructose and 17.2 U mL(-1) on glycerol). This was further increased in high cell density fed-batch processes up to 55 U mL(-1), reflecting a levansucrase concentration of 0.52 g L(-1). This is 100-fold more than previous efforts for this enzyme in B. megaterium and more than 10-fold higher than reported values of other extracellular protein produced in this microorganism so far. The recombinant strain could also handle raw glycerol from biodiesel industry which provided the same amount and quality of the recombinant protein and suggests future implementation into existing biorefinery concepts.

Removal of envelope protein-free retroviral vectors by anion-exchange chromatography to improve product quality.

PubMed

Rodrigues, Teresa; Alves, Ana; Lopes, António; Carrondo, Manuel J T; Alves, Paula M; Cruz, Pedro E

2008-10-01

We have investigated the role of the retroviral lipid bilayer and envelope proteins in the adsorption of retroviral vectors (RVs) to a Fractogel DEAE matrix. Intact RVs and their degradation components (envelope protein-free vectors and solubilized vector components) were adsorbed to this matrix and eluted using a linear gradient. Envelope protein-free RVs (Env(-)) and soluble envelope proteins (gp70) eluted in a significantly lower range of conductivities than intact RVs (Env(+)) (13.7-30 mS/cm for Env(-) and gp70 proteins vs. 47-80 mS/cm for Env(+)). The zeta (zeta)-potential of Env(+) and Env(-) vectors was evaluated showing that envelope proteins define the pI of the viral particles (pI (Env(+)) < 2 versus 3 < pI (Env(-)) < 4) and that Env(+) and Env(-) vectors have similar zeta-potentials within pH 5 and 8. The results presented herein indicate that the adsorption of retroviral particles occurs through multi-point interaction of the envelope proteins with the cationic groups on the chromatographic matrix. The strength of this adsorption is thus dependent on the amount of envelope protein present in the viral lipid bilayer. In conclusion, AEXc enables the separation of gp70 proteins as well as envelope protein-free vectors constituting a significant improvement to the quality of retroviral preparations for gene therapy applications.

Identification of Host Proteins Associated with Retroviral Vector Particles by Proteomic Analysis of Highly Purified Vector Preparations▿

PubMed Central

Segura, María Mercedes; Garnier, Alain; Di Falco, Marcos Rafael; Whissell, Gavin; Meneses-Acosta, Angélica; Arcand, Normand; Kamen, Amine

2008-01-01

The Moloney murine leukemia virus (MMLV) belongs to the Retroviridae family of enveloped viruses, which is known to acquire minute amounts of host cellular proteins both on the surface and inside the virion. Despite the extensive use of retroviral vectors in experimental and clinical applications, the repertoire of host proteins incorporated into MMLV vector particles remains unexplored. We report here the identification of host proteins from highly purified retroviral vector preparations obtained by rate-zonal ultracentrifugation. Viral proteins were fractionated by one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis, in-gel tryptic digested, and subjected to liquid chromatography/tandem mass spectrometry analysis. Immunogold electron microscopy studies confirmed the presence of several host membrane proteins exposed at the vector surface. These studies led to the identification of 27 host proteins on MMLV vector particles derived from 293 HEK cells, including 5 proteins previously described as part of wild-type MMLV. Nineteen host proteins identified corresponded to intracellular proteins. A total of eight host membrane proteins were identified, including cell adhesion proteins integrin β1 (fibronectin receptor subunit beta) and HMFG-E8, tetraspanins CD81 and CD9, and late endosomal markers CD63 and Lamp-2. Identification of membrane proteins on the retroviral surface is particularly attractive, since they can serve as anchoring sites for the insertion of tags for targeting or purification purposes. The implications of our findings for retrovirus-mediated gene therapy are discussed. PMID:18032515

Cap analog and Potato virus A HC-Pro silencing suppressor improve GFP transient expression using an infectious virus vector in Nicotiana benthamiana.

PubMed

Tahmasebi, Amin-Alah; Afsharifar, Alireza

2017-06-01

Transient expression of proteins in plants has become a choice to facilitate recombinant protein production with its fast and easy application. On the other hand, host defensive mechanisms have been reported to reduce the efficiency of transient expression in plants. Hence, this study was designed to evaluate the effect of cap analog and Potato virus A helper component proteinase (PVA HC-Pro) on green fluorescent protein (GFP) expression efficiency. N . benthamiana leaves were inoculated with capped or un-capped RNA transcripts of a Turnip crinkle virus (TCV) construct containing a green fluorescent protein reporter gene (TCV-sGFP) in place of its coat protein (CP) ORF. PVA HC-Pro as a viral suppressor of RNA silencing was infiltrated in trans by Agrobacterium tumefaciens , increased the GFP foci diameter to six and even more cells in both capped and un capped treatments. The expression level of GFP in inoculated plants with TCV-sGFP transcript pre-infiltrated with PVA HC-Pro was 12.97-fold higher than the GFP accumulation level in pre-infiltrated leaves with empty plasmid (EP) control. Also, the yield of GFP in inoculated N. benthamiana plants with capped TCV-sGFP transcript pre-infiltrated with EP and PVA HC-Pro was 1.54 and 1.2-fold respectively, greater than the level of GFP expressed without cap analog application at 5 days post inoculation (dpi). In addition, the movement of TCV-sGFP was increased in some cells of inoculated leaves with capped transcripts. Results of this study indicated that PVA HC-Pro and mRNA capping can increase GFP expression and its cell to cell movement in N. benthamiana .

Functional Cell Surface Display and Controlled Secretion of Diverse Agarolytic Enzymes by Escherichia coli with a Novel Ligation-Independent Cloning Vector Based on the Autotransporter YfaL

PubMed Central

Ko, Hyeok-Jin; Park, Eunhye; Song, Joseph; Yang, Taek Ho; Lee, Hee Jong; Kim, Kyoung Heon

2012-01-01

Autotransporters have been employed as the anchoring scaffold for cell surface display by replacing their passenger domains with heterologous proteins to be displayed. We adopted an autotransporter (YfaL) of Escherichia coli for the cell surface display system. The critical regions in YfaL for surface display were identified for the construction of a ligation-independent cloning (LIC)-based display system. The designed system showed no detrimental effect on either the growth of the host cell or overexpressing heterologous proteins on the cell surface. We functionally displayed monomeric red fluorescent protein (mRFP1) as a reporter protein and diverse agarolytic enzymes from Saccharophagus degradans 2-40, including Aga86C and Aga86E, which previously had failed to be functional expressed. The system could display different sizes of proteins ranging from 25.3 to 143 kDa. We also attempted controlled release of the displayed proteins by incorporating a tobacco etch virus protease cleavage site into the C termini of the displayed proteins. The maximum level of the displayed protein was 6.1 × 104 molecules per a single cell, which corresponds to 5.6% of the entire cell surface of actively growing E. coli. PMID:22344647

Photonic reagents for concentration measurement of flu-orescent proteins with overlapping spectra

NASA Astrophysics Data System (ADS)

Goun, Alexei; Bondar, Denys I.; Er, Ali O.; Quine, Zachary; Rabitz, Herschel A.

2016-05-01

By exploiting photonic reagents (i.e., coherent control by shaped laser pulses), we employ Optimal Dynamic Discrimination (ODD) as a novel means for quantitatively characterizing mixtures of fluorescent proteins with a large spectral overlap. To illustrate ODD, we simultaneously measured concentrations of in vitro mixtures of Enhanced Blue Fluorescent Protein (EBFP) and Enhanced Cyan Fluorescent Protein (ECFP). Building on this foundational study, the ultimate goal is to exploit the capabilities of ODD for parallel monitoring of genetic and protein circuits by suppressing the spectral cross-talk among multiple fluorescent reporters.

A Modular Plasmid Assembly Kit for Multigene Expression, Gene Silencing and Silencing Rescue in Plants

PubMed Central

Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin

2014-01-01

The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083

Oral Administration of Recombinant Lactococcus lactis Expressing the Cellulase Gene Increases Digestibility of Fiber in Geese.

PubMed

Zhou, Haizhu; Gao, Yunhang; Gao, Guang; Lou, Yujie

2015-12-01

Enhancing cellulose digestibility in animals is important for improving the utilization of forage, which can decrease the amount of food used in animal production. The aim of the present study was to achieve recombinant expression of the cellulase gene in Lactococcus lactis and evaluate the effects of oral administration of the recombinant L. lactis on fiber digestibility in geese. Cellulase (Cell) and green fluorescent protein (GFP) genes were cloned into a L. lactis expression vector (pNZ8149) to construct the recombinant expression plasmid (pNZ8149-GFP-Cell). Then, the recombinant expression plasmid was transformed into L. lactis (NZ3900) competent cells by electroporation to obtain recombinant L. lactis (pNZ8149-GFP-Cell/NZ3900) in which protein expression was induced by Nisin. Expression of GFP and Cell by the recombinant L. lactis was confirmed using SDS-PAGE, fluorescence detection, and Congo red assays. A feeding experiment showed that oral administration of pNZ8149-GFP-Cell/NZ3900 significantly increased the digestibility of dietary fiber in geese fed either a maize stalk diet or a rice chaff diet. Therefore, oral administration of recombinant L. lactis cells expressing the cellulase gene increases fiber digestibility in geese, offering a way to increase the utilization of dietary fiber in geese.

New Frontiers in NanoBiotechnology: Monitoring the Protein Function With Single Protein Resolution

DTIC Science & Technology

2005-03-29

Protein (GFP) is a spontaneously fluorescent polypeptide of 27 kD from the jellyfish Aequorea victoria that absorbs UV-blue light and emits in the...will have vast applications in science. Relationship between structure and optical properties in Green Fluorescent Proteins : A quantum mechanical study...RESEARCH AND DEVELOPMENT Invited talks Folding, stability and fluorescence efficiency of the Green and Red Fluorescent Proteins Saverio Alberti Lab.

Fluorescent proteins such as eGFP lead to catalytic oxidative stress in cells.

PubMed

Ganini, Douglas; Leinisch, Fabian; Kumar, Ashutosh; Jiang, JinJie; Tokar, Erik J; Malone, Christine C; Petrovich, Robert M; Mason, Ronald P

2017-08-01

Fluorescent proteins are an important tool that has become omnipresent in life sciences research. They are frequently used for localization of proteins and monitoring of cells [1,2]. Green fluorescent protein (GFP) was the first and has been the most used fluorescent protein. Enhanced GFP (eGFP) was optimized from wild-type GFP for increased fluorescence yield and improved expression in mammalian systems [3]. Many GFP-like fluorescent proteins have been discovered, optimized or created, such as the red fluorescent protein TagRFP [4]. Fluorescent proteins are expressed colorless and immature and, for eGFP, the conversion to the fluorescent form, mature, is known to produce one equivalent of hydrogen peroxide (H 2 O 2 ) per molecule of chromophore [5,6]. Even though it has been proposed that this process is non-catalytic and generates nontoxic levels of H 2 O 2 [6], this study investigates the role of fluorescent proteins in generating free radicals and inducing oxidative stress in biological systems. Immature eGFP and TagRFP catalytically generate the free radical superoxide anion (O 2 •- ) and H 2 O 2 in the presence of NADH. Generation of the free radical O 2 •- and H 2 O 2 by eGFP in the presence of NADH affects the gene expression of cells. Many biological pathways are altered, such as a decrease in HIF1α stabilization and activity. The biological pathways altered by eGFP are known to be implicated in the pathophysiology of many diseases associated with oxidative stress; therefore, it is critical that such experiments using fluorescent proteins are validated with alternative methodologies and the results are carefully interpreted. Since cells inevitably experience oxidative stress when fluorescent proteins are expressed, the use of this tool for cell labeling and in vivo cell tracing also requires validation using alternative methodologies. Published by Elsevier B.V.

A single EBV-based vector for stable episomal maintenance and expression of GFP in human embryonic stem cells.

PubMed

Thyagarajan, Bhaskar; Scheyhing, Kelly; Xue, Haipeng; Fontes, Andrew; Chesnut, Jon; Rao, Mahendra; Lakshmipathy, Uma

2009-03-01

Stable expression of transgenes in stem cells has been a challenge due to the nonavailability of efficient transfection methods and the inability of transgenes to support sustained gene expression. Several methods have been reported to stably modify both embryonic and adult stem cells. These methods rely on integration of the transgene into the genome of the host cell, which could result in an expression pattern dependent on the number of integrations and the genomic locus of integration. To overcome this issue, site-specific integration methods mediated by integrase, adeno-associated virus or via homologous recombination have been used to generate stable human embryonic stem cell (hESC) lines. In this study, we describe a vector that is maintained episomally in hESCs. The vector used in this study is based on components derived from the Epstein-Barr virus, containing the Epstein-Barr virus nuclear antigen 1 expression cassette and the OriP origin of replication. The vector also expresses the drug-resistance marker gene hygromycin, which allows for selection and long-term maintenance of cells harboring the plasmid. Using this vector system, we show sustained expression of green fluorescent protein in undifferentiated hESCs and their differentiating embryoid bodies. In addition, the stable hESC clones show comparable expression with and without drug selection. Consistent with this observation, bulk-transfected adipose tissue-derived mesenchymal stem cells showed persistent marker gene expression as they differentiate into adipocytes, osteoblasts and chondroblasts. Episomal vectors offer a fast and efficient method to create hESC reporter lines, which in turn allows one to test the effect of overexpression of various genes on stem cell growth, proliferation and differentiation.

Human adipose derived mesenchymal stromal cells transduced with GFP lentiviral vectors: assessment of immunophenotype and differentiation capacity in vitro.

PubMed

van Vollenstee, Fiona A; Jackson, Carlo; Hoffmann, Danie; Potgieter, Marnie; Durandt, Chrisna; Pepper, Michael S

2016-10-01

Adipose derived mesenchymal stromal/stem cells (ASCs) are a heterogeneous population characterized by (a) their ability to adhere to plastic; (b) immunophenotypic expression of certain cell surface markers, while lacking others; and (c) the capacity to differentiate into lineages of mesodermal origin including osteocytes, chondrocytes and adipocytes. The long-term goal is to utilize these cells for clinical translation into cell-based therapies. However, preclinical safety and efficacy need to be demonstrated in animal models. ASCs can also be utilized as biological vehicles for vector-based gene delivery systems, since they are believed to home to sites of inflammation and infection in vivo. These factors motivated the development of a labelling system for ASCs using lentiviral vector-based green fluorescent protein (GFP) transduction. Human ASCs were transduced with GFP-expressing lentiviral vectors. A titration study determined the viral titer required to transduce the maximum number of ASCs. The effect of the transduced GFP lentiviral vector on ASC immunophenotypic expression of surface markers as well as their ability to differentiate into osteocytes and adipocytes were assessed in vitro. A transduction efficiency in ASC cultures of approximately 80 % was observed with an MOI of ~118. No significant immunophenotypic differences were observed between transduced and non-transduced cells and both cell types successfully differentiated into adipocytes and osteocytes in vitro. We obtained >80 % transduction of ASCs using GFP lentiviral vectors. Transduced ASCs maintained plastic adherence, demonstrated ASC immunophenotype and the ability to differentiate into cells of the mesodermal lineage. This GFP-ASC transduction technique offers a potential tracking system for future pre-clinical studies.

[Spectral diversity among the members of the family of Green Fluorescent Protein in hydroid jellyfish (Cnidaria, Hydrozoa)].

PubMed

Ianushevich, Iu G; Shagin, D A; Fradkov, A F; Shakhbazov, K S; Barsova, E V; Gurskaia, N G; Labas, Iu A; Matts, M V; Luk'ianov, k A; Lul'ianov, S A

2005-01-01

The cDNAs encoding the genes of new proteins homologous to the well-known Green Fluorescent Protein (GFP) from the hydroid jellyfish Aequorea victoria were cloned. Two green fluorescent proteins from one un-identified anthojellyfish, a yellow fluorescent protein from Phialidium sp., and a nonfluorescent chromoprotein from another unidentified anthojellyfish were characterized. Thus, a broad diversity of GFP-like proteins among the organisms of the class Hydrozoa in both spectral properties and primary structure was shown.

The fluorescence intensities ratio is not a reliable parameter for evaluation of protein unfolding transitions.

PubMed

Žoldák, Gabriel; Jancura, Daniel; Sedlák, Erik

2017-06-01

Monitoring the fluorescence of proteins, particularly the fluorescence of intrinsic tryptophan residues, is a popular method often used in the analysis of unfolding transitions (induced by temperature, chemical denaturant, and pH) in proteins. The tryptophan fluorescence provides several suitable parameters, such as steady-state fluorescence intensity, apparent quantum yield, mean fluorescence lifetime, position of emission maximum that are often utilized for the observation of the conformational/unfolding transitions of proteins. In addition, the fluorescence intensities ratio at different wavelengths (usually at 330 nm and 350 nm) is becoming an increasingly popular parameter for the evaluation of thermal transitions. We show that, under certain conditions, the use of this parameter for the analysis of unfolding transitions leads to the incorrect determination of thermodynamic parameters characterizing unfolding transitions in proteins (e.g., melting temperature) and, hence, can compromise the hit identification during high-throughput drug screening campaigns. © 2017 The Protein Society.

Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo

PubMed Central

Plamont, Marie-Aude; Billon-Denis, Emmanuelle; Maurin, Sylvie; Gauron, Carole; Pimenta, Frederico M.; Specht, Christian G.; Shi, Jian; Quérard, Jérôme; Pan, Buyan; Rossignol, Julien; Moncoq, Karine; Morellet, Nelly; Volovitch, Michel; Lescop, Ewen; Chen, Yong; Triller, Antoine; Vriz, Sophie; Le Saux, Thomas; Jullien, Ludovic; Gautier, Arnaud

2016-01-01

This paper presents Yellow Fluorescence-Activating and absorption-Shifting Tag (Y-FAST), a small monomeric protein tag, half as large as the green fluorescent protein, enabling fluorescent labeling of proteins in a reversible and specific manner through the reversible binding and activation of a cell-permeant and nontoxic fluorogenic ligand (a so-called fluorogen). A unique fluorogen activation mechanism based on two spectroscopic changes, increase of fluorescence quantum yield and absorption red shift, provides high labeling selectivity. Y-FAST was engineered from the 14-kDa photoactive yellow protein by directed evolution using yeast display and fluorescence-activated cell sorting. Y-FAST is as bright as common fluorescent proteins, exhibits good photostability, and allows the efficient labeling of proteins in various organelles and hosts. Upon fluorogen binding, fluorescence appears instantaneously, allowing monitoring of rapid processes in near real time. Y-FAST distinguishes itself from other tagging systems because the fluorogen binding is highly dynamic and fully reversible, which enables rapid labeling and unlabeling of proteins by addition and withdrawal of the fluorogen, opening new exciting prospects for the development of multiplexing imaging protocols based on sequential labeling. PMID:26711992

Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo.

PubMed

Plamont, Marie-Aude; Billon-Denis, Emmanuelle; Maurin, Sylvie; Gauron, Carole; Pimenta, Frederico M; Specht, Christian G; Shi, Jian; Quérard, Jérôme; Pan, Buyan; Rossignol, Julien; Moncoq, Karine; Morellet, Nelly; Volovitch, Michel; Lescop, Ewen; Chen, Yong; Triller, Antoine; Vriz, Sophie; Le Saux, Thomas; Jullien, Ludovic; Gautier, Arnaud

2016-01-19

This paper presents Yellow Fluorescence-Activating and absorption-Shifting Tag (Y-FAST), a small monomeric protein tag, half as large as the green fluorescent protein, enabling fluorescent labeling of proteins in a reversible and specific manner through the reversible binding and activation of a cell-permeant and nontoxic fluorogenic ligand (a so-called fluorogen). A unique fluorogen activation mechanism based on two spectroscopic changes, increase of fluorescence quantum yield and absorption red shift, provides high labeling selectivity. Y-FAST was engineered from the 14-kDa photoactive yellow protein by directed evolution using yeast display and fluorescence-activated cell sorting. Y-FAST is as bright as common fluorescent proteins, exhibits good photostability, and allows the efficient labeling of proteins in various organelles and hosts. Upon fluorogen binding, fluorescence appears instantaneously, allowing monitoring of rapid processes in near real time. Y-FAST distinguishes itself from other tagging systems because the fluorogen binding is highly dynamic and fully reversible, which enables rapid labeling and unlabeling of proteins by addition and withdrawal of the fluorogen, opening new exciting prospects for the development of multiplexing imaging protocols based on sequential labeling.

