Structure–activity relationships for the binding of polymyxins with human α-1-acid glycoprotein
Azad, Mohammad A.K.; Huang, Johnny X.; Cooper, Matthew A.; Roberts, Kade D.; Thompson, Philip E.; Nation, Roger L.; Li, Jian; Velkov, Tony
2012-01-01
Here, for the first time, we have characterized binding properties of the polymyxin class of antibiotics for human α-1-acid glycoprotein (AGP) using a combination of biophysical techniques. The binding affinity of colistin, polymyxin B, polymyxin B3, colistin methansulfonate, and colistin nona-peptide was determined by isothermal titration calorimetry (ITC), surface plasma resonance (SPR) and fluorometric assay methods. All assay techniques indicated colistin, polymyxin B and polymyxin B3 display a moderate binding affinity for AGP. ITC and SPR showed there was no detectable binding affinity for colistin methansulfonate and colistin nona-peptide, suggesting both the positive charges of the diaminobutyric acid (Dab) side chains and the N-terminal fatty acyl chain of the polymyxin molecule are required to drive binding to AGP. In addition, the ITC and fluorometric data suggested that endogenous lipidic substances bound to AGP provide part of the polymyxin binding surface. A molecular model of the polymyxin B3–AGP F1*S complex was presented that illustrates the pivotal role of the N-terminal fatty acyl chain and the D-Phe6-L-Leu7 hydrophobic motif of polymyxin B3 for binding to the cleft-like ligand binding cavity of AGP F1*S variant. The model conforms with the entropy driven binding interaction characterized by ITC which suggests hydrophobic interactions coupled to desolvation events and conformational changes are the primary driving force for polymyxins binding to AGP. Collectively, the data are consistent with a role of this acute-phase reactant protein in the transport of polymyxins in plasma. PMID:22587817
Fernández-Sierra, Mónica; Quiñones, Edwin
2015-03-15
Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.
Sun, Xiaolong; Lacina, Karel; Ramsamy, Elena C; Flower, Stephen E; Fossey, John S; Qian, Xuhong; Anslyn, Eric V; Bull, Steven D; James, Tony D
2015-05-01
Using the self-assembly of aromatic boronic acids with Alizarin Red S (ARS), we developed a new chemosensor for the selective detection of peroxynitrite. Phenylboronic acid (PBA), benzoboroxole (BBA) and 2-( N , N -dimethylaminomethyl)phenylboronic acid (NBA) were employed to bind with ARS to form the complex probes. In particular, the ARS-NBA system with a high binding affinity can preferably react with peroxynitrite over hydrogen peroxide and other ROS/RNS due to the protection of the boron via the solvent-insertion B-N interaction. Our simple system produces a visible colorimetric change and on-off fluorescence response towards peroxynitrite. By coupling a chemical reaction that leads to an indicator displacement, we have developed a new sensing strategy, referred to herein as RIA (Reaction-based Indicator displacement Assay).
Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng
2015-01-15
A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.
Bahreyni, Amirhossein; Yazdian-Robati, Rezvan; Ramezani, Mohammad; Abnous, Khalil; Taghdisi, Seyed Mohammad
2018-04-29
A fluorometric aptamer-based assay was developed for ultrasensitive and selective determination of the neonicotinoid insecticide acetamiprid. The method is based on the use of an aptamer against acetamiprid, multiple complementary strands (CSs), and gold nanoparticles (AuNPs). It is found that by using different CSs, the sensitivity and selectivity of the method is enhanced. On addition of acetamiprid to the aptamer, they will bind to each other and CS1-fluorescein (FAM)-labeled CS2 (as a dsDNA) will be formed. The FAM-labeled dsDNA does not bind to the AuNPs (as a strong quencher) and remains free in the environment, resulting in a strong fluorescence intensity. Without the introduction of acetamiprid, FAM-labeled CS2 binds to AuNPs directly and indirectly through hybridization with CS3 immobilized on the surface of the AuNPs. So, the fluorescence intensity of FAM-labeled CS2 is significantly quenched by AuNPs. The method can detect acetamiprid in the 5 to 50 nM concentration range with a 2.8 nM detection limit. The assay was applied to the determination of acetamiprid in spiked tap water where is gave recoveries that ranged between 95.4% and 94.4%. Graphical abstract (a) In the presence of acetamiprid, aptamer interacts with acetamiprid. The formation of aptamer/acetamiprid causes pairing of complementary strand 1 with FAM-labeled complementary strand, leading to a strong fluorescence intensity. (b) In the absence of acetamiprid, aptamer is hybridized with complementary strand 1. Thus, a very weak fluorescence signal is detected.
Application of a fluorometric microplate algal toxicity assay for riverine periphytic algal species.
Nagai, Takashi; Taya, Kiyoshi; Annoh, Hirochica; Ishihara, Satoru
2013-08-01
Although riverine periphytic algae attached to riverbed gravel are dominant species in flowing rivers, there is limited toxicity data on them because of the difficulty in cell culture and assays. Moreover, it is well known that sensitivity to pesticides differ markedly among species, and therefore the toxicity data for multiple species need to be efficiently obtained. In this study, we investigated the use of fluorometric microplate toxicity assay for testing periphytic algal species. We selected five candidate test algal species Desmodesmus subspicatus, Achnanthidium minutissimum, Navicula pelliculosa, Nitzschia palea, and Pseudanabaena galeata. The selected species are dominant in the river, include a wide range of taxon, and represent actual species composition. Other additional species were also used to compare the sensitivity and suitability of the microplate assay. A 96-well microplate was used as a test chamber and algal growth was measured by in-vivo fluorescence. Assay conditions using microplate and fluorometric measurement were established, and sensitivities of 3,5-dichlorophenol as a reference substance were assayed. The 50 percent effect concentrations (EC50s) obtained by fluorometric microplate assay and those obtained by conventional Erlenmeyer flask assay conducted in this study were consistent. Moreover, the EC50 values of 3,5-dichlorophenol were within the reported confidence intervals in literature. These results supported the validity of our microplate assay. Species sensitivity distribution (SSD) analysis was conducted using the EC50s of five species. The SSD was found to be similar to the SSD obtained using additional tested species, suggesting that SSD using the five species largely represents algal sensitivity. Our results provide a useful and efficient method for high-tier probabilistic ecological risk assessment of pesticides. Copyright © 2013 Elsevier Inc. All rights reserved.
Tips on the analysis of phosphatidic acid by the fluorometric coupled enzyme assay.
Hassaninasab, Azam; Han, Gil-Soo; Carman, George M
2017-06-01
The fluorometric coupled enzyme assay to measure phosphatidic acid (PA) involves the solubilization of extracted lipids in Triton X-100, deacylation, and the oxidation of PA-derived glycerol-3-phosphate to produce hydrogen peroxide for conversion of Amplex Red to resorufin. The enzyme assay is sensitive, but plagued by high background fluorescence from the peroxide-containing detergent and incomplete heat inactivation of lipoprotein lipase. These problems affecting the assay reproducibility were obviated by the use of highly pure Triton X-100 and by sufficient heat inactivation of the lipase enzyme. The enzyme assay could accurately measure the PA content from the subcellular fractions of yeast cells. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Leskinen, Stephaney D.; Schlemmer, Sarah M.; Kearns, Elizabeth A.; Lim, Daniel V.
2009-02-01
The development of rapid assays for detection of microbial pathogens in complex matrices is needed to protect public health due to continued outbreaks of disease from contaminated foods and water. An Escherichia coli O157:H7 detection assay was designed using a robotic, fluorometric assay system. The system integrates optics, fluidics, robotics and software for the detection of foodborne pathogens or toxins in as many as four samples simultaneously. It utilizes disposable fiber optic waveguides coated with biotinylated antibodies for capture of target analytes from complex sample matrices. Computer-controlled rotation of sample cups allows complete contact between the sample and the waveguide. Detection occurs via binding of a fluorophore-labeled antibody to the captured target, which leads to an increase in the fluorescence signal. Assays are completed within twenty-five minutes. Sample matrices included buffer, retentate (material recovered from the filter of the Automated Concentration System (ACS) following hollow fiber ultrafiltration), spinach wash and ground beef. The matrices were spiked with E. coli O157:H7 (103-105 cells/ml) and the limits of detection were determined. The effect of sample rotation on assay sensitivity was also examined. Rotation parameters for each sample matrix included 10 ml with rotation, 5 ml with rotation and 0.1 ml without rotation. Detection occurred at 104 cells/ml in buffer and spinach wash and at 105 cells/ml in retentate and ground beef. Detection was greater for rotated samples in each matrix except ground beef. Enhanced detection of E. coli from large, rotated volumes of complex matrices was confirmed.
Bose, Debosreeta; Sarkar, Deboleena; Chattopadhyay, Nitin
2010-01-01
In the present investigation, an attempt has been made to study the interaction of phenosafranin (PSF), a cationic phenazinium dye with the transport proteins, bovine serum albumin (BSA) and human serum albumin (HSA), employing steady-state and time-resolved fluorometric and circular dichroism (CD) techniques. The photophysical properties of the dye are altered on binding with the serum proteins. An explicit study with respect to the modification of the fluorescence and fluorescence anisotropy upon binding, effect of denaturant, fluorescence lifetime and CD measurements reveal that the dye binds to both BSA and HSA with almost the same affinity. Far-UV CD spectra indicate a decrease in the percentage of alpha-helicity only for BSA upon binding with the probe. Near-UV CD responses indicate an alteration in the tertiary structure of both the transport proteins because of binding.
Herrera, D; Monaga, M; Campos, D; Pampín, Y; González, E C; Lavaut, K
2013-01-01
Gaucher disease (GD) is a lysosomal storage disorder characterized by a deficiency of the lysosomal acid β-D-glucosidase (GBA). The aim of this study was to develop an ultramicro-fluorometric assay based on the method of Chamoles et al. for determining GBA activity in dried blood spots on filter paper (DBS). The assay used 3-mm diameter blood spot and 8 mmol/l of 4-methylumbelliferyl-β-D-glucoside as enzymatic substrate. The reaction occurred in plates incubated at 37°C for 20 hours and the enzyme activity was expressed in μmol hydrolysed substrate/l blood/h. The fluorescence of the enzyme product was automatically measured in a fluorometer-photometer reader (SUMA Technology). The intra and inter-assay coefficients of variation were lower than 9 and 12%, respectively, and the recovery range was 97-109%.Three patients with GD were correctly diagnosed using the ultramicroassay. Healthy newborn DBS samples (n = 3003) from the National Neonatal Screening Program were analyzed, and the mean GBA activity was 5.7 μmol/l blood/h. Our assay showed high Pearson (n = 26; r = 0.99) and concordance correlations (ρc = 0.99) with the traditional method described by Chamoles et al. The analytical performance characteristics of our ultramicro-fluorometric assay suggest that it can be used in the diagnosis of GD in newborns and adults.
Fluorometric assay for phenotypic differentiation of drug-resistant HIV mutants
Zhu, Qinchang; Yu, Zhiqiang; Kabashima, Tsutomu; Yin, Sheng; Dragusha, Shpend; El-Mahdy, Ahmed F. M.; Ejupi, Valon; Shibata, Takayuki; Kai, Masaaki
2015-01-01
Convenient drug-resistance testing of viral mutants is indispensable to effective treatment of viral infection. We developed a novel fluorometric assay for phenotypic differentiation of drug-resistant mutants of human immunodeficiency virus-I protease (HIV-PR) which uses enzymatic and peptide-specific fluorescence (FL) reactions and high-performance liquid chromatography (HPLC) of three HIV-PR substrates. This assay protocol enables use of non-purified enzyme sources and multiple substrates for the enzymatic reaction. In this study, susceptibility of HIV mutations to drugs was evaluated by selective formation of three FL products after the enzymatic HIV-PR reaction. This proof-of-concept study indicates that the present HPLC-FL method could be an alternative to current phenotypic assays for the evaluation of HIV drug resistance. PMID:25988960
Magiati, Maria; Sevastou, Areti; Kalogianni, Despina P
2018-06-04
A fluorometric lateral flow assay has been developed for the detection of nucleic acids. The fluorophores phycoerythrin (PE) and fluorescein isothiocyanate (FITC) were used as labels, while a common digital camera and a colored vinyl-sheet, acting as a cut-off optical filter, are used for fluorescence imaging. After DNA amplification by polymerase chain reaction (PCR), the biotinylated PCR product is hybridized to its complementary probe that carries a poly(dA) tail at 3΄ edge and then applied to the lateral flow strip. The hybrids are captured to the test zone of the strip by immobilized poly(dT) sequences and detected by streptavidin-fluorescein and streptavidin-phycoerythrin conjugates, through streptavidin-biotin interaction. The assay is widely applicable, simple, cost-effective, and offers a large multiplexing potential. Its performance is comparable to assays based on the use of streptavidin-gold nanoparticles conjugates. As low as 7.8 fmol of a ssDNA and 12.5 fmol of an amplified dsDNA target were detectable. Graphical abstract Schematic presentation of a fluorometric lateral flow assay based on fluorescein and phycoerythrin fluorescent labels for the detection of single-stranded (ssDNA) and double-stranded DNA (dsDNA) sequences and using a digital camera readout. SA: streptavidin, BSA: Bovine Serum Albumin, B: biotin, FITC: fluorescein isothiocyanate, PE: phycoerythrin, TZ: test zone, CZ: control zone.
In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2
Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R
2018-01-01
Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V1) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys8]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg8]-vasopressin (AVP) at V1 and vasopressin-2 (V2) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V1 and V2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [3H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V1) and cyclic adenosine monophosphate (V2). Binding potency at V1 and V2 was AVP>LVP>>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V1 than for V2. Cellular activity potency was also AVP>LVP>>terlipressin. Terlipressin was a partial agonist at V1 and a full agonist at V2; LVP was a full agonist at both V1 and V2. The in vivo response to terlipressin is likely due to the partial V1 agonist activity of terlipressin and full V1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors. PMID:29302194
In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2.
Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R
2018-01-01
Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V 1 ) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys 8 ]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg 8 ]-vasopressin (AVP) at V 1 and vasopressin-2 (V 2 ) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V 1 and V 2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [ 3 H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V 1 ) and cyclic adenosine monophosphate (V 2 ). Binding potency at V 1 and V 2 was AVP>LVP>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V 1 than for V 2 . Cellular activity potency was also AVP>LVP>terlipressin. Terlipressin was a partial agonist at V 1 and a full agonist at V 2 ; LVP was a full agonist at both V 1 and V 2 . The in vivo response to terlipressin is likely due to the partial V 1 agonist activity of terlipressin and full V 1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors.
Sista, Ramakrishna S; Eckhardt, Allen E; Wang, Tong; Graham, Carrie; Rouse, Jeremy L; Norton, Scott M; Srinivasan, Vijay; Pollack, Michael G; Tolun, Adviye A; Bali, Deeksha; Millington, David S; Pamula, Vamsee K
2011-10-01
Newborn screening for lysosomal storage diseases (LSDs) has been gaining considerable interest owing to the availability of enzyme replacement therapies. We present a digital microfluidic platform to perform rapid, multiplexed enzymatic analysis of acid α-glucosidase (GAA) and acid α-galactosidase to screen for Pompe and Fabry disorders. The results were compared with those obtained using standard fluorometric methods. We performed bench-based, fluorometric enzymatic analysis on 60 deidentified newborn dried blood spots (DBSs), plus 10 Pompe-affected and 11 Fabry-affected samples, at Duke Biochemical Genetics Laboratory using a 3-mm punch for each assay and an incubation time of 20 h. We used a digital microfluidic platform to automate fluorometric enzymatic assays at Advanced Liquid Logic Inc. using extract from a single punch for both assays, with an incubation time of 6 h. Assays were also performed with an incubation time of 1 h. Assay results were generally comparable, although mean enzymatic activity for GAA using microfluidics was approximately 3 times higher than that obtained using bench-based methods, which could be attributed to higher substrate concentration. Clear separation was observed between the normal and affected samples at both 6- and 1-h incubation times using digital microfluidics. A digital microfluidic platform compared favorably with a clinical reference laboratory to perform enzymatic analysis in DBSs for Pompe and Fabry disorders. This platform presents a new technology for a newborn screening laboratory to screen LSDs by fully automating all the liquid-handling operations in an inexpensive system, providing rapid results.
Saberi, Zeinab; Rezaei, Behzad; Faroukhpour, Hossein; Ensafi, Ali Ashghar
2018-05-17
Cobalt oxyhydroxide (CoOOH) nanosheets are efficient fluorescence quenchers due to their specific optical properties and high surface area. The combination of CoOOH nanosheets and carbon dots (CDs) has not been used in any aptasensor based on fluorescence quenching so far. An aptamer based fluorometric assay is introduced that is making use of fluorescent CDs conjugated to the aptamer against methamphetamine (MTA), and of CoOOH nanosheets which reduce the fluorescence of the CDs as a quencher. The results revealed that the conjugated CDs with aptamers were able to enclose the CoOOH nanosheets. Consequently, fluorescence is quenched. If the aptamer on the CD binds MTA, the CDs are detached from CoOOH nanosheets. As a result, fluorescence is restored proportionally to zhe MTA concentration. The fluorometric limit of detection is 1 nM with a dynamic range from 5 to 156 nM. The method was validated by comparing the results obtained by the new method to those obtained by ion mobility spectroscopy. Theoretical studies showed that the distance between CoOOH nanosheet and C-Ds is approximately 7.6 Å which can illustrate the possibility of FRET phenomenon. The interactions of MTA and the aptamer were investigated using molecular dynamic simulation (MDS). Graphical abstract Carbon dots (C-Ds) were prepared from grape leaves, conjugated to aptamer, and adsorbed on CoOOH nanosheets. So, the fluorescence of C-Ds is quenched. On addition of MTA, fluorescence is restored.
Novel application of digital microfluidics for the detection of biotinidase deficiency in newborns.
Graham, Carrie; Sista, Ramakrishna S; Kleinert, Jairus; Wu, Ning; Eckhardt, Allen; Bali, Deeksha; Millington, David S; Pamula, Vamsee K
2013-12-01
Newborn screening for biotinidase deficiency can be performed using a fluorometric enzyme assay on dried blood spot specimens. As a pre-requisite to the consolidation of different enzymatic assays onto a single platform, we describe here a novel analytical method for detecting biotinidase deficiency using the same digital microfluidic cartridge that has already been demonstrated to screen for five lysosomal storage diseases (Pompe, Fabry, Gaucher, Hurler and Hunter) in a multiplex format. A novel assay to quantify biotinidase concentration in dried blood spots (DBS) was developed and optimized on the digital microfluidic platform using proficiency testing samples from the Centers for Disease Control and Prevention. The enzymatic assay uses 4-methylumbelliferyl biotin as the fluorogenic substrate. Biotinidase deficiency assays were performed on normal (n=200) and deficient (n=7) newborn DBS specimens. Enzymatic activity analysis of biotinidase deficiency revealed distinct separation between normal and affected DBS specimens using digital microfluidics and these results matched the expected activity. This study has demonstrated performance of biotinidase deficiency assays by measurement of 4-methylumbelliferyl product on a digital microfluidic platform. Due to the inherent ease in multiplexing on such a platform, consolidation of other fluorometric assays onto a single cartridge may be realized. © 2013.
M-DNA: a self-assembling molecular wire for nanoelectronics and biosensing.
Wettig, Shawn D; Li, Chen-Zhong; Long, Yi-Tao; Kraatz, Heinz-Bernhard; Lee, Jeremy S
2003-01-01
M-DNA is a complex between divalent metal ions such as Zn2+ and duplex DNA which forms at pH 8.5. Unlike B-DNA, M-DNA does not bind ethidium so that M-DNA formation can be monitored conveniently by an ethidium fluorescence assay. M-DNA was shown to be a better conductor than B-DNA by fluorometric measurements of electron transport in donor-acceptor labelled duplexes; by direct conductivity measurements of M-DNA bound between gold electrodes and by cyclic voltammetric studies on ferrocene labelled duplexes attached to gold microelectrodes. As is the case with B-DNA, M-DNA can self-assemble into a variety of structures and is anticipated to find widespread use in nanoelectronics and biosensing.
Fluorometric enzymatic assay of L-arginine
NASA Astrophysics Data System (ADS)
Stasyuk, Nataliya; Gayda, Galina; Yepremyan, Hasmik; Stepien, Agnieszka; Gonchar, Mykhailo
2017-01-01
The enzymes of L-arginine (further - Arg) metabolism are promising tools for elaboration of selective methods for quantitative Arg analysis. In our study we propose an enzymatic method for Arg assay based on fluorometric monitoring of ammonia, a final product of Arg splitting by human liver arginase I (further - arginase), isolated from the recombinant yeast strain, and commercial urease. The selective analysis of ammonia (at 415 nm under excitation at 360 nm) is based on reaction with o-phthalaldehyde (OPA) in the presence of sulfite in alkali medium: these conditions permit to avoid the reaction of OPA with any amino acid. A linearity range of the fluorometric arginase-urease-OPA method is from 100 nM to 6 μМ with a limit of detection of 34 nM Arg. The method was used for the quantitative determination of Arg in the pooled sample of blood serum. The obtained results proved to be in a good correlation with the reference enzymatic method and literature data. The proposed arginase-urease-OPA method being sensitive, economical, selective and suitable for both routine and micro-volume formats, can be used in clinical diagnostics for the simultaneous determination of Arg as well as urea and ammonia in serum samples.
NASA Technical Reports Server (NTRS)
Goyal, S. S.; Rains, D. W.; Huffaker, R. C.
1988-01-01
A fast, sensitive, simple, and highly reproducible method for routine assay of ammonium ion (NH4+) was developed by using HPLC equipment. The method is based on the reaction of NH4+ with o-phthalaldehyde (OPA) in the presence of 2-mercaptoethanol. After an on-line derivatization, the resulting NH4(+)-OPA product was quantified by using fluorometric or spectrophotometric detection. For fluorometric detection, the excitation and emission wavelengths were 410 and 470 nm, respectively. The spectrophotometric detection was made by measuring absorbance at 410 nm. Results on the effects of OPA-reagent composition and pH, reaction temperature, sample matrix, and linearity of the assay are presented. Even though it took about 2 min from the time of sample injection to the appearance of sample peak, sample injections could be overlapped at an interval of about 1 min. Thus, the actual time needed for analysis was about 1 min per assay. The method can be used in a fully automated mode by using an autosampler injector.
Xu, Ai-Zhen; Zhang, Li; Zeng, Hui-Hui; Liang, Ru-Ping; Qiu, Jian-Ding
2018-05-09
A fluorometric method is described for the determination of the activity of alkaline phosphatase (ALP). It relies on the competition between gold nanoparticles (AuNPs) and pyrophosphate (PPi) for the coordination sites on the surface of CePO 4 :Tb nanorods. The green fluorescence of the CePO 4 :Tb is reduced in the presence of AuNPs due to fluorescence resonance energy transfer (FRET), but can be restored on addition of PPi due to the stronger affinity of PPi to the CePO 4 :Tb. In the presence of ALP, PPi is hydrolyzed to form phosphate which has much weaker affinity for the CePO 4 :Tb. Hence, the AuNPs will reassemble on the CePO 4 :Tb, and fluorescence is reduced. Fluorescence drops linearly in the 0.2 to 100 U·L -1 activity range, and the detection limit is 60 mU·L -1 (at S/N = 3). The method does not require any modification of the surface of the CePO 4 :Tb and is highly sensitive and selective. The inhibition of ALP activity by Na 3 VO 4 was also studied. In our perception, the method may find application in the diagnosis of ALP-related diseases, in screening for inhibitors, and in studies on ALP-related functions in biological systems. Graphical abstract A assay for the detection of alkaline phosphatase is proposed based on the fluorescence resonance energy transfer between CePO 4 :Tb and AuNPs. It relies on the competitive binding of AuNPs and pyrophosphate (PPi) to CePO 4 :Tb and the hydrolysis of PPi by ALP.
Surface changes and polymyxin interactions with a resistant strain of Klebsiella pneumoniae.
Velkov, Tony; Deris, Zakuan Z; Huang, Johnny X; Azad, Mohammad A K; Butler, Mark; Sivanesan, Sivashangarie; Kaminskas, Lisa M; Dong, Yao-Da; Boyd, Ben; Baker, Mark A; Cooper, Matthew A; Nation, Roger L; Li, Jian
2014-05-01
This study examines the interaction of polymyxin B and colistin with the surface and outer membrane components of a susceptible and resistant strain of Klebsiella pneumoniae. The interaction between polymyxins and bacterial membrane and isolated LPS from paired wild type and polymyxin-resistant strains of K. pneumoniae were examined with N-phenyl-1-naphthylamine (NPN) uptake, fluorometric binding and thermal shift assays, lysozyme and deoxycholate sensitivity assays, and by (1)H NMR. LPS from the polymyxin-resistant strain displayed a reduced binding affinity for polymyxins B and colistin in comparison with the wild type LPS. The outer membrane NPN permeability of the resistant strain was greater compared with the susceptible strain. Polymyxin exposure enhanced the permeability of the outer membrane of the wild type strain to lysozyme and deoxycholate, whereas polymyxin concentrations up to 32 mg/ml failed to permeabilize the outer membrane of the resistant strain. Zeta potential measurements revealed that mid-logarithmic phase wild type cells exhibited a greater negative charge than the mid-logarithmic phase-resistant cells. Taken together, our findings suggest that the resistant derivative of K. pneumoniae can block the electrostatically driven first stage of polymyxin action, which thereby renders the hydrophobically driven second tier of polymyxin action on the outer membrane inconsequential.
Wang, Ping; Wu, Tun-Hua; Zhang, Yong
2016-01-01
Metal-enhanced fluorescence (MEF) has exhibited promise for applications in fluorometric assays. The effects of silver nanoparticles (AgNP) on the fluorescence behaviours of tetracycline hydrochloride (TCH) and chlortetracycline hydrochloride (CTC) in aqueous solutions were investigated. The experimental results demonstrated that the fluorescence intensities of each tetracycline in water solutions were greatly enhanced by AgNP through the MEF effect. In addition, a novel silver nanoparticle-enhanced fluorometric method was established for the direct determination of TCH and CTC in aqueous solutions. Under optimum experimental conditions, the linear dynamic ranges for the determination of TCH and CTC in aqueous solutions varied from 0.10 to 6.0 mg L(-1) and 0.050 to 3.0 mg L(-1) with detection limits of 0.63 µg L(-1) and 0.19 µg L(-1), respectively, and with the relative standard deviation of less than 1.9% (n=9). The experimental recovery results for the determination of TCH and CTC in aqueous solutions ranged from 93-106% and 95-104%, respectively. Compared with the established method without the addition of AgNP, the limits of quantitation of the silver nanoparticle-enhanced fluorometric method were approximately 5-fold lower for TCH and 3-fold lower for CTC. Moreover, the newly established silver nanoparticle-enhanced fluorometric method was successfully applied to the direct determination of TCH and CTC in pharmaceutical preparations. Copyright © 2015 Elsevier B.V. All rights reserved.
Kim, Sung Hoon; Jeyakumar, M; Katzenellenbogen, John A
2007-10-31
We present the first example of a fluorophore-doped nickel chelate surface-modified silica nanoparticle that functions in a dual mode, combining histidine-tagged protein purification with site-specific fluorophore labeling. Tetramethylrhodamine (TMR)-doped silica nanoparticles, estimated to contain 700-900 TMRs per ca. 23 nm particle, were surface modified with nitrilotriacetic acid (NTA), producing TMR-SiO2-NTA-Ni2+. Silica-embedded TMR retains very high quantum yield, is resistant to quenching by buffer components, and is modestly quenched and only to a certain depth (ca. 2 nm) by surface-attached Ni2+. When exposed to a bacterial lysate containing estrogen receptor alpha ligand binding domain (ERalpha) as a minor component, these beads showed very high specificity binding, enabling protein purification in one step. The capacity and specificity of these beads for binding a his-tagged protein were characterized by electrophoresis, radiometric counting, and MALDI-TOF MS. ERalpha, bound to TMR-SiO2-NTA-Ni++ beads in a site-specific manner, exhibited good activity for ligand binding and for ligand-induced binding to coactivators in solution FRET experiments and protein microarray fluorometric and FRET assays. This dual-mode type TMR-SiO2-NTA-Ni2+ system represents a powerful combination of one-step histidine-tagged protein purification and site-specific labeling with multiple fluorophore species.
Pivoting between calmodulin lobes triggered by calcium in the Kv7.2/calmodulin complex.
Alaimo, Alessandro; Alberdi, Araitz; Gomis-Perez, Carolina; Fernández-Orth, Juncal; Bernardo-Seisdedos, Ganeko; Malo, Covadonga; Millet, Oscar; Areso, Pilar; Villarroel, Alvaro
2014-01-01
Kv7.2 (KCNQ2) is the principal molecular component of the slow voltage gated M-channel, which strongly influences neuronal excitability. Calmodulin (CaM) binds to two intracellular C-terminal segments of Kv7.2 channels, helices A and B, and it is required for exit from the endoplasmic reticulum. However, the molecular mechanisms by which CaM controls channel trafficking are currently unknown. Here we used two complementary approaches to explore the molecular events underlying the association between CaM and Kv7.2 and their regulation by Ca(2+). First, we performed a fluorometric assay using dansylated calmodulin (D-CaM) to characterize the interaction of its individual lobes to the Kv7.2 CaM binding site (Q2AB). Second, we explored the association of Q2AB with CaM by NMR spectroscopy, using (15)N-labeled CaM as a reporter. The combined data highlight the interdependency of the N- and C-lobes of CaM in the interaction with Q2AB, suggesting that when CaM binds Ca(2+) the binding interface pivots between the N-lobe whose interactions are dominated by helix B and the C-lobe where the predominant interaction is with helix A. In addition, Ca(2+) makes CaM binding to Q2AB more difficult and, reciprocally, the channel weakens the association of CaM with Ca(2+).
Yang, Xiaolan; Hu, Xiaolei; Xu, Bangtian; Wang, Xin; Qin, Jialin; He, Chenxiong; Xie, Yanling; Li, Yuanli; Liu, Lin; Liao, Fei
2014-06-17
A fluorometric titration approach was proposed for the calibration of the quantity of monoclonal antibody (mcAb) via the quench of fluorescence of tryptophan residues. It applied to purified mcAbs recognizing tryptophan-deficient epitopes, haptens nonfluorescent at 340 nm under the excitation at 280 nm, or fluorescent haptens bearing excitation valleys nearby 280 nm and excitation peaks nearby 340 nm to serve as Förster-resonance-energy-transfer (FRET) acceptors of tryptophan. Titration probes were epitopes/haptens themselves or conjugates of nonfluorescent haptens or tryptophan-deficient epitopes with FRET acceptors of tryptophan. Under the excitation at 280 nm, titration curves were recorded as fluorescence specific for the FRET acceptors or for mcAbs at 340 nm. To quantify the binding site of a mcAb, a universal model considering both static and dynamic quench by either type of probes was proposed for fitting to the titration curve. This was easy for fitting to fluorescence specific for the FRET acceptors but encountered nonconvergence for fitting to fluorescence of mcAbs at 340 nm. As a solution, (a) the maximum of the absolute values of first-order derivatives of a titration curve as fluorescence at 340 nm was estimated from the best-fit model for a probe level of zero, and (b) molar quantity of the binding site of the mcAb was estimated via consecutive fitting to the same titration curve by utilizing such a maximum as an approximate of the slope for linear response of fluorescence at 340 nm to quantities of the mcAb. This fluorometric titration approach was proved effective with one mcAb for six-histidine and another for penicillin G.
Tanaka, T; Nishihara, M; Seki, M; Sakamoto, A; Tanaka, K; Irifune, K; Morikawa, H
1995-05-01
Gold particles coated with beta-glucuronidase (GUS) mRNA with a 5' cap structure that had been synthesized in vitro were introduced, by use of a pneumatic particle gun, into pollen grains of lily (Lilium longiflorum), freesia (Freesia refracta) and tulip (Tulipa gesneriana). A fluorometric assay for the GUS activity indicated that in vitro synthesized GUS mRNA introduced into these pollen cells by particle bombardment was successfully expressed. GUS activity in extracts of the bombarded lily pollen became detectable fluorometrically within 30 min after bombardment, peaked at 6 h, then gradually decreased. This activity changed as a function of the developmental stage of the pollen cell of lily.
Koller, E; Wolfbeis, O S
1984-11-15
A direct and continuous kinetic method for the photometric and fluorometric determination of various acid phosphatases is described. It is based on new coumarin-derived phosphates, which after enzymatic hydrolysis undergo dissociation to form intensely colored and strongly fluorescent phenolate anions. The latter have absorption maxima ranging from 385 to 505 nm, and fluorescence maxima between 470 and 595 nm. The new substrates were compared with respect to their rate of enzymatic hydrolysis, optimum pH, and detection limits of acid phosphatase from potato and wheat germ. Detection limits of 0.001 unit/ml were found by photometry, and as low as 0.00006 unit/ml by fluorometry. The principal advantages of the new substrates over existing ones are longwave absorptions and emissions, large Stokes shifts, and the low pKa values of the corresponding phenols, thus allowing a direct and continuous assay of acid phosphatase even in weakly acidic solutions.
NASA Astrophysics Data System (ADS)
Sudhi, Geethu; Rajina, S. R.; Praveen, S. G.; Xavier, T. S.; Kenny, Peter T. M.; Jaiswal-Nagar, D.; Binoy, J.
2017-10-01
The bioactivity of compounds is mainly dependent on molecular structure and the present work aims to explore the bonding features responsible for biological activity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester (FNGABEE). In the present study, we investigate the molecular structural properties of newly synthesized title compound through experimental and quantum chemical studies. The detailed vibrational analysis has been performed using FT IR and FT Raman spectrum, aided by DFT computed geometry, vibrational spectrum, Eigen vector distribution and PED, at B3LYP/6-311 ++G(d,p) level. The resonance structure of naphthalene, different from that of benzene, revealed by molecular structure has been investigated using Csbnd C and Cdbnd C stretching modes. The proton transfer in amide has been analyzed to obtain spectral distinction between different carbonyl and Csbnd N groups which point to the reactive sites responsible for binding with DNA and bovine serum albumin (BSA). The spectral distinction between eclipsed and staggered form of ferrocene has been analyzed. The molecular docking of FNGABEE with BSA and DNA has been performed to find the strength of binding and the moieties responsible for the interactions. The experimental binding studies of FNGABEE with BSA and DNA has been performed using UV absorption spectroscopy and fluorometric assay, to find the nature and strength of binding.
Crystal Structures of Yellowtail Ascites Virus VP4 Protease
Chung, Ivy Yeuk Wah; Paetzel, Mark
2013-01-01
Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637
Chung, Ivy Yeuk Wah; Paetzel, Mark
2013-05-03
Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water.
Larsen, Torben; Aulrich, Karen
2012-02-01
Activity of the enzyme β-glucuronidase (EC 3.2.1.31) is found in milk from ruminants with mastitis. However, the use of this enzymic activity as an indicator of mastitis has gained little attention possibly because of its low activity when compared with other mastitis indicators. The determination may therefore be less precise and the analytical procedure very time consuming and labour intensive. The present study optimized the fluorometric determination of the β-glucuronidase activity with respect to substrate concentration, pH, incubation time etc., validated the assay, and developed it into large scale analyses. The assay performance is satisfactory regarding precision, linearity etc., and it appears comparable to analogous fluorometric assays for mastitis indicators in milk. From a local dairy herd, 825 milk samples were analysed for potential mastitis indicators, i.e. β-glucuronidase, lactate dehydrogenase (LDH), alkaline phosphatase (AP), and N-acetyl-β-d-glucosaminidase (NAGase) activity, and for somatic cell counts (SCC) and the variables were compared. Activity of β-glucuronidase was moderately but significantly correlated to SCC (r=0·21; n=768) as well as the other mentioned variables (r=0·25-0·43; n=825). Simple indices based on β-glucuronidase and LDH or NAGase activity were tested as indicators of mastitis (SCC), but were not found to improve the diagnostic value. Future studies may further verify whether β-glucuronidase can compete with well-established indicators of mastitis in cows such as LDH or NAGase as well as determine whether β-glucuronidase activity, in combination with other indicators of mastitis, has an advantage. Nineteen milk samples from subclinical and latent cases of mastitis (individual quarters) were identified for specific pathogens (PCR method) and measured for β-glucuronidase activity. The activity was tested at four different pH levels (5·5, 6·0, 6·5 and 7·0) in order to investigate the possibility of discrimination between pathogens. However, all milk samples (strains of pathogens) had the same pH optimum for β-glucuronidase activity; this may indicate that enzymic activity from mammary tissue and leucocytes dominates over enzyme activity from bacterial cells.
NASA Astrophysics Data System (ADS)
Stasyuk, Nataliya; Gayda, Galina; Zakalskiy, Andriy; Zakalska, Oksana; Errachid, Abdelhamid; Gonchar, Mykhailo
2018-03-01
A novel enzymatic method of manganese (II) and cobalt (II) ions assay, based on using apo-enzyme of Mn2 +-dependent recombinant arginase I (arginase) and 2,3-butanedione monoxime (DMO) as a chemical reagent is proposed. The principle of the method is the evaluation of the activity of L-arginine-hydrolyzing of arginase holoenzyme after the specific binding of Mn2 + or Co2 + with apo-arginase. Urea, which is the product of enzymatic hydrolysis of L-arginine (Arg), reacts with DMO and the resulted compound is detected by both fluorometry and visual spectrophotometry. Thus, the content of metal ions in the tested samples can be determined by measuring the level of urea generated after enzymatic hydrolysis of Arg by reconstructed arginase holoenzyme in the presence of tested metal ions. The linearity range of the fluorometric apo-arginase-DMO method in the case of Mn2 + assay is from 4 pM to 1.10 nM with a limit of detection of 1 pM Mn2 +, whereas the linearity range of the present method in the case of Co2 + assay is from 8 pM to 45 nM with a limit of detection of 2.5 pM Co2 +. The proposed method being highly sensitive, selective, valid and low-cost, may be useful to monitor Mn2 + and Co2 + content in clinical laboratories, food industry and environmental control service.
2003-05-01
retinoids, deltanoids (vitamin D derivatives), phytoestrogens, flavonoids , and aromatase inhibitors among others (Kelloffet al, 1996). On a global basis...Dietetics, University of Illinois at Chicago, Chicago. Responsibilities included development and validation of MDA-TBA assay by HPLC with fluorometric
A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.
Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia
2015-01-01
A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.
Biardi, J E; Nguyen, K T; Lander, S; Whitley, M; Nambiar, K P
2011-02-01
Metalloproteases are responsible for the hemorrhagic effects of many snake venoms and contribute to other pathways that lead to local tissue damage. Methods that quantify snake venom metalloproteases (SVMP) are therefore valuable tools in research on the clinical, physiological, and biochemical effects of envenomation. Comparative analysis of individual, population, and species differences requires screening of large numbers of samples and treatments, and therefore require a method of quantifying SVMP activity that is simple, rapid, and sensitive. This paper demonstrates the properties of a new fluorometric assay of SVMP activity that can provide a measure of metalloprotease activity in 1 h. The assay is reliable, with variation among replicates sufficiently small to reliably detect differences in between species (F(19,60) = 2924, p < 0.001), even for those venoms with low overall activity. It is also sensitive enough to detect differences among venoms using <2 ng of whole venom protein. We provide an example use of this assay to detect the presence of natural SVMP inhibitors in minute samples of blood plasma from rock squirrels (S. variegatus), a natural prey species for North American rattlesnakes. We propose this assay is a useful addition to the set of tools used to characterize venoms, as well as high-throughput screening of natural or synthetic inhibitors, or other novel therapeutic agents against SVMP effects. Copyright © 2010 Elsevier Ltd. All rights reserved.
Wang, Yanying; Yang, Yan; Liu, Wei; Ding, Fang; Zhao, Qingbiao; Zou, Ping; Wang, Xianxiang; Rao, Hanbing
2018-05-04
A dual-read detection system is described for non-enzymatic and non-aggregation based analysis of uric acid (UA). Silver triangular nanoprisms (AgTNPs) were used as colorimetric probes, while the reduction in the fluorescence of nitrogen-doped carbon quantum dots (N-CQDs) served as the fluorometric readout. The absorption band of the AgTNPs overlaps the emission band of N-CQDs (with a peak at 440 nm). Therefore, fluorescence is reduced owing to an inner filter effect. The AgTNPs are etched if exposed to H 2 O 2 , and round nanodiscs are formed. In the presence of UA, etching of the AgTNPs is suppressed because the facets of the AgTNPs are coated with UA. The absorbance, best measured at 683 nm, increases with the concentration of the pre-added UA. The colorimetric assay works in the 0.1-45 μM UA concentration range, and the fluorometric assay between 1 and 42 μM of UA. The respective detection limits are 50 and 200 nM, respectively. The probe can be used for direct visualization of UA. The method was successfully applied to the determination of UA in urine samples. Graphical abstract The fluorescence of nitrogen-doped carbon quantum dots (N-CQDs) is quenched by AgTNPs (silver triangular nanoprisms). As the AgTNPs are etched by H 2 O 2 , fluorescence recovers in the system after H 2 O 2 is added, and also undergoes a color change. Uric acid (UA) protects the AgTNPs from etching because the facets of the AgTNPs are coated with UA. The fluorescence of N-CQDs decreases. Thus, a dual-read probe is developed for determination of UA.
Elbin, Carole S; Olivova, Petra; Marashio, Carla A; Cooper, Samantha K; Cullen, Emmaline; Keutzer, Joan M; Zhang, X Kate
2011-06-11
Fluorometric and tandem mass spectrometry assays can be used to measure lysosomal enzyme activities in dried blood spots (DBS). The effect of DBS preparation, storage and shipping was evaluated on the activities of acid α-glucosidase, acid α-galactosidase, acid β-glucocerebrosidase, acid sphingomyelinase, and galactocerebrosidase. Whole blood from normal donors was used to prepare DBS following Clinical and Laboratory Standards Institute guidelines and by several deviations. Some DBS were subjected to various treatments, storage and shipping conditions. The activity of 5 lysosomal enzymes (GAA, GLA, GBA, ASM, and GALC) was measured using tandem mass spectrometric and fluorometric (GAA only) assays with 2 distinct and commonly used synthetic substrates. Enzyme activities were strongly affected by the way DBS were prepared and stored. Exposure of DBS to elevated heat and humidity can destroy enzyme functions rapidly. DBS prepared from poorly mixed blood caused significant variation on enzyme activities. EDTA, but not heparin, as an anti-coagulant gave more precise results. The study confirmed the importance of proper and consistent DBS preparation and storage when screening for deficiencies of lysosomal enzymes. Copyright © 2011 Elsevier B.V. All rights reserved.
Ge, Jia; Bai, Dong-Mei; -Geng, Xin; Hu, Ya-Lei; Cai, Qi-Yong; Xing, Ke; Zhang, Lin; Li, Zhao-Hui
2018-01-10
The authors describe a fluorometric method for the quantitation of nucleic acids by combining (a) cycled strand displacement amplification, (b) the unique features of the DNA probe SYBR Green, and (c) polydopamine nanotubes. SYBR Green undergoes strong fluorescence enhancement upon intercalation into double-stranded DNA (dsDNA). The polydopamine nanotubes selectively adsorb single-stranded DNA (ssDNA) and molecular beacons. In the absence of target DNA, the molecular beacon, primer and SYBR Green are adsorbed on the surface of polydopamine nanotubes. This results in quenching of the fluorescence of SYBR Green, typically measured at excitation/emission wavelengths of 488/518 nm. Upon addition of analyte (target DNA) and polymerase, the stem of the molecular beacon is opened so that it can bind to the primer. This triggers target strand displacement polymerization, during which dsDNA is synthesized. The hybridized target is then displaced due to the strand displacement activity of the polymerase. The displaced target hybridizes with another molecular beacon. This triggers the next round of polymerization. Consequently, a large amount of dsDNA is formed which is detected by addition of SYBR Green. Thus, sensitive and selective fluorometric detection is realized. The fluorescent sensing strategy shows very good analytical performances towards DNA detection, such as a wide linear range from 0.05 to 25 nM with a low limit of detection of 20 pM. Graphical abstract Schematic of a fluorometric strategy for highly sensitive and selective determination of nucleic acids by combining strand displacement amplification and the unique features of SYBR Green I (SG) and polydopamine nanotubes.
An enzymatic fluorescent assay for the quantification of phosphite in a microtiter plate format.
Berkowitz, Oliver; Jost, Ricarda; Pearse, Stuart J; Lambers, Hans; Finnegan, Patrick M; Hardy, Giles E St J; O'Brien, Philip A
2011-05-01
A sensitive fluorometric assay for the quantification of phosphite has been developed. The assay uses the enzymatic oxidation of phosphite to phosphate by a recombinant phosphite dehydrogenase with NAD(+) as cosubstrate to produce the highly fluorescent reaction product resorufin. The optimized assay can be carried out in a 96-well microtiter plate format for high-throughput screening purposes and has a detection limit of 0.25 nmol phosphite. We used the method to quantify phosphite levels in plant tissue extracts and to determine phosphite dehydrogenase activity in transgenic plants. The assay is suitable for other biological or environmental samples. Because phosphite is a widely used fungicide to protect plants from pathogenic oomycetes, the assay provides a cost-effective and easy-to-use method to monitor the fate of phosphite following application. Copyright © 2011 Elsevier Inc. All rights reserved.
Absorbance and fluorometric sensing with capillary wells microplates.
Tan, Han Yen; Cheong, Brandon Huey-Ping; Neild, Adrian; Liew, Oi Wah; Ng, Tuck Wah
2010-12-01
Detection and readout from small volume assays in microplates are a challenge. The capillary wells microplate approach [Ng et al., Appl. Phys. Lett. 93, 174105 (2008)] offers strong advantages in small liquid volume management. An adapted design is described and shown here to be able to detect, in a nonimaging manner, fluorescence and absorbance assays minus the error often associated with meniscus forming at the air-liquid interface. The presence of bubbles in liquid samples residing in microplate wells can cause inaccuracies. Pipetting errors, if not adequately managed, can result in misleading data and wrong interpretations of assay results; particularly in the context of high throughput screening. We show that the adapted design is also able to detect for bubbles and pipetting errors during actual assay runs to ensure accuracy in screening.
In vitro effects of doxorubicin and tetrathiomolybdate on canine hemangiosarcoma cells.
Sloan, Caroline Q; Rodriguez, Carlos O
2018-02-01
OBJECTIVE To assess the in vitro effects of doxorubicin and tetrathiomolybdate (TM) on cells from a canine hemangiosarcoma cell line. SAMPLE Cultured cells from the canine hemangiosarcoma-derived cell line DEN-HSA. PROCEDURES Cells were treated with TM (0 to 1.5μM), doxorubicin (0 to 5μM), or both with or without 24 hours of pretreatment with ascorbic acid (750μM). Degree of cellular cytotoxicity was measured with a colorimetric assay. Long-term growth inhibition was assessed with a 10-day colony-formation assay. Induction of apoptosis was quantitated by fluorometric assessment of caspase-3 and -7 activation. Formation of reactive oxygen species (ROS) was also detected fluorometrically. RESULTS Exposure of cells to the combination of TM and doxorubicin resulted in a greater decrease in proliferation and clonogenic survival rates than exposure to each drug alone. This treatment combination increased ROS formation and apoptosis to a greater extent than did doxorubicin or TM alone. Ascorbic acid inhibited both TM-induced ROS formation and apoptosis. CONCLUSIONS AND CLINICAL RELEVANCE Results suggested that the enhancement in cytotoxic effects observed with DEN-HSA cell exposure to the combination of doxorubicin and TM was achieved through an increase in ROS production. These findings provide a rationale for a clinical trial of this treatment combination in dogs with hemangiosarcoma.
Bahreyni, Amirhossein; Yazdian-Robati, Rezvan; Hashemitabar, Shirin; Ramezani, Mohammad; Ramezani, Pouria; Abnous, Khalil; Taghdisi, Seyed Mohammad
2017-06-30
The common cancer treatment strategies like chemotherapy and radiotherapy are nonspecific and can trigger severe side effects by damaging normal cells. So, targeted cancer therapies, such as apoptosis induction, have attracted great attention in recent years. In this project, two nano-complexes, MUC1 aptamer-NAS-24 aptamer-Graphene oxide (GO) and MUC1 aptamer-Cytochrome C aptamer-GO, were designed to induce cell programmed death in MDA-MB-231 and MCF-7 cells (breast cancer cell lines) and to verify the level of apoptosis in both cell lines. MUC1 aptamer was a molecular recognition probe that led the internalization of two nano-complexes into MDA-MB-231 and MCF-7 cells (MUC1 positive cells) but not into HepG2 cell (liver cancer cell line, MUC1 negative cells). The apoptosis induction relied on binding of NAS-24 aptamer to its target, vimentin, in MDA-MB-231 and MCF-7 (target cells) with different levels of vimentin content. The function of first nano-complex was confirmed by binding of FAM-labeled cytochrome C aptamer to its target (cytochrome C) which was released from mitochondria, based on the function of the first nano-complex. Fluorometric analysis and gel retardation assay proved the formation of nano-complexes. The results of flow cytometry and fluorescence microscopy indicated efficient apoptosis induction just in target cells (MDA-MB-231 and MCF-7 cells) but not in non-target cells (HepG2 cell). The results of MTT assay also confirmed cell death process. Overall, our results proved excellent targeted apoptosis in breast cancer cells by designed nano-complexes which can be applied as an efficient cancer therapy method. Copyright © 2017 Elsevier B.V. All rights reserved.
