Science.gov

Sample records for fmd transmission applied

  1. Geographic and topographic determinants of local FMD transmission applied to the 2001 UK FMD epidemic.

    PubMed

    Bessell, Paul R; Shaw, Darren J; Savill, Nicholas J; Woolhouse, Mark E J

    2008-10-03

    Models of Foot and Mouth Disease (FMD) transmission have assumed a homogeneous landscape across which Euclidean distance is a suitable measure of the spatial dependency of transmission. This paper investigated features of the landscape and their impact on transmission during the period of predominantly local spread which followed the implementation of the national movement ban during the 2001 UK FMD epidemic. In this study 113 farms diagnosed with FMD which had a known source of infection within 3 km (cases) were matched to 188 control farms which were either uninfected or infected at a later timepoint. Cases were matched to controls by Euclidean distance to the source of infection and farm size. Intervening geographical features and connectivity between the source of infection and case and controls were compared. Road distance between holdings, access to holdings, presence of forest, elevation change between holdings and the presence of intervening roads had no impact on the risk of local FMD transmission (p > 0.2). However the presence of linear features in the form of rivers and railways acted as barriers to FMD transmission (odds ratio = 0.507, 95% CIs = 0.297,0.887, p = 0.018). This paper demonstrated that although FMD spread can generally be modelled using Euclidean distance and numbers of animals on susceptible holdings, the presence of rivers and railways has an additional protective effect reducing the probability of transmission between holdings.

  2. Quantitative risk assessment of FMD virus transmission via water.

    PubMed

    Schijven, Jack; Rijs, Gerard B J; de Roda Husman, Ana Maria

    2005-02-01

    distance of the location of discharge within one day. This clearly underlines current measures that prohibit such discharges, and also asks for strict control. This risk assessment clearly demonstrated the potential significance of FMD virus transmission via water, and the results will be useful on an international scale, and could also serve as a basis for other FMD risk-assessment models.

  3. The effect of foot-and-mouth disease (FMD) vaccination on virus transmission and the significance for the field.

    PubMed

    Orsel, Karin; Bouma, Annemarie

    2009-10-01

    Vaccination against foot-and-mouth disease (FMD) might be one of the control measures used during an FMD epidemic depending on the local epidemiological situation, the status of the country, and the opinion of policy makers. A sound decision on vaccination can be made only if there is sufficient scientific knowledge on the effectiveness of vaccination in eliminating the virus from the population. An important question is whether a single vaccination applied as an emergency vaccine can contribute to the control of an epidemic. This paper presents the results of transmission experiments on vaccine efficacy in groups of cattle, pigs, and sheep and concludes that vaccination seemed to be effective in cattle and sheep, but was less effective in pigs. The possible implications for application to field conditions are discussed.

  4. An overview on ELISA techniques for FMD.

    PubMed

    Ma, Li-na; Zhang, Jie; Chen, Hao-tai; Zhou, Jian-hua; Ding, Yao-zhong; Liu, Yong-sheng

    2011-09-04

    FMD is one of the major causes of economic loss of cloven-hoofed animals in the world today. The assessment of dominant genotype/lineage and prevalent trends and confirmation the presence of infection or vaccination not only provides scientific basis and first-hand information for appropriate control measure but also for disease eradication and regaining FMD free status following an outbreak. Although different biological and serological approaches are still applied to study this disease, ELISA test based on the distinct format, antigen type and specific antibody reinforce its predominance in different research areas of FMD, and this may replace the traditional methods in the near future. This review gives comprehensive insight on ELISA currently available for typing, antigenic analysis, vaccination status differentiation and surveillance vaccine purity and content at all stages of manufacture in FMDV. Besides, some viewpoint about the recent advances and trends of ELISA reagent for FMD are described here. More than 100 studies regarding ELISA method available for FMD diagnosis, antigenic analysis and monitor were thoroughly reviewed. We investigated previous sagacious results of these tests on their sensitivity, specificity. We found that in all ELISA formats for FMD, antibody-trapping and competitive ELISAs have high specificity and RT-PCR (oligoprobing) ELISA has extra sensitivity. A panel of monoclonal antibodies to different sites or monoclonal antibody in combination of antiserum is the most suitable combination of antibodies in ELISA for FMD. Even though from its beginning, 3ABC is proven to be best performance in many studies, no single NSP can differentiate infected from vaccinated animals with complete confidence. Meanwhile, recombinant antigens and peptide derived from FMDV NPs, and NSPs have been developed for use as an alternative to the inactivated virus antigen for security. There is a need of target protein, which accurately determines the

  5. ACC-FMD: ant colony clustering for functional module detection in protein-protein interaction networks.

    PubMed

    Ji, Junzhong; Liu, Hongxin; Zhang, Aidong; Liu, Zhijun; Liu, Chunnian

    2015-01-01

    Mining functional modules in Protein-Protein Interaction (PPI) networks is a very important research for revealing the structure-functionality relationships in biological processes. More recently, some swarm intelligence algorithms have been successfully applied in the field. This paper presents a new nature-inspired approach, ACC-FMD, which is based on ant colony clustering to detect functional modules. First, some proteins with the higher clustering coefficients are, respectively, selected as ant seed nodes. And then, the picking and dropping operations based on ant probabilistic models are developed and employed to assign proteins into the corresponding clusters represented by seeds. Finally, the best clustering result in each generation is used to perform the information transmission by updating the similarly function. Experimental results on some benchmarked datasets show that ACC-FMD outperforms the CFinder and MCODE algorithms and has comparative performance with the MINE, COACH, DPClus and Core algorithms in terms of the general evaluation metrics.

  6. Research in advance for FMD novel vaccines.

    PubMed

    Zhang, Liang; Zhang, Jie; Chen, Hao-tai; Zhou, Jian-hua; Ma, Li-na; Ding, Yao-zhong; Liu, Yong-sheng

    2011-06-03

    Foot-and-Mouth Disease (FMD), as a major global animal disease, affects millions of animals worldwide and remains the main sanitary barrier to the international and national trade of animals and animal products. Inactivated vaccination is the most effective measure for prevention of FMD at present, but fail to induce long-term protection and content new requires for production of FMD vaccines. As a number of Researchers hope to obtain satisfactory novel vaccines by new bio-technology, novel vaccines have been studied for more than thirty years. Here reviews the latest research progress of new vaccines, summarizes some importance and raises several suggestions for the future of FMD vaccine.

  7. Cedivac-FMD can be used according to a marker vaccine principle.

    PubMed

    Chénard, Gilles; Selman, Paulus; Dekker, Aldo

    2008-04-01

    In this study, we investigated whether Cedivac-FMD, an emergency vaccine against foot-and-mouth disease (FMD), is suitable for use conjointly with a screening program intended to confirm freedom from disease in vaccinated herds based on evidence of virus replication in vaccinates. Different sets of sera were tested using the Ceditest FMDV-NS ELISA for the detection of antibodies against non-structural proteins (NSPs) of FMD virus. During a vaccine safety study, serum samples were collected from 10 calves, 10 lambs and 10 piglets following administration of a double dose and a repeat dose of high payload trivalent Cedivac-FMD vaccine. All serum samples collected both 2 weeks following the administration of a double dose as well as those collected 2 weeks after the single dose booster (given 2 weeks after the double dose) were negative in the Ceditest FMDV-NS ELISA. In a series of vaccine potency experiments, serum samples were collected from 70 vaccinated cattle prior to and following exposure to infectious, homologous FMD virus. When testing cattle sera collected 4 weeks after vaccination with a regular dose of monovalent >6 PD(50) vaccines, 1 of 70 animals tested positive in the NSP antibody ELISA. After infection with FMD virus, antibodies to NSP were detected in 59 of 70 vaccinated cattle and 27 of 28 non-vaccinated control animals within 7 days. Cedivac-FMD vaccines do not induce NSP antibodies in cattle, pigs or sheep following administration of a double dose or a repeat dose. FMD-exposed animals can be detected in a vaccinated group within 7-14 days. Because Cedivac-FMD does not induce NSP antibodies, the principle of 'marker vaccine' applies.

  8. Vaccination against foot-and-mouth disease II: Regaining FMD-free status.

    PubMed

    Backer, J A; Engel, B; Dekker, A; van Roermund, H J W

    2012-11-01

    An epidemic of foot-and-mouth disease (FMD) can have devastating effects on animal welfare, economic revenues, the export position and society as a whole. The preferred control strategy in the Netherlands has recently changed to vaccination-to-live, but - not have been applied before - this poses unprecedented challenges for effectively controlling an epidemic, regaining FMD-free status and minimizing economic losses. These three topics are addressed in an interdisciplinary model analysis. In this second part we evaluate whether vaccination-to-live poses a higher risk for regaining FMD-free status than non-vaccination strategies and whether the final screening can be improved to reduce this risk. The FMD transmission model that was developed in the first part, predicted the prevalence of infected animals in undetected herds for 1000 hypothetical epidemics per control strategy. These results serve as input for the final screening model that was developed in this part. It calculates the expected number of undetected infected herds and animals per epidemic after final screening, as well as the number of herds and animals to be tested. Our results show that vaccination strategies yield a larger number of undetected infected animals in the whole country per epidemic before final screening than preemptive culling (median values and 5-95% interval): 8 (0-42) animals for 1 km preemptive culling, 50 (7-148) for 2 km vaccination and 35 (6-99) for 5 km vaccination. But the final screening reduced these to comparably low numbers: 1.0 (0-9.1) for 1 km preemptive culling, 3.5 (0.3-15) for 2 km vaccination and 2.1 (0.3-9.4) for 5 km vaccination. Undetected infected animals were mainly found in non-vaccinated sheep herds and vaccinated cattle and sheep herds. As a consequence, testing more non-vaccinated cattle and pig herds will not reduce the expected number of undetected infected animals after the final screening by much, while the required testing resources drastically

  9. Transmissivity evolution through interface of composite liners under applied constraint.

    PubMed

    Diagne, M

    2011-08-01

    In landfill liners, geomembranes have defects that constitute preferential passages of leachate from rainwater percolation. Non-woven geotextiles are widely used in wastelandfills as materials having the functions of protection, separation, filtration and drainage. This study seeks to select geotextiles through an investigation conducted among landfill operators who commonly arise a geotextile in the geomembrane-clay interface to facilitate geomembrane welding and to prevent its puncture by angular materials. It also attempts to find out the influence of geotextile in a decimetric transmissivity cell size under 50 kPa stress and smooth ground surface. The results show that the transmissivity in composite liner interface is almost the same as the one calculated with the European standard EN ISO 12958. Transmissivity depends on the mechanical stress applied to the bottom liner, on the geotextile type in the interface and on the ground surface.

  10. FMD vaccines: reflections on quality aspects for applicability in European disease control policy.

    PubMed

    De Clercq, K; Goris, N; Barnett, P V; MacKay, D K

    2008-01-01

    Most foot-and-mouth disease (FMD) vaccines used around the world are inactivated vaccines for prophylactic or emergency use, generally manufactured by the same basic methodology outlined in the OIE Manual and, for Europe, in the European Pharmacopoeia, and for the EU Member States in compliance with Directive 2001/82/EC of the European Parliament and of the Council of 6 November 2001 on the Community code relating to veterinary medicinal products as amended by Directive 2004/28/EC. Most of the requirements that apply to all immunological veterinary medicinal products apply equally to FMD vaccines. There are, however, some unique features of the disease and vaccines used against it that require a different approach to fulfil the requirements of the relevant legislation, if a vaccinate-to-live policy will be applied with 'authorized' vaccines. Several aspects of vaccine efficacy and safety are elaborated with emphasis on quality assurance/quality control (QA/QC). The purity of the vaccine in respect of the presence of non-structural protein antibodies could be checked indirectly by serology after vaccination. The viability of a vaccine bank approach was greatly aided by the principle of storing inactivated concentrated FMD viral antigen (Ag) over liquid nitrogen for subsequent formulation into vaccine. A worldwide Ag bank network might be an option for the far future and a solution to the problem of covering many different FMDV serotypes and strains. The producers should respect the strict FMD biosecurity rules worked out by the FAO EUFMD and described in Council Directive 2003/85/EC. Making the experience related to vaccine QA/QC available to all countries will reduce the risk of an FMD outbreak within these countries and consequently will reduce the FMD risk around the world.

  11. Assessment of flow-mediated vasodilatation (FMD) of the brachial artery: effects of technical aspects of the FMD measurement on the FMD response.

    PubMed

    Bots, Michiel L; Westerink, Jan; Rabelink, Ton J; de Koning, Eelco J P

    2005-02-01

    The ability to assess endothelial function non-invasively with B-mode ultrasound has lead to its widespread application in a variety of studies. However, the absolute values obtained using this approach vary considerably across studies. We studied whether technical aspects of the methodology can explain the wide variety in absolute values across studies. A literature search was performed to identify published reports on flow-mediated vasodilatation (FMD) of the brachial artery published between 1992 and 2001. Information on type of equipment (wall track/B-mode), location of the measurement (antecubital fossa/upper arm), occlusion site (lower/upper arm), occlusion duration (min), and occlusion pressure was extracted. Patient characteristics were also extracted. For the healthy populations, mean FMD varied from 0.20 to 19.2%; for the coronary heart disease (CHD) patients FMD varied from -1.3 to 14%; for subjects with diabetes mellitus FMD varied from 0.75 to 12%. Compared with occlusion at the upper arm, lower arm occlusion was related to decreased FMD (mean difference in FMD -2.47%; 95% CI 0.55-4.39). An occlusion duration of > or =4.5 min was related to an increased FMD compared with an occlusion time of < or =4 min (mean difference 1.30%; 95% CI 0.35-2.46). These findings were adjusted for other technical aspects of the methodology and for differences in risk factors between populations. Mean FMD differs widely between studies. There is a great overlap between populations (healthy, CHD, diabetics). Our findings suggest that the technical aspects of the measurements, the location, and the duration of the occlusion may explain some of these differences, whereas type of equipment, location of the measurement, and occlusion pressure do not.

  12. The problem of applying information theory to efficient image transmission.

    NASA Technical Reports Server (NTRS)

    Sakrison, D. J.

    1973-01-01

    The main ideas of Shannon's (1948, 1960) theory of source encoding with a fidelity constraint, more commonly known as rate distortion theory, are summarized. The theory was specifically intended to provide a theoretical basis for efficient transmission of information such as images. What the theory has to contribute to the problem is demonstrated. Difficulties that impeded application of the theory to image transmission, and current efforts to solve these difficulties are discussed.

  13. Global FMD control--is it an option?

    PubMed

    Kitching, Paul; Hammond, Jef; Jeggo, Martyn; Charleston, Bryan; Paton, David; Rodriguez, Luis; Heckert, Robert

    2007-07-26

    The outbreaks of foot-and-mouth disease (FMD) in Europe in 2001 identified the vulnerability of the intensive agricultural industries in Europe and North America to the economic consequences of the introduction of a highly infectious animal disease. The very large illegal international trade in animal products bypasses the safeguards recommended by World Animal Health Organization (OIE) and put in place by governments to prevent the importation of foreign pathogens. If it is not possible to stop the entry of FMD virus, what are the options to mitigate the risk by reducing the area of the globe in which FMD is endemic? There are a number of constraints that would prevent global control of FMD; current vaccines are expensive, have a narrow antigenic spectrum, provide only short term immunity and are very fragile; diagnostics are also expensive, require training to use and if not handled properly lose sensitivity and specificity; we still do not understand the significance of carrier animals in the epidemiology of FMD, and whether it is necessary or possible to prevent the carrier state; and many decision support tools, such as models are currently more dangerous than useful in that they fail to fully accommodate all the complexities of the disease. The four national foreign animal disease laboratories in USA, Canada, UK and Australia together with the International Livestock Research Institute have put forward a proposal to address some of these constraints (the Global FMD Research Alliance, GFRA), not only to protect their own national livestock industries, but also to support FMD control programs in countries in which the disease is present.

  14. Signal Detection Theory Applied to Helicopter Transmission Diagnostic Thresholds

    NASA Technical Reports Server (NTRS)

    Dempsey, Paula J.; Keller, Jonathan A.; Wade, Daniel R.

    2009-01-01

    Helicopter Health Usage Monitoring Systems (HUMS) have potential for providing data to support increasing the service life of a dynamic mechanical component in the transmission of a helicopter. Data collected can demonstrate the HUMS condition indicator responds to a specific component fault with appropriate alert limits and minimal false alarms. Defining thresholds for specific faults requires a tradeoff between the sensitivity of the condition indicator (CI) limit to indicate damage and the number of false alarms. A method using Receiver Operating Characteristic (ROC) curves to assess CI performance was demonstrated using CI data collected from accelerometers installed on several UH60 Black Hawk and AH64 Apache helicopters and an AH64 helicopter component test stand. Results of the analysis indicate ROC curves can be used to reliably assess the performance of commercial HUMS condition indicators to detect damaged gears and bearings in a helicopter transmission.

  15. Signal Detection Theory Applied to Helicopter Transmission Diagnostic Thresholds

    NASA Technical Reports Server (NTRS)

    Dempsey, Paula J.; Keller, Jonathan A.; Wade, Daniel R.

    2008-01-01

    Helicopter Health Usage Monitoring Systems (HUMS) have potential for providing data to support increasing the service life of a dynamic mechanical component in the transmission of a helicopter. Data collected can demonstrate the HUMS condition indicator responds to a specific component fault with appropriate alert limits and minimal false alarms. Defining thresholds for specific faults requires a tradeoff between the sensitivity of the condition indicator (CI) limit to indicate damage and the number of false alarms. A method using Receiver Operating Characteristic (ROC) curves to assess CI performance was demonstrated using CI data collected from accelerometers installed on several UH60 Black Hawk and AH64 Apache helicopters and an AH64 helicopter component test stand. Results of the analysis indicate ROC curves can be used to reliably assess the performance of commercial HUMS condition indicators to detect damaged gears and bearings in a helicopter transmission.

  16. Signal Detection Theory Applied to Helicopter Transmission Diagnostic Thresholds

    NASA Technical Reports Server (NTRS)

    Dempsey, Paula J.; Keller, Jonathan A.; Wade, Daniel R.

    2009-01-01

    Helicopter Health Usage Monitoring Systems (HUMS) have potential for providing data to support increasing the service life of a dynamic mechanical component in the transmission of a helicopter. Data collected can demonstrate the HUMS condition indicator responds to a specific component fault with appropriate alert limits and minimal false alarms. Defining thresholds for specific faults requires a tradeoff between the sensitivity of the condition indicator (CI) limit to indicate damage and the number of false alarms. A method using Receiver Operating Characteristic (ROC) curves to assess CI performance was demonstrated using CI data collected from accelerometers installed on several UH60 Black Hawk and AH64 Apache helicopters and an AH64 helicopter component test stand. Results of the analysis indicate ROC curves can be used to reliably assess the performance of commercial HUMS condition indicators to detect damaged gears and bearings in a helicopter transmission.

  17. Wireless power transmission applied the mutual coupling between coils

    NASA Astrophysics Data System (ADS)

    Furuta, Kenta; Baba, Ryouichi; Shun, Endo; Nunokawa, Kazuki; Takahashi, Wataru; Maruyama, Tamami

    2017-07-01

    Recently, the studies of wireless power transfer (WPT) to electric vehicles in motion on the snow-piled road have been reported. In WPT by magnetic field resonance method, transmission coefficient S21, which is one of the scattering parameters, from transmission coil to received coil are degraded because of misalignment of transmitting and receiving coil, the distance between these coils, and the effects of the ice and snow. This paper adopts parasitic coil as a solution to improve the reception power in which the parasitic coil is inserted between transmitting and receiving coils. Analysis and experimental results show that parasitic coil could improve the value of S21 by 15 dB using mutual coupling. LED could be light by this solution when the distance between transmitting and receiving coils are 150 mm.

  18. Continuously variable vehicular transmission for reducing transmission torque applied to belt-type continuously variable transmission mechanism

    SciTech Connect

    Sumiyoshi, M.; Matsunari, F.

    1987-02-24

    This patent describes a continuously variable transmission for a vehicle, comprising: a torque converter driven by an engine; an input shaft connected to an output of the torque converter; a transmission output shaft; a transmission mechanism of variable ratio including a planetary gear mechanism and a controller for controlling rotational states of elements of the planetary gear mechanism. The transmission mechanism has at least reverse and forward low speed ranges of large reduction ratios and a forward high speed range of small reduction ratio. The transmission mechanism of variable ratio is in torque transmitting engagement with the input shaft and the transmission output shaft, the input shaft constituting a first input to the transmission mechanism of variable ratio; a belt-type continuously variable transmission mechanism including an input pulley in torque transmitting engagement with the input shaft and an output pulley provided on a sleeve, each pulley having a stationary flange and a movable flange axially movable with respect to the stationary flange, and torque transmitting means of an endless belt type running on the two pulleys. The output pulley is coupled to the transmission output shaft via the planetary gear mechanism in the forward high speed range.