Unique fluorescence and high-molecular weight characteristics of protein isolates from manuka honey (Leptospermum scoparium).

PubMed

Rückriemen, Jana; Hohmann, Christoph; Hellwig, Michael; Henle, Thomas

2017-09-01

This study compared the fluorescence properties (λ ex/em =350/450nm) and molecular size of proteins from manuka and non-manuka honey. The fluorescence characteristics of non-manuka and manuka proteins differ markedly, whereby manuka honey protein fluorescence increases with increasing methylglyoxal (MGO) content of the honey. It was concluded that manuka honey proteins are modified due to MGO-derived glycation and crosslinking reactions, thus resulting in fluorescent structures. The molecular size of honey proteins was studied using size exclusion chromatography. Manuka honey proteins contain a significantly higher amount of high molecular weight (HMW) fraction compared to non-manuka honey proteins. Moreover, HMW fraction of manuka honey proteins was stable against reducing agents such as dithiothreitol, whereas HMW fraction of non-manuka honey proteins was significantly decreased. Thus, the chemical nature of manuka honey HMW fraction is probably covalent MGO crosslinking, whereas non-manuka HMW fraction is caused by disulfide bonds. Storage of a non-manuka honey, which was artificially spiked with MGO and DHA, did not induce above mentioned fluorescence properties of proteins during 84days of storage. Hence, MGO-derived fluorescence and crosslinking of honey proteins can be useful parameters to characterize manuka honey. Copyright © 2017 Elsevier Ltd. All rights reserved.

Transduction of skeletal muscles with common reporter genes can promote muscle fiber degeneration and inflammation.

PubMed

Winbanks, Catherine E; Beyer, Claudia; Qian, Hongwei; Gregorevic, Paul

2012-01-01

Recombinant adeno-associated viral vectors (rAAV vectors) are promising tools for delivering transgenes to skeletal muscle, in order to study the mechanisms that control the muscle phenotype, and to ameliorate diseases that perturb muscle homeostasis. Many studies have employed rAAV vectors carrying reporter genes encoding for β-galactosidase (β-gal), human placental alkaline phosphatase (hPLAP), and green fluorescent protein (GFP) as experimental controls when studying the effects of manipulating other genes. However, it is not clear to what extent these reporter genes can influence signaling and gene expression signatures in skeletal muscle, which may confound the interpretation of results obtained in experimentally manipulated muscles. Herein, we report a strong pro-inflammatory effect of expressing reporter genes in skeletal muscle. Specifically, we show that the administration of rAAV6:hPLAP vectors to the hind limb muscles of mice is associated with dose- and time-dependent macrophage recruitment, and skeletal muscle damage. Dose-dependent expression of hPLAP also led to marked activity of established pro-inflammatory IL-6/Stat3, TNFα, IKKβ and JNK signaling in lysates obtained from homogenized muscles. These effects were independent of promoter type, as expression cassettes featuring hPLAP under the control of constitutive CMV and muscle-specific CK6 promoters both drove cellular responses when matched for vector dose. Importantly, the administration of rAAV6:GFP vectors did not induce muscle damage or inflammation except at the highest doses we examined, and administration of a transgene-null vector (rAAV6:MCS) did not cause damage or inflammation at any of the doses tested, demonstrating that GFP-expressing, or transgene-null vectors may be more suitable as experimental controls. The studies highlight the importance of considering the potential effects of reporter genes when designing experiments that examine gene manipulation in vivo.

Guide to red fluorescent proteins and biosensors for flow cytometry.

PubMed

Piatkevich, Kiryl D; Verkhusha, Vladislav V

2011-01-01

Since the discovery of the first red fluorescent protein (RFP), named DsRed, 12 years ago, a wide pallet of red-shifted fluorescent proteins has been cloned and biotechnologically developed into monomeric fluorescent probes for optical microscopy. Several new types of monomeric RFPs that change the emission wavelength either with time, called fluorescent timers, or after a brief irradiation with violet light, known as photoactivatable proteins, have been also engineered. Moreover, RFPs with a large Stokes shift of fluorescence emission have been recently designed. Because of their distinctive excitation and fluorescence detection conditions developed specifically for microscopy, these fluorescent probes can be suboptimal for flow cytometry. Here, we have selected and summarized the advanced orange, red, and far-red fluorescent proteins with the properties specifically required for the flow cytometry applications. Their effective brightness was calculated for the laser sources available for the commercial flow cytometers and sorters. Compatibility of the fluorescent proteins of different colors in a multiparameter flow cytometry was determined. Novel FRET pairs, utilizing RFPs, RFP-based intracellular biosensors, and their application to a high-throughput screening, are also discussed. Copyright © 2011 Elsevier Inc. All rights reserved.

A pH-sensitive red fluorescent protein compatible with hydrophobic resin embedding

NASA Astrophysics Data System (ADS)

Guo, Wenyan; Gang, Yadong; Liu, Xiuli; Zhou, Hongfu; Zeng, Shaoqun

2017-02-01

pH sensitive fluorescent proteins enabling chemical reactivation in resin are useful tools for fluorescence microimaging. EYFP or EGFP improved from GFP in jellyfish are good for such applications. For simultaneous two-color imaging, a suitable red fluorescent protein is of urgent need. Here a pH sensitive red fluorescent protein, pHuji, is selected and verified to be compatible with hydrophobic resin embedding and thus may be promising for dual-colour chemical reactivation imaging in conjunction with EGFP or EYFP.

Classification of different kinds of pesticide residues on lettuce based on fluorescence spectra and WT-BCC-SVM algorithm

NASA Astrophysics Data System (ADS)

Zhou, Xin; Jun, Sun; Zhang, Bing; Jun, Wu

2017-07-01

In order to improve the reliability of the spectrum feature extracted by wavelet transform, a method combining wavelet transform (WT) with bacterial colony chemotaxis algorithm and support vector machine (BCC-SVM) algorithm (WT-BCC-SVM) was proposed in this paper. Besides, we aimed to identify different kinds of pesticide residues on lettuce leaves in a novel and rapid non-destructive way by using fluorescence spectra technology. The fluorescence spectral data of 150 lettuce leaf samples of five different kinds of pesticide residues on the surface of lettuce were obtained using Cary Eclipse fluorescence spectrometer. Standard normalized variable detrending (SNV detrending), Savitzky-Golay coupled with Standard normalized variable detrending (SG-SNV detrending) were used to preprocess the raw spectra, respectively. Bacterial colony chemotaxis combined with support vector machine (BCC-SVM) and support vector machine (SVM) classification models were established based on full spectra (FS) and wavelet transform characteristics (WTC), respectively. Moreover, WTC were selected by WT. The results showed that the accuracy of training set, calibration set and the prediction set of the best optimal classification model (SG-SNV detrending-WT-BCC-SVM) were 100%, 98% and 93.33%, respectively. In addition, the results indicated that it was feasible to use WT-BCC-SVM to establish diagnostic model of different kinds of pesticide residues on lettuce leaves.

Viral Paratransgenesis in the Malaria Vector Anopheles gambiae

PubMed Central

Ren, Xiaoxia; Hoiczyk, Egbert; Rasgon, Jason L.

2008-01-01

Paratransgenesis, the genetic manipulation of insect symbiotic microorganisms, is being considered as a potential method to control vector-borne diseases such as malaria. The feasibility of paratransgenic malaria control has been hampered by the lack of candidate symbiotic microorganisms for the major vector Anopheles gambiae. In other systems, densonucleosis viruses (DNVs) are attractive agents for viral paratransgenesis because they infect important vector insects, can be genetically manipulated and are transmitted to subsequent generations. However, An. gambiae has been shown to be refractory to DNV dissemination. We discovered, cloned and characterized the first known DNV (AgDNV) capable of infection and dissemination in An. gambiae. We developed a flexible AgDNV-based expression vector to express any gene of interest in An. gambiae using a two-plasmid helper-transducer system. To demonstrate proof-of-concept of the viral paratransgenesis strategy, we used this system to transduce expression of an exogenous gene (enhanced green fluorescent protein; EGFP) in An. gambiae mosquitoes. Wild-type and EGFP-transducing AgDNV virions were highly infectious to An. gambiae larvae, disseminated to and expressed EGFP in epidemiologically relevant adult tissues such as midgut, fat body and ovaries and were transmitted to subsequent mosquito generations. These proof-of-principle data suggest that AgDNV could be used as part of a paratransgenic malaria control strategy by transduction of anti-Plasmodium peptides or insect-specific toxins in Anopheles mosquitoes. AgDNV will also be extremely valuable as an effective and easy-to-use laboratory tool for transient gene expression or RNAi in An. gambiae. PMID:18725926

[Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

PubMed

Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

2013-04-01

This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

Sodium Chloride Enhances Recombinant Adeno-Associated Virus Production in a Serum-Free Suspension Manufacturing Platform Using the Herpes Simplex Virus System

PubMed Central

Adamson-Small, Laura; Potter, Mark; Byrne, Barry J.; Clément, Nathalie

2017-01-01

The increase in effective treatments using recombinant adeno-associated viral (rAAV) vectors has underscored the importance of scalable, high-yield manufacturing methods. Previous work from this group reported the use of recombinant herpes simplex virus type 1 (rHSV) vectors to produce rAAV in adherent HEK293 cells, demonstrating the capacity of this system and quality of the product generated. Here we report production and optimization of rAAV using the rHSV system in suspension HEK293 cells (Expi293F) grown in serum and animal component-free medium. Through adjustment of salt concentration in the medium and optimization of infection conditions, titers greater than 1 × 1014 vector genomes per liter (VG/liter) were observed in purified rAAV stocks produced in Expi293F cells. Furthermore, this system allowed for high-titer production of multiple rAAV serotypes (2, 5, and 9) as well as multiple transgenes (green fluorescent protein and acid α-glucosidase). A proportional increase in vector production was observed as this method was scaled, with a final 3-liter shaker flask production yielding an excess of 1 × 1015 VG in crude cell harvests and an average of 3.5 × 1014 total VG of purified rAAV9 material, resulting in greater than 1 × 105 VG/cell. These results support the use of this rHSV-based rAAV production method for large-scale preclinical and clinical vector production. PMID:28117600

Photonic reagents for concentration measurement of flu-orescent proteins with overlapping spectra

PubMed Central

Goun, Alexei; Bondar, Denys I.; Er, Ali O.; Quine, Zachary; Rabitz, Herschel A.

2016-01-01

By exploiting photonic reagents (i.e., coherent control by shaped laser pulses), we employ Optimal Dynamic Discrimination (ODD) as a novel means for quantitatively characterizing mixtures of fluorescent proteins with a large spectral overlap. To illustrate ODD, we simultaneously measured concentrations of in vitro mixtures of Enhanced Blue Fluorescent Protein (EBFP) and Enhanced Cyan Fluorescent Protein (ECFP). Building on this foundational study, the ultimate goal is to exploit the capabilities of ODD for parallel monitoring of genetic and protein circuits by suppressing the spectral cross-talk among multiple fluorescent reporters. PMID:27181496

Chemical reactivation of quenched fluorescent protein molecules enables resin-embedded fluorescence microimaging

PubMed Central

Xiong, Hanqing; Zhou, Zhenqiao; Zhu, Mingqiang; Lv, Xiaohua; Li, Anan; Li, Shiwei; Li, Longhui; Yang, Tao; Wang, Siming; Yang, Zhongqin; Xu, Tonghui; Luo, Qingming; Gong, Hui; Zeng, Shaoqun

2014-01-01

Resin embedding is a well-established technique to prepare biological specimens for microscopic imaging. However, it is not compatible with modern green-fluorescent protein (GFP) fluorescent-labelling technique because it significantly quenches the fluorescence of GFP and its variants. Previous empirical optimization efforts are good for thin tissue but not successful on macroscopic tissue blocks as the quenching mechanism remains uncertain. Here we show most of the quenched GFP molecules are structurally preserved and not denatured after routine embedding in resin, and can be chemically reactivated to a fluorescent state by alkaline buffer during imaging. We observe up to 98% preservation in yellow-fluorescent protein case, and improve the fluorescence intensity 11.8-fold compared with unprocessed samples. We demonstrate fluorescence microimaging of resin-embedded EGFP/EYFP-labelled tissue block without noticeable loss of labelled structures. This work provides a turning point for the imaging of fluorescent protein-labelled specimens after resin embedding. PMID:24886825

Very Bright Green Fluorescent Proteins from the Pontellid Copepod Pontella mimocerami

PubMed Central

Hunt, Marguerite E.; Scherrer, Michael P.; Ferrari, Frank D.; Matz, Mikhail V.

2010-01-01

Background Fluorescent proteins (FP) homologous to the green fluorescent protein (GFP) from the jellyfish Aequorea victoria have revolutionized biomedical research due to their usefulness as genetically encoded fluorescent labels. Fluorescent proteins from copepods are particularly promising due to their high brightness and rapid fluorescence development. Results Here we report two novel FPs from Pontella mimocerami (Copepoda, Calanoida, Pontellidae), which were identified via fluorescence screening of a bacterial cDNA expression library prepared from the whole-body total RNA of the animal. The proteins are very similar in sequence and spectroscopic properties. They possess high molar extinction coefficients (79,000 M−1 cm−) and quantum yields (0.92), which make them more than two-fold brighter than the most common FP marker, EGFP. Both proteins form oligomers, which we were able to counteract to some extent by mutagenesis of the N-terminal region; however, this particular modification resulted in substantial drop in brightness. Conclusions The spectroscopic characteristics of the two P. mimocerami proteins place them among the brightest green FPs ever described. These proteins may therefore become valuable additions to the in vivo imaging toolkit. PMID:20644720

Biodegradable Nanoparticles of mPEG-PLGA-PLL Triblock Copolymers as Novel Non-Viral Vectors for Improving siRNA Delivery and Gene Silencing

PubMed Central

Du, Jing; Sun, Ying; Shi, Qiu-Sheng; Liu, Pei-Feng; Zhu, Ming-Jie; Wang, Chun-Hui; Du, Lian-Fang; Duan, You-Rong

2012-01-01

Degradation of mRNA by RNA interference is one of the most powerful and specific mechanisms for gene silencing. However, insufficient cellular uptake and poor stability have limited its usefulness. Here, we report efficient delivery of siRNA via the use of biodegradable nanoparticles (NPs) made from monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly-l-lysine (mPEG-PLGA-PLL) triblock copolymers. Various physicochemical properties of mPEG-PLGA-PLL NPs, including morphology, size, surface charge, siRNA encapsulation efficiency, and in vitro release profile of siRNA from NPs, were characterized by scanning electron microscope, particle size and zeta potential analyzer, and high performance liquid chromatography. The levels of siRNA uptake and targeted gene inhibition were detected in human lung cancer SPC-A1-GFP cells stably expressing green fluorescent protein. Examination of the cultured SPC-A1-GFP cells with fluorescent microscope and flow cytometry showed NPs loading Cy3-labeled siRNA had much higher intracellular siRNA delivery efficiencies than siRNA alone and Lipofectamine-siRNA complexes. The gene silencing efficiency of mPEG-PLGA-PLL NPs was higher than that of commercially available transfecting agent Lipofectamine while showing no cytotoxicity. Thus, the current study demonstrates that biodegradable NPs of mPEG-PLGA-PLL triblock copolymers can be potentially applied as novel non-viral vectors for improving siRNA delivery and gene silencing. PMID:22312268

Protein subcellular localization assays using split fluorescent proteins

DOEpatents

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2009-09-08

The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).

Fluorescence Modulation of Green Fluorescent Protein Using Fluorinated Unnatural Amino Acids.

PubMed

Villa, Jordan K; Tran, Hong-Anh; Vipani, Megha; Gianturco, Stephanie; Bhasin, Konark; Russell, Brent L; Harbron, Elizabeth J; Young, Douglas D

2017-07-16

The ability to modulate protein function through minimal perturbations to amino acid structure represents an ideal mechanism to engineer optimized proteins. Due to the novel spectroscopic properties of green fluorescent protein, it has found widespread application as a reporter protein throughout the fields of biology and chemistry. Using site-specific amino acid mutagenesis, we have incorporated various fluorotyrosine residues directly into the fluorophore of the protein, altering the fluorescence and shifting the pKa of the phenolic proton associated with the fluorophore. Relative to wild type GFP, the fluorescence spectrum of the protein is altered with each additional fluorine atom, and the mutant GFPs have the potential to be employed as pH sensors due to the altered electronic properties of the fluorine atoms.

An in vivo imaging-based assay for detecting protein interactions over a wide range of binding affinities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowlkes, Jason Davidson; Owens, Elizabeth T; Standaert, Robert F

2009-01-01

Identifying and characterizing protein interactions are fundamental steps towards understanding and modeling biological networks. Methods that detect protein interactions in intact cells rather than buffered solutions are likely more relevant to natural systems since molecular crowding events in the cytosol can influence the diffusion and reactivity of individual proteins. One in vivo, imaging-based method relies on the co-localization of two proteins of interest fused to DivIVA, a cell division protein from Bacillus subtilis, and green fluorescent protein (GFP). We have modified this imaging-based assay to facilitate rapid cloning by constructing new vectors encoding N- and C-terminal DivIVA or GFP molecularmore » tag fusions based on site-specific recombination technology. The sensitivity of the assay was defined using a well-characterized protein interaction system involving the eukaryotic nuclear import receptor subunit, Importin (Imp ) and variant nuclear localization signals (NLS) representing a range of binding affinities. These data demonstrate that the modified co-localization assay is sensitive enough to detect protein interactions with Kd values that span over four orders of magnitude (1nM to 15 M). Lastly, this assay was used to confirm numerous protein interactions identified from mass spectrometry-based analyses of affinity isolates as part of an interactome mapping project in Rhodopseudomonas palustris« less

SVM-based feature extraction and classification of aflatoxin contaminated corn using fluorescence hyperspectral data

USDA-ARS?s Scientific Manuscript database

Support Vector Machine (SVM) was used in the Genetic Algorithms (GA) process to select and classify a subset of hyperspectral image bands. The method was applied to fluorescence hyperspectral data for the detection of aflatoxin contamination in Aspergillus flavus infected single corn kernels. In the...

Dissecting the mechanism of histone deacetylase inhibitors to enhance the activity of zinc finger nucleases delivered by integrase-defective lentiviral vectors.

PubMed

Joglekar, Alok V; Stein, Libby; Ho, Michelle; Hoban, Megan D; Hollis, Roger P; Kohn, Donald B

2014-07-01

Integrase-defective lentiviral vectors (IDLVs) have been of limited success in the delivery of zinc finger nucleases (ZFNs) to human cells, due to low expression. A reason for reduced gene expression has been proposed to involve the epigenetic silencing of vector genomes, carried out primarily by histone deacetylases (HDACs). In this study, we tested valproic acid (VPA), a known HDAC inhibitor (HDACi), for its ability to increase transgene expression from IDLVs, especially in the context of ZFN delivery. Using ZFNs targeting the human adenosine deaminase (ADA) gene in K562 cells, we demonstrated that treatment with VPA enhanced ZFN expression by up to 3-fold, resulting in improved allelic disruption at the ADA locus. Furthermore, three other U.S. Food and Drug Administration-approved HDACis (vorinostat, givinostat, and trichostatin-A) exhibited a similar effect on the activity of ZFN-IDLVs in K562 cells. In primary human CD34(+) cells, VPA- and vorinostat-treated cells showed higher levels of expression of both green fluorescent protein (GFP) as well as ZFNs from IDLVs. A major mechanism for the effects of HDAC inhibitors on improving expression was from their modulation of the cell cycle, and the influence of heterochromatinization was determined to be a lesser contributing factor.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

PubMed

Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

PubMed Central

Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

Salicylic acid interferes with GFP fluorescence in vivo

PubMed Central

de Jonge, Jennifer; Hofius, Daniel

2017-01-01

Abstract Fluorescent proteins have become essential tools for cell biologists. They are routinely used by plant biologists for protein and promoter fusions to infer protein localization, tissue‐specific expression and protein abundance. When studying the effects of biotic stress on chromatin, we unexpectedly observed a decrease in GFP signal intensity upon salicylic acid (SA) treatment in Arabidopsis lines expressing histone H1-GFP fusions. This GFP signal decrease was dependent on SA concentration. The effect was not specific to the linker histone H1-GFP fusion but was also observed for the nucleosomal histone H2A-GFP fusion. This result prompted us to investigate a collection of fusion proteins, which included different promoters, subcellular localizations and fluorophores. In all cases, fluorescence signals declined strongly or disappeared after SA application. No changes were detected in GFP‐fusion protein abundance when fluorescence signals were lost indicating that SA does not interfere with protein stability but GFP fluorescence. In vitro experiments showed that SA caused GFP fluorescence reduction only in vivo but not in vitro, suggesting that SA requires cellular components to cause fluorescence reduction. Together, we conclude that SA can interfere with the fluorescence of various GFP‐derived reporter constructs in vivo. Assays that measure relocation or turnover of GFP‐tagged proteins upon SA treatment should therefore be evaluated with caution. PMID:28369601

Development of Fluorescent Protein Probes Specific for Parallel DNA and RNA G-Quadruplexes.