Kumari, Amrita; Koyama, Tetsuo; Hatano, Ken; Matsuoka, Koji
2016-10-01
A tetravalent GlcNAc pendant glycocluster was constructed with terminal biotin through C6 linker. To acquire the multivalent carbohydrate-protein interactions, we synthesized a glycopolymer of tetrameric structure using N-acetyl-d-glucosamine (GlcNAc) as the target carbohydrate by the use of 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMT-MM) as coupling reagent, followed by biotin-avidin complexation leading to the formation of glycocluster of avidin-biotin-GlcNAc conjugate (ABG complex). The dynamic light scattering (DLS) system was implied for size detection and to check the binding affinity of GlcNAc conjugate with a WGA lectin we use fluorometric assay by means of specific excitation of tryptophan at λex 295nm and it was found to be very high Ka∼1.39×10(7) M(-1) in case of ABG complex as compared to GlcNAc only Ka∼1.01×10(4) M(-1) with the phenomenon proven to be due to glycocluster effect. Copyright © 2016 Elsevier Inc. All rights reserved.
Rapid detection of trace amounts of surfactants using nanoparticles in fluorometric assays
NASA Astrophysics Data System (ADS)
Härmä, Harri; Laakso, Susana; Pihlasalo, Sari; Hänninen, Pekka; Faure, Bertrand; Rana, Subhasis; Bergström, Lennart
2010-01-01
Rapid microtiter assays that utilize the time-resolved fluorescence resonance energy transfer or quenching of dye-labeled proteins adsorbed onto the surfaces of polystyrene or maghemite nanoparticles have been developed for the detection and quantification of trace amounts of surfactants at concentrations down to 10 nM.Rapid microtiter assays that utilize the time-resolved fluorescence resonance energy transfer or quenching of dye-labeled proteins adsorbed onto the surfaces of polystyrene or maghemite nanoparticles have been developed for the detection and quantification of trace amounts of surfactants at concentrations down to 10 nM. Electronic supplementary information (ESI) available: Experimental details and Fig. S1 and S2. See DOI: 10.1039/b9nr00172g
Briciu-Burghina, Ciprian; Heery, Brendan; Regan, Fiona
2015-09-07
E. coli β-glucuronidase (GUS) activity assays are routinely used in fields such as plant molecular biology, applied microbiology and healthcare. Methods based on the optical detection of GUS using synthetic fluorogenic substrates are widely employed since they don't require expensive instrumentation and are easy to perform. In this study three fluorogenic substrates and their respective fluorophores were studied for the purpose of developing a continuous fluorometric method for GUS. The fluorescence intensity of 6-chloro-4-methyl-umbelliferone (6-CMU) at pH 6.8 was found to be 9.5 times higher than that of 4-methyl umbelliferone (4-MU) and 3.2 times higher than the fluorescence of 7-hydroxycoumarin-3-carboxylic acid (3-CU). Michaelis-Menten kinetic parameters of GUS catalysed hydrolysis of 6-chloro-4-methyl-umbelliferyl-β-D-glucuronide (6-CMUG) were determined experimentally (Km = 0.11 mM, Kcat = 74 s(-1), Kcat/Km = 6.93 × 10(5) s(-1) M(-1)) and compared with the ones found for 4-methyl-umbelliferyl-β-D-glucuronide (4-MUG) (Km = 0.07 mM, Kcat = 92 s(-1), Kcat/Km = 1.29 × 10(6) s(-1) M(-1)) and 3-carboxy-umbelliferyl-β-D-glucuronide (3-CUG) (Km = 0.48 mM, Kcat = 35 s(-1), Kcat/Km = 7.40 × 10(4) s(-1) M(-1)). Finally a continuous fluorometric method based on 6-CMUG as a fluorogenic substrate has been developed for measuring GUS activity. When compared with the highly used discontinuous method based on 4-MUG as a substrate it was found that the new method is more sensitive and reproducible (%RSD = 4.88). Furthermore, the developed method is less laborious, faster and more economical and should provide an improved alternative for GUS assays and kinetic studies.
Glowing locked nucleic acids: brightly fluorescent probes for detection of nucleic acids in cells.
Østergaard, Michael E; Cheguru, Pallavi; Papasani, Madhusudhan R; Hill, Rodney A; Hrdlicka, Patrick J
2010-10-13
Fluorophore-modified oligonucleotides have found widespread use in genomics and enable detection of single-nucleotide polymorphisms, real-time monitoring of PCR, and imaging of mRNA in living cells. Hybridization probes modified with polarity-sensitive fluorophores and molecular beacons (MBs) are among the most popular approaches to produce hybridization-induced increases in fluorescence intensity for nucleic acid detection. In the present study, we demonstrate that the 2'-N-(pyren-1-yl)carbonyl-2'-amino locked nucleic acid (LNA) monomer X is a highly versatile building block for generation of efficient hybridization probes and quencher-free MBs. The hybridization and fluorescence properties of these Glowing LNA probes are efficiently modulated and optimized by changes in probe backbone chemistry and architecture. Correctly designed probes are shown to exhibit (a) high affinity toward RNA targets, (b) excellent mismatch discrimination, (c) high biostability, and (d) pronounced hybridization-induced increases in fluorescence intensity leading to formation of brightly fluorescent duplexes with unprecedented emission quantum yields (Φ(F) = 0.45-0.89) among pyrene-labeled oligonucleotides. Finally, specific binding between messenger RNA and multilabeled quencher-free MBs based on Glowing LNA monomers is demonstrated (a) using in vitro transcription assays and (b) by quantitative fluorometric assays and direct microscopic observation of probes bound to mRNA in its native form. These features render Glowing LNA as promising diagnostic probes for biomedical applications.
Absorbance and fluorometric sensing with capillary wells microplates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, Han Yen; Cheong, Brandon Huey-Ping; Neild, Adrian
2010-12-15
Detection and readout from small volume assays in microplates are a challenge. The capillary wells microplate approach [Ng et al., Appl. Phys. Lett. 93, 174105 (2008)] offers strong advantages in small liquid volume management. An adapted design is described and shown here to be able to detect, in a nonimaging manner, fluorescence and absorbance assays minus the error often associated with meniscus forming at the air-liquid interface. The presence of bubbles in liquid samples residing in microplate wells can cause inaccuracies. Pipetting errors, if not adequately managed, can result in misleading data and wrong interpretations of assay results; particularly inmore » the context of high throughput screening. We show that the adapted design is also able to detect for bubbles and pipetting errors during actual assay runs to ensure accuracy in screening.« less
Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer.
Chinnappan, Raja; AlAmer, Saleh; Eissa, Shimaa; Rahamn, Anas Abdel; Abu Salah, Khalid M; Zourob, Mohammed
2017-12-18
The work describes a fluorescence-based study for mapping the highest affinity truncated aptamer from the full length sequence and its integration in a graphene oxide platform for the detection of Salmonella enteriditis. To identify the best truncated sequence, molecular beacons and a displacement assay design are applied. In the fluorescence displacement assay, the truncated aptamer was hybridized with fluorescein and quencher-labeled complementary sequences to form a fluorescence/quencher pair. In the presence of S. enteritidis, the aptamer dissociates from the complementary labeled oligonucleotides and thus, the fluorescein/quencher pair becomes physically separated. This leads to an increase in fluorescence intensity. One of the truncated aptamers identified has a 2-fold lower dissociation constant (3.2 nM) compared to its full length aptamer (6.3 nM). The truncated aptamer selected in this process was used to develop a fluorometric graphene oxide (GO) based assay. If fluorescein-labeled aptamer is adsorbed on GO via π stacking interaction, fluorescence is quenched. However, in the presence of target (S. enteriditis), the labeled aptamers is released from surface to form a stable complex with the bacteria and fluorescence is restored, depending on the quantity of bacteria being present. The resulting assay has an unsurpassed detection limit of 25 cfu·mL -1 in the best case. The cross reactivity to Salmonella typhimurium, Staphylococcus aureus and Escherichia coli is negligible. The assay was applied to analyze doped milk samples for and gave good recovery. Thus, we believe that the truncated aptamer/graphene oxide platform is a potential tool for the detection of S. Enteritidis. Graphical abstract Fluorescently labelled aptamer against Salmonella enteritidis was adsorbed on the surface of graphene oxide by π-stacking interaction. This results in quenching of the fluorescence of the label. Addition of Salmonella enteritidis restores fluorescence, and this effect is used for quantification of this food-borne pathogen.
Yang, Dongqin; Luo, Minchuan; Di, Junwei; Tu, Yifeng; Yan, Jilin
2018-05-18
A method is described for ratiometric fluorometric assays of H 2 O 2 by using two probes that have distinct response profiles. Under the catalytic action of ferrous ion, the 615 nm emission of protein-stabilized gold nanoclusters (under 365 nm photoexcitation) is quenched by H 2 O 2 , while an increased signal is generated with a peak at 450 nm by oxidizing coumarin with the H 2 O 2 /Fe(II) system to form a blue emitting fluorophore. These decrease/increase responses give a ratiometric signal. The ratio of the fluorescences at the two peaks are linearly related to the concentration of H 2 O 2 in the range from 0.05 to 10 μM, with a 7.7 nM limit of detection. The detection scheme was further coupled to the urate oxidase catalyzed oxidation of uric acid which proceeds under the formation of H 2 O 2 . This method provides an simple and effective means for the construction of ratiometric fluorometric (enzymatic) assays that involve the detection of H 2 O 2 . Graphical abstract Under catalysis by ferrous ion, hydrogen peroxide quenches the luminescence of gold nanoclusters (AuNCs) and oxidizes coumarin into a fluorescent derivative, which rendered fluorescence ON and OFF at two distinct wavelengths for ratiometric measurements.
Fluorometric method of quantitative cell mutagenesis
Dolbeare, Frank A.
1982-01-01
A method for assaying a cell culture for mutagenesis is described. A cell culture is stained first with a histochemical stain, and then a fluorescent stain. Normal cells in the culture are stained by both the histochemical and fluorescent stains, while abnormal cells are stained only by the fluorescent stain. The two stains are chosen so that the histochemical stain absorbs the wavelengths that the fluorescent stain emits. After the counterstained culture is subjected to exciting light, the fluorescence from the abnormal cells is detected.
Fluorometric method of quantitative cell mutagenesis
Dolbeare, F.A.
1980-12-12
A method for assaying a cell culture for mutagenesis is described. A cell culture is stained first with a histochemical stain, and then a fluorescent stain. Normal cells in the culture are stained by both the histochemical and fluorescent stains, while abnormal cells are stained only by the fluorescent stain. The two stains are chosen so that the histochemical stain absorbs the wavelengths that the fluorescent stain emits. After the counterstained culture is subjected to exciting light, the fluorescence from the abnormal cells is detected.
NASA Astrophysics Data System (ADS)
Shahabadi, Nahid; Khorshidi, Aref; Moghadam, Neda Hossinpour
2013-10-01
In the present investigation, an attempt has been made to study the interaction of zonisamide (ZNS) with the transport protein, human serum albumin (HSA) employing UV-Vis, fluorometric, circular dichroism (CD) and molecular docking techniques. The results indicated that binding of ZNS to HSA caused strong fluorescence quenching of HSA through static quenching mechanism, hydrogen bonds and van der Waals contacts are the major forces in the stability of protein ZNS complex and the process of the binding of ZNS with HSA was driven by enthalpy (ΔH = -193.442 kJ mol-1). The results of CD and UV-Vis spectroscopy showed that the binding of this drug to HSA induced conformational changes in HSA. Furthermore, the study of molecular docking also indicated that zonisamide could strongly bind to the site I (subdomain IIA) of HSA mainly by hydrophobic interaction and there were hydrogen bond interactions between this drug and HSA, also known as the warfarin binding site.
NASA Astrophysics Data System (ADS)
Rui, Qing-Qing; Zhou, Yi; Fang, Yuan; Yao, Cheng
2016-04-01
Two new rhodamine B-based fluorescent probes PyRbS and PyRbO containing pyrene moiety were designed and synthesized. Both of the probes showed colorimetric and fluorometric sensing abilities for Hg2 + with high selectivity over other metal ions. The binding analysis using Job's plot suggested 1:1 stoichiometry for the complexes formed for Hg2 +. Compared with PyRbO, the PyRbS showed higher selectivity and sensitivity due to the thiophilic property of Hg2 + ion. The PyRbS exhibited the linear fluorescence quenching to Hg2 + in the range of 0.3 to 4.8 μM (λex = 365 nm) and 0.3 to 5.4 μM (λex = 515 nm), and the detection limit was 0.72 μM. Moreover, ratiometric changes of PyRbS with Hg2 + in absorption spectrum were observed, which could not be obtained in the combination of PyRbO with Hg2 +. In addition, the methyl thiazolyl tetrazolium (MTT) assay demonstrated that RbPyS had low cytotoxicity and was successfully used to monitor intracellular Hg2 + levels in living cells.
A fluorometric determination of urinary 17-hydroxycorticosteroids using benzamidine.
Yamaguchi, Y; Seki, T
1984-10-01
A fluorometric determination of urinary 17-hydroxycorticosteroids using a reaction of benzamidine with compounds carrying the dihydroxyacetone side chain is described. The fluorescent compounds have excitation and emission maxima at 370 and 480 nm, respectively. The method includes enzymatic hydrolysis with beta-glucuronidase (EC 3.2.1.31, from Escherichia coli) and extraction with methylene chloride and generation of fluorescence in alkaline solution (pH 13.4). The specificity of the reaction was examined and the results were compared with those of an accepted method based on the Porter-Silber reaction (C. C. Porter and R. H. Silber, 1950, J. Biol. Chem. 185, 201-207). The coefficient of correlation was 0.945 with regression line of y = 0.91x + 0.7 mg/day (y, present method; x, Porter-Silber reaction method). Sensitivity of the reaction was 0.5 microgram/ml of standard or sample, mean recovery of cortisol added to five urine samples (5-micrograms addition) was 95%, and the coefficient of variation of the method (five repeated assays of sample with a value of 5.2 mg/liter) was 6.2%.
Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori
2006-11-01
The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.
Repellents Inhibit P450 Enzymes in Stegomyia (Aedes) aegypti
Jaramillo Ramirez, Gloria Isabel; Logan, James G.; Loza-Reyes, Elisa; Stashenko, Elena; Moores, Graham D.
2012-01-01
The primary defence against mosquitoes and other disease vectors is often the application of a repellent. Despite their common use, the mechanism(s) underlying the activity of repellents is not fully understood, with even the mode of action of DEET having been reported to be via different mechanisms; e.g. interference with olfactory receptor neurones or actively detected by olfactory receptor neurones on the antennae or maxillary palps. In this study, we discuss a novel mechanism for repellence, one of P450 inhibition. Thirteen essential oil extracts from Colombian plants were assayed for potency as P450 inhibitors, using a kinetic fluorometric assay, and for repellency using a modified World Health Organisation Pesticide Evaluations Scheme (WHOPES) arm-in cage assay with Stegomyia (Aedes) aegypti mosquitoes. Bootstrap analysis on the inhibition analysis revealed a significant correlation between P450-inhibition and repellent activity of the oils. PMID:23152795
Sensitive method to monitor trace quantities of benzanthrone in workers of dyestuff industries
DOE Office of Scientific and Technical Information (OSTI.GOV)
Joshi, A.; Khanna, S.K.; Singh, G.B.
1986-03-01
Dyestuff workers coming in contact with benzanthrone (an intermediate used for the synthesis of a variety of dyes) develop skin lesions, gastritis, liver malfunctions, and sexual disturbances. A highly sensitive fluorometric method to monitor trace quantities of benzanthrone in urine, serum, and biological tissues for experimental studies, has been developed. Coupled with simple extraction and resolution, optimum fluorescence is obtained in an equal mixture of chloroform:methanol, detecting as low as 2 ng benzanthrone. This method is approximately 250 times more sensitive than currently available colorimetric assay.
Sengupta, Abhigyan; Sasikala, Wilbee D; Mukherjee, Arnab; Hazra, Partha
2012-06-04
Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) are derivatives of riboflavin (RF), a water-soluble vitamin, more commonly known as vitamin B(2). Flavins have attracted special attention in the last few years because of the recent discovery of a large number of flavoproteins. In this work, these flavins are used as extrinsic fluorescence markers for probing the microheterogeneous environment of a well-known transport protein, human serum albumin (HSA). Steady-state and time-resolved fluorescence experiments confirm that both FMN and FAD bind to the Sudlow's site-1 (SS1) binding pocket of HSA, where Trp214 resides. In the case of RF, a fraction of RF molecules binds at the SS1, whereas the major fraction of RF molecules remains unbound or surface bound to the protein. Moreover, flavin(s)-HSA interactions are monitored with the help of isothermal titration calorimetry, which provides free energy, enthalpy, and entropy changes of binding along with the binding constants. The molecular picture of binding interaction between flavins and HSA is well explored by docking and molecular dynamics studies. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tracey, Matthew P; Pham, Dianne; Koide, Kazunori
2015-07-21
Neither palladium nor platinum is an endogenous biological metal. Imaging palladium in biological samples, however, is becoming increasingly important because bioorthogonal organometallic chemistry involves palladium catalysis. In addition to being an imaging target, palladium has been used to fluorometrically image biomolecules. In these cases, palladium species are used as imaging-enabling reagents. This review article discusses these fluorometric methods. Platinum-based drugs are widely used as anticancer drugs, yet their mechanism of action remains largely unknown. We discuss fluorometric methods for imaging or quantifying platinum in cells or biofluids. These methods include the use of chemosensors to directly detect platinum, fluorescently tagging platinum-based drugs, and utilizing post-labeling to elucidate distribution and mode of action.
Fluorometric procedures for dye tracing
Wilson, James F.; Cobb, Ernest D.; Kilpatrick, F.A.
1986-01-01
This manual describes the current fluorometric procedures used by the U.S. Geological Survey in dye tracer studies such as time of travel, dispersion, reaeration, and dilution-type discharge measurements. The advantages of dye tracing are (1) low detection and measurement limits and (2) simplicity and accuracy in measuring dye tracer concentrations using fluorometric techniques. The manual contains necessary background information about fluorescence, dyes, and fluorometers and a description of fluorometric operation and calibration procedures as a guide for laboratory and field use. The background information should be useful to anyone wishing to experiment with dyes, fluorometer components, or procedures different from those described. In addition, a brief section on aerial photography is included because of its possible use to supplement ground-level fluorometry.
Fluorometric procedures for dye tracing
Wilson, James F.
1968-01-01
This manual describes the current fluorometric procedures used by the U.S. Geological Survey in dye tracer studies such as time of travel, dispersion, reaeration, and dilution-type discharge measurements. The advantages of dye tracing are (1) low detection and measurement limits and (2) simplicity and accuracy in measuring dye tracer concentrations using fluorometric techniques. The manual contains necessary background information about fluorescence, dyes, and fluorometers and a description of fluorometric operation and calibration procedures as a guide for laboratory and field use. The background information should be useful to anyone wishing to experiment with dyes, fluorometer components, or procedures different from those described. In addition, a brief section on aerial photography is included because of its possible use to supplement ground-level fluorometry.
Fluorometric procedures for dye tracing
Wilson, James E.; Cobb, Ernest D.; Kilpatrick, Frederick A.
1984-01-01
This manual describes the current fluorometric procedures used by the U.S. Geological Survey in dye tracer studies such as time of travel, dispersion, reaeration, and dilution-type discharge measurements. The outstanding characteristics of dye tracing are: (1) the low detection and measurement limits, and (2) the simplicity and accuracy of measuring dye tracer concentrations using fluorometric techniques. The manual contains necessary background information about fluorescence, dyes, and fluorometers and a description of fluorometric operation and calibration procedures as a general guide for laboratory and field use. The background information should be useful to anyone wishing to experiment with dyes, fluorometer components, or procedures different from those described. In addition, a brief section is included on aerial photography because of its possible use to supplement ground-level fluorometry.
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-01-01
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-05-23
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.
Rui, Qing-Qing; Zhou, Yi; Fang, Yuan; Yao, Cheng
2016-04-15
Two new rhodamine B-based fluorescent probes PyRbS and PyRbO containing pyrene moiety were designed and synthesized. Both of the probes showed colorimetric and fluorometric sensing abilities for Hg(2+) with high selectivity over other metal ions. The binding analysis using Job's plot suggested 1:1 stoichiometry for the complexes formed for Hg(2+). Compared with PyRbO, the PyRbS showed higher selectivity and sensitivity due to the thiophilic property of Hg(2+) ion. The PyRbS exhibited the linear fluorescence quenching to Hg(2+) in the range of 0.3 to 4.8 μM (λ(ex)=365 nm) and 0.3 to 5.4 μM (λ(ex)=515 nm), and the detection limit was 0.72 μM. Moreover, ratiometric changes of PyRbS with Hg(2+) in absorption spectrum were observed, which could not be obtained in the combination of PyRbO with Hg(2+). In addition, the methyl thiazolyl tetrazolium (MTT) assay demonstrated that RbPyS had low cytotoxicity and was successfully used to monitor intracellular Hg(2+) levels in living cells. Copyright © 2016 Elsevier B.V. All rights reserved.
Advanced Glycation End-products and Bone Fractures.
Vashishth, Deepak
2009-08-01
Bone does not turn over uniformly, and becomes susceptible to post-translational modification by non-enzymatic glycation (NEG). NEG of bone causes the formation of advanced glycation end-products (AGEs) and this process is accelerated with aging, diabetes and antiresorptive postmenopausal osteoporosis therapy. Due to the elevated incidence of fracture associated with aging and diabetes, several studies have attempted to measure and evaluate AGEs as biomarkers for fracture risk. Here current methods of estimating AGEs in bone by liquid chromatography and fluorometric assay are summarized and the relationships between AGEs and fracture properties at whole bone, apparent tissue and matrix levels are discussed.
Melancon, M.J.; Rattner, B.A.; Rice, C.P.; Hines, R.K.; Eisemann, J.
1992-01-01
In a continuation of our studies on the use of hepatic cytochromes P450 as a biomarker for contaminant exposure, BCNH eggs were collected from Baltimore Harbor (BH) (n = 20), Washington National Zoo (WNZ) (n = 13) and Chincoteague National Wildlife Refuge (CNWR) (reference location) (n = 20). Eggs were artificially incubated and sacrificed at pipping. Livers were snap frozen in liquid nitrogen and stored at -80?C until assay. Hepatic microsomes were prepared by differential centrifugation of homogenates and assayed for protein, benzyloxy-resorufin-O-dealkylase, (BROD) ethoxyresorufinO-dealkylase (EROD) and pentoxyresorufin-O-dealkylase (PROD). Monooxygenase assays were run in triplicate using a computer-coupled fluorometric microwell plate scanner. Values for EROD and BROD, but not PROD, from BH and WNZ were significantly greater (approximately double) than those from CNWR. Organochlorine pesticide residues were much higher in carcasses from BH and WNZ as compared to CNWR. Carcasses are presently being analyzed for PCB congeners.
Artemisinin induces ROS-mediated caspase3 activation in ASTC-a-1 cells
NASA Astrophysics Data System (ADS)
Xiao, Feng-Lian; Chen, Tong-Sheng; Qu, Jun-Le; Liu, Cheng-Yi
2010-02-01
Artemisinin (ART), an antimalarial phytochemical from the sweet wormwood plant or a naturally occurring component of Artemisia annua, has been shown a potential anticancer activity by apoptotic pathways. In our report, cell counting kit (CCK-8) assay showed that treatment of human lung adenocarcinoma (ASTC-a-1) cells with ART effectively increase cell death by inducing apoptosis in a time- and dose-dependent fashion. Hoechst 33258 staining was used to detect apoptosis as well. Reactive oxygen species (ROS) generation was observed in cells exposed to ART at concentrations of 400 μM for 48 h. N-acetyl-L-cysteine (NAC), an oxygen radical scavenger, suppressed the rate of ROS generation and inhibited the ART-induced apoptosis. Moreover, AFC assay (Fluorometric assay for Caspase3 activity) showed that ROS was involved in ART-induced caspase3 acitvation. Taken together, our data indicate that ART induces ROS-mediated caspase3 activation in a time-and dose-dependent way in ASCT-a-1 cells.
Ummarino, Simone; Mozzon, Massimo; Zamporlini, Federica; Amici, Adolfo; Mazzola, Francesca; Orsomando, Giuseppe; Ruggieri, Silverio; Raffaelli, Nadia
2017-04-15
Nicotinamide riboside, the most recently discovered form of vitamin B3, and its phosphorylated form nicotinamide mononucleotide, have been shown to be potent supplements boosting intracellular nicotinamide adenine dinucleotide (NAD) levels, thus preventing or ameliorating metabolic and mitochondrial diseases in mouse models. Here we report for the first time on the simultaneous quantitation of nicotinamide riboside, nicotinamide mononucleotide and NAD in milk by means of a fluorometric, enzyme-coupled assay. Application of this assay to milk from different species revealed that the three vitamers were present in human and donkey milk, while being selectively distributed in the other milks. Human milk was the richest source of nicotinamide mononucleotide. Overall, the three vitamers accounted for a significant fraction of total vitamin B3 content. Pasteurization did not affect the bovine milk content of nicotinamide riboside, whereas UHT processing fully destroyed the vitamin. In human milk, NAD levels were significantly affected by the lactation time. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOT National Transportation Integrated Search
1971-04-01
An automated fluorometric trihydroxyindole procedure is described for the measurement of norepinephrine (NE) and epinephrine (E) in blood plasma or urine. The method employs conventional techniques for isolation of the catecholamines by alumina colum...
Hu, Teh-Min; Chiu, Shih-Jiuan; Hsu, Yu-Ming
2014-08-22
Simultaneous production of nitric oxide (NO) and superoxide generates peroxynitrite and causes nitroxidative stress. The fluorometric method for NO detection is based on the formation of a fluorescent product from the reaction of a nonfluorescent probe molecule with NO-derived nitrosating species. Here, we present an example of how nitroxidative chemistry could interact with fluorescent probe chemistry. 2,3-Naphthotriazole (NAT) is the NO-derived fluorescent product of 2,3-diaminonaphthalene (DAN), a commonly used NO-detecting molecule. We show that NO/superoxide cogeneration, and particularly peroxynitrite, mediates the chemical decomposition of NAT. Moreover, the extent of NAT decomposition depends on the relative fluxes of NO and superoxide; the maximum effect being reached at almost equivalent generation rates for both radicals. The rate constant for the reaction of NAT with peroxynitrite was determined to be 2.2×10(3)M(-1)s(-1). Further, various peroxynitrite scavengers were shown to effectively inhibit NO/superoxide- and peroxynitrite-mediated decomposition of NAT. Taken together, the present study suggests that the interference of a fluorometric NO assay can be originated from the interaction between the final fluorescent product and the formed reactive nitrogen and oxygen species. Copyright © 2014 Elsevier Inc. All rights reserved.
Fluorometric prediction of successful amputation level in the ischemic limb.
Silverman, D G; Rubin, S M; Reilly, C A; Brousseau, D A; Norton, K J; Wolf, G L
1985-01-01
The present study was undertaken to compare fluorometric documentation of fluorescein dye delivery with the standard means of determining the level at which an amputation should be performed in the dysvascular extremity. Thirty-nine patients underwent lower-extremity amputation at the level determined by the surgeon based upon physical examination, angiography, segmental pressure indices, and/or pulse volume recordings. In addition, fiberoptic fluorometry was performed preoperatively. After intravenous administration of sodium fluorescein (4-8 mg/kg), fluorometric readings were obtained by placing the fluorometer's light guide on 126 reading sites. Fluorometric findings were evaluated retrospectively, and therefore did not influence the surgeon's decision. Of the 39 amputations performed overall, only 26 healed. The accuracy of the standard criteria was lowest for the 20 below-ankle amputations, where only 12 cases healed. Alternatively, fluorometric indices separated healing from nonhealing sites in 36 of the 39 cases and in 18 of the 20 below-ankle amputations. Overall, healing sites averaged 94 percent of the fluorescence of the healthy reference area, while nonhealing sites averaged only 29 percent. We conclude that fluorometry should prove to be a valuable adjunct in the assessment of the dysvascular extremity. It uses a low dose of dye, is easy to perform, and is readily repeatable.
Novel assay procedures for the measurement of α-amylase in weather-damaged wheat.
Cornaggia, Claudio; Ivory, Ruth; Mangan, David; McCleary, Barry V
2016-01-30
The measurement of α-amylase (EC 3.2.1.1) in sprout-damaged grains is a crucial analysis yet a problematic one owing to the typically low α-amylase levels in ground wheat samples. A number of standardised methods such as the Falling Number method and the Ceralpha method exist which are routinely used for the assay of α-amylase. These methods, however, are either highly substrate-dependent or lack the required sensitivity to assess sprout damage. Novel colorimetric and fluorometric reagents have been prepared (Amylase HR, Amylase SD, BzCNPG7 reagent and BzMUG7 reagent) for the direct and specific assay of α-amylase activity in sprout-damaged wheat. Assays employing these reagents have been developed and optimised to include a decolourisation step using activated charcoal. When used in a convenient assay format, Amylase SD--containing EtNPG7 (II) as the colorimetric substrate and α-glucosidase as the ancillary enzyme--was found to be an excellent reagent for the assessment of sprout damage in wheat with incubation times as short as 5 min. The assay using Amylase SD is completely specific for α-amylase. The use of the Amylase SD assay represents a sensitive and valid alternative to the traditionally used Falling Number values for the assessment of sprout damage in wheat samples. © 2015 Society of Chemical Industry.
Cieniak, Carolina; Liu, Rui; Fottinger, Alexandra; Smiley, Sheila A M; Guerrero-Analco, Jose A; Bennett, Steffany A L; Haddad, Pierre S; Cuerrier, Alain; Saleem, Ammar; Arnason, John T; Foster, Brian C
2013-12-12
Interactions between conventional drug and traditional medicine therapies may potentially affect drug efficacy and increase the potential for adverse reactions. Cree traditional healing is holistic and patients may use medicinal plants simultaneously with the conventional drugs. However, there is limited information that these medicinal plants may interact with drugs and additional mechanistic information is required. In this study, extracts from traditionally used Cree botanicals were assessed for their potential interaction that could alter the disposition of two blood glucose lowering drugs, gliclazide (Diamicron) and repaglinide (Gluconorm) though inhibition of either metabolism or transport across cell membranes. The effect of 17 extracts on metabolism was examined in a human liver microsome assay by HPLC and individual cytochrome P450s 2C9, 2C19, 2C8 and 3A4 in a microplate fluorometric assay. Gliclazide, rhaponticin and its aglycone derivative, rhapontigenin were also examined in the fluorometric assay. The effect on transport was examined with 11 extracts using the intestinal epithelial Caco-2 differentiated cell monolayer model at times up to 180 min. Both blood glucose lowering medications, gliclazide and repaglinide traversed the Caco-2 monolayer in a time-dependent manner that was not affected by the Cree plant extracts. Incubation of the Cree plant extracts inhibited CYP2C9, 2C19, 2C8 and 3A4-mediated metabolism, and the formation of four repaglinide metabolites: M4, m/z 451-A, m/z 451-B and the glucuronide of repaglinide in the human liver microsome assay. Gliclazide caused no significant inhibition. Likewise, rhaponticin had little effect on the enzymes causing changes of less than 10% with an exception of 17% inhibition of CYP2C19. By contrast, the aglycone rhapontigenin showed the greatest effects on all CYP-mediated metabolism. Its inhibition ranged from a mean of 58% CYP3A4 inhibition to 89% inhibition of CYP2C9. While rhaponticin and the aglycone did not show significant effects on repaglinide metabolism, they demonstrated inhibition of gliclazide metabolism. The aglycone significantly affected levels of gliclazide and its metabolites. These studies demonstrate that the Cree plant extracts examined have the potential in vitro to cause drug interactions through effects on key metabolic enzymes. © 2013 Elsevier Ireland Ltd. All rights reserved.
Sista, Ramakrishna S; Wang, Tong; Wu, Ning; Graham, Carrie; Eckhardt, Allen; Winger, Theodore; Srinivasan, Vijay; Bali, Deeksha; Millington, David S; Pamula, Vamsee K
2013-09-23
New therapies for lysosomal storage diseases (LSDs) have generated interest in screening newborns for these conditions. We present performance validation data on a digital microfluidic platform that performs multiplex enzymatic assays for Pompe, Fabry, Hunter, Gaucher, and Hurler diseases. We developed an investigational disposable digital microfluidic cartridge that uses a single dried blood spot (DBS) punch for performing a 5-plex fluorometric enzymatic assay on up to 44 DBS samples. Precision and linearity of the assays were determined by analyzing quality control DBS samples; clinical performance was determined by analyzing 600 presumed normal and known affected samples (12 for Pompe, 7 for Fabry and 10 each for Hunter, Gaucher and Hurler). Overall coefficient of variation (CV) values between cartridges, days, instruments, and operators ranged from 2 to 21%; linearity correlation coefficients were ≥0.98 for all assays. The multiplex enzymatic assay performed from a single DBS punch was able to discriminate presumed normal from known affected samples for 5 LSDs. Digital microfluidic technology shows potential for rapid, high-throughput screening for 5 LSDs in a newborn screening laboratory environment. Sample preparation to enzymatic activity on each cartridge is less than 3h. Copyright © 2013 Elsevier B.V. All rights reserved.
Jackson, Colin R.; Tyler, Heather L.; Millar, Justin J.
2013-01-01
Much of the nutrient cycling and carbon processing in natural environments occurs through the activity of extracellular enzymes released by microorganisms. Thus, measurement of the activity of these extracellular enzymes can give insights into the rates of ecosystem level processes, such as organic matter decomposition or nitrogen and phosphorus mineralization. Assays of extracellular enzyme activity in environmental samples typically involve exposing the samples to artificial colorimetric or fluorometric substrates and tracking the rate of substrate hydrolysis. Here we describe microplate based methods for these procedures that allow the analysis of large numbers of samples within a short time frame. Samples are allowed to react with artificial substrates within 96-well microplates or deep well microplate blocks, and enzyme activity is subsequently determined by absorption or fluorescence of the resulting end product using a typical microplate reader or fluorometer. Such high throughput procedures not only facilitate comparisons between spatially separate sites or ecosystems, but also substantially reduce the cost of such assays by reducing overall reagent volumes needed per sample. PMID:24121617
Jackson, Colin R; Tyler, Heather L; Millar, Justin J
2013-10-01
Much of the nutrient cycling and carbon processing in natural environments occurs through the activity of extracellular enzymes released by microorganisms. Thus, measurement of the activity of these extracellular enzymes can give insights into the rates of ecosystem level processes, such as organic matter decomposition or nitrogen and phosphorus mineralization. Assays of extracellular enzyme activity in environmental samples typically involve exposing the samples to artificial colorimetric or fluorometric substrates and tracking the rate of substrate hydrolysis. Here we describe microplate based methods for these procedures that allow the analysis of large numbers of samples within a short time frame. Samples are allowed to react with artificial substrates within 96-well microplates or deep well microplate blocks, and enzyme activity is subsequently determined by absorption or fluorescence of the resulting end product using a typical microplate reader or fluorometer. Such high throughput procedures not only facilitate comparisons between spatially separate sites or ecosystems, but also substantially reduce the cost of such assays by reducing overall reagent volumes needed per sample.
NASA Technical Reports Server (NTRS)
Bonner, J.
1976-01-01
A highly sensitive fluorometric technique is developed for the determination of biological and geo-organic compounds in ancient sediments and extraterrestrial samples. This technique is used to establish chemical evidence for fossil pigments in an extraterrestrial sample. Also developed is a highly sensitive and specific fluorometric method for the determination of total primary amine nitrogen in soil samples.
Duan, Nuo; Wu, Shijia; Zhang, Huiling; Zou, Ying; Wang, Zhouping
2018-05-18
An F 0 F 1 -ATPase-based aptasensor is described for the fluorometric determination of Vibrio parahaemolyticus. Chromatophores containing F 0 F 1 -ATPases were first prepared from Rhodospirillum rubrum cells. Then, an aptamer-functionalized chromatophore acts as the capture probe, and a chromatophore labeled with the pH probe fluorescein acts as the signalling probe. In the presence of V. parahaemolyticus, the rotation rate of F 0 F 1 -ATPase is decreased due to the formation of the aptamer-chromatophore complex. This leads to a retarded proton flux out of the chromatophores. As a result, the pH value inside the chromatophores is reduced, and the fluorescence of the pH probe F1300 is accordingly decreased. The relative fluorescence varies linearly over the 15 to 1.5 × 10 6 cfu·mL -1 Vibrio parahaemolyticus concentration range, and the limit of detection is 15 cfu·mL -1 . The method was applied to analyze artificially contaminated salmon samples where it showed excellent perfomance. Graphical abstract In this assay, aptamer functionalized chromatophores act as a capture probe, and the fluoresce in labeled chromatophores as signalling probe. The formation of aptamer-chromatophore complex leads to a retarded proton flux out of the chromatophores. As a result, the pH value inside the chromatophores is reduced, and fluorescence intensity is accordingly decreased.
Critical ligand binding reagent preparation/selection: when specificity depends on reagents.
Rup, Bonita; O'Hara, Denise
2007-05-11
Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.
Analysis of Ethylene Receptors: Ethylene-Binding Assays.
Binder, Brad M; Schaller, G Eric
2017-01-01
Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.
Monoclonal antibodies to human vitamin D-binding protein.
Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F
1985-01-01
Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035
Murakami, Chiaki; Mizuno, Satoru; Kado, Sayaka; Sakane, Fumio
2017-06-01
Phosphatidylcholine (PC)-specific phospholipase C (PC-PLC) hydrolyzes PC to generate the second messenger 1,2-diacylglycerol (DG) and phosphocholine. PC-PLC plays pivotal roles in inflammation, carcinogenesis, tumor progression, atherogenesis, and subarachnoid hemorrhage. Although the activity of PC-PLC in mammalian tissues was discovered approximately 40 years ago, neither the protein nor its gene has been identified. In the present study, we developed a non-radioactive enzyme activity assay for PC-PLC based on mass spectrometric detection of DG following HPLC separation. This new liquid chromatography-mass spectrometry (LC-MS) assay directly determines a specific reaction product, 1-palmitoyl-2-oleoyl-DG, that is generated from 1-palmitoyl-2-oleoyl-PC by purified Bacillus cereus PC-PLC. The LC-MS assay offers several advantages including a lower background (0.02% versus 91%), higher signal background ratio (4242 versus 1.06)/signal noise ratio (7494 versus 4.4), higher sensitivity (≥32-fold), and lower limit of quantitation (0.04 pmol versus 0.69 pmol of PC-PLC), than a conventional fluorometric assay, which indirectly detects phosphocholine produced in the reaction. In addition to Bacillus cereus PC-PLC, the LC-MS assay was applicable to the measurement of mammalian PC-PLC prepared from the mouse brain. The radioisotope-free, highly sensitive and precise LC-MS assay for PC-PLC would be useful for the purification and identification of PC-PLC protein. Copyright © 2017 Elsevier Inc. All rights reserved.
Čapek, Jan; Hauschke, Martina; Brůčková, Lenka; Roušar, Tomáš
2017-11-01
Fluorometric glutathione assays have been generally preferred for their high specificity and sensitivity. An additional advantage offered by fluorescent bimane dyes is their ability to penetrate inside the cell. Their ability to react with glutathione within intact cells is frequently useful in flow cytometry and microscopy. Hence, the aims of our study were to use monochlorobimane for optimizing a spectrofluorometric glutathione assay in cells and then to compare that assay with the frequently used ortho-phthalaldehyde assay. We used glutathione-depleting agents (e.g., cisplatin and diethylmalonate) to induce cell impairment. For glutathione assessment, monochlorobimane (40μM) was added to cells and fluorescence was detected at 394/490nm. In addition to the regularly used calculation of glutathione levels from fluorescence change after 60min, we used an optimized calculation from the linear part of the fluorescence curve after 10min of measurement. We found that 10min treatment of cells with monochlorobimane is sufficient for evaluating cellular glutathione concentration and provides results entirely comparable with those from the standard ortho-phthalaldehyde assay. In contrast, the results obtained by the standardly used evaluation after 60min of monochlorobimane treatment provided higher glutathione values. We conclude that measuring glutathione using monochlorobimane with the here-described optimized evaluation of fluorescence signal could be a simple and useful method for routine and rapid assessment of glutathione within intact cells in large numbers of samples. Copyright © 2017 Elsevier Inc. All rights reserved.
Spectrometric microbiological analyzer
NASA Astrophysics Data System (ADS)
Schlager, Kenneth J.; Meissner, Ken E.
1996-04-01
Currently, there are four general approaches to microbiological analysis, i.e., the detection, identification and quantification of micro-organisms: (1) Traditional culturing and staining procedures, metabolic fermentations and visual morphological characteristics; (2) Immunological approaches employing microbe-specific antibodies; (3) Biotechnical techniques employing DNA probes and related genetic engineering methods; and (4) Physical measurement techniques based on the biophysical properties of micro-organisms. This paper describes an instrumentation development in the fourth of the above categories, physical measurement, that uses a combination of fluorometric and light scatter spectra to detect and identify micro-organisms at the species level. A major advantage of this approach is the rapid turnaround possible in medical diagnostic or water testing applications. Fluorometric spectra serve to define the biochemical characteristics of the microbe, and light scatter spectra the size and shape morphology. Together, the two spectra define a 'fingerprint' for each species of microbe for detection, identification and quantification purposes. A prototype instrument has been developed and tested under NASA sponsorship based on fluorometric spectra alone. This instrument demonstrated identification and quantification capabilities at the species level. The paper reports on test results using this instrument, and the benefits of employing a combination of fluorometric and light scatter spectra.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giulliani, S. E.; Frank, A. E.; Collart, F. R.
2008-12-08
We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less
Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.
Schuller, Marion; Höfner, Georg; Wanner, Klaus T
2017-10-09
MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Comparison of functional assays used in the clinical development of a placental malaria vaccine.
Pehrson, Caroline; Heno, Kristine K; Adams, Yvonne; Resende, Mafalda; Mathiesen, Line; Soegaard, Max; de Jongh, Willem A; Theander, Thor G; Salanti, Ali; Nielsen, Morten A
2017-01-23
Malaria in pregnancy is associated with significant morbidity in pregnant women and their offspring. Plasmodium falciparum infected erythrocytes (IE) express VAR2CSA that mediates binding to chondroitin sulphate A (CSA) in the placenta. Two VAR2CSA-based vaccines for placental malaria are in clinical development. The purpose of this study was to evaluate the robustness and comparability of binding inhibition assays used in the clinical development of placental malaria vaccines. The ability of sera from animals immunised with different VAR2CSA constructs to inhibit IE binding to CSA was investigated in three in vitro assays using 96-well plates, petri dishes, capillary flow and an ex vivo placental perfusion assay. The inter-assay variation was not uniform between assays and ranged from above ten-fold in the flow assay to two-fold in the perfusion assay. The intra-assay variation was highest in the petri dish assay. A positive correlation between IE binding avidity and the level of binding after antibody inhibition in the petri dish assay indicate that high avidity IE binding is more difficult to inhibit. The highest binding inhibition sensitivity was found in the 96-well and petri dish assays compared to the flow and perfusion assays where binding inhibition required higher antibody titers. The inhibitory capacity of antibodies is not easily translated between assays and the high sensitivity of the 96-well and petri dish assays stresses the need for comparing serial dilutions of serum. Furthermore, IE binding avidity must be in the same range when comparing data from different days. There was an overall concordance in the capacity of antibody-mediated inhibition, when comparing the in vitro assays with the perfusion assay, which more closely represents in vivo conditions. Importantly the ID1-ID2a protein in a liposomal formulation, currently in a phase I trial, effectively induced antibodies that inhibited IE adhesion in placental tissue. Copyright © 2016. Published by Elsevier Ltd.
Filonova, Lada; Kallas, Asa M; Greffe, Lionel; Johansson, Gunnar; Teeri, Tuula T; Daniel, Geoffrey
2007-01-01
Carbohydrate binding modules (CBMs) are noncatalytic substrate binding domains of many enzymes involved in carbohydrate metabolism. Here we used fluorescent labeled recombinant CBMs specific for crystalline cellulose (CBM1(HjCel7A)) and mannans (CBM27(TmMan5) and CBM35(CjMan5C)) to analyze the complex surfaces of wood tissues and pulp fibers. The crystalline cellulose CBM1(HjCel7A) was found as a reliable marker of both bacterially produced and plant G-layer cellulose, and labeling of spruce pulp fibers with CBM1(HjCel7A) revealed a signal that increased with degree of fiber damage. The mannan-specific CBM27(TmMan5) and CBM35(CjMan5C) CBMs were found to be more specific reagents than a monoclonal antibody specific for (1-->4)-beta-mannan/galacto-(1-->4)-beta-mannan for mapping carbohydrates on native substrates. We have developed a quantitative fluorometric method for analysis of crystalline cellulose accumulation on fiber surfaces and shown a quantitative difference in crystalline cellulose binding sites in differently processed pulp fibers. Our results indicated that CBMs provide useful, novel tools for monitoring changes in carbohydrate content of nonuniform substrate surfaces, for example, during wood or pulping processes and possibly fiber biosynthesis.
Krivanek, Peter; Koppatz, Karl; Turnheim, Klaus
2003-06-01
A rapid and low-cost assay for simultaneous vigabatrin (VGA) and gabapentin (GBP) determination is described that can be performed with simple HPLC instrumentation. The method involves derivatization of the primary amine group of VGA and GBP with dansyl chloride followed by isocratic separation (column: microBondapak C-18, 10 microm, 300 x 3.9 mm; mobile phase: 50 mmol/L NaH(2)PO(4) in 40% acetonitrile) at 50 degrees C and fluorometric detection (excitation and emission wavelength: 318 and 510 nm, respectively) of the fluorescent product, which is stable for at least 7 days. Correlation coefficients of the calibration curves are >0.999 with a lower limit of detection of 0.3 microg/mL. Between- and within-run coefficients of variation are below 4.5%, and assay time is 15 minutes. This method may be used for therapeutic drug monitoring in the case of GBP and to control patient compliance in the case of VGA.
Xu, Shenghao; Feng, Xiuying; Gao, Teng; Wang, Ruizhi; Mao, Yaning; Lin, Jiehua; Yu, Xijuan; Luo, Xiliang
2017-03-15
A novel ultrasensitive dual-functional biosensor for highly sensitive detection of inorganic pyrophosphate (PPi) and pyrophosphatase (PPase) activity was developed based on the fluorescent variation of globulin protected gold nanoclusters (Glo@Au NCs) with the assistance of Cu 2+ . Glo@Au NCs and PPi were used as the fluorescent indicator and substrate for PPase activity evaluation, respectively. In the presence of Cu 2+ , the fluorescence of the Glo@Au NCs will be quenched owing to the formation of Cu 2+ -Glo@Au NCs complex, while PPi can restore the fluorescence of the Cu 2+ -Glo@Au NCs complex because of its higher binding affinity with Cu 2+ . As PPase can catalyze the hydrolysis of PPi, it will lead to the release of Cu 2+ and re-quench the fluorescence of the Glo@Au NCs. Based on this mechanism, quantitative evaluation of the PPi and PPase activity can be achieved ranging from 0.05 μM to 218.125 μM for PPi and from 0.1 to 8 mU for PPase, with detection limits of 0.02 μM and 0.04 mU, respectively, which is much lower than that of other PPi and PPase assay methods. More importantly, this ultrasensitive dual-functional biosensor can also be successfully applied to evaluate the PPase activity in human serum, showing great promise for practical diagnostic applications. Copyright © 2016 Elsevier B.V. All rights reserved.
Microfluidic passive permeability assay using nanoliter droplet interface lipid bilayers.
Nisisako, Takasi; Portonovo, Shiva A; Schmidt, Jacob J
2013-11-21
Membrane permeability assays play an important role in assessing drug transport activities across biological membranes. However, in conventional parallel artificial membrane permeability assays (PAMPA), the membrane model used is dissimilar to biological membranes physically and chemically. Here, we describe a microfluidic passive permeability assay using droplet interface bilayers (DIBs). In a microfluidic network, nanoliter-sized donor and acceptor aqueous droplets are alternately formed in cross-flowing oil containing phospholipids. Subsequently, selective removal of oil through hydrophobic pseudo-porous sidewalls induces the contact of the lipid monolayers, creating arrayed planar DIBs between the donor and acceptor droplets. Permeation of fluorescein from the donor to the acceptor droplets was fluorometrically measured. From the measured data and a simple diffusion model we calculated the effective permeabilities of 5.1 × 10(-6) cm s(-1), 60.0 × 10(-6) cm s(-1), and 87.6 × 10(-6) cm s(-1) with donor droplets at pH values of 7.5, 6.4 and 5.4, respectively. The intrinsic permeabilities of specific monoanionic and neutral fluorescein species were obtained similarly. We also measured the permeation of caffeine in 10 min using UV microspectroscopy, obtaining a permeability of 20.8 × 10(-6) cm s(-1). With the small solution volumes, short measurement time, and ability to measure a wide range of compounds, this device has considerable potential as a platform for high-throughput drug permeability assays.
Jothikumar, Prithiviraj; Narayanan, Jothikumar; Hill, Vincent R
2014-03-01
Rapid and specific detection methods for bacterial agents in drinking water are important for disease prevention and responding to suspected contamination events. In this study, an isothermal Genome Exponential Amplification Reaction (GEAR) assay for Escherichia coli O157:H7 was designed specifically to recognize a 199-bp fragment of the lipopolysaccharide gene (rfbE) for rapid testing of water samples. The GEAR assay was found to be specific for E. coli O157:H7 using 10 isolates of E. coli O157:H7 and a panel of 86 bacterial controls. The GEAR assay was performed at a constant temperature of 65°C using SYTO 9 intercalating dye. Detection limits were determined to be 20 CFU for the GEAR assay. When SYTO 9 fluorescence was measured using a real-time PCR instrument, the assay had the same detection limit as when malachite green was added to the reaction mix and a characteristic blue color was visually observed in positive reactions. The study also found that 50 and 20 CFU of E. coli O157:H7 seeded into 100-liter of tap water could be detected by the GEAR assays after the sample was concentrated by hollow-fiber ultrafiltration (HFUF) and approximately 10% of HFUF concentrate was cultured using trypticase soy broth-novobiocin. When applied to 19 surface water samples collected from Tennessee and Kentucky, the GEAR assay and a published real-time PCR assay both detected E. coli O157:H7 in two of the samples. The results of this study indicate that the GEAR assay can be sensitive for rapid detection of E. coli O157:H7 in water samples using fluorometric instruments and visual endpoint determination. Published by Elsevier B.V.