  19. A multi-analysis approach for space-time and economic evaluation of risks related with livestock diseases: the example of FMD in Peru.

    PubMed

    Martínez-López, B; Ivorra, B; Fernández-Carrión, E; Perez, A M; Medel-Herrero, A; Sánchez-Vizcaíno, F; Gortázar, C; Ramos, A M; Sánchez-Vizcaíno, J M

    2014-04-01

    This study presents a multi-disciplinary decision-support tool, which integrates geo-statistics, social network analysis (SNA), spatial-stochastic spread model, economic analysis and mapping/visualization capabilities for the evaluation of the sanitary and socio-economic impact of livestock diseases under diverse epidemiologic scenarios. We illustrate the applicability of this tool using foot-and-mouth disease (FMD) in Peru as an example. The approach consisted on a flexible, multistep process that may be easily adapted based on data availability. The first module (mI) uses a geo-statistical approach for the estimation (if needed) of the distribution and abundance of susceptible population (in the example here, cattle, swine, sheep, goats, and camelids) at farm-level in the region or country of interest (Peru). The second module (mII) applies SNA for evaluating the farm-to-farm contact patterns and for exploring the structure and frequency of between-farm animal movements as a proxy for potential disease introduction or spread. The third module (mIII) integrates mI-II outputs into a spatial-stochastic model that simulates within- and between-farm FMD-transmission. The economic module (mIV) connects outputs from mI-III to provide an estimate of associated direct and indirect costs. A visualization module (mV) is also implemented to graph and map the outputs of module I-IV. After 1000 simulated epidemics, the mean (95% probability interval) number of outbreaks, infected animals, epidemic duration, and direct costs were 37 (1, 1164), 2152 (1, 13, 250), 63 days (0, 442), and US$ 1.2 million (1072, 9.5 million), respectively. Spread of disease was primarily local (<4.5km), but geolocation and type of index farm strongly influenced the extent and spatial patterns of an epidemic. The approach is intended to support decisions in the last phase of the FMD eradication program in Peru, in particular to inform and support the implementation of risk-based surveillance and

  20. Endothelial dysfunction or dysfunctions? Identification of three different FMD responses in males with type 2 diabetes.

    PubMed

    Irace, Concetta; Tschakovsky, Michael E; Carallo, Claudio; Cortese, Claudio; Gnasso, Agostino

    2008-10-01

    Endothelial function is widely evaluated by vasodilatation of the brachial artery induced by ischemia (flow-mediated vasodilatation, FMD). The function of the endothelium, in this setting, is to sense wall shear stress (WSS) increase and to release vasodilators. Following current guidelines FMD is measured 50-60s after ischemia. It is not known whether this lapse of time is sufficient to observe maximal vasodilatation, especially in diseased subjects. Sixty-six subjects with type 2 diabetes and 30 controls underwent FMD-test. Brachial artery WSS was measured at rest and during the first 15s after ischemia as index of peripheral resistances vessels reactivity, and FMD at 50, 120, 180, and 300s after ischemia as index of conduit vessel function. All controls exhibited increased WSS and peak FMD at 50s. Among subjects with diabetes three groups were identified based on the time at which peak FMD occurred. Twenty subjects with diabetes exhibited peak at 50s (Early FMD), 28 at 2 min (Late FMD), and 18 showed no FMD (Absent FMD). Peak FMD in Late FMD subgroup was comparable to peak in control subjects and significantly higher than peak in other subjects with diabetes. The "Absent FMD" group showed also impaired WSS. The present findings demonstrate that brachial artery response to ischemia is heterogeneous in type 2 diabetes, suggesting different mechanisms responsible for FMD alteration in this condition.

  1. Using field-based epidemiological methods to investigate FMD outbreaks: an example from the 2002 outbreak in Korea.

    PubMed

    Wee, S-H; Nam, H-M; Moon, O-K; Yoon, H; Park, J-Y; More, S J

    2008-12-01

    Relevant to foot and mouth disease (FMD), most published epidemiological studies have been conducted using quantitative methods and substantial regional or national datasets. Veterinary epidemiology also plays a critical role during outbreak investigations, both to assist with herd-level decision-making and to contribute relevant information to assist with ongoing national or regional control strategies. Despite the importance of this role, however, little information has been published on the use of applied (field-based) epidemiological methods during disease outbreaks. In this study, we outline an investigative template for FMD, and a case study of its use during the 2002 FMD outbreak in Korea. Suitable for use during field-based epidemiological investigations of individual farms within a broader regional/national response, the template considers three steps including confirming infection, estimating date of introduction and determining method of introduction. A case study was conducted on IP13 (the 13th infected premises), the only IP during the 2002 FMD outbreak in Korea that was geographically isolated from all other known cases. The authorities first became aware of FMD on IP13 on 2 June, however, infection may have been present from 12 May. Infection was confirmed on 3 June 2002. FMD was probably spread to IP13 by a contract worker who had participated during 2-4 May in the culling operations on IP1. Other routes of spread were ruled out during the investigation. The contract worker lived in the locality of IP13 and worked on a part-time basis at a pork-processing plant that was adjacent to this farm. The contractor became heavily contaminated during the cull, but did not comply fully with cleaning and disinfection requirements once the cull had been completed. The investigative template contributed structure and focus to the field-based investigation. Results from this case study demonstrate the need for strict management of personnel in disease control and

  2. DOES BRACHIAL ARTERY FMD PROVIDE A BIOASSAY FOR NITRIC OXIDE?

    PubMed Central

    Wray, D. Walter; Witman, Melissa A. H.; Ives, Stephen J.; McDaniel, John; Trinity, Joel D.; Conklin, Jamie D.; Supiano, Mark A.; Richardson, Russell S.

    2013-01-01

    This study sought to better define the role of nitric oxide (NO) in brachial artery flow-mediated vasodilation (FMD) in young, healthy humans. Brachial artery blood velocity and diameter were determined (ultrasound Doppler) in eight volunteers (26 ± 1 yrs) before and after 5-min forearm circulatory occlusion with and without intra-arterial infusion of the endothelial nitric oxide synthase (eNOS) inhibitor L-NMMA (0.48 mg/dl/min). Control (CON) and L-NMMA trials were performed with the occlusion cuff placed in the traditional distal position, as well as proximal to the measurement site. FMD was significantly reduced, but not abolished, by L-NMMA in the distal cuff trial (8.9 ± 1.3 to 6.0 ± 0.7%, CON vs. L-NMMA, P = 0.02), with no effect of L-NMMA on FMD with proximal cuff placement (10.6 ± 1.2 to 12.4 ± 1.7%, CON vs. L-NMMA, P = 0.39). When the reduction in shear stimulus following L-NMMA was taken into account, no drug difference was observed for either distal (0.26 ± 0.02 to 0.23 ± 0.03, CON vs. L-NMMA, P = 0.40) or proximal (0.23 ± 0.08 to 0.23 ± 0.03, CON vs. L-NMMA, P = 0.89) FMD trials. These findings challenge the assertion that NO is obligatory for brachial artery FMD, and call into question the sensitivity of this procedure for non-invasive determination of NO bioavailability in young, healthy humans. PMID:23774225

  3. PDD applied in the dog transmissible venereal tumor

    NASA Astrophysics Data System (ADS)

    Hage, Raduan; Duarte, Janaina; Martin, Airton A.; Zangaro, Renato A.; Pacheco, Marcos T. T.

    2003-07-01

    The Transmissible Venereal Tumor (TVT) is a very common neoplasic disease in a free-roaming dogs which affects the extern genital and presenting resistance to conventional drugs that promote high toxicity. Photodynamic Therapy (PDT) is based in tumor cells irradiation after absorption of photosensitizer substance. At present, the protoporphirin IX (PP IX) has been explored in PDT due to be endogen, then it does not present toxicity effect. This substance can be obtained by exogenous way through aminolevulinic acid (5-ALA) administration in patient. The aim of this work was establish the optimal conditions for PDD (Phodynamic Diagnosis) to irradiate the tumor after ALA administration through fluorescence spectroscopy to improve the results with PDT. In this research was studied the 5-ALA 20% absorption in TVT of vaginal and penial mucous of a female and a male dog, respectivaly. This drug was administrated topically and after 30 minutes the fluorescence spectra were collected in intervals of 15 minutes during 120 minutes. The results showed that the maximum peak of PP IX in the tumor was between 60 and 105 minutes after the ALA application. In conclusion, the optimum effect will be achieved irradiating the tumor tissue into this period.

  4. Semiquantitative Decision Tools for FMD Emergency Vaccination Informed by Field Observations and Simulated Outbreak Data

    PubMed Central

    Willeberg, Preben William; AlKhamis, Mohammad; Boklund, Anette; Perez, Andres M.; Enøe, Claes; Halasa, Tariq

    2017-01-01

    We present two simple, semiquantitative model-based decision tools, based on the principle of first 14 days incidence (FFI). The aim is to estimate the likelihood and the consequences, respectively, of the ultimate size of an ongoing FMD epidemic. The tools allow risk assessors to communicate timely, objectively, and efficiently to risk managers and less technically inclined stakeholders about the potential of introducing FMD suppressive emergency vaccination. To explore the FFI principle with complementary field data, we analyzed the FMD outbreaks in Argentina in 2001, with the 17 affected provinces as the units of observation. Two different vaccination strategies were applied during this extended epidemic. In a series of 5,000 Danish simulated FMD epidemics, the numbers of outbreak herds at day 14 and at the end of the epidemics were estimated under different control strategies. To simplify and optimize the presentation of the resulting data for urgent decisions to be made by the risk managers, we estimated the sensitivity, specificity, as well as the negative and positive predictive values, using a chosen day-14 outbreak number as predictor of the magnitude of the number of remaining post-day-14 outbreaks under a continued basic control strategy. Furthermore, during an ongoing outbreak, the actual cumulative number of detected infected herds at day 14 will be known exactly. Among the number of epidemics lasting >14 days out of the 5,000 simulations under the basic control scenario, we selected those with an assumed accumulated number of detected outbreaks at day 14. The distribution of the estimated number of detected outbreaks at the end of the simulated epidemics minus the number at day 14 was estimated for the epidemics lasting more than 14 days. For comparison, the same was done for identical epidemics (i.e., seeded with the same primary outbreak herds) under a suppressive vaccination scenario. The results indicate that, during the course of an FMD

  5. Semiquantitative Decision Tools for FMD Emergency Vaccination Informed by Field Observations and Simulated Outbreak Data.

    PubMed

    Willeberg, Preben William; AlKhamis, Mohammad; Boklund, Anette; Perez, Andres M; Enøe, Claes; Halasa, Tariq

    2017-01-01

    We present two simple, semiquantitative model-based decision tools, based on the principle of first 14 days incidence (FFI). The aim is to estimate the likelihood and the consequences, respectively, of the ultimate size of an ongoing FMD epidemic. The tools allow risk assessors to communicate timely, objectively, and efficiently to risk managers and less technically inclined stakeholders about the potential of introducing FMD suppressive emergency vaccination. To explore the FFI principle with complementary field data, we analyzed the FMD outbreaks in Argentina in 2001, with the 17 affected provinces as the units of observation. Two different vaccination strategies were applied during this extended epidemic. In a series of 5,000 Danish simulated FMD epidemics, the numbers of outbreak herds at day 14 and at the end of the epidemics were estimated under different control strategies. To simplify and optimize the presentation of the resulting data for urgent decisions to be made by the risk managers, we estimated the sensitivity, specificity, as well as the negative and positive predictive values, using a chosen day-14 outbreak number as predictor of the magnitude of the number of remaining post-day-14 outbreaks under a continued basic control strategy. Furthermore, during an ongoing outbreak, the actual cumulative number of detected infected herds at day 14 will be known exactly. Among the number of epidemics lasting >14 days out of the 5,000 simulations under the basic control scenario, we selected those with an assumed accumulated number of detected outbreaks at day 14. The distribution of the estimated number of detected outbreaks at the end of the simulated epidemics minus the number at day 14 was estimated for the epidemics lasting more than 14 days. For comparison, the same was done for identical epidemics (i.e., seeded with the same primary outbreak herds) under a suppressive vaccination scenario. The results indicate that, during the course of an FMD

  6. Comparative immunogenecity of foot and mouth disease virus antigens in FMD-haemorrhagic septicaemia combined vaccine and FMD vaccine alone in buffalo calves.

    PubMed

    Chhabra, Rajesh; Sharma, R; Kakker, N K

    2004-03-01

    Humoral immune response was evaluated by monitoring the serum antibody titres and virus specific IgM titres against Foot and Mouth Disease (FMD) virus antigens in serum samples obtained from different groups of calves inoculated with combined vaccine or FMD vaccine alone, on 0, 7, 14, 21, 28, 42 and 56 days post-vaccination (DPV). The cellular immune response was monitored by MTT based lymphoproliferation in peripheral blood mononuclear cell cultures. Higher liquid phase blocking (LPB) ELISA antibody titres were observed in calves receiving combined vaccine as compared to calves immunized with FMD vaccine alone with the peak titres in both the groups obtained on 21 days post-vaccination. However, the virus specific IgM titres were significantly higher in group of calves inoculated with combined vaccine than FMD vaccine alone. The lymphoproliferative responses against FMDV types O, A22 and Asia 1 in the groups receiving combined vaccine and FMD vaccine alone started increasing gradually after day 14 and reached peak levels on 28 DPV followed by a gradual decline subsequently. The group receiving combined vaccine showed higher proliferative responses on in vitro stimulation with FMD virus type O, whereas, with FMD virus type Asia 1, the responses were significantly higher on 14 and 21 DPV as compared to the group immunized with FMD vaccine alone. However, in the group receiving combined vaccine, the responses on in vitro stimulation with FMD virus type A22 were significantly higher than FMD vaccine alone group on all DPV except on 42 DPV.

  7. Microscopic Nuclear Structure and Reaction Calculations in the FMD Approach

    NASA Astrophysics Data System (ADS)

    Neff, T.; Feldmeier, H.; Langanke, K.

    We present here a first application of the Fermionic Molecular Dynamics (FMD) approach to low-energy nuclear reactions, namely the $^3$He($\\alpha$,$\\gamma$)$^7$Be radiative capture reaction. We divide the Hilbert space into an external region where the system is described as $^3$He and $^4$He clusters interacting only via the Coulomb interaction and an internal region where the nuclear interaction will polarize the clusters. Polarized configurations are obtained by a variation after parity and angular momentum projection procedure with respect to the parameters of all single particle states. A constraint on the radius of the intrinsic many-body state is employed to obtain polarized clusters at desired distances. The boundary conditions for bound and scattering states are implemented using the Bloch operator. The FMD calculations reproduce the correct energy for the centroid of the $3/2^-$ and $1/2^-$ bound states in $^7$Be. The charge radius of the ground state is in good agreement with recent experimental results. The FMD calculations also describe well the experimental phase shift data in the $1/2^+$, $3/2^+$ and $5/2^+$ channels that are important for the capture reaction at low energies. Using the bound and scattering many-body wave functions we calculate the radiative capture cross section. The calculated $S$ factor agrees very well, both in absolute normalization and energy dependence, with the recent experimental data from the Weizmann, LUNA, Seattle and ERNA experiments.

  8. Flow-mediated dilatation (FMD) and prevalence of cardiovascular risk factors: the value of FMD assessment in high risk patients is limited.

    PubMed

    Mizia-Stec, Katarzyna; Wieczorek, Joanna; Orszulak, Michał; Mizia, Magdalena; Gieszczyk-Strózik, Klaudia; Sikora-Puz, Agnieszka; Haberka, Maciej; Lasota, Bartosz; Chmiel, Artur

    2014-01-01

    Since flow-mediated dilatation (FMD) is influenced by different factors, its clinical usefulness and validation is widely discussed. To assess the major factors that determine FMD values in a wide range of subjects with and without cardiovascular (CV) risk factors/diseases (CVRF/CVD). 617 consecutive patients (mean age: 50.1 ± 14.9 years, males: 349/56.5%) hospitalised between 2005 and 2011 were enrolled into the study. Demographic data and CVRF/CVD with a significant impact on FMD values were analysed: hyperlipidaemia, active smoking, arterial hypertension, coronary artery disease, diabetes mellitus and heart valve disease. The population was divided depending on the number of coexisting CVRF/CVD (0-, 1-, 2-, 3-, 4-, 5-CVRF/CVD groups). The median FMD value in the entire group of patients was 10% (5-17). An analysis of the FMD percentage in particular groups showed significantly higher FMD values in patients without any CVRF/CVD (group 0), as well as in patients with one coexisting CVRF/CVD (group 1) compared to the other groups. The presence of two or more CVRF/CVD was not associated with a significantly higher FMD reduction. The analysis of patients with only one CVRF/CVD revealed the lowest FMD values in patients with coronary artery disease. FMD is related to the number of traditional CVRF/CVDs; however, coronary artery disease has the most significant influence on FMD decrease among analysed factors. The value of FMD assessment in high risk patients is limited.

  9. Surveillance of foot-and-mouth disease (FMD) in susceptible wildlife and domestic ungulates in Southeast of Bulgaria following a FMD case in wild boar.

    PubMed

    Alexandrov, Tsviatko; Stefanov, Dimitar; Kamenov, Pencho; Miteva, Alexandra; Khomenko, Sergei; Sumption, Keith; Meyer-Gerbaulet, Hinrich; Depner, Klaus

    2013-09-27

    Following a foot-and-mouth disease (FMD) case of serotype O in wild boar in Southeast of Bulgaria, notified in January 2011 and eleven FMD outbreaks in livestock, a control and eradication plan according to the EU legislation was implemented. Based on the epidemiological considerations a "Cordon Sanitaire" along the border to Turkey, consisting of a defined infected area (1240 km(2)) and two areas of risk (2160 km(2)) was established. Within these areas a total of 812 wild boar, 68 roe deer, 7 red deer and 2 mouflons, hunted between February 2011 and January 2012, were tested for the presence of FMD. No FMD virus could be detected. Seropositive animals were found in wild boar (6.9%) and roe deer (4.4%), most of them spatially clustered around the FMD outbreaks in livestock, limited within a radius of 20 km. The outbreaks in domestic ungulates were controlled in the framework of EU legislation, including stamping out, standstill and no use of vaccination. All villages within the Cordon Sanitaire were examined for the presence of FMD according to the control and eradication plan. Neither clinical signs nor seroconversion was detected and the region could regain its status of FMD freedom without vaccination. The relatively low seroprevalence and clustered spatial distribution of seropositive wild boar and roe deer suggest that the FMD infection in wildlife was mainly a short living event, which failed to develop into a large scale epidemic. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Optimized setup for integral refractive index direct determination applying digital holographic microscopy by reflection and transmission

    NASA Astrophysics Data System (ADS)

    Frómeta, M.; Moreno, G.; Ricardo, J.; Arias, Y.; Muramatsu, M.; Gomes, L. F.; Palácios, G.; Palácios, F.; Velázquez, H.; Valin, J. L.; Ramirez Q, L.

    2017-03-01

    In this paper the integral refractive index of a microscopic sample was directly measured by applying Digital Holographic Microscopy (DHM) capturing transmission and reflection holograms simultaneously, of the same sample's region, using Mach-Zehnder and Michelson micro interferometers for transmission and reflection holograms capture and modeling the 3D sample in a medium of known refractive index nm. The system was calibrated using standard polystyrene sphere immersed in water with known diameter and refractive index, and the method was applied for erythrocyte integral refractive index determination. The results are in accordance with predicted, the measurements error of the order of ± 0.005 in absolute values.

  11. Finite element analysis using NASTRAN applied to helicopter transmission vibration/noise reduction

    NASA Technical Reports Server (NTRS)

    Howells, R. W.; Sciarra, J. J.

    1975-01-01

    A finite element NASTRAN model of the complete forward rotor transmission housing for the Boeing Vertol CH-47 helicopter was developed and applied to reduce transmission vibration/noise at its source. In addition to a description of the model, a technique for vibration/noise prediction and reduction is outlined. Also included are the dynamic response as predicted by NASTRAN, test data, the use of strain energy methods to optimize the housing for minimum vibration/noise, and determination of design modifications which will be manufactured and tested. The techniques presented are not restricted to helicopters but are applicable to any power transmission system. The transmission housing model developed can be used further to evaluate static and dynamic stresses, thermal distortions, deflections and load paths, fail-safety/vulnerability, and composite materials.