PubMed

Dang, Dung Thanh; Phan, Anh Tuân

2016-01-01

We have developed fluorescent protein probes specific for parallel G-quadruplexes by attaching cyan fluorescent protein to the G-quadruplex-binding motif of the RNA helicase RHAU. Fluorescent probes containing RHAU peptide fragments of different lengths were constructed, and their binding to G-quadruplexes was characterized. The selective recognition and discrimination of G-quadruplex topologies by the fluorescent protein probes was easily detected by the naked eye or by conventional gel imaging. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Intrinsic Fluorescence as a Spectral Probe for Protein Denaturation Studies in the Presence of Honey

NASA Astrophysics Data System (ADS)

Wong, Y. H.; Kadir, H. A.; Tayyab, S.

2015-11-01

Honey was found to quench the intrinsic fluorescence of bovine serum albumin (BSA) in a concentration dependent manner, showing complete quenching in the presence of 5% (w/v) honey. Increasing the protein concentration up to 5.0 μM did not lead to the recovery of the protein fluorescence. Urea denaturation of BSA, which otherwise shows a two-step, three-state transition, using intrinsic fluorescence of the protein as the probe failed to produce any result in the presence of 5% (w/v) honey. Thus, intrinsic fluorescence cannot be used as a spectral probe for protein denaturation studies in the presence of honey.

Metal-enhanced fluorescence of single green fluorescent protein (GFP)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu Yi; Zhang Jian; Lakowicz, Joseph R.

2008-11-28

The green fluorescent protein (GFP) has emerged as a powerful reporter molecule for monitoring gene expression, protein localization, and protein-protein interaction. However, the detection of low concentrations of GFPs is limited by the weakness of the fluorescent signal and the low photostability. In this report, we observed the proximity of single GFPs to metallic silver nanoparticles increases its fluorescence intensity approximately 6-fold and decreases the decay time. Single protein molecules on the silvered surfaces emitted 10-fold more photons as compared to glass prior to photobleaching. The photostability of single GFP has increased to some extent. Accordingly, we observed longer durationmore » time and suppressed blinking. The single-molecule lifetime histograms indicate the relatively heterogeneous distributions of protein mutants inside the structure.« less

Construction and characterization of stable, constitutively expressed, chromosomal green and red fluorescent transcriptional fusions in the select agents, Bacillus anthracis, Yersinia pestis, Burkholderia mallei, and Burkholderia pseudomallei

PubMed Central

Su, Shengchang; Bangar, Hansraj; Saldanha, Roland; Pemberton, Adin; Aronow, Bruce; Dean, Gary E; Lamkin, Thomas J; Hassett, Daniel J

2014-01-01

Here, we constructed stable, chromosomal, constitutively expressed, green and red fluorescent protein (GFP and RFP) as reporters in the select agents, Bacillus anthracis, Yersinia pestis, Burkholderia mallei, and Burkholderia pseudomallei. Using bioinformatic approaches and other experimental analyses, we identified P0253 and P1 as potent promoters that drive the optimal expression of fluorescent reporters in single copy in B. anthracis and Burkholderia spp. as well as their surrogate strains, respectively. In comparison, Y. pestis and its surrogate strain need two chromosomal copies of cysZK promoter (P2cysZK) for optimal fluorescence. The P0253-, P2cysZK-, and P1-driven GFP and RFP fusions were first cloned into the vectors pRP1028, pUC18R6KT-mini-Tn7T-Km, pmini-Tn7-gat, or their derivatives. The resultant constructs were delivered into the respective surrogates and subsequently into the select agent strains. The chromosomal GFP- and RFP-tagged strains exhibited bright fluorescence at an exposure time of less than 200 msec and displayed the same virulence traits as their wild-type parental strains. The utility of the tagged strains was proven by the macrophage infection assays and lactate dehydrogenase release analysis. Such strains will be extremely useful in high-throughput screens for novel compounds that could either kill these organisms, or interfere with critical virulence processes in these important bioweapon agents and during infection of alveolar macrophages. PMID:25044501

Construction and characterization of stable, constitutively expressed, chromosomal green and red fluorescent transcriptional fusions in the select agents, Bacillus anthracis, Yersinia pestis, Burkholderia mallei, and Burkholderia pseudomallei.

PubMed

Su, Shengchang; Bangar, Hansraj; Saldanha, Roland; Pemberton, Adin; Aronow, Bruce; Dean, Gary E; Lamkin, Thomas J; Hassett, Daniel J

2014-10-01

Here, we constructed stable, chromosomal, constitutively expressed, green and red fluorescent protein (GFP and RFP) as reporters in the select agents, Bacillus anthracis, Yersinia pestis, Burkholderia mallei, and Burkholderia pseudomallei. Using bioinformatic approaches and other experimental analyses, we identified P0253 and P1 as potent promoters that drive the optimal expression of fluorescent reporters in single copy in B. anthracis and Burkholderia spp. as well as their surrogate strains, respectively. In comparison, Y. pestis and its surrogate strain need two chromosomal copies of cysZK promoter (P2cysZK) for optimal fluorescence. The P0253-, P2cysZK-, and P1-driven GFP and RFP fusions were first cloned into the vectors pRP1028, pUC18R6KT-mini-Tn7T-Km, pmini-Tn7-gat, or their derivatives. The resultant constructs were delivered into the respective surrogates and subsequently into the select agent strains. The chromosomal GFP- and RFP-tagged strains exhibited bright fluorescence at an exposure time of less than 200 msec and displayed the same virulence traits as their wild-type parental strains. The utility of the tagged strains was proven by the macrophage infection assays and lactate dehydrogenase release analysis. Such strains will be extremely useful in high-throughput screens for novel compounds that could either kill these organisms, or interfere with critical virulence processes in these important bioweapon agents and during infection of alveolar macrophages. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Cytoplasmic bacteriophage display system

DOEpatents

Studier, F.W.; Rosenberg, A.H.

1998-06-16

Disclosed are display vectors comprising DNA encoding a portion of a structural protein from a cytoplasmic bacteriophage, joined covalently to a protein or peptide of interest. Exemplified are display vectors wherein the structural protein is the T7 bacteriophage capsid protein. More specifically, in the exemplified display vectors the C-terminal amino acid residue of the portion of the capsid protein is joined to the N-terminal residue of the protein or peptide of interest. The portion of the T7 capsid protein exemplified comprises an N-terminal portion corresponding to form 10B of the T7 capsid protein. The display vectors are useful for high copy number display or lower copy number display (with larger fusion). Compositions of the type described herein are useful in connection with methods for producing a virus displaying a protein or peptide of interest. 1 fig.

Cytoplasmic bacteriophage display system

DOEpatents

Studier, F. William; Rosenberg, Alan H.

1998-06-16

Disclosed are display vectors comprising DNA encoding a portion of a structural protein from a cytoplasmic bacteriophage, joined covalently to a protein or peptide of interest. Exemplified are display vectors wherein the structural protein is the T7 bacteriophage capsid protein. More specifically, in the exemplified display vectors the C-terminal amino acid residue of the portion of the capsid protein is joined to the N-terminal residue of the protein or peptide of interest. The portion of the T7 capsid protein exemplified comprises an N-terminal portion corresponding to form 10B of the T7 capsid protein. The display vectors are useful for high copy number display or lower copy number display (with larger fusion). Compositions of the type described herein are useful in connection with methods for producing a virus displaying a protein or peptide of interest.

Fluorescent-protein-based probes: general principles and practices.

PubMed

Ai, Hui-Wang

2015-01-01

An important application of fluorescent proteins is to derive genetically encoded fluorescent probes that can actively respond to cellular dynamics such as pH change, redox signaling, calcium oscillation, enzyme activities, and membrane potential. Despite the large diverse group of fluorescent-protein-based probes, a few basic principles have been established and are shared by most of these probes. In this article, the focus is on these general principles and strategies that guide the development of fluorescent-protein-based probes. A few examples are provided in each category to illustrate the corresponding principles. Since these principles are quite straightforward, others may adapt them to create fluorescent probes for their own interest. Hopefully, the development of the ever-growing family of fluorescent-protein-based probes will no longer be limited to a small number of laboratories specialized in senor development, leading to the situation that biological studies will be bettered assisted by genetically encoded sensors.

Chromophore Isomer Stabilization Is Critical to the Efficient Fluorescence of Cyan Fluorescent Proteins.

PubMed

Gotthard, Guillaume; von Stetten, David; Clavel, Damien; Noirclerc-Savoye, Marjolaine; Royant, Antoine

2017-12-12

ECFP, the first usable cyan fluorescent protein (CFP), was obtained by adapting the tyrosine-based chromophore environment in green fluorescent protein to that of a tryptophan-based one. This first-generation CFP was superseded by the popular Cerulean, CyPet, and SCFP3A that were engineered by rational and random mutagenesis, yet the latter CFPs still exhibit suboptimal properties of pH sensitivity and reversible photobleaching behavior. These flaws were serendipitously corrected in the third-generation CFP mTurquoise and its successors without an obvious rationale. We show here that the evolution process had unexpectedly remodeled the chromophore environment in second-generation CFPs so they would accommodate a different isomer, whose formation is favored by acidic pH or light irradiation and which emits fluorescence much less efficiently. Our results illustrate how fluorescent protein engineering based solely on fluorescence efficiency optimization may affect other photophysical or physicochemical parameters and provide novel insights into the rational evolution of fluorescent proteins with a tryptophan-based chromophore.

Quenching of photoexcited states of the proteins chromophores and introduced into the protein macromolecules fluorescent probes by heavy metal ions

NASA Astrophysics Data System (ADS)

Melnikov, A. G.; Dyachuk, O. A.; Melnikov, G. V.

2015-03-01

We have studied the processes of quenching of photoexcited states of fluorescent probes and quenching of the fluorescence of the chromophores of human serum albumin (HSA) by heavy metal ions (HM): cations Tl+, Pb2+, Cu2+, Cd2+, and the anion of iodine (I-). We used the dye from xanthene series - eosin as a fluorescent probe. By quenching of the fluorescence of protein chromophores we found an influence of HM on the structure of proteins, resulting in a shift of the peak of the fluorescence of HSA tryptophanyl. This can be explained by proteins denaturation under the influence of heavy metals and penetration of water into the inner environment of HSA tryptophan. It was established that the constant of the quenching of the probe phosphorescence is much higher than the fluorescence, which is explained by significantly longer lifetime of the photoexcited states of fluorescent probes in the triplet state than in the singlet.

Spatial and Temporal Analysis of Alphavirus Replication and Assembly in Mammalian and Mosquito Cells.

PubMed

Jose, Joyce; Taylor, Aaron B; Kuhn, Richard J

2017-02-14

Sindbis virus (SINV [genus Alphavirus , family Togaviridae ]) is an enveloped, mosquito-borne virus. Alphaviruses cause cytolytic infections in mammalian cells while establishing noncytopathic, persistent infections in mosquito cells. Mosquito vector adaptation of alphaviruses is a major factor in the transmission of epidemic strains of alphaviruses. Though extensive studies have been performed on infected mammalian cells, the morphological and structural elements of alphavirus replication and assembly remain poorly understood in mosquito cells. Here we used high-resolution live-cell imaging coupled with single-particle tracking and electron microscopy analyses to delineate steps in the alphavirus life cycle in both the mammalian host cell and insect vector cells. Use of dually labeled SINV in conjunction with cellular stains enabled us to simultaneously determine the spatial and temporal differences of alphavirus replication complexes (RCs) in mammalian and insect cells. We found that the nonstructural viral proteins and viral RNA in RCs exhibit distinct spatial organization in mosquito cytopathic vacuoles compared to replication organelles from mammalian cells. We show that SINV exploits filopodial extensions for virus dissemination in both cell types. Additionally, we propose a novel mechanism for replication complex formation around glycoprotein-containing vesicles in mosquito cells that produced internally released particles that were seen budding from the vesicles by live imaging. Finally, by characterizing mosquito cell lines that were persistently infected with fluorescent virus, we show that the replication and assembly machinery are highly modified, and this allows continuous production of alphaviruses at reduced levels. IMPORTANCE Reemerging mosquito-borne alphaviruses cause serious human epidemics worldwide. Several structural and imaging studies have helped to define the life cycle of alphaviruses in mammalian cells, but the mode of virus replication and assembly in the invertebrate vector and mechanisms producing two disease outcomes in two types of cells are yet to be identified. Using transmission electron microscopy and live-cell imaging with dual fluorescent protein-tagged SINV, we show that while insect and mammalian cells display similarities in entry and exit, they present distinct spatial and temporal organizations in virus replication and assembly. By characterizing acutely and persistently infected cells, we provide new insights into alphavirus replication and assembly in two distinct hosts, resulting in high-titer virus production in mammalian cells and continuous virus production at reduced levels in mosquito cells-presumably a prerequisite for alphavirus maintenance in nature. Copyright © 2017 Jose et al.

[Construction and Function Verification of a Novel Shuttle Vector Containing a Marker Gene Self-deletion System].

PubMed

Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi

2015-09-01

For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.

Focal expression of mutated tau in entorhinal cortex neurons of rats impairs spatial working memory.

PubMed

Ramirez, Julio J; Poulton, Winona E; Knelson, Erik; Barton, Cole; King, Michael A; Klein, Ronald L

2011-01-01

Entorhinal cortex neuropathology begins very early in Alzheimer's disease (AD), a disorder characterized by severe memory disruption. Indeed, loss of entorhinal volume is predictive of AD and two of the hallmark neuroanatomical markers of AD, amyloid plaques and neurofibrillary tangles (NFTs), are particularly prevalent in the entorhinal area of AD-afflicted brains. Gene transfer techniques were used to create a model neurofibrillary tauopathy by injecting a recombinant adeno-associated viral vector with a mutated human tau gene (P301L) into the entorhinal cortex of adult rats. The objective of the present investigation was to determine whether adult onset, spatially restricted tauopathy could be sufficient to reproduce progressive deficits in mnemonic function. Spatial memory on a Y-maze was tested for approximately 3 months post-surgery. Upon completion of behavioral testing the brains were assessed for expression of human tau and evidence of tauopathy. Rats injected with the tau vector became persistently impaired on the task after about 6 weeks of postoperative testing, whereas the control rats injected with a green fluorescent protein vector performed at criterion levels during that period. Histological analysis confirmed the presence of hyperphosphorylated tau and NFTs in the entorhinal cortex and neighboring retrohippocampal areas as well as limited synaptic degeneration of the perforant path. Thus, highly restricted vector-induced tauopathy in retrohippocampal areas is sufficient for producing progressive impairment in mnemonic ability in rats, successfully mimicking a key aspect of tauopathies such as AD. Copyright © 2010 Elsevier B.V. All rights reserved.

Direct comparison of administration routes for AAV8-mediated ocular gene therapy.

PubMed

Igarashi, Tsutomu; Miyake, Koichi; Asakawa, Nagisa; Miyake, Noriko; Shimada, Takashi; Takahashi, Hiroshi

2013-05-01

We recently demonstrated that direct subretinal (SR) injection of adeno-associated virus (AAV) type 8 (AAV8) into photoreceptor cells and retinal pigment epithelium (RPE) is a highly efficient model of gene delivery. The current study compared transduction efficiency and expression patterns associated with various routes of vector administration. The efficacy of intravitreal (VT), SR and subconjunctival (SC) injections for delivery of AAV8-derived vectors, i.e. those expressing luciferase (Luc) and enhanced green fluorescent protein (GFP) - AAV8/Luc and AAV8/GFP, respectively - were compared in an animal (mouse) model (n = 8 mice/group). Transduction efficiency and expression patterns were examined at post-injection weeks 1 and 2, and months 1, 3, 6 and 12 via in vivo imaging. One year after AAV injection, AAV8/Luc-treated mice exhibited stable and sustained high expression of vector in the VT and SR groups, but not in the SC group (VT:SR:SC = 3,218:2,923:115; 1 × 10(5 )photons/s). Histological analysis showed that GFP expression was observed in the inner retina of VT group mice, and in photoreceptor cells and RPE of SR group mice, whereas no GFP expression was noted in the SC group. Electroretinography (ERG) revealed adverse effects following SR delivery. Results suggest that both SR and VT injections of AAV8 vectors are useful routes for administering ocular gene therapy, and stress the importance of selecting an appropriate administration route, i.e. one that targets specific cells, for treating ocular disorders.

AAV-mediated RLBP1 gene therapy improves the rate of dark adaptation in Rlbp1 knockout mice

PubMed Central

Choi, Vivian W; Bigelow, Chad E; McGee, Terri L; Gujar, Akshata N; Li, Hui; Hanks, Shawn M; Vrouvlianis, Joanna; Maker, Michael; Leehy, Barrett; Zhang, Yiqin; Aranda, Jorge; Bounoutas, George; Demirs, John T; Yang, Junzheng; Ornberg, Richard; Wang, Yu; Martin, Wendy; Stout, Kelly R; Argentieri, Gregory; Grosenstein, Paul; Diaz, Danielle; Turner, Oliver; Jaffee, Bruce D; Police, Seshidhar R; Dryja, Thaddeus P

2015-01-01

Recessive mutations in RLBP1 cause a form of retinitis pigmentosa in which the retina, before its degeneration leads to blindness, abnormally slowly recovers sensitivity after exposure to light. To develop a potential gene therapy for this condition, we tested multiple recombinant adeno-associated vectors (rAAVs) composed of different promoters, capsid serotypes, and genome conformations. We generated rAAVs in which sequences from the promoters of the human RLBP1, RPE65, or BEST1 genes drove the expression of a reporter gene (green fluorescent protein). A promoter derived from the RLBP1 gene mediated expression in the retinal pigment epithelium and Müller cells (the intended target cell types) at qualitatively higher levels than in other retinal cell types in wild-type mice and monkeys. With this promoter upstream of the coding sequence of the human RLBP1 gene, we compared the potencies of vectors with an AAV2 versus an AAV8 capsid in transducing mouse retinas, and we compared vectors with a self-complementary versus a single-stranded genome. The optimal vector (scAAV8-pRLBP1-hRLBP1) had serotype 8 capsid and a self-complementary genome. Subretinal injection of scAAV8-pRLBP1-hRLBP1 in Rlbp1 nullizygous mice improved the rate of dark adaptation based on scotopic (rod-plus-cone) and photopic (cone) electroretinograms (ERGs). The effect was still present after 1 year. PMID:26199951

Fluorescent genetic barcoding in mammalian cells for enhanced multiplexing capabilities in flow cytometry.

PubMed

Smurthwaite, Cameron A; Hilton, Brett J; O'Hanlon, Ryan; Stolp, Zachary D; Hancock, Bryan M; Abbadessa, Darin; Stotland, Aleksandr; Sklar, Larry A; Wolkowicz, Roland

2014-01-01

The discovery of the green fluorescent protein from Aequorea victoria has revolutionized the field of cell and molecular biology. Since its discovery a growing panel of fluorescent proteins, fluorophores and fluorescent-coupled staining methodologies, have expanded the analytical capabilities of flow cytometry. Here, we exploit the power of genetic engineering to barcode individual cells with genes encoding fluorescent proteins. For genetic engineering, we utilize retroviral technology, which allows for the expression of ectopic genetic information in a stable manner in mammalian cells. We have genetically barcoded both adherent and nonadherent cells with different fluorescent proteins. Multiplexing power was increased by combining both the number of distinct fluorescent proteins, and the fluorescence intensity in each channel. Moreover, retroviral expression has proven to be stable for at least a 6-month period, which is critical for applications such as biological screens. We have shown the applicability of fluorescent barcoded multiplexing to cell-based assays that rely themselves on genetic barcoding, or on classical staining protocols. Fluorescent genetic barcoding gives the cell an inherited characteristic that distinguishes it from its counterpart. Once cell lines are developed, no further manipulation or staining is required, decreasing time, nonspecific background associated with staining protocols, and cost. The increasing number of discovered and/or engineered fluorescent proteins with unique absorbance/emission spectra, combined with the growing number of detection devices and lasers, increases multiplexing versatility, making fluorescent genetic barcoding a powerful tool for flow cytometry-based analysis. © 2013 International Society for Advancement of Cytometry.