Characterization of fatty acid amide hydrolase activity by a fluorescence-based assay.
Dato, Florian M; Maaßen, Andreas; Goldfuß, Bernd; Pietsch, Markus
2018-04-01
Fatty acid amide hydrolase (FAAH) is involved in many human diseases, particularly cancer, pain and inflammation as well as neurological, metabolic and cardiovascular disorders. Therefore, FAAH is an attractive target for the development of low-molecular-weight inhibitors as therapeutics, which requires robust assays that can be used for high-throughput screening (HTS) of compound libraries. Here, we report the development of a fluorometric assay based on FAAH's ability to effectively hydrolyze medium-chain fatty acid amides, introducing N-decanoyl-substituted 5-amino-2-methoxypyridine (D-MAP) as new amide substrate. D-MAP is cleaved by FAAH with an 8-fold larger specificity constant than the previously reported octanoyl-analog Oc-MAP (V max /K m of 1.09 and 0.134 mL min -1 mg -1 , respectively), with both MAP derivatives possessing superior substrate properties and much increased aqueous solubility compared to the respective p-nitroaniline compounds D-pNA and Oc-pNA. The new assay with D-MAP as substrate is highly sensitive using a lower enzyme concentration (1 μg mL -1 ) than literature-reported fluorimetric FAAH assays. In addition, D-MAP was validated in comparison to the substrate Oc-MAP for the characterization of FAAH inhibitors by means of the reference compounds URB597 and TC-F2 and was shown to be highly suitable for HTS in both kinetic and endpoint assays (Z' factors of 0.81 and 0.78, respectively). Copyright © 2018 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Perdian, D.C.; Cha, Sangwon; Oh, Jisun
2010-03-18
Mass spectrometric imaging has been utilized to localize individual astrocytes and to obtain cholesterol populations at the single-cell level in laser desorption ionization (LDI) with colloidal silver. The silver ion adduct of membrane-bound cholesterol was monitored to detect individual cells. Good correlation between mass spectrometric and optical images at different cell densities indicates the ability to perform single-cell studies of cholesterol abundance. The feasibility of quantification is confirmed by the agreement between the LDI-MS ion signals and the results from a traditional enzymatic fluorometric assay. We propose that this approach could be an effective tool to study chemical populations atmore » the cellular level.« less
Fluorometric aptamer based assay for ochratoxin A based on the use of exonuclease III.
Liu, Renjie; Wu, Hua; Lv, Lei; Kang, Xiaojiao; Cui, Chengbi; Feng, Jin; Guo, Zhijun
2018-04-14
This study describes an aptamer based assay for the mycotoxin ochratoxin A (OTA). The method is based on the use of an OTA-specific aptamer, exonuclease (Exo) III, SYBR Gold as a fluorescent probe, and a complementary strand that specifically combines with the aptamer. In the presence of OTA, the aptamer and OTA hybridize, thereby resulting in the formation of ssDNA, which is not digested by Exo III. Intense fluorescence is observed after addition of SYBR Gold (best measured at excitation/emission wavelengths of 495/540 nm). Fluorescence increases linearly with the log of the OTA concentration in the range from 8 to 1000 ng·mL -1 . The detection limit is 4.7 ng·mL -1 . The assay was applied to the determination of OTA in diluted [2%(v/v)] red wine, and recoveries and RSDs ranged between 93.5% and 113.8%, and between 3.2% and 5.7%, respectively. Graphical abstract In the presence of ochratoxin A (OTA), specific combinations of aptamer and OTA may occur and result in DNA double strands being untied, which avoids being digested by Exo III. Intense fluorescence is observed after SYBR Gold addition.
Li, Jingwen; Li, Xinming; Shi, Xiujuan; He, Xuewen; Wei, Wei; Ma, Nan; Chen, Hong
2013-10-09
We describe here a simple fluorometric assay for the highly sensitive detection of caspase-3 activities on the basis of the inner-filter effect of gold nanoparticles (AuNPs) on CdTe quantum dots (QDs). The method takes advantage of the high molar absorptivity of the plasmon band of gold nanoparticles as well as the large absorption band shift from 520 to 680 nm upon nanoparticle aggregation. When labeled with a peptide possessing the caspase-3 cleavage sequence (DEVD), the monodispersed Au-Ps (peptide-modified AuNPs) exhibited a tendency to aggregate when exposed to caspase-3, which induced the absorption band transition from 520 to 680 nm and turned on the fluorescence of the CdTe QDs for caspase-3 sensing. Under optimum conditions, a high sensitivity towards caspase-3 was achieved with a detection limit as low as 18 pM, which was much lower than the corresponding assays based on absorbance or other approaches. Overall, we demonstrated a facile and sensitive approach for caspase-3 detection, and we expected that this method could be potentially generalized to design more fluorescent assays for sensing other bioactive entities.
NASA Astrophysics Data System (ADS)
Ali, Anwar; Malik, Nisar Ahmad; Uzair, Sahar; Ali, Maroof
2014-10-01
The critical micelle concentration (CMC) of sodium dodecyl sulphate (SDS) in pure water and in the presence of amino acids (0.01, 0.02 and 0.03 mol kg-1), L-valine (Val) and L-leucine (Leu) was determined from conductometric and fluorometric methods using pyrene as luminescence probe. Depression in the CMC at low concentration of amino acids is attributed to the increased hydrophobic-hydrophobic interaction between the non-polar groups of the surfactant, while, at high concentration, amino acids bind strongly with the anion, DS-, head groups of SDS, thereby, delaying the micelle formation, resulting in increased CMC. A pronounced decrease in the CMC, while a marked increase in λ0+, with decrease in the solvated radius (rather than crystal radius) of the counterions is observed. Negative values of ΔG0m and ΔH0m indicate that micellisation of SDS in the presence of amino acids is thermodynamically spontaneous and exothermic. Highest negative value of ΔH0m in 0.01 m Val, with lowest CMC value, shows that 0.01 m aqueous Val is the most suitable medium favouring the micellisation of SDS. Decrease in I1/I3 from Val to Leu confirms the relative hydrophobicity of two amino acids. The observed values of the packing parameter, P, of SDS in water and in aqueous amino acids suggest that micelles formed are spherical in nature.
In Situ Protein Binding Assay Using Fc-Fusion Proteins.
Padmanabhan, Nirmala; Siddiqui, Tabrez J
2017-01-01
This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.
Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S
2007-02-27
Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.
Obayashi, Yumiko; Wei Bong, Chui; Suzuki, Satoru
2017-01-01
Microbial extracellular hydrolytic enzymes that degrade organic matter in aquatic ecosystems play key roles in the biogeochemical carbon cycle. To provide linkages between hydrolytic enzyme activities and genomic or metabolomic studies in aquatic environments, reliable measurements are required for many samples at one time. Extracellular proteases are one of the most important classes of enzymes in aquatic microbial ecosystems, and protease activities in seawater are commonly measured using fluorogenic model substrates. Here, we examined several concerns for measurements of extracellular protease activities (aminopeptidases, and trypsin-type, and chymotrypsin-type activities) in seawater. Using a fluorometric microplate reader with low protein binding, 96-well microplates produced reliable enzymatic activity readings, while use of regular polystyrene microplates produced readings that showed significant underestimation, especially for trypsin-type proteases. From the results of kinetic experiments, this underestimation was thought to be attributable to the adsorption of both enzymes and substrates onto the microplate. We also examined solvent type and concentration in the working solution of oligopeptide-analog fluorogenic substrates using dimethyl sulfoxide (DMSO) and 2-methoxyethanol (MTXE). The results showed that both 2% (final concentration of solvent in the mixture of seawater sample and substrate working solution) DMSO and 2% MTXE provide similarly reliable data for most of the tested substrates, except for some substrates which did not dissolve completely in these assay conditions. Sample containers are also important to maintain the level of enzyme activity in natural seawater samples. In a small polypropylene containers (e.g., standard 50-mL centrifugal tube), protease activities in seawater sample rapidly decreased, and it caused underestimation of natural activities, especially for trypsin-type and chymotrypsin-type proteases. In conclusion, the materials and method for measurements should be carefully selected in order to accurately determine the activities of microbial extracellular hydrolytic enzymes in aquatic ecosystems; especially, low protein binding materials should be chosen to use at overall processes of the measurement. PMID:29067013
Obayashi, Yumiko; Wei Bong, Chui; Suzuki, Satoru
2017-01-01
Microbial extracellular hydrolytic enzymes that degrade organic matter in aquatic ecosystems play key roles in the biogeochemical carbon cycle. To provide linkages between hydrolytic enzyme activities and genomic or metabolomic studies in aquatic environments, reliable measurements are required for many samples at one time. Extracellular proteases are one of the most important classes of enzymes in aquatic microbial ecosystems, and protease activities in seawater are commonly measured using fluorogenic model substrates. Here, we examined several concerns for measurements of extracellular protease activities (aminopeptidases, and trypsin-type, and chymotrypsin-type activities) in seawater. Using a fluorometric microplate reader with low protein binding, 96-well microplates produced reliable enzymatic activity readings, while use of regular polystyrene microplates produced readings that showed significant underestimation, especially for trypsin-type proteases. From the results of kinetic experiments, this underestimation was thought to be attributable to the adsorption of both enzymes and substrates onto the microplate. We also examined solvent type and concentration in the working solution of oligopeptide-analog fluorogenic substrates using dimethyl sulfoxide (DMSO) and 2-methoxyethanol (MTXE). The results showed that both 2% (final concentration of solvent in the mixture of seawater sample and substrate working solution) DMSO and 2% MTXE provide similarly reliable data for most of the tested substrates, except for some substrates which did not dissolve completely in these assay conditions. Sample containers are also important to maintain the level of enzyme activity in natural seawater samples. In a small polypropylene containers (e.g., standard 50-mL centrifugal tube), protease activities in seawater sample rapidly decreased, and it caused underestimation of natural activities, especially for trypsin-type and chymotrypsin-type proteases. In conclusion, the materials and method for measurements should be carefully selected in order to accurately determine the activities of microbial extracellular hydrolytic enzymes in aquatic ecosystems; especially, low protein binding materials should be chosen to use at overall processes of the measurement.
International Validation of Two Human Recombinant Estrogen ...
An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe
Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.
Murase, Akio; Nakao, Kazunari; Takada, Junji
2008-01-01
In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.
Parallel Force Assay for Protein-Protein Interactions
Aschenbrenner, Daniela; Pippig, Diana A.; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E.
2014-01-01
Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay. PMID:25546146
Parallel force assay for protein-protein interactions.
Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E
2014-01-01
Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.
Aubertine, C. L.; Rivera, M.; Rohan, S. M.; Larone, D. H.
2006-01-01
The new VITEK 2 colorimetric card was compared to the previous fluorometric card for identification of yeast. API 20C was considered the “gold standard.” The new card consistently performed better than the older card. Isolates from CHROMagar Candida plates were identified equally as well as those from Sabouraud dextrose agar. PMID:16390976
Fluorometric Method for Determining the Efficiency of Spun-Glass Air Filtration Media
Sullivan, James F.; Songer, Joseph R.; Mathis, Raymond G.
1967-01-01
The procedures and equipment needed to measure filtration efficiency by means of fluorescent aerosols are described. The filtration efficiency of individual lots of spun-glass air filtration medium or of entire air filtration systems employing such media was determined. Data relating to the comparative evaluation of spun-glass filter media by means of the fluorometric method described, as well as by conventional biological procedures, are presented. PMID:6031433
Ribeiro, David S M; Prior, João A V; Taveira, Christian J M; Mendes, José M A F S; Santos, João L M
2011-06-15
In this work, and for the first time, it was developed an automatic and fast screening miniaturized flow system for the toxicological control of glibenclamide in beverages, with application in forensic laboratory investigations, and also, for the chemical control of commercially available pharmaceutical formulations. The automatic system exploited the multipumping flow (MPFS) concept and allowed the implementation of a new glibenclamide determination method based on the fluorometric monitoring of the drug in acidic medium (λ(ex)=301 nm; λ(em)=404 nm), in the presence of an anionic surfactant (SDS), promoting an organized micellar medium to enhance the fluorometric measurements. The developed approach assured good recoveries in the analysis of five spiked alcoholic beverages. Additionally, a good agreement was verified when comparing the results obtained in the determination of glibenclamide in five commercial pharmaceutical formulations by the proposed method and by the pharmacopoeia reference procedure. Copyright © 2011 Elsevier B.V. All rights reserved.
Renauld, A.E.; Melancon, M.J.; Sordillo, L.M.
1999-01-01
Seven modulators of mammalian monooxygenase activity were screened for their ability to selectively stimulate or inhibit in vitro monooxygenase activities of hepatic microsomes from mallard ducklings treated with phenobarbital, β-naphthoflavone, 3,3′,4,4′,5-pentachlorobiphenyl or vehicle. Microsomes were assayed fluorometrically for four monooxygenases: benzyloxy-, ethoxy-, methoxy-, and pentoxyresorufin-O-dealkylase, in combination with each of the seven modulators. Four combinations: α-naphthoflavone and 2-methylbenzimidazole with benzyloxyresorufin, and Proadifen with methoxy- and ethoxyresorufin, respectively, were evaluated further. β-Naphthoflavone-treated groups were clearly distinguished from the corn oil vehicle control group by all of the assays and by the effects of the modulators in three of the four assay/modulator combinations. Enzyme activities of the phenobarbital and saline groups were statistically similar (P≥0.05) when assayed without modulator added, but each assay/modulator combination distinguished between these groups. The PCB-treated group was distinguished from the corn oil vehicle control group only for BROD activity, with or without the presence of modulator. Graphing of per cent modulation of BROD activity versus initial BROD activity provided the clearest distinction between all of the study groups. Identification of these selective in vitro modulators may improve detection and measurement of low level cytochrome P450 induction in avian species. Also, both the monooxygenase activities induced and the impacts of the modulators indicated differences between mammalian and avian cytochromes P450.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yinfa, Ma.
Thin-layer chromatography (TLC) is a broadly applicable separation technique. It offers many advantages over high performance liquid chromatography (HPLC), such as easily adapted for two-dimensional separation, for whole-column'' detection and for handling multiple samples, etc. However, due to its draggy development of detection techniques comparing with HPLC, TLC has not received the attention it deserves. Therefore, exploring new detection techniques is very important to the development of TLC. It is the principal of this dissertation to present a new detection method for TLC -- indirect fluorometric detection method. This detection technique is universal sensitive, nondestructive, and simple. This will bemore » described in detail from Sections 1 through Section 5. Section 1 and 3 describe the indirect fluorometric detection of anions and nonelectrolytes in TLC. In Section 2, a detection method for cations based on fluorescence quenching of ethidium bromide is presented. In Section 4, a simple and interesting TLC experiment is designed, three different fluorescence detection principles are used for the determination of caffeine, saccharin and sodium benzoate in beverages. A laser-based indirect fluorometric detection technique in TLC is developed in Section 5. Section 6 is totally different from Sections 1 through 5. An ultrasonic effect on the separation of DNA fragments in agarose gel electrophoresis is investigated. 262 refs.« less
Marcella, Aaron M; Barb, Adam W
The development of biorenewable chemicals will support green chemistry initiatives and supplement the catalog of starting materials available to the chemical industry. Bacterial fatty acid biosynthesis is being pursued as a source of protein catalysts to synthesize novel reduced carbon molecules in fermentation systems. The availability of methods to measure enzyme catalysis for native and engineered enzymes from this pathway remains a bottleneck because a simple quantitative enzyme assay for numerous enzymes does not exist. Here we present two variations of a fluorescence assay that is readily extendable to high-throughput screening and is appropriate for thiol consuming and generating enzymes including the Escherichia coli enzymes malonyl-coenzyme A transacylase (FabD) and keto-acylsynthase III (FabH). We measured K M values of 60 ± 20 µM (acetyl-CoA) and 20 ± 10 µM (malonyl-ACP) and a k cat of 7.4-9.0 s -1 with FabH. Assays of FabD included a precipitation step to remove the thiol-containing substrate holo-ACP from the reaction product coenzyme-A to estimate reaction rates. Analysis of initial velocity measurements revealed K M values of 60 ± 20 µM (malonyl-CoA) and 40 ± 10 µM (holo-ACP) and a k cat of 2100-2600 s -1 for the FabD enzyme. Our data show similar results when compared to existing radioactive and continuous coupled assays in terms of sensitivity while providing the benefit of simplicity, scalability and repeatability. Fluorescence detection also eliminates the need for radioactive substrates traditionally used to assay these enzymes.
Ultraviolet, Visible, and Fluorescence Spectroscopy
NASA Astrophysics Data System (ADS)
Penner, Michael H.
Spectroscopy in the ultraviolet-visible (UV-Vis) range is one of the most commonly encountered laboratory techniques in food analysis. Diverse examples, such as the quantification of macrocomponents (total carbohydrate by the phenol-sulfuric acid method), quantification of microcomponents, (thiamin by the thiochrome fluorometric procedure), estimates of rancidity (lipid oxidation status by the thiobarbituric acid test), and surveillance testing (enzyme-linked immunoassays), are presented in this text. In each of these cases, the analytical signal for which the assay is based is either the emission or absorption of radiation in the UV-Vis range. This signal may be inherent in the analyte, such as the absorbance of radiation in the visible range by pigments, or a result of a chemical reaction involving the analyte, such as the colorimetric copper-based Lowry method for the analysis of soluble protein.
Perdian, D C; Cha, Sangwon; Oh, Jisun; Sakaguchi, Donald S; Yeung, Edward S; Lee, Young Jin
2010-04-30
Mass spectrometric imaging has been utilized to localize individual astrocytes and to obtain cholesterol populations at the single-cell level in laser desorption ionization (LDI) with colloidal silver. The silver ion adduct of membrane-bound cholesterol was monitored to detect individual cells. Good correlation between mass spectrometric and optical images at different cell densities indicates the ability to perform single-cell studies of cholesterol abundance. The feasibility of quantification is confirmed by the agreement between the LDI-MS ion signals and the results from a traditional enzymatic fluorometric assay. We propose that this approach could be an effective tool to study chemical populations at the cellular level. Published in 2010 by John Wiley & Sons, Ltd.
International Validation of Two Human Recombinant Estrogen Receptor (ERa) Binding Assays
An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay...
Adaptive Focused Acoustics (AFA) Improves the Performance of Microtiter Plate ELISAs.
Green, David J; Rudd, Edwin A; Laugharn, James A
2014-08-01
We investigated the use of Adaptive Focused Acoustics (AFA) technology to improve the performance of microtiter plate enzyme-linked immunosorbent assays (ELISAs). Experiments were performed with commercially available AFA instrumentation and off-the-shelf 96-well microtiter plate sandwich ELISAs. AFA was applied over a range of acoustic energies, temperatures, and durations to the antigen/antibody binding step of an ELISA for measuring HIV-1 p24 in tissue culture samples. AFA-mediated antigen/antibody binding was enhanced up to 2-fold over passive binding at comparable temperatures and was superior or comparable at low temperature (8-10 °C) to passive binding at 37 °C. Lower nonspecific binding (NSB), lower inter- and intra-assay coefficients of variation (CVs), higher Z' factors, and lower limits of detection (LODs) were measured in AFA-mediated assays compared with conventional passive binding. In a more limited study, AFA enhancement of antigen/antibody binding and lower NSB was measured in an ELISA for measuring IGFBP-3 in human plasma. We conclude from this study that application of AFA to antigen/antibody binding steps in microtiter plate ELISAs can enhance key assay performance parameters, particularly Z' factors and LODs. These features render AFA-mediated binding assays potentially more useful in applications such as high-throughput screening and in vitro diagnostics than assays processed with conventional passive antigen/antibody binding steps. © 2014 Society for Laboratory Automation and Screening.
Integrated Summary Report: Validation of Two Binding Assays ...
This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (hrERα), to identify chemicals that may impact estrogen signaling through binding to the ER. The purpose of the ISR is to support the peer review of the findings obtained during the validation process.The two assays evaluated during this validation process are: The Freyberger-Wilson Assay (FW) using a full length human ER, and The Chemical Evaluation and Research Institute (CERI) Assay using a ligand-binding domain of the human ER.The two assays are mechanistically and functionally similar in that each measures the ability of a test chemical to competitively inhibit binding of [3H]17β-estradiol to the human recombinant ER. The essential elements of the FW and the CERI assays were developed at the laboratories of Bayer Pharma AG, Wuppertal, Germany (Freyberger et al., 2010) and CERI, Tokyo, Japan (Akahori et al., 2008), respectively.The ER competitive binding assay has long been in use, and is a well characterized approach, but historically uses rodent or other animal tissues as a source of the ER. Validation of the FW and CERI assays using human recombinant estrogen receptors ( subtype) will provide an updated alternative for the Agency’s current test guideline (OPPTS 89
Shen, Xiang; Liang, Fuxin; Zhang, Guanxin; Zhang, Deqing
2012-05-07
Emissive core-shell silica particles with tetraphenylethylene moieties were prepared and characterized. Fluorescence quenching was observed for the silica particles upon addition of compound 2 (Dabcyl-ACh). This was attributed to the electrostatic interaction between the silica particles and 2 and the resulting photoinduced energy transfer between them. After incubation with AChE, the fluorescence intensity started to increase. The fluorescence enhancement became more significant when the concentration of AChE was higher. The reaction kinetic parameters for AChE were successfully estimated with the silica particles and 2. These results reveal that the ensemble of the silica particles and 2 can be utilized for AChE assay. Moreover, the fluorescence spectra of the ensemble of the silica particles and 2 containing AChE were also measured after further addition of either neostigmine or tacrine which are typical inhibitors of AChE. The results manifest that the ensemble of the emissive silica particles and 2 is also useful for screening the inhibitors of AChE.
Tao, Yu; Lin, Youhui; Huang, Zhenzhen; Ren, Jinsong; Qu, Xiaogang
2012-01-15
An easy prepared fluorescence turn-on and colorimetric dual channel probe was developed for rapid assay of Hg(2+) ions with high sensitivity and selectivity by using poly(acrylic acid)-templated silver nanoclusters (PAA-AgNCs). The PAA-AgNCs exhibited weak fluorescence, while upon the addition of Hg(2+) ions, AgNCs gives a dramatic increase in fluorescence as a result of the changes of the AgNCs states. The detection limit was estimated to be 2 nM, which is much lower than the Hg(2+) detection requirement for drinking water of U.S. Environmental Protection Agency, and the turn-on sensing mode offers additional advantage to efficiently reduce background noise. Also, a colorimetric assay of Hg(2+) ions can be realized due to the observed absorbance changes of the AgNCs. More importantly, the method was successfully applied to the determination of Hg(2+) ions in real water samples, which suggests our proposed method has a great potential of application in environmental monitoring. Copyright © 2011 Elsevier B.V. All rights reserved.
Saito, Yoshio; Kugenuma, Kenji; Tanaka, Makiko; Suzuki, Azusa; Saito, Isao
2012-06-01
We demonstrated an intriguing method to discriminate adenine by incident appearance of an intense new emission via exciplex formation in hybridization of target DNA with newly designed fluorescent 8-arylethynylated deoxyguanosine derivatives. We described the synthesis of such highly electron donating fluorescent guanosine derivatives and their incorporation into DNA oligomers which may be used for the structural study and the fluorometric analysis of nucleic acids. Copyright © 2012 Elsevier Ltd. All rights reserved.
Interaction of diazepam with surfactants. Spectrophotometric and spectrofluorometric study
NASA Astrophysics Data System (ADS)
De La Guardia, M.; Rodilla, F.
1986-03-01
The interaction of diazepam with non-ionic, anionic and cationic surfactants has been studied spectrophotometrically and fluorometrically. It has been verified that the absorption spectrum of diazepam is not modified in micellar medium. However, a dramatic five-fold increase in fluorescence sensitivity is observed in the presence of sodium lauryl sulphate (SDS). The experimental conditions, temperature, pH and surfactant concentration have been optimized to improve the fluorometric determination of diazepam and a detection limit of 0,04 ppmhas been obtained.
NASA Astrophysics Data System (ADS)
Hutterer, Rudi
2018-01-01
The author discusses methods for the fluorometric determination of affinity constants by linear and nonlinear fitting methods. This is outlined in particular for the interaction between cyclodextrins and several anesthetic drugs including benzocaine. Special emphasis is given to the limitations of certain fits, and the impact of such studies on enzyme-substrate interactions are demonstrated. Both the experimental part and methods of analysis are well suited for students in an advanced lab.
Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.
Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S
2001-04-01
The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.
Rhaman, Md Mhahabubur; Hasan, Mohammad H; Alamgir, Azmain; Xu, Lihua; Powell, Douglas R; Wong, Bryan M; Tandon, Ritesh; Hossain, Md Alamgir
2018-01-10
The selective detection of citrate anions is essential for various biological functions in living systems. A quantitative assessment of citrate is required for the diagnosis of various diseases in the human body; however, it is extremely challenging to develop efficient fluorescence and color-detecting molecular probes for sensing citrate in water. Herein, we report a macrocycle-based dinuclear foldamer (1) assembled with eosin Y (EY) that has been studied for anion binding by fluorescence and colorimetric techniques in water at neutral pH. Results from the fluorescence titrations reveal that the 1·EY ensemble strongly binds citrate anions, showing remarkable selectivity over a wide range of inorganic and carboxylate anions. The addition of citrate anions to the 1·EY adduct led to a large fluorescence enhancement, displaying a detectable color change under both visible and UV light in water up to 2 μmol. The biocompatibility of 1·EY as an intracellular carrier in a biological system was evaluated on primary human foreskin fibroblast (HF) cells, showing an excellent cell viability. The strong binding properties of the ensemble allow it to be used as a highly sensitive, detective probe for biologically relevant citrate anions in various applications.
Development of binding assays in microfabricated picoliter vials: an assay for biotin.
Grosvenor, A L; Feltus, A; Conover, R C; Daunert, S; Anderson, K W
2000-06-01
A homogeneous binding assay for the detection of biotin in picoliter vials was developed using the photoprotein aequorin as the label. The binding assay was based on the competition of free biotin with biotinylated aequorin (AEQ-biotin) for avidin. A sequential protocol was used, and modification of the assay to reduce the number of steps was examined. Results showed that detection limits on the order of 10(-14) mol of biotin were possible. Reducing the number of steps provided similar detection limits but only if the amount of avidin used was decreased. These binding assays based on picoliter volumes have potential applications in a variety of fields, including microanalysis and single-cell analysis, where the amount of sample is limited. In addition, these assays are suitable for the high-throughput screening of biopharmaceuticals.
Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data
Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong
2017-01-01
ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487
Bentley, Marvin; Decker, Helena; Luisi, Julie
2015-01-01
Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392
Watabe, Tadashi; Naka, Sadahiro; Ikeda, Hayato; Horitsugi, Genki; Kanai, Yasukazu; Isohashi, Kayako; Ishibashi, Mana; Kato, Hiroki; Shimosegawa, Eku; Watabe, Hiroshi; Hatazawa, Jun
2014-01-01
Acetylcholinesterase (AChE) inhibitors have been used for patients with Alzheimer's disease. However, its pharmacokinetics in non-target organs other than the brain has not been clarified yet. The purpose of this study was to evaluate the relationship between the whole-body distribution of intravenously administered (11)C-Donepezil (DNP) and the AChE activity in the normal rat, with special focus on the adrenal glands. The distribution of (11)C-DNP was investigated by PET/CT in 6 normal male Wistar rats (8 weeks old, body weight = 220 ± 8.9 g). A 30-min dynamic scan was started simultaneously with an intravenous bolus injection of (11)C-DNP (45.0 ± 10.7 MBq). The whole-body distribution of the (11)C-DNP PET was evaluated based on the Vt (total distribution volume) by Logan-plot analysis. A fluorometric assay was performed to quantify the AChE activity in homogenized tissue solutions of the major organs. The PET analysis using Vt showed that the adrenal glands had the 2nd highest level of (11)C-DNP in the body (following the liver) (13.33 ± 1.08 and 19.43 ± 1.29 ml/cm(3), respectively), indicating that the distribution of (11)C-DNP was the highest in the adrenal glands, except for that in the excretory organs. The AChE activity was the third highest in the adrenal glands (following the small intestine and the stomach) (24.9 ± 1.6, 83.1 ± 3.0, and 38.5 ± 8.1 mU/mg, respectively), indicating high activity of AChE in the adrenal glands. We demonstrated the whole-body distribution of (11)C-DNP by PET and the AChE activity in the major organs by fluorometric assay in the normal rat. High accumulation of (11)C-DNP was observed in the adrenal glands, which suggested the risk of enhanced cholinergic synaptic transmission by the use of AChE inhibitors.
Determination of lithium in rocks: Fluorometric method
White, C.E.; Fletcher, M.H.; Parks, J.
1951-01-01
The gravimetric method in general use for the determination of lithium is tedious, and the final weighed product often contains other alkali metals. A fluorometric method was developed to shorten the time required for the analysis and to assure that the final determination is for lithium alone. This procedure is based on the complex formed between lithium and 8-hydroxyquinoline. The fluorescence is developed in a slightly alkaline solution of 95% alcohol and measurement is made on a photoelectric fluorometer. Separation from the ore is carried out by the wet method or by the distillation procedure. Sodium and potassium are removed by alcohol and ether, but complete separation is not necessary. Comparison of analyzed samples shows excellent agreement with spectrographic and gravimetric methods. The fluorometric method is more rapid than the gravimetric and produces more conclusive results. Another useful application is in the preparation of standard lithium solutions from reagent quality salts when a known standard is available. In this case no separations are necessary.
BODIPY-based fluorometric sensor array for the highly sensitive identification of heavy-metal ions.
Niu, Li-Ya; Li, Hui; Feng, Liang; Guan, Ying-Shi; Chen, Yu-Zhe; Duan, Chun-Feng; Wu, Li-Zhu; Guan, Ya-Feng; Tung, Chen-Ho; Yang, Qing-Zheng
2013-05-02
A BODIPY(4,4-difluoro-4-bora-3a,4a-diaza-s-indacene)-based fluorometric sensor array has been developed for the highly sensitive detection of eight heavy-metal ions at micromolar concentration. The di-2-picolyamine (DPA) derivatives combine high affinities for a variety of heavy-metal ions with the capacity to perturb the fluorescence properties of BODIPY, making them perfectly suitable for the design of fluorometric sensor arrays for heavy-metal ions. 12 cross-reactive BODIPY fluorescent indicators provide facile identification of the heavy-metal ions using a standard chemometric approach (hierarchical clustering analysis); no misclassifications were found over 45 trials. Clear differentiation among heavy-metal ions as a function of concentration was also achieved, even down to 10(-7)M. A semi-quantitative interpolation of the heavy-metal concentration is obtained by comparing the total Euclidean distance of the measurement with a set of known concentrations in the library. Copyright © 2013 Elsevier B.V. All rights reserved.
Horka, Marie; Ruzicka, Filip; Horký, Jaroslav; Holá, Veronika; Slais, Karel
2006-12-15
The nonionogenic pyrene-based tenside, poly(ethylene glycol) pyrenebutanoate, was prepared and applied in capillary isoelectric focusing with fluorometric detection. This dye was used here as a buffer additive in capillary isoelectric focusing for a dynamic modification of the sample of proteins and microorganisms. The values of the isoelectric points of the labeled bioanalytes were calculated with use of the fluorescent pI markers and were found comparable with pI of the native compounds. The mixed cultures of proteins and microorganisms, Escherichia coli CCM 3954, Staphylococcus epidermidis CCM 4418, Proteus vulgaris, Enterococcus faecalis CCM 4224, and Stenotrophomonas maltophilia, the strains of the yeast cells, Candida albicans CCM 8180, Candida krusei, Candida parapsilosis, Candida glabrata, Candida tropicalis, and Saccharomyces cerevisiae were reproducibly focused and separated by the suggested technique. Using UV excitation for the on-column fluorometric detection, the minimum detectable amount was down to 10 cells injected on the separation capillary.
Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W
2017-08-01
We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.
Predicting changes in cardiac myocyte contractility during early drug discovery with in vitro assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morton, M.J., E-mail: michael.morton@astrazeneca.com; Armstrong, D.; Abi Gerges, N.
2014-09-01
Cardiovascular-related adverse drug effects are a major concern for the pharmaceutical industry. Activity of an investigational drug at the L-type calcium channel could manifest in a number of ways, including changes in cardiac contractility. The aim of this study was to define which of the two assay technologies – radioligand-binding or automated electrophysiology – was most predictive of contractility effects in an in vitro myocyte contractility assay. The activity of reference and proprietary compounds at the L-type calcium channel was measured by radioligand-binding assays, conventional patch-clamp, automated electrophysiology, and by measurement of contractility in canine isolated cardiac myocytes. Activity inmore » the radioligand-binding assay at the L-type Ca channel phenylalkylamine binding site was most predictive of an inotropic effect in the canine cardiac myocyte assay. The sensitivity was 73%, specificity 83% and predictivity 78%. The radioligand-binding assay may be run at a single test concentration and potency estimated. The least predictive assay was automated electrophysiology which showed a significant bias when compared with other assay formats. Given the importance of the L-type calcium channel, not just in cardiac function, but also in other organ systems, a screening strategy emerges whereby single concentration ligand-binding can be performed early in the discovery process with sufficient predictivity, throughput and turnaround time to influence chemical design and address a significant safety-related liability, at relatively low cost. - Highlights: • The L-type calcium channel is a significant safety liability during drug discovery. • Radioligand-binding to the L-type calcium channel can be measured in vitro. • The assay can be run at a single test concentration as part of a screening cascade. • This measurement is highly predictive of changes in cardiac myocyte contractility.« less
Alleti, Ramesh; Vagner, Josef; Dehigaspitiya, Dilani Chathurika; Moberg, Valerie E; Elshan, N G R D; Tafreshi, Narges K; Brabez, Nabila; Weber, Craig S; Lynch, Ronald M; Hruby, Victor J; Gillies, Robert J; Morse, David L; Mash, Eugene A
2013-09-01
Probes for use in time-resolved fluorescence competitive binding assays at melanocortin receptors based on the parental ligands MSH(4), MSH(7), and NDP-α-MSH were prepared by solid phase synthesis methods, purified, and characterized. The saturation binding of these probes was studied using HEK-293 cells engineered to overexpress the human melanocortin 4 receptor (hMC4R) as well as the human cholecystokinin 2 receptor (hCCK2R). The ratios of non-specific binding to total binding approached unity at high concentrations for each probe. At low probe concentrations, receptor-mediated binding and uptake was discernable, and so probe concentrations were kept as low as possible in determining Kd values. The Eu-DTPA-PEGO-MSH(4) probe exhibited low specific binding relative to non-specific binding, even at low nanomolar concentrations, and was deemed unsuitable for use in competition binding assays. The Eu-DTPA-PEGO probes based on MSH(7) and NDP-α-MSH exhibited Kd values of 27±3.9nM and 4.2±0.48nM, respectively, for binding with hMC4R. These probes were employed in competitive binding assays to characterize the interactions of hMC4R with monovalent and divalent MSH(4), MSH(7), and NDP-α-MSH constructs derived from squalene. Results from assays with both probes reflected only statistical enhancements, suggesting improper ligand spacing on the squalene scaffold for the divalent constructs. The Ki values from competitive binding assays that employed the MSH(7)-based probe were generally lower than the Ki values obtained when the probe based on NDP-α-MSH was employed, which is consistent with the greater potency of the latter probe. The probe based on MSH(7) was also competed with monovalent, divalent, and trivalent MSH(4) constructs that previously demonstrated multivalent binding in competitive binding assays against a variant of the probe based on NDP-α-MSH. Results from these assays confirm multivalent binding, but suggest a more modest increase in avidity for these MSH(4) constructs than was previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.
Kessler, Jan H; Mommaas, Bregje; Mutis, Tuna; Huijbers, Ivo; Vissers, Debby; Benckhuijsen, Willemien E; Schreuder, Geziena M Th; Offringa, Rienk; Goulmy, Els; Melief, Cornelis J M; van der Burg, Sjoerd H; Drijfhout, Jan W
2003-02-01
We report the development, validation, and application of competition-based peptide binding assays for 13 prevalent human leukocyte antigen (HLA) class I alleles. The assays are based on peptide binding to HLA molecules on living cells carrying the particular allele. Competition for binding between the test peptide of interest and a fluorescein-labeled HLA class I binding peptide is used as read out. The use of cell membrane-bound HLA class I molecules circumvents the need for laborious biochemical purification of these molecules in soluble form. Previously, we have applied this principle for HLA-A2 and HLA-A3. We now describe the assays for HLA-A1, HLA-A11, HLA-A24, HLA-A68, HLA-B7, HLA-B8, HLA-B14, HLA-B35, HLA-B60, HLA-B61, and HLA-B62. Together with HLA-A2 and HLA-A3, these alleles cover more than 95% of the Caucasian population. Several allele-specific parameters were determined for each assay. Using these assays, we identified novel HLA class I high-affinity binding peptides from HIVpol, p53, PRAME, and minor histocompatibility antigen HA-1. Thus these convenient and accurate peptide-binding assays will be useful for the identification of putative cytotoxic T lymphocyte epitopes presented on a diverse array of HLA class I molecules.
Zhu, Li; Hwang, Peter; Witkowska, H. Ewa; Liu, Haichuan; Li, Wu
2014-01-01
Tooth enamel is the hardest tissue in vertebrate animals. Consisting of millions of carbonated hydroxyapatite crystals, this highly mineralized tissue develops from a protein matrix in which amelogenin is the predominant component. The enamel matrix proteins are eventually and completely degraded and removed by proteinases to form mineral-enriched tooth enamel. Identification of the apatite-binding motifs in amelogenin is critical for understanding the amelogenin–crystal interactions and amelogenin–proteinases interactions during tooth enamel biomineralization. A stepwise strategy is introduced to kinetically and quantitatively identify the crystal-binding motifs in amelogenin, including a peptide screening assay, a competitive adsorption assay, and a kinetic-binding assay using amelogenin and gene-engineered amelogenin mutants. A modified enzyme-linked immunosorbent assay on crystal surfaces is also applied to compare binding amounts of amelogenin and its mutants on different planes of apatite crystals. We describe the detailed protocols for these assays and provide the considerations for these experiments in this chapter. PMID:24188774
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Avoiding false positives and optimizing identification of true ...
The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented from screening 94 chemicals from 54 chemical groups for estrogen receptor (ER) activation in a competitive rainbow trout ER (rtER) binding assay and a trout liver slice vitellogenin mRNA expression assay. Results from true competitive agonists and antagonists, and inactive chemicals with little or no indication of ER binding or gene activation were easily interpreted. However, results for numerous industrial chemicals were more challenging to interpret, including chemicals with: (1) apparent competitive binding curves but no gene activation, (2) apparent binding and gene inhibition with evidence of either cytotoxicity or changes in assay media pH, (3) apparent binding but non-competitive gene inhibition of unknown cause, or (4) no rtER binding and gene inhibition not due to competitive ER interaction but due to toxicity, pH change, or some unknown cause. The use of endpoints such as toxicity, pH, precipitate formation, and determination of inhibitor dissociation constants (Ki) for interpreting the results of antagonism and binding assays for diverse chemicals is presented. Of the 94 chemicals tested for antagonism only two, tamoxifen and ICI-182,780, were found to be true competitive
Wang, Jia-Hui; Shao, Xiao-Xia; Hu, Meng-Jun; Wei, Dian; Liu, Ya-Li; Xu, Zeng-Guang; Guo, Zhan-Yun
2017-05-01
Relaxin family peptide receptor 3 (RXFP3) is an A-class G protein-coupled receptor that is implicated in the regulation of food intake and stress response upon activation by its cognate agonist relaxin-3. To study its interaction with various ligands, we developed a novel bioluminescence resonance energy transfer (BRET)-based binding assay using the brightest NanoLuc as an energy donor and a newly developed cyan-excitable orange fluorescent protein (CyOFP) as an energy acceptor. An engineered CyOFP without intrinsic cysteine residues but with an introduced cysteine at the C-terminus was overexpressed in Escherichia coli and chemically conjugated to the A-chain N-terminus of an easily labeled chimeric R3/I5 peptide via an intermolecular disulfide linkage. After the CyOFP-conjugated R3/I5 bound to a shortened human RXFP3 (removal of 33 N-terminal residues) fused with the NanoLuc reporter at the N-terminus, high BRET signals were detected. Saturation binding and real-time binding assays demonstrated that this BRET pair retained high binding affinity with fast association/dissociation. Using this BRET pair, binding potencies of various ligands with RXFP3 were conveniently measured through competition binding assays. Thus, the novel BRET-based binding assay facilitates interaction studies of RXFP3 with various ligands. The engineered CyOFP without intrinsic cysteine residues may also be applied to other BRET-based binding assays in future studies.
Taner, Bilge; Kursunlu, Ahmed Nuri; Güler, Ersin
2014-01-24
A novel chemosensor based on calix[4]pyrrole derivative modified by Bodipy unit has been synthesized, and its complexes with various anions were investigated. The results show that the receptors can selectively recognize biologically important fluoride ions. The binding affinity for fluoride ions was investigated by naked-eye color change, absorption, emission, proton nuclear magnetic resonance spectroscopy. The addition of fluoride ions to an acetonitrile solution of chemosensor can result in an obvious color change (brownish yellow color to straw yellow). The stoichiometries between the receptor and fluoride were determined from the molar ratio plots using the UV-visible spectra, which showed evident 1:1. The proton nuclear magnetic resonance spectral data supported the fluoride anion recognition with the disappearance of the amino proton peaks. Published by Elsevier B.V.
Sarma, Dominik; Gawlitza, Kornelia; Rurack, Knut
2016-04-19
The need for rapid and high-throughput screening in analytical laboratories has led to significant growth in interest in suspension array technologies (SATs), especially with regard to cytometric assays targeting a low to medium number of analytes. Such SAT or bead-based assays rely on spherical objects that constitute the analytical platform. Usually, functionalized polymer or silica (SiO2) microbeads are used which each have distinct advantages and drawbacks. In this paper, we present a straightforward synthetic route to highly monodisperse SiO2-coated polystyrene core-shell (CS) beads for SAT with controllable architectures from smooth to raspberry- and multilayer-like shells by varying the molecular weight of poly(vinylpyrrolidone) (PVP), which was used as the stabilizer of the cores. The combination of both organic polymer core and a structurally controlled inorganic SiO2 shell in one hybrid particle holds great promises for flexible next-generation design of the spherical platform. The particles were characterized by electron microscopy (SEM, T-SEM, and TEM), thermogravimetry, flow cytometry, and nitrogen adsorption/desorption, offering comprehensive information on the composition, size, structure, and surface area. All particles show ideal cytometric detection patterns and facile handling due to the hybrid structure. The beads are endowed with straightforward modification possibilities through the defined SiO2 shells. We successfully implemented the particles in fluorometric SAT model assays, illustrating the benefits of tailored surface area which is readily available for small-molecule anchoring. Very promising assay performance was shown for DNA hybridization assays with quantification limits down to 8 fmol.
NASA Astrophysics Data System (ADS)
Mitsubayashi, Kohji; Chien, Po-Jen; Ye, Ming; Suzuki, Takuma; Toma, Koji; Arakawa, Takahiro
2016-11-01
A fluorometric acetone biosniffer (biochemical gas sensor) for assessment of lipid metabolism utilizing reverse reaction of secondary alcohol dehydrogenase was constructed and evaluated. The biosniffer showed highly sensitivity and selectivity for continuous monitoring of gaseous acetone. The measurement of breath acetone concentration during fasting and aerobic exercise were also investigated. The acetone biosniffer provides a novel analytical tool for noninvasive evaluation of human lipid metabolism and it is also expected to use for the clinical and physiological applications such as monitoring the progression of diabetes.
Wang, E T; Zhou, D R; He, L H
1992-07-01
The blood levels of histamine and 5-hydroxytryptamine (5-HT) in 10 subjects, with or without administration of the transdermal therapeutic system of scopolamine (TTS-S), were measured following motion sickness (MS) induced by Coriolis stimulation. Histamine and 5-HT were assayed using the fluorometric method. The results demonstrated that the blood levels of histamine increased significantly following MS and were even higher in the subjects using TTS-S, but we found neither significant changes in the blood levels of 5-HT following MS nor any effect of TTS-S on it. The results suggest that histamine contributes to the development of MS, and scopolamine may exert its anti-MS action by affecting the histaminergic system as well as the acetylcholinergic system; there may not be a definite relation between 5-HT and the development of MS.
Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena
2015-10-01
Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.
NASA Astrophysics Data System (ADS)
Shao, Xin; Ai, Ni; Xu, Donghang; Fan, Xiaohui
2016-05-01
Human serum albumin (HSA) binding is one of important pharmacokinetic properties of drug, which is closely related to in vivo distribution and may ultimately influence its clinical efficacy. Compared to conventional drug, limited information on this transportation process is available for medicinal herbs, which significantly hampers our understanding on their pharmacological effects, particularly when herbs and drug are co-administrated as polytherapy to the ailment. Several lines of evidence suggest the existence of Salvia miltiorrhiza-Warfarin interaction. Since Warfarin is highly HSA bound in the plasma with selectivity to site I, it is critical to evaluate the possibility of HSA-related herb-drug interaction. Herein an integrated approach was employed to analyze the binding of chemicals identified in S. miltiorrhiza to HSA. Molecular docking simulations revealed filtering criteria for HSA site I compounds that include docking score and key molecular determinants for binding. For eight representative ingredients from the herb, their affinity and specificity to HSA site I was measured and confirmed fluorometrically, which helps to improve the knowledge of interaction mechanisms between this herb and HSA. Our results indicated that several compounds in S. miltiorrhiza were capable of decreasing the binding constant of Warfarin to HSA site I significantly, which may increase free drug concentration in vivo, contributing to the herb-drug interaction observed clinically. Furthermore, the significance of HSA mediated herb-drug interactions was further implied by manual mining on the published literatures on S. miltiorrhiza.
Evaluation of potential endocrine activity of 2,4-dichlorophenoxyacetic acid using in vitro assays.
Coady, Katherine K; Kan, H Lynn; Schisler, Melissa R; Gollapudi, B Bhaskar; Neal, Barbara; Williams, Amy; LeBaron, Matthew J
2014-08-01
The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) was evaluated in five in vitro screening assays to assess the potential for interaction with the androgen, estrogen and steroidogenesis pathways in the endocrine system. The assays were conducted to meet the requirements of the in vitro component of Tier 1 of the United States Environmental Protection Agency's Endocrine Disruptor Screening Program (EDSP), and included assays for estrogen receptor (ER) binding (rat uterine cytosol ER binding assay), ER-mediated transcriptional activation (HeLa-9903-ERα transactivation assay), androgen receptor (AR) binding (rat prostate cytosol AR binding assay), aromatase enzymatic activity inhibition (recombinant human CYP19 aromatase inhibition assay), and interference with steroidogenesis (H295R steroidogenesis assay). Results from these five assays demonstrated that 2,4-D does not have the potential to interact in vitro with the estrogen, androgen, or steroidogenesis pathways. These in vitro data are consistent with a corresponding lack of endocrine effects observed in apical in vivo animal studies, and thus provide important supporting data valuable in a comprehensive weight of evidence evaluation indicating a low potential of 2,4-D to interact with the endocrine system. Copyright © 2014 Elsevier Ltd. All rights reserved.
Wu, Qing-Ping; Zhang, Lei; Shao, Xiao-Xia; Wang, Jia-Hui; Gao, Yu; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun
2016-04-01
Relaxin is a prototype of the relaxin family peptide hormones and plays important biological functions by binding and activating the G protein-coupled receptor RXFP1. To study their interactions, in the present work, we applied the newly developed bioluminescent ligand-receptor binding assay to the relaxin-RXFP1 system. First, a fully active easily labeled relaxin, in which three Lys residues of human relaxin-2 were replaced by Arg, was prepared through overexpression of a single-chain precursor in Pichia pastoris and in vitro enzymatic maturation. Thereafter, the B-chain N-terminus of the easily labeled relaxin was chemically cross-linked with a C-terminal cysteine residue of an engineered NanoLuc through a disulfide linkage. Receptor-binding assays demonstrated that the NanoLuc-conjugated relaxin retained high binding affinity with the receptor RXFP1 (K d = 1.11 ± 0.08 nM, n = 3) and was able to sensitively monitor binding of a variety of ligands with RXFP1. Using the novel bioluminescent binding assay, we demonstrated that three highly conserved B-chain Arg residues of relaxin-3 had distinct contributions to binding of the receptor RXFP1. In summary, our present work provides a novel bioluminescent ligand-receptor binding assay for the relaxin-RXFP1 system to facilitate their interaction studies, such as characterization of relaxin analogues or screening novel agonists or antagonists of RXFP1.
Kundu, Pronab; Chattopadhyay, Nitin
2018-06-15
Molecular interactions and binding of probes/drugs with biomacromolecular systems are of fundamental importance in understanding the mechanism of action and hence designing of proactive drugs. In the present study, binding interactions of a biologically potent fluorophore, (E)-1,5-diphenyl-3-styryl-4,5-dihydro-1H-pyrazole (DSDP) with two serum transport proteins, human serum albumin and bovine serum albumin, have been investigated exploiting multi-spectroscopic techniques. The spectrophotometric and fluorometric studies together with fluorescence quenching, fluorescence anisotropy, urea induced denaturation studies and fluorescence lifetime measurements reveal strong binding of DSDP with both the plasma proteins. Going beyond the vast literature data mostly providing 1:1 probe-protein complexation, the present investigation portrays 2:1 probe-protein complex formation at higher relative probe concentration. A newer approach has been developed to have an estimate of the binding constants varying the concentration of the protein, instead of the usual practice of varying the probe. The binding constants for the 2:1 DSDP-protein complexes are determined to be 1.37 × 10 10 M -2 and 1.47 × 10 10 M -2 for HSA and BSA respectively, while those for the 1:1 complexation process come out to be 1.85 × 10 5 M -1 and 1.73 × 10 5 M -1 for DSDP-HSA and DSDP-BSA systems respectively. Thermodynamic analysis at different temperatures implies that the forces primarily involved in the binding process are hydrogen bonding and hydrophobic interactions. Competitive replacement studies with known site markers and molecular docking simulations direct to the possible locations and binding energies of DSDP with the two serum proteins, corroborating well with the experimental results. Copyright © 2018 Elsevier B.V. All rights reserved.