  12. Measuring FMD in the brachial artery: how important is QRS gating?

    PubMed Central

    Kizhakekuttu, Tinoy J.; Gutterman, David D.; Phillips, Shane A.; Jurva, Jason W.; Arthur, Emily I. L.; Das, Emon

    2010-01-01

    Recommendations for the measurement of brachial flow-mediated dilation (FMD) typically suggest images be obtained at identical times in the cardiac cycle, usually end diastole (QRS complex onset). This recommendation presumes that inter-individual differences in arterial compliance are minimized. However, published evidence is conflicting. Furthermore, ECG gating is not available on many ultrasound systems; it requires an expensive software upgrade or increased image processing time. We tested whether analysis of images acquired with QRS gating or with the more simplified method of image averaging would yield similar results. We analyzed FMD and nitroglycerin-mediated dilation (NMD) in 29 adults with type 2 diabetes mellitus and in 31 older adults and 12 young adults without diabetes, yielding a range of brachial artery distensibility. FMD and NMD were measured using recommended QRS-gated brachial artery diameter measurements and, alternatively, the average brachial diameters over the entire R-R interval. We found strong agreement between both methods for FMD and NMD (intraclass correlation coefficients = 0.88–0.99). Measuring FMD and NMD using average diameter measurements significantly reduced post-image-processing time (658.9 ± 71.6 vs. 1,024.1 ± 167.6 s for QRS-gated analysis, P < 0.001). FMD and NMD measurements based on average diameter measurements can be performed without reducing accuracy. This finding may allow for simplification of FMD measurement and aid in the development of FMD as a potentially useful clinical tool. PMID:20671033

  13. Measuring FMD in the brachial artery: how important is QRS gating?

    PubMed

    Kizhakekuttu, Tinoy J; Gutterman, David D; Phillips, Shane A; Jurva, Jason W; Arthur, Emily I L; Das, Emon; Widlansky, Michael E

    2010-10-01

    Recommendations for the measurement of brachial flow-mediated dilation (FMD) typically suggest images be obtained at identical times in the cardiac cycle, usually end diastole (QRS complex onset). This recommendation presumes that inter-individual differences in arterial compliance are minimized. However, published evidence is conflicting. Furthermore, ECG gating is not available on many ultrasound systems; it requires an expensive software upgrade or increased image processing time. We tested whether analysis of images acquired with QRS gating or with the more simplified method of image averaging would yield similar results. We analyzed FMD and nitroglycerin-mediated dilation (NMD) in 29 adults with type 2 diabetes mellitus and in 31 older adults and 12 young adults without diabetes, yielding a range of brachial artery distensibility. FMD and NMD were measured using recommended QRS-gated brachial artery diameter measurements and, alternatively, the average brachial diameters over the entire R-R interval. We found strong agreement between both methods for FMD and NMD (intraclass correlation coefficients = 0.88-0.99). Measuring FMD and NMD using average diameter measurements significantly reduced post-image-processing time (658.9 ± 71.6 vs. 1,024.1 ± 167.6 s for QRS-gated analysis, P < 0.001). FMD and NMD measurements based on average diameter measurements can be performed without reducing accuracy. This finding may allow for simplification of FMD measurement and aid in the development of FMD as a potentially useful clinical tool.

  14. A case of mesenteric ischemia secondary to Fibromuscular Dysplasia (FMD) with a positive outcome after intervention.

    PubMed

    Patel, Neal C; Palmer, William C; Gill, Kanwar R S; Wallace, Michael B

    2012-10-01

    Fibromuscular dysplasia (FMD) is a non-inflammatory, non-atherosclerotic angiopathy, which commonly affects the renal and internal carotid arteries. Although rare, FMD has the potential of involving the mesenteric vasculature. Due its low incidence and relatively little knowledge concerning its risk factors and etiology, actual diagnosis of FMD involving the mesenteric vessels requires a very high degree of suspicion. Upon review of the few reported cases of FMD causing mesenteric ischemia, it is clear that therapeutic interventions are rarely discussed and that positive outcomes are even more uncommon. Herein, we present the case of a 47 year-old female with mesenteric ischemia secondary to FMD, which was diagnosed and treated originally with angioplasty, then repeat angioplasty with stent placement, and finally with a bypass graft. Ultimately, the patient had a positive outcome, including eight month follow-up.

  15. Global situation of foot-and-mouth disease (FMD)--a short review.

    PubMed

    Kesy, A

    2002-01-01

    This article reviews the actual world FMD situation. In 2000, fifty nine countries officially reported outbreaks of FMD. The disease occurred in Europe (Greece), Asia (Russia, Mongolia, Bangladesh, Cambodia, China, Japan, Laos, Nepal, Pakistan, Philippines, Republic of Korea, Taiwan, Thailand, Vietnam, Iran, Iraq, Turkey, in Caucasian region--Georgia, Azerbaijan and Armenia as well as in Kazakhstan, Kyrgyzstan, Turkmenistan and Tajikistan), Africa (Egypt, Kenya, Mauritania, South Africa, Tanzania, Uganda, Malawi, Namibia, Zambia and Zimbabwe) and in South America (Brazil, Colombia, Uruguay, Bolivia, Peru, Ecuador and Venezuela). In 2001, FMD was still spreading throughout the endemic regions and appeared in some of the west European countries--Great Britain, The Netherlands, France and Ireland. In South America, FMD occurred in Argentina, Uruguay, Brazil and Colombia. In Asia the FMD spread in Turkey, Iran, Afghanistan, Georgia, Azerbaijan, Mongolia, Kuwait, Bahrain, Yemen, Qatar, United Arab Emirates, Oman, Iran, Bhutan, Nepal, Malaysia, Philippines, Thailand and Taiwan. The FMD situation in Africa was unclear, but probably most countries in West, East and South Africa were affected. The most recent data of the OIE from May 2002 confirmed FMD outbreaks in population of pigs in Republic of Korea.

  16. New transmission line analogy applied to single and multilayered piezoelectric transducers.

    PubMed

    Dion, J L

    1993-01-01

    It is shown that a piezoelectric element vibrating in an extensional or shear mode can be modeled rigorously by systematic use of the transmission line analogy and the superposition theorem. A schematic representation of such an element which is in a way more intuitive than others representations is introduced. The stresses on the electroded faces are considered as sources of stress applied at the two ends of an acoustic transmission line, since the acoustical perturbations may be considered as originating on these faces. Using transmission line theory, a complete set of expressions is found for electrical impedance, acoustic stresses, and velocities. Computed results are exactly the same as those given by the classical method, even if the computation sequence is almost entirely different. An intuitive graphical model for a piezoelectric element is proposed. It is also shown that the acoustic velocities on opposite faces of an asymmetrical loaded piezoelectric plate are exactly equal at the antiresonance frequency when internal losses are neglected. The programs developed can be used efficiently for practical multilayered transducer design.

  17. Foot-and-mouth disease (FMD) in the Maghreb and its threat to southern European countries.

    PubMed

    Kardjadj, Moustafa

    2017-02-01

    Foot-and-mouth disease (FMD) is a highly contagious and transboundary viral disease of domesticated and wild cloven-hoofed animals. The present study summarizes the knowledge generated from the epidemiology, diagnosis, and surveillance of the disease in the Maghreb (2014-2015) in assessing its threat to southern European countries. Currently, two serotypes of the FMD virus (O and SAT-2) and four lineages are circulating in the Maghreb region. The introduction of serotype SAT-2 in Libya and Mauritania in 2012 and 2015 respectively sets their neighbors and subsequently south European countries at constant risk of FMD re-emergence. The potential pathways of FMD introduction to southern European countries from the Maghreb are the illegal introduction of infected animals and animal products, particularly meat or meat products carried by refugees.

  18. BoLA-DRB3 gene polymorphism and FMD resistance or susceptibility in Wanbei cattle.

    PubMed

    Lei, Wei; Liang, Qinglong; Jing, Luo; Wang, Chengmin; Wu, Xiaobing; He, Hongxuan

    2012-09-01

    For the further characterization of foot-and-mouth disease virus (FMDV)-induced foot-and-mouth disease, we investigated the association between polymorphism of BoLA-DRB3 gene and FMD resistance/susceptibility of Wanbei cattle challenged with FMDV. One hundred cattle were challenged with FMDV and exon 2 of BoLA-DRB3 genes was amplified by hemi-nested polymerase chain reaction from asymptomatic animals and from animals with FMD. PCR products were characterized by the RFLP technique using restriction enzymes Hae III. The results revealed extensive polymorphisms, 6 RFLP patterns were identified. By analyzing alleles and genotypic frequencies between healthy and infection with FMD cattle, we found that allele Hae III A was associated with susceptibility to FMD in Wanbei cattle (P < 0.05), whereas Hae III C was associated with resistance to FMD (P < 0.01) and may have a strong protective effect against FMD. Hae IIICC and Hae III BC genotype were associated with resistance to FMD (P < 0.01). By contrast, Hae III AA genotype was associated with susceptibility to FMD (P < 0.01). Sequence analysis show that 89 amino acids were translated in exon 2 of BoLA-DRB3 and 13.70 % of nucleotide mutated, which resulted in 14.61 % of amino acid change. One PKC, one Tyr and one CAMP phosphorylation were increased; the hydrophobicity and secondary structure of proteins produced change after amino acid substitution. These results revealed that Wanbei cattle had the ability of resistance to disease by mutation which result changes of the protein structure to perform the regulation of the cell using different signaling pathways in the long process of choice evolution.

  19. A model of malaria epidemiology involving weather, exposure and transmission applied to north East India.

    PubMed

    Goswami, Prashant; Murty, Upadhayula Suryanarayana; Mutheneni, Srinivasa Rao; Kukkuthady, Avinash; Krishnan, Swathi Trithala

    2012-01-01

    Quantitative relations between weather variables and malaria vector can enable pro-active control through meteorological monitoring. Such relations are also critical for reliable projections in a changing climate, especially since the vector abundance depends on a combination of weather variables, each in a given range. Further, such models need to be region-specific as vector population and exposure depend on regional characteristics. We consider days of genesis based on daily temperature, rainfall and humidity in given ranges. We define a single model parameter based on estimates of exposure and transmission to calibrate the model; the model is applied to 12 districts of Arunachal Pradesh, a region endemic to malaria. The epidemiological data is taken as blood samples that test positive. The meteorological data is adopted from NCEP daily Reanalysis on a global grid; population data is used to estimate exposure and transmission coefficients. The observed annual cycles (2006-2010) and the interannual variability (2002-2010) of epidemiology are well simulated for each of the 12 districts by the model. While no single weather variable like temperature can reproduce the observed epidemiology, a combination of temperature, rainfall and humidity provides an accurate description of the annual cycle as well as the inter annual variability over all the 12 districts. Inclusion of the three meteorological variables, along with the expressions for exposure and transmission, can quite accurately represent observed epidemiology over multiple locations and different years. The model is potentially useful for outbreak forecasts at short time scales through high resolution weather monitoring; however, validation with longer and independent epidemiological data is required for more robust estimation of realizable skill. While the model has been examined over a specific region, the basic algorithm is easily applicable to other regions; the model can account for shifting

  20. Effect of applied magnetic field on sound transmission loss of MR-based sandwich panels

    NASA Astrophysics Data System (ADS)

    Hemmatian, Masoud; Sedaghati, Ramin

    2017-02-01

    This study aims to investigate the sound transmission loss (STL) capability of sandwich panels treated with Magnetorheological (MR) fluids at low frequencies. An experimental setup has been designed to investigate the effect of the intensity of applied magnetic field on the natural frequencies and STL of a clamped circular panel. It is shown that the fundamental natural frequency of the MR sandwich panel increases in proportion to the applied magnetic field. In addition, the STL of the panel at the resonance frequency increases as the magnetic field is amplified. Furthermore, the classical plate theory and Ritz method have been utilized to develop the governing equations of motion of the finite multilayered circular panels comprising two elastic face sheets and MR fluid core layer. The radiated sound power from the panel is derived using Rayleigh integral as a function of the transverse velocity of the panel which is subsequently used to evaluate the STL. The theoretical study is validated comparing the simulation results with the experimental measurements. Experimental and analytical parametric study have also been conducted to study the effect of the core layers’ thickness on the natural frequency and the STL of sandwich panel.

  1. Improving the Effect and Efficiency of FMD Control by Enlarging Protection or Surveillance Zones.

    PubMed

    Halasa, Tariq; Toft, Nils; Boklund, Anette

    2015-01-01

    An epidemic of foot-and-mouth disease (FMD) in a FMD-free country with large exports of livestock and livestock products would result in profound economic damage. This could be reduced by rapid and efficient control of the disease spread. The objectives of this study were to estimate the economic impact of a hypothetical FMD outbreak in Denmark based on changes to the economic assumptions of the model, and to investigate whether the control of an FMD epidemic can be improved by combining the enlargement of protection or surveillance zones with pre-emptive depopulation or emergency vaccination. The stochastic spatial simulation model DTU-DADS was used to simulate the spread of FMD in Denmark. The control strategies were the basic EU and Danish strategy, pre-emptive depopulation, suppressive or protective vaccination, enlarging protection or surveillance zones, and a combination of pre-emptive depopulation or emergency vaccination with enlarged protection or surveillance zones. Herds are detected either based on basic detection through the appearance of clinical signs, or as a result of surveillance in the control zones. The economic analyses consisted of direct costs and export losses. Sensitivity analysis was performed on uncertain and potentially influential input parameters. Enlarging the surveillance zones from 10 to 15 km, combined with pre-emptive depopulation over a 1-km radius around detected herds resulted in the lowest total costs. This was still the case even when the different input parameters were changed in the sensitivity analysis. Changing the resources for clinical surveillance did not affect the epidemic consequences. In conclusion, an FMD epidemic in Denmark would have a larger economic impact on the agricultural sector than previously anticipated. Furthermore, the control of a potential FMD outbreak in Denmark may be improved by combining pre-emptive depopulation with an enlarged protection or surveillance zone.

  2. Truncated Bovine Integrin Alpha-v/Beta-6 as a Universal Capture Ligand for FMD Diagnosis.

    PubMed

    Shimmon, Gareth; Wood, Britta A; Morris, Alison; Mioulet, Valerie; Grazioli, Santina; Brocchi, Emiliana; Berryman, Stephen; Tuthill, Toby; King, Donald P; Burman, Alison; Jackson, Terry

    2016-01-01

    Foot-and-mouth disease (FMD) is endemic in many regions of the world and is one of the most prevalent epizootic animal diseases. FMD affects livestock, such as cattle, sheep, goats and pigs, and causes enormous economic losses due to reduced productivity and trade restrictions. Preparedness and early diagnosis are essential for effective control of FMD. Many diagnostic assays are dependent on raising high-affinity, anti-FMD virus (FMDV) serotype-specific antibodies in small animals (rabbits and guinea pigs) that give broad virus coverage. Here we show that soluble, truncated forms of bovine αvβ6 bind FMDV in an authentic RGD and divalent cation dependent interaction and can be used as the trapping reagent in a FMDV sandwich ELISA. In addition, inclusion of FLAG or His tags facilitates simple purification without the loss of virus binding. We also provide evidence that when combined with a guinea pig polyclonal serum, or serotype-specific monoclonal antibodies, the integrin can be used to detect viruses representative of all FMDV serotypes. We also show that recombinant FMDV empty capsids, with stabilising disulphide bonds, can serve as an antigen in the ELISA and can therefore replace inactivated virus antigen as a positive control for the assay. Our results demonstrate the potential use of bovine αvβ6 and FMDV empty capsids in FMD diagnostic assays.

  3. Truncated Bovine Integrin Alpha-v/Beta-6 as a Universal Capture Ligand for FMD Diagnosis

    PubMed Central

    Shimmon, Gareth; Wood, Britta A.; Morris, Alison; Mioulet, Valerie; Grazioli, Santina; Brocchi, Emiliana; Berryman, Stephen; Tuthill, Toby; King, Donald P.; Burman, Alison; Jackson, Terry

    2016-01-01

    Foot-and-mouth disease (FMD) is endemic in many regions of the world and is one of the most prevalent epizootic animal diseases. FMD affects livestock, such as cattle, sheep, goats and pigs, and causes enormous economic losses due to reduced productivity and trade restrictions. Preparedness and early diagnosis are essential for effective control of FMD. Many diagnostic assays are dependent on raising high-affinity, anti-FMD virus (FMDV) serotype-specific antibodies in small animals (rabbits and guinea pigs) that give broad virus coverage. Here we show that soluble, truncated forms of bovine αvβ6 bind FMDV in an authentic RGD and divalent cation dependent interaction and can be used as the trapping reagent in a FMDV sandwich ELISA. In addition, inclusion of FLAG or His tags facilitates simple purification without the loss of virus binding. We also provide evidence that when combined with a guinea pig polyclonal serum, or serotype-specific monoclonal antibodies, the integrin can be used to detect viruses representative of all FMDV serotypes. We also show that recombinant FMDV empty capsids, with stabilising disulphide bonds, can serve as an antigen in the ELISA and can therefore replace inactivated virus antigen as a positive control for the assay. Our results demonstrate the potential use of bovine αvβ6 and FMDV empty capsids in FMD diagnostic assays. PMID:27494135

  4. Applying shot boundary detection for automated crystal growth analysis during in situ transmission electron microscope experiments.

    PubMed

    Moeglein, W A; Griswold, R; Mehdi, B L; Browning, N D; Teuton, J

    2017-01-01

    In situ scanning transmission electron microscopy is being developed for numerous applications in the study of nucleation and growth under electrochemical driving forces. For this type of experiment, one of the key parameters is to identify when nucleation initiates. Typically, the process of identifying the moment that crystals begin to form is a manual process requiring the user to perform an observation and respond accordingly (adjust focus, magnification, translate the stage, etc.). However, as the speed of the cameras being used to perform these observations increases, the ability of a user to "catch" the important initial stage of nucleation decreases (there is more information that is available in the first few milliseconds of the process). Here, we show that video shot boundary detection can automatically detect frames where a change in the image occurs. We show that this method can be applied to quickly and accurately identify points of change during crystal growth. This technique allows for automated segmentation of a digital stream for further analysis and the assignment of arbitrary time stamps for the initiation of processes that are independent of the user's ability to observe and react.

  5. Tetrahedral node for Transmission-Line Modeling (TLM) applied to Bio-heat Transfer.

    PubMed

    Milan, Hugo F M; Gebremedhin, Kifle G

    2016-12-01

    Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, parallelepipeds are used to discretize three-dimensional problems. The drawback in using parallelepiped shapes is that instead of refining only the domain of interest, a large additional domain would also have to be refined, which results in increased computational time and memory space. In this paper, we developed a tetrahedral node for TLM applied to bio-heat transfer that does not have the drawback associated with the parallelepiped node. The model includes heat source, blood perfusion, boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. The predicted temperature and heat flux were compared against results from an analytical solution and the results agreed within 2% for a mesh size of 69,941 nodes and a time step of 5ms. The method was further validated against published results of maximum skin-surface temperature difference in a breast with and without tumor and the results agreed within 6%. The published results were obtained from a model that used parallelepiped TLM node. An open source software, TLMBHT, was written using the theory developed herein and is available for download free-of-charge. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Triangular node for Transmission-Line Modeling (TLM) applied to bio-heat transfer.

    PubMed

    Milan, Hugo F M; Gebremedhin, Kifle G

    2016-12-01

    Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, rectangles are used to discretize two-dimensional problems. The drawback in using rectangular shapes is that instead of refining only the domain of interest, a large additional domain will also be refined in the x and y axes, which results in increased computational time and memory space. In this paper, we developed a triangular node for TLM applied to bio-heat transfer that does not have the drawback associated with the rectangular nodes. The model includes heat source, blood perfusion (advection), boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. A matrix equation for TLM, which simplifies the solution of time-domain problems or solves steady-state problems, was also developed. The predicted results were compared against results obtained from the solution of a simplified two-dimensional problem, and they agreed within 1% for a mesh length of triangular faces of 59µm±9µm (mean±standard deviation) and a time step of 1ms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Improving Estimation Performance in Networked Control Systems Applying the Send-on-delta Transmission Method

    PubMed Central

    Nguyen, Vinh Hao; Suh, Young Soo

    2007-01-01

    This paper is concerned with improving performance of a state estimation problem over a network in which a send-on-delta (SOD) transmission method is used. The SOD method requires that a sensor node transmit data to the estimator node only if its measurement value changes more than a given specified δ value. This method has been explored and applied by researchers because of its efficiency in the network bandwidth improvement. However, when this method is used, it is not ensured that the estimator node receives data from the sensor nodes regularly at every estimation period. Therefore, we propose a method to reduce estimation error in case of no sensor data reception. When the estimator node does not receive data from the sensor node, the sensor value is known to be in a (−δi,+δi) interval from the last transmitted sensor value. This implicit information has been used to improve estimation performance in previous studies. The main contribution of this paper is to propose an algorithm, where the sensor value interval is reduced to (−δi/2,+δi/2) in certain situations. Thus, the proposed algorithm improves the overall estimation performance without any changes in the send-on-delta algorithms of the sensor nodes. Through numerical simulations, we demonstrate the feasibility and the usefulness of the proposed method.