Incomplete proteasomal degradation of green fluorescent proteins in the context of tandem fluorescent protein timers

PubMed Central

Khmelinskii, Anton; Meurer, Matthias; Ho, Chi-Ting; Besenbeck, Birgit; Füller, Julia; Lemberg, Marius K.; Bukau, Bernd; Mogk, Axel; Knop, Michael

2016-01-01

Tandem fluorescent protein timers (tFTs) report on protein age through time-dependent change in color, which can be exploited to study protein turnover and trafficking. Each tFT, composed of two fluorescent proteins (FPs) that differ in maturation kinetics, is suited to follow protein dynamics within a specific time range determined by the maturation rates of both FPs. So far, tFTs have been constructed by combining slower-maturing red fluorescent proteins (redFPs) with the faster-maturing superfolder green fluorescent protein (sfGFP). Toward a comprehensive characterization of tFTs, we compare here tFTs composed of different faster-maturing green fluorescent proteins (greenFPs) while keeping the slower-maturing redFP constant (mCherry). Our results indicate that the greenFP maturation kinetics influences the time range of a tFT. Moreover, we observe that commonly used greenFPs can partially withstand proteasomal degradation due to the stability of the FP fold, which results in accumulation of tFT fragments in the cell. Depending on the order of FPs in the timer, incomplete proteasomal degradation either shifts the time range of the tFT toward slower time scales or precludes its use for measurements of protein turnover. We identify greenFPs that are efficiently degraded by the proteasome and provide simple guidelines for the design of new tFTs. PMID:26609072

Hyperspectral Imaging and Spectroscopy of Fluorescently Coupled Acyl-CoA: Cholesterol Acyltransferase in Insect Cells

NASA Technical Reports Server (NTRS)

Malak, H.; Mahtani, H.; Herman, P.; Vecer, J.; Lu, X.; Chang, T. Y.; Richmond, Robert C.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

A high-performance hyperspectral imaging module with high throughput of light suitable for low-intensity fluorescence microscopic imaging and subsequent analysis, including single-pixel-defined emission spectroscopy, was tested on Sf21 insect cells expressing green fluorescence associated with recombinant green fluorescent protein linked or not with the membrane protein acyl-CoA:cholesterol acyltransferase. The imager utilized the phenomenon of optical activity as a new technique providing information over a spectral range of 220-1400 nm, and was inserted between the microscope and an 8-bit CCD video-rate camera. The resulting fluorescence image did not introduce observable image aberrations. The images provided parallel acquisition of well resolved concurrent spatial and spectral information such that fluorescence associated with green fluorescent protein alone was demonstrated to be diffuse within the Sf21 insect cell, and that green fluorescence associated with the membrane protein was shown to be specifically concentrated within regions of the cell cytoplasm. Emission spectra analyzed from different regions of the fluorescence image showed blue shift specific for the regions of concentration associated with the membrane protein.

Photoconversion in orange and red fluorescent proteins

PubMed Central

Kremers, Gert-Jan; Hazelwood, Kristin L.; Murphy, Christopher S.; Davidson, Michael W.; Piston, David W.

2009-01-01

We report that photoconversion is fairly common among orange and red fluorescent proteins, as a screen of 12 variants yielded 8 that exhibit photoconversion. Specifically, three red fluorescent proteins can be switched into a green state, and two orange variants can be photoconverted to the far red. The orange highlighters are ideal for dual-probe highlighter applications, and they exhibit the most red-shifted excitation of all fluorescent protein described to date. PMID:19363494

Photocontrollable Fluorescent Proteins for Superresolution Imaging

PubMed Central

Shcherbakova, Daria M.; Sengupta, Prabuddha; Lippincott-Schwartz, Jennifer; Verkhusha, Vladislav V.

2014-01-01

Superresolution fluorescence microscopy permits the study of biological processes at scales small enough to visualize fine subcellular structures that are unresolvable by traditional diffraction-limited light microscopy. Many superresolution techniques, including those applicable to live cell imaging, utilize genetically encoded photocontrollable fluorescent proteins. The fluorescence of these proteins can be controlled by light of specific wavelengths. In this review, we discuss the biochemical and photophysical properties of photocontrollable fluorescent proteins that are relevant to their use in superresolution microscopy. We then describe the recently developed photoactivatable, photoswitchable, and reversibly photoswitchable fluorescent proteins, and we detail their particular usefulness in single-molecule localization–based and nonlinear ensemble–based superresolution techniques. Finally, we discuss recent applications of photocontrollable proteins in superresolution imaging, as well as how these applications help to clarify properties of intracellular structures and processes that are relevant to cell and developmental biology, neuroscience, cancer biology and biomedicine. PMID:24895855

Effect of pH on the Heat-Induced Denaturation and Renaturation of Green Fluorescent Protein: A Laboratory Experiment

ERIC Educational Resources Information Center

Flores, Rosa V.; Sola, Hilda M.; Torres, Juan C.; Torres, Rafael E.; Guzman, Ernick E.

2013-01-01

A fluorescence spectroscopy experiment is described where students integrated biochemistry and instrumental analysis, while characterizing the green fluorescent protein excitation and emission spectra in terms of its phenolic and phenolate chromophores. Students studied the combined effect of pH and temperature on the protein's fluorescence,…

Robo-Lector - a novel platform for automated high-throughput cultivations in microtiter plates with high information content.

PubMed

Huber, Robert; Ritter, Daniel; Hering, Till; Hillmer, Anne-Kathrin; Kensy, Frank; Müller, Carsten; Wang, Le; Büchs, Jochen

2009-08-01

In industry and academic research, there is an increasing demand for flexible automated microfermentation platforms with advanced sensing technology. However, up to now, conventional platforms cannot generate continuous data in high-throughput cultivations, in particular for monitoring biomass and fluorescent proteins. Furthermore, microfermentation platforms are needed that can easily combine cost-effective, disposable microbioreactors with downstream processing and analytical assays. To meet this demand, a novel automated microfermentation platform consisting of a BioLector and a liquid-handling robot (Robo-Lector) was sucessfully built and tested. The BioLector provides a cultivation system that is able to permanently monitor microbial growth and the fluorescence of reporter proteins under defined conditions in microtiter plates. Three examplary methods were programed on the Robo-Lector platform to study in detail high-throughput cultivation processes and especially recombinant protein expression. The host/vector system E. coli BL21(DE3) pRhotHi-2-EcFbFP, expressing the fluorescence protein EcFbFP, was hereby investigated. With the method 'induction profiling' it was possible to conduct 96 different induction experiments (varying inducer concentrations from 0 to 1.5 mM IPTG at 8 different induction times) simultaneously in an automated way. The method 'biomass-specific induction' allowed to automatically induce cultures with different growth kinetics in a microtiter plate at the same biomass concentration, which resulted in a relative standard deviation of the EcFbFP production of only +/- 7%. The third method 'biomass-specific replication' enabled to generate equal initial biomass concentrations in main cultures from precultures with different growth kinetics. This was realized by automatically transferring an appropiate inoculum volume from the different preculture microtiter wells to respective wells of the main culture plate, where subsequently similar growth kinetics could be obtained. The Robo-Lector generates extensive kinetic data in high-throughput cultivations, particularly for biomass and fluorescence protein formation. Based on the non-invasive on-line-monitoring signals, actions of the liquid-handling robot can easily be triggered. This interaction between the robot and the BioLector (Robo-Lector) combines high-content data generation with systematic high-throughput experimentation in an automated fashion, offering new possibilities to study biological production systems. The presented platform uses a standard liquid-handling workstation with widespread automation possibilities. Thus, high-throughput cultivations can now be combined with small-scale downstream processing techniques and analytical assays. Ultimately, this novel versatile platform can accelerate and intensify research and development in the field of systems biology as well as modelling and bioprocess optimization.

LucY: A Versatile New Fluorescent Reporter Protein

PubMed Central

Auldridge, Michele E.; Franz, Laura P.; Bingman, Craig A.; Yennamalli, Ragothaman M.; Phillips, George N.; Mead, David; Steinmetz, Eric J.

2015-01-01

We report on the discovery, isolation, and use of a novel yellow fluorescent protein. Lucigen Yellow (LucY) binds one FAD molecule within its core, thus shielding it from water and maintaining its structure so that fluorescence is 10-fold higher than freely soluble FAD. LucY displays excitation and emission spectra characteristic of FAD, with 3 excitation peaks at 276nm, 377nm, and 460nm and a single emission peak at 530nm. These excitation and emission maxima provide the large Stokes shift beneficial to fluorescence experimentation. LucY belongs to the MurB family of UDP-N-acetylenolpyruvylglucosamine reductases. The high resolution crystal structure shows that in contrast to other structurally resolved MurB enzymes, LucY does not contain a potentially quenching aromatic residue near the FAD isoalloxazine ring, which may explain its increased fluorescence over related proteins. Using E. coli as a system in which to develop LucY as a reporter, we show that it is amenable to circular permutation and use as a reporter of protein-protein interaction. Fragmentation between its distinct domains renders LucY non-fluorescent, but fluorescence can be partially restored by fusion of the fragments to interacting protein domains. Thus, LucY may find application in Protein-fragment Complementation Assays for evaluating protein-protein interactions. PMID:25906065

LucY: A Versatile New Fluorescent Reporter Protein.

PubMed

Auldridge, Michele E; Cao, Hongnan; Sen, Saurabh; Franz, Laura P; Bingman, Craig A; Yennamalli, Ragothaman M; Phillips, George N; Mead, David; Steinmetz, Eric J

2015-01-01

We report on the discovery, isolation, and use of a novel yellow fluorescent protein. Lucigen Yellow (LucY) binds one FAD molecule within its core, thus shielding it from water and maintaining its structure so that fluorescence is 10-fold higher than freely soluble FAD. LucY displays excitation and emission spectra characteristic of FAD, with 3 excitation peaks at 276 nm, 377 nm, and 460 nm and a single emission peak at 530 nm. These excitation and emission maxima provide the large Stokes shift beneficial to fluorescence experimentation. LucY belongs to the MurB family of UDP-N-acetylenolpyruvylglucosamine reductases. The high resolution crystal structure shows that in contrast to other structurally resolved MurB enzymes, LucY does not contain a potentially quenching aromatic residue near the FAD isoalloxazine ring, which may explain its increased fluorescence over related proteins. Using E. coli as a system in which to develop LucY as a reporter, we show that it is amenable to circular permutation and use as a reporter of protein-protein interaction. Fragmentation between its distinct domains renders LucY non-fluorescent, but fluorescence can be partially restored by fusion of the fragments to interacting protein domains. Thus, LucY may find application in Protein-fragment Complementation Assays for evaluating protein-protein interactions.

LucY: A versatile new fluorescent reporter protein

DOE PAGES

Auldridge, Michele E.; Cao, Hongnan; Sen, Saurabh; ...

2015-04-23

We report on the discovery, isolation, and use of a novel yellow fluorescent protein. Lucigen Yellow (LucY) binds one FAD molecule within its core, thus shielding it from water and maintaining its structure so that fluorescence is 10-fold higher than freely soluble FAD. LucY displays excitation and emission spectra characteristic of FAD, with 3 excitation peaks at 276nm, 377nm, and 460nm and a single emission peak at 530nm. These excitation and emission maxima provide the large Stokes shift beneficial to fluorescence experimentation. LucY belongs to the MurB family of UDP-N-acetylenolpyruvylglucosamine reductases. The high resolution crystal structure shows that in contrastmore » to other structurally resolved MurB enzymes, LucY does not contain a potentially quenching aromatic residue near the FAD isoalloxazine ring, which may explain its increased fluorescence over related proteins. Using E. coli as a system in which to develop LucY as a reporter, we show that it is amenable to circular permutation and use as a reporter of protein-protein interaction. Fragmentation between its distinct domains renders LucY non-fluorescent, but fluorescence can be partially restored by fusion of the fragments to interacting protein domains. Thus, LucY may find application in Protein-fragment Complementation Assays for evaluating protein-protein interactions.« less

Synthesis, depletion and cell-type expression of a protein from the male accessory glands of the dengue vector mosquito Aedes aegypti

PubMed Central

Alfonso-Parra, Catalina; Avila, Frank W.; Deewatthanawong, Prasit; Sirot, Laura K.; Wolfner, Mariana F.; Harrington, Laura C.

2014-01-01

Aedes aegypti males transfer sperm and seminal fluid proteins (Sfps), primarily produced by male accessory glands (AGs), to females during mating. When collectively injected or transplanted into females, AG tissues and/or seminal fluid homogenates have profound effects on Aedes female physiology and behavior. To identify targets and design new strategies for vector control, it is important to understand the biology of the AGs. Thus, we examined characteristics of AG secretion and development in Ae. aegypti, using the AG-specific seminal fluid protein, AAEL010824, as a marker. We showed that AAEL010824 is first detectable by 12h post-eclosion, and increases in amount over the first 3 days of adult life. We then showed that the amount of AAEL0010824 in the AG decreases after mating, with each successive mating depleting it further; by 5 successive matings with no time for recovery, its levels are very low. AAEL010824 levels in a depleted male are replenished by 48hr post-mating. In addition to examining the level of AAEL010824 protein, we also characterized the expression of its gene. We did this by making a transgenic mosquito line that carries an Enhanced Green Fluorescence Protein (EGFP) fused to the AAEL0010824 promoter that we defined here. We showed that AAEL010824 is expressed in the anterior cells of the accessory glands, and that its RNA levels also respond to mating. In addition to further characterizing AAEL010824 expression, our results with the EGFP fusion provide a promoter for driving AG expression. By providing this information on the biology of an important male reproductive tissue and the production of one of its seminal proteins, our results lay the foundation for future work aimed at identifying novel targets for mosquito population control. PMID:25107876

Nucleic acid encoding a self-assembling split-fluorescent protein system

DOEpatents

Waldo, Geoffrey S.; Cabantous, Stephanie

2014-04-01

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Nucleic acid encoding a self-assembling split-fluorescent protein system

DOEpatents

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2011-06-07

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Nucleic acid encoding a self-assembling split-fluorescent protein system

DOEpatents

Waldo, Geoffrey S.; Cabantous, Stephanie

2015-07-14

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Expression of fluorescently tagged connexins: a novel approach to rescue function of oligomeric DsRed-tagged proteins.

PubMed

Lauf, U; Lopez, P; Falk, M M

2001-06-01

A novel, brilliantly red fluorescent protein, DsRed has become available recently opening up a wide variety of experimental opportunities for double labeling and fluorescence resonance electron transfer experiments in combination with green fluorescent protein (GFP). Unlike in the case of GFP, proteins tagged with DsRed were often found to aggregate within the cell. Here we report a simple method that allows rescuing the function of an oligomeric protein tagged with DsRed. We demonstrate the feasibility of this approach on the subunit proteins of an oligomeric membrane channel, gap junction connexins. Additionally, DsRed fluorescence was easily detected 12-16 h post transfection, much earlier than previously reported, and could readily be differentiated from co-expressed GFP. Thus, this approach can eliminate the major drawbacks of this highly attractive autofluorescent protein.

Efficient and stable expression of GFP through Wheat streak mosaic virus-based vectors in cereal hosts using a range of cleavage sites: Formation of dense fluorescent aggregates for sensitive virus tracking

USDA-ARS?s Scientific Manuscript database

A series of Wheat streak mosaic virus (WSMV)-based expression vectors were developed by engineering cycle 3 GFP (GFP) cistron between P1 and HC-Pro cistrons with several catalytic/cleavage peptides at the C-terminus of GFP. WSMV-GFP vectors with the Foot-and-mouth disease virus 1D/2A or 2A catalytic...

Localization-based super-resolution imaging of cellular structures.

PubMed

Kanchanawong, Pakorn; Waterman, Clare M

2013-01-01

Fluorescence microscopy allows direct visualization of fluorescently tagged proteins within cells. However, the spatial resolution of conventional fluorescence microscopes is limited by diffraction to ~250 nm, prompting the development of super-resolution microscopy which offers resolution approaching the scale of single proteins, i.e., ~20 nm. Here, we describe protocols for single molecule localization-based super-resolution imaging, using focal adhesion proteins as an example and employing either photoswitchable fluorophores or photoactivatable fluorescent proteins. These protocols should also be easily adaptable to imaging a broad array of macromolecular assemblies in cells whose components can be fluorescently tagged and assemble into high density structures.

Common fluorescent proteins for single-molecule localization microscopy

NASA Astrophysics Data System (ADS)

Klementieva, Natalia V.; Bozhanova, Nina G.; Mishina, Natalie M.; Zagaynova, Elena V.; Lukyanov, Konstantin A.; Mishin, Alexander S.

2015-07-01

Super-resolution techniques for breaking the diffraction barrier are spread out over multiple studies nowadays. Single-molecule localization microscopy such as PALM, STORM, GSDIM, etc allow to get super-resolved images of cell ultrastructure by precise localization of individual fluorescent molecules via their temporal isolation. However, these methods are supposed the use of fluorescent dyes and proteins with special characteristics (photoactivation/photoconversion). At the same time, there is a need for retaining high photostability of fluorophores during long-term acquisition. Here, we first showed the potential of common red fluorescent protein for single-molecule localization microscopy based on spontaneous intrinsic blinking. Also, we assessed the effect of different imaging media on photobleaching of these fluorescent proteins. Monomeric orange and red fluorescent proteins were examined for stochastic switching from a dark state to a bright fluorescent state. We studied fusions with cytoskeletal proteins in NIH/3T3 and HeLa cells. Imaging was performed on the Nikon N-STORM system equipped with EMCCD camera. To define the optimal imaging conditions we tested several types of cell culture media and buffers. As a result, high-resolution images of cytoskeleton structure were obtained. Essentially, low-intensity light was sufficient to initiate the switching of tested red fluorescent protein reducing phototoxicity and provide long-term live-cell imaging.

Salicylic acid interferes with GFP fluorescence in vivo.

PubMed

de Jonge, Jennifer; Hofius, Daniel; Hennig, Lars

2017-03-01

Fluorescent proteins have become essential tools for cell biologists. They are routinely used by plant biologists for protein and promoter fusions to infer protein localization, tissue-specific expression and protein abundance. When studying the effects of biotic stress on chromatin, we unexpectedly observed a decrease in GFP signal intensity upon salicylic acid (SA) treatment in Arabidopsis lines expressing histone H1-GFP fusions. This GFP signal decrease was dependent on SA concentration. The effect was not specific to the linker histone H1-GFP fusion but was also observed for the nucleosomal histone H2A-GFP fusion. This result prompted us to investigate a collection of fusion proteins, which included different promoters, subcellular localizations and fluorophores. In all cases, fluorescence signals declined strongly or disappeared after SA application. No changes were detected in GFP-fusion protein abundance when fluorescence signals were lost indicating that SA does not interfere with protein stability but GFP fluorescence. In vitro experiments showed that SA caused GFP fluorescence reduction only in vivo but not in vitro, suggesting that SA requires cellular components to cause fluorescence reduction. Together, we conclude that SA can interfere with the fluorescence of various GFP-derived reporter constructs in vivo. Assays that measure relocation or turnover of GFP-tagged proteins upon SA treatment should therefore be evaluated with caution. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Avidin-Based Targeting and Purification of a Protein IX-Modified, Metabolically Biotinylated Adenoviral Vector

PubMed Central

Campos, Samuel K.; Parrott, M. Brandon; Barry, Michael A.