Xu, Kefeng; Chen, Zhonghui; Zhou, Ling; Zheng, Ou; Wu, Xiaoping; Guo, Longhua; Qiu, Bin; Lin, Zhenyu; Chen, Guonan
2015-01-06
A fluorometric method for pyrophosphatase (PPase) activity detection was developed based on click chemistry. Cu(II) can coordinate with pyrophosphate (PPi), the addition of pyrophosphatase (PPase) into the above system can destroy the coordinate compound because PPase catalyzes the hydrolysis of PPi into inorganic phosphate and produces free Cu(II), and free Cu(II) can be reduced by sodium ascorbate (SA) to form Cu(I), which in turn initiates the ligating reaction between nonfluorescent 3-azidocoumarins and terminal alkynes to produce a highly fluorescent triazole complex, based on which, a simple and sensitive turn on fluorometric method for PPase can be developed. The fluorescence intensity of the system has a linear relationship with the logarithm of the PPase concentration in the range of 0.5 and 10 mU with a detection limit down to 0.2 mU (S/N = 3). This method is cost-effective and convenient without any labels or complicated operations. The proposed system was applied to screen the potential PPase inhibitor with high efficiency. The proposed method can be applied to diagnosis of PPase-related diseases.
Arakawa, Takahiro; Sato, Toshiyuki; Iitani, Kenta; Toma, Koji; Mitsubayashi, Kohji
2017-04-18
Various volatile organic compounds can be found in human transpiration, breath and body odor. In this paper, a novel two-dimensional fluorometric imaging system, known as a "sniffer-cam" for ethanol vapor released from human breath and palm skin was constructed and validated. This imaging system measures ethanol vapor concentrations as intensities of fluorescence through an enzymatic reaction induced by alcohol dehydrogenase (ADH). The imaging system consisted of multiple ultraviolet light emitting diode (UV-LED) excitation sheet, an ADH enzyme immobilized mesh substrate and a high-sensitive CCD camera. This imaging system uses ADH for recognition of ethanol vapor. It measures ethanol vapor by measuring fluorescence of nicotinamide adenine dinucleotide (NADH), which is produced by an enzymatic reaction on the mesh. This NADH fluorometric imaging system achieved the two-dimensional real-time imaging of ethanol vapor distribution (0.5-200 ppm). The system showed rapid and accurate responses and a visible measurement, which could lead to an analysis of metabolism function at real time in the near future.
Crochet, John R; Shah, Anish A; Schomberg, David W; Price, Thomas M
2012-09-01
Trophoblast-derived human chorionic gonadotropin (hCG) promotes corpus luteum progesterone (P4) production, and wide ranges of serum P4 levels are noted in various pregnancy outcomes, despite similar hCG concentrations. There are five unique biologically active hCG variants in human pregnancy urine, and previous studies of P4 production in response to hCG have used only preparations containing all isoforms. Understanding exactly which hCG variant is primarily responsible for stimulating corpus luteum steroidogenesis may have great clinical and diagnostic implications, including in the setting of ectopic pregnancy. Our objective was to delineate the role of the standard and hyperglycosylated (H)-hCG isoforms in stimulating P4 production by luteinized granulosa cells. Cell culture, ELISA, and fluorometric-based protein assays were done at Duke University Medical Center. Patients were anonymous oocyte donors. Cultured luteinized granulosa cells were treated with 0.25, 0.5, and 1.0 ng/ml total hCG, which contains all isoforms, purified standard hCG (37.1 kDa), and purified H-hCG (42.8 kDa). P4 produced per total cellular protein (nanograms per microgram) was measured via ELISA and fluorometric protein determination kits. Both total hCG (P = 0.0003) and purified standard hCG (P < 0.0001) stimulated a dose-dependent increase in P4 production. Purified H-hCG did not change the P4 produced per total cellular protein response (P value not significant). Standard hCG stimulated P4 production by cultured granulosa cells and likely supports corpus luteum function via interactions with the LH/hCG receptor. In contrast, H-hCG did not increase P4 production, which indicates a nonsteroidogenic role for this protein during early gestation.
HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.
Brendle, Sarah A; Christensen, Neil D
2015-01-01
Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.
A novel assay to identify the trafficking proteins that bind to specific vesicle populations
Bentley, Marvin; Banker, Gary
2016-01-01
Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371
Shaily; Kumar, Ajay; Parveen, Iram; Ahmed, Naseem
2018-06-01
Exposure to even very low concentrations of Pb 2+ is known to cause cardiovascular, neurological, developmental, and reproductive disorders, and affects children in particular more severely. Consequently, much effort has been dedicated to the development of colorimetric and fluorescent sensors that can selectively detect Pb 2+ ions. Here, we describe the development of a triazole-based fluorescent sensor L5 for Pb 2+ ion detection. The fluorescence intensity of chemosensor L5 was selectively quenched by Pb 2+ ions and a clear color change from colorless to yellow could be observed by the naked eye. Chemosensor L5 exhibited high sensitivity and selectivity towards Pb 2+ ions in phosphate-buffered solution [20 mM, 1:9 DMSO/H 2 O (v/v), pH 8.0] with a 1:1 binding stoichiometry, a detection limit of 1.9 nM and a 6.76 × 10 6 M -1 binding constant. Additionally, low-cost and easy-to-prepare test strips impregnated with chemosensor L5 were also produced for efficient of Pb 2+ detection and proved the practical use of this test. Copyright © 2018 John Wiley & Sons, Ltd.
Palsule, Vrushalee V.; Yeo, Jiyoun; Shepherd, Brian S.; Crawford, Erin L.; Stepien, Carol A.
2013-01-01
Viral Hemorrhagic Septicemia virus (VHSv) is one of the world's most serious fish pathogens, infecting >80 marine, freshwater, and estuarine fish species from Eurasia and North America. A novel and especially virulent strain – IVb – appeared in the Great Lakes in 2003, has killed many game fish species in a series of outbreaks in subsequent years, and shut down interstate transport of baitfish. Cell culture is the diagnostic method approved by the USDA-APHIS, which takes a month or longer, lacks sensitivity, and does not quantify the amount of virus. We thus present a novel, easy, rapid, and highly sensitive real-time quantitative reverse transcription PCR (qRT-PCR) assay that incorporates synthetic competitive template internal standards for quality control to circumvent false negative results. Results demonstrate high signal-to-analyte response (slope = 1.00±0.02) and a linear dynamic range that spans seven orders of magnitude (R2 = 0.99), ranging from 6 to 6,000,000 molecules. Infected fishes are found to harbor levels of virus that range to 1,200,000 VHSv molecules/106 actb1 molecules with 1,000 being a rough cut-off for clinical signs of disease. This new assay is rapid, inexpensive, and has significantly greater accuracy than other published qRT-PCR tests and traditional cell culture diagnostics. PMID:23977162
Pierce, Lindsey R; Willey, James C; Palsule, Vrushalee V; Yeo, Jiyoun; Shepherd, Brian S; Crawford, Erin L; Stepien, Carol A
2013-01-01
Viral Hemorrhagic Septicemia virus (VHSv) is one of the world's most serious fish pathogens, infecting >80 marine, freshwater, and estuarine fish species from Eurasia and North America. A novel and especially virulent strain - IVb - appeared in the Great Lakes in 2003, has killed many game fish species in a series of outbreaks in subsequent years, and shut down interstate transport of baitfish. Cell culture is the diagnostic method approved by the USDA-APHIS, which takes a month or longer, lacks sensitivity, and does not quantify the amount of virus. We thus present a novel, easy, rapid, and highly sensitive real-time quantitative reverse transcription PCR (qRT-PCR) assay that incorporates synthetic competitive template internal standards for quality control to circumvent false negative results. Results demonstrate high signal-to-analyte response (slope = 1.00±0.02) and a linear dynamic range that spans seven orders of magnitude (R(2) = 0.99), ranging from 6 to 6,000,000 molecules. Infected fishes are found to harbor levels of virus that range to 1,200,000 VHSv molecules/10(6) actb1 molecules with 1,000 being a rough cut-off for clinical signs of disease. This new assay is rapid, inexpensive, and has significantly greater accuracy than other published qRT-PCR tests and traditional cell culture diagnostics.
Ozyurt, Dilek; Demirata, Birsen; Apak, Resat
2011-11-01
A Ce(IV)-based reducing capacity (CERAC) assay was developed to measure the total antioxidant capacity (TAC) of foods, in which Ce(IV) would selectively oxidize antioxidant compounds but not citric acid and reducing sugars which are not classified as antioxidants. The method is based on the electron-transfer (ET) reaction between Ce(IV) ion and antioxidants in optimized acidic sulphate medium (i.e., 0.3 M H(2)SO(4) and 0.7 M Na(2)SO(4)) and subsequent determination of the produced Ce(III) ions by a fluorometric method. The fluorescent product, Ce(III), exhibited strong fluorescence at 360 nm with an excitation wavelength of 256 nm, the fluorescence intensity being correlated to antioxidant power of the original sample. The linear concentration range for most antioxidants was quite wide, e.g., 5.0 × 10(-7)-1.0 × 10(-5) M for quercetin. The developed procedure was successfully applied to the TAC assay of antioxidant compounds such as trolox, quercetin, gallic acid, ascorbic acid, catechin, naringin, naringenin, caffeic acid, ferulic acid, glutathione, and cysteine. The proposed method was reproducible, additive in terms of TAC values of constituents of complex mixtures, and the trolox equivalent antioxidant capacities (TEAC coefficients) of the tested antioxidant compounds gave good correlations with those found by reference methods such as ABTS and CUPRAC.
Ahmad, Islamudin; Yanuar, Arry; Mulia, Kamarza; Mun’im, Abdul
2017-01-01
The renin-angiotensin-aldosterone system is a signaling pathway which responsible in the blood pressure regulation. Angiotensin-converting enzyme (ACE) is one of the key elements responsible for the hypertensive mechanism. It converts angiotensin-I to angiotensin-II. The discovery history of the ACE inhibitory activity assay method has been through a long stage for decades and development continues until today. The ACE inhibitory activity has become an effective screening method in the search for new antihypertensive agents from herbal plants. Some of in vitro assay methods were used to examine the activity of ACE inhibitors based on the substrate usage, such as; Cushman and Cheung Method using a substrate hippuryl-histidyl-leucine (HHL), Holmquist method using a substrate furanacryloyl-tripeptide, Elbl and Wagner method using a substrate benzoil-[l-14C] glicyl-L-histidine-L-leucine, Carmel and Yaron method using a substrate o-aminobenzoylglycyl-p-nitrophenylalanilproline, and Lam method using 3-hydroxybutyrylglycyl-glycyl-glycine as substrate. Several different methods to measure the results of enzymatic reactions or separating substrate with products, including spectrophotometric, fluorometric, high-performance liquid chromatography, electrophoresis, and radiochemistry. Application of the test method for screening the ACE inhibitors activity and investigation of active compounds from natural products can be done easily with this method, it is very helpful in research because the results obtained are simple, accurate, and rapid. PMID:28503045
Mishra, Om P; Popov, Anatoliy V; Pietrofesa, Ralph A; Nakamaru-Ogiso, Eiko; Andrake, Mark; Christofidou-Solomidou, Melpo
2018-06-01
Myeloperoxidase (MPO) generates hypochlorous acid (HOCl) during inflammation and infection. We showed that secoisolariciresinol diglucoside (SDG) scavenges radiation-induced HOCl in physiological solutions. However, the action of SDG and its synthetic version, LGM2605, on MPO-catalyzed generation of HOCl is unknown. The present study evaluated the effect of LGM2605 on human MPO, and murine MPO from macrophages and neutrophils. MPO activity was determined fluorometrically using hypochlorite-specific 3'-(p-aminophenyl) fluorescein (APF). The effect of LGM2605 on (a) the peroxidase cycle of MPO was determined using Amplex Red while the effect on (b) the chlorination cycle was determined using a taurine chloramine assay. Using electron paramagnetic resonance (EPR) spectroscopy we determined the effect of LGM2605 on the EPR signals of MPO. Finally, computational docking of SDG was used to identify energetically favorable docking poses to enzyme's active site. LGM2605 inhibited human and murine MPO activity. MPO inhibition was observed in the absence and presence of Cl - . EPR confirmed that LGM2605 suppressed the formation of Compound I, an oxoiron (IV) intermediate [Fe(IV)O] containing a porphyrin π-radical of MPO's catalytic cycle. Computational docking revealed that SDG can act as an inhibitor by binding to the enzyme's active site. We conclude that LGM2605 inhibits MPO activity by suppressing both the peroxidase and chlorination cycles. EPR analysis demonstrated that LGM2605 inhibits MPO by decreasing the formation of the highly oxidative Compound I. This study identifies a novel mechanism of LGM2605 action as an inhibitor of MPO and indicates that LGM2605 may be a promising attenuator of oxidant-dependent inflammatory tissue damage. Copyright © 2018 Elsevier B.V. All rights reserved.
IgG-Paraoxonase-1 Fusion Protein for Targeted Drug Delivery Across the Human Blood-Brain Barrier
Boado, Ruben J.; Zhang, Yun; Zhang, Yufeng; Wang, Yuntao; Pardridge, William M.
2009-01-01
Paraoxonase (PON)-1 is the most potent human protein with organophosphatase activity against organophosphate (OP) toxins. OP compounds readily cross the blood-brain barrier (BBB), and have lethal mechanisms of action within the brain. The production of a brain penetrating form of human PON1, which crosses the BBB, is possible with the re-engineering of the enzyme as a fusion protein with a monoclonal antibody (MAb) against the human insulin receptor (HIR). The HIRMAb crosses the BBB via the endogenous insulin receptor, and acts as a molecular Trojan horse to ferry the PON1 into brain. The human PON1 was fused to the carboxyl terminus of the heavy chain of the chimeric HIRMAb. COS cells were dual transfected with the heavy chain gene and the light chain gene, and the HIRMAb-PON1 fusion protein was affinity purified with protein A chromatography. Western blotting with antibodies to human IgG or human PON1 showed the heavy chain of the HIRMAb-PON1 fusion protein was 40 kDa larger than the heavy chain of the chimeric HIRMAb. The ED50 of binding to the HIR extracellular domain was 0.55 ± 0.07 nM and 1.1 ±0.1 nM, respectively, for the chimeric HIRMAb and the HIRMAb-PON1 fusion protein. The PON1 enzyme activity of the fusion protein was approximately 25% of the enzyme activity in human plasma, based on a fluorometric enzymatic assay. In conclusion, human PON1 has been re-engineered as an IgG-organophosphatase fusion protein that penetrates the human BBB. PMID:19434854
Lectin binding assays for in-process monitoring of sialylation in protein production.
Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong
2010-07-01
Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.
Development of Carbocyanine Dyes for PRMT Inhibition and Imaging
Sinha, Sarmistha Halder; Owens, Eric A.; Feng, You; Yang, Yutao; Xie, Yan; Tu, Yaping; Henary, Maged; Zheng, Yujun George
2014-01-01
Summary Protein arginine methylation regulates multiple biological processes. Deregulation of protein arginine methyltransferase (PRMT) activities has been observed in many disease phenotypes. Small molecule probes that target PRMTs with strong affinity and selectivity can be used as valuable tools to dissect biological mechanisms of arginine methylation and establish the role of PRMT proteins in a disease process. In this work, we report synthesis and evaluation of a class of carbocyanine compounds containing indolium, benz[e]indolium or benz[c,d]indolium heterocyclic moieties that bind to the predominant arginine methyltransferase PRMT1 and inhibit its methyltransferase activity at low micromolar potencies. In particular, the developed molecules have long wavelength colorimetric and fluorometric photoactivities, which can be used for optical and near-infrared fluorescence imaging in cells or biological tissues. Together, these new chemical probes have potential application in PRMT studies both as enzyme inhibitors and as fluorescent dyes for microscope imaging. PMID:22749641
Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V
2012-11-21
Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.
2012-01-01
Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064
Flow cytometer measurement of binding assays
Saunders, George C.
1987-01-01
A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.
The Analysis of Riboflavin in Urine Using Fluorescence
NASA Astrophysics Data System (ADS)
Henderleiter, Julie A.; Hyslop, Richard M.
1996-06-01
To become functional as scientists, chemistry students must integrate concepts learned in their classes and apply them to novel, "real life" situations. The laboratory provides an important place for the students to practice integrating concepts. This laboratory experiment, designed for undergraduate biochemistry students, requires each student to determine the amount of riboflavin excreted by his/her body following oral administration of riboflavin contained in a multi-vitamin tablet. The experimental procedure describes a protocol for the analysis of riboflavin concentration in urine using a fluorometric assay. The students must draw upon their knowledge of solution preparation, construction of a standard curve, and back-calculation procedures to determine the concentration of riboflavin in their urine. Students need to combine knowledge from general and analytical chemistry with that learned in biochemistry to complete this analysis, thus providing an opportunity to integrate knowledge while answering a novel question.
Guarnieri, Michael T.; Blagg, Brian S. J.
2011-01-01
Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069
Xu, Weifeng; Jiang, Hao; Titsch, Craig; Gadkari, Snaehal; Batog, Alicja; Wang, Bonnie; Hippeli, Lauren; Yamamoto, Brent; Chadwick, Kristina; Wheeler, Jennifer; Thompson, Chris; Stahl, James; Willett, Scott; DeSilva, Binodh S; Myler, Heather; Dodge, Robert W; Pillutla, Renuka C
2018-06-20
A ligand-binding assay (LBA) was used to measure exposure of PRM-151, the recombinant form of human pentraxin-2 (PTX-2), a complex pentamer with multiple binding partners. However, the assay showed a lack of dose-dependent exposure in select preclinical species and it could not differentiate the infused PRM-151 from the endogenous PTX-2 in nonhuman primates. Instead of assessing interference from its multiple binding partners, which could be time consuming and laborious, a LC-MS assay avoid of these interference was implemented to measure 'total' drug without the use of immunoaffinity capture reagents. The resultant LC-MS data confirmed the original data and the lack of dose-dependent exposure is now understood to be due to the multiple and diverse targets and functions and resultant complex biodistribution rather than an assay artifact.
Monserrat, J M; Seixas, A L R; Ferreira-Cravo, M; Bürguer-Mendonça, M; Garcia, S C; Kaufmann, C G; Ventura-Lima, J
2017-06-01
Nanomaterials (NM) exhibit unique properties due their size and relative area, but the mechanisms and effects in the living organisms are yet to be unfold in their totality. Potential toxicity mechanisms concerning NM as carbon nanotubes include oxidative stress generation. Several fluorimetric and colorimetric methods have been systematically used to measure NM toxicity, and controversial results have been reported. One of the problems can be related to the interference effects induced by NM, leading to artifacts that can lead to misleading conclusions. In present study, it was performed in vitro assays with two aquatic species: the zebrafish Danio rerio and the polychaete Laeonereis acuta to evaluate the potential interference capacity of single-wall carbon nanotubes (SWCNT) in a fluorometric method (TBARS assay) to measure lipid peroxidation. Obtained results indicated that gills and brain of zebrafish presented a lowered fluorescence only at extremely high concentrations (50 and 500mg/L). Determinations in anterior, middle, and posterior body regions of L. acuta showed a quite different pattern: high fluorescence at low SWCNT concentrations (0.5mg/L) and lowering at the highest (500mg/L). To eliminate matrix effect of biological samples, tests employing the standard for TBARS assay, 1,3,3-tetramethoxipropane, were run and the results showed again higher fluorescence values at low concentrations (0.5-5mg SWCNT/L), a technique artifact that could lead to misleading conclusions since higher fluorescence values implicate higher TBARS concentration, implying oxidative stress. Using the colorimetric FOX assay with cumene hydroperoxide as standard presented remarkable better results since no artifacts were observed in the same SWCNT concentration range that employed with the TBARS technique. Copyright © 2017 Elsevier Inc. All rights reserved.
Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward
2016-01-01
Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837
Glucocorticoid receptor ligand binding in monocytic cells using a microplate assay.
Jansen, J; Uitdehaag, B; Koper, J W; van Den Berg, T K
1999-01-01
Glucocorticoids have profound effects on macrophage function and are widely used as anti-inflammatory drugs. Glucocorticoids receptor (GR) ligand binding capacity is a major determinant of cellular glucocorticoid sensitivity. The number and affinity of GR can be measured in a whole cell binding assay using (3)H-dexamethasone. Here, we describe a rapid and simple microplate assay for GR measurement using the human promonocytic cell line THP-1. Copyright 2000 S. Karger AG, Basel.
Huang, W; Feltus, A; Witkowski, A; Daunert, S
1996-05-01
A homogeneous bioluminescence competitive binding assay for folate was developed by using a coupled enzyme system of glucose-6-phosphate dehydrogenase (G6PDH) and bacterial luciferase. A highly substituted G6PDH-folate conjugate was prepared by employing an N-hydroxysuccinimide/carbodiimide method. Folate binding protein inhibits the activity of the conjugate. In the presence of folate, there is a competition between folate and the G6PDH-folate conjugate for the binding site of the folate binding protein, and the activity of the conjugate is recovered. Thus, the concentration of folate can be related to the activity of the G6PDH-folate conjugate, which is directly related to the bioluminescence produced by the coupled enzyme reaction. Using this assay, dose-response curves with a detection limit of 2.5 x 10(-8) M folate were obtained, which is an improvement of an order of magnitude with respect to an assay that monitors G6PDH activity spectrophotometrically. The assay was validated using vitamin tablets and a cell culture medium.
The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...
This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (h...
McGowan, K B; Kurtis, M S; Lottman, L M; Watson, D; Sah, R L
2002-07-01
To compare two fluorometric assays, utilizing (1) the bisbenzimidazole Hoechst 33258 and (2) PicoGreen, for determining DNA content in human cartilage. Human articular and nasal septal cartilage explants were digested using proteinase K. Portions of sample digest were analysed for intrinsic and dye-enhanced fluorescence with either Hoechst 33258 or PicoGreen. Intrinsic tissue fluorescence in both articular and septal cartilage increased with age and was prominent at wavelengths used for Hoechst 33258 but relatively low at wavelengths used for PicoGreen. The relative contribution of intrinsic fluorescence to total dye-enhanced fluorescence of human cartilage was markedly greater for Hoechst 33258 (19-57%) than for PicoGreen (2-7%). Thus, in many situations, DNA in human cartilage can be assayed using PicoGreen without the need to correct for intrinsic cartilage fluorescence. The enhancement of fluorescence by each dye was found to be specific for DNA, as shown by fluorescence spectra, >90% sensitivity to DNase, and resistance to RNase. In addition, little or no interference was caused by non-DNA tissue components, since DNA caused an equal enhancement in the absence or presence of proteinase K digested human cartilage, once intrinsic cartilage fluorescence was subtracted. PicoGreen was more sensitive for assaying DNA (0.9ng DNA/ml) than Hoechst 33258 (6ng DNA/ml) and can also be used in a microplate reader. PicoGreen can be used in a rapid and sensitive assay to quantify DNA in small samples of human cartilage. Copyright 2002 Published by Elsevier Science Ltd on behalf of OsteoArthritis Research Society International.
Fluorometric method for the determination of gas-phase hydrogen peroxide
NASA Technical Reports Server (NTRS)
Kok, Gregory L.; Lazrus, Allan L.
1986-01-01
The fluorometric gas-phase hydrogen peroxide procedure is based on the technique used by Lazrus et. al. for the determination of H2O2 in the liquid phase. The analytical method utilizes the reaction of H2O2 with horseradish peroxidase and p-hydroxphenylacetic acid (POPHA) to form the fluorescent dimer of POPHA. The analytical reaction responds stoichiometrically to both H2O2 and some organic hydroperoxides. To discriminate H2O2 from organic hydroperoxides, catalase is used to preferentially destroy H2O2. Using a dual-channel flow system the H2O2 concentration is determined by difference.
Davarani, Saied Saeed Hosseiny; Moazami, Hamid Reza; Keshtkar, Ali Reza; Banitaba, Mohammad Hossein; Nojavan, Saeed
2013-06-14
A novel method for the selective electromembrane extraction (EME) of U(6+) prior to fluorometric determination has been proposed. The effect of extraction conditions including supported liquid membrane (SLM) composition, extraction time and extraction voltage were investigated. An SLM composition of 1% di-2-ethyl hexyl phosphonic acid in nitrophenyl octyl ether (NPOE) showed good selectivity, recovery and enrichment factor. The best performance was achieved at an extraction potential of 80 volts and an extraction time of 14 minutes Under the optimized conditions, a linear range from 1 to 1000 ng mL(-1) and LOD of 0.1 ng mL(-1) were obtained for the determination of U(6+). The EME method showed good performance in sample cleanup and the reduction of the interfering effects of Mn(2+), Zn(2+), Cd(2+), Ni(2+), Fe(3+), Co(2+), Cu(2+), Cl(-) and PO4(3-) ions during fluorometric determination of uranium in real water samples. The recoveries above 54% and enrichment factors above 64.7 were obtained by the proposed method for real sample analysis. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Rana, Md. Muhit
DNA nanotechnology has shown great promise in molecular diagnostic, bioanalytical and biomedical applications. The great challenge of detecting target analytes, biomarkers and small molecules, in molecular diagnostics is low yield sensitivity. To address this challenge, different nanomaterials have been used for a long time and to date there is no such cost-effective bioanalytical technique which can detect these target biomarkers (DNA, RNA, circulating DNA/miRNA) or environmental heavy metal ions (Hg2+ and Ag+) in a cost-effective and efficient manner. Herein, we initially discuss two possible bioanalytical detection methods- a) colorimetric and b) fluorometric assays which are very popular nowadays due to their distinctive spectroscopic properties. Finally, we report the promising colorimetric assay using a novel DNA based amplification strategy know as hybridization chain reaction (HCR) for potential application in the visual detection of low copies of biomarkers (miRNAs as little as 20 femtomole in an RNA pool and cell extracts in seven different combinations and Ebola virus DNA as low as 400 attomoles in liquid biopsy mimics in sixteen different combinations), environmental and biological heavy metal ions (mercury and silver concentrations as low as 10 pM in water, soil and urine samples) and also successfully applied to a molecular logic gate operation to distinguish OR and AND logic gates. No results showed any false-positive or false-negative information. On the other hand, we also discuss the future possibilities of HCR amplification technology, which is very promising for fluorometric bioanalysis. The HCR based nanoprobe technology has numerous remarkable advantages over other methods. It is re-programmable, simple, inexpensive, easy to assemble and operate and can be performed with visual and spectroscopic read-outs upon recognition of the target analytes. This rapid, specific and sensitive approach for biomarkers and heavy metal ion detection generates an on-site signal while eliminating the use of sophisticated high-maintenance instrumentation. We demonstrate that this state-of-the-art technology and methodology can potentially serve as an alternative approach to detect novel disease biomarkers, small molecules and inorganic compounds. This approach can be combined with the current existing methods for real-time point-of-care molecular diagnostics and is significant for preclinical or clinical studies.
Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.
Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T
2018-06-01
To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.
Gassner, C; Karlsson, R; Lipsmeier, F; Moelleken, J
2018-05-30
Previously we have introduced two SPR-based assay principles (dual-binding assay and bridging assay), which allow the determination of two out of three possible interaction parameters for bispecific molecules within one assay setup: two individual interactions to both targets, and/or one simultaneous/overall interaction, which potentially reflects the inter-dependency of both individual binding events. However, activity and similarity are determined by comparing report points over a concentration range, which also mirrors the way data is generated by conventional ELISA-based methods So far, binding kinetics have not been specifically considered in generic approaches for activity assessment. Here, we introduce an improved slope-ratio model which, together with a sensorgram comparison based similarity assessment, allows the development of a detailed, USP-conformal ligand binding assay using only a single sample concentration. We compare this novel analysis method to the usual concentration-range approach for both SPR-based assay principles and discuss its impact on data quality and increased sample throughput. Copyright © 2018 Elsevier B.V. All rights reserved.
A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.
Banasik, Michał; Sachadyn, Paweł
2016-09-01
A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.
A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties
Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.
2017-01-01
Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129
Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui
2017-01-01
Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples. PMID:28451157
Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.
Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong
2006-07-07
We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.
Highly variable sensitivity of five binding and two bio-assays for TSH-receptor antibodies.
Diana, T; Wüster, C; Kanitz, M; Kahaly, G J
2016-10-01
TSH-receptor (TSHR) antibodies (Ab) can be measured with binding or bio-assays. Sensitivity and specificity of five binding and two bio-assays were compared. TSHR-blocking (TBAb) and TSHR-stimulating (TSAb) Ab were measured with reporter bio-assays. Blocking activity was defined as percent inhibition of luciferase expression relative to induction with bTSH alone. TSAb was reported as percentage of specimen-to-reference ratio (SRR%). TSHR-binding inhibitory immunoglobulins (TBII) were measured with Kronus, Dynex, Kryptor, Cobas, and Immulite. Sixty patients with Graves' disease (GD), 20 with Hashimoto's thyroiditis (HT), and 20 healthy controls (C) were included. C tested negative in all assays (specificity 100 %) while all 60 hyperthyroid GD patients tested positive in the TSAb bio-assay (sensitivity 100 %). Among these 60 GD patients, 20 had low TSAb positivity (SRR% 140-279), but were TBII positive in only 20 (100 %), 7 (35 %), 9 (45 %), 11 (55 %), and 18 (90 %) using the Kronus, Dynex, Kryptor, Cobas, and Immulite, respectively. In 20 moderate TSAb-positive (SRR% 280-420) patients, TBII tested positive in 20 (100 %), 14 (70 %), 13 (65 %), 16 (80 %), and 19 (95 %), respectively. The high (SRR% > 420) TSAb-positive patients were all TBII positive. All 20 hypothyroid HT patients tested TBAb positive (sensitivity 100 %) in the bio-assay while they tested TBII positive in 20 (100 %), 18 (90 %), 20, 20, and 18, respectively. Results obtained with two luminometers correlated for TSAb positive (r = 0.99, p < 0.001), TBAb positive (r = 0.88, p < 0.001), and C (r = 0.86, p < 0.001). None of the binding assays differentiated between TSAb and TBAb. Sensitivity is highly variable between binding and bio-assays for TSHR-Abs.
Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M
2012-09-01
Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.
Wetherall, N T; Trivedi, T; Zeller, J; Hodges-Savola, C; McKimm-Breschkin, J L; Zambon, M; Hayden, F G
2003-02-01
The increasing use of influenza virus neuraminidase (NA) inhibitors (NIs) necessitates the development of reliable methods for assessing the NI susceptibility of clinical isolates. We evaluated three NA inhibition assays against a panel of five clinical isolates each of influenza virus A/H1N1, A/H3N2, and B strains and four viruses with a defined resistance genotype (R292K, H274Y, R152K, and E119V). For fluorometric enzyme assay (FA) 1 (FA-1), 2'-(4-methylumbelliferyl)-alpha-D-N-acetylneuraminic acid (MUNANA) at 100 microM was used as the substrate, with pretitration of the virus input. For FA-2, MUNANA at 200 microM was used as the substrate, with a fixed 1:10 dilution of input virus. For the chemiluminescence (CL) assay, the 1,2-dioxetane derivative of sialic acid at 100 microM was used as the substrate, with pretitration of the virus. Four different operators repeated the assays several times in a blinded fashion with both zanamivir and oseltamivir carboxylate (GS4071) to determine intra- and interassay variations. Mean 50% inhibitory concentration (IC(50)) values were lower and generally less variable with the CL assay. FA-1 displayed greater variation than the CL assay or FA-2 and the highest IC(50) values with zanamivir; FA-2 showed the highest values with oseltamivir, particularly for influenza virus B, and was more variable with zanamivir than was the CL assay. All three assays detected 40-fold or greater changes in IC(50) values for the resistant viruses with at least one drug. Mixing experiments, whereby increasing fractions (0, 20, 40, 60, 80, and 100%) of NA from a known NI-resistant virus were mixed with the corresponding NI-sensitive parental NA, indicated that the resolution of IC(50) values was clearer with the CL assay than with FA-2 for two of the resistant variants (R152K and E119V). The FA and CL methods were reliable for the detection of NI resistance, but all assays have certain limitations. Based on reproducibility, ease of automation, time required for the assay, and greater sensitivity, the CL assay was selected for future susceptibility testing of influenza virus isolates circulating globally.
Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan
2016-06-01
G protein-coupled receptors (GPCRs) mediate many important physiological functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of experimental approaches for screening compound libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small molecules, and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput determination of receptor-ligand binding affinities and kinetic rate constants for various therapeutically relevant GPCRs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Johnson, G G; Geiduschek, E P
1977-04-05
The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.
Ohara, Nobumasa; Kaneko, Masanori; Kitazawa, Masaru; Uemura, Yasuyuki; Minagawa, Shinichi; Miyakoshi, Masashi; Kaneko, Kenzo; Kamoi, Kyuzi
2017-02-06
Graves' disease is an autoimmune thyroid disorder characterized by hyperthyroidism, and patients exhibit thyroid-stimulating hormone receptor antibody. The major methods of measuring circulating thyroid-stimulating hormone receptor antibody include the thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Although the diagnostic accuracy of these assays has been improved, a minority of patients with Graves' disease test negative even on second-generation and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulins. We report a rare case of a thyroid-stimulating hormone-binding inhibitory immunoglobulin-positive patient with Graves' disease who showed rapid lowering of thyroid-stimulating hormone-binding inhibitory immunoglobulin levels following administration of the anti-thyroid drug thiamazole, but still experienced Graves' hyperthyroidism. A 45-year-old Japanese man presented with severe hyperthyroidism (serum free triiodothyronine >25.0 pg/mL; reference range 1.7 to 3.7 pg/mL) and tested weakly positive for thyroid-stimulating hormone-binding inhibitory immunoglobulins on second-generation tests (2.1 IU/L; reference range <1.0 IU/L). Within 9 months of treatment with oral thiamazole (30 mg/day), his thyroid-stimulating hormone-binding inhibitory immunoglobulin titers had normalized, but he experienced sustained hyperthyroidism for more than 8 years, requiring 15 mg/day of thiamazole to correct. During that period, he tested negative on all first-generation, second-generation, and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, but thyroid scintigraphy revealed diffuse and increased uptake, and thyroid ultrasound and color flow Doppler imaging showed typical findings of Graves' hyperthyroidism. The possible explanations for serial changes in the thyroid-stimulating hormone-binding inhibitory immunoglobulin results in our patient include the presence of thyroid-stimulating hormone receptor antibody, which is bioactive but less reactive on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, or the effect of reduced levels of circulating thyroid-stimulating hormone receptor antibody upon improvement of thyroid autoimmunity with thiamazole treatment. Physicians should keep in mind that patients with Graves' disease may show thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results that do not reflect the severity of Graves' disease or indicate the outcome of the disease, and that active Graves' disease may persist even after negative results on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Timely performance of thyroid function tests in combination with sensitive imaging tests, including thyroid ultrasound and scintigraphy, are necessary to evaluate the severity of Graves' disease and treatment efficacy.
Wilson, Kris; Mole, Damian J; Homer, Natalie Z M; Iredale, John P; Auer, Manfred; Webster, Scott P
2015-02-01
Human kynurenine 3-monooxygenase (KMO) is emerging as an important drug target enzyme in a number of inflammatory and neurodegenerative disease states. Recombinant protein production of KMO, and therefore discovery of KMO ligands, is challenging due to a large membrane targeting domain at the C-terminus of the enzyme that causes stability, solubility, and purification difficulties. The purpose of our investigation was to develop a suitable screening method for targeting human KMO and other similarly challenging drug targets. Here, we report the development of a magnetic bead-based binding assay using mass spectrometry detection for human KMO protein. The assay incorporates isolation of FLAG-tagged KMO enzyme on protein A magnetic beads. The protein-bound beads are incubated with potential binding compounds before specific cleavage of the protein-compound complexes from the beads. Mass spectrometry analysis is used to identify the compounds that demonstrate specific binding affinity for the target protein. The technique was validated using known inhibitors of KMO. This assay is a robust alternative to traditional ligand-binding assays for challenging protein targets, and it overcomes specific difficulties associated with isolating human KMO. © 2014 Society for Laboratory Automation and Screening.
ERIC Educational Resources Information Center
Hicks, Katherine A.
2016-01-01
Fluorescence quenching assays are often used to measure dissociation constants that quantify the binding affinity between small molecules and proteins. In an upper-division undergraduate laboratory course, where students work on projects using a guided inquiry-based approach, a binding titration experiment at physiological pH is performed to…
ERIC Educational Resources Information Center
Mascotti, David P.; Waner, Mark J.
2010-01-01
A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…
Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...
Lipid A binding sites in membranes of macrophage tumor cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.
1988-10-15
Lipopolysaccharide affects a variety of eukaryotic cells and mammalian organisms. These actions are involved in the pathogenesis of Gram-negative septicemia. Many of the actions of lipopolysaccharide are believed to be caused by its active moiety, lipid A. Our laboratory has previously identified a bioactive lipid A precursor, termed lipid IVA, which can be labeled with 32P of high specific activity and purified. In this work we have used the labeled probe, 4'-32P-lipid IVA, to develop a novel assay for the specific binding of lipid IVA to whole cells. We have also demonstrated its use in a ligand blotting assay ofmore » immobilized cellular proteins. Using the whole cell assay, we show that 4'-32P-lipid IVA specifically binds to RAW 264.7 macrophage-like cultured cells. The binding is saturable, is inhibited with excess unlabeled lipid IVA, and is proteinase K-sensitive. It displays cellular and pharmacological specificity. Using the ligand blotting assay, we show that several RAW 264.7 cell proteins can bind 4'-32P-lipid IVA. The two principal binding proteins have Mr values of 31 and 95 kDa, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fractionation studies indicate that the 31-kDa protein is enriched in the nuclear fraction and may be a histone, whereas the 95-kDa protein is enriched in the membrane fraction. The binding assays that we have developed should lead to a clearer understanding of lipid A/animal cell interactions.« less
Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins
Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira
2013-01-01
Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103
Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.
Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira
2013-01-01
Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.
Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.
Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen
2010-08-01
Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.
Tang, Cong; Qian, Zhaosheng; Huang, Yuanyuan; Xu, Jiamin; Ao, Hang; Zhao, Meizhi; Zhou, Jin; Chen, Jianrong; Feng, Hui
2016-09-15
A convenient, reliable and highly sensitive assay for alkaline phosphatase (ALP) activity in the real-time manner is developed based on β-cyclodextrin-modified carbon quantum dots (β-CD-CQDs) nanoprobe through specific host-guest recognition. Carbon quantum dots were first functionalized with 3-aminophenyl boronic acid to produce boronic acid-functionalized CQDs, and then further modified with hydropropyl β-cyclodextrins (β-CD) through B-O bonds to form β-CD-CQDs nanoprobe. p-Nitrophenol phosphate disodium salt is used as the substrate of ALP, and can hydrolyze to p-nitrophenol under the catalysis of ALP. The resulting p-nitrophenol can enter the cavity of β-CD moiety in the nanoprobe due to their specific host-guest recognition, where photoinduced electron transfer process between p-nitrophenol and CQDs takes place to efficiently quench the fluorescence of the probe. The correlation between quenched fluorescence and ALP level can be used to establish quantitative evaluation of ALP activity in a broad range from 3.4 to 100.0U/L with the detection limit of 0.9U/L. This assay shows a high sensitivity to ALP even in the presence of a very high concentration of glucose. This study demonstrates a good electron donor/acceptor pair, which can be used to design general detection strategy through PET process, and also broadens the application of host-guest recognition for enzymes detection in clinical practice. Copyright © 2016 Elsevier B.V. All rights reserved.
Neiens, Patrick; De Simone, Angela; Ramershoven, Anna; Höfner, Georg; Allmendinger, Lars; Wanner, Klaus T
2018-03-03
MS Binding Assays represent a label-free alternative to radioligand binding assays. In this study, we present an LC-ESI-MS/MS method for the quantification of (R,R)-4-(2-benzhydryloxyethyl)-1-(4-fluorobenzyl)piperidin-3-ol [(R,R)-D-84, (R,R)-1], (S,S)-reboxetine [(S,S)-2], and (S)-citalopram [(S)-3] employed as highly selective nonlabeled reporter ligands in MS Binding Assays addressing the dopamine [DAT, (R,R)-D-84], norepinephrine [NET, (S,S)-reboxetine] and serotonin transporter [SERT, (S)-citalopram], respectively. The developed LC-ESI-MS/MS method uses a pentafluorphenyl stationary phase in combination with a mobile phase composed of acetonitrile and ammonium formate buffer for chromatography and a triple quadrupole mass spectrometer in the multiple reaction monitoring mode for mass spectrometric detection. Quantification is based on deuterated derivatives of all three analytes serving as internal standards. The established LC-ESI-MS/MS method enables fast, robust, selective and highly sensitive quantification of all three reporter ligands in a single chromatographic run. The method was validated according to the Center for Drug Evaluation and Research (CDER) guideline for bioanalytical method validation regarding selectivity, accuracy, precision, calibration curve and sensitivity. Finally, filtration-based MS Binding Assays were performed for all three monoamine transporters based on this LC-ESI-MS/MS quantification method as read out. The affinities determined in saturation experiments for (R,R)-D-84 toward hDAT, for (S,S)-reboxetine toward hNET, and for (S)-citalopram toward hSERT, respectively, were in good accordance with results from literature, clearly demonstrating that the established MS Binding Assays have the potential to be an efficient alternative to radioligand binding assays widely used for this purpose so far. Copyright © 2018 John Wiley & Sons, Ltd.
Taga, C; Tsuji, M; Nakajima, T
1989-05-01
A reversed phase HPLC method with fluorometric detection for the analysis of beta-phenylethylamine has been developed using p-methoxyphenylethylamine as an internal standard. Two columns, containing 200 microL of Dowex 50-X8 and Amberlite CG-50 respectively, were used to prepare a fraction containing beta-phenylethylamine. The recoveries of beta-phenylethylamine and p-methoxyphenylethylamine were 53.9 +/- 9.4% and 68.1 +/- 12.4%, respectively, and elution profile of p-methoxyphenylethylamine was sufficiently well correlated with that of beta-phenylethylamine. Regional distributions of beta-phenylethylamine in rat and mouse brains were determined. The highest concentrations were found in hypothalamus and hippocampus in both animals.
Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu
2003-08-29
We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.
Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.
Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S
1994-01-01
The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.
FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.
Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R
2015-03-07
A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.
Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.
2009-01-01
The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256
Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M
2013-03-01
Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.
ApoHRP-based assay to measure intracellular regulatory heme.
Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M
2015-02-01
The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.
Staack, Roland F; Jordan, Gregor; Heinrich, Julia
2012-02-01
For every drug development program it needs to be discussed whether discrimination between free and total drug concentrations is required to accurately describe its pharmacokinetic behavior. This perspective describes the application of mathematical simulation approaches to guide this initial decision based on available knowledge about target biology, binding kinetics and expected drug concentrations. We provide generic calculations that can be used to estimate the necessity of free drug quantification for different drug molecules. In addition, mathematical approaches are used to simulate various assay conditions in bioanalytical ligand-binding assays: it is demonstrated that due to the noncovalent interaction between the binding partners and typical assay-related interferences in the equilibrium, a correct quantification of the free drug concentration is highly challenging and requires careful design of different assay procedure steps.
Sustained Release of Antibacterial Lipopeptides from Biodegradable Polymers against Oral Pathogens
Eckhard, Lea H.; Houri-Haddad, Yael; Sol, Asaf; Zeharia, Rotem; Shai, Yechiel; Beyth, Shaul; Domb, Abraham J.
2016-01-01
The development of antibacterial drugs to overcome various pathogenic species, which inhabit the oral cavity, faces several challenges, such as salivary flow and enzymatic activity that restrict dosage retention. Owing to their amphipathic nature, antimicrobial peptides (AMPs) serve as the first line of defense of the innate immune system. The ability to synthesize different types of AMPs enables exploitation of their advantages as alternatives to antibiotics. Sustained release of AMPs incorporated in biodegradable polymers can be advantageous in maintaining high levels of the peptides. In this study, four potent ultra-short lipopeptides, conjugated to an aliphatic acid chain (16C) were incorporated in two different biodegradable polymers: poly (lactic acid co castor oil) (PLACO) and ricinoleic acid-based poly (ester-anhydride) (P(SA-RA)) for sustained release. The lipopeptide and polymer formulations were tested for antibacterial activity during one week, by turbidometric measurements of bacterial outgrowth, anti-biofilm activity by live/dead staining, biocompatibility by hemolysis and XTT colorimetric assays, mode of action by fluorescence-activated cell sorting (FACS) and release profile by a fluorometric assay. The results show that an antibacterial and anti-biofilm effect, as well as membrane disruption, can be achieved by the use of a formulation of lipopeptide incorporated in biodegradable polymer. PMID:27606830
Extracellular enzyme activity in a willow sewage treatment system.
Brzezinska, Maria Swiontek; Lalke-Porczyk, Elżbieta; Kalwasińska, Agnieszka
2012-12-01
This paper presents the results of studies on the activity of extra-cellular enzymes in soil-willow vegetation filter soil which is used in the post-treatment of household sewage in an onsite wastewater treatment system located in central Poland. Wastewater is discharged from the detached house by gravity into the onsite wastewater treatment system. It flows through a connecting pipe into a single-chamber septic tank and is directed by the connecting pipe to a control well to be further channelled in the soil-willow filter by means of a subsurface leaching system. Soil samples for the studies were collected from two depths of 5 cm and 1 m from three plots: close to the wastewater inflow, at mid-length of the plot and close to its terminal part. Soil samples were collected from May to October 2009. The activity of the extra-cellular enzymes was assayed by the fluorometric method using 4-methylumbelliferyl and 7-amido-4-methylcoumarin substrate. The ranking of potential activity of the assayed enzymes was the same at 5 cm and 1 m soil depths, i.e. esterase > phosphmomoesterase > leucine-aminopeptidase > β-glucosidase > α-glucosidase. The highest values of enzymatic activity were recorded in the surface layer of the soil at the wastewater inflow and decreased with increasing distance from that point.
Laser fluorometric analysis of plants for uranium exploration
Harms, T.F.; Ward, F.N.; Erdman, J.A.
1981-01-01
A preliminary test of biogeochemical exploration for locating uranium occurrences in the Marfa Basin, Texas, was conducted in 1978. Only 6 of 74 plant samples (mostly catclaw mimosa, Mimosa biuncifera) contained uranium in amounts above the detection limit (0.4 ppm in the ash) of the conventional fluorometric method. The samples were then analyzed using a Scintrex UA-3 uranium analyzer* * Use of trade names in this paper is for descriptive purposes only and does not constitute endorsement by the U.S. Geological Survey. - an instrument designed for direct analysis of uranium in water, and which can be conveniently used in a mobile field laboratory. The detection limit for uranium in plant ash (0.05 ppm) by this method is almost an order of magnitude lower than with the fluorometric conventional method. Only 1 of the 74 samples contained uranium below the detection limit of the new method. Accuracy and precision were determined to be satisfactory. Samples of plants growing on mineralized soils and nonmineralized soils show a 15-fold difference in uranium content; whereas the soils themselves (analyzed by delayed neutron activation analysis) show only a 4-fold difference. The method involves acid digestion of ashed tissue, extraction of uranium into ethyl acetate, destruction of the ethyl acetate, dissolution of the residue in 0.005% nitric acid, and measurement. ?? 1981.
Effects of pH on the association between the inhibitor cystatin and the proteinase chymopapain.
Reyes-Espinosa, Francisco; Arroyo-Reyna, Alfonso; Garcia-Gutierrez, Ponciano; Serratos, Iris N; Zubillaga, Rafael A
2014-01-01
Cysteine proteinases are involved in many aspects of physiological regulation. In humans, some cathepsins have shown another function in addition to their role as lysosomal proteases in intracellular protein degradation; they have been implicated in the pathogenesis of several heart and blood vessel diseases and in cancer development. In this work, we present a fluorometric and computational study of the binding of one representative plant cysteine proteinase, chymopapain, to one of the most studied inhibitors of these proteinases: chicken cystatin. The binding equilibrium constant, Kb, was determined in the pH range between 3.5 and 10.0, revealing a maximum in the affinity at pH 9.0. We constructed an atomic model for the chymopapain-cystatin dimer by docking the individual 3D protein structures; subsequently, the model was refined using a 100 ns NPT molecular dynamics simulation in explicit water. Upon scrutiny of this model, we identified 14 ionizing residues at the interface of the complex using a cutoff distance of 5.0 Å. Using the pKa values predicted with PROPKA and a modified proton-linkage model, we performed a regression analysis on our data to obtain the composite pKavalues for three isoacidic residues. We also calculated the electrostatic component of the binding energy (ΔGb,elec) at different pH values using an implicit solvent model and APBS software. The pH profile of this calculated energy compares well with the experimentally obtained binding energy, ΔGb. We propose that the residues that form an interchain ionic pair, Lys139A from chymopapain and Glu19B from cystatin, as well as Tyr61A and Tyr67A from chymopapain are the main residues responsible for the observed pH dependence in the chymopapain- cystatin affinity.