  8. Perspectives on low voltage transmission electron microscopy as applied to cell biology.

    PubMed

    Bendayan, Moise; Paransky, Eugene

    2014-12-01

    Low voltage transmission electron microscopy (LVTEM) with accelerating voltages as low as 5 kV was applied to cell biology. To take advantage of the increased contrast given by LVTEM, tissue preparation was modified omitting all heavy metals such as osmium, uranium, and lead from the fixation, on block staining and counterstaining. Nonstained ultra-thin tissue sections (40 nm thick) generated highly contrasted images. While the aspect of the cells remains similar to that obtained by conventional TEM, some new substructures were revealed. The pancreatic acinar cells granules present a heterogeneous matrix with partitions corresponding to segregation of their different secretory proteins. Microvilli display their core of microfilaments anchored to the dense top membrane. Mitochondria revealed the presence of distinct particles along their cristea membranes that may correspond to the ATP synthase complexes or oxysomes. The dense nuclear chromatin displays a honey-comb appearance while distinct beads aligned along thin threads were seen in the dispersed chromatin. These new features revealed by LVTEM correlate with structures described or predicted through other approaches. Masking effects due to thickness of the tissue sections and to the presence of heavy metals must have prevented their observation by conventional TEM. Furthermore, the immunogold was adapted to LVTEM revealing nuclear lamin-A at the edge of the dense chromatin ribbons. Combining cytochemistry with LVTEM brings additional advantages to this new approach in cell biology.

  9. A modelling approach to support dynamic decision-making in the control of FMD epidemics.

    PubMed

    Ge, Lan; Mourits, Monique C M; Kristensen, Anders R; Huirne, Ruud B M

    2010-07-01

    Most studies on control strategies for contagious diseases such as foot-and-mouth disease (FMD) evaluate pre-defined control strategies and imply static decision-making during epidemic control. Such a static approach contradicts the dynamic nature of the decision-making process during epidemic control. This paper presents an integrated epidemic-economic modelling approach to support dynamic decision-making in controlling FMD epidemics. This new modelling approach reflects ongoing uncertainty about epidemic growth during epidemic control and provides information required by a dynamic decision process. As demonstrated for a Dutch FMD-case, the modelling approach outperforms static evaluation of pre-fixed control strategies by: (1) providing guidance to decision-making during the entire control process; and (2) generating more realistic estimation of the costs of overreacting or underreacting in choosing control options.

  10. Novel non-invasive method of measurement of endothelial function: enclosed-zone flow-mediated dilatation (ezFMD).

    PubMed

    Ukawa, Teiji; Takayanagi, Tsuneo; Morimoto, Haruka; Higashi, Yukihito; Idei, Naomi; Yoshizumi, Masao; Tsuji, Toshio

    2012-12-01

    Measurement of flow-mediated dilatation (FMD) is the conventional non-invasive method for assessment of endothelial function; however, it requires an expensive ultrasound system and high levels of technical skill. Therefore, we developed a novel method for measurement of endothelial function, namely, measurement of ezFMD. ezFMD estimates the degree of vasodilatation from the oscillation signals transmitted to a sphygmomanometer cuff attached to the upper arm. The objective of this study was to validate the principle underlying the measurement of ezFMD, and to evaluate the repeatability of the ezFMD measurements. We observed the blood vessel behavior and oscillometric pattern in ten subjects. When the cuff was inflated to the level of the mean blood pressure, the oscillation amplitude increased with increasing degree of vasodilatation. In experiment to evaluate the repeatability of the ezFMD measurement, the average difference between the paired measurements was 3.7 %, the standard deviation was 11.5 %, and the average coefficient of variation value for the 11 paired measurements was 23.7 %. These results suggest the validity of the principle underlying the measurement of the ezFMD for the assessment of endothelial function. And, this study suggests that the repeatability of the ezFMD measurements is superior to that of the conventional measurement of FMD.

  11. Trend in groundwater quality near FMD burials in agricultural region, South Korea

    NASA Astrophysics Data System (ADS)

    Lim, Jeong-Won; Lee, Kang-Kun

    2015-04-01

    After the nation-wide outbreak of Foot and Mouth Disease (FMD) in winter of 2010-2011, thousands of mass burial site had been built all over the country in Korea. Though the burial pits were partially lined with impermeable material, potential threat of leachate leakage was still in concern. In worry of leachate release from those livestock burials during decomposition of carcasses, groundwater samples from wells near the burials were collected and analyzed in between 2011 and 2013. Among the sample locations, 250 wells with monitoring priorities were chosen and had been watched continuously through the years. For trend analysis of groundwater quality, relations between land use types, distances to burial and nitrate concentrations are studied. Types of land use within 300 m radius of each well were investigated. Nitrate concentrations show proportional relations to the area of agricultural activity and inversely proportional to the area of forest. The proportionality decreased with both agricultural and forest area since 2011. When seasonal variation is concerned, slightly stronger proportionality is shown in dry season for both agricultural and forested area. For a qualitative analysis of the trend, non-parametric Kendall test is applied. Especially, regional Kendall test is implemented to find out spatial feature of nitrate concentration. Nitrate concentrations show slow but statistically significant deceasing trend for every well. When the wells are group according to their distances from the nearest burial pit, decreasing trend of nitrate concentration is shown in all groups. However, there was no consistency in significant factor among the groups. Considering the above mentioned results, the groundwater wells near the burials seem to be influence more from agricultural activities near the wells than from the burial leachate. The slow but significant decreasing trend in nitrate concentration is supposed as the result of an increasing governmental interest in

  12. Applying a New Parallelized Version of PSO Algorithm for Electrical Power Transmission

    NASA Astrophysics Data System (ADS)

    Zemzami, M.; Makhloufi, A.; Elhami, N.; Elhami, A.; Itmi, M.; Hmina, N.

    2017-06-01

    In this paper, the optimization of an electric power transmission material is presented giving specific consideration on material configuration and characteristics. The nature of electric power transmission networks makes it hard to manage. Thus, giving need for optimization. So the problem of optimization of electric power transmission as considered in this paper is improving the performance and reliability of the electricity pylon; the objective is to maximize resistance to load while reducing material usage and cost. For this purpose, we suggest a new version of PSO algorithm that allows the amelioration of its performance by introducing its parallelization associated to the concept of evolutionary neighborhoods. According to the experimental results, the proposed method is effective and outperforms basic PSO in terms of solution quality, accuracy, constraint handling, and time consuming.

  13. Preliminary risk analysis applied to the transmission of Creutzfeldt-Jakob disease.

    PubMed

    Bertrand, E; Schlatter, J

    2011-01-01

    Transmissible spongiform encephalopathy (TSE) is a degenerative disease of the central nervous system. As yet, there is no human screening test and no effective treatment. This disease is invariably fatal. General preventive measures are therefore essential. The objective of this study is to analyze and address on a prioritized basis the risks relating to the transmission of Creutzfeldt-Jakob disease during surgical operations by means of a preliminary risk analysis (PRA). The PRA produces 63 scenarios with maximum risk relating to operational and legal dangers. The study recommends a number of courses of action, such as training and internal controls, in order to reduce the risks identified. A procedure has been drawn up and assessed for each action. This PRA makes it possible to target and significantly reduce the potential dangers for transmission of Creutzfeldt-Jakob disease through the use of medical instruments.

  14. Dissection and Aneurysm in Patients With Fibromuscular Dysplasia: Findings From the U.S. Registry for FMD.

    PubMed

    Kadian-Dodov, Daniella; Gornik, Heather L; Gu, Xiaokui; Froehlich, James; Bacharach, J Michael; Chi, Yung-Wei; Gray, Bruce H; Jaff, Michael R; Kim, Esther S H; Mace, Pamela; Sharma, Aditya; Kline-Rogers, Eva; White, Christopher; Olin, Jeffrey W

    2016-07-12

    Fibromuscular dysplasia (FMD) is a noninflammatory arterial disease that predominantly affects women. The arterial manifestations may include beading, stenosis, aneurysm, dissection, or tortuosity. This study compared the frequency, location, and outcomes of FMD patients with aneurysm and/or dissection to those of patients without. The U.S. Registry for FMD involves 12 clinical centers. This analysis included clinical history, diagnostic, and therapeutic procedure results for 921 FMD patients enrolled in the registry as of October 17, 2014. Aneurysm occurred in 200 patients (21.7%) and dissection in 237 patients (25.7%); in total, 384 patients (41.7%) had an aneurysm and/or a dissection by the time of FMD diagnosis. The extracranial carotid, renal, and intracranial arteries were the most common sites of aneurysm; dissection most often occurred in the extracranial carotid, vertebral, renal, and coronary arteries. FMD patients with dissection were younger at presentation (48.4 vs. 53.5 years of age, respectively; p < 0.0001) and experienced more neurological symptoms and other end-organ ischemic events than those without dissection. One-third of aneurysm patients (63 of 200) underwent therapeutic intervention for aneurysm repair. Patients with FMD have a high prevalence of aneurysm and/or dissection prior to or at the time of FMD diagnosis. Patients with dissection were more likely to experience ischemic events, and a significant number of patients with dissection or aneurysm underwent therapeutic procedures for these vascular events. Because of the high prevalence and associated morbidity in patients with FMD who have an aneurysm and/or dissection, it is recommended that every patient with FMD undergo one-time cross-sectional imaging from head to pelvis with computed tomographic angiography or magnetic resonance angiography. Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  15. Transmission

    SciTech Connect

    Sugano, K.

    1988-12-27

    A transmission is described which consists of: an input shaft; an output shaft; a first planetary gear set including a first sun gear selectively connectable by a first clutch to the input shaft, a first carrier selectively connectable by a second clutch to the input shaft and a first ring gear connected to the output shaft. The first sun gear selectively held stationary by a first brake, the first carrier is allowed to rotate in the same forward direction as the input shaft when the second clutch is engaged, but prevented from rotating in a reverse direction opposite to the forward direction by a first one-way clutch, the first carrier being selectively held stationary by a second brake; a second planetary gear set including a second sun gear connected to the input shaft, a second carrier connected to the first ring gear and also the the output shaft, and a second ring gear.

  16. Code to Optimize Load Sharing of Split-Torque Transmissions Applied to the Comanche Helicopter

    NASA Technical Reports Server (NTRS)

    1995-01-01

    Most helicopters now in service have a transmission with a planetary design. Studies have shown that some helicopters would be lighter and more reliable if they had a transmission with a split-torque design instead. However, a split-torque design has never been used by a U.S. helicopter manufacturer because there has been no proven method to ensure equal sharing of the load among the multiple load paths. The Sikorsky/Boeing team has chosen to use a split-torque transmission for the U.S. Army's Comanche helicopter, and Sikorsky Aircraft is designing and manufacturing the transmission. To help reduce the technical risk of fielding this helicopter, NASA and the Army have done the research jointly in cooperation with Sikorsky Aircraft. A theory was developed that equal load sharing could be achieved by proper configuration of the geartrain, and a computer code was completed in-house at the NASA Lewis Research Center to calculate this optimal configuration.

  17. Phase-shifting real-time holographic interferometry applied to load transmission evaluation in dried human skull.

    PubMed

    Gesualdi, Marcos R R; Mori, Matsuyoshi; Muramatsu, Mikiya; Liberti, Edson A; Munin, Egberto

    2007-08-01

    Phase-shifting real-time holography with photorefractive Bi(12)SiO(20) crystal as holographic recording medium applied to load transmission evaluation and tension dissipation on a dried human skull under loading is presented. The applied loading stands as a simulation of isolated contraction (SIC) of some masticatories muscles. The four-frames phase-shifting technique and the unwrapping branch-cut technique were used to obtain the phase map. The quantitative results show the feasibility of the employed system in the study of microdisplacements in the skull structure provided by SIC.

  18. Patterns, risk factors and characteristics of reported and perceived foot-and-mouth disease (FMD) in Uganda.

    PubMed

    Ayebazibwe, Chrisostom; Tjørnehøj, Kirsten; Mwiine, Frank N; Muwanika, Vincent B; Okurut, Anna Rose Ademun; Siegismund, Hans R; Alexandersen, Soren

    2010-10-01

    Patterns of outbreaks of foot-and-mouth disease (FMD) in Uganda were elucidated from spatial and temporal retrospective data retrieved from monthly reports from District Veterinary Officers (DVOs) to the central administration for the years spanning 2001-2008. An assessment of perceived FMD occurrence, risk factors and the associated characteristics was made based on semi-structured questionnaires administered to the DVOs. During this period, a total of 311 FMD outbreaks were reported in 56 (70%) out of Uganda's 80 districts. The number of reported FMD outbreaks changed over time and by geographical regions. Occurrence of FMD was significantly associated with the dry season months (p = 0.0346), the time when animals movements are more frequent. The average number of FMD outbreaks was higher for some sub-counties adjacent to national parks than for other sub-counties, whilst proximity to international border only seemed to play a role at the southern border. DVOs believed that the major risk factor for FMD outbreaks was animal movements (odds ratio OR 50.8, confidence interval CI 17.8-144.6) and that most outbreaks were caused by introduction of sick animals.

  19. Serum ADMA concentration-- an independent factor determining FMD impairment in cardiac syndrome X.

    PubMed

    Haberka, Maciej; Mizia-Stec, Katarzyna; Gasior, Zbigniew; Mizia, Magdalena; Janowska, Joanna; Holecki, Michał; Zahorska-Markiewicz, Barbara

    2009-01-01

    Mechanisms of decreased endogenous vascular reactivity in individuals with cardiac syndrome X (CSX) are not fully understood. To evaluate the following serum markers: total nitric oxide (NO), asymmetric dimethylarginine (ADMA), platelet-derived growth factor (PDGF), and to establish their relation to ultrasound indexes of endothelial function and structural remodeling in CSX patients. The study group consisted of 43 CSX patients (mean age: 56.3 +/- 9 years), while the control group included 21 healthy subjects (mean age: 54.86 +/- 6.9 years). The high-resolution ultrasound was performed to measure: flow-mediated vasodilatation (FMD), nitroglycerine-mediated vasodilatation (NMD) and intima-media thickness (IMT) of carotid arteries. In CSX patients, significantly lower FMD (9.06 +/- 3.2%) and significantly higher IMT (0.667 +/- 0.14 mm) values were observed compared to healthy individuals (17.42 +/- 8.4%, 0.571 +/- 0.2 mm; P < 0.05). Mean total NO serum concentration was significantly higher in the CSX group (48.2 +/- 18.2 micromol/L) as compared to controls (32.1 +/- 1.4 micromol/L; P < 0.0001). There were no differences in serum ADMA and PDGF levels. In CSX patients, FMD values correlated with NO (r = 0.323; P = 0.039) and ADMA (r = -0.387; P = 0.012) serum levels; however, there were no significant correlations between NO and ADMA concentrations. Serum ADMA concentration is the only independent factor determining FMD impairment.

  20. Montanide ISA™ 201 adjuvanted FMD vaccine induces improved immune responses and protection in cattle.

    PubMed

    Dar, Pervaiz; Kalaivanan, Ramya; Sied, Nuru; Mamo, Bedaso; Kishore, Subodh; Suryanarayana, V V S; Kondabattula, Ganesh

    2013-07-18

    Despite significant advancements in modern vaccinology, inactivated whole virus vaccines for foot-and-mouth disease (FMD) remain the mainstay for prophylactic and emergency uses. Many efforts are currently devoted to improve the immune responses and protective efficacy of these vaccines. Adjuvants, which are often used to potentiate immune responses, provide an excellent mean to improve the efficacy of FMD vaccines. This study aimed to evaluate three oil adjuvants namely: Montanide ISA-201, ISA-206 (SEPPIC, France) and GAHOL (an in-house developed oil-adjuvant) for adjuvant potential in inactivated FMD vaccine. Groups of cattle (n=6) were immunized once intramuscularly with monovalent FMDV 'O' vaccine formulated in these adjuvants, and humoral (serum neutralizing antibody, IgG1 and IgG2) and cellular (lymphoproliferation) responses were measured. Montanide ISA-201 adjuvanted vaccine induced earlier and higher neutralizing antibody responses as compared to the two other adjuvants. All the adjuvants induced mainly serum IgG1 isotype antibody responses against FMDV. However, Montanide ISA-201 induced relatively higher IgG2 responses than the other two adjuvants. Lymphoproliferative responses to recall FMDV antigen were relatively higher with Montanide ISA-201, although not always statistically significant. On homologous FMDV challenge at 30 days post-vaccination, 100% (6/6) of the cattle immunized with Montanide-201 adjuvanted vaccine were protected, which was superior to those immunized with ISA-206 (66.6%, 4/6) or GAHOL adjuvanted vaccine (50%, 3/6). Virus replication following challenge infection, as determined by presence of the viral genome in oropharynx and non-structural protein serology, was lowest with Montanide ISA-201 adjuvant. Collectively, these results indicate that the Montanide ISA-201 adjuvanted FMD vaccine induces enhanced immune responses and protective efficacy in cattle. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Electrical Resistivity Monitoring for Leachate Distribution at Two Foot-and-Mouth- Disease (FMD) Burial Sites

    NASA Astrophysics Data System (ADS)

    Lee, S.; Kaown, D.; Lee, K.; Leem, K.; Ko, K.

    2011-12-01

    The main objective of this study was to provide the basic information on leachate distribution with time changes through the electrical resistivity monitoring for a certain period of time in the Foot-and-Mouth-Disease (FMD) burial facilities which is needed to prevent further soil and groundwater contamination and to build an effective plan for stabilization of the burial site. In this study, dipole-dipoles surveys were carried out around two FMD burial sites in Iceon-si, Gyeonggi-do. The FMD burial facility installed at Daewall-myeon is consists of one block but, at Yul-myeon, it is divided into 2 blocks named A and B blocks. Dipole-Dipole surveys with 8 lines at Yul-myeon and 3 lines at Daewall-myeon were carried out. The observed leachate distribution along survey lines was not clearly evident as time passes at Daewall-myeon site, but, at Yul-myeon site, the leachate distribution around the survey lines showed a decrease of resistivity around the burial facility. At and around A and B blocks of Yul-myeon site, interpretations of the survey data show low resistivity zones below 10 Ωm from a depth 3 m to 10 m and such low resistivity zones of the A block are thicker than the B block by about 5~10 m. From the geochemical data and resistivity survey at two FMD burial sites, it is inferred that the groundwater within a 50-meter radius around burial facilities of the Yul-myeon site are contaminated by leachate. The general resistivity distribution around the burial site is seemed affected by the leachate with high electrical conductivity. The detail distribution patterns can be explained by local distributions of soil and weathered rocks and associated leachate flow. This subject is supported by Brain Korea 21 and Korea Ministry of Environment as 'The GAIA Project (173-092-009)'.

  2. Experimental and Numerical Study of Vibration Monitoring Applied on Gear Transmission Systems

    DTIC Science & Technology

    1996-04-01

    usiag vibratcn r’,easurements is rapidly established itself as a worthwhile techniques in modem industry . The analysis permit to characterize results...These de doctorat , I.N.S.A de Lyon, 1994, 198 p. [2]-RANDALL R.B., A new method of modelling gear faults, Jotr-tl of cý’hanical design, ASME, 1982, 104...m6canique d6veloppement. [10]-BARD C., Moddlisation du comportement dynamique des transmission par engrenages, These de Doctorat , [NSA de LYON, 1995, 292

  3. FMD virus isolates: the candidate strains for polyvalent vaccine development in Ethiopia.

    PubMed

    Ayelet, G; Soressa, M; Sisay, T; Belay, A; Gelaye, E; Jembere, S; Skjerve, E; Asmare, K

    2013-06-01

    The study was conducted on foot-and-mouth disease (FMD) viruses with the aim of selecting appropriate vaccinal strain to control of FMD in Ethiopia. The study was conducted in two-dimensional virus neutralization assay to determine the antigenic relationship 'r' value between the candidate vaccine strains and field isolates. A total of 21 serotype O, 7 serotype A, and 8 serotype SAT 2 FMD viruses, which were isolated from cattle and swine. A couple of isolates from each serotype were identified as vaccine candidates in the trial (O-ETH/38/2005, O-ETH/58/2008, A-ETH/7/2008, A-ETH/6/2000, SAT2-ETH/76/2009 and SAT2-ETH/64/2009). The finding revealed all the vaccine candidate depicted high antigenic similarity, above the mean "r" value, to their own serotypes in the studied serotype population except for one serotype A field isolate, A-ETH/13/1981, with "r" value=0.14 and 0.25) which is significantly lower than the minimum requirement. In general, the result indicated that these candidate vaccinal strains can be used for polyvalent vaccine production in the country. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. The expression of IL6 and 21 in crossbred calves upregulated by inactivated trivalent FMD vaccine.