2014-01-01

While genetic modification of adenoviral vectors can produce vectors with modified tropism, incorporation of targeting peptides/proteins into the structural context of the virion can also result in destruction of ligand targeting or virion integrity. To combat this problem, we have developed a versatile targeting system using metabolically biotinylated adenoviral vectors bearing biotinylated fiber proteins. These vectors have been demonstrated to be useful as a platform for avidin-based ligand screening and vector targeting by conjugating biotinylated ligands to the virus using high-affinity tetrameric avidin (Kd = 10−15 M). The biotinylated vector could also be purified by biotin-reversible binding on monomeric avidin (Kd = 10−7 M). In this report, a second metabolically biotinylated adenovirus vector, Ad-IX-BAP, has been engineered by fusing a biotin acceptor peptide (BAP) to the C-terminus of the adenovirus pIX protein. This biotinylated vector displays twice as many biotins and was markedly superior for single-step affinity purification on monomeric avidin resin. However, unlike the fiber-biotinylated vector, Ad-IX-BAP failed to retarget to cells with biotinylated antibodies including anti-CD71 against the transferrin receptor. In contrast, Ad-IX-BAP was retargeted if transferrin, the cognate ligand for CD71, was used as a ligand rather than the anti-CD71. This work demonstrates the utility of metabolic biotinylation as a molecular screening tool to assess the utility of different viral capsid proteins for ligand display and the biology and compatibility of different ligands and receptors for vector targeting applications. These results also demonstrate the utility of the pIX-biotinylated vector as a platform for gentle single-step affinity purification of adenoviral vectors. PMID:15194061

Genetically encoded fluorescent tags

PubMed Central

Thorn, Kurt

2017-01-01

Genetically encoded fluorescent tags are protein sequences that can be fused to a protein of interest to render it fluorescent. These tags have revolutionized cell biology by allowing nearly any protein to be imaged by light microscopy at submicrometer spatial resolution and subsecond time resolution in a live cell or organism. They can also be used to measure protein abundance in thousands to millions of cells using flow cytometry. Here I provide an introduction to the different genetic tags available, including both intrinsically fluorescent proteins and proteins that derive their fluorescence from binding of either endogenous or exogenous fluorophores. I discuss their optical and biological properties and guidelines for choosing appropriate tags for an experiment. Tools for tagging nucleic acid sequences and reporter molecules that detect the presence of different biomolecules are also briefly discussed. PMID:28360214

Structural analysis and insertion study reveal the ideal sites for surface displaying foreign peptides on a betanodavirus-like particle.

PubMed

Xie, Junfeng; Li, Kunpeng; Gao, Yuanzhu; Huang, Runqing; Lai, Yuxiong; Shi, Yan; Yang, Shaowei; Zhu, Guohua; Zhang, Qinfen; He, Jianguo

2016-01-11

Betanodavirus infection causes fatal disease of viral nervous necrosis in many cultured marine and freshwater fish worldwide and the virus-like particles (VLP) are effective vaccines against betanodavirus. But vaccine and viral vector designs of betanodavirus VLP based on their structures remain lacking. Here, the three-dimensional structure of orange-spotted grouper nervous necrosis virus (OGNNV) VLP (RBS) at 3.9 Å reveals the organization of capsid proteins (CP). Based on the structural results, seven putative important sites were selected to genetically insert a 6× histidine (His)-tag for VLP formation screen, resulting in four His-tagged VLP (HV) at positions N-terminus, Ala220, Pro292 and C-terminus. The His-tags of N-terminal HV (NHV) were concealed inside virions while those of 220HV and C-terminal HV (CHV) were displayed at the outer surface. NHV, 220HV and CHV maintained the same cell entry ability as RBS in the Asian sea bass (SB) cell line, indicating that their similar surface structures can be recognized by the cellular entry receptor(s). For application of vaccine design, chromatography-purified CHV could provoke NNV-specific antibody responses as strong as those of RBS in a sea bass immunization assay. Furthermore, in carrying capacity assays, N-terminus and Ala220 can only carry short peptides and C-terminus can even accommodate large protein such as GFP to generate fluorescent VLP (CGV). For application of a viral vector, CGV could be real-time visualized to enter SB cells in invasion study. All the results confirmed that the C-terminus of CP is a suitable site to accommodate foreign peptides for vaccine design and viral vector development.

Adeno-associated virus (AAV)-3-based vectors transduce haematopoietic cells not susceptible to transduction with AAV-2-based vectors.

PubMed

Handa, A; Muramatsu, S; Qiu, J; Mizukami, H; Brown, K E

2000-08-01

Although adeno-associated virus (AAV)-2 has a broad tissue-host range and can transduce a wide variety of tissue types, some cells, such as erythro-megakaryoblastoid cells, are non-permissive and appear to lack the AAV-2 receptor. However, limited studies have been reported with the related dependovirus AAV-3. We have previously cloned this virus, characterized its genome and produced an infectious clone. In this study, the gene for green fluorescent protein (GFP) was inserted into AAV-2- and AAV-3-based plasmids and recombinant viruses were produced. These viruses were then used to transduce haematopoietic cells and the transduction efficiencies were compared. In contrast to recombinant (r) AAV-2, rAAV-3 successfully transduced erythroid and megakaryoblastoid cells, although rAAV-2 was superior in transduction of lymphocyte-derived cell lines. Recently, it was reported that heparan sulphate can act as a receptor of AAV-2. The infectivity of rAAV-2 and rAAV-3 was tested with mutant cell lines of Chinese hamster ovary cells that were defective for heparin or heparan sulphate expression on the cell surface. There was no correlation between the ability of rAAV-2 or rAAV-3 to infect cells and the cell surface expression of heparan sulphate and, although heparin blocked both rAAV-2 and rAAV-3 transduction, the ID(50) of rAAV-3 was higher than that of rAAV-2. In addition, virus-binding overlay assays indicated that AAV-2 and AAV-3 bound different membrane proteins. These results suggest not only that there are different cellular receptors for AAV-2 and AAV-3, but that rAAV-3 vectors may be preferred for transduction of some haematopoietic cell types.

Adenoviral modification of mouse brain derived endothelial cells, bEnd3, to induce apoptosis by vascular endothelial growth factor.

PubMed

Mitsuuchi, Y; Powell, D R; Gallo, J M

2006-02-09

A second generation genetically-engineered cell-based drug delivery system, referred to as apoptotic-induced drug delivery (AIDD), was developed using endothelial cells (ECs) that undergo apoptosis upon binding of vascular endothelial growth factor (VEGF) to a Flk-1:Fas fusion protein (FF). This new AIDD was redesigned using mouse brain derived ECs, bEnd3 cells, and an adenovirus vector in order to enhance and control the expression of FF. The FF was tagged with a HA epitope (FFHA) and designed to be coexpressed with green fluorescence protein (GFP) by the regulation of cytomegalovirus promoters in the adenovirus vector. bEnd3 cells showed favorable coexpression of FFHA and GFP consistent with the multiplicity of infection of the adenovirus. Immunofluorescence analysis demonstrated that FFHA was localized at the plasma membrane, whereas GFP was predominantly located in the cytoplasm of ECs. Cell death was induced by VEGF, but not by platelet derived growth factor or fibroblast growth factor in a dose-dependent manner (range 2-20 ng/ml), and revealed caspase-dependent apoptotic profiles. The FFHA expressing bEnd3 cells underwent apoptosis when cocultured with a glioma cell (SF188V+) line able to overexpress VEGF. The combined data indicated that the FFHA adenovirus system can induce apoptotic signaling in ECs in response to VEGF, and thus, is an instrumental modification to the development of AIDD.

In vitro non-viral murine pro-neurotrophin 3 gene transfer into rat bone marrow stromal cells.

PubMed

Darabi, Shahram; Tiraihi, Taki; Delshad, AliReza; Sadeghizadeh, Majid; Khalil, Wisam; Taheri, Taher

2017-04-15

Neurotrophin 3 (NT-3) is an important factor for promoting prenatal neural development, as well as regeneration, axogenesis and plasticity in postnatal life. Therapy with NT-3 was reported to improve the condition of patients suffering from degenerative diseases and traumatic injuries, however, the disadvantage of NT-3 protein delivery is its short half-life, thus our alternative approach is the use of NT-3 gene therapy. In this study, the bone marrow stromal cells (BMSCs) were isolated from adult rats, cultured for 4 passages and transfected with either pEGFP-N1 or a constructed vector containing murine proNT-3 (pSecTag2/HygroB-murine proNT-3) using Lipofectamine 2000 followed by Hygromycin B (200mg/kg). The transfection efficiency of the transiently transfected BMSCs was evaluated using the green fluorescence protein containing vector (pEGFP-N1). A quantitative evaluation of the NT-3 expression of mRNA using real time qRT-PCR shows that there was double fold increase in NT-3 gene expression compared with non-transfected BMSCs, also, the culture supernatant yielded double fold increase in NT-3 using ELISA technique, the data were supported by immunoblotting technique. This suggests that the use of this transfection technique can be useful for gene therapy in different neurological disorders with neurodegenerative or traumatic origins. Copyright © 2017 Elsevier B.V. All rights reserved.

A recombinant rabies virus carrying GFP between N and P affects viral transcription in vitro.

PubMed

Luo, Jun; Zhao, Jing; Tian, Qin; Mo, Weiyu; Wang, Yifei; Chen, Hao; Guo, Xiaofeng

2016-06-01

Several studies have demonstrated the rabies virus to be a perfect potential vaccine vector to insert foreign genes into the target genome. For this study, a green fluorescent protein (GFP) gene was cloned into the rabies virus (RABV) genome between the N and P gene. CT dinucleotide was inserted as intergenic region. The recombinant high egg passage Flury strain (HEP-Flury) of RABV, carrying GFP (rHEP-NP-GFP), was generated in BHK-21 cells using reverse genetics. According to the viral growth kinetics assay, the addition of GFP between N and P gene has little effect on the viral growth compared to the parental strain HEP-Flury. Quantitative real-time PCR (qPCR) indicated that rHEP-NP-GFP showed different viral gene transcription, especially for G gene, compared to HEP-Flury. The same is true for one other recombinant RABV carrying GFP between G and L gene in NA cells. In addition, parent HEP-Flury showed more expression of innate immune-related molecules in NA cells. Compared to HEP-Flury, Western blotting (WB) indicated that insertion of a foreign gene following N gene enhanced the expression of M and G proteins. According to the qPCR and WB, GFP expression levels of rHEP-NP-GFP were significantly higher than rHEP-GFP. This study indicates HEP-Flury as valid vector to express exogenous genes between N and P.

Polyethyleneimine grafted short halloysite nanotubes for gene delivery.

PubMed

Long, Zheru; Zhang, Jun; Shen, Yan; Zhou, Changren; Liu, Mingxian

2017-12-01

Inorganic nanoparticles have attracted much attentions in gene delivery because of their desirable characteristics including low toxicity, well-controlled characteristics, high gene delivery efficiency, and multi-functionalities. Here, natural occurred halloysite nanotubes (HNTs) were developed as a novel non-viral gene vector. To increase the efficiency of endocytosis, HNTs were firstly shortened into an appropriate size (~200nm). Then polyethyleneimine (PEI) was grafted onto HNTs to bind green fluorescence protein (GFP) labeled pDNA. The structure and physical-chemical properties of PEI grafted HNTs (PEI-g-HNTs) were characterized by various methods. PEI-g-HNTs show lower cytotoxicity than PEI. PEI-g-HNTs are positively charged and can bind DNA tightly at designed N/P ratio from 5:1 to 40:1. PEI-g-HNTs/pDNA complexes show much higher transfection efficiency towards both 293T and HeLa cells compared with PEI/pDNA complexes at the equivalent N/P ratio. The transfection efficiencies of PEI-g-HNTs/pDNA complex towards HeLa cell can reach to 44.4% at N/P ratio of 20. PEI-g-HNTs/pDNA complexes possess a higher GFP protein expression than PEI/pDNA from simple western immunoblots. So, PEI-g-HNTs are potential gene vectors with good biocompatibility and high transfection efficiency, which have promising applications in cancer gene therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of Plasmid Design and Type of Integration Event on Recombinant Protein Expression in Pichia pastoris.

PubMed

Vogl, Thomas; Gebbie, Leigh; Palfreyman, Robin W; Speight, Robert

2018-03-15

Pichia pastoris (syn. Komagataella phaffii ) is one of the most common eukaryotic expression systems for heterologous protein production. Expression cassettes are typically integrated in the genome to obtain stable expression strains. In contrast to Saccharomyces cerevisiae , where short overhangs are sufficient to target highly specific integration, long overhangs are more efficient in P. pastoris and ectopic integration of foreign DNA can occur. Here, we aimed to elucidate the influence of ectopic integration by high-throughput screening of >700 transformants and whole-genome sequencing of 27 transformants. Different vector designs and linearization approaches were used to mimic the most common integration events targeted in P. pastoris Fluorescence of an enhanced green fluorescent protein (eGFP) reporter protein was highly uniform among transformants when the expression cassettes were correctly integrated in the targeted locus. Surprisingly, most nonspecifically integrated transformants showed highly uniform expression that was comparable to specific integration, suggesting that nonspecific integration does not necessarily influence expression. However, a few clones (<10%) harboring ectopically integrated cassettes showed a greater variation spanning a 25-fold range, surpassing specifically integrated reference strains up to 6-fold. High-expression strains showed a correlation between increased gene copy numbers and high reporter protein fluorescence levels. Our results suggest that for comparing expression levels between strains, the integration locus can be neglected as long as a sufficient numbers of transformed strains are compared. For expression optimization of highly expressible proteins, increasing copy number appears to be the dominant positive influence rather than the integration locus, genomic rearrangements, deletions, or single-nucleotide polymorphisms (SNPs). IMPORTANCE Yeasts are commonly used as biotechnological production hosts for proteins and metabolites. In the yeast Saccharomyces cerevisiae , expression cassettes carrying foreign genes integrate highly specifically at the targeted sites in the genome. In contrast, cassettes often integrate at random genomic positions in nonconventional yeasts, such as Pichia pastoris (syn. Komagataella phaffii ). Hence, cells from the same transformation event often behave differently, with significant clonal variation necessitating the screening of large numbers of strains. The importance of this study is that we systematically investigated the influence of integration events in more than 700 strains. Our findings provide novel insight into clonal variation in P. pastoris and, thus, how to avoid pitfalls and obtain reliable results. The underlying mechanisms may also play a role in other yeasts and hence could be generally relevant for recombinant yeast protein production strains. Copyright © 2018 American Society for Microbiology.

A practical teaching course in directed protein evolution using the green fluorescent protein as a model.

PubMed

Ruller, Roberto; Silva-Rocha, Rafael; Silva, Artur; Cruz Schneider, Maria Paula; Ward, Richard John

2011-01-01

Protein engineering is a powerful tool, which correlates protein structure with specific functions, both in applied biotechnology and in basic research. Here, we present a practical teaching course for engineering the green fluorescent protein (GFP) from Aequorea victoria by a random mutagenesis strategy using error-prone polymerase chain reaction. Screening of bacterial colonies transformed with random mutant libraries identified GFP variants with increased fluorescence yields. Mapping the three-dimensional structure of these mutants demonstrated how alterations in structural features such as the environment around the fluorophore and properties of the protein surface can influence functional properties such as the intensity of fluorescence and protein solubility. Copyright © 2011 Wiley Periodicals, Inc.

Quantifying cadherin mechanotransduction machinery assembly/disassembly dynamics using fluorescence covariance analysis.

PubMed

Vedula, Pavan; Cruz, Lissette A; Gutierrez, Natasha; Davis, Justin; Ayee, Brian; Abramczyk, Rachel; Rodriguez, Alexis J

2016-06-30

Quantifying multi-molecular complex assembly in specific cytoplasmic compartments is crucial to understand how cells use assembly/disassembly of these complexes to control function. Currently, biophysical methods like Fluorescence Resonance Energy Transfer and Fluorescence Correlation Spectroscopy provide quantitative measurements of direct protein-protein interactions, while traditional biochemical approaches such as sub-cellular fractionation and immunoprecipitation remain the main approaches used to study multi-protein complex assembly/disassembly dynamics. In this article, we validate and quantify multi-protein adherens junction complex assembly in situ using light microscopy and Fluorescence Covariance Analysis. Utilizing specific fluorescently-labeled protein pairs, we quantified various stages of adherens junction complex assembly, the multiprotein complex regulating epithelial tissue structure and function following de novo cell-cell contact. We demonstrate: minimal cadherin-catenin complex assembly in the perinuclear cytoplasm and subsequent localization to the cell-cell contact zone, assembly of adherens junction complexes, acto-myosin tension-mediated anchoring, and adherens junction maturation following de novo cell-cell contact. Finally applying Fluorescence Covariance Analysis in live cells expressing fluorescently tagged adherens junction complex proteins, we also quantified adherens junction complex assembly dynamics during epithelial monolayer formation.

Highly thermostable fluorescent proteins

DOEpatents

Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

2011-11-29

Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

Highly thermostable fluorescent proteins

DOEpatents

Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

2011-03-22

Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

Highly thermostable fluorescent proteins

DOEpatents

Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

2012-05-01

Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

Quenching of Superoxide Radicals by Green Fluorescent Protein

PubMed Central

Bou-Abdallah, Fadi; Chasteen, N. Dennis; Lesser, Michael P.

2006-01-01

Green fluorescent protein (GFP) is a widely used in vivo molecular marker. These proteins are particularly resistant, and maintain function, under a variety of cellular conditions such as pH extremes and elevated temperatures. Green fluorescent proteins are also abundant in several groups of marine invertebrates including reef-forming corals. While molecular oxygen is required for the post-translational maturation of the protein, mature GFPs are found in corals where hyperoxia and reactive oxygen species (ROS) occur due to the photosynthetic activity of algal symbionts. In vitro spin trapping electron paramagnetic resonance and spectrophotometric assays of superoxide dismutase (SOD)-like enzyme activity show that wild type GFP from the hydromedusa, Aequorea victoria, quenches superoxide radicals (O2•−) and exhibits SOD-like activity by competing with cytochrome c for reaction with O2•−. When exposed to high amounts of O2•− the SOD-like activity and protein structure of GFP are altered without significant changes to the fluorescent properties of the protein. Because of the distribution of fluorescent proteins in both the epithelial and gastrodermal cells of reef-forming corals we propose that GFP, and possibly other fluorescent proteins, can provide supplementary antioxidant protection. PMID:17023114

A family of GFP-like proteins with different spectral properties in lancelet Branchiostoma floridae

PubMed Central

Baumann, Diana; Cook, Malcolm; Ma, Limei; Mushegian, Arcady; Sanders, Erik; Schwartz, Joel; Yu, C Ron

2008-01-01

Background Members of the green fluorescent protein (GFP) family share sequence similarity and the 11-stranded β-barrel fold. Fluorescence or bright coloration, observed in many members of this family, is enabled by the intrinsic properties of the polypeptide chain itself, without the requirement for cofactors. Amino acid sequence of fluorescent proteins can be altered by genetic engineering to produce variants with different spectral properties, suitable for direct visualization of molecular and cellular processes. Naturally occurring GFP-like proteins include fluorescent proteins from cnidarians of the Hydrozoa and Anthozoa classes, and from copepods of the Pontellidae family, as well as non-fluorescent proteins from Anthozoa. Recently, an mRNA encoding a fluorescent GFP-like protein AmphiGFP, related to GFP from Pontellidae, has been isolated from the lancelet Branchiostoma floridae, a cephalochordate (Deheyn et al., Biol Bull, 2007 213:95). Results We report that the nearly-completely sequenced genome of Branchiostoma floridae encodes at least 12 GFP-like proteins. The evidence for expression of six of these genes can be found in the EST databases. Phylogenetic analysis suggests that a gene encoding a GFP-like protein was present in the common ancestor of Cnidaria and Bilateria. We synthesized and expressed two of the lancelet GFP-like proteins in mammalian cells and in bacteria. One protein, which we called LanFP1, exhibits bright green fluorescence in both systems. The other protein, LanFP2, is identical to AmphiGFP in amino acid sequence and is moderately fluorescent. Live imaging of the adult animals revealed bright green fluorescence at the anterior end and in the basal region of the oral cirri, as well as weaker green signals throughout the body of the animal. In addition, red fluorescence was observed in oral cirri, extending to the tips. Conclusion GFP-like proteins may have been present in the primitive Metazoa. Their evolutionary history includes losses in several metazoan lineages and expansion in cephalochordates that resulted in the largest repertoire of GFP-like proteins known thus far in a single organism. Lancelet expresses several of its GFP-like proteins, which appear to have distinct spectral properties and perhaps diverse functions. Reviewers This article was reviewed by Shamil Sunyaev, Mikhail Matz (nominated by I. King Jordan) and L. Aravind. PMID:18598356

Impact of fluorescent protein fusions on the bacterial flagellar motor.