Leemans, Bart; Gadella, Bart M; Sostaric, Edita; Nelis, Hilde; Stout, Tom A E; Hoogewijs, Maarten; Van Soom, Ann
2014-07-01
Sperm-oviduct binding is an essential step in the capacitation process preparing the sperm for fertilization in several mammalian species. In many species, capacitation can be induced in vitro by exposing spermatozoa to bicarbonate, Ca(2+), and albumin; however, these conditions are insufficient in the horse. We hypothesized that binding to the oviduct epithelium is an essential requirement for the induction of capacitation in stallion spermatozoa. Sperm-oviduct binding was established by coincubating equine oviduct explants for 2 h with stallion spermatozoa (2 × 10(6) spermatozoa/ml), during which it transpired that the highest density (per mm(2)) of oviduct-bound spermatozoa was achieved under noncapacitating conditions. In subsequent experiments, sperm-oviduct incubations were performed for 6 h under noncapacitating versus capacitating conditions. The oviduct-bound spermatozoa showed a time-dependent protein tyrosine phosphorylation response, which was not observed in unbound spermatozoa or spermatozoa incubated in oviduct explant conditioned medium. Both oviduct-bound and unbound sperm remained motile with intact plasma membrane and acrosome. Since protein tyrosine phosphorylation can be induced in equine spermatozoa by media with high pH, the intracellular pH (pHi) of oviduct explant cells and bound spermatozoa was monitored fluorometrically after staining with BCECF-AM dye. The epithelial secretory cells contained large, alkaline vesicles. Moreover, oviduct-bound spermatozoa showed a gradual increase in pHi, presumably due to an alkaline local microenvironment created by the secretory epithelial cells, given that unbound spermatozoa did not show pHi changes. Thus, sperm-oviduct interaction appears to facilitate equine sperm capacitation by creating an alkaline local environment that triggers intracellular protein tyrosine phosphorylation in bound sperm. © 2014 by the Society for the Study of Reproduction, Inc.
Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K
A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.
Wischhusen, Jennifer; Padilla, Frederic
2017-07-01
Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Real-time Measurements of Amino Acid and Protein Hydroperoxides Using Coumarin Boronic Acid*
Michalski, Radoslaw; Zielonka, Jacek; Gapys, Ewa; Marcinek, Andrzej; Joseph, Joy; Kalyanaraman, Balaraman
2014-01-01
Hydroperoxides of amino acid and amino acid residues (tyrosine, cysteine, tryptophan, and histidine) in proteins are formed during oxidative modification induced by reactive oxygen species. Amino acid hydroperoxides are unstable intermediates that can further propagate oxidative damage in proteins. The existing assays (oxidation of ferrous cation and iodometric assays) cannot be used in real-time measurements. In this study, we show that the profluorescent coumarin boronic acid (CBA) probe reacts with amino acid and protein hydroperoxides to form the corresponding fluorescent product, 7-hydroxycoumarin. 7-Hydroxycoumarin formation was catalase-independent. Based on this observation, we have developed a fluorometric, real-time assay that is adapted to a multiwell plate format. This is the first report showing real-time monitoring of amino acid and protein hydroperoxides using the CBA-based assay. This approach was used to detect protein hydroperoxides in cell lysates obtained from macrophages exposed to visible light and photosensitizer (rose bengal). We also measured the rate constants for the reaction between amino acid hydroperoxides (tyrosyl, tryptophan, and histidine hydroperoxides) and CBA, and these values (7–23 m−1 s−1) were significantly higher than that measured for H2O2 (1.5 m−1 s−1). Using the CBA-based competition kinetics approach, the rate constants for amino acid hydroperoxides with ebselen, a glutathione peroxidase mimic, were also determined, and the values were within the range of 1.1–1.5 × 103 m−1 s−1. Both ebselen and boronates may be used as small molecule scavengers of amino acid and protein hydroperoxides. Here we also show formation of tryptophan hydroperoxide from tryptophan exposed to co-generated fluxes of nitric oxide and superoxide. This observation reveals a new mechanism for amino acid and protein hydroperoxide formation in biological systems. PMID:24928516
Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen
2010-08-01
Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation. Copyright 2010 Elsevier Inc. All rights reserved.
Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy
2014-04-01
The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field. Copyright © 2013 Elsevier B.V. All rights reserved.
A novel and sensitive radioreceptor assay for serum melatonin levels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tenn, C.; Niles, L.
A simple and sensitive radioreceptor assay (RRA) has been developed to measure melatonin levels in serum. The assay is based on competition between 2-({sup 125}I)iodomelatonin (({sup 125}I)MEL) and melatonin for binding to high-affinity binding sites in chick forebrain. To measure the amount of melatonin present in a serum sample, it was extracted with dichloromethane and added to the assay medium. The percentage inhibition of radioligand binding in the presence of the extracted serum was determined and compared to the percent displacement by known amounts of melatonin in a standard curve. There was little or no cross-reactivity with other structurally relatedmore » compounds. The sensitivity of the assay is {approximately}1.5pg/0.15 mL and the intra- and inter-assay variations are approximately 8%. Since the RRA results are comparable to that of an established radioimmunoassay (RIA), it provides a sensitive and rapid alternative to the more time consuming RIA.« less
Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin
2008-12-01
Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.
Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Miranda Santos, I.K.; Pereira, M.E.
1984-09-01
Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less
A versatile assay for RNA-binding proteins in living cells
Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo
2014-01-01
RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470
Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul
2008-01-01
We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332
Synthesis and evaluation of carbocyanine dyes as PRMT inhibitors and imaging agents.
Sinha, Sarmistha Halder; Owens, Eric A; Feng, You; Yang, Yutao; Xie, Yan; Tu, Yaping; Henary, Maged; Zheng, Yujun George
2012-08-01
Protein arginine methylation regulates multiple biological processes. Deregulation of protein arginine methyltransferase (PRMT) activities has been observed in many disease phenotypes. Small molecule probes that target PRMTs with strong affinity and selectivity can be used as valuable tools to dissect biological mechanisms of arginine methylation and establish the role of PRMT proteins in a disease process. In this work, we report synthesis and evaluation of a class of carbocyanine compounds containing indolium, benz[e]indolium or benz[c,d]indolium heterocyclic moieties that bind to the predominant arginine methyltransferase PRMT1 and inhibit its methyltransferase activity at low micromolar potencies. In particular, the developed molecules have long wavelength colorimetric and fluorometric photoactivities, which can be used for optical and near-infrared fluorescence imaging in cells or biological tissues. Together, these new chemical probes have potential application in PRMT studies both as enzyme inhibitors and as fluorescent dyes for microscope imaging. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Improved flow cytometer measurement of binding assays
Saunders, G.C.
1984-05-30
The invention relates to a method of measuring binding assays carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also a known quantity of smaller particles with a coating of binder reactant. The binding reactant is the same as the binding reactant present in the sample. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number and strength of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating. (LEW)
Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A
2016-10-01
The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin
2015-05-15
It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.
Catarino, Ana I; Cabral, Henrique N; Peeters, Kris; Pernet, Philippe; Punjabi, Usha; Dubois, Philippe
2008-07-01
The present study evaluated the effects of field metal contamination on sperm motility and the RNA/DNA ratio in echinoderms. Populations of Asterias rubens and Echinus acutus that occur naturally along a contamination gradient of sediments by cadmium, copper, lead, and zinc in a Norwegian fjord (the Sørfjord) were studied. Sperm motility, a measure of sperm quality, was quantified using a computer-assisted sperm analysis system. The RNA/DNA ratio, a measure of protein synthesis, was assessed by a one-dye (ethidium bromide)/one-enzyme (RNase), 96-well microplate fluorometric assay. Although both species accumulate metals at high concentrations, neither sperm motility parameters in A. rubens nor the RNA/DNA ratio in both species were affected. The Sørfjord is still one of the most metal-contaminated marine sites in Europe, but even so, populations of A. rubens and E. acutus are able to endure under these conditions.
Hsieh, Hua-Yi; Li, Li-Hua; Hsu, Ren-Yu; Kao, Wei-Fong; Huang, Ying-Chen; Hsu, Cheng-Chih
2017-06-06
Blood testing for endogenous small metabolites to determine physiological and biochemical states is routine for laboratory analysis. Here we demonstrate that by combining the commercial direct analysis in real time (DART) ion source with an ion trap mass spectrometer, native cholesterol in its free alcohol form is readily detected from a few hundred nanoliters of human serum loaded onto chromatography paper. Deuterium-labeled cholesterol was used as the internal standard to obtain the absolute quantity of the endogenous cholesterol. The amount of the cholesterol measured by this paper-loaded DART mass spectrometry (pDART-MS) is statistically comparable with that obtained by using commercially available fluorometric-enzymatic assay and liquid chromatography/mass spectrometry. Furthermore, sera from 21 participants at three different time points in an ultramarathon were collected to obtain their cholesterol levels. The test requires only very minimal sample preparation, and the concentrations of cholesterol in each sample were acquired within a minute.
Papoti, Vassiliki T; Tsimidou, Maria Z
2009-05-13
The impact of sampling parameters, that is, cultivar, leaf age, and sampling date, on the radical scavenging potential of olive leaf extracts was examined via the DPPH(*) and other assays. Total phenol content was estimated colorimetrically and by fluorometry, whereas phenol composition was assessed by RP-HPLC coupled with diode array, fluorometric, and MS detection systems. Oleuropein was not always the major leaf constituent. Considerable differences noted in individual phenol levels (hydroxytyrosol, oleuropein and other secoiridoids, verbascoside, and flavonoids) among samples were not reflected either in the total phenol content or in the radical scavenging potential of the extracts. It can be suggested that olive leaf is a robust source of radical scavengers throughout the year and that differentiation in the levels of individual components depends rather on sampling period than on cultivar or age. The latter does not present predictable regularity. Exploitation of all types of leaves expected in an olive tree shoot for the extraction of bioactive compounds is feasible.
Lee, SangWook; Lee, Jong Hyun; Kwon, Hyuck Gi; Laurell, Thomas; Jeong, Ok Chan; Kim, Soyoun
2018-01-01
Here, we report a sol-gel integrated affinity microarray for on-chip matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) that enables capture and identification of prostate?specific antigen (PSA) in samples. An anti-PSA antibody (H117) was mixed with a sol?gel, and the mixture was spotted onto a porous silicon (pSi) surface without additional surface modifications. The antibody easily penetrates the sol-gel macropore fluidic network structure, making possible high affinities. To assess the capture affinity of the platform, we performed a direct assay using fluorescein isothiocyanate-labeled PSA. Pure PSA was subjected to on-chip MALDI-TOF-MS analysis, yielding three clear mass peptide peaks (m/z = 1272, 1407, and 1872). The sol-gel microarray platform enables dual readout of PSA both fluorometric and MALDI-TOF MS analysis in biological samples. Here we report a useful method for a means for discovery of biomarkers in complex body fluids.
Xu, Liping; Vagner, Josef; Alleti, Ramesh; Rao, Venkataramanarao; Jagadish, Bhumasamudram; Morse, David L; Hruby, Victor J; Gillies, Robert J; Mash, Eugene A
2010-04-15
A labeled variant of MSH(4), a tetrapeptide that binds to the human melanocortin 4 receptor (hMC4R) with low microM affinity, was prepared by solid-phase synthesis methods, purified, and characterized. The labeled ligand, Eu-DTPA-PEGO-His-dPhe-Arg-Trp-NH(2), exhibited a K(d) for hMC4R of 9.1+/-1.4 microM, approximately 10-fold lower affinity than the parental ligand. The labeled MSH(4) derivative was employed in a competitive binding assay to characterize the interactions of hMC4R with monovalent and divalent MSH(4) constructs derived from squalene. The results were compared with results from a similar assay that employed a more potent labeled ligand, Eu-DTPA-NDP-alpha-MSH. While results from the latter assay reflected only statistical effects, results from the former assay reflected a mixture of statistical, proximity, and/or cooperative binding effects. Copyright 2010 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.
2016-05-01
Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.
Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha
2008-11-25
The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.
In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.
Machida, Kazuya
2017-01-01
Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.
Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.
Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S
2014-11-01
A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.
Inpota, Prawpan; Strzelak, Kamil; Koncki, Robert; Sripumkhai, Wisaroot; Jeamsaksiri, Wutthinan; Ratanawimarnwong, Nuanlaor; Wilairat, Prapin; Choengchan, Nathawut; Chantiwas, Rattikan; Nacapricha, Duangjai
2018-01-01
A microfluidic method with front-face fluorometric detection was developed for the determination of total inorganic iodine in drinking water. A polydimethylsiloxane (PDMS) microfluidic device was employed in conjunction with the Sandell-Kolthoff reaction, in which iodide catalyzed the redox reaction between Ce(IV) and As(III). Direct alignment of an optical fiber attached to a spectrofluorometer was used as a convenient detector for remote front-face fluorometric detection. Trace inorganic iodine (IO 3 - and I - ) present naturally in drinking water was measured by on-line conversion of iodate to iodide for determination of total inorganic iodine. On-line conversion efficiency of iodate to iodide using the microfluidic device was investigated. Excellent conversion efficiency of 93 - 103% (%RSD = 1.6 - 11%) was obtained. Inorganic iodine concentrations in drinking water samples were measured, and the results obtained were in good agreement with those obtained by an ICP-MS method. Spiked sample recoveries were in the range of 86%(±5) - 128%(±8) (n = 12). Interference of various anions and cations were investigated with tolerance limit concentrations ranging from 10 -6 to 2.5 M depending on the type of ions. The developed method is simple and convenient, and it is a green method for iodine analysis, as it greatly reduces the amount of toxic reagent consumed with reagent volumes in the microfluidic scale.
Rainbow trout-based assays for estrogenicity are currently being used for development of predictive models based upon quantitative structure activity relationships. A predictive model based on a single species raises the question of whether this information is valid for other spe...
We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...
NASA Astrophysics Data System (ADS)
Agus, Viviana; Di Silvio, Alberto; Rolland, Jean Francois; Mondini, Anna; Tremolada, Sara; Montag, Katharina; Scarabottolo, Lia; Redaelli, Loredana; Lohmer, Stefan
2015-03-01
The use of light-activated proteins represents a powerful tool to control biological processes with high spatial and temporal precision. These so called "optogenetic" technologies have been successfully validated in many recombinant systems, and have been widely applied to the study of cellular mechanisms in intact tissues or behaving animals; to do that, complex, high-intensity, often home-made instrumentations were developed to achieve the optimal power and precision of light stimulation. In our study we sought to determine if this optical modulation can be obtained also in a miniaturized format, such as a 384-well plate, using the instrumentations normally dedicated to fluorescence analysis in High Throughput Screening (HTS) activities, such as for example the FLIPR (Fluorometric Imaging Plate Reader) instrument. We successfully generated optogenetic assays for the study of different ion channel targets: the CaV1.3 calcium channel was modulated by the light-activated Channelrhodopsin-2, the HCN2 cyclic nucleotide gated (CNG) channel was modulated by the light activated bPAC adenylyl cyclase, and finally the genetically encoded voltage indicator ArcLight was efficiently used to measure potassium, sodium or chloride channel activity. Our results showed that stable, robust and miniaturized cellular assays can be developed using different optogenetic tools, and efficiently modulated by the FLIPR instrument LEDs in a 384-well format. The spatial and temporal resolution delivered by this technology might enormously advantage the early stages of drug discovery, leading to the identification of more physiological and effective drug molecules.
Thani, Noor Azela Abdullah; Keshavarz, Sholeh; Lwaleed, Bashir A; Cooper, Alan J; Rooprai, Harcharan K
2014-11-01
Extending work with brain tumours, the hypothesis that micronutrients may usefully augment anticancer regimens, chokeberry (Aronia melanocarpa) extract was tested to establish whether it has pro-apoptotic effects in AsPC-1, an established human pancreatic cell line, and whether it potentiates cytotoxicity in combination with gemcitabine. Pancreatic cancer was chosen as a target, as its prognosis remains dismal despite advances in therapy. An MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) assay was used to assess the growth of the single pancreatic cancer cell line AsPC-1, alone and in comparison or combination with gemcitabine. This was backed up by flow cytometric DRAQ7 cell viability analysis. TUNEL assays were also carried out to investigate pro-apoptotic properties as responsible for the effects of chokeberry extract. Chokeberry extract alone and its IC75 value (1 µg/mL) in combination with gemcitabine were used to assess the growth of the AsPC-1 cell line. Gemcitabine in combination with chokeberry extract was more effective than gemcitabine alone. TUNEL assays showed apoptosis to be a mechanism occurring at 1 µg/mL concentration of chokeberry, with apoptotic bodies detected by both colourimetric and fluorometric methods. The implication of this study, using single cancer cell line, is that chemotherapy (at least with gemcitabine) might be usefully augmented with the use of micronutrients such as chokeberry extract. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
A practical approach to automate randomized design of experiments for ligand-binding assays.
Tsoi, Jennifer; Patel, Vimal; Shih, Judy
2014-03-01
Design of experiments (DOE) is utilized in optimizing ligand-binding assay by modeling factor effects. To reduce the analyst's workload and error inherent with DOE, we propose the integration of automated liquid handlers to perform the randomized designs. A randomized design created from statistical software was imported into custom macro converting the design into a liquid-handler worklist to automate reagent delivery. An optimized assay was transferred to a contract research organization resulting in a successful validation. We developed a practical solution for assay optimization by integrating DOE and automation to increase assay robustness and enable successful method transfer. The flexibility of this process allows it to be applied to a variety of assay designs.
Improved flow cytometer measurement of binding assays
NASA Astrophysics Data System (ADS)
Saunders, G. C.
1984-05-01
A method of measuring binding assays is carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also known quantity of smaller particles with a coating of binder reactant. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating.
Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić
2003-11-01
Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.
Detection of Z DNA binding proteins in tissue culture cells.
Leith, I R; Hay, R T; Russell, W C
1988-01-01
A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919
Binding of environmental carcinogens to asbestos and mineral fibres.
Harvey, G; Pagé, M; Dumas, L
1984-01-01
A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497
DNA-aptamers binding aminoglycoside antibiotics.
Nikolaus, Nadia; Strehlitz, Beate
2014-02-21
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.
NASA Astrophysics Data System (ADS)
Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi
Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.
Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya
2015-06-26
There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.
Use of a Fluorometric Imaging Plate Reader in high-throughput screening
NASA Astrophysics Data System (ADS)
Groebe, Duncan R.; Gopalakrishnan, Sujatha; Hahn, Holly; Warrior, Usha; Traphagen, Linda; Burns, David J.
1999-04-01
High-throughput screening (HTS) efforts at Abbott Laboratories have been greatly facilitated by the use of a Fluorometric Imaging Plate Reader. The FLIPR consists of an incubated cabinet with integrated 96-channel pipettor and fluorometer. An argon laser is used to excite fluorophores in a 96-well microtiter plate and the emitted fluorometer. An argon laser is used to excite fluorophores in a 96-well microtiter plate and the emitted fluorescence is imaged by a cooled CCD camera. The image data is downloaded from the camera and processed to average the signal form each well of the microtiter pate for each time point. The data is presented in real time on the computer screen, facilitating interpretation and trouble-shooting. In addition to fluorescence, the camera can also detect luminescence form firefly luciferase.
NASA Astrophysics Data System (ADS)
Zhu, Qin; Li, Zhao; Mu, Lan; Zeng, Xi; Redshaw, Carl; Wei, Gang
2018-01-01
The compound (E)-8-hydroxyl-2-[(E)-2-(2, 4-dihydroxyphenyl)vinyl]-quinoline (1) has been developed as a fluorometric and colorimetric dual-modal probe for pH detection in solution and in vivo. Remarkable changes in the fluorescence intensity with large Stokes shifts and colorimetric responses were observed as a function of pH. The sensing mechanisms involving protonation and deprotonation processes over the acidic and alkaline pH ranges were confirmed by 1H NMR and IR spectroscopic analysis. Furthermore, the application of probe 1 for the imaging of live PC3 cells was successfully achieved. Test strips based on probe 1 were fabricated, and were found to act as a convenient and efficient pH test kits.
Tian, Qingyun; Zhao, Shuai; Liu, Chuanju
2014-01-01
The discovery that TNF receptors (TNFR) serve as the binding receptors for progranulin (PGRN) reveals the significant role of PGRN in inflammatory and autoimmune diseases, including inflammatory arthritis. Herein we describe a simple, antibody-free analytical assay, i.e., a biotin-based solid-phase binding assay, to examine the direct interaction of PGRN/TNFR and the PGRN inhibition of TNF/TNFR interactions. Briefly, a 96-well high-binding microplate is first coated with the first protein (protein A), and after blocking, the coated microplate is incubated with the biotin-labeled second protein (protein B) in the absence or presence of the third protein (protein C). Finally the streptavidin conjugated with a detecting enzyme is added, followed by a signal measurement. Also discussed in this chapter are the advantages of the strategy, key elements to obtain reliable results, and discrepancies among various PGRN proteins in view of the binding activity with TNFR.
Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A
2008-08-15
Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.
Development of binding assays for the SH2 domain of Grb7 and Grb2 using fluorescence polarization.
Luzy, Jean-Philippe; Chen, Huixiong; Gril, Brunilde; Liu, Wang-Qing; Vidal, Michel; Perdereau, Dominique; Burnol, Anne-Françoise; Garbay, Christiane
2008-02-01
Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY(1139). Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(alphaMe)pTyr-Asn-NH(2)) that exhibits the most potent affinity for the Grb7 SH2 domain described to date.
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Just, Sarah
2017-02-01
von Willebrand disease (VWD) was first described nearly a century ago in 1924 by Erik Adolf von Willebrand. Diagnostic testing at the time was very limited and it was not until the mid to late 1900s that more tests became available to assist with the diagnosis and classification of VWD. Two of these tests are based on ristocetin, one being ristocetin-induced platelet aggregation (RIPA) and the other the von Willebrand factor (VWF) ristocetin cofactor assay (VWF:RCo). The VWF:RCo assay provides functional assessment of in vitro VWF binding to the platelet glycoprotein (Gp) complex, GPIb-IX-V. Despite some advancements and newer technologies utilizing the principles of the original VWF:RCo assay, the original assay is still referred to as the gold standard for measurement of VWF activity. This article will review the history of VWD diagnostic assays, including RIPA and VWF:RCo over the past 40 years, as well as the newer assays that measure platelet binding with or without ristocetin, and which have been developed with the aim to potentially replace platelet-based ristocetin-dependent assays. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun
2017-12-01
In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.
Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang
2018-02-26
The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.
The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...
Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay
Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. Wilson
U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...
Tago, Tetsuro; Furumoto, Shozo; Okamura, Nobuyuki; Harada, Ryuichi; Adachi, Hajime; Ishikawa, Yoichi; Yanai, Kazuhiko; Iwata, Ren; Kudo, Yukitsuka
2016-04-01
Noninvasive imaging of tau and amyloid-β pathologies would facilitate diagnosis of Alzheimer's disease (AD). Recently, we have developed [(18)F]THK-5105 for selective detection of tau pathology by positron emission tomography (PET). The purpose of this study was to clarify biological properties of optically pure [(18)F]THK-5105 enantiomers. Binding for tau aggregates in AD brain section was evaluated by autoradiography (ARG). In vitro binding assays were performed to evaluate the binding properties of enantiomers for AD brain homogenates. The pharmacokinetics in the normal mouse brains was assessed by ex vivo biodistribution assay The ARG of enantiomers showed the high accumulation of radioactivity corresponding to the distribution of tau deposits. In vitro binding assays revealed that (S)-[(18)F]THK-5105 has slower dissociation from tau than (R)-[(18)F]THK-5105. Biodistribution assays indicated that (S)-[(18)F]THK-5105 eliminated faster from the mouse brains and blood compared with (R)-[(18)F]THK-5105. (S)-[(18)F]THK-5105 could be more suitable than (R)-enantiomer for a tau imaging agent.
Fuentes, Rolly G; Toume, Kazufumi; Arai, Midori A; Sadhu, Samir K; Ahmed, Firoj; Ishibashi, Masami
2015-04-24
Scopadulciol (1), a scopadulan-type diterpenoid, was isolated from Scoparia dulcis along with three other compounds (2-4) by an activity-guided approach using the TCF reporter (TOP) luciferase-based assay system. A fluorometric microculture cytotoxicity assay (FMCA) revealed that compound 1 was cytotoxic to AGS human gastric adenocarcinoma cells. The treatment of AGS cells with 1 decreased β-catenin levels and also inhibited its nuclear localization. The pretreatment of AGS cells with a proteasome inhibitor, either MG132 or epoxomicin, protected against the degradation of β-catenin induced by 1. The 1-induced degradation of β-catenin was also abrogated in the presence of pifithrin-α, an inhibitor of p53 transcriptional activity. Compound 1 inhibited TOP activity in AGS cells and downregulated the protein levels of cyclin D1, c-myc, and survivin. Compound 1 also sensitized AGS cells to tumor necrosis factor-related apoptosis ligand (TRAIL)-induced apoptosis by increasing the levels of the death receptors, DR4 and DR5, and decreasing the level of the antiapoptotic protein Bcl-2. Collectively, our results demonstrated that 1 induced the p53- and proteasome-dependent degradation of β-catenin, which resulted in the inhibition of TCF/β-catenin transcription in AGS cells. Furthermore, 1 enhanced apoptosis in TRAIL-resistant AGS when combined with TRAIL.
Shuaibu, M N; Wuyep, P A; Yanagi, T; Hirayama, K; Tanaka, T; Kouno, I
2008-05-01
In vitro antiplasmodial activity of methanolic extracts of 16 medicinal plants was evaluated by fluorometric assay using PicoGreen. The IC50s, as determined by parasite DNA concentration, ranged from <11 to >200 and <13 to >200 microg/ml for Plasmodium falciparum 3D7 and K1, respectively; and the most active extracts were those from Anogeissus leiocarpus and Terminalia avicennoides (<11-> or =14 microg/ml). Aqueous, butanolic, ethyl acetate, and methanolic fractions of these two extracts revealed butanolic fraction to have a relatively better activity (IC50, 10-12 microg/ml). Activity-guided chromatographic separation of the butanolic fraction on Sephadex LH-20 followed by nuclear magnetic resonance and correlation high-performance liquid chromatography revealed the presence of known hydrolysable tannins and some related compounds-castalagin, ellagic acid, flavogallonic acid, punicalagin, terchebulin, and two other fractions. The IC50s of all these compounds ranged between 8-21 microg/ml (8-40 microM) against both the strains. Toxicity assay with mouse fibroblasts showed all the extracts and isolated compounds to have IC50 > or = 1500 microg/ml, except for Momordica balsamina with <1500 microg/l. All the extracts and isolated compounds did not affect the integrity of human erythrocyte membrane at the observed IC50s. However, adverse effects manifest in a concentration-dependent fashion (from IC50 > or = 500 microg/ml).
Almog, Yaniv; Perl, Yael; Novack, Victor; Galante, Ori; Klein, Moti; Pencina, Michael J.; Douvdevani, Amos
2014-01-01
Aim The aim of the current study is to assess the mortality prediction accuracy of circulating cell-free DNA (CFD) level at admission measured by a new simplified method. Materials and Methods CFD levels were measured by a direct fluorescence assay in severe sepsis patients on intensive care unit (ICU) admission. In-hospital and/or twenty eight day all-cause mortality was the primary outcome. Results Out of 108 patients with median APACHE II of 20, 32.4% have died in hospital/or at 28-day. CFD levels were higher in decedents: median 3469.0 vs. 1659 ng/ml, p<0.001. In multivariable model APACHE II score and CFD (quartiles) were significantly associated with the mortality: odds ratio of 1.05, p = 0.049 and 2.57, p<0.001 per quartile respectively. C-statistics for the models was 0.79 for CFD and 0.68 for APACHE II. Integrated discrimination improvement (IDI) analyses showed that CFD and CFD+APACHE II score models had better discriminatory ability than APACHE II score alone. Conclusions CFD level assessed by a new, simple fluorometric-assay is an accurate predictor of acute mortality among ICU patients with severe sepsis. Comparison of CFD to APACHE II score and Procalcitonin (PCT), suggests that CFD has the potential to improve clinical decision making. PMID:24955978
Morato, Manuela; Correia-Costa, Liane; Sousa, Teresa; Cosme, Dina; Schaefer, Franz; Areias, José Carlos; Guerra, António; Afonso, Alberto Caldas; Barros, Henrique; Azevedo, Ana; Albino-Teixeira, António
2017-08-01
We aimed to study the impact of obesity on urinary excretion of angiotensinogen (U-AGT) in prepubertal children, focusing on the duration of obesity and gender. Also, we aimed to evaluate whether plasma angiotensinogen (P-AGT) and hydrogen peroxide (H 2 O 2 ) play a role in the putative association. Cross-sectional evaluation of 305 children aged 8-9 years (160 normal weight, 86 overweight, and 59 obese). Anthropometric measurements and 24-h ambulatory blood pressure monitoring were performed. Angiotensinogen (AGT) was determined by a commercial enzyme-linked immunosorbent assay (ELISA) kit and H 2 O 2 by a microplate fluorometric assay. U-AGT and P-AGT levels were similar across body mass index (BMI) groups and between sexes. However, boys who were overweight/obese since the age of 4 years presented lower levels of U-AGT compared with those of normal weight at the same age. In children who were overweight/obese since the age of 4, urinary H 2 O 2 decreased with P-AGT. A higher duration of obesity was associated with decreased U-AGT in boys, thus reflecting decreased intrarenal activity of the renin-angiotensin system. Also, children with a longer duration of obesity showed an inverse association between urinary H 2 O 2 and P-AGT. Future studies should address whether these results reflect an early compensatory mechanism to limit obesity-triggered renal dysfunction.
Zirconium Phosphate Nanoplatelet Potential for Anticancer Drug Delivery Applications.
González, Millie L; Ortiz, Mayra; Hernández, Carmen; Cabán, Jennifer; Rodríguez, Axel; Colón, Jorge L; Báez, Adriana
2016-01-01
Zirconium phosphate (ZrP) nanoplatelets can intercalate anticancer agents via an ion exchange reaction creating an inorganic delivery system with potential for cancer treatment. ZrP delivery of anticancer agents inside tumor cells was explored in vitro. Internalization and cytotoxicity of ZrP nanoplatelets were studied in MCF-7 and MCF-10A cells. DOX-loaded ZrP nanoplatelets (DOX@ZrP) uptake was assessed by confocal (CLSM) and transmission electron microscopy (TEM). Cytotoxicity to MCF-7 and MCF-10A cells was determined by the MTT assay. Reactive Oxy- gen Species (ROS) production was analyzed by fluorometric assay, and cell cycle alterations and induction of apoptosis were analyzed by flow cytometry. ZrP nanoplatelets were localized in the endosomes of MCF-7 cells. DOX and ZrP nanoplatelets were co-internalized into MCF-7 cells as detected by CLSM. While ZrP showed limited toxicity to MCF-7 cells, DOX@ZrP was cytotoxic at an IC₅₀ similar to that of free DOX. Meanwhile, DOX lC₅₀ was significantly lower than the equivalent concentration of DOX@ZrP in MCF-10A cells. ZrP did not induce apoptosis in both cell lines. DOX and DOX@ZrP induced significant oxidative stress in both cell models. Results suggest that ZrP nanoplatelets are promising as carriers of anticancer agents into cancer cells.
La Claire, J W; Manning, S R; Talarski, A E
2015-08-01
A fluorometric assay was developed to semi-quantify co-purified polyketide prymnesins-1 and -2 (PPs) from Prymnesium parvum cultures. Evaluations performed throughout the growth cycle of 5 practical salinity unit (PSU) cultures detected relatively 8-10 × more PPs in the culture medium (exotoxins) than in cells (endotoxins). The [exotoxin] remained stable and relatively low until post-log growth, when they increased significantly. However, on a per-cell basis, [exotoxin] declined throughout log phase and subsequently increased dramatically during late- and post-log phases. The [endotoxin] remained stable until late- and post-log phases, when it achieved its highest level before declining sharply. Shaking cultures of strains from Texas, South Carolina and the United Kingdom displayed dramatically different [exotoxin] during post-log decline. Cultures adapted to 30 PSU had significantly lower [exotoxin] over the course of cultivation than those grown at 5 PSU. Phosphate limitation enhanced [exotoxin] on a per-cell basis, especially in late- and post-log cultures. Media containing streptomycin exhibited a ∼20% increase in [exotoxin] in post-log cultures vs. control treatments, but it had only negligible effects on endotoxin levels. Brefeldin A had minimal effects on [exotoxin], suggesting that the presence of PPs in the medium may be largely derived from cell lysis or some other passive means. Copyright © 2015 Elsevier Ltd. All rights reserved.
Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A
2018-06-01
Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.
Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah
2017-11-21
The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.
Method for screening inhibitors of the toxicity of Bacillus anthracis
Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.
2001-01-01
The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.
Duo, Jia; Bruno, JoAnne; Kozhich, Alexander; David-Brown, Donata; Luo, Linlin; Kwok, Suk; Santockyte, Rasa; Haulenbeek, Jonathan; Liu, Rong; Hamuro, Lora; Peterson, Jon E; Piccoli, Steven; DeSilva, Binodh; Pillutla, Renuka; Zhang, Yan J
2018-04-01
Ligand-binding assay (LBA) performance depends on quality reagents. Strategic reagent screening and characterization is critical to LBA development, optimization and validation. Application of advanced technologies expedites the reagent screening and assay development process. By evaluating surface plasmon resonance technology that offers high-throughput kinetic information, this article aims to provide perspectives on applying the surface plasmon resonance technology to strategic LBA critical reagent screening and characterization supported by a number of case studies from multiple biotherapeutic programs.
Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan; Jensen, Lars Juhl; Berthelsen, Jens
2014-01-01
Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening conditions. Furthermore a marked improvement in the correlation was found by using kinase constructs containing the catalytic domain in presence of additional domains or subunits. PMID:24915177
Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.
Machida, Kazuya; Liu, Bernard
2017-01-01
Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.
Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros
2017-01-01
One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Lipid Microarray Biosensor for Biotoxin Detection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.
2006-05-01
We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less
Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi
2017-02-01
Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.
Circulating Immune Complexes in Lyme Arthritis
Hardin, John A.; Walker, Lesley C.; Steere, Allen C.; Trumble, Thomas C.; Tung, Kenneth S. K.; Williams, Ralph C.; Ruddy, Shaun; Malawista, Stephen E.
1979-01-01
We have found immunoglobulin (Ig) G-containing material consistent with immune complexes in the sera of patients with Lyme arthritis. It was detected in 29 of 55 sera (55%) from 31 patients by at least one of three assays: 125I-C1q binding, C1q solid phase, or Raji cell. The presence of reactive material correlated with clinical aspects of disease activity; it was found early in the illness, was most prominent in sera from the sickest patients, was infrequent during remissions, and often fluctuated in parallel with changes in clinical status. The results in the two C1q assays showed a strong positive correlation (P<0.001). They were each elevated in 45% of the sera and were usually concordant (85%). In contrast, the Raji cell assay was less frequently positive and often discordant with the C1q assays. In sucrose density gradients, putative circulating immune complexes sedimented near 19S; they, too, were detected best by the two assays based on C1q binding. An additional 7S component was found in some sera by the 125I-C1q binding assay. Serum complement was often above the range of normal in patients with mild disease and normal in patients with severe disease but did not correlate significantly with levels of circulating immune complexes. IgM and IgG rheumatoid factors were not detectable. These findings support a role for immune complexes in the pathogenesis of Lyme arthritis. Their measurement, by either the 125I-C1q binding assay or by the C1q solid phase assay, often provides a sensitive index of disease activity. Moreover, the complexes are likely sources of disease-related antigens for further study of this new disorder. PMID:429566
Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan
2018-05-22
Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.
Steele, J C P; Phelps, R J; Simmonds, M S J; Warhurst, D C; Meyer, D J
2002-07-01
Forty-two compounds isolated from nine plants used within South America for the treatment of malaria were tested for haemin binding using two novel, rapid screening methods. The data obtained were analysed with respect to IC(50) values for in vitro toxicity to Plasmodium falciparum trophozoites. One method, a multiwell assay based on the inhibition of the interaction of haemin with glutathione (GSH), is sensitive in the 10 microM range, takes c. 1 h and is suitable for either a high throughput screen or rapid assay during natural product isolation. Of 19 compounds showing antiplasmodial activity (IC(50) < 40 microM), 16 (84%) showed >40% inhibition of GSH-haemin reaction. The sensitivity and specificity of the assay were 0.85 and 0.82, respectively. The positive predictive value was 0.81 and the negative predictive value 0.86. A more sensitive assay (0.1 microM range) is based on the reversal by haemin-binding compounds of the haemin inhibition of the L-dopachrome-methyl ester tautomerase activity of human macrophage migration inhibitory factor. This assay gives a better idea of the affinity of interaction and uses very small amounts of test compound. The log[RI(50)] of eight of the compounds that tested positive in the above assays together with those of quinine and chloroquine showed a positive correlation with log[antiplasmodial IC(50)] for strain T9-96 (r = 0.824) and strain K1 (r = 0.904). Several of the antimalarial compounds that bind haemin are isoquinolines, a class not shown previously to interact with haemin.
Hayward, C P M; Moffat, K A; Graf, L
2014-06-01
Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.
Alder, J Tracy; Hacksell, Uli; Strange, Philip G
2003-01-01
Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269
Our objectives were to assess whether binding of chemicals differs significantly between recombinant estrogen receptors from fathead minnow (fhERα) and human (hERα) and to evaluate the performance of these receptors using two different in vitro assay systems: a COS whole cell bin...
RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY.
MC Cardon, PC Hartig,LE Gray, Jr. and VS Wilson.
U.S. EPA, ORD, NHEERL, RTD, Research Triangle Park, NC, USA.
Typically, in vitro hazard assessments for ...
USDA-ARS?s Scientific Manuscript database
A quantifiable in situ immune fluorescent assay (IFA) was developed to measure bluetongue virus (BTV) binding to mammalian cells. The utility of the assay was demonstrated with both Chinese hamster ovary (CHO) and bovine pulmonary artery endothelial (CPAE) cells. Since heparin sulfate (HS) has been ...
Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.
Dong, Q; Schuchman, J; Carey, G B
1994-07-01
The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.
Sloan, John H; Conway, Richard G; Pottanat, Thomas G; Troutt, Jason S; Higgs, Richard E; Konrad, Robert J; Qian, Yue-Wei
2016-10-01
Immunogenicity testing of biotherapeutic drugs is a regulatory requirement. Herein, we describe a drug-tolerant assay for detecting neutralizing antibodies against a therapeutic antibody. Excess target of the therapeutic antibody was incorporated into the detection step of an affinity capture elution assay. Signal generated from binding of antidrug antibody (ADA) to the therapeutic antibody was compared with signal from binding of ADA to the therapeutic antibody preincubated with its target. The results demonstrated that the target blocked binding of the therapeutic antibody to neutralizing monkey ADA and to two anti-idiotypic antibodies. This highly drug-tolerant novel approach enables the detection of neutralizing antibodies and allows for one basic assay format to achieve complete characterization of ADA responses.
Patzke, Juergen; Budde, Ulrich; Huber, Andreas; Méndez, Adriana; Muth, Heidrun; Obser, Tobias; Peerschke, Ellinor; Wilkens, Matthias; Schneppenheim, Reinhard
2014-12-01
The functional activity of von Willebrand factor (VWF) is most frequently measured by using the ristocetin cofactor assay (VWF:RCo). However, the method's drawbacks include unsatisfactory precision, sensitivity and availability of automated system applications. We have developed an alternative assay (INNOVANCE VWF Ac) that is based on the binding of VWF to recombinant glycoprotein Ib (GPIb). Two gain-of-function mutations were introduced into a GPIb fragment, allowing an assay format without ristocetin. Fully automated assay applications are available for the BCS/BCS XP systems and the Sysmex CS-2000i, Sysmex CA-7000, Sysmex CA-1500 and Sysmex CA-560 systems.The INNOVANCE VWF Ac assay measuring range extends from 4 to 600% VWF for all systems except the Sysmex CA-560 system. Within-device precision values were found to be between 2 and 7%. The limit of detection was below 2.2% VWF. In a study on the BCS XP system, a total number of 580 sample results yielded a correlation to the VWF:RCo assay of r equal to 0.99 (slope = 0.96). Very similar results were observed when von Willebrand disease samples type 1, 2A, 2B, 2M, 2N and 3 were investigated with the new assay and the VWF:RCo assay. The excellent performance data and comparability to VWF:RCo, together with the ease of use, led us to the conclusion that the ristocetin cofactor assay can be replaced by the new GPIb-binding assay to reliably diagnosing patients with von Willebrand disease.
Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease
Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David
2013-01-01
The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839
Antibody binding in altered gravity: implications for immunosorbent assay during space flight
NASA Technical Reports Server (NTRS)
Maule, Jake; Fogel, Marilyn; Steele, Andrew; Wainwright, Norman; Pierson, Duane L.; McKay, David S.
2003-01-01
A single antibody-incubation step of an indirect, enzyme-linked immunosorbent assay (ELISA) was performed during microgravity, Martian gravity (0.38 G) and hypergravity (1.8 G) phases of parabolic flight, onboard the NASA KC-135 aircraft. Antibody-antigen binding occurred within 15 seconds; the level of binding did not differ between microgravity, Martian gravity and 1 G (Earth's gravity) conditions. During hypergravity and 1 G, antibody binding was directly proportional to the fluid volume (per microtiter well) used for incubation; this pattern was not observed during microgravity. These effects in microgravity may be due to "fluid spread" within the chamber (observed during microgravity with digital photography), leading to greater fluid-surface contact and subsequently antibody-antigen contact. In summary, these results demonstrate that: i) ELISA antibody-incubation and washing steps can be successfully performed by human operators during microgravity, Martian gravity and hypergravity; ii) there is no significant difference in antibody binding between microgravity, Martian gravity and 1 G conditions; and iii) a smaller fluid volume/well (and therefore less antibody) was required for a given level of binding during microgravity. These conclusions indicate that reduced gravity would not present a barrier to successful operation of immunosorbent assays during spaceflight.
Jiang, Jian; Huang, Ying; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Song, Fuping; Lai, Jinsheng
2017-01-01
ABSTRACT The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), containing two cry genes (cry8-like and cry8Ga), is toxic to Holotrichia oblita larvae. Both Cry8-like and Cry8Ga proteins are active against this insect pest, and Cry8-like is more toxic. To analyze the characteristics of the binding of Cry8-like and Cry8Ga proteins to brush border membrane vesicles (BBMVs) in H. oblita larvae, binding assays were conducted with a fluorescent DyLight488-labeled Cry8-like toxin. The results of saturation binding assays demonstrated that Cry8-like bound specifically to binding sites on BBMVs from H. oblita, and heterologous competition assays revealed that Cry8Ga shared binding sites with Cry8-like. Furthermore, Cry8-like-binding proteins in the midgut from H. oblita larvae were identified by pulldown assays and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the H. oblita midgut transcriptome was assembled by high-throughput RNA sequencing and used for identification of Cry8-like-binding proteins. Eight Cry8-like-binding proteins were obtained from pulldown assays conducted with BBMVs. The LC-MS/MS data for these proteins were successfully matched with the H. oblita transcriptome, and BLASTX results identified five proteins as serine protease, transferrin-like, uncharacterized protein LOC658236 of Tribolium castaneum, ATPase catalytic subunit, and actin. These identified Cry8-like-binding proteins were different from those confirmed previously as receptors for Cry1A proteins in lepidopteran insect species, such as aminopeptidase, alkaline phosphatase, and cadherin. IMPORTANCE Holotrichia oblita is one of the main soil-dwelling pests in China. The larvae damage the roots of crops, resulting in significant yield reductions and economic losses. H. oblita is difficult to control, principally due to its soil-dwelling habits. In recent years, some Cry8 toxins from Bacillus thuringiensis were shown to be active against this pest. Study of the mechanism of action of these Cry8 toxins is needed for their effective use in the control of H. oblita and for their future utilization in transgenic plants. Our work provides important basic data and promotes understanding of the insecticidal mechanism of Cry8 proteins against H. oblita larvae. PMID:28389549
Fluorometric determination of nitrite in cured meats.
Coppola, E D; Wickroski, A F; Hanna, J G
1975-05-01
An indirect fluorometric method for determining sodium nitrite in meat products is presented. The extracted sodium nitrite is consumed in a diazotization reaction with a measured excess of sulfanilic acid. Fluorescamine, which acts selectively with primary amines such as sulfanilic acid, is a fluorogenic reagent for the excess amine. The amine consumed, calculated by difference from the total originally present, is directly related to the sodium nitrite content of the sample. Interferences from amino acids and soluble proteins in the meat extract are eliminated by judicious use of a secondary peak in the fluorescence spectra (436 nm excitation, 495 nm fluorescence) combined with measurement at low pH (3.30). The recoveries of sodium nitrite ranged from 83.2 to 99.6% with an average of 93.4 and a standard deviation of +/- 5.28% for 11 determinations.
Schwab, Karen; Lauber, Jennifer; Hesse, Friedemann
2016-01-01
The glycosyltransferase HisDapGalNAcT2 is the key protein of the Escherichia coli (E. coli) SHuffle® T7 cell factory which was genetically engineered to allow glycosylation of a protein substrate in vivo. The specific activity of the glycosyltransferase requires time-intensive analytics, but is a critical process parameter. Therefore, it has to be monitored closely. This study evaluates fluorometric in situ monitoring as option to access this critical process parameter during complex E. coli fermentations. Partial least square regression (PLS) models were built based on the fluorometric data recorded during the EnPresso® B fermentations. Capable models for the prediction of glucose and acetate concentrations were built for these fermentations with rout mean squared errors for prediction (RMSEP) of 0.19 g·L−1 and 0.08 g·L−1, as well as for the prediction of the optical density (RMSEP 0.24). In situ monitoring of soluble enzyme to cell dry weight ratios (RMSEP 5.5 × 10−4 µg w/w) and specific activity of the glycosyltransferase (RMSEP 33.5 pmol·min−1·µg−1) proved to be challenging, since HisDapGalNAcT2 had to be extracted from the cells and purified. However, fluorescence spectroscopy, in combination with PLS modeling, proved to be feasible for in situ monitoring of complex expression systems. PMID:28952595
Ramirez-Sanchez, Israel; Maya, Lisandro; Ceballos, Guillermo; Villarreal, Francisco
2010-12-01
Polyphenolic compounds of the flavanoid family are abundantly present in cacao seed and its cocoa products. Results from studies using cocoa products indicate beneficial effects of flavanols on cardiovascular endpoints. Evidence indicates that (-)-epicatechin is the main cacao flavanol associated with cardiovascular effects, so the accurate quantification of its content in cacao seeds or cocoa products is important. Common methods for the quantification of phenolic content in cocoa products are based on the reaction of phenols with colorimetric reagents such as the Folin-Ciocalteu (FC) In this study, we compared the FC method of phenolic determinations using 2 different standards (gallic acid and (-)-epicatechin) to construct calibration curves. We compare these results with those obtained from a simple fluorometric method (Ex(280)/Em(320) nm) used to determine catechin/(-)-epicatechin content in samples of cacao seeds and cocoa products. Values obtained from the FC method determination of polyphenols yield an overestimation of phenol (flavonoid) content when gallic acid is used as standard. Moreover, the epicatechin is a more reliable standard because of its abundance in cacao seeds and cocoa products. The use of fluorometric spectra yields a simple and highly quantitative means for a more precise and rapid quantification of cacao catechins. Fluorometric values are essentially in agreement with those reported using more cumbersome methods. In conclusion, the use of fluorescence emission spectra is a quick, practical and suitable means to quantifying catechins in cacao seeds and cocoa products.
A high-throughput fluorescence polarization assay for inhibitors of gyrase B.
Glaser, Bryan T; Malerich, Jeremiah P; Duellman, Sarah J; Fong, Julie; Hutson, Christopher; Fine, Richard M; Keblansky, Boris; Tang, Mary J; Madrid, Peter B
2011-02-01
DNA gyrase, a type II topoisomerase that introduces negative supercoils into DNA, is a validated antibacterial drug target. The holoenzyme is composed of 2 subunits, gyrase A (GyrA) and gyrase B (GyrB), which form a functional A(2)B(2) heterotetramer required for bacterial viability. A novel fluorescence polarization (FP) assay has been developed and optimized to detect inhibitors that bind to the adenosine triphosphate (ATP) binding domain of GyrB. Guided by the crystal structure of the natural product novobiocin bound to GyrB, a novel novobiocin-Texas Red probe (Novo-TRX) was designed and synthesized for use in a high-throughput FP assay. The binding kinetics of the interaction of Novo-TRX with GyrB from Francisella tularensis has been characterized, as well as the effect of common buffer additives on the interaction. The assay was developed into a 21-µL, 384-well assay format and has been validated for use in high-throughput screening against a collection of Food and Drug Administration-approved compounds. The assay performed with an average Z' factor of 0.80 and was able to identify GyrB inhibitors from a screening library.
Method for estimating protein binding capacity of polymeric systems.
Sharma, Vaibhav; Blackwood, Keith A; Haddow, David; Hook, Lilian; Mason, Chris; Dye, Julian F; García-Gareta, Elena
2015-01-01
Composite biomaterials made from synthetic and protein-based polymers are extensively researched in tissue engineering. To successfully fabricate a protein-polymer composite, it is critical to understand how strongly the protein binds to the synthetic polymer, which occurs through protein adsorption. Currently, there is no cost-effective and simple method for characterizing this interfacial binding. To characterize this interfacial binding, we introduce a simple three-step method that involves: 1) synthetic polymer surface characterisation, 2) a quick, inexpensive and robust novel immuno-based assay that uses protein extraction compounds to characterize protein binding strength followed by 3) an in vitro 2D model of cell culture to confirm the results of the immuno-based assay. Fibrinogen, precursor of fibrin, was adsorbed (test protein) on three different polymeric surfaces: silicone, poly(acrylic acid)-coated silicone and poly(allylamine)-coated silicone. Polystyrene surface was used as a reference. Characterisation of the different surfaces revealed different chemistry and roughness. The novel immuno-based assay showed significantly stronger binding of fibrinogen to both poly(acrylic acid) and poly(allylamine) coated silicone. Finally, cell studies showed that the strength of the interaction between the protein and the polymer had an effect on cell growth. This novel immuno-based assay is a valuable tool in developing composite biomaterials of synthetic and protein-based polymers with the potential to be applied in other fields of research where protein adsorption onto surfaces plays an important role.
Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone
Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna
2016-01-01
The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023
Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G
2014-08-01
Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.