    PubMed

    Gowane, G R; Sharma, A K; Sankar, M; Narayanan, K; Bisht, Punam; Subramaniam, S; Pattnaik, B

    2014-04-03

    Foot and mouth disease (FMD) is an economically important disease and a whole-virus inactivated trivalent virus vaccine is the mainstay for controlling the disease in India. The protective humoral immune response to FMD vaccination is a complex, but, tightly regulated process mediated by the interplay of interleukins (IL). Based on the specific role of IL6 and 21 in adaptive immune response, we hypothesized that inactivated trivalent FMD vaccine would stimulate IL6 and 21 expression in the circulating lymphocytes. The expressions of IL6 and 21 were assayed on 0, 28, 60, 90, and 120 d post-vaccination (DPV) by quantitative PCR (qPCR) with simultaneous assessment of FMDV antibody titer by liquid phase blocking ELISA. The results revealed that the peak expression of IL6 and 21 was on DPV 28 which correlated well with the FMDV antibody titer and plummeted to the prevaccination titer level by 60 DPV. As IL21 is the final effector of antibody production as compared to IL6, we investigated the expression of IL21 in calves that had protective titer (>1.8) with the unprotected group (<1.8). Expression of IL21 on 28 DPV was numerically higher in the protected than that of the unprotected group of calves.

  5. Suppression of transmission of malaria through source reduction: antianopheline measures applied in Israel, the United States, and Italy.

    PubMed

    Kitron, U; Spielman, A

    1989-01-01

    To provide a conceptual basis applicable to future antimalarial efforts, we sought to identify the sources of success in three notable campaigns that were consummated largely before DDT became available. A variety of measures directed against the aquatic stages of the anopheline vectors provided the main strategy for the antimalarial programs in Palestine/Israel, Italy, and the Tennessee River Valley of the United States. Source reduction-the modification or elimination of aquatic habitats to reduce mosquito breeding-was applied extensively and proved decisive. In all three regions, transmission of malaria was reduced to the point of extinction. Effective measures against anopheline larvae, in particular through source reduction, depend upon locally derived ecologic concepts that can be adapted to each vector species and applied continuously without limit of time. An integrated control program based on the long-term application of such measures can suppress transmission of malaria in edemic areas, as well as contain episodes of locally increased transmission of malaria.

  6. Effect of FMD vaccine antigen payload on protection, sub-clinical infection and persistence following needle challenge in sheep.

    PubMed

    Madhanmohan, Muthukrishnan; Nagendrakumar, Singanallur Balasubramanian; Narasu, Mangamoori Lakshmi; Srinivasan, Villuppanoor Alwar

    2010-12-01

    The relationship of Foot-and-Mouth Disease (FMD) virus antigen payload and single and double vaccinations in conferring protection against virus challenge in sheep was studied. Sheep vaccinated with half the cattle dose (1 ml) containing 15 and 3.75 μg of FMDV antigen with or without booster resisted virulent challenge on 21 days post vaccination or 7 days post booster. FMDV RNA could be detected in nasal secretions in 26% of vaccinated sheep (10(3.12) to 10(3.82) viral RNA copies) on day 35 post challenge. No live virus could be isolated after 5 days post challenge indicating that the risk of transmission of disease was probably very low. The finding showed that vaccines containing antigen payload of 1.88 μg may prevent or reduce the local virus replication at the oropharynx and shedding of virus from nasal secretions and thereby reduce the amount of virus released into the environment subsequent to exposure to live virus. Sheep with no vaccination or with poor sero conversion to vaccination can be infected without overt clinical signs and became carriers. Copyright © 2009 Elsevier Ltd. All rights reserved.

  7. New discoveries in the transmission biology of sleeping sickness parasites: applying the basics.

    PubMed

    MacGregor, Paula; Matthews, Keith R

    2010-09-01

    The sleeping sickness parasite, Trypanosoma brucei, must differentiate in response to the changing environments that it encounters during its complex life cycle. One developmental form, the bloodstream stumpy stage, plays an important role in infection dynamics and transmission of the parasite. Recent advances have shed light on the molecular mechanisms by which these stumpy forms differentiate as they are transmitted from the mammalian host to the insect vector of sleeping sickness, tsetse flies. These molecular advances now provide improved experimental tools for the study of stumpy formation and function within the mammalian bloodstream. They also offer new routes to therapy via high-throughput screens for agents that accelerate parasite development. Here, we shall discuss the recent advances that have been made and the prospects for future research now available.

  8. Cytochemical techniques and energy-filtering transmission electron microscopy applied to the study of parasitic protozoa

    PubMed Central

    Lins, Ulysses

    2001-01-01

    The study of parasitic protozoa plays a major role in cell biology, biochemistry and molecular biology. Numerous cytochemical techniques have been developed in order to unequivocally identify the nature of subcellular compartments. Enzyme and immuno-cytochemistry allow the detection of, respectively, enzymatic activity products and antigens in particular sites within the cell. Energy-filtering transmission electron microscopy permits the detection of specific elements within such compartments. These approaches are particularly useful for studies employing antimicrobial agents where cellular compartments may be destroyed or remarkably altered and thus hardly identified by standard methods of observation. In this regard cytochemical and spectroscopic techniques provide valuable data allowing the determination of the mechanisms of action of such compounds. PMID:12734583

  9. Renal FMD may not confer a familial hypertensive risk nor is it caused by ACTA2 mutations.

    PubMed

    Marks, Stephen D; Gullett, Ambrose M; Brennan, Eileen; Tullus, Kjell; Jaureguiberry, Graciana; Klootwijk, Enriko; Stanescu, Horia C; Kleta, Robert; Woolf, Adrian S

    2011-10-01

    Renal fibromuscular dysplasia (FMD) can cause hypertension, and previous reports suggest that FMD is familial. We hypothesized that, in families containing an individual with proven FMD, relatives of index cases would have an increased risk of hypertension. ACTA2 mutations cause a spectrum of extra-renal arteriopathy, leading to our second hypothesis that mutations are implicated in FMD. The blood pressure of first-degree relatives was measured using standard devices and, when indicated, with 24-h ambulatory monitoring. Leucocyte DNA was obtained from FMD index cases and ACTA2 sequenced. Thirteen unrelated index cases, aged 2-32 (median 15) years, were recruited. Blood pressure was assessed in 40 first-degree relatives, comprising 22 parents aged 28-58 (median 44) years and 18 siblings aged 3-30 (median 13) years. Hypertension was evident in six (27%) parents but in none of the eight adult siblings. Of the ten screened siblings aged less than 18 years, one teenager was pre-hypertensive (90th-95th centile), the remainder being normotensive. No ACTA2 mutations were found in 13 index cases. Hypertension was evident in 20% of all assessed adult first-degree relatives and is therefore not increased relative to 25% of the adult population. Although hypertensive parents did not undergo angiography to assign FMD status, this observation, together with the lack of hypertension in 18 siblings, indicates that FMD is unlikely to confer an excess hypertension risk in first-degree relatives up to middle-age. Furthermore, in our cohort, FMD was not caused by ACTA2 mutations.

  10. Prevention of virus transmission to macaque monkeys by a vaginally applied monoclonal antibody to HIV-1 gp120.

    PubMed

    Veazey, Ronald S; Shattock, Robin J; Pope, Melissa; Kirijan, J Christian; Jones, Jennifer; Hu, Qinxue; Ketas, Tom; Marx, Preston A; Klasse, Per Johan; Burton, Dennis R; Moore, John P

    2003-03-01

    A topical microbicide reduces the probability of virus transmission when applied to the vagina or rectum of a person at risk of sexually acquiring HIV-1 infection. An effective microbicide could significantly reduce the global spread of HIV-1, particularly if women were able to use it covertly to protect themselves. A microbicide could target the incoming virus and either permanently inactivate it or reduce its infectivity, or it could block receptors on susceptible cells near the sites of transmission. We describe here how vaginal administration of the broadly neutralizing human monoclonal antibody b12 can protect macaques from simian-human immunodeficiency virus (SHIV) infection through the vagina. Only 3 of 12 animals receiving 5 mg b12 vaginally in either saline or a gel and then challenged vaginally (up to 2 h later) with SHIV-162P4 became infected. In contrast, infection occurred in 12 of 13 animals given various control agents under similar conditions. Lower amounts of b12 were less effective, suggesting that protection was dose dependent. These observations support the concept that viral entry inhibitors can help prevent the sexual transmission of HIV-1 to humans.

  11. Investigations and improvements of digital holographic tomography applied for 3D studies of transmissive photonics microelements

    NASA Astrophysics Data System (ADS)

    Kujawinska, Malgorzata; Jozwicka, Agata; Kozacki, Tomasz

    2008-08-01

    In order to control performance of photonics microelements it is necessary to receive 3D information about their amplitude and phase distributions. To perform this task we propose to apply tomography based on projections gather by digital holography (DH). Specifically the DH capability to register several angular views of the object during a single hologram capture is employed, which may in future shorten significantly the measurement time or even allow for tomographic analysis of dynamic media. However such a new approach brings a lot of new issues to be considered. Therefore, in this paper the method limitations, with special emphasis on holographic reconstruction process, are investigated through extensive numerical experiments with special focus on 3D refractive index distribution determination.. The main errors and means of their elimination are presented. The possibility of 3D refractive index distribution determination by means of DHT is proved numerically and experimentally.

  12. SAT2 foot and mouth disease (FMD) outbreak in a mixed farm in Egypt.

    PubMed

    Byom, Ahmed M

    2015-01-01

    A dairy farm keeping Holstein cattle and buffaloes in the Menoufia Governorate was investigated during and after the last Foot and Mouth Disease (FMD) outbreak in Egypt (starting February 2012) to determine the impact of the outbreak on animals as well as to assess some factors that might have helped to spread the disease in the investigated farm. All animals were vaccinated against FMD with the locally produced bivalent vaccine containing O1 and A/Egy/2006 strains two months before the onset of the outbreak. Laboratory examination of the samples collected from diseased and dead animals' revealed detection of a newly emerged serotype of FMD (SAT2). Although, all buffaloes (8/8) in the herd were infected (100%), none of them died, while lactating Holstein cattle showed varying morbidity rates along the period of the outbreak with peak rates in March followed by April, May and June. Crud mortality and case fatality rates among cattle peaked during April 2012 to reach 9.3 and 21.7%, respectively. Calves were the most affected animals with the highest morbidities and mortalities. The high prevalence of the disease among all animal categories in the investigated farm is attributed to the lack of previous immunity through vaccination against the new serotype of the virus. In addition, the hygienic and biosecurity measures in the farm were unsatisfactory with respect to prevention of introduction and spread of the disease between the farm units. The prevalent weather conditions during the outbreak might have played a role in spread of the FMDv, especially ambient temperature, humidity and wind movement.

  13. Effect of FMD vaccination on semen quality parameters in Karan Fries and Murrah buffalo bulls.

    PubMed

    Bhakat, Mukesh; Mohanty, Tushar K; Gupta, Ashok K; Raina, Virendra S; Brahma, Biswajit; Mahapatra, R K; Sarkar, M

    2010-10-01

    Effect of Foot and Mouth disease (FMD) vaccination was studied on semen quality parameters of 19 Karan Fries (KF) and eight Murrah (MU) breeding bulls during the period 2002 to 2004 at Artificial Breeding Complex, NDRI, Karnal. A total of non-vaccinated 155 KF and 72 MU bulls' ejaculates were taken as control, while 169 KF and 51 MU bulls' ejaculates, collected after vaccination, were used to study the effect of vaccination stress. The results showed that FMD vaccination had no significant (P > 0.05) effect on ejaculate volume and total volume per day of semen in both KF and MU bulls. Volume of semen increased slightly during post-vaccination period in both the breeds. After FMD vaccination, there was significant (P < 0.01) decrease in mass activity (2.27 +/- 0.06 vs. 1.67 +/- 0.07 and 2.49 +/- 0.09. vs. 1.75 +/- 0.10, for KF and MU, respectively), initial motility (56.89 +/- 0.03% vs. 44.62 +/- 0.02% and 62.26 +/- 0.04% vs. 47.08 +/- 0.05%, for KF and MU, respectively), sperm concentration (754.19 +/- 23.96 vs. 554.14 +/- 22.95 x 10(6)/ml and 848.61 +/- 33.65 vs. 571.57 +/- 39.99 x 10(6)/ml, for KF and MU, respectively), and total sperm output per ejaculate (3,685.94 +/- 158.40 vs. 2,781.54 +/- 151.70 x 10(6) and 2,218.75 +/- 133.14 vs. 1,582.84 +/- 158.20 x 10(6), for KF and MU, respectively). Application of FMD vaccine had significantly (P < 0.05) adverse effect on most of the seminal attributes during post-vaccination in KF and MU buffalo bulls. So, the spermiograms affected following vaccination suggest that in bovines, the semen collection and preservation should be suspended till normal fertility of sperm is restored to avoid the failure of conception from artificial insemination using such semen.

  14. a Continuous Health Monitoring Guided Wave Fmd System for Retrofit to Existing Offshore Oilrigs

    NASA Astrophysics Data System (ADS)

    Mijarez, R.; Solis, L.; Martinez, F.

    2010-02-01

    An automatic health monitoring guided wave flood member detection (FMD) system, for retrofit to existing offshore oilrigs is presented. The system employs a microcontroller piezoelectric (PZT) based transmitter and a receiver instrumentation package composed of a PZT 40 kHz ultrasound transducer and a digital signal processor (DSP) module connected to a PC via USB for monitoring purposes. The transmitter and receiver were attached, non-intrusively, to the external wall of a steel tube; 1 m×27 cm×2 mm. Experiments performed in the laboratory have successfully identified automatically flooded tubes.

  15. [Veterinary medicine in the media society--science and media in relation to FMD].

    PubMed

    Quandt, S

    2001-12-01

    The outbreak and explosive spread of foot-and-mouth disease in the European Union brought about an intense discussion in the media. FMD was an outstanding media topic in Germany. But the scientific experts of veterinary medicine had no prominent role in this public debate. The reason for this fact seemed to be a lack of competence to present themselves and their knowledge in the media arena. The scientists should try to fit themselves in the media society by training their communication competence.

  16. Quantum Monte Carlo method applied to non-Markovian barrier transmission

    NASA Astrophysics Data System (ADS)

    Hupin, Guillaume; Lacroix, Denis

    2010-01-01

    In nuclear fusion and fission, fluctuation and dissipation arise because of the coupling of collective degrees of freedom with internal excitations. Close to the barrier, quantum, statistical, and non-Markovian effects are expected to be important. In this work, a new approach based on quantum Monte Carlo addressing this problem is presented. The exact dynamics of a system coupled to an environment is replaced by a set of stochastic evolutions of the system density. The quantum Monte Carlo method is applied to systems with quadratic potentials. In all ranges of temperature and coupling, the stochastic method matches the exact evolution, showing that non-Markovian effects can be simulated accurately. A comparison with other theories, such as Nakajima-Zwanzig or time-convolutionless, shows that only the latter can be competitive if the expansion in terms of coupling constant is made at least to fourth order. A systematic study of the inverted parabola case is made at different temperatures and coupling constants. The asymptotic passing probability is estimated by different approaches including the Markovian limit. Large differences with an exact result are seen in the latter case or when only second order in the coupling strength is considered, as is generally assumed in nuclear transport models. In contrast, if fourth order in the coupling or quantum Monte Carlo method is used, a perfect agreement is obtained.

  17. A registration-based approach to quantify flow-mediated dilation (FMD) of the brachial artery in ultrasound image sequences.

    PubMed

    Frangi, Alejandro F; Laclaustra, Martín; Lamata, Pablo

    2003-11-01

    Flow-mediated dilation (FMD) offers a mechanism to characterize endothelial function and, therefore, may play a role in the diagnosis of cardiovascular diseases. Computerized analysis techniques are very desirable to give accuracy and objectivity to the measurements. Virtually all methods proposed up to now to measure FMD rely on accurate edge detection of the arterial wall, and they are not always robust in the presence of poor image quality or image artifacts. A novel method for automatic dilation assessment based on a global image analysis strategy is presented. We model interframe arterial dilation as a superposition of a rigid motion and a scaling factor perpendicular to the artery. Rigid motion can be interpreted as a global compensation for patient and probe movements, an aspect that has not been sufficiently studied before. The scaling factor explains arterial dilation. The ultrasound sequence is analyzed in two phases using image registration to recover both transformation models. Temporal continuity in the registration parameters along the sequence is enforced with a Kalman filter since the dilation process is known to be a gradual physiological phenomenon. Comparing automated and gold standard measurements (average of manual measurements) we found a negligible bias (0.05%FMD) and a small standard deviation (SD) of the differences (1.05%FMD). These values are comparable with those obtained from manual measurements (bias = 0.23%FMD, SD(intra-obs) = 1.13%FMD, SD(inter-obs) 1.20%FMD). The proposed method offers also better reproducibility (CV = 0.40%) than the manual measurements (CV = 1.04%).

  18. An approach to a FMD vaccine based on genetic engineered attenuated pseudorabies virus: one experiment using VP1 gene alone generates an antibody responds on FMD and pseudorabies in swine.

    PubMed

    Qian, Ping; Li, Xiang-Min; Jin, Mei-Lin; Peng, Gui-Qing; Chen, Huan-Chun

    2004-06-02

    Foot-and-mouth disease (FMD) and pseudorabies (PR) are two important infectious diseases in swine. An attenuated pseudorabies virus (PRV) has been successfully used as a gene delivery vector for the development of live-viral vaccines. In this study, a recombinant PRV-VP1 virus was constructed by fusioning the VP1 gene of FMD virus in frame to the N-terminal sequence of the gG gene of PRV. To test the protective immunity, 15 FMDV sero-negative white swine were divided into three groups and immunized with the recombinant PRV-VP1 virus, commercial FMD vaccine and vector virus (TK(-)/gG(-)/LacZ(+)), respectively, and challenged intramuscularly with 20 minimal infecting doses (MID) of virulent type O FMDV 4 weeks after booster immunization. Swine vaccinated with PRV-VP1 acquired antibodies against both FMDV and PRV, however, anti-FMDV antibodies were much lower than those vaccinated with the commercial FMD vaccine. Our results suggested that the recombinant PRV-VP1 virus, which only expressed FMDV VP1 gene controlled by PRV gG promoter, could not protect swine from the challenge of 20 MID type O FMDV, but could delay and reduce the clinical symptoms of FMD.

  19. Effective transmission conditions for domain decomposition methods applied to the time-harmonic curl-curl Maxwell's equations

    NASA Astrophysics Data System (ADS)

    Dolean, Victorita; Gander, Martin J.; Lanteri, Stephane; Lee, Jin-Fa; Peng, Zhen

    2015-01-01

    The time-harmonic Maxwell equations describe the propagation of electromagnetic waves and are therefore fundamental for the simulation of many modern devices we have become used to in everyday life. The numerical solution of these equations is hampered by two fundamental problems: first, in the high frequency regime, very fine meshes need to be used in order to avoid the pollution effect well known for the Helmholtz equation, and second the large scale systems obtained from the vector valued equations in three spatial dimensions need to be solved by iterative methods, since direct factorizations are not feasible any more at that scale. As for the Helmholtz equation, classical iterative methods applied to discretized Maxwell equations have severe convergence problems. We explain in this paper a family of domain decomposition methods based on well chosen transmission conditions. We show that all transmission conditions proposed so far in the literature, both for the first and second order formulation of Maxwell's equations, can be written and optimized in the common framework of optimized Schwarz methods, independently of the first or second order formulation one uses, and the performance of the corresponding algorithms is identical. We use a decomposition into transverse electric and transverse magnetic fields to describe these algorithms, which greatly simplifies the convergence analysis of the methods. We illustrate the performance of our algorithms with large scale numerical simulations.

  20. Effect of cell and microvillus mechanics on the transmission of applied loads to single bonds in dynamic force spectroscopy

    NASA Astrophysics Data System (ADS)

    Gupta, V. K.; Eggleton, C. D.