PubMed

Heo, M; Nord, A L; Chamousset, D; van Rijn, E; Beaumont, H J E; Pedaci, F

2017-10-03

Fluorescent fusion proteins open a direct and unique window onto protein function. However, they also introduce the risk of perturbation of the function of the native protein. Successful applications of fluorescent fusions therefore rely on a careful assessment and minimization of the side effects, but such insight is still lacking for many applications. This is particularly relevant in the study of the internal dynamics of motor proteins, where both the chemical and mechanical reaction coordinates can be affected. Fluorescent proteins fused to the stator of the Bacterial Flagellar Motor (BFM) have previously been used to unveil the motor subunit dynamics. Here we report the effects on single motors of three fluorescent proteins fused to the stators, all of which altered BFM behavior. The torque generated by individual stators was reduced while their stoichiometry remained unaffected. MotB fusions decreased the switching frequency and induced a novel bias-dependent asymmetry in the speed in the two directions. These effects could be mitigated by inserting a linker at the fusion point. These findings provide a quantitative account of the effects of fluorescent fusions to the stator on BFM dynamics and their alleviation- new insights that advance the use of fluorescent fusions to probe the dynamics of protein complexes.

The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

PubMed

Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

2014-01-24

This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

BAC-recombineering for studying plant gene regulation: developmental control and cellular localization of SnRK1 kinase subunits.

PubMed

Bitrián, Marta; Roodbarkelari, Farshad; Horváth, Mihály; Koncz, Csaba

2011-03-01

Recombineering, permitting precise modification of genes within bacterial artificial chromosomes (BACs) through homologous recombination mediated by lambda phage-encoded Red proteins, is a widely used powerful tool in mouse, Caenorhabditis and Drosophila genetics. As Agrobacterium-mediated transfer of large DNA inserts from binary BACs and TACs into plants occurs at low frequency, recombineering is so far seldom exploited in the analysis of plant gene functions. We have constructed binary plant transformation vectors, which are suitable for gap-repair cloning of genes from BACs using recombineering methods previously developed for other organisms. Here we show that recombineering facilitates PCR-based generation of precise translational fusions between coding sequences of fluorescent reporter and plant proteins using galK-based exchange recombination. The modified target genes alone or as part of a larger gene cluster can be transferred by high-frequency gap-repair into plant transformation vectors, stably maintained in Agrobacterium and transformed without alteration into plants. Versatile application of plant BAC-recombineering is illustrated by the analysis of developmental regulation and cellular localization of interacting AKIN10 catalytic and SNF4 activating subunits of Arabidopsis Snf1-related (SnRK1) protein kinase using in vivo imaging. To validate full functionality and in vivo interaction of tagged SnRK1 subunits, it is demonstrated that immunoprecipitated SNF4-YFP is bound to a kinase that phosphorylates SnRK1 candidate substrates, and that the GFP- and YFP-tagged kinase subunits co-immunoprecipitate with endogenous wild type AKIN10 and SNF4. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Dynamic imaging of protein-protein interactions by MP-FLIM

NASA Astrophysics Data System (ADS)

Ameer-Beg, Simon M.; Peter, Marion; Keppler, Melanie D.; Prag, Soren; Barber, Paul R.; Ng, Tony C.; Vojnovic, Borivoj

2005-03-01

The spatio-temporal localization of molecular interactions within cells in situ is of great importance in elucidating the key mechanisms in regulation of fundamental process within the cell. Measurements of such near-field localization of protein complexes may be achieved by the detection of fluorescence (or Forster) resonance energy transfer (FRET) between protein-conjugated fluorophores. We demonstrate the applicability of time-correlated single photon counting multiphoton microscopy to the spatio-temporal localization of protein-protein interactions in live and fixed cell populations. Intramolecular interactions between protein hetero-dimers are investigated using green fluorescent protein variants. We present an improved monomeric form of the red fluorescent protein, mRFP1, as the acceptor in biological fluorescence resonance energy transfer (FRET) experiments using the enhanced green fluorescent protein as donor. We find particular advantage in using this fluorophore pair for quantitative measurements of FRET. The technique was exploited to demonstrate a novel receptor-kinase interaction between the chemokine receptor (CXCR4) and protein kinase C (PKC) α in carcinoma cells for both live and fixed cell experiments.

On chip preconcentration and fluorescence labeling of model proteins by use of monolithic columns: device fabrication, optimization, and automation.

PubMed

Yang, Rui; Pagaduan, Jayson V; Yu, Ming; Woolley, Adam T

2015-01-01

Microfluidic systems with monolithic columns have been developed for preconcentration and on-chip labeling of model proteins. Monoliths were prepared in microchannels by photopolymerization, and their properties were optimized by varying the composition and concentration of the monomers to improve flow and extraction. On-chip labeling of proteins was achieved by driving solutions through the monolith by use of voltage then incubating fluorescent dye with protein retained on the monolith. Subsequently, the labeled proteins were eluted, by applying voltages to reservoirs on the microdevice, and then detected, by monitoring laser-induced fluorescence. Monoliths prepared from octyl methacrylate combine the best protein retention with the possibility of separate elution of unattached fluorescent label with 50% acetonitrile. Finally, automated on-chip extraction and fluorescence labeling of a model protein were successfully demonstrated. This method involves facile sample pretreatment, and therefore has potential for production of integrated bioanalysis microchips.

Conversion of red fluorescent protein into a bright blue probe.

PubMed

Subach, Oksana M; Gundorov, Illia S; Yoshimura, Masami; Subach, Fedor V; Zhang, Jinghang; Grüenwald, David; Souslova, Ekaterina A; Chudakov, Dmitriy M; Verkhusha, Vladislav V

2008-10-20

We used a red chromophore formation pathway, in which the anionic red chromophore is formed from the neutral blue intermediate, to suggest a rational design strategy to develop blue fluorescent proteins with a tyrosine-based chromophore. The strategy was applied to red fluorescent proteins of the different genetic backgrounds, such as TagRFP, mCherry, HcRed1, M355NA, and mKeima, which all were converted into blue probes. Further improvement of the blue variant of TagRFP by random mutagenesis resulted in an enhanced monomeric protein, mTagBFP, characterized by the substantially higher brightness, the faster chromophore maturation, and the higher pH stability than blue fluorescent proteins with a histidine in the chromophore. The detailed biochemical and photochemical analysis indicates that mTagBFP is the true monomeric protein tag for multicolor and lifetime imaging, as well as the outstanding donor for green fluorescent proteins in Förster resonance energy transfer applications.

Photonic-plasmonic hybrid single-molecule nanosensor measures the effect of fluorescent labels on DNA-protein dynamics

PubMed Central

Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin

2017-01-01

Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341

Novel 1:1 labeling and purification process for C-terminal thioester and single cysteine recombinant proteins using generic peptidic toolbox reagents.

PubMed

Portal, Christophe F; Seifert, Jan-Marcus; Buehler, Christof; Meisner-Kober, Nicole-Claudia; Auer, Manfred

2014-07-16

We developed a versatile set of chemical labeling reagents which allow dye ligation to the C-terminus of a protein or a single internal cysteine and target purification in a simple two-step process. This simple process results in a fully 1:1 labeled conjugate suitable for all quantitative fluorescence spectroscopy and imaging experiments. We refer to a "generic labeling toolbox" because of the flexibility to choose one of many available dyes, spacers of different lengths and compositions which increase the target solubility, a variety of affinity purification tags, and different cleavage chemistries to release the 1:1 labeled proteins. Studying protein function in vitro or in the context of live cells and organisms is of vital importance in biological research. Although label free detection technologies gain increasing interest in molecular recognition science, fluorescence spectroscopy is still the most often used detection technique for assays and screens both in academic as well as in industrial groups. For generations, fluorescence spectroscopists have labeled their proteins of interest with small fluorescent dyes by random chemical linking on the proteins' exposed lysines and cysteines. Chemical reactions with a certain excess of activated esters or maleimides of longer wavelength dyes hardly ever result in quantitative labeling of the target protein. Most of the time, more than one exposed amino acid side chain reacts. This results in a mixture of dye-protein complexes of different labeling stoichiometries and labeling sites. Only mass spectrometry allows resolving the precise chemical composition of the conjugates. In "classical" ensemble averaging fluorescent experiments, these labeled proteins are still useful, and quantification of, e.g., ligand binding experiments, is achieved via knowledge of the overall protein concentration and a fluorescent signal change which is proportional to the amount of complex formed. With the development of fluorescence fluctuation analysis techniques working at single molecule resolution, like fluorescence correlation spectroscopy (FCS), fluorescence cross correlation spectroscopy (FCCS), fluorescence intensity diffusion analysis (FIDA), etc., it became important to work with homogeneously labeled target proteins. Each molecule participating in a binding equilibrium should be detectable when it freely fluctuates through the confocal focus of a microscope. The measured photon burst for each transition contains information about the size and the stoichiometry of a protein complex. Therefore, it is important to work with reagents that contain an exact number of tracers per protein at identical positions. The ideal fluorescent tracer-protein complex stoichiometry is 1:1. While genetic tags such as fluorescent proteins (FPs) are widely used to detect proteins, FPs have several limitations compared to chemical tags. For example, FPs cannot easily compete with organic dyes in the flexibility of modification and spectral range; moreover, FPs have disadvantages in brightness and photostability and are therefore not ideal for most biochemical single molecule studies. We present the synthesis of a series of exemplaric toolbox reagents and labeling results on three target proteins which were needed for high throughput screening experiments using fluorescence fluctuation analysis at single molecule resolution. On one target, Hu-antigen R (HuR), we demonstrated the activity of the 1:1 labeled protein in ribonucleic acid (RNA) binding, and the ease of resolving the stoichiometry of an RNA-HuR complex using the same dye on protein and RNA by Fluorescence Intensity Multiple Distribution Analysis (FIMDA) detection.

Click chemistry for the conservation of cellular structures and fluorescent proteins: ClickOx.

PubMed

Löschberger, Anna; Niehörster, Thomas; Sauer, Markus

2014-05-01

Reactive oxygen species (ROS), including hydrogen peroxide, are known to cause structural damage not only in living, but also in fixed, cells. Copper-catalyzed azide-alkyne cycloaddition (click chemistry) is known to produce ROS. Therefore, fluorescence imaging of cellular structures, such as the actin cytoskeleton, remains challenging when combined with click chemistry protocols. In addition, the production of ROS substantially weakens the fluorescence signal of fluorescent proteins. This led us to develop ClickOx, which is a new click chemistry protocol for improved conservation of the actin structure and better conservation of the fluorescence signal of green fluorescent protein (GFP)-fusion proteins. Herein we demonstrate that efficient oxygen removal by addition of an enzymatic oxygen scavenger system (ClickOx) considerably reduces ROS-associated damage during labeling of nascent DNA with ATTO 488 azide by Cu(I)-catalyzed click chemistry. Standard confocal and super-resolution fluorescence images of phalloidin-labeled actin filaments and GFP/yellow fluorescent protein-labeled cells verify the conservation of the cytoskeleton microstructure and fluorescence intensity, respectively. Thus, ClickOx can be used advantageously for structure preservation in conventional and most notably in super-resolution microscopy methods. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Intrinsic Tryptophan Fluorescence in the Detection and Analysis of Proteins: A Focus on Förster Resonance Energy Transfer Techniques

PubMed Central

Ghisaidoobe, Amar B. T.; Chung, Sang J.

2014-01-01

Förster resonance energy transfer (FRET) occurs when the distance between a donor fluorophore and an acceptor is within 10 nm, and its application often necessitates fluorescent labeling of biological targets. However, covalent modification of biomolecules can inadvertently give rise to conformational and/or functional changes. This review describes the application of intrinsic protein fluorescence, predominantly derived from tryptophan (λEX ∼ 280 nm, λEM ∼ 350 nm), in protein-related research and mainly focuses on label-free FRET techniques. In terms of wavelength and intensity, tryptophan fluorescence is strongly influenced by its (or the protein’s) local environment, which, in addition to fluorescence quenching, has been applied to study protein conformational changes. Intrinsic Förster resonance energy transfer (iFRET), a recently developed technique, utilizes the intrinsic fluorescence of tryptophan in conjunction with target-specific fluorescent probes as FRET donors and acceptors, respectively, for real time detection of native proteins. PMID:25490136

Poly(amidoamine) Dendrimers Modified with 1,2-Epoxyhexane or 1,2-Epoxydodecane for Enhanced Gene Delivery Applications.

PubMed

Xiao, Tongyu; Cao, Xueyan; Hou, Wenxiu; Peng, Chen; Qiu, Jieru; Shi, Xiangyang

2015-12-01

We report a new non-viral gene delivery system based on hydrophobically modified poly(amidoamine) (PAMAM) dendrimers. In this study, the periphery of amine-terminated generation 5 (G5) PAMAM dendrimers was partially reacted with 1,2-epoxyhexane and 1,2-epoxydodecane, respectively. The formed hydrophobically modified G5 dendrimers (denoted as G5.NH2-C6 or G5.NH2-C12) were used to complex two different plasmid DNAs (pDNAs) encoding luciferase (Luc) and enhanced green fluorescent protein (EGFP), respectively for gene transfection studies. The polyplexes formed between vectors and pDNA were characterized by gel retardation assay, dynamic light scattering, and zeta potential measurements. We show that the G5.NH2-C6 and G5.NH2-C12 vectors are able to effectively compact the pDNA, allowing for highly efficient gene transfection into a model cell line (HeLa cells) as demonstrated by both Luc assay and confocal microscopic imaging of the EGFP expression. Under the studied N/P ratios (the molar ratio of primary amines of the dendrimers to phosphates in the pDNA backbone) at 2.5 or 5, the transfection efficiency of the dendrimer-based vectors followed the order of G5.NH2-C12 > G5.NH2-C6 > G5.NH2. This enhanced gene transfection capacity is believed to be associated with the enhanced hydrophobic interaction between the vector/pDNA complexes and the relatively hydrophobic cell membranes. The developed hydrophobically modified dendrimers may be used as a promising non-viral vector for enhanced gene delivery applications.

Highly efficient gene transfer in naive human T cells with a murine leukemia virus-based vector.

PubMed

Dardalhon, V; Jaleco, S; Rebouissou, C; Ferrand, C; Skander, N; Swainson, L; Tiberghien, P; Spits, H; Noraz, N; Taylor, N

2000-08-01

Retroviral vectors based on the Moloney murine leukemia virus (MuLV) have become the primary tool for gene delivery into hematopoietic cells, but clinical trials have been hampered by low transduction efficiencies. Recently, we and others have shown that gene transfer of MuLV-based vectors into T cells can be significantly augmented using a fibronectin-facilitated protocol. Nevertheless, the relative abilities of naive (CD45RA(+)) and memory (CD45RO(+)) lymphocyte subsets to be transduced has not been assessed. Although naive T cells demonstrate a restricted cytokine profile following antigen stimulation and a decreased susceptibility to infection with human immunodeficiency virus, it was not clear whether they could be efficiently infected with a MuLV vector. This study describes conditions that permitted gene transfer of an enhanced green fluorescent protein-expressing retroviral vector in more than 50% of naive umbilical cord (UC) blood and peripheral blood (PB) T cells following CD3/CD28 ligation. Moreover, treatment of naive T cells with interleukin-7 resulted in the maintenance of a CD45RA phenotype and gene transfer levels approached 20%. Finally, it was determined that parameters for optimal transduction of CD45RA(+) T cells isolated from PB and UC blood differed: transduction of the UC cells was significantly increased by the presence of autologous mononuclear cells (24.5% versus 56.5%). Because naive T cells harbor a receptor repertoire that allows them to respond to novel antigens, the development of protocols targeting their transduction is crucial for gene therapy applications. This approach will also allow the functions of exogenous genes to be evaluated in primary nontransformed naive T cells.

Construction of a 'turn-on' fluorescent probe system for His-tagged proteins.

PubMed

Murata, Atsushi; Arai, Satoshi; Yoon, Su-In; Takabayashi, Masao; Ozaki, Miwako; Takeoka, Shinji

2010-12-01

Hexahistidine ((His)(6)) tags are used to purify genetically engineered proteins. Herein, we describe the construction of a 'turn-on' fluorescent probe system that consists of the fluorescence quencher, Dabcyl, conjugated to (His)(6), and fluorescent tetramethylrhodamine conjugated to nitrilotriacetic acid, which, in the presence of Ni(2+), can bind (His)(6). The system is turned off when Dabcyl-(His)(6) is bound to the fluorescent nitrilotriacetic acid derivative. The binding strength of this system was assessed using electrospray ionization mass spectrometry, fluorescence correlation spectroscopy, and fluorescence intensity distribution analysis-polarization. Although there was no significant enhancement in fluorescence after addition of an equimolar amount of ubiquitin, the fluorescence increased from 14% to 40% of its initial intensity when an equimolar amount of (His)(6)-ubiquitin was added. Therefore, this system should be able to specifically recognize (His)(6)-proteins with good resolution and has the additional advantage that a washing step is not required to remove fluorescent probe, that is, not bound to the (His)(6)-protein. Copyright © 2010 Elsevier Ltd. All rights reserved.

Virus-Like Particles Derived from HIV-1 for Delivery of Nuclear Proteins: Improvement of Production and Activity by Protein Engineering.

PubMed

Robert, Marc-André; Lytvyn, Viktoria; Deforet, Francis; Gilbert, Rénald; Gaillet, Bruno

2017-01-01

Virus-like particles (VLPs) derived from retroviruses and lentiviruses can be used to deliver recombinant proteins without the fear of causing insertional mutagenesis to the host cell genome. In this study we evaluate the potential of an inducible lentiviral vector packaging cell line for VLP production. The Gag gene from HIV-1 was fused to a gene encoding a selected protein and it was transfected into the packaging cells. Three proteins served as model: the green fluorescent protein and two transcription factors-the cumate transactivator (cTA) of the inducible CR5 promoter and the human Krüppel-like factor 4 (KLF4). The sizes of the VLPs were 120-150 nm in diameter and they were resistant to freeze/thaw cycles. Protein delivery by the VLPs reached up to 100% efficacy in human cells and was well tolerated. Gag-cTA triggered up to 1100-fold gene activation of the reporter gene in comparison to the negative control. Protein engineering was required to detect Gag-KLF4 activity. Thus, insertion of the VP16 transactivation domain increased the activity of the VLPs by eightfold. An additional 2.4-fold enhancement was obtained by inserting nuclear export signal. In conclusion, our platform produced VLPs capable of efficient protein transfer, and it was shown that protein engineering can be used to improve the activity of the delivered proteins as well as VLP production.

Targeted Modifications in Adeno-Associated Virus Serotype 8 Capsid Improves Its Hepatic Gene Transfer Efficiency In Vivo

PubMed Central

Sen, Dwaipayan; Gadkari, Rupali A; Sudha, Govindarajan; Gabriel, Nishanth; Kumar, Yesupatham Sathish; Selot, Ruchita; Samuel, Rekha; Rajalingam, Sumathi; Ramya, V.; Nair, Sukesh C.; Srinivasan, Narayanaswamy; Srivastava, Alok

2013-01-01

Abstract Recombinant adeno-associated virus vectors based on serotype 8 (AAV8) have shown significant promise for liver-directed gene therapy. However, to overcome the vector dose dependent immunotoxicity seen with AAV8 vectors, it is important to develop better AAV8 vectors that provide enhanced gene expression at significantly low vector doses. Since it is known that AAV vectors during intracellular trafficking are targeted for destruction in the cytoplasm by the host–cellular kinase/ubiquitination/proteasomal machinery, we modified specific serine/threonine kinase or ubiquitination targets on the AAV8 capsid to augment its transduction efficiency. Point mutations at specific serine (S)/threonine (T)/lysine (K) residues were introduced in the AAV8 capsid at the positions equivalent to that of the effective AAV2 mutants, generated successfully earlier. Extensive structure analysis was carried out subsequently to evaluate the structural equivalence between the two serotypes. scAAV8 vectors with the wild-type (WT) and each one of the S/T→Alanine (A) or K-Arginine (R) mutant capsids were evaluated for their liver transduction efficiency in C57BL/6 mice in vivo. Two of the AAV8-S→A mutants (S279A and S671A), and a K137R mutant vector, demonstrated significantly higher enhanced green fluorescent protein (EGFP) transcript levels (∼9- to 46-fold) in the liver compared to animals that received WT-AAV8 vectors alone. The best performing AAV8 mutant (K137R) vector also had significantly reduced ubiquitination of the viral capsid, reduced activation of markers of innate immune response, and a concomitant two-fold reduction in the levels of neutralizing antibody formation in comparison to WT-AAV8 vectors. Vector biodistribution studies revealed that the K137R mutant had a significantly higher and preferential transduction of the liver (106 vs. 7.7 vector copies/mouse diploid genome) when compared to WT-AAV8 vectors. To further study the utility of the K137R-AAV8 mutant in therapeutic gene transfer, we delivered human coagulation factor IX (h.FIX) under the control of liver-specific promoters (LP1 or hAAT) into C57BL/6 mice. The circulating levels of h.FIX:Ag were higher in all the K137R-AAV8 treated groups up to 8 weeks post-hepatic gene transfer. These studies demonstrate the feasibility of the use of this novel AAV8 vectors for potential gene therapy of hemophilia B. PMID:23442071

RoMo: An efficient strategy for functional mosaic analysis via stochastic Cre recombination and gene targeting in the ROSA26 locus.