Assessment of the nickel-albumin binding assay for diagnosis of acute coronary syndrome.
da Silva, Sandra Huber; Pereira, Renata da Silva; Hausen, Bruna dos Santos; Signor, Cristiane; Gomes, Patrícia; de Campos, Marli Matiko Anraku; Moresco, Rafael Noal
2011-03-01
Myocardial ischemia may alter the metal binding capacity of circulating serum albumin. Thus, the aim of this study was to describe an automated method to measure ischemia-induced alterations in the binding capacity of serum albumin for exogenous nickel, and to evaluate the diagnostic characteristics of this assay for the assessment of acute coronary syndrome (ACS) in patients presenting to the emergency room (ER) with acute chest pain. We assessed the concentrations of cardiac troponin I (cTnI), serum albumin, ischemia-modified albumin (IMA) measured by the cobalt-albumin binding assay (CABA), and by an automated nickel-albumin binding assay (NABA) in the following groups: ACS (n=63) and non-ischemic chest pain (NICP, n=26). Biochemical markers were determined in blood samples obtained from patients within 3 h of ER admission. cTnI, CABA and NABA concentrations were higher in ACS group in comparison to the NICP group. A significant correlation between NABA and CABA was observed (r=0.5387, p<0.001). Areas under the curve for CABA and NABA were 0.7289 and 0.7582, respectively. Both CABA and NABA have the ability to discriminate patients with ACS. However, NABA has a slightly higher ability to discriminate ACS compared with CABA. Patients with ACS have reduced nickel binding to human serum albumin, and NABA may have an important role as an early marker of myocardial ischemia, particularly in patients presenting to the ER with acute chest pain.
Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E
2014-11-28
We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.
Thekkumkara, Thomas; Snyder, Russell; Karamyan, Vardan T
2016-01-01
The role of 2-methoxyestradiol is becoming a major area of investigation because of its therapeutic utility, though its mechanism is not fully explored. Recent studies have identified the G-protein-coupled receptor 30 (GPR30, GPER) as a high-affinity membrane receptor for 2-methoxyestradiol. However, studies aimed at establishing the binding affinities of steroid compounds for specific targets are difficult, as the tracers are highly lipophilic and often result in nonspecific binding in lipid-rich membrane preparations with low-level target receptor expression. 2-Methoxyestradiol binding studies are essential to elucidate the underlying effects of this novel estrogen metabolite and to validate its targets; therefore, this competitive receptor-binding assay protocol was developed in order to assess the membrane receptor binding and affinity of 2-methyoxyestradiol.
Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya
2017-09-01
The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.
Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui; Xiao, Yi
2017-01-01
Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples.
ERIC Educational Resources Information Center
John, Nancy J.; Firestone, Gary L.
1987-01-01
Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…
Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.
2000-01-01
Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511
Newton, Ana S; Deiana, Luca; Puleo, David E; Cisneros, José A; Cutrona, Kara J; Schlessinger, Joseph; Jorgensen, William L
2017-06-08
A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as K d results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses.
2017-01-01
A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as Kd results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses. PMID:28626520
Maheswari, Palanisamy Uma; Renuga, Duraisamy; Henry, Linda Jeeva Kumari; Ruckmani, Kandasamy
2018-04-30
The (E)-2-((2-hydrohy-5-methylphenylimino) methyl) phenol ligand was synthesized. The receptor was characterized by IR, 1 H and 13 C NMR and CHN analysis. The ligand exhibits colorimetric and fluorometric sensing of Zn 2+ and Mg 2+ ions in semi-aqueous medium (DMSO-H2O). The receptor was tested with series of transition metal ions (Cr 2+ , Fe 2+ , Ni 2+ , Co 2+ , Cu 2+ , Zn 2+ ) and heavy metal ions (Sn 2+ , Pd 2+ , Ce 2+ , Hg 2+ , Cd 2+ ) and the essential human body elements like Ca 2+ , Mg 2+ , Na + and K + ions. The naked eye colorimetric sensing was absorbed only for Zn 2+ and Mg 2+ . Both ions (ZnCl 2 and MgCl 2 in H 2 O), when added to the colorless solutions of the receptor of about 1 equivalence in incremental additions turn the solution into bright turmeric yellow. All other ions remain inactive, in colorimetric sensing. Further the Zn 2+ and Mg 2+ ions were probed by absorption and emission spectroscopy through incremental addition of respective metal ions. The in-situ deprotonation of the ligand on both Mg 2+ and Zn 2+ ions binding was confirmed by 1 H NMR titration studies. The imino nitrogen of the receptor is not coordinated to the metal ions. The Job's plot studies reveal the 1:2 binding ratio of metal ions to the receptor. The high fold fluorescence output on metal ions binding was positively used to sense the Zn 2+ and Mg 2+ ions, separately and together in HeLa cancer cells through cell imaging. Copyright © 2018 Elsevier B.V. All rights reserved.
Braaten, B A; Spangrude, G J; Daynes, R A
1984-07-01
Lymphocyte migration from the blood into the lymph nodes in most species occurs across post-capillary high endothelial venules (HEV). In a previous study, we proposed that lymphocyte extravasation involves receptor-mediated binding followed by adenylate cyclase-dependent activation of lymphocyte motility. This hypothesis was, in part, based on observations of in vitro lymphocyte adherence to HEV by employing pertussigen, which is a known inhibitor of lymphocyte recirculation. In vitro lymphocyte-HEV binding requires a cold (6 degrees C) incubation step and binding is poor to nil if the assay is attempted at room (23 degrees C) or physiologic temperature. We decided to investigate why this assay is temperature restricted, because of the possibility that pertussigen or fucoidin -treated lymphocytes might interact with HEV differently at higher temperatures. We now report that O.C.T. compound (OCT), the embedding matrix generally used to cut frozen lymph node sections, is toxic to lymphocytes at temperatures above 6 degrees C. Exclusion of OCT from the assay system will allow lymphocyte-HEV binding to occur at 23 degrees C and to a lesser extent at 37 degrees C. With this modified protocol, lymphocytes treated with either pertussigen, fucoidin , or neuraminidase were tested for adherence to HEV at 23 degrees C. No essential difference in binding properties was observed from what had been reported at 6 degrees C. In contrast, trypsin-treated lymphocytes that did not bind to HEV with the standard technique at 6 degrees C did adhere to a minimal extent to HEV at 23 degrees C using the modified procedure. We also report some preliminary work, using the modified assay, on in vitro lymphocyte-HEV binding of rat, rabbit, and guinea pig lymphocytes to sections of lymph nodes from the respective species.
NASA Astrophysics Data System (ADS)
Damayanti, E.; Istiqomah, L.; Saragih, J. E.; Purwoko, T.; Sardjono
2017-12-01
Our previous studies have selected lactic acid bacteria (LAB) with antifungal activities from traditional fermented foods made from cassava (G7) and silage feed palm leaf (PDS5 and PDS3). In this study we evaluated their ability to bind aflatoxin B1 (AFB1) and probiotic characteristic. The probiotic characteristic assays of LAB consisted of resistance to acidic conditions (pH 3), gastric juice and bile salts 0.3%. We also carried out an in vitro evaluation of LAB aflatoxin binding ability in viable and non-viable cell for 24 and 48 hours of incubation. The measurement of aflatoxin content was performed by ELISA method using AgraQuant Total Aflatoxin Assay kit. The results showed that all isolates were potential as probiotics and the G7 isolate had the highest viability among other isolates in pH 3 (92.61 %) and the bile salts assay (97.71 %). The percentage of aflatoxin reduction between viable and non-viable cell from each LAB isolate were different. The highest aflatoxin reduction in viable cell assay was performed by G7 isolate (69.11 %) whereas in non-viable cell assay was performed by PDS3 isolate (73.75 %) during incubation time 48 hours. In this study, G7 isolate performed the best probiotic characteristics with the highest viability in acid pH assay, bile salt 0.3% assay and percentage of aflatoxin B1 reduction in viable cell condition. Molecular identification using 16S rRNA sequence analysis showed that G7 isolate had homology with Lactobacillus plantarum (99.9%). It was concluded that Lactobacillus plantarum G7 was potential as probiotic with aflatoxin binding activities.
Flexible Label-Free Quantitative Assay for Antibodies to Influenza Virus Hemagglutinins ▿
Carney, Paul J.; Lipatov, Aleksandr S.; Monto, Arnold S.; Donis, Ruben O.; Stevens, James
2010-01-01
During the initial pandemic influenza H1N1 virus outbreak, assays such as hemagglutination inhibition and microneutralization provided important information on the relative protection afforded by the population's cross-reactivity from prior infections and immunizations with seasonal vaccines. However, these assays continue to be limited in that they are difficult to automate for high throughput, such as in pandemic situations, as well as to standardize between labs. Thus, new technologies are being sought to improve standardization, reliability, and throughput by using chemically defined reagents rather than whole cells and virions. We now report the use of a cell-free and label-free flu antibody biosensor assay (f-AbBA) for influenza research and diagnostics that utilizes recombinant hemagglutinin (HA) in conjunction with label-free biolayer interferometry technology to measure biomolecular interactions between the HA and specific anti-HA antibodies or sialylated ligands. We evaluated f-AbBA to determine anti-HA antibody binding activity in serum or plasma to assess vaccine-induced humoral responses. This assay can reveal the impact of antigenic difference on antibody binding to HA and also measure binding to different subtypes of HA. We also show that the biosensor assay can measure the ability of HA to bind a model sialylated receptor-like ligand. f-AbBA could be used in global surveillance laboratories since preliminary tests on desiccated HA probes showed no loss of activity after >2 months in storage at room temperature, indicating that the same reagent lots could be used in different laboratories to minimize interlaboratory assay fluctuation. Future development of such reagents and similar technologies may offer a robust platform for future influenza surveillance activities. PMID:20660137
Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi
2012-12-04
Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.
Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi
2013-08-01
The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.
Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi
2014-01-01
Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021
Meng, Q; Li, M; Silberg, M A; Conrad, F; Bettencourt, J; To, R; Huang, C; Ma, J; Meyer, K; Shimizu, R; Cao, L; Tomic, M T; Marks, J D
2012-02-15
Quantitation of individual monoclonal antibodies (mAbs) within a combined antibody drug product is required for preclinical and clinical drug development, including pharmacokinetic (PK), toxicology, stability, and biochemical characterization studies of such drugs. We have developed an antitoxin, XOMA 3AB, consisting of three recombinant mAbs that potently neutralize the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind nonoverlapping BoNT/A epitopes with high affinity. XOMA 3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from Escherichia coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. mAb-specific domains were used to develop an enzyme-linked immunosorbent assay (ELISA) for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay that is robust to interference from components in serum was also developed, and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that binds the same protein and is superior to anti-idiotype approaches. Copyright © 2011 Elsevier Inc. All rights reserved.
Qu, Kai; Shen, Nai-ying; Xu, Xin-sen; Su, Hai-bo; Wei, Ji-chao; Tai, Ming-hui; Meng, Fan-di; Zhou, Lei; Zhang, Yue-lang; Liu, Chang
2013-01-01
Aim: To elucidate the molecular mechanisms underlying the immunosuppressive effects of emodin isolated from Rheum palmatum L. Methods: Human T cells were isolated from the peripheral venous blood of 10 healthy adult donors. Cell viability was analyzed with MTT assay. AO/EB and Annexin V/PI staining and DNA damage assay were used to detect cell apoptosis. Fluorescence staining was used to detect the levels of ROS, the mitochondrial membrane potential and intracellular Ca2+. Colorimetry was used to detect the levels of MDA and total SOD and GSH/GSSG ratio. The expression and activity of caspase-3, -4, and -9 were detected with Western blotting and a fluorometric assay. Western blotting was also used to detect the expression of Bcl-2, Bax, cytochrome C, and endoplasmic reticulum (ER) markers. Results: Emodin (1, 10, and 100 μmol/L) inhibited the growth of human T cells and induced apoptosis in dose- and time dependent manners. Emodin triggered ER stress and significantly elevated intracellular free Ca2+ in human T cells. It also disrupted mitochondrial membrane potential, and increased cytosolic level of cytochrome C, and the levels of activated cleavage fragments of caspase-3, -4, and -9 in human T cells. Furthermore, emodin significantly increased the levels of ROS and MDA, inhibited both SOD level and GSH/GSSG ratio in human T cells, whereas co-incubation with the ROS scavenger N-acetylcysteine (NAC, 20 μmol/L) almost completely blocked emodin-induced ER stress and mitochondrial dysfunction in human T cells, and decreased the caspase cascade-mediated apoptosis. Conclusion: Emodin exerts immunosuppressive actions at least partly by inducing apoptosis of human T cells, which is triggered by ROS-mediated ER stress and mitochondrial dysfunction. PMID:23811723
Liu, Yanyan; Li, Hongchang; Guo, Bin; Wei, Lijuan; Chen, Bo; Zhang, Youyu
2017-05-15
Herein we report a novel switch-off fluorescent probe for highly selective determination of uric acid (UA) based on the inner filter effect (IFE), by using poly-(vinylpyrrolidone)-protected gold nanoparticles (PVP-AuNPs) and chondroitin sulfate-stabilized gold nanoclusters (CS-AuNCs) as the IFE absorber/fluorophore pair. In this IFE-based fluorometric assay, the newly designed CS-AuNCs were explored as an original fluorophore and the hydrogen peroxide (H 2 O 2 ) -driven formed PVP-AuNPs can be a powerful absorber to influence the excitation of the fluorophore, due to the complementary overlap between the absorption band of PVP-AuNPs and the emission band of CS-AuNCs. Under the optimized conditions, the extent of the signal quenching depends linearly on the H 2 O 2 concentration in the range of 1-100μM (R 2 =0.995) with a detection limit down to 0.3μM. Based on the H 2 O 2 -dependent fluorescence IFE principle, we further developed a new assay strategy to enable selective sensing of UA by using a specific uricase-catalyzed UA oxidation as the in situ H 2 O 2 generator. The proposed uricase-linked IFE-based assay exhibited excellent analytical performance for measuring UA over the concentration ranging from 5 to 100μM (R 2 =0.991), and can be successfully applied to detection of UA as low as 1.7μM (3σ) in diluted human serum samples. Copyright © 2017 Elsevier B.V. All rights reserved.
Solid-phase receptor binding assay for /sup 125/I-hCG
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bortolussi, M.; Selmin, O.; Colombatti, A.
1987-01-01
A solid-phase radioligand-receptor assay (RRA) to measure the binding of /sup 125/I-labelled human chorionic gonadotropin (/sup 125/I-hCG) to target cell membranes has been developed. The binding of /sup 125/I-hCG to membranes immobilized on the wells of microtitration plates reached a maximum at about 3 hours at 37 degrees C, was saturable, displayed a high affinity (Ka = 2.4 X 10(9) M-1) and was specifically inhibited by unlabelled hCG. In comparison with RRAs carried out with membranes in suspension, the solid-phase RRA is significantly simpler and much faster to perform as it avoids centrifugation or filtration procedures. The solid-phase RRA wasmore » adapted profitably to process large numbers of samples at the same time. It proved particularly useful as a screening assay to detect anti-hCG monoclonal antibodies with high inhibitory activity for binding of /sup 125/I-hCG to its receptors.« less
Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine
Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.
2016-01-01
Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774
Mohammed, Fatima H; Khajah, Maitham A; Yang, Ming; Brackenbury, William J; Luqmani, Yunus A
2016-01-01
Voltage-gated Na+ channels (VGSCs) are membrane proteins which are normally expressed in excitable cells but have also been detected in cancer cells, where they are thought to be involved in malignancy progression. In this study we examined the ion current and expression profile of VGSC (Nav1.5) in estrogen receptor (ER)-positive (MCF-7) and silenced (pII) breast cancer cells and its possible influence on their proliferation, motility and invasion. VGSC currents were analysed by whole cell patch clamp recording. Nav1.5 expression and localization, in response to EGF stimulation, was examined by western blotting and immunofluorescence respectively. Cell invasion (under-agarose and Matrigel assays), motility (wound healing assay) and proliferation (MTT assay) were assessed in pII cells in response to VGSC blockers, phenytoin (PHT) and tetrodotoxin (TTX), or by siRNA knockdown of Nav1.5. The effect of PHT and TTX on modulating EGF-induced phosphorylation of Akt and ERK1/2 was determined by western blotting. Total matrix metalloproteinase (MMP) was determined using a fluorometric-based activity assay. The level of various human proteases was detected by using proteome profiler array kit. VGSC currents were detected in pII cells, but were absent in MCF-7. Nav1.5 showed cytoplasmic and perinuclear expression in both MCF-7 and pII cells, with enhanced expression upon EGF stimulation. Treatment of pII cells with PHT, TTX or siRNA significantly reduced invasion towards serum components and EGF, in part through reduction of P-ERK1/2 and proteases such as cathepsin E, kallikrein-10 and MMP-7, as well as total MMP activity. At high concentrations, PHT inhibited motility while TTX reduced cell proliferation. Pharmacological or genetic blockade of Nav1.5 may serve as a potential anti-metastatic therapy for breast cancer.
Dye-binding protein assay using a long-wave-absorbing cyanine probe.
Zheng, Hong; Mao, Yu Xia; Li, Dong Hui; Zhu, Chang Qing
2003-07-01
A simple and fast protein assay that involves the binding of water-soluble sulfonate heptamethylene cyanine to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 778 to 904 nm, and the increase in absorption at 904 nm is monitored. This assay is very reproducible, of good color stability for at least 80 min, and sensitive at the 100 ng/mL level of human serum albumin (HSA) when a spectrophotometer with near-infrared wavelength is used to measure absorbance. Few chemicals except ionic surfactants such as cetyltrimethylammonium bromide and sodium dodecyl sulfonate interfere with the assay. Purified proteins have different capacities to interact with the dye; under the experimental conditions, the linear ranges of bovine serum albumin (BSA), HSA and gamma-IgG were 200-2000, 100-2400, and 200-3000 ng/mL, respectively. The relative standard deviation for the five replicate determinations of 1200 ng/mL BSA is 2.1%.
Lipid-binding analysis using a fat blot assay.
Munnik, Teun; Wierzchowiecka, Magdalena
2013-01-01
Protein-lipid interactions play an important role in lipid metabolism, membrane trafficking and cell -signaling by regulating protein localization, activation, and function. The Fat Blot assay is a relatively simple and inexpensive method to examine these interactions using nitrocellulose membrane-immobilized lipids. The assay is adapted from the method by Dowler et al. (Sci STKE 129:pl6, 2002) and provides qualitative and quantitative information on the relative affinity with which a protein binds to a particular lipid. To perform a Fat Blot assay, serial dilutions of different phospholipids are spotted onto a nitrocellulose membrane. These membranes are then incubated with a lipid-binding protein possessing a GST (or other epitope) tag. The membranes are washed and the protein, which is bound to the membrane by virtue of its interaction with the lipid's head group, is detected by immunoblotting with an antibody against GST (or other epitope). The procedure only requires a few micrograms of protein and is quick, simple and cheap to perform.
Bruno, Agostino; Lembo, Francesca; Novellino, Ettore; Stornaiuolo, Mariano; Marinelli, Luciana
2014-01-01
Cannabinoid type 1 Receptor (CB1) belongs to the GPCR family and it has been targeted, so far, for the discovery of drugs aimed at the treatment of neuropathic pain, nausea, vomit, and food intake disorders. Here, we present the development of the first fluorescent assay enabling the measurement of kinetic binding constants for CB1orthosteric ligands. The assay is based on the use of T1117, a fluorescent analogue of AM251. We prove that T1117 binds endogenous and recombinant CB1 receptors with nanomolar affinity. Moreover, T1117 binding to CB1 is sensitive to the allosteric ligand ORG27569 and thus it is applicable to the discovery of new allosteric drugs. The herein presented assay constitutes a sustainable valid alternative to the expensive and environmental impacting radiodisplacement techniques and paves the way for an easy, fast and cheap high-throughput drug screening toward CB1 for identification of new orthosteric and allosteric modulators. PMID:24441508
Sato, Takaji; Saito, Yoshihiro; Chikuma, Masahiko; Saito, Yutaka; Nagai, Sonoko
2008-03-01
A highly sensitive flow injection fluorometry for the determination of albumin was developed and applied to the determination of albumin in human bronchoalveolar lavage fluids (BALF). This method is based on binding of chromazurol S (CAS) to albumin. The calibration curve was linear in the range of 5-200 microg/ml of albumin. A highly linear correlation (r=0.986) was observed between the albumin level in BALF samples (n=25) determined by the proposed method and by a conventional fluorometric method using CAS (CAS manual method). The IgG interference was lower in the CAS flow injection method than in the CAS manual method. The albumin level in BALF collected from healthy volunteers (n=10) was 58.5+/-13.1 microg/ml. The albumin levels in BALF samples obtained from patients with sarcoidosis and idiopathic pulmonary fibrosis were increased. This finding shows that the determination of albumin levels in BALF samples is useful for investigating lung diseases and that CAS flow injection method is promising in the determination of trace albumin in BALF samples, because it is sensitive and precise.
Advantages and application of label-free detection assays in drug screening.
Cunningham, Brian T; Laing, Lance G
2008-08-01
Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.
Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay
Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.
2011-01-01
The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207
Stimulation of iodine organification in porcine thyroid cells by thyroid stimulators.
Ginsberg, J; Shewring, G; Howells, R; Smith, B R; Hall, R
Several Graves' sera were simultaneously assessed in a bioassay based on the ability of porcine thyroid cells to organify 125I and in a radioreceptor assay for TSH receptor binding activity. Both assay systems were sensitive to 1 mcU/ml (final concentration) of unlabelled bovine TSH. Six Graves' sera were studied in detail over a wide (0-1.0 mcl sera) dose response range in repeat determinations. Two sera exhibited parallel binding and stimulating. However, two sera revealed significant inhibition of 125I-TSH binding prior to the demonstration of stimulation and the other two sera showed stimulatory capabilities before significant binding was evident. IgG was prepared from one serum by ammonium sulphate precipitation and chromatography on Sepharose 6B and then subjected to preparative isoelectric focusing. The isoelectric distribution of the two activities were found to be identical with major peaks of activity at pl=9.5 and pl=8.5. In summary: 1) each Graves' sera exhibits different dose-response curves with respect to binding and stimulation, 2) at certain concentrations of sera, only binding or stimulation were evident, 3) neither assay was consistently more sensitive for the presence of Graves' immunoglobulins, 4) for one Graves' sera, binding and stimulation could not be separated by isoelectric focusing. These studies would suggest each Graves' immunoglobulin has inherently different characteristics in its interaction with the TSH receptor.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
Gamaleldin Elsadig Karar, Mohamed; Matei, Marius-Febi; Jaiswal, Rakesh; Illenberger, Susanne; Kuhnert, Nikolai
2016-04-01
Plants rich in chlorogenic acids (CGAs), caffeic acids and their derivatives have been found to exert antiviral effects against influenza virus neuroaminidase. In this study several dietary naturally occurring chlorogenic acids, phenolic acids and derivatives were screened for their inhibitory activity against neuroaminidases (NAs) from C. perfringens, H5N1 and recombinant H5N1 (N-His)-Tag using a fluorometric assay. There was no significant difference in inhibition between the different NA enzymes. The enzyme inhibition results indicated that chlorogenic acids and selected derivatives, exhibited high activities against NAs. It seems that the catechol group from caffeic acid was important for the activity. Dietary CGA therefore show promise as potential antiviral agents. However, caffeoyl quinic acids show low bioavailibility and are intensly metabolized by the gut micro flora, only low nM concentrations are observed in plasma and urine, therefore a systemic antiviral effect of these compounds is unlikely. Nevertheless, gut floral metabolites with a catechol moiety or structurally related dietary phenolics with a catechol moiety might serve as interesting compounds for future investigations.
Cree antidiabetic plant extracts display mechanism-based inactivation of CYP3A4.
Tam, Teresa W; Liu, Rui; Arnason, John T; Krantis, Anthony; Staines, William A; Haddad, Pierre S; Foster, Brian C
2011-01-01
Seventeen Cree antidiabetic medicinal plants were studied to determine their potential to inhibit cytochrome P450 3A4 (CYP3A4) through mechanism-based inactivation (MBI). The ethanolic extracts of the medicinal plants were studied for their inhibition of CYP3A4 using the substrates testosterone and dibenzylfluorescein (DBF) in high pressure liquid chromatography (HPLC) and microtiter fluorometric assays, respectively. Using testosterone as a substrate, extracts of Alnus incana, Sarracenia purpurea, and Lycopodium clavatum were identified as potent CYP3A4 MBIs, while those from Abies balsamea, Picea mariana, Pinus banksiana, Rhododendron tomentosum, Kalmia angustifolia, and Picea glauca were identified as less potent inactivators. Not unexpectedly, the other substrate, DBF, showed a different profile of inhibition. Only A. balsamea was identified as a CYP3A4 MBI using DBF. Abies balsamea displayed both NADPH- and time-dependence of CYP3A4 inhibition using both substrates. Overall, several of the medicinal plants may markedly deplete CYP3A4 through MBI and, consequently, decrease the metabolism of CYP3A4 substrates including numerous medications used by diabetics.
Evaluation of human D-amino acid oxidase inhibition by anti-psychotic drugs in vitro.
Shishikura, Miho; Hakariya, Hitomi; Iwasa, Sumiko; Yoshio, Takashi; Ichiba, Hideaki; Yorita, Kazuko; Fukui, Kiyoshi; Fukushima, Takeshi
2014-06-01
It is of importance to determine whether antipsychotic drugs currently prescribed for schizophrenia exert D-amino acid oxidase (DAO)-inhibitory effects. We first investigated whether human (h)DAO can metabolize D-kynurenine (D-KYN) to produce the fluorescent compound kynurenic acid (KYNA) by using high-performance liquid chromatography with mass spectrometry, and fluorescence spectrometry. After confirmation of KYNA production from D-KYN by hDAO, 8 first- and second-generation antipsychotic drugs, and 6 drugs often prescribed concomitantly, were assayed for hDAO-inhibitory effects by using in vitro fluorometric methods with D-KYN as the substrate. DAO inhibitors 3-methylpyrazole-5-carboxylic acid and 4H-thieno[3,2-b]pyrrole-5-carboxylic acid inhibited KYNA production in a dose-dependent manner. Similarly, the second-generation antipsychotics blonanserin and risperidone were found to possess relatively strong hDAO-inhibitory effects in vitro (5.29 ± 0.47 μM and 4.70 ± 0.17 μM, respectively). With regard to blonanserin and risperidone, DAO-inhibitory effects should be taken into consideration in the context of their in vivo pharmacotherapeutic efficacy.
Fluorophore-based sensor for oxygen radicals in processing plasmas
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choudhury, Faraz A.; Shohet, J. Leon, E-mail: shohet@engr.wisc.edu; Sabat, Grzegorz
2015-11-15
A high concentration of radicals is present in many processing plasmas, which affects the processing conditions and the properties of materials exposed to the plasma. Determining the types and concentrations of free radicals present in the plasma is critical in order to determine their effects on the materials being processed. Current methods for detecting free radicals in a plasma require multiple expensive and bulky instruments, complex setups, and often, modifications to the plasma reactor. This work presents a simple technique that detects reactive-oxygen radicals incident on a surface from a plasma. The measurements are made using a fluorophore dye thatmore » is commonly used in biological and cellular systems for assay labeling in liquids. Using fluorometric analysis, it was found that the fluorophore reacts with oxygen radicals incident from the plasma, which is indicated by degradation of its fluorescence. As plasma power was increased, the quenching of the fluorescence significantly increased. Both immobilized and nonimmobilized fluorophore dyes were used and the results indicate that both states function effectively under vacuum conditions. The reaction mechanism is very similar to that of the liquid dye.« less
Inhibition of pectin methyl esterase activity by green tea catechins.
Lewis, Kristin C; Selzer, Tzvia; Shahar, Chen; Udi, Yael; Tworowski, Dmitry; Sagi, Irit
2008-10-01
Pectin methyl esterases (PMEs) and their endogenous inhibitors are involved in the regulation of many processes in plant physiology, ranging from tissue growth and fruit ripening to parasitic plant haustorial formation and host invasion. Thus, control of PME activity is critical for enhancing our understanding of plant physiological processes and regulation. Here, we report on the identification of epigallocatechin gallate (EGCG), a green tea component, as a natural inhibitor for pectin methyl esterases. In a gel assay for PME activity, EGCG blocked esterase activity of pure PME as well as PME extracts from citrus and from parasitic plants. Fluorometric tests were used to determine the IC50 for a synthetic substrate. Molecular docking analysis of PME and EGCG suggests close interaction of EGCG with the catalytic cleft of PME. Inhibition of PME by the green tea compound, EGCG, provides the means to study the diverse roles of PMEs in cell wall metabolism and plant development. In addition, this study introduces the use of EGCG as natural product to be used in the food industry and agriculture.
Zhou, Xiao-rong; Duan, Shao-bin; Peng, You-ming; Liu, Fu-you; Ye, Yun; Liu, Rui-hong; Li, Gui-yuan
2007-10-01
To explore the protective effect of amlodipine on the cytotoxicity induced by contrast media (meglumine diatrizoate) in human kidney cells (HKC). An HKC line was used. The experiment was divided into 4 groups: a model group (diatrizoate 111g/L), a prevention group (diatrizoate 111g/L+amlodipine 10(-5)mol/L), an amlodipine control group (amlodipine 10(-5)mol/L), and a culture medium control group (simple none blood serum DMEM-F12 medium). Cytotoxicity induced by meglumine diatrizoate was analysed by methyl thiazolyl tetrazolium (MTT) test, lactate dehydrogenase (LDH) assay, Hochest33258 fluorescence stained cytospins, and flow cytometric DNA analysis. The protein expression of Bax was determined by Western blot, and caspase-3 activity was examined by fluorometric method. In the prevention group, the cell viability increased significantly (P<0.05), LDH levels decreased (P<0.05), and the apoptosis was lower than that of the model group (P<0.05) .Bax protein expression and caspase 3 activity decreased (P<0.05). Amlodipine can inhibit the HKC apoptosis and protect the renal tubule cell from injury induced by meglumine diatrizoate.
Yuan, Hang; Li, Ai-Jun; Ma, Sen-Lin; Cui, Long-Jiu; Wu, Bin; Yin, Lei; Wu, Meng-Chao
2014-05-07
To clarify whether histone deacetylase inhibitors histone deacetylase inhibitors (HDACIs) can sensitize hepatocellular carcinoma (HCC) cells to sorafenib treatment. Bax, Bcl-2, ATG5-ATG12, p21, and p27 protein levels in Hep3B, HepG2, and PLC/PRF/5 cells were examined by Western blot. CCK8 and a fluorometric caspase-3 assay were used to examine cellular viability and apoptosis levels. The effect of Beclin-1 on sensitization of HCC cells to sorafenib was examined by transfecting Beclin-1 siRNA into Hep3B, HepG2, and PLC/PRF/5 cells. Autophagy inhibition enhances the inhibitory effects of vorinostat and sorafenib alone or in combination on HCC cell growth. Vorinostat and sorafenib synergistically induced apoptosis and cell cycle alterations. Western blot data indicated that HDACIs and Beclin-1 knockdown increased the p53 acetylation level. The knockdown of Beclin-1 enhanced the synergistic effect of the combination of vorinostat with sorafenib. HDACIs can sensitize HCC cells to sorafenib treatment by regulating the acetylation level of Beclin-1.
Zhong, H.; Sun, B.; Warkentin, D.; Zhang, S.; Wu, R.; Wu, T.; Sticklen, M. B.
1996-01-01
We have developed a novel and reproducible system for recovery of fertile transgenic maize (Zea mays L.) plants. The transformation was performed using microprojectile bombardment of cultured shoot apices of maize with a plasmid carrying two linked genes, the Streptomyces hygroscopicus phosphinothricin acetyltransferase gene (bar) and the potato proteinase inhibitor II gene, either alone or in combination with another plasmid containing the 5[prime] region of the rice actin 1 gene fused to the Escherichia coli [beta]-glucuronidase gene (gus). Bombarded shoot apices were subsequently multiplied and selected under 3 to 5 mg/L glufosinate ammonium. Co-transformation frequency was 100% (146/146) for linked genes and 80% (41/51) for unlinked genes. Co-expression frequency of the bar and gus genes was 57% (29/51). The co-integration, co-inheritance, and co-expression of bar, the potato proteinase inhibitor II gene, and gus in transgenic R0, R1, and R2 plants were confirmed. Localized expression of the actin 1-GUS protein in the R0 and R1 plants was extensively analyzed by histochemical and fluorometric assays. PMID:12226244
NASA Astrophysics Data System (ADS)
Foster, E.; Fogle, E. J.; Cotrufo, M. F.
2017-12-01
Enzymes catalyze biogeochemical reactions in soils and play a key role in nutrient cycling in agricultural systems. Often, to increase soil nutrients, agricultural managers add organic amendments and have recently experimented with charcoal-like biocarbon products. These amendments can enhance soil water and nutrient holding capacity through increasing porosity. However, the large surface area of the biocarbon has the potential to sorb nutrients and other organic molecules. Does the biocarbon decrease nutrient cycling through sorption of enzymes? In a laboratory setting, we compared the interaction of two purified enzymes β-glucosidase and acid phosphatase with a sandy clay loam and two biocarbons. We quantified the sorbed enzymes at three different pHs using a Bradford protein assay and then measured the activity of the sorbed enzyme via high-throughput fluorometric analysis. Both sorption and activity depended upon the solid phase, pH, and specific enzyme. Overall the high surface area biocarbon impacted the catalytic capacity of the enzymes more than the loam soil, which may have implications for soil nutrient management with these organic amendments.
The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.
Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E
2017-12-05
Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.
Alkylating derivative of oxotremorine interacts irreversibly with the muscarinic receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ehlert, F.J.; Jenden, D.J.; Ringdahl, B.
A 2-chloroethylamine derivative of oxotremorine was studied in pharmacological experiments and muscarinic receptor binding assays. The compound, N-(4-(2-chloroethylmethylamino)-2-butynyl)-2-pyrrolidone (BM 123), forms an aziridinium ion in aqueous solution at neutral pH that stimulates contractions of guinea pig ileum with a potency similar to that of oxotremorine. Following the initial stimulation, there is a long lasting period of lack of sensitivity of the guinea pig ileum to muscarinic agonists. BM 123 also produces muscarinic effects in vivo. When homogenates of the rat cerebral cortex were incubated with BM 123 and assayed subsequently in muscarinic receptor binding assays, a loss of binding capacitymore » for the muscarinic antagonist, (/sup 3/H)N-methylscopolamine ((/sup 3/H)NMS), was noted without a change in affinity. Similar observations were made in (/sup 3/H)1-3-quinuclidinyl benzilate ((/sup 3/H)-QNB) binding assays on the forebrains of mice that had been injected with BM 123 24 hr earlier. The loss in receptor capacity for both (/sup 3/H)NMS and (/sup 3/H)-QNB was prevented by atropine treatment. Kinetic studies of the interaction of BM 123 with homogenates of the rat cerebral cortex in vitro showed that the half-time for the loss of (/sup 3/H)-QNB binding sites increased from 10 to 45 min as the concentration of BM 123 decreased from 10 to 1 ..mu..M. In contrast to the aziridinium ion, the parent 2-chloroethylamine compound and the alcoholic hydrolysis product were largely devoid of pharmacological and binding activity.« less
Berenguer, J A; Gonzalez, L; Jimenez, I; Legarda, T M; Olmedo, J B; Burdaspal, P A
1993-01-01
A study was undertaken to determine if any reduction in contamination of Acanthocardia tuberculatum L. (Mediterranean cockle) by paralytic shellfish poisons (PSP) could be enhanced by operations carried out during the industrial canning process, allowing contaminated raw material to be commercially marketed in safe conditions for edible purposes. A general decrease in PSP levels was consistently observed when comparing raw materials and their corresponding final products, these dropping to acceptable levels. PSP levels were determined by mouse bioassay and a fluorometric method, and saxitoxin was determined by HPLC. The detoxifying effects averaged over 71.7% and 81.8% (mouse bioassay), 70.6% and 90.9% (fluorometric method), 77.9% and 83.5% (HPLC), for boiling and sterilizing operations respectively. The highest level detected in raw material was 800 micrograms/100 g by mouse bioassay.
A fluorometric paper-based sensor array for the discrimination of heavy-metal ions.
Feng, Liang; Li, Hui; Niu, Li-Ya; Guan, Ying-Shi; Duan, Chun-Feng; Guan, Ya-Feng; Tung, Chen-Ho; Yang, Qing-Zheng
2013-04-15
A fluorometric paper-based sensor array has been developed for the sensitive and convenient determination of seven heavy-metal ions at their wastewater discharge standard concentrations. Combining with nine cross-reactive BODIPY fluorescent indicators and array technologies-based pattern-recognition, we have obtained the discrimination capability of seven different heavy-metal ions at their wastewater discharge standard concentrations. After the immobilization of indicators and the enrichment of analytes, identification of the heavy-metal ions was readily acquired using a standard chemometric approach. Clear differentiation among heavy-metal ions as a function of concentration was also achieved, even down to 10(-7)M. A semi-quantitative estimation of the heavy-metal ion concentration was obtained by comparing color changes with a set of known concentrations. The sensor array was tentatively investigated in spiked tap water and sea water, and showed possible feasibility for real sample testing. Copyright © 2013 Elsevier B.V. All rights reserved.
Scholz, Norman; Behnke, Thomas; Resch-Genger, Ute
2018-01-01
Micelles are of increasing importance as versatile carriers for hydrophobic substances and nanoprobes for a wide range of pharmaceutical, diagnostic, medical, and therapeutic applications. A key parameter indicating the formation and stability of micelles is the critical micelle concentration (CMC). In this respect, we determined the CMC of common anionic, cationic, and non-ionic surfactants fluorometrically using different fluorescent probes and fluorescence parameters for signal detection and compared the results with conductometric and surface tension measurements. Based upon these results, requirements, advantages, and pitfalls of each method are discussed. Our study underlines the versatility of fluorometric methods that do not impose specific requirements on surfactants and are especially suited for the quantification of very low CMC values. Conductivity and surface tension measurements yield smaller uncertainties particularly for high CMC values, yet are more time- and substance consuming and not suitable for every surfactant.
Seo, Minjeong; Park, Dong-Hoon; Lee, Chan Woo; Jaworski, Justyn; Kim, Jong-Man
2016-01-01
Much of atmospheric water originates from transpiration, the process by which plants release H2O from pores, known as stomata, that simultaneously intake CO2 for photosynthesis. Controlling stomatal aperture can regulate the extent of water transport in response to dynamic environmental factors including osmotic stress, temperature, light, and wind. While larger leaf regions are often examined, the extent of water vapor release from individual stomata remains unexplored. Using a “brush-on” sensing material, we can now assess transpiration using a water-responsive, polydiacetylene-based coating on the leaves surfaces. By eliciting a fluorometric signal to passing water vapor, we obtained information regarding the activity of individual stomata. In this demonstration, our results prove that this coating can identify the proportion of active stomata and the extent of transpirational diffusion of water in response to different conditions. PMID:27578430
Lynch, D M; Leali, B A; Howe, S E
1986-08-01
An enzyme-linked immunosorbent assay (ELISA) that quantitates antisperm antibody in serum was compared with standard sperm agglutination and immobilization assays with the use of sera from 40 normal and 292 subfertile individuals. Quantitation of the assay was accomplished by standardizing assay parameters, including the incorporation of a standard reference curve, the number of whole target sperm, the optimal dilution of serum, the selection of microtiter plate, and the time and temperatures involved in the adsorption and incubation phases. With this method, the level of antisperm antibody binding to target sperm in 40 normal fertile individuals was found to be 2.3 (+/- 1.1 standard deviation [SD]) fg immunoglobulin (Ig)/sperm. An increased mean level of 7.4 +/- 3.7 fg Ig/sperm was determined in 84 infertile patients with positive agglutination and/or immobilization tests. In 208 individuals with negative agglutination and immobilization tests the mean concentration of antisperm antibody was 2.5 +/- 1.3 fg Ig/sperm. Postvasectomy patients assayed by this method had a mean Ig binding value of 7.1 +/- 2.4 fg Ig/sperm. The infertile group with positive agglutination and/or immobilization tests had a significantly higher mean antisperm antibody level than the normal fertile group, according to the Student's t-test for independent samples (P less than 0.001). This indirect serum-based assay reproducibly quantitates antisperm antibody binding to whole target sperm, suggests the normal and abnormal levels of antisperm antibody, and correlates with standard functional assays.
A model of high-affinity antibody binding to type III group B Streptococcus capsular polysaccharide.
Wessels, M R; Muñoz, A; Kasper, D L
1987-12-01
We recently reported that the single repeating-unit pentasaccharide of type III group B Streptococcus (GBS) capsular polysaccharide is only weakly reactive with type III GBS antiserum. To further elucidate the relationship between antigen-chain length and antigenicity, tritiated oligosaccharides derived from type III capsular polysaccharide were used to generate detailed saturation binding curves with a fixed concentration of rabbit antiserum in a radioactive antigen-binding assay. A graded increase in affinity of antigen-antibody binding was seen as oligosaccharide size increased from 2.6 repeating units to 92 repeating units. These differences in affinity of antibody binding to oligosaccharides of different molecular size were confirmed by immunoprecipitation and competitive ELISA, two independent assays of antigen-antibody binding. Analysis of the saturation binding experiment indicated a difference of 300-fold in antibody-binding affinity for the largest versus the smallest tested oligosaccharides. Unexpectedly, the saturation binding values approached by the individual curves were inversely related to oligosaccharide chain length on a molar basis but equivalent on a weight basis. This observation is compatible with a model in which binding of an immunoglobulin molecule to an antigenic site on the polysaccharide facilitates subsequent binding of antibody to that antigen.
Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard
2009-10-07
Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.
Automated data processing and radioassays.
Samols, E; Barrows, G H
1978-04-01
Radioassays include (1) radioimmunoassays, (2) competitive protein-binding assays based on competition for limited antibody or specific binding protein, (3) immunoradiometric assay, based on competition for excess labeled antibody, and (4) radioreceptor assays. Most mathematical models describing the relationship between labeled ligand binding and unlabeled ligand concentration have been based on the law of mass action or the isotope dilution principle. These models provide useful data reduction programs, but are theoretically unfactory because competitive radioassay usually is not based on classical dilution principles, labeled and unlabeled ligand do not have to be identical, antibodies (or receptors) are frequently heterogenous, equilibrium usually is not reached, and there is probably steric and cooperative influence on binding. An alternative, more flexible mathematical model based on the probability or binding collisions being restricted by the surface area of reactive divalent sites on antibody and on univalent antigen has been derived. Application of these models to automated data reduction allows standard curves to be fitted by a mathematical expression, and unknown values are calculated from binding data. The vitrues and pitfalls are presented of point-to-point data reduction, linear transformations, and curvilinear fitting approaches. A third-order polynomial using the square root of concentration closely approximates the mathematical model based on probability, and in our experience this method provides the most acceptable results with all varieties of radioassays. With this curvilinear system, linear point connection should be used between the zero standard and the beginning of significant dose response, and also towards saturation. The importance is stressed of limiting the range of reported automated assay results to that portion of the standard curve that delivers optimal sensitivity. Published methods for automated data reduction of Scatchard plots for radioreceptor assay are limited by calculation of a single mean K value. The quality of the input data is generally the limiting factor in achieving good precision with automated as it is with manual data reduction. The major advantages of computerized curve fitting include: (1) handling large amounts of data rapidly and without computational error; (2) providing useful quality-control data; (3) indicating within-batch variance of the test results; (4) providing ongoing quality-control charts and between assay variance.
Dynamics of TBP binding to the TATA box
NASA Astrophysics Data System (ADS)
Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.
2008-02-01
Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.
Engineering and exploitation of a fluorescent HIV-1 gp120 for live cell CD4 binding assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costantini, Lindsey M.; Irvin, Susan C.; Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461
The HIV-1 envelope glycoprotein, gp120, binds the host cell receptor, CD4, in the initial step of HIV viral entry and infection. This process is an appealing target for the development of inhibitory drugs and neutralizing antibodies. To study gp120 binding and intracellular trafficking, we engineered a fluorescent fusion of the humanized gp120 JRFL HIV-1 variant and GFP. Gp120-sfGFP is glycosylated with human sugars, robustly expressed, and secreted from cultured human cells. Protein dynamics, quality control, and trafficking can be visualized in live cells. The fusion protein can be readily modified with different gp120 variants or fluorescent proteins. Finally, secreted gp120-sfGFPmore » enables a sensitive and easy binding assay that can quantitatively screen potential inhibitors of gp120-CD4 binding on live cells via fluorescence imaging or laser scanning cytometry. This adaptable research tool should aid in studies of gp120 cell biology and the development of novel anti-HIV drugs. - Highlights: • Development of fluorescent protein labeled HIV-1 envelope gp120. • Imaging of gp120 dynamics and trafficking in live cells. • Quantitative visual assay of antibody-mediated inhibition of gp120 binding to CD4 on live cells.« less
Data quality in drug discovery: the role of analytical performance in ligand binding assays
NASA Astrophysics Data System (ADS)
Wätzig, Hermann; Oltmann-Norden, Imke; Steinicke, Franziska; Alhazmi, Hassan A.; Nachbar, Markus; El-Hady, Deia Abd; Albishri, Hassan M.; Baumann, Knut; Exner, Thomas; Böckler, Frank M.; El Deeb, Sami
2015-09-01
Despite its importance and all the considerable efforts made, the progress in drug discovery is limited. One main reason for this is the partly questionable data quality. Models relating biological activity and structures and in silico predictions rely on precisely and accurately measured binding data. However, these data vary so strongly, such that only variations by orders of magnitude are considered as unreliable. This can certainly be improved considering the high analytical performance in pharmaceutical quality control. Thus the principles, properties and performances of biochemical and cell-based assays are revisited and evaluated. In the part of biochemical assays immunoassays, fluorescence assays, surface plasmon resonance, isothermal calorimetry, nuclear magnetic resonance and affinity capillary electrophoresis are discussed in details, in addition radiation-based ligand binding assays, mass spectrometry, atomic force microscopy and microscale thermophoresis are briefly evaluated. In addition, general sources of error, such as solvent, dilution, sample pretreatment and the quality of reagents and reference materials are discussed. Biochemical assays can be optimized to provide good accuracy and precision (e.g. percental relative standard deviation <10 %). Cell-based assays are often considered superior related to the biological significance, however, typically they cannot still be considered as really quantitative, in particular when results are compared over longer periods of time or between laboratories. A very careful choice of assays is therefore recommended. Strategies to further optimize assays are outlined, considering the evaluation and the decrease of the relevant error sources. Analytical performance and data quality are still advancing and will further advance the progress in drug development.
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Brockman, Adam H; Oller, Haley R; Moreau, Benoît; Kriksciukaite, Kristina; Bilodeau, Mark T
2015-02-12
Medicinal chemists have been encouraged in recent years to embrace high speed protein binding assays. These methods employ dialysis membranes in 96-well format or spin filters. Membrane-based methods do not separate lipoprotein binding from albumin binding and introduce interference despite membrane binding controls. Ultracentrifugation methods, in contrast, do not introduce interference if density gradients can be avoided and they resolve lipoprotein from albumin. A new generation of compact, fast ultracentrifuges facilitates the rapid and fully informative separation of plasma into albumin, albumin/fatty acid complex, lipoprotein, protein-free, and chylomicron fractions with no need of salt or sugar density gradients. We present a simple and fast ultracentrifuge method here for two platinum compounds and a taxane that otherwise bound irreversibly to dialysis membranes and which exhibited distinctive lipoprotein binding behaviors. This new generation of ultracentrifugation methods underscores a need to further discuss protein binding assessments as they relate to medicinal chemistry efforts.
A Spectrophotometric Assay Optimizing Conditions for Pepsin Activity.
ERIC Educational Resources Information Center
Harding, Ethelynda E.; Kimsey, R. Scott
1998-01-01
Describes a laboratory protocol optimizing the conditions for the assay of pepsin activity using the Coomasie Blue dye binding assay of protein concentration. The dye bonds through strong, noncovalent interactions to basic and aromatic amino acid residues. (DDR)
DiCaprio, Erin; Phantkankum, Nuttapong; Culbertson, Doug; Ma, Yuanmei; Hughes, John H; Kingsley, David; Uribe, Roberto M; Li, Jianrong
2016-09-02
Human norovirus (NoV) is a major cause of fresh produce-associated outbreaks and human NoV in irrigation water can potentially lead to viral internalization in fresh produce. Therefore, there is a need to develop novel intervention strategies to target internalized viral pathogens while maintaining fresh produce quality. In this study electron beam (E-beam) and gamma radiation were evaluated for efficacy against a human NoV GII.4 strain and Tulane virus (TV). Virus survival following ionizing radiation treatments was determined using direct quantitative reverse transcriptase PCR (RT-qPCR), the porcine gastric mucin magnetic bead (PGM-MB) binding assay followed by RT-qPCR, and plaque assay. In simple media, a high dose of E-beam treatment was required to completely abolish the receptor binding ability of human NoV (35.3kGy) and TV (19.5-24.1kGy), as assessed using the PGM-MB binding assay. Both human NoV and TV were more susceptible to gamma irradiation than E-beam, requiring 22.4kGy to achieve complete inactivation. In whole strawberries, no human NoV or TV RNA was detected following 28.7kGy of E-beam treatment using the PGM-MB binding assay. Overall, human NoV and TV are highly resistant to ionizing radiation and therefore the technology may not be suitable to eliminate viruses in fresh produce at the currently approved levels. In addition, the PGM-MB binding assay is an improved method to detect viral infectivity compared to direct RT-qPCR. Copyright © 2016. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Su, Rongguo; Chen, Xiaona; Wu, Zhenzhen; Yao, Peng; Shi, Xiaoyong
2015-07-01
The feasibility of using fluorescence excitation-emission matrix (EEM) along with parallel factor analysis (PARAFAC) and nonnegative least squares (NNLS) method for the differentiation of phytoplankton taxonomic groups was investigated. Forty-one phytoplankton species belonging to 28 genera of five divisions were studied. First, the PARAFAC model was applied to EEMs, and 15 fluorescence components were generated. Second, 15 fluorescence components were found to have a strong discriminating capability based on Bayesian discriminant analysis (BDA). Third, all spectra of the fluorescence component compositions for the 41 phytoplankton species were spectrographically sorted into 61 reference spectra using hierarchical cluster analysis (HCA), and then, the reference spectra were used to establish a database. Finally, the phytoplankton taxonomic groups was differentiated by the reference spectra database using the NNLS method. The five phytoplankton groups were differentiated with the correct discrimination ratios (CDRs) of 100% for single-species samples at the division level. The CDRs for the mixtures were above 91% for the dominant phytoplankton species and above 73% for the subdominant phytoplankton species. Sixteen of the 85 field samples collected from the Changjiang River estuary were analyzed by both HPLC-CHEMTAX and the fluorometric technique developed. The results of both methods reveal that Bacillariophyta was the dominant algal group in these 16 samples and that the subdominant algal groups comprised Dinophyta, Chlorophyta and Cryptophyta. The differentiation results by the fluorometric technique were in good agreement with those from HPLC-CHEMTAX. The results indicate that the fluorometric technique could differentiate algal taxonomic groups accurately at the division level.