    2011-07-01

    Receptor-ligand interactions that mediate cellular adhesion are often subjected to forces that regulate their detachment via modulating off-rates. Although the dynamics of detachment is primarily controlled by the physical chemistry of adhesion molecules, cellular features such as cell deformability and microvillus viscoelasticity have been shown to affect the rolling velocity of leukocytes in vitro through experiments and simulation. In this work, we demonstrate via various micromechanical models of two cells adhered by a single (intramolecular) bond that cell deformability and microvillus viscoelasticity modulate transmission of an applied external load to an intramolecular bond, and thus the dynamics of detachment. Specifically, it is demonstrated that the intermolecular bond force is not equivalent to the instantaneous applied force and that the instantaneous bond force decreases with cellular and microvillus compliance. As cellular compliance increases, not only does the time lag between the applied load and the bond force increase, an initial response time is observed during which cell deformation is observed without transfer of force to the bond. It is further demonstrated that following tether formation the instantaneous intramoleular bond force increases linearly at a rate dependent on microvillus viscosity. Monte Carlo simulations with fixed kinetic parameters predict that both cell and microvillus compliance increase the average rupture time, although the average rupture force based on bond length remains nearly unchanged.

  1. Can a combination of handgrip exercise and prolonged forearm occlusion elicit a maximal brachial artery FMD response?

    PubMed

    Ku, Jennifer; McEvoy, Alana; Pyke, Kyra E

    2014-06-01

    The upper limit of brachial artery (BA) flow-mediated dilation (FMD) has not been thoroughly interrogated, and long duration occlusion + handgrip exercise may create larger shear stress stimuli than previous manipulations. To determine whether novel combinations of occlusion + handgrip exercise can extend the range of FMD stimulus-response relationship characterization and permit identification of a BA-FMD response ceiling. Ten healthy subjects performed eight reactive hyperemia (RH) FMD trials: 5, 10, and 15 min of occlusion (5RH, 10RH, 15RH); 5, 10 and 15 min of occlusion + 3-min ischemic exercise (IE) (5IE, 10IE, 15IE); 10 and 15 min of occlusion + 3-min IE + 4-min post-occlusion exercise (PE) (10IEPE, 15IEPE). Shear stress was estimated as shear rate (SR = blood velocity/BA diameter; (ultrasound assessment)) (SR stimulus = area under the curve (AUC) until peak diameter). Data are mean ± SE. There were no differences in SR-AUC among IE and IEPE trials (p > 0.70), however, IE consistently increased the SR-AUC (IE + IEPE trial average 17,845.1 ± 2,023.3 a.u.) vs. the 5RH and 10RH trials (4,943.0 ± 428.4 a.u., 6,800.6 ± 805.9 a.u.) (p < 0.05). The %FMD ranged from 7.3 ± 0.8% (5RH) to 19.1 ± 2.0% (15IEPE) (p < 0.001) with no differences among IE and IEPE trials (p > 0.16). FMD increased with increasing SR-AUC (all subjects, all trials: r(2) 0.36, p < 0.001) CONCLUSIONS: The stimulus created by brief (5 min) occlusion + ischemic exercise was not significantly enhanced by prolonging occlusion or continuing to exercise post-occlusion. The FMD response did not clearly plateau with increasing stimulus magnitude; however, the FMD capacity was shown to be more than double the FMD magnitude that was elicited with a standard 5-min occlusion test.

  2. Application of non-structural protein ELISA kits in nationwide FMD surveillance in pigs to demonstrate virus circulation in Taiwan.

    PubMed

    Chen, S P; Lee, M C; Sun, Y F; Yang, P C

    2011-09-28

    Large scale surveillance of FMD non-structural protein (NSP) antibody in pigs was conducted to monitor for FMD virus circulation in Taiwan using Ceditest and UBI NSP ELISA kits after recurrence of FMD in 2009. A total of 53,759 serum samples were collected from pigs in the auction markets in 2009. There were 43 farms with positive FMD NSP reactors to both NSP ELISA tests in the nationwide surveillance. After tracing back, clinical examination and the NSP ELISA testing using both Ceditest and UBI on 14 follow-up serum samples from all the herds with confirmed NSP reactors in 2009, there were 4 farms classified as positive on follow-up testing criteria. In this surveillance, we have demonstrated that the NSP ELISA tests of outbreak farms followed by clinical and serological investigation could be used to detect FMD circulation in the pig population in Taiwan even while the national compulsory vaccination program is ongoing. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. A controlled comparison of brachial artery flow mediated dilation (FMD) and digital pulse amplitude tonometry (PAT) in the assessment of endothelial function in systemic lupus erythematosus.

    PubMed

    Aizer, J; Karlson, E W; Chibnik, L B; Costenbader, K H; Post, D; Liang, M H; Gall, V; Gerhard-Herman, M D

    2009-03-01

    The utility of flow mediated dilation (FMD) a measure of endothelial function is limited by operator dependence. Pulse amplitude tonometry (PAT) is a novel, less operator-dependent technique to assess endothelial function. This study compares PAT to FMD in SLE and controls. Thirty women with SLE and 31 controls were enrolled. Medications, cardiovascular disease and risk factors, SLE activity (SLAM-R) and damage (SLICC-DI) were recorded. FMD and PAT were performed simultaneously. Endothelium-independent function was assessed with nitroglycerin. Average age was 48.3 +/- 10.1 years, SLE duration 16.2 years, SLAM-R 8.3 and SLICC-DI 1.0. Framingham Risk Scores were < or =2% in most subjects. There were no differences between SLE cases and controls in FMD, PAT or response to nitroglycerin. This study found no association between FMD and PAT in SLE or controls. In the 17 SLE cases with a history of Raynaud's, correlation between FMD and PAT was 0.50 (P = 0.04). There was no difference in endothelial function assessed by FMD or PAT in SLE cases versus controls. FMD did not correlate with PAT except in SLE cases with a history of Raynaud's. Correlation between FMD and PAT may be stronger in populations with greater variation in endothelial function and more cardiovascular risk factors.

  4. Is fibromuscular dysplasia underdiagnosed? A comparison of the prevalence of FMD seen in CORAL trial participants versus a single institution population of renal donor candidates.

    PubMed

    Hendricks, Nicholas J; Matsumoto, Alan H; Angle, John F; Baheti, Aparna; Sabri, Saher S; Park, Auh W; Stone, James R; Patrie, James T; Dworkin, Lance; Cooper, Christopher J; Murphy, Timothy P; Cutlip, Donald E

    2014-10-01

    Renal artery fibromuscular dysplasia (FMD) may be underdiagnosed. We evaluated the prevalence of FMD in CORAL (Cardiovascular Outcomes in Renal Atherosclerotic Lesions) renal artery stent trial participants, in which FMD was an exclusion criterion for inclusion. We also evaluated the prevalence of FMD in a relatively healthy population of patients undergoing computed tomographic angiographic (CTA) screening for renal donor evaluation. All renal donor CTAs performed at our institution from January 2003 through November 2011 were retrospectively reviewed for the presence of FMD along with patient sex and age. These results were compared to angiographic core lab (ACL) findings for the CORAL trial. The CORAL ACL database contained 997 patients (mean age 69.3 years; 50% female). Fifty-eight (5.8%) CORAL trial patients (mean age 71.8 years; 75.9% female) demonstrated incidental FMD. The renal donor cohort included 220 patients (mean age 40.5 years; 64.5% female). Five (2.3%) demonstrated FMD (mean age 48.6 years; all female). The odds of FMD in the CORAL cohort were 2.65 times that seen in the renal donor cohort (95% CI: 1.12, 7.57). In C: onclusion, the 5.8% prevalence of renal artery FMD in the CORAL trial population, the presence of which was biased against, suggests underdiagnosis. © The Author(s) 2014.

  5. Prioritization of Managed Pork Supply Movements during a FMD Outbreak in the US

    PubMed Central

    Patterson, Gilbert R.; Mohr, Alicia H.; Snider, Tim P.; Lindsay, Thomas A.; Davies, Peter R.; Goldsmith, Tim J.; Sampedro, Fernando

    2016-01-01

    In the event of a foot-and-mouth disease (FMD) outbreak in the United States, local, state, and federal authorities will implement a foreign animal disease emergency response plan restricting the pork supply chain movements and likely disrupting the continuity of the swine industry business. To minimize disruptions of the food supply while providing an effective response in an outbreak, it is necessary to have proactive measures in place to ensure minimal disease spread and maximum continuation of business. Therefore, it is critical to identify candidate movements for proactive risk assessments: those that are both most likely to contribute to disease spread and most necessary for business continuity. To do this, experts from production, harvest, retail, and allied pork industries assessed 30 common pork supply movements for risk of disease spread and industry criticality. The highest priority movements for conducting a risk assessment included the movement of weaned pigs originating from multiple sow farm sources to an off-site nursery or wean to finish facility, the movement of employees or commercial crews, the movement of vaccination crews, the movement of dedicated livestock hauling trucks, and the movement of commercial crews such as manure haulers and feed trucks onto, off, or between sites. These critical movements, along with several others identified in this study, will provide an initial guide for prioritization of risk management efforts and resources to be better prepared in the event of a FMD outbreak in the United States. By specifically and proactively targeting movements that experts agree are likely to spread the disease and are critical to the continuity of business operations, potentially catastrophic consequences in the event of an outbreak can be limited. PMID:27843934

  6. Prioritization of Managed Pork Supply Movements during a FMD Outbreak in the US.

    PubMed

    Patterson, Gilbert R; Mohr, Alicia H; Snider, Tim P; Lindsay, Thomas A; Davies, Peter R; Goldsmith, Tim J; Sampedro, Fernando

    2016-01-01

    In the event of a foot-and-mouth disease (FMD) outbreak in the United States, local, state, and federal authorities will implement a foreign animal disease emergency response plan restricting the pork supply chain movements and likely disrupting the continuity of the swine industry business. To minimize disruptions of the food supply while providing an effective response in an outbreak, it is necessary to have proactive measures in place to ensure minimal disease spread and maximum continuation of business. Therefore, it is critical to identify candidate movements for proactive risk assessments: those that are both most likely to contribute to disease spread and most necessary for business continuity. To do this, experts from production, harvest, retail, and allied pork industries assessed 30 common pork supply movements for risk of disease spread and industry criticality. The highest priority movements for conducting a risk assessment included the movement of weaned pigs originating from multiple sow farm sources to an off-site nursery or wean to finish facility, the movement of employees or commercial crews, the movement of vaccination crews, the movement of dedicated livestock hauling trucks, and the movement of commercial crews such as manure haulers and feed trucks onto, off, or between sites. These critical movements, along with several others identified in this study, will provide an initial guide for prioritization of risk management efforts and resources to be better prepared in the event of a FMD outbreak in the United States. By specifically and proactively targeting movements that experts agree are likely to spread the disease and are critical to the continuity of business operations, potentially catastrophic consequences in the event of an outbreak can be limited.

  7. Foot-and-mouth Disease Transmission in Africa: Implications for Control, a Review.

    PubMed

    Tekleghiorghis, T; Moormann, R J M; Weerdmeester, K; Dekker, A

    2016-04-01

    In Africa, for the control of foot-and-mouth disease (FMD), more information is needed on the spread of the disease at local, regional and inter-regional level. The aim of this review is to identify the role that animal husbandry, trade and wildlife have on the transmission of FMD and to provide a scientific basis for different FMD control measures in Africa. Review of literature, published reports and databases shows that there is more long distance spread of FMD virus serotypes within North, West, Central and East Africa than in southern Africa. In North, West, Central and East Africa migratory animal husbandry systems often related with search for grazing and water as well as trade are practiced to a greater extent than in southern Africa. In southern Africa, the role of African buffalo (Syncerus caffer) is more extensively studied than in the other parts of Africa, but based on the densities of African buffalo in Central and East Africa, one would assume that buffalo should also play a role in the epidemiology of FMD in this part of Africa. More sampling of buffalo is necessary in West, Central and East Africa. The genetic analysis of virus strains has proven to be valuable to increase our understanding in the spread of FMD in Africa. This review shows that there is a difference in FMD occurrence between southern Africa and the rest of the continent; this distinction is most likely based on differences in animal husbandry and trade systems. Insufficient data on FMD in wildlife outside southern Africa is limiting our understanding on the role wildlife plays in the transmission of FMD in the other buffalo inhabited areas of Africa. © 2014 Blackwell Verlag GmbH.

  8. Extended RF shimming: Sequence-level parallel transmission optimization applied to steady-state free precession MRI of the heart.

    PubMed

    Beqiri, Arian; Price, Anthony N; Padormo, Francesco; Hajnal, Joseph V; Malik, Shaihan J

    2017-06-01

    Cardiac magnetic resonance imaging (MRI) at high field presents challenges because of the high specific absorption rate and significant transmit field (B1(+) ) inhomogeneities. Parallel transmission MRI offers the ability to correct for both issues at the level of individual radiofrequency (RF) pulses, but must operate within strict hardware and safety constraints. The constraints are themselves affected by sequence parameters, such as the RF pulse duration and TR, meaning that an overall optimal operating point exists for a given sequence. This work seeks to obtain optimal performance by performing a 'sequence-level' optimization in which pulse sequence parameters are included as part of an RF shimming calculation. The method is applied to balanced steady-state free precession cardiac MRI with the objective of minimizing TR, hence reducing the imaging duration. Results are demonstrated using an eight-channel parallel transmit system operating at 3 T, with an in vivo study carried out on seven male subjects of varying body mass index (BMI). Compared with single-channel operation, a mean-squared-error shimming approach leads to reduced imaging durations of 32 ± 3% with simultaneous improvement in flip angle homogeneity of 32 ± 8% within the myocardium. © 2017 The Authors. NMR in Biomedicine published by John Wiley & Sons Ltd.

  9. Preparation of FMD type A87/IRN inactivated vaccine by gamma irradiation and the immune response on guinea pig.

    PubMed

    Sedeh, Farahnaz Motamedi; Khorasani, Akbar; Shafaee, Kamal; Fatolahi, Hadi; Arbabi, Kourosh

    2008-09-01

    FMD is one of the most economically damaging diseases that affect livestock animals. In this study FMD Virus type A87/IRN was multiplied on BHK21 cells. The virus was titrated by TCID50 method, it was 10(7.5)/ml. The FMD virus samples were inactivated by gamma ray from 60Co source at -20°C. Safety test was done by IBRS2 monolayer cell culture method, also antigenicity of irradiated and un-irradiated virus samples were studied by Complement Fixation Test. The Dose/Survival curve for irradiated FMD Virus was drawn, the optimum dose range for inactivation of FMDV type A87/IRN and unaltered antigenicity was obtained 40-44 kGy. The inactivated virus samples by irradiation and ethyleneimine (EI) were formulated respectively as vaccine with Al(OH)3 gel and other substances. The vaccines were inoculated to Guinea pigs and the results of Serum Neutralization Test for the normal vaccine and radio-vaccine showed protective titer after 8 months. The potency test of the inactivated vaccines was done, PD50 Value of the vaccines were calculated 7.06 and 5.6 for inactivated vaccine by EI and gamma irradiation respectively.

  10. Sero-prevalence of foot-and-mouth disease (FMD) in large ruminants at peri urban dairy farms near Islamabad, Pakistan

    USDA-ARS?s Scientific Manuscript database

    Foot-and-mouth disease (FMD) is an important, endemic, trans-boundary viral disease affecting livestock in Pakistan and associated with high economic losses. This survey was conducted to estimate sero-prevalence of FMD in large ruminants from peri-urban dairy farms near Islamabad. Serum samples were...

  11. Association of cytokines with endothelium dependent flow mediated vasodilation (FMD) of systemic arteries in patients with non-ischemic cardiomyopathy.

    PubMed

    Vallbracht-Israng, Katja B; Kazak, Ilkay; Schwimmbeck, Peter L

    2007-12-10

    Aim of this study was to elucidate the relation between localised inflammatory heart disease and endothelial dysfunction in the peripheral circulation, considering circulating cytokines as a potential link. In 38 patients with non-ischemic heart disease, myocardial biopsies were examined for myocardial inflammation (immunohistology) and virus persistence (PCR). Cytokines (sIL-4, IFN-g, IFN-b, IFN-a, sIL-12p7, TNF-a) were measured by ELISA in venous serum. Endothelial function of the radial artery was examined by ultrasound, measuring diameter changes in response to reactive hyperemia (FMD), compared to glyceroltrinitrate (GTN-MD). Patients with EF < 35% were excluded. Age 44 +/- 14 years, 19 male, 19 female, EF 63.5[16]%. FMD 4.38 [4.82]%. 30 patients had myocardial inflammation (8 not), 23 virus persistence (15 not). FMD correlated significantly with sIL-12p7 (p = 0.024, r = -0.365), but not with other cytokines. sIL-12p7 levels were significantly higher in patients with severely impaired FMD (n = 17), compared with normal FMD (n = 21): 10.70 [10.72] vs. 4.33 [7.81] pg/ml (p = 0.002). Endothelium independent vasodilation (GTN-MD 23.67 [8.21]%) was not impaired. Endothelial dysfunction of peripheral arteries in patients with non-ischemic cardiomyopathy is associated with elevated serum concentrations of sIL-12p7, but not of other cytokines. Circulating sIL-12p7 may partly explain, that endothelial dysfunction is not restricted to the coronary circulation, but involves systemic arteries.

  12. The Reusable Load Cell with Protection Applied for Online Monitoring of Overhead Transmission Lines Based on Fiber Bragg Grating.

    PubMed

    Ma, Guoming; Mao, Naiqiang; Li, Yabo; Jiang, Jun; Zhou, Hongyang; Li, Chengrong

    2016-06-21

    Heavy ice coating of high-voltage overhead transmission lines may lead to conductor breakage and tower collapse causing the unexpected interrupt of power supply. The optical load cell applied in ice monitoring systems is immune to electromagnetic interference and has no need of a power supply on site. Therefore, it has become a hot research topic in China and other countries. In this paper, to solve the problem of eccentric load in measurement, we adopt the shearing structure with additional grooves to improve the strain distribution and acquire good repeatability. Then, the fiber Bragg grating (FBG) with a permanent weldable package are mounted onto the front/rear groove of the elastic element by spot welding, the direction deviation of FBGs is 90° from each other to achieve temperature compensation without an extra FBG. After that, protection parts are designed to guarantee high sensitivity for a light load condition and industrial safety under a heavy load up to 65 kN. The results of tension experiments indicate that the sensitivity and resolution of the load cell is 0.1285 pm/N and 7.782 N in the conventional measuring range (0-10 kN). Heavy load tension experiments prove that the protection structure works and the sensitivity and resolution are not changed after several high load (65 kN) cycles. In addition, the experiment shows that the resolution of the sensor is 87.79 N in the large load range, allowing the parameter to be used in heavy icing monitoring.

  13. The Reusable Load Cell with Protection Applied for Online Monitoring of Overhead Transmission Lines Based on Fiber Bragg Grating

    PubMed Central

    Ma, Guoming; Mao, Naiqiang; Li, Yabo; Jiang, Jun; Zhou, Hongyang; Li, Chengrong

    2016-01-01

    Heavy ice coating of high–voltage overhead transmission lines may lead to conductor breakage and tower collapse causing the unexpected interrupt of power supply. The optical load cell applied in ice monitoring systems is immune to electromagnetic interference and has no need of a power supply on site. Therefore, it has become a hot research topic in China and other countries. In this paper, to solve the problem of eccentric load in measurement, we adopt the shearing structure with additional grooves to improve the strain distribution and acquire good repeatability. Then, the fiber Bragg grating (FBG) with a permanent weldable package are mounted onto the front/rear groove of the elastic element by spot welding, the direction deviation of FBGs is 90° from each other to achieve temperature compensation without an extra FBG. After that, protection parts are designed to guarantee high sensitivity for a light load condition and industrial safety under a heavy load up to 65 kN. The results of tension experiments indicate that the sensitivity and resolution of the load cell is 0.1285 pm/N and 7.782 N in the conventional measuring range (0–10 kN). Heavy load tension experiments prove that the protection structure works and the sensitivity and resolution are not changed after several high load (65 kN) cycles. In addition, the experiment shows that the resolution of the sensor is 87.79 N in the large load range, allowing the parameter to be used in heavy icing monitoring. PMID:27338403

  14. Risk evaluation of nonvaccinated, weaned calves transported through areas under systematic foot and mouth disease (FMD) vaccination.