PubMed

Movahedi, Kiavash; Wiegmann, Robert; De Vlaminck, Karen; Van Ginderachter, Jo A; Nikolaev, Viacheslav O

2018-07-01

Functional mosaic analysis allows for the direct comparison of mutant cells with differentially marked control cells in the same organism. While this offers a powerful approach for elucidating the role of specific genes or signalling pathways in cell populations of interest, genetic strategies for generating functional mosaicism remain challenging. We describe a novel and streamlined approach for functional mosaic analysis, which combines stochastic Cre/lox recombination with gene targeting in the ROSA26 locus. With the RoMo strategy a cell population of interest is randomly split into a cyan fluorescent and red fluorescent subset, of which the latter overexpresses a chosen transgene. To integrate this approach into high-throughput gene targeting initiatives, we developed a procedure that utilizes Gateway cloning for the generation of new targeting vectors. RoMo can be used for gain-of-function experiments or for altering signaling pathways in a mosaic fashion. To demonstrate this, we developed RoMo-dnGs mice, in which Cre-recombined red fluorescent cells co-express a dominant-negative Gs protein. RoMo-dnGs mice allowed us to inhibit G protein-coupled receptor activation in a fraction of cells, which could then be directly compared to differentially marked control cells in the same animal. We demonstrate how RoMo-dnGs mice can be used to obtain mosaicism in the brain and in peripheral organs for various cell types. RoMo offers an efficient new approach for functional mosaic analysis that extends the current toolbox and may reveal important new insights into in vivo gene function. © 2018 Wiley Periodicals, Inc.

Computer Modeling of the Structure and Spectra of Fluorescent Proteins

PubMed Central

Grigorenko, B.L.; Savitsky, A.P.

2009-01-01

Fluorescent proteins from the family of green fluorescent proteins are intensively used as biomarkers in living systems. The chromophore group based on the hydroxybenzylidene-imidazoline molecule, which is formed in nature from three amino-acid residues inside the protein globule and well shielded from external media, is responsible for light absorption and fluorescence. Along with the intense experimental studies of the properties of fluorescent proteins and their chromophores by biochemical, X-ray, and spectroscopic tools, in recent years, computer modeling has been used to characterize their properties and spectra. We present in this review the most interesting results of the molecular modeling of the structural parameters and optical and vibrational spectra of the chromophorecontaining domains of fluorescent proteins by methods of quantum chemistry, molecular dynamics, and combined quantum-mechanical-molecular-mechanical approaches. The main emphasis is on the correlation of theoretical and experimental data and on the predictive power of modeling, which may be useful for creating new, efficient biomarkers. PMID:22649601

Some Secrets of Fluorescent Proteins: Distinct Bleaching in Various Mounting Fluids and Photoactivation of Cyan Fluorescent Proteins at YFP-Excitation

PubMed Central

Malkani, Naila; Schmid, Johannes A.

2011-01-01

Background The use of spectrally distinct variants of green fluorescent protein (GFP) such as cyan or yellow mutants (CFP and YFP, respectively) is very common in all different fields of life sciences, e.g. for marking specific proteins or cells or to determine protein interactions. In the latter case, the quantum physical phenomenon of fluorescence resonance energy transfer (FRET) is exploited by specific microscopy techniques to visualize proximity of proteins. Methodology/Principal Findings When we applied a commonly used FRET microscopy technique - the increase in donor (CFP)-fluorescence after bleaching of acceptor fluorophores (YFP), we obtained good signals in live cells, but very weak signals for the same samples after fixation and mounting in commercial microscopy mounting fluids. This observation could be traced back to much faster bleaching of CFP in these mounting media. Strikingly, the opposite effect of the mounting fluid was observed for YFP and also for other proteins such as Cerulean, TFP or Venus. The changes in photostability of CFP and YFP were not caused by the fixation but directly dependent on the mounting fluid. Furthermore we made the interesting observation that the CFP-fluorescence intensity increases by about 10 - 15% after illumination at the YFP-excitation wavelength – a phenomenon, which was also observed for Cerulean. This photoactivation of cyan fluorescent proteins at the YFP-excitation can cause false-positive signals in the FRET-microscopy technique that is based on bleaching of a yellow FRET acceptor. Conclusions/Significance Our results show that photostability of fluorescent proteins differs significantly for various media and that CFP bleaches significantly faster in commercial mounting fluids, while the opposite is observed for YFP and some other proteins. Moreover, we show that the FRET microscopy technique that is based on bleaching of the YFP is prone to artifacts due to photoactivation of cyan fluorescent proteins under these conditions. PMID:21490932

Some secrets of fluorescent proteins: distinct bleaching in various mounting fluids and photoactivation of cyan fluorescent proteins at YFP-excitation.

PubMed

Malkani, Naila; Schmid, Johannes A

2011-04-07

The use of spectrally distinct variants of green fluorescent protein (GFP) such as cyan or yellow mutants (CFP and YFP, respectively) is very common in all different fields of life sciences, e.g. for marking specific proteins or cells or to determine protein interactions. In the latter case, the quantum physical phenomenon of fluorescence resonance energy transfer (FRET) is exploited by specific microscopy techniques to visualize proximity of proteins. When we applied a commonly used FRET microscopy technique--the increase in donor (CFP)-fluorescence after bleaching of acceptor fluorophores (YFP), we obtained good signals in live cells, but very weak signals for the same samples after fixation and mounting in commercial microscopy mounting fluids. This observation could be traced back to much faster bleaching of CFP in these mounting media. Strikingly, the opposite effect of the mounting fluid was observed for YFP and also for other proteins such as Cerulean, TFP or Venus. The changes in photostability of CFP and YFP were not caused by the fixation but directly dependent on the mounting fluid. Furthermore we made the interesting observation that the CFP-fluorescence intensity increases by about 10-15% after illumination at the YFP-excitation wavelength--a phenomenon, which was also observed for Cerulean. This photoactivation of cyan fluorescent proteins at the YFP-excitation can cause false-positive signals in the FRET-microscopy technique that is based on bleaching of a yellow FRET acceptor. Our results show that photostability of fluorescent proteins differs significantly for various media and that CFP bleaches significantly faster in commercial mounting fluids, while the opposite is observed for YFP and some other proteins. Moreover, we show that the FRET microscopy technique that is based on bleaching of the YFP is prone to artifacts due to photoactivation of cyan fluorescent proteins under these conditions.

The Role of Protein Kinase-C in Breast Cancer Invasion and Metastasis

DTIC Science & Technology

1997-09-01

relatively new reporter molecule that is being increasingly used in a variety of studies is the green fluorescent protein (GFP) from the jellyfish Aequorea ...Calf Serum GFP Green Fluorescent Protein IHC Immunohistochemistry IRB Institutional Review Board MAPK Mitogen Activated Protein Kinase MMP...and in vivo. A relatively new reporter molecule that is being increasingly used in a variety of studies is the green fluorescent protein (GFP) from

Fluorescence alteration of MPA capped CdSe quantum dots by spontaneous biomarker protein adsorption.

PubMed

Rowley, Amber; Parks, Tegan; Parks, Kaden; Medley, Kyle; Cordner, Alex; Yu, Ming

2018-05-23

Quantum dots (QDs) have significant potentials in biomedical applications of bioimaging and biosensing. Spontaneous adsorption of proteins on QDs surface is a common phenomenon, which occurred to serum proteins in biological samples, and has been observed to enhance QDs fluorescence. In this study, fluorescence alteration of 3-mercaptopropionic acid (MPA) capped CdSe quantum dots by four individual biomarker proteins was investigated. By monitoring the fluorescence emission of QDs, the biomarker protein adsorbed spontaneously on QDs surface was recognized and quantified. When alpha fetoprotein (AFP) or heat shock protein 90 alpha (HSP90α) were present, the QDs became brighter. The presence of cytochrome C (CytoC) or lysozyme (Lyz) made the QDs dimmer first, and then brighter. Within 5 min response time all four biomarker proteins were detected individually with the estimated detection limit in the range of 1-10 ng/mL and good linear dynamic ranges. The results suggested that the fluorescence of QDs was responsive to not only serum proteins but also biomarker proteins. The fluorescence response was able to correlate quantitatively with the amount of biomarker proteins in relatively low concentrations. These results provide more information to understand QDs and support their applications in biomedical fields. Copyright © 2018. Published by Elsevier Inc.

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE PAGES

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...

2018-01-25

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Construction and characterization of recombinant adenovirus carrying a mouse TIGIT-GFP gene.

PubMed

Zheng, J M; Cui, J L; He, W T; Yu, D W; Gao, Y; Wang, L; Chen, Z K; Zhou, H M

2015-12-29

Recombinant adenovirus vector systems have been used extensively in protein research and gene therapy. However, the construction and characterization of recombinant adenovirus is a tedious and time-consuming process. TIGIT is a recently discovered immunosuppressive molecule that plays an important role in maintaining immunological balance. The construction of recombinant adenovirus mediating TIGIT expression must be simplified to facilitate its use in the study of TIGIT. In this study, the TIGIT gene was combined with green fluorescent protein (GFP); the TIGIT-GFP gene was inserted into a gateway plasmid to construct a TIGIT-GFP adenovirus. HEK 293A cells were infected with the adenovirus, which was then purified and subjected to virus titering. TIGIT-GFP adenovirus was characterized by flow cytometry and immunofluorescence, and its expression in mouse liver was detected by infection through caudal vein injection. The results showed the successful construction of the TIGIT-GFP adenovirus (5 x 10(10) PFU/mL). Co-expression of TIGIT and GFP was identified in 293A and liver cells; synthesis and positioning of TIGIT-GFP was viewed under a fluorescence microscope. TIGIT-GFP was highly expressed on liver cells 1 day (25.53%) after infection and faded 3 days (11.36%) after injection. In conclusion, the fusion of TIGIT with GFP allows easy, rapid, and uncomplicated detection of TIGIT translation. The construction of a TIGIT-GFP adenovirus, mediating TIGIT expression in vitro and in vivo, lays the foundation for further research into TIGIT function and gene therapy. Moreover, the TIGIT-GFP adenovirus is a helpful tool for studying other proteins (which could replace the TIGIT gene).

Spectroscopic studies on the interaction of a water-soluble cationic porphyrin with proteins

NASA Astrophysics Data System (ADS)

Ma, Hong-Min; Chen, Xin; Zhang, Nuo; Han, Yan-Yan; Wu, Dan; Du, Bin; Wei, Qin

2009-04-01

The interaction of a water-soluble cationic porphyrin, meso-tetrakis (4- N, N, N-trimethylanilinium) porphyrin (TMAP), with two proteins, bovine serum albumin (BSA) and human serum albumin (HSA), was studied by UV-vis absorption spectroscopy, fluorescence spectroscopy, fluorescence anisotropy and synchronous fluorescence spectroscopy at neutral aqueous solutions. Free base TMAP bound to proteins as monomers and no aggregation was observed. The binding of TMAP quenched the fluorescence of the protein. On the contrary, the fluorescence of TMAP was enhanced and the fluorescence anisotropy increased due to the binding. The direct static binding mechanism could account for the quenching by TMAP and the binding constants were calculated. TMAP showed a higher quenching efficiency and binding constant of HSA than BSA. The binding of TMAP had no obvious effect on the molecular conformation of the protein. There was only one binding site for TMAP and it was located on the surface of the protein molecule. Electrostatic force played an important role in the binding due to the opposite charges on porphyrin and the proteins.

Spectroscopic studies on the interaction of a water-soluble cationic porphyrin with proteins.

PubMed

Ma, Hong-Min; Chen, Xin; Zhang, Nuo; Han, Yan-Yan; Wu, Dan; Du, Bin; Wei, Qin

2009-04-01

The interaction of a water-soluble cationic porphyrin, meso-tetrakis (4-N,N,N-trimethylanilinium) porphyrin (TMAP), with two proteins, bovine serum albumin (BSA) and human serum albumin (HSA), was studied by UV-vis absorption spectroscopy, fluorescence spectroscopy, fluorescence anisotropy and synchronous fluorescence spectroscopy at neutral aqueous solutions. Free base TMAP bound to proteins as monomers and no aggregation was observed. The binding of TMAP quenched the fluorescence of the protein. On the contrary, the fluorescence of TMAP was enhanced and the fluorescence anisotropy increased due to the binding. The direct static binding mechanism could account for the quenching by TMAP and the binding constants were calculated. TMAP showed a higher quenching efficiency and binding constant of HSA than BSA. The binding of TMAP had no obvious effect on the molecular conformation of the protein. There was only one binding site for TMAP and it was located on the surface of the protein molecule. Electrostatic force played an important role in the binding due to the opposite charges on porphyrin and the proteins.

The use of a viral 2A sequence for the simultaneous over-expression of both the vgf gene and enhanced green fluorescent protein (eGFP) in vitro and in vivo.

PubMed

Lewis, Jo E; Brameld, John M; Hill, Phil; Barrett, Perry; Ebling, Francis J P; Jethwa, Preeti H

2015-12-30

The viral 2A sequence has become an attractive alternative to the traditional internal ribosomal entry site (IRES) for simultaneous over-expression of two genes and in combination with recombinant adeno-associated viruses (rAAV) has been used to manipulate gene expression in vitro. To develop a rAAV construct in combination with the viral 2A sequence to allow long-term over-expression of the vgf gene and fluorescent marker gene for tracking of the transfected neurones in vivo. Transient transfection of the AAV plasmid containing the vgf gene, viral 2A sequence and eGFP into SH-SY5Y cells resulted in eGFP fluorescence comparable to a commercially available reporter construct. This increase in fluorescent cells was accompanied by an increase in VGF mRNA expression. Infusion of the rAAV vector containing the vgf gene, viral 2A sequence and eGFP resulted in eGFP fluorescence in the hypothalamus of both mice and Siberian hamsters, 32 weeks post infusion. In situ hybridisation confirmed that the location of VGF mRNA expression in the hypothalamus corresponded to the eGFP pattern of fluorescence. The viral 2A sequence is much smaller than the traditional IRES and therefore allowed over-expression of the vgf gene with fluorescent tracking without compromising viral capacity. The use of the viral 2A sequence in the AAV plasmid allowed the simultaneous expression of both genes in vitro. When used in combination with rAAV it resulted in long-term over-expression of both genes at equivalent locations in the hypothalamus of both Siberian hamsters and mice, without any adverse effects. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

PubMed

Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

2010-05-31

Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

Quantitative measurement of intracellular protein dynamics using photobleaching or photoactivation of fluorescent proteins.

PubMed

Matsuda, Tomoki; Nagai, Takeharu

2014-12-01

Unlike in vitro protein dynamics, intracellular protein dynamics are intricately regulated by protein-protein interactions or interactions between proteins and other cellular components, including nucleic acids, the plasma membrane and the cytoskeleton. Alteration of these dynamics plays a crucial role in physiological phenomena such as gene expression and cell division. Live-cell imaging via microscopy with the inherent properties of fluorescent proteins, i.e. photobleaching and photoconversion, or fluorescence correlation spectroscopy, provides insight into the movement of proteins and their interactions with cellular components. This article reviews techniques based on photo-induced changes in the physicochemical properties of fluorescent proteins to measure protein dynamics inside living cells, and it also discusses the strengths and weaknesses of these techniques. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Color transitions in coral's fluorescent proteins by site-directed mutagenesis

PubMed Central

Gurskaya, Nadya G; Savitsky, Alexander P; Yanushevich, Yurii G; Lukyanov, Sergey A; Lukyanov, Konstantin A

2001-01-01

Background Green Fluorescent Protein (GFP) cloned from jellyfish Aequorea victoria and its homologs from corals Anthozoa have a great practical significance as in vivo markers of gene expression. Also, they are an interesting puzzle of protein science due to an unusual mechanism of chromophore formation and diversity of fluorescent colors. Fluorescent proteins can be subdivided into cyan (~ 485 nm), green (~ 505 nm), yellow (~ 540 nm), and red (>580 nm) emitters. Results Here we applied site-directed mutagenesis in order to investigate the structural background of color variety and possibility of shifting between different types of fluorescence. First, a blue-shifted mutant of cyan amFP486 was generated. Second, it was established that cyan and green emitters can be modified so as to produce an intermediate spectrum of fluorescence. Third, the relationship between green and yellow fluorescence was inspected on closely homologous green zFP506 and yellow zFP538 proteins. The following transitions of colors were performed: yellow to green; yellow to dual color (green and yellow); and green to yellow. Fourth, we generated a mutant of cyan emitter dsFP483 that demonstrated dual color (cyan and red) fluorescence. Conclusions Several amino acid substitutions were found to strongly affect fluorescence maxima. Some positions primarily found by sequence comparison were proved to be crucial for fluorescence of particular color. These results are the first step towards predicting the color of natural GFP-like proteins corresponding to newly identified cDNAs from corals. PMID:11459517

In vivo production of recombinant proteins using occluded recombinant AcMNPV-derived baculovirus vectors.

PubMed

Guijarro-Pardo, Eva; Gómez-Sebastián, Silvia; Escribano, José M

2017-12-01

Trichoplusia ni insect larvae infected with vectors derived from the Autographa californica multiple nucleopolyhedrovirus (AcMNPV), are an excellent alternative to insect cells cultured in conventional bioreactors to produce recombinant proteins because productivity and cost-efficiency reasons. However, there is still a lot of work to do to reduce the manual procedures commonly required in this production platform that limit its scalability. To increase the scalability of this platform technology, a current bottleneck to be circumvented in the future is the need of injection for the inoculation of larvae with polyhedrin negative baculovirus vectors (Polh-) because of the lack of oral infectivity of these viruses, which are commonly used for production in insect cell cultures. In this work we have developed a straightforward alternative to obtain orally infective vectors derived from AcMNPV and expressing recombinant proteins that can be administered to the insect larvae (Trichoplusia ni) by feeding, formulated in the insect diet. The approach developed was based on the use of a recombinant polyhedrin protein expressed by a recombinant vector (Polh+), able to co-occlude any recombinant Polh- baculovirus vector expressing a recombinant protein. A second alternative was developed by the generation of a dual vector co-expressing the recombinant polyhedrin protein and the foreign gene of interest to obtain the occluded viruses. Additionally, by the incorporation of a reporter gene into the helper Polh+ vector, it was possible the follow-up visualization of the co-occluded viruses infection in insect larvae and will help to homogenize infection conditions. By using these methodologies, the production of recombinant proteins in per os infected larvae, without manual infection procedures, was very similar in yield to that obtained by manual injection of recombinant Polh- AcMNPV-based vectors expressing the same proteins. However, further analyses will be required for a detailed comparison of production yields reached by injection vs oral infections for different recombinant proteins. In conclusion, these results open the possibility of future industrial scaling-up production of recombinant proteins in insect larvae by reducing manual operations. Copyright © 2017 Elsevier B.V. All rights reserved.

Rationally designed fluorescently labeled sulfate-binding protein mutants: evaluation in the development of a sensing system for sulfate

NASA Technical Reports Server (NTRS)

Shrestha, Suresh; Salins, Lyndon L E.; Mark Ensor, C.; Daunert, Sylvia

2002-01-01

Periplasmic binding proteins from E. coli undergo large conformational changes upon binding their respective ligands. By attaching a fluorescent probe at rationally selected unique sites on the protein, these conformational changes in the protein can be monitored by measuring the changes in fluorescence intensity of the probe which allow the development of reagentless sensing systems for their corresponding ligands. In this work, we evaluated several sites on bacterial periplasmic sulfate-binding protein (SBP) for attachment of a fluorescent probe and rationally designed a reagentless sensing system for sulfate. Eight different mutants of SBP were prepared by employing the polymerase chain reaction (PCR) to introduce a unique cysteine residue at a specific location on the protein. The sites Gly55, Ser90, Ser129, Ala140, Leu145, Ser171, Val181, and Gly186 were chosen for mutagenesis by studying the three-dimensional X-ray crystal structure of SBP. An environment-sensitive fluorescent probe (MDCC) was then attached site-specifically to the protein through the sulfhydryl group of the unique cysteine residue introduced. Each fluorescent probe-conjugated SBP mutant was characterized in terms of its fluorescence properties and Ser171 was determined to be the best site for the attachment of the fluorescent probe that would allow for the development of a reagentless sensing system for sulfate. Three different environment-sensitive fluorescent probes (1,5-IAEDANS, MDCC, and acylodan) were studied with the SBP171 mutant protein. A calibration curve for sulfate was constructed using the labeled protein and relating the change in the fluorescence intensity with the amount of sulfate present in the sample. The detection limit for sulfate was found to be in the submicromolar range using this system. The selectivity of the sensing system was demonstrated by evaluating its response to other anions. A fast and selective sensing system with detection limits for sulfate in the submicromolar range was developed. Copyright 2002 Wiley Periodicals, Inc. Biotechnol Bioeng 78: 517-526, 2002.