Insight into the novel inhibition mechanism of apigenin to Pneumolysin by molecular modeling
NASA Astrophysics Data System (ADS)
Niu, Xiaodi; Yang, Yanan; Song, Meng; Wang, Guizhen; Sun, Lin; Gao, Yawen; Wang, Hongsu
2017-11-01
In this study, the mechanism of apigenin inhibition was explored using molecular modelling, binding energy calculation, and mutagenesis assays. Energy decomposition analysis indicated that apigenin binds in the gap between domains 3 and 4 of PLY. Using principal component analysis, we found that binding of apigenin to PLY weakens the motion of domains 3 and 4. Consequently, these domains cannot complete the transition from monomer to oligomer, thereby blocking oligomerisation of PLY and counteracting its haemolytic activity. This inhibitory mechanism was confirmed by haemolysis assays, and these findings will promote the future development of an antimicrobial agent.
Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian
2018-07-06
Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625 /S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.
Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.
Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki
2014-07-01
Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian
2018-07-01
Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625/S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.
Arnold, A R; Burnham, C-A D; Ford, B A; Lawhon, S D; McAllister, S K; Lonsway, D; Albrecht, V; Jerris, R C; Rasheed, J K; Limbago, B; Burd, E M; Westblade, L F
2016-03-01
The performance of a rapid penicillin-binding protein 2a (PBP2a) detection assay, the Alere PBP2a culture colony test, was evaluated for identification of PBP2a-mediated beta-lactam resistance in human and animal clinical isolates of Staphylococcus intermedius group, Staphylococcus lugdunensis, and Staphylococcus schleiferi. The assay was sensitive and specific, with all PBP2a-negative and PBP2a-positive strains testing negative and positive, respectively. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A
2008-12-01
Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.
Ribosomal targets for antibiotic drug discovery
Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R
2016-09-13
The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.
BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.
Fischer, Cornelia; Sauter, Margret; Dietrich, Petra
2017-01-01
Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.
Schöttner, M; Gansser, D; Spiteller, G
1997-12-01
Polar extracts of the stinging nettle (Urtica dioica L.) roots contain the ligans (+)-neoolivil, (-)-secoisolariciresinol, dehydrodiconiferyl alcohol, isolariciresinol, pinoresinol, and 3,4-divanillyltetrahydrofuran. These compounds were either isolated from Urtica roots, or obtained semisynthetically. Their affinity to human sex hormone binding globulin (SHBG) was tested in an in vitro assay. In addition, the main intestinal transformation products of plant lignans in humans, enterodiol and enterolactone, together with enterofuran were checked for their activity. All lignans except (-)-pinoresinol developed a binding affinity to SHBG in the in vitro assay. The affinity of (-)-3,4-divanillyltetrahydrofuran was outstandingly high. These findings are discussed with respect to potential beneficial effects of plant lignans on benign prostatic hyperplasia (BPH).
Tissue Specific and Hormonal Regulation of Gene Expression
1997-08-01
interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the
Styriak, I; Lauková, A; Fallgren, C; Wadström, T
1999-12-01
Thirty-three enterococcal strains and 10 Streptococcus bovis strains were investigated for their protein-binding cell surface components. Seven extracellular matrix (ECM) proteins were immobilized on Difco latex beads to detect these components on the surface of all enterococcal strains and eight non-autoaggregating S. bovis strains by a particle agglutination assay (PAA). Twenty-three selected strains were also examined in microtiter plate assays. According to the absorbance readings (A(570nm)), 11 strains were classified as nonadherent (A(570nm) < 0.1), 10 strains as weakly adherent (0.1 < A(570nm) > 0.3), and 2 strains as strongly adherent (A(570nm) > 0.3) in these assays. A direct correlation was found between the values obtained in PAA and A(570nm) readings of microtiter plate assays. Binding of (125)I-labeled bovine lactoferrin to enterococci and streptococci was in the range of 6%-30% and of (125)I-labeled human vitronectin in the range of 9%-33% to streptococci. The binding of(125)I-labeled ECM proteins to selected strains was much more effectively inhibited by sulfated carbohydrates than by non-sulfated hyaluronic acid, indicating the importance of the sulfate groups of these inhibitors. An inhibition effect of heparin on bLf binding to four selected strains was higher in comparison with fucoidan in the microtiter plates. Thirty-five out of 44 strains had agglutinated rabbit erythrocytes. However, these strains showed no ability to agglutinate bovine or sheep erythrocytes.
Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.
1988-09-01
To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less
Chiaraviglio, Lucius
2014-01-01
Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788
Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay
Huang, Tao; Long, Mian; Huo, Bo
2010-01-01
Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379
Vasu, Srividya; McClenaghan, Neville H; Flatt, Peter R
2016-10-01
Mechanisms of toxicity and cell damage were investigated in novel clonal human pancreatic beta cell line, 1.1B4, after exposure to streptozotocin, alloxan, ninhydrin, and hydrogen peroxide. Viability, DNA damage, insulin secretion/content, [Ca]i, and glucokinase/hexokinase, mRNA expression were measured by MTT assay, comet assay, radioimmunoassay, fluorometric imaging plate reader, enzyme-coupled photometry, and real-time polymerase chain reaction, respectively. Chemicals significantly reduced 1.1B4 cell viability in a time/concentration-dependent manner. Chronic 18-hour exposure decreased cellular insulin, glucokinase, and hexokinase activities. Chemicals decreased transcription of INS, GCK, PCSK1, PCSK2, and GJA1 (involved in secretory function). Insulin release and [Ca]i responses to nutrients and membrane-depolarizing agents were impaired. Streptozotocin and alloxan up-regulated transcription of genes, SOD1 and SOD2 (antioxidant enzymes). Ninhydrin and hydrogen peroxide up-regulated SOD2 transcription, whereas alloxan and hydrogen peroxide increased CAT transcription. Chemicals induced DNA damage, apoptosis, and increased caspase 3/7 activity. Streptozotocin and alloxan decreased transcription of BCL2 while increasing transcription of BAX. Chemicals did not affect transcription of HSPA4 and HSPA5 and nitrite production. 1.1B4 cells represent a useful model of human beta cells. Chemicals impaired 1.1B4 cell secretory function and activated antioxidant defense and apoptotic pathways without activating endoplasmic reticulum stress response/nitrosative stress.
Collins, Valerie M; Daly, Donna M; Liaskos, Marina; McKay, Neil G; Sellers, Donna; Chapple, Christopher; Grundy, David
2013-11-01
To investigate the direct effect of onabotulinumtoxinA (OnaBotA) on bladder afferent nerve activity and release of ATP and acetylcholine (ACh) from the urothelium. Bladder afferent nerve activity was recorded using an in vitro mouse preparation enabling simultaneous recordings of afferent nerve firing and intravesical pressure during bladder distension. Intraluminal and extraluminal ATP, ACh, and nitric oxide (NO) release were measured using the luciferin-luciferase and Amplex(®) Red assays (Molecular Probes, Carlsbad, CA, USA), and fluorometric assay kit, respectively. OnaBotA (2U), was applied intraluminally, during bladder distension, and its effect was monitored for 2 h after application. Whole-nerve activity was analysed to classify the single afferent units responding to physiological (low-threshold [LT] afferent <15 mmHg) and supra-physiological (high-threshold [HT] afferent >15 mmHg) distension pressures. Bladder distension evoked reproducible pressure-dependent increases in afferent nerve firing. After exposure to OnaBotA, both LT and HT afferent units were significantly attenuated. OnaBotA also significantly inhibited ATP release from the urothelium and increased NO release. These data indicate that OnaBotA attenuates the bladder afferent nerves involved in micturition and bladder sensation, suggesting that OnaBotA may exert its clinical effects on urinary urgency and the other symptoms of overactive bladder syndrome through its marked effect on afferent nerves. © 2013 The Authors. BJU International © 2013 BJU International.
Khan, Zainul A.; Abdin, Malik Z.; Khan, Jawaid A.
2015-01-01
Cotton leaf curl Burewala virus (CLCuBuV), belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP) genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV) were fused with β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi) leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum) plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells. PMID:25799504
Khan, Zainul A; Abdin, Malik Z; Khan, Jawaid A
2015-01-01
Cotton leaf curl Burewala virus (CLCuBuV), belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP) genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV) were fused with β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi) leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum) plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.
Zamporlini, Federica; Ruggieri, Silverio; Mazzola, Francesca; Amici, Adolfo; Orsomando, Giuseppe; Raffaelli, Nadia
2014-11-01
The redox coenzyme NAD(+) is also a rate-limiting co-substrate for several enzymes that consume the molecule, thus rendering its continuous re-synthesis indispensable. NAD(+) biosynthesis has emerged as a therapeutic target due to the relevance of NAD(+) -consuming reactions in complex intracellular signaling networks whose alteration leads to many neurologic and metabolic disorders. Distinct metabolic routes, starting from various precursors, are known to support NAD(+) biosynthesis with tissue/cell-specific efficiencies, probably reflecting differential expression of the corresponding rate-limiting enzymes, i.e. nicotinamide phosphoribosyltransferase, quinolinate phosphoribosyltransferase, nicotinate phosphoribosyltransferase and nicotinamide riboside kinase. Understanding the contribution of these enzymes to NAD(+) levels depending on the tissue/cell type and metabolic status is necessary for the rational design of therapeutic strategies aimed at modulating NAD(+) availability. Here we report a simple, fast and sensitive coupled fluorometric assay that enables simultaneous determination of the four activities in whole-cell extracts and biological fluids. Its application to extracts from various mouse tissues, human cell lines and plasma yielded for the first time an overall picture of the tissue/cell-specific distribution of the activities of the various enzymes. The screening enabled us to gather novel findings, including (a) the presence of quinolinate phosphoribosyltransferase and nicotinamide riboside kinase in all examined tissues/cell lines, indicating that quinolinate and nicotinamide riboside are relevant NAD(+) precursors, and (b) the unexpected occurrence of nicotinate phosphoribosyltransferase in human plasma. © 2014 FEBS.
Šimšíková, Michaela; Čechal, Jan; Zorkovská, Anna; Antalík, Marián; Šikola, Tomáš
2014-11-01
Cysteine and homocysteine play a crucial role in many biological functions but abnormal levels of these amino acids may lead to various forms of pathogenesis. Therefore, selective and easy-to-use methods for the detection of cysteine and homocysteine are essential for the early diagnosis of developing diseases. In this paper we report on a rapid, straightforward and highly selective method for the detection of cysteine (Cys) and homocysteine (Hcy) which uses a CuO/ZnO nanocomposite as a dual colorimetric and fluorometric assay. The presence of Cys and Hcy in a solution of these nanorods (NRs) induces a change in its color from light blue to dark grey which is visible to the naked eye. This is accompanied by a blue shift in the absorption spectra from 725 nm to 650 nm and a decrease in the intensity of CuO/ZnO nanocomposite emission. These changes are ascribed to the reduction of Cu(II) to Cu(0), and the oxidation of cysteine (homocysteine) and subsequent formation of the disulfide bond. This novel assay method does not respond to any other amino-acid which is present in living organisms; therefore the selective determination of cysteine (homocysteine) with a lower analyte limit of 40 μM (4.8 μg mL(-1)) can be carried out in aqueous solutions without the need for any sophisticated instrumentation, fluorophore molecules or complicated procedures. Copyright © 2014 Elsevier B.V. All rights reserved.
Lee, Bonggi; Moon, Kyoung Mi; Kim, Seong Jin; Kim, So Hee; Kim, Dae Hyun; An, Hye Jin; Jeong, Ji Won; Kim, Ye Ra; Son, Sujin; Kim, Min Jo; Chung, Ki Wung; Lee, Eun Kyeong; Chun, Pusoon; Ha, Young Mi; Kim, Min-Sun; Mo, Sang Hyun; Moon, Hyung Ryong; Chung, Hae Young
2016-01-01
Background. Uncontrolled melanogenesis and wrinkle formation are an indication of photoaging. Our previous studies demonstrated that (Z)-5-(2,4-dihydroxybenzylidene)thiazolidine-2,4-dione (MHY498) inhibited tyrosinase activity and melanogenesis in vitro. Objective. To examine in vivo effects of MHY498 as an antiaging compound on UVB-induced melanogenesis and wrinkle formation, we topically applied MHY498 on dorsal skin of HRM-2 hairless mice. Methods. Using histological analysis, we evaluated effects of MHY498 on melanogenesis and wrinkle formation after UVB exposure. In addition, related molecular signaling pathways were examined using western blotting, fluorometric assay, and enzyme-linked immunosorbent assay. Results. MHY498 suppressed UVB-induced melanogenesis by inhibiting phosphorylation of CREB and translocation of MITF protein into the nucleus, which are key factors for tyrosinase expression. Consistently, tyrosinase protein levels were notably reduced in the dorsal skin of the hairless mice by MHY498 treatment. Furthermore, MHY498 inhibited UVB-induced wrinkle formation and collagen fiber destruction by increasing type 1 procollagen concentration and decreasing protein expression levels of MMPs, which play an essential role in collagen fiber degradation. As a mechanism, MHY498 notably ameliorated UVB-induced oxidative stress and NF-κB activation in the dermal skin of the hairless mice. Conclusion. Our study suggests that MHY498 can be used as a therapeutic or cosmetic agent for preventing uncontrolled melanogenesis and wrinkle formation. PMID:27242917
Chiang, Wei-Chung; Wei, Yongjie; Kuo, Yi-Chun; Wei, Shuguang; Zhou, Anwu; Zou, Zhongju; Yehl, Jenna; Ranaghan, Matthew J; Skepner, Adam; Bittker, Joshua A; Perez, Jose R; Posner, Bruce A; Levine, Beth
2018-06-21
Autophagy, a lysosomal degradation pathway, plays a crucial role in cellular homeostasis, development, immunity, tumor suppression, metabolism, prevention of neurodegeneration, and lifespan extension. Thus, pharmacological stimulation of autophagy may be an effective approach for preventing or treating certain human diseases and/or aging. We sought to establish a method for developing new chemical compounds that specifically induce autophagy. To do this, we developed two assays to identify compounds that target a key regulatory node of autophagy induction-specifically, the binding of Bcl-2 (a negative regulator of autophagy) to Beclin 1 (an allosteric modulator of the Beclin 1/VPS34 lipid kinase complex that functions in autophagy initiation). These assays use either a split-luciferase assay to measure Beclin 1/Bcl-2 binding in cells or an AlphaLISA assay to directly measure direct Beclin 1/Bcl-2 binding in vitro. We screened two different chemical compound libraries, comprising ∼300 K compounds, to identify small molecules that disrupt Beclin 1/Bcl-2 binding and induce autophagy. Three novel compounds were identified that directly inhibit Beclin 1/Bcl-2 interaction with an IC 50 in the micromolar range and increase autophagic flux. These compounds do not demonstrate significant cytotoxicity, and they exert selectivity for disruption of Bcl-2 binding to the BH3 domain of Beclin 1 compared with the BH3 domain of the pro-apoptotic Bcl-2 family members, Bax and Bim. Thus, we have identified candidate molecules that serve as lead templates for developing potent and selective Beclin 1/Bcl-2 inhibitors that may be clinically useful as autophagy-inducing agents.
Ferrero, Maximiliano R; Heins, Anja M; Soprano, Luciana L; Acosta, Diana M; Esteva, Mónica I; Jacobs, Thomas; Duschak, Vilma G
2016-02-01
In order to investigate the involvement of sulfated groups in the Trypanosoma cruzi host-parasite relationship, we studied the interaction between the major cysteine proteinase of T. cruzi, cruzipain (Cz), a sulfate-containing sialylated molecule and the sialic acid-binding immunoglobulin like lectin-E (Siglec-E). To this aim, ELISA, indirect immunofluorescence assays and flow cytometry, using mouse Siglec-E-Fc fusion molecules and glycoproteins of parasites, were performed. Competition assays verified that the lectins, Maackia amurensis II (Mal II) and Siglec-E-Fc, compete for the same binding sites. Taking into account that Mal II binding remains unaltered by sulfation, we established this lectin as sialylation degree control. Proteins of an enriched microsomal fraction showed the highest binding to Siglec-E as compared with those from the other parasite subcellular fractions. ELISA assays and the affinity purification of Cz by a Siglec-E column confirmed the interaction between both molecules. The significant decrease in binding of Siglec-E-Fc to Cz and to its C-terminal domain (C-T) after desulfation of these molecules suggests that sulfates contribute to the interaction between Siglec-E-Fc and these glycoproteins. Competitive ELISA assays confirmed the involvement of sulfated epitopes in the affinity between Siglec-E and Cz, probably modified by natural protein environment. Interestingly, data from flow cytometry of untreated and chlorate-treated parasites suggested that sulfates are not primary receptors, but enhance the binding of Siglec-E to trypomastigotic forms. Altogether, our findings support the notion that sulfate-containing sialylated glycoproteins interact with Siglec-E, an ortholog protein of human Siglec-9, and might modulate the immune response of the host, favoring parasitemia and persistence of the parasite.
Ramsey, Simeon J; Attkins, Neil J; Fish, Rebecca; van der Graaf, Piet H
2011-01-01
BACKGROUND AND PURPOSE A series of novel non-peptide corticotropin releasing factor type-1 receptor (CRF1) antagonists were found to display varying degrees of insurmountable and non-competitive behaviour in functional in vitro assays. We describe how we attempted to relate this behaviour to ligand receptor-binding kinetics in a quantitative manner and how this resulted in the development and implementation of an efficient pharmacological screening method based on principles described by Motulsky and Mahan. EXPERIMENTAL APPROACH A non-equilibrium binding kinetic assay was developed to determine the receptor binding kinetics of non-peptide CRF1 antagonists. Nonlinear, mixed-effects modelling was used to obtain estimates of the compounds association and dissociation rates. We present an integrated pharmacokinetic–pharmacodynamic (PKPD) approach, whereby the time course of in vivo CRF1 receptor binding of novel compounds can be predicted on the basis of in vitro assays. KEY RESULTS The non-competitive antagonist behaviour appeared to be correlated to the CRF1 receptor off-rate kinetics. The integrated PKPD model suggested that, at least in a qualitative manner, the in vitro assay can be used to triage and select compounds for further in vivo investigations. CONCLUSIONS AND IMPLICATIONS This study provides evidence for a link between ligand offset kinetics and insurmountable/non-competitive antagonism at the CRF1 receptor. The exact molecular pharmacological nature of this association remains to be determined. In addition, we have developed a quantitative framework to study and integrate in vitro and in vivo receptor binding kinetic behaviour of CRF1 receptor antagonists in an efficient manner in a drug discovery setting. PMID:21449919
A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry.
Diago-Navarro, Elizabeth; Kamphuis, Monique B; Boelens, Rolf; Barendregt, Arjan; Heck, Albert J; van den Heuvel, Robert H; Díaz-Orejas, Ramón
2009-09-01
Kid, the toxin of the parD (kis, kid) maintenance system of plasmid R1, is an endoribonuclease that preferentially cleaves RNA at the 5' of A in the core sequence 5'-UA(A/C)-3'. A model of the Kid toxin interacting with the uncleavable mimetic 5'-AdUACA-3' is available. To evaluate this model, a significant collection of mutants in some of the key residues proposed to be involved in RNA binding (T46, A55, T69 and R85) or RNA cleavage (R73, D75 and H17) were analysed by mass spectrometry in RNA binding and cleavage assays. A pair of substrates, 5'-AUACA-3', and its uncleavable mimetic 5'-AdUACA-3', used to establish the model and structure of the Kid-RNA complex, were used in both the RNA cleavage and binding assays. A second RNA substrate, 5'-UUACU-3' efficiently cleaved by Kid both in vivo and in vitro, was also used in the cleavage assays. Compared with the wild-type protein, mutations in the residues of the catalytic site abolished RNA cleavage without substantially altering RNA binding. Mutations in residues proposed to be involved in RNA binding show reduced binding efficiency and a corresponding decrease in RNA cleavage efficiency. The cleavage profiles of the different mutants were similar with the two substrates used, but RNA cleavage required much lower protein concentrations when the 5'-UUACU-3' substrate was used. Protein synthesis and growth assays are consistent with there being a correlation between the RNase activity of Kid and its inhibitory potential. These results give important support to the available models of Kid RNase and the Kid-RNA complex.
Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H
1997-03-14
Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.
Replacing antibodies with modified DNA aptamers in vaccine potency assays.
Trausch, Jeremiah J; Shank-Retzlaff, Mary; Verch, Thorsten
2017-10-04
Vaccine in vitro potency assays are vital regulatory tests that are used to confirm the presence and concentration of an antigen of interest in a form that directly or indirectly relates to protective activity in patients. Current assays come in many forms, but they almost exclusively use antibody reagents for selective detection of the target antigen. Antibodies provide specific recognition of vaccine antigens but also exhibit drawbacks such as stability limitations, cost, and lot-to-lot variation, which can make it challenging to maintain the reagent throughout the lifetime of the vaccine. We explored replacing antibodies with aptamers. Aptamers are macromolecules, such as nucleic acids, which can bind to their targets with high specificity and affinity, similar to that of antibodies. Some of the advantages of using aptamers over antibodies is that aptamers can be more stable, smaller, less expensive to produce, synthesized in vitro, and logistically easier to supply throughout the multi-decade lifespan of a commercial vaccine. We created modified DNA aptamers against the common vaccine carrier protein, CRM 197 . Several aptamers were discovered and one was chosen for further characterization. The binding kinetics of the aptamer revealed an off-rate 16-fold slower than anti-CRM 197 antibodies used for comparison. The aptamers were more sensitive than available antibodies in some assay formats and comparable in others. The aptamer epitope was mapped to the receptor-binding domain of CRM 197 , a site adjacent to a known antibody binding site. These data address some key aspects for a path forward in replacing antibodies with aptamers for use as critical reagents in vaccine assays. We further highlight the possibility of using nucleic acid reagents to develop next generation potency assays. Copyright © 2017 Elsevier Ltd. All rights reserved.
Parween, Shahila; Nahar, Pradip
2013-10-15
In this communication, we report ELISA technique on an activated polypropylene microtest plate (APPµTP) as an illustrative example of a low cost diagnostic assay. Activated test zone in APPµTP binds a capture biomolecule through covalent linkage thereby, eliminating non-specific binding often prevalent in absorption based techniques. Efficacy of APPµTP is demonstrated by detecting human immunoglobulin G (IgG), human immunoglobulin E (IgE) and Aspergillus fumigatus antibody in patient's sera. Detection is done by taking the image of the assay solution by a desktop scanner and analyzing the color of the image. Human IgE quantification by color saturation in the image-based assay shows excellent correlation with absorbance-based assay (Pearson correlation coefficient, r=0.992). Significance of the relationship is seen from its p value which is 4.087e-11. Performance of APPµTP is also checked with respect to microtiter plate and paper-based ELISA. APPµTP can quantify an analyte as precisely as in microtiter plate with insignificant non-specific binding, a necessary prerequisite for ELISA assay. In contrast, paper-ELISA shows high non-specific binding in control sera (false positive). Finally, we have carried out ELISA steps on APPµTP by ultrasound waves on a sonicator bath and the results show that even in 8 min, it can convincingly differentiate a test sample from a control sample. In short, spectrophotometer-free image-based miniaturized ELISA on APPµTP is precise, reliable, rapid, and sensitive and could be a good substitute for conventional immunoassay procedures widely used in clinical and research laboratories. Copyright © 2013 Elsevier B.V. All rights reserved.
Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len
2005-03-01
We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.
Characterization of 12 GnRH peptide agonists - a kinetic perspective.
Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak-Reppel, Katrin; Fernández-Montalván, Amaury E; IJzerman, Adriaan P; Heitman, Laura H
2016-01-01
Drug-target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin-releasing hormone (GnRH) receptor for the treatment of hormone-dependent diseases. Surprisingly, the kinetic receptor-binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor-binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. A novel radioligand-binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [(125) I]-triptorelin. In addition to radioligand-binding studies, a homogeneous time-resolved FRET Tag-lite™ method was developed as an alternative assay for the same purpose. Two novel competition association assays were successfully developed and applied to determine the kinetic receptor-binding characteristics of 12 high-affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. © 2015 The British Pharmacological Society.
Characterization of 12 GnRH peptide agonists – a kinetic perspective
Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak‐Reppel, Katrin; Fernández‐Montalván, Amaury E.; IJzerman, Adriaan P.
2015-01-01
Background and Purpose Drug‐target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin‐releasing hormone (GnRH) receptor for the treatment of hormone‐dependent diseases. Surprisingly, the kinetic receptor‐binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor‐binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. Experimental Approach A novel radioligand‐binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [125I]‐triptorelin. In addition to radioligand‐binding studies, a homogeneous time‐resolved FRET Tag‐lite™ method was developed as an alternative assay for the same purpose. Key Results Two novel competition association assays were successfully developed and applied to determine the kinetic receptor‐binding characteristics of 12 high‐affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Conclusions and Implications Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. PMID:26398856
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ransom, R.W.; Wai-si Eng; Burns, H.D.
1990-01-01
Synthetic methods have been established for preparing high specific activity (+)-3-({sup 123}I)Iodo-MK-801 in high radiochemical yield. The binding of the radiotracer to rat cortical membranes has been examine to assess its potential use as an in vivo imaging agent for the N-methyl-D-aspartate (NMDA) receptor-ion channel complex. Under the conditions of the assay, specific (+)-3-({sup 123}I)Iodo-MK-801 binding to membrane homogenates represented greater than 95% of the total binding. Several structurally distinct, noncompetitive NMDA receptor antagonists inhibited binding with potencies in accordance with their reported inhibitory activity at the receptor complex. The concentration of ({plus minus})-3-Iodo-MK-801 required to inhibit 50% of (+)-3-({supmore » 123}I)Iodo-MK-801 binding (IC{sub 50}) was 3.4 nM when using a low ionic strength assay buffer and 5.5 nM in a physiological buffer. In a thoroughly washed membrane preparation, (+)-3-({sup 123}I)Iodo-MK-801 binding was enhanced by L-glutamate and glycine at concentrations known to activate the NMDA receptor. The results indicate that (+)-3-({sup 123}I)Iodo-MK-801 specifically labels the NMDA receptor complex in rat brain membranes and the retention of high affinity under near physiological assay conditions suggests that it may be useful as a SPECT imaging agent for the receptor in vivo.« less
Liu, Zhihui; Lam, Norris; Thiele, Carol J
2015-09-29
The zinc finger transcription factor CASZ1 has been found to control neural fate-determination in flies, regulate murine and frog cardiac development, control murine retinal cell progenitor expansion and function as a tumor suppressor gene in humans. However, the molecular mechanism by which CASZ1 regulates gene transcription to exert these diverse biological functions has not been described. Here we identify co-factors that are recruited by CASZ1b to regulate gene transcription using co-immunoprecipitation (co-IP) and mass spectrometry assays. We find that CASZ1b binds to the nucleosome remodeling and histone deacetylase (NuRD) complex, histones and DNA repair proteins. Mutagenesis of the CASZ1b protein assay demonstrates that the N-terminus of CASZ1b is required for NuRD binding, and a poly(ADP-ribose) binding motif in the CASZ1b protein is required for histone H3 and DNA repair proteins binding. The N-terminus of CASZ1b fused to an artificial DNA-binding domain (GAL4DBD) causes a significant repression of transcription (5xUAS-luciferase assay), which could be blocked by treatment with an HDAC inhibitor. Realtime PCR results show that the transcriptional activity of CASZ1b mutants that abrogate NuRD or histone H3/DNA binding is significantly decreased. This indicates a model in which CASZ1b binds to chromatin and recruits NuRD complexes to orchestrate epigenetic-mediated transcriptional programs.
Peptide-cellulose conjugates for protease point of care diagnostics and treatment
USDA-ARS?s Scientific Manuscript database
Peptide-cellulose conjugates containing Human Neutrophil Elastase substrate sequences with both colorimetric and fluorometric signal molecules have been synthesized on a variety of cellulosic and nanocellulosic substrates including cotton and wood nanocrystals, wood nanocomposites, cotton-based aero...
OPTIMIZATION OF THE WASH-OFF METHOD FOR MEASURING AEROSOL CONCENTRATIONS
Using the fluorescence-washing technique, oleic acid particles tagged with uranine were extracted and analyzed fluorometrically. The possible sources of errors in the technique were evaluated in this study. First, the sensitivity of uranine fluorescence in different solutions ...
Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin
2013-05-01
Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.
Wilkinson, Kim; Boyd, Justin D.; Glicksman, Marcie; Moore, Kathryn J.; El Khoury, Joseph
2011-01-01
A pathological hallmark of Alzheimer disease (AD) is deposition of amyloid β (Aβ) in the brain. Aβ binds to microglia via a receptor complex that includes CD36 leading to production of proinflammatory cytokines and neurotoxic reactive oxygen species and subsequent neurodegeneration. Interruption of Aβ binding to CD36 is a potential therapeutic strategy for AD. To identify pharmacologic inhibitors of Aβ binding to CD36, we developed a 384-well plate assay for binding of fluorescently labeled Aβ to Chinese hamster ovary cells stably expressing human CD36 (CHO-CD36) and screened an Food and Drug Administration-approved compound library. The assay was optimized based on the cells' tolerance to dimethyl sulfoxide, Aβ concentration, time required for Aβ binding, reproducibility, and signal-to-background ratio. Using this assay, we identified four compounds as potential inhibitors of Aβ binding to CD36. These compounds were ursolic acid, ellipticine, zoxazolamine, and homomoschatoline. Of these compounds, only ursolic acid, a naturally occurring pentacyclic triterpenoid, successfully inhibited binding of Aβ to CHO-CD36 cells in a dose-dependent manner. The ursolic acid effect reached a plateau at ∼20 μm, with a maximal inhibition of 64%. Ursolic acid also blocked binding of Aβ to microglial cells and subsequent ROS production. Our data indicate that cell-based high-content screening of small molecule libraries for their ability to block binding of Aβ to its receptors is a useful tool to identify novel inhibitors of receptors involved in AD pathogenesis. Our data also suggest that ursolic acid is a potential therapeutic agent for AD via its ability to block Aβ-CD36 interactions. PMID:21835916
A receptor binding assay for paralytic shellfish poisoning toxins: recent advances and applications.
Powell, C L; Doucette, G J
1999-01-01
We recently described a high throughput receptor binding assay for paralytic shellfish poisoning (PSP) toxins, the use of the assay for detecting toxic activity in shellfish and algal extracts, and the validation of 11-[3H]-tetrodotoxin as an alternative radioligand to the [3H]-saxitoxin conventionally employed in the assay. Here, we report a dramatic increase in assay efficiency through application of microplate scintillation technology, resulting in an assay turn around time of 4 h. Efforts are now focused on demonstrating the range of applications for which this receptor assay can provide data comparable to the more time consuming, technically demanding HPLC analysis of PSP toxins, currently the method of choice for researchers. To date, we have compared the results of both methods for a variety of sample types, including different genera of PSP toxin producing dinoflagellates (e.g. Alexandrium lusitanicum, r2 = 0.9834, n = 12), size-fractioned field samples of Alexandrium spp. (20-64 microm; r2 = 0.9997, n = 10) as well as its associated zooplankton grazer community (200-500 microm: r2 = 0.6169, n = 10; >500 microm: r2 = 0.5063, n = 10), and contaminated human fluids (r2 = 0.9661, n = 7) from a PSP outbreak. Receptor-based STX equivalent values for all but the zooplankton samples were highly correlated and exhibited close quantitative agreement with those produced by HPLC. While the PSP receptor binding assay does not provide information on toxin composition obtainable by HPLC, it does represent a robust and reliable means of rapidly assessing PSP-like toxicity in laboratory and field samples. Moreover, this assay should be effective as a screening tool for use by public health officials in responding to suspected cases of PSP intoxication.
NASA Technical Reports Server (NTRS)
Lynes, Michael A. (Inventor); Fernandez, Salvador M. (Inventor)
2010-01-01
An assay technique for label-free, highly parallel, qualitative and quantitative detection of specific cell populations in a sample and for assessing cell functional status, cell-cell interactions and cellular responses to drugs, environmental toxins, bacteria, viruses and other factors that may affect cell function. The technique includes a) creating a first array of binding regions in a predetermined spatial pattern on a sensor surface capable of specifically binding the cells to be assayed; b) creating a second set of binding regions in specific spatial patterns relative to the first set designed to efficiently capture potential secreted or released products from cells captured on the first set of binding regions; c) contacting the sensor surface with the sample, and d) simultaneously monitoring the optical properties of all the binding regions of the sensor surface to determine the presence and concentration of specific cell populations in the sample and their functional status by detecting released or secreted bioproducts.
DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuzuhara, T.; Suganuma, M.; Oka, K.
2007-11-03
Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less
Radioligand Recognition of Insecticide Targets.
Casida, John E
2018-04-04
Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.
Streptomyces coelicolor SCO4226 Is a Nickel Binding Protein
Jin, Hua; Zhang, Rong-Guang; Virolle, Marie-Joelle; Chen, Yuxing; Zhou, Cong-Zhao
2014-01-01
The open reading frame SCO4226 of Streptomyces coelicolor A3(2) encodes an 82-residue hypothetical protein. Biochemical assays revealed that each SCO4226 dimer binds four nickel ions. To decipher the molecular function, we solved the crystal structures of SCO4226 in both apo- and nickel-bound (Ni-SCO4226) forms at 1.30 and 2.04 Å resolution, respectively. Each subunit of SCO4226 dimer adopts a canonical ferredoxin-like fold with five β-strands flanked by two α-helices. In the structure of Ni-SCO4226, four nickel ions are coordinated at the surface of the dimer. Further biochemical assays suggested that the binding of Ni2+ triggers the self-aggregation of SCO4226 in vitro. In addition, RT-qPCR assays demonstrated that the expression of SCO4226 gene in S. coelicolor is specifically up-regulated by the addition of Ni2+, but not other divalent ions such as Cu2+, Mn2+ or Co2+. All these results suggested that SCO4226 acts as a nickel binding protein, probably required for nickel sequestration and/or detoxification. PMID:25285530
Sugiyama, Yuka; Ikeshita, Nobuko; Shibahara, Hiromi; Yamamoto, Daisuke; Kawagishi, Mayuko; Iguchi, Genzo; Iida, Keiji; Takahashi, Yutaka; Kaji, Hidesuke; Chihara, Kazuo; Okimura, Yasuhiko
2013-08-25
PROP1 mutation causes combined pituitary hormone deficiency (CPHD). Several mutations are located in a transactivation domain (TAD) of Prop1, and the loss of TAD binding to cofactors is likely the cause of CPHD. PROP1 cofactors have not yet been identified. In the present study, we aimed to identify the PROP1-interacting proteins from the human brain cDNA library. Using a yeast two-hybrid assay, we cloned nine candidate proteins that may bind to PROP1. Of those nine candidates, amino-terminal enhancer of split (AES) was the most abundant, and we analyzed the AES function. AES dose-dependently decreased the PROP1-induced Pit-1 reporter gene expression. An immunoprecipitation assay revealed the relationship between AES and PROP1. In a mammalian two-hybrid assay, a leucine zipper-like motif of the AES Q domain was identified as a region that interacted with TAD. These results indicated that AES was a corepressor of PROP1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.
2017-01-01
Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158
Structural Requirements For Bone Sialoprotein Binding And Modulation Of Matrix Metalloproteinase-2
Jain, Alka; Karadag, Abdullah; Fisher, Larry W.; Fedarko, Neal S.
2008-01-01
Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2′s propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation. PMID:18729384
Structural requirements for bone sialoprotein binding and modulation of matrix metalloproteinase-2.
Jain, Alka; Karadag, Abdullah; Fisher, Larry W; Fedarko, Neal S
2008-09-23
Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2's propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation.
Addressing matrix effects in ligand-binding assays through the use of new reagents and technology.
Chilewski, Shannon D; Mora, Johanna R; Gleason, Carol; DeSilva, Binodh
2014-04-01
Ligand-binding assays (LBAs) used in the quantification of biotherapeutics for pharmacokinetic determinations rely on interactions between reagents (antibodies or target molecule) and the biotherapeutic. Most LBAs do not employ an analyte extraction procedure and are susceptible to matrix interference. Here, we present a case study on the development of a LBA for the quantification of a PEGylated domain antibody where matrix interference was observed. The assay used to support the single ascending dose study was a plate-based electrochemiluminescent assay with a lower limit of quantification of 80 ng/mL. To meet sensitivity requirements of future studies, new reagents and the Gyrolab™ Workstation were evaluated. Assay sensitivity improved nearly threefold in the final method utilizing new antibody reagents, a buffer containing blockers to human anti-animal antibodies, and the Gyrolab Workstation. Experimental data indicate that all factors changed played a role in overcoming matrix effects.
Goussard, J
1998-10-23
The importance of the receptor level in breast cancer as an indicator of hormone response has been extensively studied for more than 20 years. Besides cytosol-based ligand-binding assays (dextran-coated charcoal assay, DCC), new methods using monoclonal antibodies raised against estrogen and progesterone receptors allow for the detection of receptors both in cytosol extracts (enzyme immunoassay, EIA) and in tissue sections (immunocytochemical assay, ICA). The biochemical assays (DCC and EIA) as well as the immunochemical detection (ICA) have specific qualities and produce original information which is useful for the therapeutic decision. While DCC gives a measure of the receptor level, whatever the real source of synthesis (normal and/or neoplastic tissue), ICA locates the positive cells and their relative proportion in the tumor. Both methods present their own advantages and disadvantages which are summarized in this study.
Cheow, Lih Feng; Viswanathan, Ramya; Chin, Chee-Sing; Jennifer, Nancy; Jones, Robert C; Guccione, Ernesto; Quake, Stephen R; Burkholder, William F
2014-10-07
Homogeneous assay platforms for measuring protein-ligand interactions are highly valued due to their potential for high-throughput screening. However, the implementation of these multiplexed assays in conventional microplate formats is considerably expensive due to the large amounts of reagents required and the need for automation. We implemented a homogeneous fluorescence anisotropy-based binding assay in an automated microfluidic chip to simultaneously interrogate >2300 pairwise interactions. We demonstrated the utility of this platform in determining the binding affinities between chromatin-regulatory proteins and different post-translationally modified histone peptides. The microfluidic chip assay produces comparable results to conventional microtiter plate assays, yet requires 2 orders of magnitude less sample and an order of magnitude fewer pipetting steps. This approach enables one to use small samples for medium-scale screening and could ease the bottleneck of large-scale protein purification.
Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong
2015-01-01
A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329
Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong
2015-07-16
A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.
Quantitation of proteins using a dye-metal-based colorimetric protein assay.
Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A
2009-02-15
We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.
Ho, C L; Li, C H
1985-03-01
Three synthetic analogs of human beta-endorphin (beta h-EP) (I, [Gln8, Gly31]-beta h-EP-Gly-Gly-NH2; II, [Arg9,12,24,28,29]-beta h-EP and III, [Cys11,26, Phe27, Gly31]-beta h-EP), which have been shown to possess potent inhibiting activity to beta h-EP-induced analgesia, were assayed in rat vas deferens and guinea pig ileum bioassay systems. In the rat vas deferens assay, relative potencies of these analogs were beta h-EP, 100; I, 30; II, 40; III, 1, whereas in the guinea pig ileum assay: beta h-EP, 100; I, 184; II, 81; III, 163. From previous studies on their analgesia potency in mice and opiate receptor-binding activity in rat brain membranes, their activity in rat vas deferens correlates well with the analgesic potency and the activity from guinea pig ileum assay shows good correlations with that from the opiate receptor-binding assay.
Naik, Subhashchandra; Kumru, Ozan S; Cullom, Melissa; Telikepalli, Srivalli N; Lindboe, Elizabeth; Roop, Taylor L; Joshi, Sangeeta B; Amin, Divya; Gao, Phillip; Middaugh, C Russell; Volkin, David B; Fisher, Mark T
2014-10-01
The ability of a GroEL-based bio-layer interferometry (BLI) assay to detect structurally altered and/or aggregated species of pharmaceutically relevant proteins is demonstrated. Assay development included optimizing biotinylated-GroEL immobilization to streptavidin biosensors, combined with biophysical and activity measurements showing native and biotinylated GroEL are both stable and active. First, acidic fibroblast growth factor (FGF-1) was incubated under conditions known to promote (40°C) and inhibit (heparin addition) molten globule formation. Heat exposed (40°C) FGF-1 exhibited binding to GroEL-biosensors, which was significantly diminished in the presence of heparin. Second, a polyclonal human IgG solution containing 6-8% non-native dimer showed an increase in higher molecular weight aggregates upon heating by size exclusion chromatography (SEC). The poly IgG solution displayed binding to GroEL-biosensors initially with progressively increased binding upon heating. Enriched preparations of the IgG dimers or monomers showed significant binding to GroEL-biosensors. Finally, a thermally treated IgG1 monoclonal antibody (mAb) solution also demonstrated increased GroEL-biosensor binding, but with different kinetics. The bound complexes could be partially to fully dissociated after ATP addition (i.e., specific GroEL binding) depending on the protein, environmental stress, and the assay's experimental conditions. Transmission electron microscopy (TEM) images of GroEL-mAb complexes, released from the biosensor, also confirmed interaction of bound complexes at the GroEL binding site with heat-stressed mAb. Results indicate that the GroEL-biosensor-BLI method can detect conformationally altered and/or early aggregation states of proteins, and may potentially be useful as a rapid, stability-indicating biosensor assay for monitoring the structural integrity and physical stability of therapeutic protein candidates. © 2014 The Protein Society.
De Souza, Melissa; Matthews, Hayden; Lee, Jodi A; Ranson, Marie; Kelso, Michael J
2011-04-15
Binding of the urokinase-type plasminogen activator (uPA) to its cell-surface-bound receptor uPAR and upregulation of the plasminogen activation system (PAS) correlates with increased metastasis and poor prognosis in several tumour types. Disruptors of the uPA:uPAR interaction represent promising anti-tumour/metastasis agents and several approaches have been explored for this purpose, including the use of small molecule antagonists. Two highly potent non-peptidic antagonists 1 and 2 (IC(50)1=0.8 nM, IC(50)2=33 nM) from the patent literature were reportedly identified using competition assays employing radiolabelled uPAR-binding uPA fragments and appeared as useful pharmacological tools for studying the PAS. Before proceeding to such studies, confirmation was sought that 1 and 2 retained their potencies in physiologically relevant cell-based competition assays employing uPAR's native binding partner high molecular weight uPA (HMW-uPA). This study describes a new solution phase synthesis of 1, a mixed solid/solution phase synthesis of 2 and reports the activities of 1 and 2 in semi-quantitative competition flow cytometry assays and quantitative cell-based uPA activity assays that employed HMW-uPA as the competing ligand. The flow cytometry experiments revealed that high concentrations of 2 (10-100 μM) are required to compete with HMW-uPA for uPAR binding and that 1 shows no antagonist effects at 100 μM. The cell-based enzyme activity assays similarly revealed that 1 and 2 are poor inhibitors of cell surface-bound HMW-uPA activity (IC(50) >100 μM for 1 and 2). The report highlights the dangers of identifying false-positive lead uPAR antagonists from competition assays employing labelled competing ligands other than the native HMW-uPA. Copyright © 2011 Elsevier Ltd. All rights reserved.
[Radiolabelling and assay of Chinese agkistrodon acutus venom with carrier-free Na 125I].
Gong, Y; Deng, C; Li, S; Li, L; Guan, J
1995-03-01
Chinese agkistroden acutus venom (CAAV) was radiolabelled with carrier-free Na 125I by the method of Iodogen. The specific activity and radiochemical purity for radiolabelled products were 4236.5 x 10(10) Bq/mmol and 98%, respectively. Each CAAV molecule carried 0.52 125I atom. Physical and chemical characterization of radiolabelled CAAV was similar to unradiolabelled CAAV. Binding analysis showed that 125I-CAAV was bound to platelet in a saturable manner. Binding sites per platelet were 13,255 +/- 6292/platelet. The dissociation constant (Kd) was 3.2 +/- 0.69 x 10(-10) mol/L. These results are similar to binding sites of other snake venom on platelet. The investigation showed that radiolabelled CAAV made by our laboratory was useful for radioligand binding assay.
Lefor Bradford, Julia
2015-01-01
This perspective article discusses key points to address in the establishment of sound partnerships between sponsors and bioanalytical CROs to assure the timeliness, quality and consistency of bioanalysis throughout biological therapeutic development. The performance of ligand-binding assays can be greatly impacted by low-grade reagents, lot-to-lot variability and lack of stability of the analyte in matrix, impacting both timelines and cost. Thorough characterization of the biologic of interest and its assay-enabling critical reagents will lend itself well to conservation of materials and continuity of assay performance. When unplanned events occur, such as performance declines or premature depletion of material, structured procedures are paramount to supplement the current loosely defined regulatory guidance on critical reagent characterization and method bridging.
Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L
2013-04-11
To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.
Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N
1981-01-01
The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676
Selb, R.; Eckl-Dorna, J.; Vrtala, S.; Valenta, R.; Niederberger, V.
2017-01-01
Background It has been shown that birch pollen immunotherapy can induce IgG antibodies which enhance IgE binding to Bet v 1. We aimed to develop a serological assay to predict the development of antibodies which enhance IgE binding to Bet v 1 during immunotherapy. Methods In 18 patients treated by Bet v 1-fragment-specific immunotherapy, the effects of IgG antibodies specific for the fragments on the binding of IgE antibodies to Bet v 1 were measured by ELISA. Blocking and possible enhancing effects on IgE binding were compared with skin sensitivity to Bet v 1 after treatment. Results We found that fragment-specific IgG enhanced IgE binding to Bet v 1 in two patients who also showed an increase of skin sensitivity to Bet v 1. Conclusion Our results indicate that it may be possible to develop serological tests which predict the induction of unfavourable IgG antibodies enhancing the binding of IgE to Bet v 1 during immunotherapy. PMID:23998344
In this work, a 96-well plate estrogen receptor binding assay was developed to facilitate the direct comparison of chemical binding to full-length recombinant estrogen receptors across vertebrate classes. Receptors were generated in a baculovirus expression system. This approach ...
Anti-DNA antibodies--quintessential biomarkers of SLE.
Pisetsky, David S
2016-02-01
Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.
Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook
2002-07-26
The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.
Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi
2015-08-04
It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.
Inhibition of HMGA2 binding to DNA by netropsin
Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David
2008-01-01
The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407
Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu
2013-05-01
The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.
NASA Astrophysics Data System (ADS)
Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang
2017-03-01
Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.
High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts
Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.
2009-01-01
Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738
Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J
2013-01-01
Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512
Wolf, Gabriele; Hessabi, Behnam; Karkour, Anke; Henrion, Ulrike; Dahlhaus, Meike; Ostmann, Annett; Giese, Bernd; Fraunholz, Martin; Grabarczyk, Piotr; Jack, Robert; Walther, Reinhard
2010-01-01
The transcriptional transactivator Pax6 binds the pancreatic islet cell-specific enhancer sequence (PISCES) of the rat insulin I gene. However the human, mouse, and rat insulin gene II promoters do not contain a PISCES element. To analyze the role of Pax6 in those PISCES-less promoters, we investigated its influence on rat insulin gene II expression and included in our studies the main activators: pancreatic and duodenal homeobox protein-1 (PDX-1) and BETA2/E47. Luciferase assays, Northern blots, and RIA were used to study effects of Pax6 overexpression, gel shift and chromatin precipitation assays to study its binding to the DNA, and yeast two-hybrid assays and glutathione S transferase capture assays to investigate its interactions with PDX-1 and BETA2. Finally, glucose-dependent intracellular transport of Pax6 was demonstrated by fluorescence microscopy. Overexpression of Pax6 prevents activation of the rat insulin II gene by BETA2 and PDX-1 and hence suppresses insulin synthesis and secretion. In vitro, Pax6 binds to the A-boxes, thereby blocking binding of PDX-1, and at the same time, its paired domain interacts with BETA2. Fluorescence microscopy demonstrated that the nuclear-cytoplasmic localization of Pax6 and PDX-1 are oppositely regulated by glucose. From the results, it is suggested that at low concentrations of glucose, Pax6 is localized in the nucleus and prevents the activation of the insulin gene by occupying the PDX-1 binding site and by interacting with BETA2. PMID:20943817
Agglutination Assays of the Plasmodium falciparum-Infected Erythrocyte.
Tan, Joshua; Bull, Peter C
2015-01-01
The agglutination assay is used to determine the ability of antibodies to recognize parasite variant antigens on the surface of Plasmodium falciparum-infected erythrocytes. In this technique, infected erythrocytes are selectively labelled with a DNA-binding fluorescent dye and mixed with antibodies of interest to allow antibody-surface antigen binding. Recognition of surface antigens by the antibodies can result in the formation of agglutinates containing multiple parasite-infected erythrocytes. These can be viewed and quantified using a fluorescence microscope.
Meng, Q.; Li, M.; Silberg, M.A.; Conrad, F.; Bettencourt, J.; To, R.; Huang, C.; Ma, J.; Meyer, K.; Shimizu, R.; Cao, L.; Tomic, M.T.; Marks, J.D.