    PubMed

    Leanes, L F; Abbiati, N N; Pereyra, A M; Maizon, D O

    2011-02-01

    The recurrence and persistence of foot and mouth disease (FMD) could be the consequence of cyclic and massive transportation of calves. For this reason, in South America, vaccination strategies related to livestock dynamic are being promoted. In order to aid the evaluation of such strategies, a method for predicting the risk of transportation of nonvaccinated weaned calves was developed; this method combines expert opinion and empirical evidence using Bayesian estimators. It was applied through Monte Carlo simulation to data of Argentina under four hypothetical vaccination schemes: E1, extended vaccination season of 1/6 of the population of calves each month from July to December without second round vaccination (SRV); E2, extended irregular vaccination from July to December with SRV applied to 70% of the calves resembling the scheme applied in Argentina in 2001; E3, vaccination in November and December without SRV; and E4, vaccination concentrated in November. E1 resulted in probability of transporting non vaccinated calves (tnvc) reaching its maximum in the following year in May with mean=0.0250 and percentile 95% (P95)=0.0404; for the same month tnvc estimates for the other schemes were E2: mean=0.0071; P95=0.0162; E3: mean=0.0017; P95=0.0042 and E4: mean=0.0001; P95=0.0004. Bonferroni multiple comparison for simultaneous assertions for May showed that E4 resulted the best scheme, E1 the worst, and E2 and E3 are intermediate with nonsignificant difference observed between overall (p<0.05). Results were consistent with historical records and quantification for future needs for re-vaccination was made possible. While the ratio "total vaccinated"/"total estimated existences" will give a biased vision of vaccination coverage under the situation of extended vaccination campaigns, a model as the one developed here could allow a more accurate assessment and the design of mitigation plans. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Effect of weight loss on inflammatory and endothelial markers and FMD using two low-fat diets.

    PubMed

    Clifton, P M; Keogh, J B; Foster, P R; Noakes, M

    2005-12-01

    Cardiovascular disease is strongly associated with obesity and there is evidence that weight loss has positive effects on cardiovascular disease risk. The aims of this study were to compare meal replacements (MR) with a conventional low-fat diet as weight loss strategies and to examine the effect of weight loss on flow-mediated dilatation (FMD) and other markers of endothelial function in overweight Australians with raised triglycerides (TG) (> 2 mmol/l). Subjects matched for age, gender, fasting plasma TG and body mass index were randomized to two low- fat high- carbohydrate weight loss strategies (both < 6000 kJ), one using MR and the other a structured eating plan, control (C). Subjects followed both diets for 3 months. In total, 55 subjects completed the study. FMD, pulse wave velocity and blood pressure (BP) were measured at baseline and at 3 months, as were fasting blood samples for lipids, glucose, insulin, C reactive protein (CRP) and endothelium-derived factors. Mean weight loss was 6.3 +/- 3.7 kg (6.0 +/- 4.2 vs 6.63 +/- 3.35 kg, MR vs C) with no difference between diet groups. TG, insulin, CRP, plasminogen activator inhibitor 1 (PAI-1) and soluble intracellular adhesion molecule-1 (sICAM1) fell after weight loss, but FMD did not change. Systolic BP fell by 8 mmHg and pulse wave velocity improved. In subjects with elevated TG, weight loss resulted in significant improvements in cardiovascular risk markers, particularly endothelium-derived factors (PAI-1 and sICAM1). However, FMD did not improve with weight loss.

  16. Cutting Balloon Angioplasty (CBA) for the Treatment of Renal Artery Fibromuscular Dysplasia (FMD) in Six Patients: 5-Year Long-Term Results.

    PubMed

    Cotroneo, Antonio Raffaele; Amoroso, Luigi; Giammarino, Alberto; Galasso, Daniele; Taglialatela, Francesco; Timpani, Carmine; Gabrielli, Daniela

    2017-04-01

    To evaluate long-term outcomes in terms of hypertension control, recurrent stenosis, and reinterventions from patients who underwent cutting balloon angioplasty (CBA) for symptomatic renal artery fibromuscular dysplasia (FMD). From 2011, six consecutive renal artery FMD women underwent CBA for poorly controlled hypertension, despite antihypertensive therapy. Follow-up consisted of blood pressure monitoring and duplex ultrasonography at 1, 6, and 12 months and thereafter annually for 5 years. All treatments were technically successful. Recurrence of hypertension was found in two patients within 12 months, and reinterventions were performed using CBA. Results show the efficacy of CBA for renal artery FMD.

  17. Recombinant non-structural polyprotein 3AB-based serodiagnostic strategy for FMD surveillance in bovines irrespective of vaccination.

    PubMed

    Mohapatra, Jajati K; Pandey, Laxmi K; Sanyal, Aniket; Pattnaik, Bramhadev

    2011-11-01

    In India, the proportion of bovines vaccinated against foot-and-mouth disease (FMD) is increasing since the implementation of the Government supported 'FMD Control Programme', and non-structural protein (NSP)-based serological assays for discriminating between antibodies induced by infection or vaccination (DIVA) could be useful. The FMD virus NSP 3AB was expressed in a prokaryotic system and an indirect ELISA (r3AB(3) I-ELISA) was developed and validated as a screening assay for detecting virus in vaccinated bovines. The diagnostic sensitivity of the assay was estimated to be 96%, while the diagnostic specificity varied between the naïve and vaccinates as 99.1% and 96.4%, respectively. This assay could detect antibodies to 3AB (3AB-Ab) from 10 to as late as 900 days post-infection in cattle infected experimentally. The "in-house" assay demonstrated higher sensitivity than a commercial 3ABC ELISA kit particularly with samples obtained from the late stages of infection. Transient post-vaccinal 3AB-Ab response could be detected in one of the three commercial vaccines during the six-month vaccination regimen, which emphasizes the fact that for a DIVA-compatible diagnostic strategy to be a realistic option, all vaccines need to be quality checked for the NSP content. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Foot-and-mouth disease virus 3C protease mutant L127P: Implications for FMD vaccine development.

    PubMed

    Puckette, Michael; Clark, Benjamin A; Smith, Justin D; Turecek, Traci; Martel, Erica; Gabbert, Lindsay; Pisano, Melia; Hurtle, William; Pacheco, Juan M; Barrera, José; Neilan, John G; Rasmussen, Max

    2017-09-06

    The foot-and-mouth disease virus (FMDV) afflicts livestock in more than 80 countries limiting food production and global trade. Production of foot-and-mouth disease (FMD) vaccines requires cytosolic expression of the FMDV 3C protease to cleave the P1 polyprotein into mature capsid proteins, but the FMDV 3C protease is toxic to host cells. To identify less toxic isoforms of the FMDV 3C protease, we screened 3C mutants for increased transgene output over wild-type 3C using a Gaussia luciferase reporter system. The novel point-mutation 3C(L127P) increased yields of recombinant FMDV subunit proteins in mammalian and bacterial cells expressing P1-3C transgenes and retained the ability to process P1 polyproteins from multiple FMDV serotypes. The 3C(L127P) mutant produced crystalline-arrays of FMDV virus-like particles in mammalian and bacterial cells, potentially providing a practical method of rapid, inexpensive FMD vaccine production in bacteria.Importance: The mutant FMDV 3C protease L127P significantly increased yields of recombinant FMDV subunit antigens and produced virus-like particles in mammalian and bacterial cells. The L127P mutation provides a novel advancement for economical FMD vaccine production. Copyright © 2017 Puckette et al.

  19. Theory of forward and reverse middle-ear transmission applied to otoacoustic emissions in infant and adult ears

    PubMed Central

    Keefe, Douglas H.; Abdala, Carolina

    2008-01-01

    The purpose of this study is to understand why otoacoustic emission (OAE) levels are higher in normal-hearing human infants relative to adults. In a previous study, distortion product (DP) OAE input/output (I/O) functions were shown to differ at f2=6 kHz in adults compared to infants through 6 months of age. These DPOAE I/O functions were used to noninvasively assess immaturities in forward/reverse transmission through the ear canal and middle ear [Abdala, C., and Keefe, D. H., (2006). J. Acoust Soc. Am. 120, 3832–3842]. In the present study, ear-canal reflectance and DPOAEs measured in the same ears were analyzed using a scattering-matrix model of forward and reverse transmission in the ear canal, middle ear, and cochlea. Reflectance measurements were sensitive to frequency-dependent effects of ear-canal and middle-ear transmission that differed across OAE type and subject age. Results indicated that DPOAE levels were larger in infants mainly because the reverse middle-ear transmittance level varied with ear-canal area, which differed by more than a factor of 7 between term infants and adults. The forward middle-ear transmittance level was −16 dB less in infants, so that the conductive efficiency was poorer in infants than adults. PMID:17348521

  20. Investigation of airborne foot-and-mouth disease virus transmission during low-wind conditions in the early phase of the UK 2001 epidemic

    NASA Astrophysics Data System (ADS)

    Mikkelsen, T.; Alexandersen, S.; Astrup, P.; Champion, H. J.; Donaldson, A. I.; Dunkerley, F. N.; Gloster, J.; Sørensen, J. H.; Thykier-Nielsen, S.

    2003-11-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed domesticated and wild animals. The highly contagious nature of FMD is a reflection of the wide range of host species, the enormous quantities of virus liberated by infected animals, the range of excretions and secretions which can be infectious, the stability of the virus in the environment, the multiplicity of routes of infection and the very small doses of the virus that can initiate infection. One of the mechanisms of spread is the carriage of droplets and droplet nuclei exhaled in the breath of infected animals. Such spread can be rapid and extensive, and it is known in certain circumstances to have transmitted disease over a distance of several hundred kilometres. During the 2001 FMD epidemic in the United Kingdom (UK), atmospheric dispersion models were applied in real time in order to assess the potential for atmospheric dispersion of the disease. The operational value of such modelling is primarily to identify premises which may have been exposed so that the human resources for surveillance and disease control purposes are employed most effectively.

    The paper describes the combined modelling techniques and presents the results obtained of detailed analyses performed during the early stages of the UK 2001 epidemic. This paper investigates the potential for disease spread in relation to two outbreaks (Burnside Farm, Heddon-on-the-Wall and Prestwick Hall Farm, Ponteland, Northumberland). A separate paper (Gloster et al., 2002) provides a more detailed analysis of the airborne disease transmission in the vicinity of Burnside Farm.

    The combined results are consistent with airborne transmission of disease to livestock in the Heddon-on-the-Wall area. Local topography may have played a significant role in influencing the pattern of disease spread.

  1. Investigation of airborne foot-and-mouth disease virus transmission during low-wind conditions in the early phase of the UK 2001 epidemic

    NASA Astrophysics Data System (ADS)

    Mikkelsen, T.; Alexandersen, S.; Astrup, P.; Champion, H. J.; Donaldson, A. I.; Dunkerley, F. N.; Gloster, J.; Sørensen, J. H.; Thykier-Nielsen, S.

    2003-02-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed domesticated and wild animals. The highly contagious nature of FMD is a reflection of the wide range of host species, the enormous quantities of virus liberated by infected animals, the range of excretions and secretions which can be infectious, the stability of the virus in the environment, the multiplicity of routes of infection and the very small doses of the virus that can initiate infection. One of the mechanisms of spread is the carriage of droplets and droplet nuclei exhaled in the breath of infected animals. Such spread can be rapid and extensive, and it is known in certain circumstances to have transmitted disease over a distance of several hundred kilometres. During the 2001 FMD epidemic in the United Kingdom (UK), atmospheric dispersion models were applied in real time in order to assess the potential for atmospheric dispersion of the disease. The operational value of such modelling is primarily to identify premises which may have been exposed so that the human resources for surveillance and disease control purposes are employed most effectively. The paper describes the combined modelling techniques and presents the results obtained of detailed analyses performed during the early stages of the UK 2001 epidemic. This paper investigates the potential for disease spread in relation to two outbreaks (Burnside Farm, Heddon-on-the-Wall and Prestwick Hall Farm, Ponteland, Northumberland). A separate paper (Gloster et al., 2002) provides a more detailed analysis of the airborne disease transmission in the vicinity of Burnside Farm. The combined results are consistent with airborne transmission of disease to livestock in the Heddon-on-the Wall area. Local topography may have played a significant role in influencing the pattern of disease spread.

  2. Policy and science of FMD control: the stakeholders' contribution to decision making. A call for integrated animal disease management.

    PubMed

    Marshall, M; Roger, P

    Effective control of foot-and-mouth disease (FMD)--prevention, surveillance and response--requires integrated animal disease management as a cooperative effort between stakeholders, scientists and decision makers, at all levels: local, national, regional and international. This paper suggests a process and outlines specific critical issues that need to be addressed in order to best use the science and technology that is available now and to develop new technologies that will lead to significant improvements. The overall objective is not to allow the disease or the disease control measures to damage, violate or destroy public health, the environment, or the economy, or to allow politics to drive disease control policies at the expense of the ethical relationship between man and animals. Critical issues of prevention, surveillance and response policies are examined, and specific recommendations are made to reduce the risk or effect of natural and deliberate introductions. For prevention: a) rapid portable diagnostics and provision of vaccines to control and eradicate the reservoirs of disease. b) alerts, leading to increased controls at borders, animal movement restrictions and biosecurity on farms. For surveillance: a) reporting of unusual symptoms, rapid diagnostics and identification of patterns. b) enhanced role of geographic information systems (GIS) linked to an IT system. c) collection, storage and sharing of disease information. For response policies: a) the role and implementation of stamping out and of vaccination. b) simulation exercises with stakeholder participation. For all aspects of FMD control, consideration should be given to: a) the composition, responsibilities and role of the balanced, permanently operational Expert Group in EU member states as specified in the EU FMD Directive. b) establishment of a balanced, permanently operational European Expert Group. c) establishment of both a European and an International FMD Task Force. Stakeholders need

  3. Targeting inflammation using salsalate in patients with type 2 diabetes: effects on flow-mediated dilation (TINSAL-FMD).

    PubMed

    Goldfine, Allison B; Buck, J Stewart; Desouza, Cyrus; Fonseca, Vivian; Chen, Yii-Der Ida; Shoelson, Steven E; Jablonski, Kathleen A; Creager, Mark A

    2013-12-01

    To test whether inhibiting inflammation with salsalate improves endothelial function in patients with type 2 diabetes (T2D). We conducted an ancillary study to the National Institutes of Health-sponsored, multicenter, randomized, double-masked, placebo-controlled trial evaluating the safety and efficacy of salsalate in targeting inflammation to improve glycemia in patients with T2D. Flow-mediated, endothelium-dependent dilation (FMD) and endothelium-independent, nitroglycerin-mediated dilation (NMD) of the brachial artery were assessed at baseline and 3 and 6 months following randomization to either salsalate 3.5 g/day or placebo. The primary end point was change in FMD at 6 months. A total of 88 participants were enrolled in the study, and data after randomization were available for 75. Patients in the treatment and control groups had similar ages (56 years), BMI (33 kg/m(2)), sex (64% male), ethnicity, current treatment, and baseline HbA1c (7.7% [61 mmol/mol]). In patients treated with salsalate versus placebo, HbA1c was reduced by 0.46% (5.0 mmol/mol; P < 0.001), fasting glucose by 16.1 mg/dL (P < 0.001), and white blood cell count by 430 cells/µL (P < 0.02). There was no difference in the mean change in either FMD (0.70% [95% CI -0.86 to 2.25%]; P = 0.38) or NMD (-0.59% [95% CI -2.70 to 1.51%]; P = 0.57) between the groups treated with salsalate and placebo at 6 months. Total and LDL cholesterol were 11 and 16 mg/dL higher, respectively, and urinary albumin was 2.0 µg/mg creatinine higher in the patients treated with salsalate compared with those treated with placebo (all P < 0.009). Salsalate does not change FMD in peripheral conduit arteries in patients with T2D despite lowering HbA1c. This finding suggests that salsalate does not have an effect on vascular inflammation, inflammation does not cause endothelial dysfunction in T2D, or confounding effects of salsalate mitigate favorable effects on endothelial function.

  4. Endothelial Function Is Impaired in Patients Receiving Antihypertensive Drug Treatment Regardless of Blood Pressure Level: FMD-J Study (Flow-Mediated Dilation Japan).

    PubMed

    Maruhashi, Tatsuya; Soga, Junko; Fujimura, Noritaka; Idei, Naomi; Mikami, Shinsuke; Iwamoto, Yumiko; Iwamoto, Akimichi; Kajikawa, Masato; Matsumoto, Takeshi; Oda, Nozomu; Kishimoto, Shinji; Matsui, Shogo; Hashimoto, Haruki; Aibara, Yoshiki; Yusoff, Farina Binti Mohamad; Hidaka, Takayuki; Kihara, Yasuki; Chayama, Kazuaki; Noma, Kensuke; Nakashima, Ayumu; Goto, Chikara; Tomiyama, Hirofumi; Takase, Bonpei; Kohro, Takahide; Suzuki, Toru; Ishizu, Tomoko; Ueda, Shinichiro; Yamazaki, Tsutomu; Furumoto, Tomoo; Kario, Kazuomi; Inoue, Teruo; Koba, Shinji; Watanabe, Kentaro; Takemoto, Yasuhiko; Hano, Takuzo; Sata, Masataka; Ishibashi, Yutaka; Node, Koichi; Maemura, Koji; Ohya, Yusuke; Furukawa, Taiji; Ito, Hiroshi; Ikeda, Hisao; Yamashina, Akira; Higashi, Yukihito

    2017-10-01

    Hypertension is associated with endothelial dysfunction. Blood pressure significantly correlates with endothelial function in antihypertensive drug-naive subjects. The purpose of this study was to determine whether treatment status affects the relationship between blood pressure and endothelial function. We measured flow-mediated vasodilation (FMD) in 2297 subjects, including 1822 antihypertensive drug-naive subjects and 475 treated hypertensive patients. FMD significantly decreased in relation to increase in systolic blood pressure (8.2±3.1% in subjects with systolic blood pressure of <120 mm Hg, 7.5±2.8% for 120-129 mm Hg, 7.1±2.8% for 130-139 mm Hg, and 6.7±2.6% for ≥140 mm Hg; P<0.001). Systolic blood pressure was independently associated with FMD in untreated subjects. In contrast, there was no significant relationship between systolic blood pressure and FMD in treated hypertensive patients (4.6±3.1% in treated hypertensives with systolic blood pressure of <120 mm Hg, 4.8±2.7% for 120-129 mm Hg, 4.9±2.8% for 130-139 mm Hg, and 4.5±2.3% for ≥140 mm Hg; P=0.77). Propensity score matching analysis revealed that the prevalence of endothelial dysfunction defined as FMD of less than the division point for the lowest tertile, and the middle tertile of FMD was significantly higher in treated hypertensive patients than in untreated subjects in all systolic blood pressure categories. Endothelial function assessed by FMD was impaired regardless of the level of blood pressure achieved by antihypertensive drug treatment in hypertensive patients. © 2017 American Heart Association, Inc.

  5. Meta-analysis on the efficacy of routine vaccination against foot and mouth disease (FMD) in China.

    PubMed

    Cai, Chang; Li, Huachun; Edwards, John; Hawkins, Chris; Robertson, Ian D

    2014-08-01

    Foot and mouth disease (FMD) outbreaks have been reported in China for many years. Recently, due to the rapid economic development, the price of meat and its demand have grown quickly. This trend has resulted in an increase in the number of livestock moving from south-east Asian countries into China. Foot and mouth disease is becoming one of the most important trans-boundary animal diseases affecting the livelihood of livestock owners in China. To contribute to the long term goal to control and eradicate FMD from China, the Chinese government has adopted a series of control measures which includes compulsory routine vaccination against the disease. In this paper, the surveillance results of the routine vaccination programme were systemically reviewed. The results from 28 published papers were combined and analysed through a meta-analysis approach. The results of the meta-analysis indicated that the vaccination programme has been very successful in China with more than 70% of animals protected against serotypes Asia-1 and O. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Impact of repeated increases in shear stress via reactive hyperemia and handgrip exercise: no evidence of systematic changes in brachial artery FMD.

    PubMed

    Pyke, K E; Jazuli, F

    2011-03-01

    Reactive hyperemia (RH) creates an uncontrolled, transient increase in brachial artery (BA) shear stress (SS) for flow-mediated dilation (FMD) assessment. In contrast, handgrip exercise (HGEX) can create similar, sustained SS increases over repeated trials. The purpose of this study was to examine the impact of repeated SS elevation via RH or HGEX and the relationship between RH and HGEX %FMD. BA diameter and blood velocity were assessed with echo and Doppler ultrasound in 20 healthy subjects. Visit A consisted of four 6-min HGEX trials (HGEX trials 1-4) at the intensity required to achieve a shear rate (SR = mean blood velocity/BA diameter; an estimate of SS) of 65 s(-1). Visit B consisted of four RH trials (RH trials 1-4). The RH SR area under the curve (AUC) was higher in trial 1 versus trial 3 and trial 4 (P = 0.019 and 0.047). The HGEX mean SR was similar across trials (mean SR = 66.1 ± 5.8 s(-1), P = 0.152). There were no differences in %FMD across trials or tests (RH trial 1: 6.9 ± 3.5%, trial 2: 6.9 ± 2.3%, trial 3: 7.1 ± 3.5%, and trial 4: 7.0 ± 2.8%; HGEX trial 1: 7.3 ± 3.6%, trial 2: 7.0 ± 3.6%, trial 3: 6.5 ± 3.5%, and trial 4: 6.8 ± 2.9%, P = 0.913). No relationship between subject's RH %FMD and HGEX %FMD was detected (r(2) = 0.12, P = 0.137). However, with response normalization, a relationship emerged (RH %FMD/SR AUC vs. HGEX %FMD/mean SR, r(2) = 0.44, P = 0.002). In conclusion, with repeat trials, there were no systematic changes in RH or HGEX %FMD. The relationship between normalized RH and HGEX %FMD suggests that endothelial responses to different SS profiles provide related information regarding endothelial function.