In Vivo Long-Term Tracking of Neural Stem Cells Transplanted into an Acute Ischemic Stroke model with Reporter Gene-Based Bimodal MR and Optical Imaging.

PubMed

Zhang, Fang; Duan, Xiaohui; Lu, Liejing; Zhang, Xiang; Chen, Meiwei; Mao, Jiaji; Cao, Minghui; Shen, Jun

2017-10-01

Transplantation of neural stem cells (NSCs) is emerging as a new therapeutic approach for stroke. Real-time imaging of transplanted NSCs is essential for successful cell delivery, safety monitoring, tracking cell fate and function, and understanding the interactions of transplanted cells with the host environment. Magnetic resonance imaging (MRI) of magnetic nanoparticle-labeled cells has been the most widely used means to track stem cells in vivo. Nevertheless, it does not allow for the reliable discrimination between live and dead cells. Reporter gene-based MRI was considered as an alternative strategy to overcome this shortcoming. In this work, a class of lentiviral vector-encoding ferritin heavy chain (FTH) and enhanced green fluorescent protein (EGFP) was constructed to deliver reporter genes into NSCs. After these transgenic NSCs were transplanted into the contralateral hemisphere of rats with acute ischemic stroke, MRI and fluorescence imaging (FLI) were performed in vivo for tracking the fate of transplanted cells over a long period of 6 wk. The results demonstrated that the FTH and EGFP can be effectively and safely delivered to NSCs via the designed lentiviral vector. The distribution and migration of grafted stem cells could be monitored by bimodal MRI and FLI. FTH can be used as a robust MRI reporter for reliable reporting of the short-term viability of cell grafts, whereas its capacity for tracking the long-term viability of stem cells remains dependent on several confounding factors such as cell death and the concomitant reactive inflammation.

Directed evolution methods for improving polypeptide folding and solubility and superfolder fluorescent proteins generated thereby

DOEpatents

Waldo, Geoffrey S.

2007-09-18

The current invention provides methods of improving folding of polypeptides using a poorly folding domain as a component of a fusion protein comprising the poorly folding domain and a polypeptide of interest to be improved. The invention also provides novel green fluorescent proteins (GFPs) and red fluorescent proteins that have enhanced folding properties.

A transposase strategy for creating libraries of circularly permuted proteins.

PubMed

Mehta, Manan M; Liu, Shirley; Silberg, Jonathan J

2012-05-01

A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions.

A transposase strategy for creating libraries of circularly permuted proteins

PubMed Central

Mehta, Manan M.; Liu, Shirley; Silberg, Jonathan J.

2012-01-01

A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions. PMID:22319214

Immunogenicity of Newcastle Disease Virus Vectors Expressing Norwalk Virus Capsid Protein in the Presence or Absence of VP2 Protein

PubMed Central

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y.; Samal, Siba K.

2015-01-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirs-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. PMID:26099695

Silica Nanoparticles for Intracellular Protein Delivery: a Novel Synthesis Approach Using Green Fluorescent Protein

NASA Astrophysics Data System (ADS)

Schmidt, Sarah; Tavernaro, Isabella; Cavelius, Christian; Weber, Eva; Kümper, Alexander; Schmitz, Carmen; Fleddermann, Jana; Kraegeloh, Annette

2017-09-01

In this study, a novel approach for preparation of green fluorescent protein (GFP)-doped silica nanoparticles with a narrow size distribution is presented. GFP was chosen as a model protein due to its autofluorescence. Protein-doped nanoparticles have a high application potential in the field of intracellular protein delivery. In addition, fluorescently labelled particles can be used for bioimaging. The size of these protein-doped nanoparticles was adjusted from 15 to 35 nm using a multistep synthesis process, comprising the particle core synthesis followed by shell regrowth steps. GFP was selectively incorporated into the silica matrix of either the core or the shell or both by a one-pot reaction. The obtained nanoparticles were characterised by determination of particle size, hydrodynamic diameter, ζ-potential, fluorescence and quantum yield. The measurements showed that the fluorescence of GFP was maintained during particle synthesis. Cellular uptake experiments demonstrated that the GFP-doped nanoparticles can be used as stable and effective fluorescent probes. The study reveals the potential of the chosen approach for incorporation of functional biological macromolecules into silica nanoparticles, which opens novel application fields like intracellular protein delivery.

Detection of recombinant human lactoferrin and lysozyme produced in a bitransgenic cow.

PubMed

Kaiser, Germán G; Mucci, Nicolás C; González, Vega; Sánchez, Lourdes; Parrón, José A; Pérez, María D; Calvo, Miguel; Aller, Juan F; Hozbor, Federico A; Mutto, Adrián A

2017-03-01

Lactoferrin and lysozyme are 2 glycoproteins with great antimicrobial activity, being part of the nonspecific defensive system of human milk, though their use in commercial products is difficult because human milk is a limited source. Therefore, many investigations have been carried out to produce those proteins in biological systems, such as bacteria, yeasts, or plants. Mammals seem to be more suitable as expression systems for human proteins, however, especially for those that are glycosylated. In the present study, we developed a bicistronic commercial vector containing a goat β-casein promoter and an internal ribosome entry site fragment between the human lactoferrin and human lysozyme genes to allow the introduction of both genes into bovine adult fibroblasts in a single transfection. Embryos were obtained by somatic cell nuclear transfer, and, after 6 transferences to recipients, 3 pregnancies and 1 viable bitransgenic calf were obtained. The presence of the vector was confirmed by fluorescent in situ hybridization of skin cells. At 13 mo of life and after artificial induction of lactation, both recombinant proteins were found in the colostrum and milk of the bitransgenic calf. Human lactoferrin concentration in the colostrum was 0.0098 mg/mL and that in milk was 0.011 mg/mL; human lysozyme concentration in the colostrum was 0.0022 mg/mL and that in milk was 0.0024 mg/mL. The molar concentration of both human proteins revealed no differences in protein production of the internal ribosome entry site upstream and downstream protein. The enzymatic activity of lysozyme in the transgenic milk was comparable to that of human milk, being 6 and 10 times higher than that of bovine lysozyme present in milk. This work represents an important step to obtain multiple proteins or enhance single protein production by using animal pharming and fewer regulatory and antibiotic-resistant foreign sequences, allowing the design of humanized milk with added biological value for newborn nutrition and development. Transgenic animals can offer a unique opportunity to the dairy industry, providing starting materials suitable to develop specific products with high added value. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Ultramicroscopy as a novel tool to unravel the tropism of AAV gene therapy vectors in the brain.

PubMed

Alves, Sandro; Bode, Julia; Bemelmans, Alexis-Pierre; von Kalle, Christof; Cartier, Nathalie; Tews, Björn

2016-06-20

Recombinant adeno-associated viral (AAV) vectors have advanced to the vanguard of gene therapy. Numerous naturally occurring serotypes have been used to target cells in various tissues. There is a strong need for fast and dynamic methods which efficiently unravel viral tropism in whole organs. Ultramicroscopy (UM) is a novel fluorescence microscopy technique that images optically cleared undissected specimens, achieving good resolutions at high penetration depths while being non-destructive. UM was applied to obtain high-resolution 3D analysis of AAV transduction in adult mouse brains, especially in the hippocampus, a region of interest for Alzheimer's disease therapy. We separately or simultaneously compared transduction efficacies for commonly used serotypes (AAV9 and AAVrh10) using fluorescent reporter expression. We provide a detailed comparative and quantitative analysis of the transduction profiles. UM allowed a rapid analysis of marker fluorescence expression in neurons with intact projections deep inside the brain, in defined anatomical structures. Major hippocampal neuronal transduction was observed with both vectors, with slightly better efficacy for AAV9 in UM. Glial response and synaptic marker expression did not change post transduction.We propose UM as a novel valuable complementary tool to efficiently and simultaneously unravel tropism of different viruses in a single non-dissected adult rodent brain.

The role of protein characteristics in the formation and fluorescence of Au nanoclusters

NASA Astrophysics Data System (ADS)

Xu, Yaolin; Sherwood, Jennifer; Qin, Ying; Crowley, Dorothy; Bonizzoni, Marco; Bao, Yuping

2014-01-01

Protein-encapsulated gold nanoclusters have shown many advantages over other gold nanocluster systems, including green synthesis, biocompatibility, high water solubility, and the ease of further conjugation. In this article, we systematically investigated the effects of the protein size and amino acid content on the formation and fluorescent properties of gold nanoclusters using four model proteins (bovine serum albumin, lysozyme, trypsin, and pepsin). We discovered that the balance of amine and tyrosine/tryptophan containing residues was critical for the nanocluster formation. Protein templates with low cysteine contents caused blue shifts in the fluorescent emissions and difference in fluorescent lifetimes of the gold nanoclusters. Furthermore, the protein size was found to be a critical factor for the photostability and long-term stability of gold nanoclusters. The size of the protein also affected the Au nanocluster behaviour after immobilization.Protein-encapsulated gold nanoclusters have shown many advantages over other gold nanocluster systems, including green synthesis, biocompatibility, high water solubility, and the ease of further conjugation. In this article, we systematically investigated the effects of the protein size and amino acid content on the formation and fluorescent properties of gold nanoclusters using four model proteins (bovine serum albumin, lysozyme, trypsin, and pepsin). We discovered that the balance of amine and tyrosine/tryptophan containing residues was critical for the nanocluster formation. Protein templates with low cysteine contents caused blue shifts in the fluorescent emissions and difference in fluorescent lifetimes of the gold nanoclusters. Furthermore, the protein size was found to be a critical factor for the photostability and long-term stability of gold nanoclusters. The size of the protein also affected the Au nanocluster behaviour after immobilization. Electronic supplementary information (ESI) available See DOI: 10.1039/c3nr06040c

Functional characterization and comparison of Plasmodium falciparum proteins as targets of transmission-blocking antibodies.

PubMed

Nikolaeva, Daria; Illingworth, Joseph J; Miura, Kazutoyo; Alanine, Daniel Gw; Brian, Iona J; Li, Yuanyuan; Fyfe, Alex J; Da, Dari F; Cohuet, Anna; Long, Carole A; Draper, Simon J; Biswas, Sumi

2017-10-31

Plasmodium falciparum malaria continues to evade control efforts, utilizing highly specialized sexual-stages to transmit infection between the human host and mosquito vector. In a vaccination model, antibodies directed to sexual-stage antigens, when ingested in the mosquito blood meal, can inhibit parasite growth in the midgut and consequently arrest transmission. Despite multiple datasets for the Plasmodium sexual-stage transcriptome and proteome, there have been no rational screens to identify candidate antigens for transmission-blocking vaccine (TBV) development. This study characterizes 12 proteins from across the P. falciparum sexual-stages as possible TBV targets. Recombinant proteins are heterologously expressed as full-length ectodomains in a mammalian HEK293 cell system. The proteins recapitulate native parasite epitopes as assessed by indirect fluorescence assay and a proportion exhibits immunoreactivity when tested against sera from individuals living in malaria-endemic Burkina Faso and Mali. Purified IgG generated to the mosquito-stage parasite antigen enolase demonstrates moderate inhibition of parasite development in the mosquito midgut by the ex vivo standard membrane feeding assay. The findings support the use of rational screens and comparative functional assessments in identifying proteins of the P. falciparum transmission pathway and establishing a robust pre-clinical TBV pipeline. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

MdCOP1 Ubiquitin E3 Ligases Interact with MdMYB1 to Regulate Light-Induced Anthocyanin Biosynthesis and Red Fruit Coloration in Apple1[W][OA

PubMed Central

Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

2012-01-01

MdMYB1 is a crucial regulator of light-induced anthocyanin biosynthesis and fruit coloration in apple (Malus domestica). In this study, it was found that MdMYB1 protein accumulated in the light but degraded via a ubiquitin-dependent pathway in the dark. Subsequently, the MdCOP1-1 and MdCOP1-2 genes were isolated from apple fruit peel and were functionally characterized in the Arabidopsis (Arabidopsis thaliana) cop1-4 mutant. Yeast (Saccharomyces cerevisiae) two-hybrid, bimolecular fluorescence complementation, and coimmunoprecipitation assays showed that MdMYB1 interacts with the MdCOP1 proteins. Furthermore, in vitro and in vivo experiments indicated that MdCOP1s are necessary for the ubiquitination and degradation of MdMYB1 protein in the dark and are therefore involved in the light-controlled stability of the MdMYB1 protein. Finally, a viral vector-based transformation approach demonstrated that MdCOP1s negatively regulate the peel coloration of apple fruits by modulating the degradation of the MdMYB1 protein. Our findings provide new insight into the mechanism by which light controls anthocyanin accumulation and red fruit coloration in apple and even other plant species. PMID:22855936

Molecular Characterization of Bombyx mori Cytoplasmic Polyhedrosis Virus Genome Segment 4

PubMed Central

Ikeda, Keiko; Nagaoka, Sumiharu; Winkler, Stefan; Kotani, Kumiko; Yagi, Hiroaki; Nakanishi, Kae; Miyajima, Shigetoshi; Kobayashi, Jun; Mori, Hajime

2001-01-01

The complete nucleotide sequence of the genome segment 4 (S4) of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) was determined. The 3,259-nucleotide sequence contains a single long open reading frame which spans nucleotides 14 to 3187 and which is predicted to encode a protein with a molecular mass of about 130 kDa. Western blot analysis showed that S4 encodes BmCPV protein VP3, which is one of the outer components of the BmCPV virion. Sequence analysis of the deduced amino acid sequence of BmCPV VP3 revealed possible sequence homology with proteins from rice ragged stunt virus (RRSV) S2, Nilaparvata lugens reovirus S4, and Fiji disease fijivirus S4. This may suggest that plant reoviruses originated from insect viruses and that RRSV emerged more recently than other plant reoviruses. A chimeric protein consisting of BmCPV VP3 and green fluorescent protein (GFP) was constructed and expressed with BmCPV polyhedrin using a baculovirus expression vector. The VP3-GFP chimera was incorporated into BmCPV polyhedra and released under alkaline conditions. The results indicate that specific interactions occur between BmCPV polyhedrin and VP3 which might facilitate BmCPV virion occlusion into the polyhedra. PMID:11134312

A Sulfhydryl-Reactive Ruthenium (II) Complex and Its Conjugation to Protein G as a Universal Reagent for Fluorescent Immunoassays

PubMed Central

Goud, Thirumani Venkatshwar; Huang, Bor-Rong; Lin, Tzu-Chau; Biellmann, Jean-François; Chen, Chien-Sheng

2012-01-01

To develop a fluorescent ruthenium complex for biosensing, we synthesized a novel sulfhydryl-reactive compound, 4-bromophenanthroline bis-2,2′-dipyridine Ruthenium bis (hexafluorophosphate). The synthesized Ru(II) complex was crosslinked with thiol-modified protein G to form a universal reagent for fluorescent immunoassays. The resulting Ru(II)-protein G conjugates were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The emission peak wavelength of the Ru(II)-protein G conjugate was 602 nm at the excitation of 452 nm which is similar to the spectra of the Ru(II) complex, indicating that Ru(II)-protein G conjugates still remain the same fluorescence after conjugation. To test the usefulness of the conjugate for biosensing, immunoglobulin G (IgG) binding assay was conducted. The result showed that Ru(II)-protein G conjugates were capable of binding IgG and the more cross-linkers to modify protein G, the higher conjugation efficiency. To demonstrate the feasibility of Ru(II)-protein G conjugates for fluorescent immunoassays, the detection of recombinant histidine-tagged protein using the conjugates and anti-histidine antibody was developed. The results showed that the histidine-tagged protein was successfully detected with dose-response, indicating that Ru(II)-protein G conjugate is a useful universal fluorescent reagent for quantitative immunoassays. PMID:22563441

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Green Fluorescent Protein (GFP) as a reporter gene for the plant pathogenic oomycete Phytophthora ramorum

Treesearch

Marko Riedel; Gautier Calmin; Lassaad Belbahri; Francois Lefort; Monika Gotz; Stefan Wagner; Sabine Werres

2009-01-01

Transgenic Phytophthora ramorum strains that produce green fluorescent protein (GFP) constitutively were obtained after stable DNA integration using a polyethylene glycol and CaCl2-based transformation protocol. Green fluorescent protein production was studied in developing colonies and in different propagules of the pathogen...

A complementation assay for in vivo protein structure/function analysis in Physcomitrella patens (Funariaceae)

DOE PAGES

Scavuzzo-Duggan, Tess R.; Chaves, Arielle M.; Roberts, Alison W.

2015-07-14

Here, a method for rapid in vivo functional analysis of engineered proteins was developed using Physcomitrella patens. A complementation assay was designed for testing structure/function relationships in cellulose synthase (CESA) proteins. The components of the assay include (1) construction of test vectors that drive expression of epitope-tagged PpCESA5 carrying engineered mutations, (2) transformation of a ppcesa5 knockout line that fails to produce gametophores with test and control vectors, (3) scoring the stable transformants for gametophore production, (4) statistical analysis comparing complementation rates for test vectors to positive and negative control vectors, and (5) analysis of transgenic protein expression by Westernmore » blotting. The assay distinguished mutations that generate fully functional, nonfunctional, and partially functional proteins. In conclusion, compared with existing methods for in vivo testing of protein function, this complementation assay provides a rapid method for investigating protein structure/function relationships in plants.« less

Fluorescent Applications to Crystallization

NASA Technical Reports Server (NTRS)

Pusey, Marc L.; Forsythe, Elizabeth; Achari, Aniruddha

2006-01-01

By covalently modifying a subpopulation, less than or equal to 1%, of a macromolecule with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification, and tests with model proteins have shown that labeling u to 5 percent of the protein molecules does not affect the X-ray data quality obtained . The presence of the trace fluorescent label gives a number of advantages. Since the label is covalently attached to the protein molecules, it "tracks" the protein s response to the crystallization conditions. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination crystals show up as bright objects against a darker background. Non-protein structures, such as salt crystals, do not show up under fluorescent illumination. Crystals have the highest protein concentration and are readily observed against less bright precipitated phases, which under white light illumination may obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries as the protein or protein structures is all that shows up. Fluorescence intensity is a faster search parameter, whether visually or by automated methods, than looking for crystalline features. Preliminary tests, using model proteins, indicates that we can use high fluorescence intensity regions, in the absence of clear crystalline features or "hits", as a means for determining potential lead conditions. A working hypothesis is that more rapid amorphous precipitation kinetics may overwhelm and trap more slowly formed ordered assemblies, which subsequently show up as regions of brighter fluorescence intensity. Experiments are now being carried out to test this approach using a wider range, of proteins. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons.

Protein labeling for live cell fluorescence microscopy with a highly photostable renewable signal† †Electronic supplementary information (ESI) available: Supplementary methods, figures, movies, and data. See DOI: 10.1039/c7sc01628j

PubMed Central

Bozhanova, Nina G.; Baranov, Mikhail S.; Klementieva, Natalia V.; Sarkisyan, Karen S.; Gavrikov, Alexey S.; Yampolsky, Ilia V.; Zagaynova, Elena V.; Lukyanov, Sergey A.; Lukyanov, Konstantin A.

2017-01-01

We present protein-PAINT – the implementation of the general principles of PAINT (Point Accumulation for Imaging in Nanoscale Topography) for live-cell protein labeling. Our method employs the specific binding of cell-permeable fluorogenic dyes to genetically encoded protein tags. We engineered three mutants of the bacterial lipocalin Blc that possess different affinities to a fluorogenic dye and exhibit a strong increase in fluorescence intensity upon binding. This allows for rapid labeling and washout of intracellular targets on a time scale from seconds to a few minutes. We demonstrate an order of magnitude higher photostability of the fluorescence signal in comparison with spectrally similar fluorescent proteins. Protein-PAINT ensures prolonged super-resolution fluorescence microscopy of living cells in both single molecule detection and stimulated emission depletion regimes. PMID:29147545