2014-01-01
Quantitation of individual mAbs within a combined antibody drug product is required for preclinical and clinical drug development including pharmacokinetics (PK), toxicology, stability and biochemical characterization studies of such drugs. We have developed an antitoxin (XOMA 3AB) consisting of three recombinant monoclonal antibodies (mAbs) that potently neutralizes the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind non-overlapping BoNT/A epitopes with high affinity. XOMA3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from E. coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. MAb specific domains were used to develop an ELISA for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay was also developed that is robust to interference from components in serum and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that bind the same protein and is superior to anti-idiotype approaches. PMID:22037290
De Silva, Channa R.; Vagner, Josef; Lynch, Ronald; Gillies, Robert J.; Hruby, Victor J.
2010-01-01
Lanthanide-based luminescent ligand binding assays are superior to traditional radiolabel assays due to improved sensitivity and affordability in high throughput screening while eliminating the use of radioactivity. Despite significant progress using lanthanide(III)-coordinated chelators such as DTPA derivatives, dissociation-enhanced lanthanide fluoroimmunoassays (DELFIA) have not yet been successfully used with more stable chelators, e.g. DOTA derivatives, due to the incomplete release of lanthanide(III) ions from the complex. Here, a modified and an optimized DELFIA procedure incorporating an acid treatment protocol is introduced for use with Eu(III)-DOTA labeled peptides. Complete release of Eu(III) ions from DOTA labeled ligands was observed using hydrochloric acid (2.0 M) prior to the luminescent enhancement step. NDP-α-MSH labeled with Eu(III)-DOTA was synthesized and the binding affinity to cells overexpressing the human melanocortin-4 receptors (hMC4R) was evaluated using the modified protocol. Binding data indicate that the Eu(III)-DOTA linked peptide bound to these cells with an affinity similar to its DTPA analogue. The modified DELFIA procedure was further used to monitor the binding of an Eu(III)-DOTA labeled heterobivalent peptide to the cells expressing both hMC4R and CCK-2 (Cholecystokinin) receptors. The modified assay provides superior results and is appropriate for high-throughput screening of ligand libraries. PMID:19852924
miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.
Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie
2015-05-01
Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
NASA Astrophysics Data System (ADS)
Lin, Hong; Kitova, Elena N.; Klassen, John S.
2014-01-01
Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.
Estrogenicity of halogenated bisphenol A: in vitro and in silico investigations.
Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Yuan, Cuiping; Zhong, Shuning; Guan, Tianzhu; Li, Zhuolin; Wang, Yongzhi; Yu, Hansong; Luo, Quan; Wang, Yongjun; Zhang, Tiehua
2018-03-01
The binding interactions of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to human estrogen receptor α ligand binding domain (hERα-LBD) was investigated using a combined in vitro and in silico approach. First, the recombinant hERα-LBD was prepared as a soluble protein in Escherichia coli BL21(DE3)pLysS. A native fluorescent phytoestrogen, coumestrol, was employed as tracer for the fluorescence polarization assay. The results of the in vitro binding assay showed that bisphenol compounds could bind to hERα-LBD as the affinity ligands. All the tested halogenated BPAs exhibited weaker receptor binding than BPA, which might be explained by the steric effect of substituents. Molecular docking studies elucidated that the halogenated BPAs adopted different conformations in the flexible hydrophobic ligand binding pocket (LBP), which is mainly dependent on their distinct halogenation patterns. The compounds with halogen substituents on the phenolic rings and on the bridging alkyl moiety acted as agonists and antagonists for hERα, respectively. Interestingly, all the compounds in the agonist conformation of hERα formed a hydrogen bond with His524, while the compounds in the antagonist conformation formed a hydrogen bond with Thr347. These docking results suggested a pivotal role of His524/Thr347 in maintaining the hERα structure in the biologically active agonist/antagonist conformation. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation, which might be applicable for the structure-based design of novel bisphenol compounds with reduced toxicities and for environmental risk assessment. In addition, based on hERα-LBD as a recognition element, the proposed fluorescence polarization assay may offer an alternative to chromatographic techniques for the multi-residue determination of bisphenol compounds.
The development of a predictive model based upon a single aquatic species inevitably raises the question of whether this information is valid for other species. To partially address this question, relative binding affinities (RBA) for six alkylphenols (para-substituted, n- and b...
Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria
2012-01-01
The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282
Darwish, Ibrahim A; Al-Obaid, Abdul-Rahman M; Al-Malaq, Hamoud A
2009-11-15
For the first time, an enzyme-linked immunosorbent assay (ELISA) has been developed and validated for the determination of fluvastatin (FLV) in plasma samples at picogram level. The assay employed a polyclonal antibody that specifically recognizes FLV with high affinity, and FLV conjugate of bovine serum albumin (FLV-BSA) immobilized onto microplate wells as a solid-phase. The assay involved a competitive binding reaction between FLV, in plasma sample, and the immobilized FLV-BSA for the binding sites on a limited amount of the anti-FLV antibody. The bound anti-FLV antibody was quantified with horseradish peroxidase-labeled second anti-rabbit IgG antibody (HRP-IgG) and 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate for the peroxidase enzyme. The concentration of FLV in the sample was quantified by its ability to inhibit the binding of the anti-FLV antibody to the immobilized FLV-BSA and subsequently the color intensity in the assay wells. The conditions for the proposed ELISA were investigated and the optimum conditions were employed in the determination of FLV in plasma samples. The assay limit of detection was 10 pg mL(-1) and the effective working range at relative standard deviations (RSD) of
76 FR 4920 - Government-Owned Inventions; Availability for Licensing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-27
... appear to be distinct from each other. Available for licensing is a Plk1 ELISA assay using peptide... binding property, an easy and reliable ELISA assay has been developed to quantify Plk1 expression levels... sequence. ELISA assay to quantify Plk1 expression and kinase activity. Advantages: Rapid, highly sensitive...
Edwards, Katie A; Baeumner, Antje J
2013-03-05
A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
ARIMURA, A.; SATO, H.; KUMASAKA, T.
1973-11-01
Repeated injections of synthetic LH -- RH decapeptide, adsorbed on polyvinylpyrrolidone and emulsified with complete Freund's adjuvant, resulted in the production of a specific antiserum to LH-- RH in two of three rabbits. The animals that produced this antiserum showed a reduction of pituitary LH content and marked atrophy of the testes. The antiserum-antibody complex was detected by the complement flxation test. The antiserum was capable of binding /sup 125/I- labeled LH--RH. After iodination of LHRH (using /sup 125/I and either the chloramine T or lactoperoxidase method) separation of the iodination products on CMC yielded three main peaks of radioactivity:more » The first was free iodide, the second was labeled peptide with low immunoreactivity, and the third was immunoreactive peptide. This 3rd peak consisted of two or three subpeaks; the leading subpeak(s) were more readily bound by antiserum than the trailing one(s). Binding of these fractions to antiserum was increased in the presence of small amounts of unlabeled LH--RH (a phenomenon called paradoxical binding or hock effect) but inhibited by larger amounts. Both the augmentation and the inhibition effects were dose-related, allowing the development of two different radioimmunoassay (RIA) systems for LH--RH. An ordinary (coinpetitive) type of RIA was developed in which a small amount (0.31 ng/assay tube) of unlabeled LH-- RH was added to the labeled peptide. This saturated the antiserum's capacity for paradoxical binding, so that further addition of LH-- RH (from 0.04 to 2.5 ng/ tube) inhibited binding of labeled LH--RH. The assay developed using paradoxical binding omitted the premixing of labeled and unlabeled LH--RH; in this assay addition of very small amounts (0.5 to 310 pg) of unlabeled LH--RH to the assay tubes increased the amount of label bound to antiserum and allowed construction of a parabolic curve of positive slope when B/T was plotted against arithmetic dose. The assays seem to be highly specific for LH--RH although both polymers and degradation products of LH--RH appeared to have some immunoreactivity.« less
A flurorometric screening method was used to estimate total polycyclic aromatic hydrocarbon concentrations in sediments collected from the St. Louis River Area of Concern in northeastern Minnesota. Sediments were collected as part of a Regional Environmental Monitoring and Asses...
FORTRAN PROCESSING OF FLUOROMETRIC DATA LOGGED BY A TURNER DESIGNS FIELD FLUOROMETER
Continuous recording of dye fluorescence using field fluorometers at selected sampling sites facilitate acquisition of real-time dye-tracing data. The Turner Designs Model 10-AU-005 Field Fluorometer allows for frequent fluorescence readings, data logging, and easy downloading t...
Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.
Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio
2009-08-13
Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.
Wad, N; Krämer, G
1998-01-23
Serum concentrations of the antiepileptic drug gabapentin (GBP) are usually determined by high-performance liquid chromatography (HPLC) using UV photometric detection after pre-column derivatization with 2,4,6-trinitrobenzenesulphonic acid. Vigabatrin levels in serum are determined by HPLC using fluorescence detection. Like vigabatrin (VGB), gabapentin has also a primary amine group that easily reacts with o-phthaldialdehyde reagent and produces a fluorescing substance. By the use of fluorometric detection, GBP can be determined more simply, sensitively and simultaneously with VGB. The day-to-day coefficient of variation for the determination of GBP in a pooled serum was 4.0% (n=17; serum concentration, 13.8 micromol/l) and forVGB was 3.1% (n=21; serum concentration, 26.4 micromol/l). The lower limit of detection is 0.5 micromol/l for both drugs and the method is linear up to 500 micromol/l for GBP and 1300 micromol/l for VGB.
Fluorometric determination of histamine in cheese.
Chambers, T L; Staruszkiewicz, W F
1978-09-01
Thirty-one samples of cheese obtained from retail outlets were analyzed for histamine, using an official AOAC fluorometric method. The types of cheese analyzed and the ranges of histamine found were: colby, 0.3--2.8; camembert, 0.4--4.2; cheddar, 1.2--5.8; gouda, 1.3--2.4; provolone, 2.0--23.5; roquefort, 1.0--16.8; mozzarella 1.6--5.0; and swiss, 0.4--250 mg histamine/100 g. Ten of the 12 samples of swiss cheese contained less than 16 mg histamine/100 g. The remaining 2 samples which contained 116 and 250 mg histamine/100 g were judged organoleptically to be of poor quality. An investigation of one processing facility showed that the production of histamine in swiss cheese may have been a result of a hydrogen peroxide/low temperature treatment of the milk supply. Recovery of histamine added to methanol extracts of cheese ranged from 93 to 105%. Histamine content was confirmed by high pressure liquid chromatographic analysis of the methanol extracts.
Yasuda, Makoto; Ota, Tatsuhiro; Morikawa, Atsushi; Mawatari, Ken-ichi; Fukuuchi, Tomoko; Yamaoka, Noriko; Kaneko, Kiyoko; Nakagomi, Kazuya
2013-09-01
A simple and rapid method for the simultaneous determination of serum nicotine and cotinine using high-performance liquid chromatography (HPLC)-fluorometric detection with a postcolumn ultraviolet-photoirradiation system was developed. Analytes were extracted from alkalinized human serum via liquid-liquid extraction using chloroform. The organic phase was back-extracted with the acidified aqueous phase, and the analytes were directly injected into an ion-pair reversed-phase HPLC system. 6-Aminoquinoline was used as an internal standard. Nicotine, cotinine, and 6-aminoquinoline were separated within 14min. The extraction efficiency of nicotine and cotinine was greater than 91%. The linear range was 0.30-1000ng for nicotine and 0.06-1000ng for cotinine. In serum samples from smokers, the concentrations of nicotine and cotinine were 8-15ng/mL and 156-372ng/mL, respectively. Copyright © 2013 Elsevier B.V. All rights reserved.
Fluorometric determination of zirconium in minerals
Alford, W.C.; Shapiro, L.; White, C.E.
1951-01-01
The increasing use of zirconium in alloys and in the ceramics industry has created renewed interest in methods for its determination. It is a common constituent of many minerals, but is usually present in very small amounts. Published methods tend to be tedious, time-consuming, and uncertain as to accuracy. A new fluorometric procedure, which overcomes these objections to a large extent, is based on the blue fluorescence given by zirconium and flavonol in sulfuric acid solution. Hafnium is the only element that interferes. The sample is fused with borax glass and sodium carbonate and extracted with water. The residue is dissolved in sulfuric acid, made alkaline with sodium hydroxide to separate aluminum, and filtered. The precipitate is dissolved in sulfuric acid and electrolysed in a Melaven cell to remove iron. Flavonol is then added and the fluorescence intensity is measured with a photo-fluorometer. Analysis of seven standard mineral samples shows excellent results. The method is especially useful for minerals containing less than 0.25% zirconium oxide.
Fluorometric Index for Sensing Oil in the Sea Environment.
Baszanowska, Emilia; Otremba, Zbigniew
2017-06-02
Excitation-emission matrix spectroscopy (EEMS) was applied to determine the fluorometric index (FI) as a parameter indicating the presence of a source of oil pollution in a specific area of the sea. Seawater from the Polish coast (the Baltic Sea) and the same water combined with various amounts of crude oil extracted from the Baltic Sea shelf ( Petrobaltic -type oil) were used in this study. The FI values were calculated for excitation and emission wavelengths found at the maximal peak, taking into account the natural seawater and the seawater artificially contaminated (for an oil-to-water ratio range of 0.5 × 10 -6 - 500 × 10 -6 ). The wavelength configurations (Ex/Em) (225/355 and 225/340) for the FI index were applied. It was found that, independent of the amount of oil, the FI achieves a higher value for natural seawater than for seawater that has had contact with oil. These results provide the basis to design a sensor signaling the appearance of oil in a defined sea area.
Parker, Lauren; Wharton, Stephen A; Martin, Stephen R; Cross, Karen; Lin, Yipu; Liu, Yan; Feizi, Ten; Daniels, Rodney S; McCauley, John W
2016-06-01
Influenza A virus (subtype H3N2) causes seasonal human influenza and is included as a component of influenza vaccines. The majority of vaccine viruses are isolated and propagated in eggs, which commonly results in amino acid substitutions in the haemagglutinin (HA) glycoprotein. These substitutions can affect virus receptor-binding and alter virus antigenicity, thereby, obfuscating the choice of egg-propagated viruses for development into candidate vaccine viruses. To evaluate the effects of egg-adaptive substitutions seen in H3N2 vaccine viruses on sialic acid receptor-binding, we carried out quantitative measurement of virus receptor-binding using surface biolayer interferometry with haemagglutination inhibition (HI) assays to correlate changes in receptor avidity with antigenic properties. Included in these studies was a panel of H3N2 viruses generated by reverse genetics containing substitutions seen in recent egg-propagated vaccine viruses and corresponding cell culture-propagated wild-type viruses. These assays provide a quantitative approach to investigating the importance of individual amino acid substitutions in influenza receptor-binding. Results show that viruses with egg-adaptive HA substitutions R156Q, S219Y, and I226N, have increased binding avidity to α2,3-linked receptor-analogues and decreased binding avidity to α2,6-linked receptor-analogues. No measurable binding was detected for the viruses with amino acid substitution combination 156Q+219Y and receptor-binding increased in viruses where egg-adaptation mutations were introduced into cell culture-propagated virus. Substitutions at positions 156 and 190 appeared to be primarily responsible for low reactivity in HI assays with post-infection ferret antisera raised against 2012-2013 season H3N2 viruses. Egg-adaptive substitutions at position 186 caused substantial differences in binding avidity with an insignificant effect on antigenicity.
Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan
2016-01-01
With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072
Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System.
Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke
2015-01-19
We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step.
Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System
Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke
2015-01-01
We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step. PMID:25607476
NASA Astrophysics Data System (ADS)
Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.
2003-09-01
A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.
What Do Chaotrope-Based Avidity Assays for Antibodies to HIV-1 Envelope Glycoproteins Measure?
Alexander, Marina R.; Ringe, Rajesh; Sanders, Rogier W.; Voss, James E.; Moore, John P.
2015-01-01
ABSTRACT When HIV-1 vaccine candidates that include soluble envelope glycoproteins (Env) are tested in humans and other species, the resulting antibody responses to Env are sifted for correlates of protection or risk. One frequently used assay measures the reduction in antibody binding to Env antigens by an added chaotrope (such as thiocyanate). Based on that assay, an avidity index was devised for assessing the affinity maturation of antibodies of unknown concentration in polyclonal sera. Since a high avidity index was linked to protection in animal models of HIV-1 infection, it has become a criterion for evaluating antibody responses to vaccine candidates. But what does the assay measure and what does an avidity index mean? Here, we have used a panel of monoclonal antibodies to well-defined epitopes on Env (gp120, gp41, and SOSIP.664 trimers) to explore how the chaotrope acts. We conclude that the chaotrope sensitivity of antibody binding to Env depends on several properties of the epitopes (continuity versus tertiary- and quaternary-structural dependence) and that the avidity index has no simple relationship to antibody affinity for functional Env spikes on virions. We show that the binding of broadly neutralizing antibodies against quaternary-structural epitopes is particularly sensitive to chaotrope treatment, whereas antibody binding to epitopes in variable loops and to nonneutralization epitopes in gp41 is generally resistant. As a result of such biases, the avidity index may at best be a mere surrogate for undefined antibody or other immune responses that correlate weakly with protection. IMPORTANCE An effective HIV-1 vaccine is an important goal. Such a vaccine will probably need to induce antibodies that neutralize typically transmitted variants of HIV-1, preventing them from infecting target cells. Vaccine candidates have so far failed to induce such antibody responses, although some do protect weakly against infection in animals and, possibly, humans. In the search for responses associated with protection, an avidity assay based on chemical disruption is often used to measure the strength of antibody binding. We have analyzed this assay mechanistically and found that the epitope specificity of an antibody has a greater influence on the outcome than does its affinity. As a result, the avidity assay is biased toward the detection of some antibody specificities while disfavoring others. We conclude that the assay may yield merely indirect correlations with weak protection, specifically when Env vaccination has failed to induce broad neutralizing responses. PMID:25810537
Schwartz, F; Hadas, E; Harnik, M; Solomon, B
1990-01-01
Two enzyme-linked immunosorbent assays were established and compared for the estimation of plasma aldosterone. In the first method immobilized aldosterone-protein complexes on the ELISA plates compete with aldosterone to be determined for the binding of certain amount of anti-aldosterone antibodies. The sensitivity of this method depends on the protein carrier used to conjugate with aldosterone. In the second method, anti-aldosterone antibodies adsorbed on ELISA plates compete for binding of known amount of the enzyme-labeled aldosterone and aldosterone to be determined. The highly specific rabbit anti-aldosterone antibodies were obtained by injection of aldosterone-oxime thyroglobulin. The detection limit of aldosterone in both methods ranged between 2-20 pg. The proposed assays are suitable for the determination of aldosterone in biological fluids compared with other reported ELISA assays, as well as with RIA.
Production and assay of forskolin antibodies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, L.T.; Ho, R.J.
1986-05-01
Forskolin (Fo), a cardiovascular active diterpene of plant origin, has been widely used as a research tool in regulation of the catalytic activity of adenylate cyclase (AC). A linear relationship of Fo binding to plasma membrane with activation of AC has been reported. The present abstract describes the production and assay of Fo antibodies (AB). 7-0-Hemisuccinyl-7-deacetyl Fo, coupled to either human serum albumin or goat IgG, was injected into goats to elicit AB to Fo haptan. AB to Fo in antiserum or an isolated IgG fraction was tested by two assay methods, a radioimmunoassay using /sup 3/H-Fo as a tracermore » and a colorimetric enzyme-linked immunosorbent assay (ELISA) using horse radish peroxidase-rabbit anti goat IgG as indicator. The titers for Fo antiserum were 4000-10,000. In the defined assay condition, approximately 20-25% of the added /sup 3/H-Fo was found to bind to AB. The bound radioactivity was displaced by Fo-HSA or Fo-goat IgG or free unlabelled Fo ranging from 0.5-50 pmol/tube, or 5-500 nM. The IC/sub 50/ was approximately 8-10 pmol/tube or 80-100 nM. The binding of HRP-rabbit anti goat IgG in the ELISA was inhibited by proper Fo conjugate. The development of methods for production and assay for Fo AB may be useful in the study of mechanism of activation of AC by Fo and Fo-like compound.« less
Guo, Dong; Mulder-Krieger, Thea; IJzerman, Adriaan P; Heitman, Laura H
2012-01-01
BACKGROUND AND PURPOSE The adenosine A2A receptor belongs to the superfamily of GPCRs and is a promising therapeutic target. Traditionally, the discovery of novel agents for the A2A receptor has been guided by their affinity for the receptor. This parameter is determined under equilibrium conditions, largely ignoring the kinetic aspects of the ligand-receptor interaction. The aim of this study was to assess the binding kinetics of A2A receptor agonists and explore a possible relationship with their functional efficacy. EXPERIMENTAL APPROACH We set up, validated and optimized a kinetic radioligand binding assay (a so-called competition association assay) at the A2A receptor from which the binding kinetics of unlabelled ligands were determined. Subsequently, functional efficacies of A2A receptor agonists were determined in two different assays: a novel label-free impedance-based assay and a more traditional cAMP determination. KEY RESULTS A simplified competition association assay yielded an accurate determination of the association and dissociation rates of unlabelled A2A receptor ligands at their receptor. A correlation was observed between the receptor residence time of A2A receptor agonists and their intrinsic efficacies in both functional assays. The affinity of A2A receptor agonists was not correlated to their functional efficacy. CONCLUSIONS AND IMPLICATIONS This study indicates that the molecular basis of different agonist efficacies at the A2A receptor lies within their different residence times at this receptor. PMID:22324512
Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).
Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M
2015-02-21
This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.
Wyant, Tim; Estevam, Jose; Yang, Lili; Rosario, Maria
2016-03-01
Vedolizumab is a monoclonal antibody approved for use in ulcerative colitis and Crohn's disease. By specifically binding to α4 β7 integrin, vedolizumab prevents trafficking of lymphocytes to the gut, thereby interfering with disease pathology. During the clinical development program, the pharmacodynamic effect of vedolizumab was evaluated by 2 flow cytometry receptor occupancy assays: act-1 (ACT-1) and mucosal addressin cell adhesion molecule-1 (MAdCAM-1). Here we describe the development and validation of these assays. The ACT-1 assay is a receptor occupancy free-site assay that uses a monoclonal antibody with the same binding epitope as vedolizumab to detect free (unbound) sites on α4 β7 integrin. The MAdCAM-1 assay used a soluble version of the natural ligand for α4 β7 integrin to detect free sites. The assays were validated using a fit-for-purpose approach throughout the clinical development of vedolizumab. Both the ACT-1 assay and the MAdCAM-1 assay demonstrated acceptable reproducibility and repeatability. The assays were sufficiently stable to allow for clinical use. During clinical testing the assays demonstrated that vedolizumab was able to saturate peripheral cells at all doses tested. Two pharmacodynamic receptor occupancy assays were developed and validated to assess the effect of vedolizumab on peripheral blood cells. The results of these assays demonstrated the practical use of flow cytometry to examine pharmacodynamic response in clinical trials. © 2015 International Clinical Cytometry Society.
Krasitskaya, V V; Korneeva, S I; Kudryavtsev, A N; Markova, S V; Stepanyuk, G A; Frank, L A
2011-11-01
The recombinant Ca(2+)-triggered coelenterazine-binding protein (CBP) from Renilla muelleri was investigated as a biospecifically labeled molecule for in vitro assay applications. The protein was shown to be stable in solutions in the frozen state, as well as stable under heating and to chemical modifications. Conjugates with biotin, oligonucleotide, and proteins were obtained and applied as biospecific molecules in a solid-phase microassay. CBP detection was performed with intact (no modifications were made) Renilla luciferase in the presence of calcium, and the detection limit was found to be 75 amol. Model experiments indicate that this approach shows much promise, especially with regard to the development of multianalytical systems.
Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.
Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D
1980-04-01
Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency.
Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.
Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D
1980-01-01
Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency. PMID:6246537
Le Saux, Thomas; Hisamoto, Hideaki; Terabe, Shigeru
2006-02-03
Measurement of binding constant by chip electrophoresis is a very promising technique for the high throughput screening of non-covalent interactions. Among the different electrophoretic methods available that yield the binding parameters, continuous frontal analysis is the most appropriate for a transposition from capillary electrophoresis (CE) to microchip electrophoresis. Implementation of this methodology in microchip was exemplified by the measurement of inclusion constants of 2-naphtalenesulfonate and neutral phenols (phenol, 4-chlorophenol and 4-nitrophenol) into beta-cyclodextrin by competitive assays. The issue of competitor choice is discussed in relation to its appropriateness for proper monitoring of the interaction.
Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.
2017-09-19
Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.
Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.
2017-07-11
Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.
Detection of molecular interactions
Groves, John T [Berkeley, CA; Baksh, Michael M [Fremont, CA; Jaros, Michal [Brno, CH
2012-02-14
A method and assay are described for measuring the interaction between a ligand and an analyte. The assay can include a suspension of colloidal particles that are associated with a ligand of interest. The colloidal particles are maintained in the suspension at or near a phase transition state from a condensed phase to a dispersed phase. An analyte to be tested is then added to the suspension. If the analyte binds to the ligand, a phase change occurs to indicate that the binding was successful.
Targeting the UPR to Circumvent Endocrine Resistance in Breast Cancer
2015-10-01
were submitted for the screen. Kinase assay protocol (DiscoverX): For most assays, kinase-tagged T7 phage strains were grown in parallel in 24-well...blocks in an E. coli host derived from the BL21 strain. E. coli were grown to log-phase and infected with T7 phage from a frozen stock (multiplicity of...unbound ligand and to reduce non-specific phage binding. Binding reactions were assembled by combining kinases, liganded affinity beads, and test
Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E
2016-11-01
Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.
Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun
2017-03-16
Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.
Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R
2017-03-01
Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caselli, G.; Ferrari, M.P.; Tonon, G.
1991-02-01
A sensitive method for the quantitation of small amounts of nuvenzepine, a new M1-selective antimuscarinic drug, in plasma is described. The analytical method involves the use of a radioreceptor binding assay based on {sup 3}Hpirenzepine displacement in rat cerebral cortex homogenates; no previous extraction is required. The method is reliable, with an interassay CV ranging from 5 to 10%, and allows the analysis of greater than 100 samples/experiment. The limit of detection is {approximately} 0.1 ng/assay. Using this method we have determined the plasma levels of nuvenzepine in eight healthy volunteers treated PO with 15 or 25 mg of nuvenzepine.HCl.more » The pharmacokinetic parameters obtained were (for 15 and 25 mg): Cmax, 64 and 131 ng/mL; AUC0-infinity, 851 and 1379 ng.h/mL; t1/2, 8.6 and 7.2 h. These values are in good agreement with those obtained using an HPLC method. Therefore, this radioreceptor binding assay proved to be simple, rapid, and specific for the determination of low levels of nuvenzepine in human plasma.« less
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Acetylcholinesterase affinity-based screening assay on Lippia gracilis Schauer extracts.
Vanzolini, K L; da F Sprenger, R; Leme, G M; de S Moraes, V R; Vilela, A F L; Cardoso, C L; Cass, Q B
2018-05-10
The use of affinity-based protein assay produced by covalently linking acetylcholinesterase to magnetic beads, followed by chemical characterization of the selective binders using Liquid Chromatography with tandem High-Resolution Mass Spectrometry (LC-HRMS) is herein described for profiling crude aqueous natural product extracts. The fishing assay was first modulated using galanthamine as a reference ligand and then, the assay condition was adjusted for the aqueous leaves extracts obtained from Lippia gracilis Schauer (genotype 201) that was used as the natural combinatory library. From the experiments, a selective binder has been undisclosed with an accurate mass of 449.1131 m/z and identified as eriodictyol 2'-O-glucoside or eriodictyol 3'-O-glucoside. The selectivity of the binding assay was demonstrated, as much as, that erydictiol 7-O-glucoside was not fished, although it was present in the crude aqueous extract. The binding assay platform exhibited high specificity and did not require any sample pretreatment, making it appropriate for profiling binders at natural libraries. Copyright © 2018 Elsevier B.V. All rights reserved.
Quantifying domain-ligand affinities and specificities by high-throughput holdup assay
Vincentelli, Renaud; Luck, Katja; Poirson, Juline; Polanowska, Jolanta; Abdat, Julie; Blémont, Marilyne; Turchetto, Jeremy; Iv, François; Ricquier, Kevin; Straub, Marie-Laure; Forster, Anne; Cassonnet, Patricia; Borg, Jean-Paul; Jacob, Yves; Masson, Murielle; Nominé, Yves; Reboul, Jérôme; Wolff, Nicolas; Charbonnier, Sebastian; Travé, Gilles
2015-01-01
Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this aim, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to a thousand domain-motif equilibrium binding affinities per day. Extracts of overexpressed domains are incubated with peptide-coated resins and subjected to filtration. Binding affinities are deduced from microfluidic capillary electrophoresis of flow-throughs. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from Human Papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human PDZome. We obtained exquisite sequence-dependent binding profiles, describing quantitatively the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has a wide potential for quantifying the specificities of interactomes. PMID:26053890
Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.
2011-01-01
SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502
Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry
NASA Astrophysics Data System (ADS)
Song, Hong Yan; Su, Xiaodi
In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.
Exploring blocking assays using Octet, ProteOn, and Biacore biosensors.
Abdiche, Yasmina N; Malashock, Dan S; Pinkerton, Alanna; Pons, Jaume
2009-03-15
We demonstrate the use of label-free real-time optical biosensors in competitive binding assays by epitope binning a panel of antibodies. We describe three assay orientations that we term in tandem, premix, and classical sandwich blocking, and we perform each of them on three platforms: ForteBio's Octet QK, Bio-Rad's ProteOn XPR36, and GE Healthcare's Biacore 3000. By testing whether antibodies block one another's binding to their antigen in a pairwise fashion, we establish a blocking profile for each antibody relative to the others in the panel. The blocking information is then used to create "bins" of antibodies with similar epitopes. The advantages and disadvantages of each biosensor, factors to consider when deciding on the most appropriate blocking assay orientation for a particular interaction system, and tips for dealing with ambiguous data are discussed. The data from our different assay orientations and biosensors agree very well, establishing these machines as valuable tools for characterizing antibody epitopes and multiprotein complexes of biological significance.
Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P
2007-11-01
Rimonabant (Acomplia, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPgammaS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPgammaS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist.
Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P
2007-01-01
Background and purpose: Rimonabant (AcompliaTM, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. Experimental approach: A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPγS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. Key results: In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPγS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. Conclusions and implications: PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist. PMID:17592509
Lytton, Simon David; Schluter, Anke; Banga, Paul J
2018-06-01
Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.
Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A
2005-06-01
Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.
Flavonoid Regulation of HCN2 Channels*
Carlson, Anne E.; Rosenbaum, Joel C.; Brelidze, Tinatin I.; Klevit, Rachel E.; Zagotta, William N.
2013-01-01
The hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels are pacemaker channels whose currents contribute to rhythmic activity in the heart and brain. HCN channels open in response to hyperpolarizing voltages, and the binding of cAMP to their cyclic nucleotide-binding domain (CNBD) facilitates channel opening. Here, we report that, like cAMP, the flavonoid fisetin potentiates HCN2 channel gating. Fisetin sped HCN2 activation and shifted the conductance-voltage relationship to more depolarizing potentials with a half-maximal effective concentration (EC50) of 1.8 μm. When applied together, fisetin and cAMP regulated HCN2 gating in a nonadditive fashion. Fisetin did not potentiate HCN2 channels lacking their CNBD, and two independent fluorescence-based binding assays reported that fisetin bound to the purified CNBD. These data suggest that the CNBD mediates the fisetin potentiation of HCN2 channels. Moreover, binding assays suggest that fisetin and cAMP partially compete for binding to the CNBD. NMR experiments demonstrated that fisetin binds within the cAMP-binding pocket, interacting with some of the same residues as cAMP. Together, these data indicate that fisetin is a partial agonist for HCN2 channels. PMID:24085296
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
NASA Astrophysics Data System (ADS)
Woods, Christopher J.; Malaisree, Maturos; Long, Ben; McIntosh-Smith, Simon; Mulholland, Adrian J.
2013-12-01
The emergence of a novel H7N9 avian influenza that infects humans is a serious cause for concern. Of the genome sequences of H7N9 neuraminidase available, one contains a substitution of arginine to lysine at position 292, suggesting a potential for reduced drug binding efficacy. We have performed molecular dynamics simulations of oseltamivir, zanamivir and peramivir bound to H7N9, H7N9-R292K, and a structurally related H11N9 neuraminidase. They show that H7N9 neuraminidase is structurally homologous to H11N9, binding the drugs in identical modes. The simulations reveal that the R292K mutation disrupts drug binding in H7N9 in a comparable manner to that observed experimentally for H11N9-R292K. Absolute binding free energy calculations with the WaterSwap method confirm a reduction in binding affinity. This indicates that the efficacy of antiviral drugs against H7N9-R292K will be reduced. Simulations can assist in predicting disruption of binding caused by mutations in neuraminidase, thereby providing a computational `assay.'
Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Ruan, Ping; Ren, Dayong; Dai, Weichang; Yu, Hansong; Li, Tiezhu
2017-08-01
A fluorescence polarization (FP) assay for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) was developed. The method was based on the competition between bisphenols (BPs) and fluorescein-labeled dexamethasone derivative (Dex-fl) for mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD). A recombinant soluble protein derivative mPPARα-LBD* was prepared, then in vitro binding of 4 BPs to mPPARα-LBD* was investigated. Fluorescence polarization assay showed that these compounds exhibited different binding potencies with mPPARα-LBD*. Additionally, molecular dynamics simulations were performed to further understand the mechanism of BPs binding affinity for mPPARα-LBD*. Docking results elucidated that the driving forces for the binding of BPs to mPPARα-LBD* were predominantly dependent on hydrophobic and hydrogen-bonding interactions. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2 = 0.7258). The proposed method has potential for multi-residue detection of BPA, BPF, BADGE, and BFDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.
Characterization of the receptor-binding domain of Ebola glycoprotein in viral entry.
Wang, Jizhen; Manicassamy, Balaji; Caffrey, Michael; Rong, Lijun
2011-06-01
Ebola virus infection causes severe hemorrhagic fever in human and non-human primates with high mortality. Viral entry/infection is initiated by binding of glycoprotein GP protein on Ebola virion to host cells, followed by fusion of virus-cell membrane also mediated by GP. Using an human immunodeficiency virus (HIV)-based pseudotyping system, the roles of 41 Ebola GP1 residues in the receptor-binding domain in viral entry were studied by alanine scanning substitutions. We identified that four residues appear to be involved in protein folding/structure and four residues are important for viral entry. An improved entry interference assay was developed and used to study the role of these residues that are important for viral entry. It was found that R64 and K95 are involved in receptor binding. In contrast, some residues such as I170 are important for viral entry, but do not play a major role in receptor binding as indicated by entry interference assay and/or protein binding data, suggesting that these residues are involved in post-binding steps of viral entry. Furthermore, our results also suggested that Ebola and Marburg viruses share a common cellular molecule for entry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.
2015-01-01
The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less
Niescierowicz, Katarzyna; Caro, Lydia; Cherezov, Vadim; Vivaudou, Michel; Moreau, Christophe J
2014-01-07
Structural studies of G protein-coupled receptors (GPCRs) extensively use the insertion of globular soluble protein domains to facilitate their crystallization. However, when inserted in the third intracellular loop (i3 loop), the soluble protein domain disrupts their coupling to G proteins and impedes the GPCRs functional characterization by standard G protein-based assays. Therefore, activity tests of crystallization-optimized GPCRs are essentially limited to their ligand binding properties using radioligand binding assays. Functional characterization of additional thermostabilizing mutations requires the insertion of similar mutations in the wild-type receptor to allow G protein-activation tests. We demonstrate that ion channel-coupled receptor technology is a complementary approach for a comprehensive functional characterization of crystallization-optimized GPCRs and potentially of any engineered GPCR. Ligand-induced conformational changes of the GPCRs are translated into electrical signal and detected by simple current recordings, even though binding of G proteins is sterically blocked by the added soluble protein domain. Copyright © 2014 Elsevier Ltd. All rights reserved.
Hong, Huixiao; Branham, William S; Ng, Hui Wen; Moland, Carrie L; Dial, Stacey L; Fang, Hong; Perkins, Roger; Sheehan, Daniel; Tong, Weida
2015-02-01
One endocrine disruption mechanism is through binding to nuclear receptors such as the androgen receptor (AR) and estrogen receptor (ER) in target cells. The concentration of a chemical in serum is important for its entry into the target cells to bind the receptors, which is regulated by the serum proteins. Human sex hormone-binding globulin (SHBG) is the major transport protein in serum that can bind androgens and estrogens and thus change a chemical's availability to enter the target cells. Sequestration of an androgen or estrogen in the serum can alter the chemical elicited AR- and ER-mediated responses. To better understand the chemical-induced endocrine activity, we developed a competitive binding assay using human pregnancy plasma and measured the binding to the human SHBG for 125 structurally diverse chemicals, most of which were known to bind AR and ER. Eighty seven chemicals were able to bind the human SHBG in the assay, whereas 38 chemicals were nonbinders. Binding data for human SHBG are compared with that for rat α-fetoprotein, ER and AR. Knowing the binding profiles between serum and nuclear receptors will improve assessment of a chemical's potential for endocrine disruption. The SHBG binding data reported here represent the largest data set of structurally diverse chemicals tested for human SHBG binding. Utilization of the SHBG binding data with AR and ER binding data could enable better evaluation of endocrine disrupting potential of chemicals through AR- and ER-mediated responses since sequestration in serum could be considered. Published by Oxford University Press on behalf of the Society of Toxicology 2014. This work is written by US Government employees and is in the public domain in the US.
Expanding the genetic toolbox for Leptospira species by generation of fluorescent bacteria.
Aviat, Florence; Slamti, Leyla; Cerqueira, Gustavo M; Lourdault, Kristel; Picardeau, Mathieu
2010-12-01
Our knowledge of the genetics and molecular basis of the pathogenesis associated with Leptospira, in comparison to those of other bacterial species, is very limited. An improved understanding of pathogenic mechanisms requires reliable genetic tools for functional genetic analysis. Here, we report the expression of gfp and mRFP1 genes under the control of constitutive spirochetal promoters in both saprophytic and pathogenic Leptospira strains. We were able to reliably measure the fluorescence of Leptospira by fluorescence microscopy and a fluorometric microplate reader-based assay. We showed that the expression of the gfp gene had no significant effects on growth in vivo and pathogenicity in L. interrogans. We constructed an expression vector for L. biflexa that contains the lacI repressor, an inducible lac promoter, and gfp as the reporter, demonstrating that the lac system is functional in Leptospira. Green fluorescent protein (GFP) expression was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) in L. biflexa transformants harboring the expression vector. Finally, we showed that GFP can be used as a reporter to assess promoter activity in different environmental conditions. These results may facilitate further advances for studying the genetics of Leptospira spp.
Lebani, Kebaneilwe; Jones, Martina L; Watterson, Daniel; Ranzoni, Andrea; Traves, Renee J; Young, Paul R; Mahler, Stephen M
2017-01-01
The multidimensional nature of dengue virus (DENV) infections, which can be caused by four distinct serotypes of the virus, complicates the sensitivity of assays designed for the diagnosis of infection. Different viral markers can be optimally detected at different stages of infection. Of particular clinical importance is the early identification of infection, which is pivotal for disease management and the development of blood screening assays. Non-structural protein 1 (NS1) is an early surrogate marker of infection and its detection in serum coincides with detectable viraemia. The aim of this work was to isolate and characterise serotype-specific monoclonal antibodies that bind to NS1 for each of the four DENV serotypes. This was achieved using phage display and a subtractive biopanning strategy to direct the antibody selection towards serotype-specific epitopes. This antibody isolation strategy has advantages over immunisation techniques where it is difficult to avoid antibody responses to cross-reactive, immunodominant epitopes. Serotype specificity to recombinant antigen for each of the antibodies was confirmed by Enzyme Linked Immunosorbent Assay (ELISA) and Surface Plasmon Resonance. Confirmation of binding to native DENV NS1 was achieved using ELISA and immunofluorescence assay on DENV infected Vero cells. No cross-reactivity with Zika or Kunjin viruses was observed. A previously isolated pan-reactive antibody that binds to an immunodominant epitope was able to pair with each of the serotype-specific antibodies in a sandwich ELISA, indicating that the serotype specific antibodies bind to epitopes which are all spatially distinct from the immunodominant epitope. These antibodies were suitable for use in a multiplexed assay for simultaneous detection and serotyping of DENV NS1 in human serum. This work demonstrates that phage display coupled with novel biopanning strategies is a valuable in vitro methodology for isolation of binders that can discern amongst antigens with high homology for diagnostic applicability.
Molecular interactions between general anesthetics and the 5HT2B receptor.
Matsunaga, Felipe; Gao, Lu; Huang, Xi-Ping; Saven, Jeffery G; Roth, Bryan L; Liu, Renyu
2015-01-01
Serotonin modulates many processes through a family of seven serotonin receptors. However, no studies have screened for interactions between general anesthetics currently in clinical use and serotonergic G-protein-coupled receptors (GPCRs). Given that both intravenous and inhalational anesthetics have been shown to target other classes of GPCRs, we hypothesized that general anesthetics might interact directly with some serotonin receptors and thus modify their function. Radioligand binding assays were performed to screen serotonin receptors for interactions with propofol and isoflurane as well as for affinity determinations. Docking calculations using the crystal structure of 5-HT2B were performed to computationally confirm the binding assay results and locate anesthetic binding sites. The 5-HT2B class of receptors interacted significantly with both propofol and isoflurane in the primary screen. The affinities for isoflurane and propofol were determined to be 7.78 and .95 μM, respectively, which were at or below the clinical concentrations for both anesthetics. The estimated free energy derived from docking calculations for propofol (-6.70 kcal/mol) and isoflurane (-5.10 kcal/mol) correlated with affinities from the binding assay. The anesthetics were predicted to dock at a pharmacologically relevant binding site of 5HT2B. The molecular interactions between propofol and isoflurane with the 5-HT2B class of receptors were discovered and characterized. This finding implicates the serotonergic GPCRs as potential anesthetic targets.
Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel
2017-05-01
Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo
2012-03-01
The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.
A simple method for determining polymeric IgA-containing immune complexes.
Sancho, J; Egido, J; González, E
1983-06-10
A simplified assay to measure polymeric IgA-immune complexes in biological fluids is described. The assay is based upon the specific binding of a secretory component for polymeric IgA. In the first step, multimeric IgA (monomeric and polymeric) immune complexes are determined by the standard Raji cell assay. Secondly, labeled secretory component added to the assay is bound to polymeric IgA-immune complexes previously fixed to Raji cells, but not to monomeric IgA immune complexes. To avoid false positives due to possible complement-fixing IgM immune complexes, prior IgM immunoadsorption is performed. Using anti-IgM antiserum coupled to CNBr-activated Sepharose 4B this step is not time-consuming. Polymeric IgA has a low affinity constant and binds weakly to Raji cells, as Scatchard analysis of the data shows. Thus, polymeric IgA immune complexes do not bind to Raji cells directly through Fc receptors, but through complement breakdown products, as with IgG-immune complexes. Using this method, we have been successful in detecting specific polymeric-IgA immune complexes in patients with IgA nephropathy (Berger's disease) and alcoholic liver disease, as well as in normal subjects after meals of high protein content. This new, simple, rapid and reproducible assay might help to study the physiopathological role of polymeric IgA immune complexes in humans and animals.
Identifying Metabolically Active Chemicals Using a Consensus ...
Endocrine disrupting chemicals (EDCs) are abundant throughout the environment and can alter neurodevelopment, behavior, and reproductive success of humans and other species by perturbing signaling pathways related to the estrogen receptor (ER). A recent study compared results across 18 ER-related assays in the ToxCast™ in vitro screening program to predict the likelihood of a chemical exhibiting in vivo estrogenic activity, with the purpose of eliminating chemicals that may produce a false signal by interfering with the technological attributes of an individual assay. However, flaws in in vitro assay design can also prevent induction of signal activity by EDCs. Another reason for not observing activity for some EDCs in in vitro assays is that metabolic activation is required to perturb ER-related pathways. In the current study, 1,024 chemicals were identified as lacking ER activity after establishing a consensus across each of the 18 ER-related in vitro assays, and nearly 2,000 primary and 3,700 secondary unique metabolites were predicted for these chemicals. The ER binding activity for each metabolite was then predicted using an existing ER activity quantitative structure activity relationship (QSAR) consensus model. Binding activity was predicted for 2-3% of the metabolites within each generation. Of the inactive parent compounds generating at least one metabolite predicted to have ER-binding activity, nearly 30% were found to have metabolites from both gene
Myricetin Inhibits the Release of Glutamate in Rat Cerebrocortical Nerve Terminals
Chang, Yi; Chang, Chia-Ying; Huang, Shu-Kuei
2015-01-01
Abstract The excessive release of glutamate is a critical element in the neuropathology of acute and chronic brain disorders. The purpose of the present study was to investigate the effect and possible mechanism of myricetin, a naturally occurring flavonoid with a neuroprotective profile, on endogenous glutamate release in the nerve terminals (synaptosomes) of the rat cerebral cortex. The release of glutamate was evoked by the K+ channel blocker 4-aminopyridine (4-AP) and measured by one-line enzyme-coupled fluorometric assay. We also used a membrane potential-sensitive dye to assay the synaptosomal plasma membrane potential, and a Ca2+ indicator Fura-2 to monitor cytosolic Ca2+ concentrations ([Ca2+]C). Results show that myricetin inhibited 4-AP-evoked glutamate release, and this effect was prevented by chelating extracellular Ca2+ ions and the vesicular transporter inhibitor bafilomycin A1. However, the glutamate transporter inhibitor dl-threo-beta-benzyl-oxyaspartate had no effect on myricetin action. Myricetin did not alter the synaptosomal membrane potential, but decreased 4-AP-induced increases in the cytosolic free Ca2+ concentration. Furthermore, the myricetin effect on 4-AP-evoked glutamate release was prevented by blocking the Cav2.2 (N-type) and Cav2.1 (P/Q-type) channels, but not by blocking intracellular Ca2+ release. These results suggest that myricetin inhibits glutamate release from cerebrocortical synaptosomes by attenuating voltage-dependent Ca2+ entry. This implies that the inhibition of glutamate release is an important pharmacological activity of myricetin that may play a critical role in the apparent clinical efficacy of this compound. PMID:25340625
Optoacoustic detection of viral antigens using targeted gold nanorods
NASA Astrophysics Data System (ADS)
Maswadi, Saher; Woodward, Lee; Glickman, Randolph D.; Barsalou, Norman
2009-02-01
We are detecting antigens (Ag), isolated from infectious organisms, utilizing laser optoacoustic spectroscopy and antibody-coupled gold nanorod (NR) contrast agents specifically targeted to the antigen of interest. We have detected, in clinical ocular samples, both Herpes Simplex Virus Type 1 and 2 (HSV-1 and HSV-2) . A monoclonal antibody (Ab) specific to both HSV-1 and HSV-2 was conjugated to gold nanorods to produce a targeted contrast agent with a strong optoacoustic signal. Elutions obtained from patient corneal swabs were adsorbed in standard plastic micro-wells. An immunoaffinity reaction was then performed with the functionalized gold nanorods, and the results were probed with an OPO laser, emitting wavelengths at the peak absorptions of the nanorods. Positive optoacoustic responses were obtained from samples containing authentic (microbiologically confirmed) HSV-1 and HSV-2. To obtain an estimate of the sensitivity of the technique, serial dilutions from 1 mg/ml to 1 pg/ml of a C. trachomatis surface Ag were prepared, and were probed with a monoclonal Ab, specific to the C. trachomatis surface Ag, conjugated to gold nanorods. An optoacoustic response was obtained, proportional to the concentration of antigen, and with a limit of detection of about 5 pg/ml. The optoacoustic signals generated from micro-wells containing albumin or saline were similar to those from blank wells. The potential benefit of this method is identify viral agents more rapidly than with existing techniques. In addition, the sensitivity of the assay is comparable or superior to existing colorimetric- or fluorometric-linked immunoaffinity assays.
Cochrane, David E; Carraway, Robert E; Harrington, Kimberly; Laudano, Melissa; Rawlings, Stephen; Feldberg, Ross S
2011-12-01
To determine if mast cells synthesize the inflammatory peptide, neurotensin (NT), secrete immunoreactive and bioactive NT, and express the NT receptor NTS1. HMC-1 cells, pleural mast cells from Sprague-Dawley rats, LAD2 mast cells, and human cord blood mast cells were used. HMC-1 cells were stimulated with NT, C48/80, mastoparan, or PGE(2). For changes in cutaneous vascular permeability, anesthetized rats were injected intravenously with Evans Blue dye and intradermally with saline, NT, histamine, diphenhydramine, and C48/80. RT-PCR was used to identify RNA transcripts. Histamine was measured by fluorometric assay. In vivo cutaneous vascular permeability assays, radio-immunoassays for NT, Western blotting for the NT precursor protein and NTS1 protein from HMC-1 cells and tissues from rats were used. Immunohistochemistry was used to identify NT precursor-like proteins in HMC-1 mast cells. HMC-1 cells express mRNAs for NT precursor, PC5A processing enzyme and NTS1 receptor. Human cord blood mast cells and LAD2 mast cells express mRNA transcripts for NT precursor and NTS1. Western blotting showed NT precursor and NTS1 receptor in HMC1. Rat tissues with high numbers of mast cells contained NT precursor proteins. NT-like peptides from HMC-1 displayed NT-like bioactivity. HMC-1 mast cells synthesize and secrete immunoreactive and bioactive NT-like peptide(s) and express the NT receptor, suggesting that NT from mast cells might serve autocrine and paracrine roles.
The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.
Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S
2014-01-01
Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.
Integrating Biology into the General Chemistry Laboratory: Fluorometric Analysis of Chlorophyll "a"
ERIC Educational Resources Information Center
Wesolowski, Meredith C.
2014-01-01
A laboratory experiment that introduces fluorometry of chlorophyll "a" at the general chemistry level is described. The use of thin-layer chromatography to isolate chlorophyll "a" from spirulina and leaf matter enables quantification of small amounts of chlorophyll "a" via fluorometry. Student results were reasonably…
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...