  7. Transmissivity estimation for highly heterogeneous aquifers: comparison of three methods applied to the Edwards Aquifer, Texas, USA

    NASA Astrophysics Data System (ADS)

    Painter, Scott L.; Woodbury, Allan D.; Jiang, Yefang

    2007-03-01

    Obtaining reliable hydrological input parameters is a key challenge in groundwater modeling. Although many quantitative characterization techniques exist, experience applying these techniques to highly heterogeneous real-world aquifers is limited. Three geostatistical characterization techniques are applied to the Edwards Aquifer, a limestone aquifer in south-central Texas, USA, for the purposes of quantifying the performance in an 88,000-cell groundwater model. The first method is a simple kriging of existing hydraulic conductivity data developed primarily from single-well tests. The second method involves numerical upscaling to the grid-block scale, followed by cokriging the grid-block conductivity. In the third method, the results of the second method are used to establish the prior distribution for a Bayesian updating calculation. Results of kriging alone are biased towards low values and fail to reproduce hydraulic heads or spring flows. The upscaling/cokriging approach removes most of the systematic bias. The Bayesian update reduced the mean residual by more than a factor of 10, to 6 m, approximately 2.5% of the total head variation in the aquifer. This agreement demonstrates the utility of automatic calibration techniques based on formal statistical approaches and lends further support for using the Bayesian updating approach for highly heterogeneous aquifers.

  8. Truncated recombinant non-structural protein 2C-based indirect ELISA for FMD sero-surveillance.

    PubMed

    Mahajan, Sonalika; Mohapatra, Jajati Keshari; Pandey, Laxmi Kant; Sharma, Gaurav Kumar; Pattnaik, Bramhadev

    2013-11-01

    Foot-and-mouth disease (FMD) is a transboundary animal disease caused by foot-and-mouth disease virus. In India, systematic preventive vaccination using inactivated trivalent (O, A and Asia 1) vaccine is the strategy being adopted to control FMD. The use of non-structural protein (NSP)-contaminated inactivated vaccine raises concerns over differentiation of infected and vaccinated animals (DIVA) by NSP based immunoassays. However, 2C being a membrane associated protein usually remain absent in vaccine formulations and thus, anti-2C response is one of the most reliable indicator of the FMDV infection. In this study, 34 amino acids from N-terminus of 2C protein were removed to eliminate membrane-binding amphipathic helicase activity for the expression of recombinant protein in soluble form. Truncated 2C (2Ct) was utilized for development of an indirect ELISA (I-ELISA) for bovine and the developed 2Ct I-ELISA was validated using a panel constituting of serum of naïve, vaccinated and infected animals. The assay was compared with the in-house r3AB3 I-ELISA and the overall concordance was 85.31%. The diagnostic sensitivity and specificity of the 2Ct I-ELISA were 92.9% and 94.0%, respectively. The apparent prevalence of anti-2C antibodies for random bovine samples tested by the developed assay was 23.7%. The developed ELISA will help in augmenting the sensitivity of detection if used in combination with r3AB3 I-ELISA for sero-surveillance. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Impact of FMD outbreak on milk production and heifers' growth on a dairy herd in southern Iran.

    PubMed

    Ansari-Lari, Maryam; Mohebbi-Fani, Mehdi; Lyons, Nicholas A; Azizi, Nezamaddin

    2017-09-01

    Foot and mouth disease is endemic in Middle Eastern countries including Iran but its impact is poorly characterized. The present study was conducted to evaluate the impact of FMD outbreak on milk production and heifers' growth in an industrial dairy herd located in Fars province, southern Iran. Data about individual milk production, heifers' growth and total daily milk (sold for manufacturing), its fat and protein content and somatic cell counts were collected from the herd database. Based on the results of the linear mixed models, a significant decline in individual milk production after the outbreak was observed compared with before the outbreak. There was a total reduction of 8.0 and 4.7% in mean daily milk production per cow after the outbreak when compared with before (over a 42days outbreak period) in lactation one (P<0.001) and lactation ≥2 cows (P=0.024), respectively. The total daily milk (P=0.027) and protein (P=0.002) showed significant decline during the outbreak period. The fat content decreased after the outbreak (P=0.014). Somatic cell counts did not show significant changes. The recorded heifers' weights (4-17 months of age) showed 7.1kg decrease after the outbreak in comparison with the period before that (P<0.001). In conclusion, we observed a negative impact of FMD outbreak on milk production and heifers' growth in study herd. The impact on daily milk production was less than the values reported previously. This difference could be attributed at least partly to differences in livestock genetics and management practices. Lower growth rate of heifers after the outbreak period could potentially extend the age at first calving. It is suggested that farmers are educated on awareness and preparation for infectious disease outbreaks and to practice good management routines that could potentially reduce the economic impact of these diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. The Assessment of short-term effect of L-Citrulline on endothelial function via FMD to NMD ratio in known CAD patients: A randomized, cross-over clinical trial (Clinical trial number: NCT02638727).

    PubMed

    Safi, Morteza; Mahjoob, Mohammad Parsa; Nateghi, Saeed; Khaheshi, Isa; Akbarzadeh, Mohammad Ali; Naderian, Mohammadreza

    2017-03-01

    Recent studies have confirmed the essential and paramount role of the L-Citrulline on the nitric oxide regulation and the endothelial function improvement. In this cross-over clinical trial, thirty patients, diagnosed with coronary artery disease (CAD) and flow mediated dilation to nitroglycerin dependent vasodilation (FMD/NMD) ratio less than 1, were included. The patients were randomly divided into two groups of 15 patients and underwent treatment by L-Citrulline or placebo for 15 days, in 2 step protocol. The indicators of assessment in the current study were the ratio of the FMD/NMD and FMD value. In the current cross-over clinical trial, the mean of FMD to NMD ratio and mean FMD value of all patients before starting the protocol were 0.91 ± 0.08 and 4.04 ± 0.51 mm, respectively. The final results of study showed that following L-Citrulline administration, mean FMD to NMD ratio and mean FMD value were enhanced to: 1.03 ± 0.09 and 4.96 ± 0.72 mm, respectively, which were statistically significant (P<0.001 and P<0.001, respectively). However, following placebo administration, mean FMD to NMD ratio and mean FMD value were receded to: 0.92 ± 0.09 and 4.06 ± 0.22 mm, respectively, which were not statistically significant (P = 0.75 and P = 0.89, respectively). Moreover, the improvement of mean FMD to NMD ratio (0.12 ± 0.02) and mean FMD value (0.92 ± 0.16 mm), following L-Citrulline administration, were statistically significant in comparison with the change of mean FMD to NMD ratio (0.01 ± 0.002) and mean FMD value (0.02 ± 0.003), following placebo administration (P<0.001 and P<0.001, respectively). L-Citrulline treatment can lead to improvement of the endothelial function in patients diagnosed with CAD which are assessed via FMD to NMD ratio FMD value enhancements.

  11. Frequent mental distress (FMD) in Irish Travellers: discrimination and bereavement negatively influence mental health in the All Ireland Traveller Health Study.

    PubMed

    McGorrian, Catherine; Hamid, Noor Aman; Fitzpatrick, Patricia; Daly, Leslie; Malone, Kevin M; Kelleher, Cecily

    2013-08-01

    Travellers are an indigenous minority group in Ireland, with poorer life expectancy and health status than the general population. Recent data have shown that Travellers are at increased risk of poor mental health and sequelae from same. We aimed to examine the associations between sociodemographic and lifestyle factors with poor mental health in Irish Travellers. A census survey of all Travellers was undertaken, with 8,492 enumerated families (80% response rate). A random subset of 1,796 adults completed an adult health survey. Traveller peer researchers employed a novel oral-visual computer-aided data collection tool. Frequent mental distress (FMD) was defined as 14 or more days of poor mental health in the preceding 1 month. Prevalence ratios for typical associates of FMD were estimated using a Poisson regression model, adjusted for age and sex. FMD was present in 11.9% of Traveller respondents, and prevalence increased with age. After age and sex adjustment, FMD was more prevalent in those whose quality of life was impaired by physical health, by those who were recently bereaved of a friend or family member, and by those who had greater experiences of discrimination. This study shows that Travellers experience discrimination and bereavement, which negatively influence their mental health. The findings have implications for the mental healthcare needs of indigenous ethnic minorities worldwide.

  12. A Probably Minor Role for Land-Applied Goat Manure in the Transmission of Coxiella burnetii to Humans in the 2007–2010 Dutch Q Fever Outbreak

    PubMed Central

    van den Brom, René; Roest, Hendrik-Jan; de Bruin, Arnout; Dercksen, Daan; Santman-Berends, Inge; van der Hoek, Wim; Dinkla, Annemiek; Vellema, Jelmer; Vellema, Piet

    2015-01-01

    In 2007, Q fever started to become a major public health problem in the Netherlands, with small ruminants as most probable source. In order to reduce environmental contamination, control measures for manure were implemented because of the assumption that manure was highly contaminated with Coxiella burnetii. The aims of this study were 1) to clarify the role of C. burnetii contaminated manure from dairy goat farms in the transmission of C. burnetii to humans, 2) to assess the impact of manure storage on temperature profiles in dunghills, and 3) to calculate the decimal reduction time of the Nine Mile RSA 493 reference strain of C. burnetii under experimental conditions in different matrices. For these purposes, records on distribution of manure from case and control herds were mapped and a potential relation to incidences of human Q fever was investigated. Additionally, temperatures in two dunghills were measured and related to heat resistance of C. burnetii. Results of negative binomial regression showed no significant association between the incidence of human Q fever cases and the source of manure. Temperature measurements in the core and shell of dunghills on two farms were above 40°C for at least ten consecutive days which would result in a strong reduction of C. burnetii over time. Our findings indicate that there is no relationship between incidence of human Q fever and land applied manure from dairy goat farms with an abortion wave caused by C. burnetii. Temperature measurements in dunghills on two farms with C. burnetii shedding dairy goat herds further support the very limited role of goat manure as a transmission route during the Dutch human Q fever outbreak. It is very likely that the composting process within a dunghill will result in a clear reduction in the number of viable C. burnetii. PMID:25816149

  13. A probably minor role for land-applied goat manure in the transmission of Coxiella burnetii to humans in the 2007-2010 Dutch Q fever outbreak.

    PubMed

    van den Brom, René; Roest, Hendrik-Jan; de Bruin, Arnout; Dercksen, Daan; Santman-Berends, Inge; van der Hoek, Wim; Dinkla, Annemiek; Vellema, Jelmer; Vellema, Piet

    2015-01-01

    In 2007, Q fever started to become a major public health problem in the Netherlands, with small ruminants as most probable source. In order to reduce environmental contamination, control measures for manure were implemented because of the assumption that manure was highly contaminated with Coxiella burnetii. The aims of this study were 1) to clarify the role of C. burnetii contaminated manure from dairy goat farms in the transmission of C. burnetii to humans, 2) to assess the impact of manure storage on temperature profiles in dunghills, and 3) to calculate the decimal reduction time of the Nine Mile RSA 493 reference strain of C. burnetii under experimental conditions in different matrices. For these purposes, records on distribution of manure from case and control herds were mapped and a potential relation to incidences of human Q fever was investigated. Additionally, temperatures in two dunghills were measured and related to heat resistance of C. burnetii. Results of negative binomial regression showed no significant association between the incidence of human Q fever cases and the source of manure. Temperature measurements in the core and shell of dunghills on two farms were above 40°C for at least ten consecutive days which would result in a strong reduction of C. burnetii over time. Our findings indicate that there is no relationship between incidence of human Q fever and land applied manure from dairy goat farms with an abortion wave caused by C. burnetii. Temperature measurements in dunghills on two farms with C. burnetii shedding dairy goat herds further support the very limited role of goat manure as a transmission route during the Dutch human Q fever outbreak. It is very likely that the composting process within a dunghill will result in a clear reduction in the number of viable C. burnetii.

  14. High-frequency ultrasonographic imaging of the endothelium-dependent flow-mediated dilatation (FMD) in a brachial artery: normative ranges in a group of low CV risk subjects of different ages.

    PubMed

    Ryliskyte, Ligita; Ghiadoni, Lorenzo; Plantinga, Yvonne; Janaviciene, Silvija; Petrulioniene, Zaneta; Laucevicius, Aleksandras; Gintautas, Jonas

    2004-01-01

    High-frequency ultrasonographic imaging of flow-mediated dilatation (FMD) in a brachial artery, as non-invasive technique, was used for the clinical evaluation of endothelial function (EF) in 115 subjects (ages 44.19+/-12.23 (26 to 83) free of coronary heart disease or its equivalents. Our aim was to study the normative ranges for FMD in subjects of different age groups with low cardiovascular risk factors. The mean FMD was 8.23+/-4.51% (0 to 20.9). Multivariate analysis revealed that there were only two independent predictors of FMD: resting vessel diameter (r = -0.45, p<0.0001) and age (r = -0.55, p<0.0001). The multiple regression equation for this data was FMD = 25.5-0.17 x age-2.6 x resting vessel diameter. Our study demonstrates that FMD in low cardiovascular risk patients inversely correlates with age as well as brachial artery diameter. Normative ranges of FMD could be predicted for different age groups. In addition to conventional methods for the assessment of cardiovascular risk by using a population-based approach (score indexes such as SCORE, FRAMINGH, PROCAM), high-frequency ultrasonographic imaging of flow-mediated dilatation (FMD) in the brachial artery is now becoming an accepted method for the assessment of an individual patient's cardiovascular risk. Although preliminary guidelines have been published, this technique has interpretive limitations. In a study that was published earlier, the authors estimated diameter-related normal ranges of FMD. Several articles reported cut points between control and diseased groups. Data about the impact of age on FMD are also available in the literature. However, this is the first attempt to classify normal values into groups according to age and diameter.

  15. Foot and mouth disease (FMD) virus: quantification of whole virus particles during the vaccine manufacturing process by size exclusion chromatography.

    PubMed

    Spitteler, Marcelo A; Fernández, Ignacio; Schabes, Erika; Krimer, Alejandro; Régulier, Emmanuel G; Guinzburg, Mariela; Smitsaart, Eliana; Levy, M Susana

    2011-09-22

    Foot and mouth disease (FMD) is a highly infectious viral disease that affects cattle, sheep, goats and swine causing severe economic losses worldwide. The efficacy of inactivated vaccines is critically dependent on the integrity of foot and mouth disease virus (FMDV) particles. The recommended method to quantify the active ingredient of vaccines is the 140S quantitative sucrose density gradient analysis. This method has been an immensely valuable tool over the past three decades but it is highly operator dependent and difficult to automate. We developed a method to quantify FMDV particles during the vaccine manufacturing process that is based on separation of components by size-exclusion chromatography and measurement of virus by absorption at 254nm. The method is linear in the 5-70μg/mL range, it is applicable to different FMDV strains, and has a good correlation with the 140S test. The proposed method uses standard chromatographic media and it is amenable to automation. The method has potential as a process analytical technology and for control of final product by manufacturers, international vaccine banks and regulatory agencies.

  16. Genetic and antigenic characterisation of serotype A FMD viruses from East Africa to select new vaccine strains

    PubMed Central

    Bari, Fufa D.; Parida, Satya; Tekleghiorghis, Tesfaalem; Dekker, Aldo; Sangula, Abraham; Reeve, Richard; Haydon, Daniel T.; Paton, David J.; Mahapatra, Mana

    2014-01-01

    Vaccine strain selection for emerging foot-and-mouth disease virus (FMDV) outbreaks in enzootic countries can be addressed through antigenic and genetic characterisation of recently circulating viruses. A total of 56 serotype A FMDVs isolated between 1998 and 2012, from Central, East and North African countries were characterised antigenically by virus neutralisation test using antisera to three existing and four candidate vaccine strains and, genetically by characterising the full capsid sequence data. A Bayesian analysis of the capsid sequence data revealed the viruses to be of either African or Asian topotypes with subdivision of the African topotype viruses into four genotypes (Genotypes I, II, IV and VII). The existing vaccine strains were found to be least cross-reactive (good matches observed for only 5.4–46.4% of the sampled viruses). Three bovine antisera, raised against A-EA-2007, A-EA-1981 and A-EA-1984 viruses, exhibited broad cross-neutralisation, towards more than 85% of the circulating viruses. Of the three vaccines, A-EA-2007 was the best showing more than 90% in-vitro cross-protection, as well as being the most recent amongst the vaccine strains used in this study. It therefore appears antigenically suitable as a vaccine strain to be used in the region in FMD control programmes. PMID:25171846

  17. Genetic and antigenic characterisation of serotype A FMD viruses from East Africa to select new vaccine strains.

    PubMed

    Bari, Fufa D; Parida, Satya; Tekleghiorghis, Tesfaalem; Dekker, Aldo; Sangula, Abraham; Reeve, Richard; Haydon, Daniel T; Paton, David J; Mahapatra, Mana

    2014-10-07

    Vaccine strain selection for emerging foot-and-mouth disease virus (FMDV) outbreaks in enzootic countries can be addressed through antigenic and genetic characterisation of recently circulating viruses. A total of 56 serotype A FMDVs isolated between 1998 and 2012, from Central, East and North African countries were characterised antigenically by virus neutralisation test using antisera to three existing and four candidate vaccine strains and, genetically by characterising the full capsid sequence data. A Bayesian analysis of the capsid sequence data revealed the viruses to be of either African or Asian topotypes with subdivision of the African topotype viruses into four genotypes (Genotypes I, II, IV and VII). The existing vaccine strains were found to be least cross-reactive (good matches observed for only 5.4-46.4% of the sampled viruses). Three bovine antisera, raised against A-EA-2007, A-EA-1981 and A-EA-1984 viruses, exhibited broad cross-neutralisation, towards more than 85% of the circulating viruses. Of the three vaccines, A-EA-2007 was the best showing more than 90% in-vitro cross-protection, as well as being the most recent amongst the vaccine strains used in this study. It therefore appears antigenically suitable as a vaccine strain to be used in the region in FMD control programmes. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Clinical, haematological and biochemical alterations in heat intolerance (panting) syndrome in Egyptian cattle following natural foot-and-mouth disease (FMD).

    PubMed

    Ghanem, Mohamed M; Abdel-Hamid, Omnia M

    2010-08-01

    Clinical signs of heat intolerance (panting) syndrome were observed in Holstein cows in a private farm in Egypt. There were heat intolerance (fever), panting, profuse salivation, hirsutism, lameness and reduced milk production. Blood and serum samples were collected from ten diseased cows and five apparently healthy cows as control. Serological tests confirmed the presence of non-structural protein of foot-and-mouth disease (FMD) infection. There were significant reductions in the total red blood cell count with increased leucocytic and lymphocytic counts in diseased group compared to control. The serum Na, Cl, Ca, Mg, Zn and Fe were significantly reduced but P was increased in diseased animals compared to control. The total protein, albumin, cholesterol and cortisol were significantly reduced but the glucose and malonaldehyde were significantly increased in diseased cows. This was the first report in Egypt to describe the clinical and haemato-biochemical changes in panting syndrome following FMD.

  19. Synthesis and in-vitro evaluation of 2-amino-4-arylthiazole as inhibitor of 3D polymerase against foot-and-mouth disease (FMD).

    PubMed

    Jeong, Kwi-Wan; Lee, Jung-Hun; Park, Sun-Mi; Choi, Joo-Hyung; Jeong, Dae-Youn; Choi, Dong-Hwa; Nam, Yeonju; Park, Jong-Hyeon; Lee, Kwang-Nyeong; Kim, Su-Mi; Ku, Jin-Mo

    2015-09-18

    Foot-and-mouth disease (FMD) is a highly contagious vesicular disease of livestock caused by a highly variable RNA virus, foot-and-mouth disease virus (FMDV). One of the targets to suppress expansion of and to control FMD is 3D polymerase (FMDV 3Dpol). In this study, 2-amino-4-arylthiazole derivatives were synthesized and evaluated for their inhibitory activity against FMDV 3Dpol. Among them, compound 20i exhibited the most potent functional inhibition (IC50 = 0.39 μM) of FMDV 3D polymerase and compound 24a (EC50 = 13.09 μM) showed more potent antiviral activity than ribavirin (EC50 = 1367 μM) and T1105 (EC50 = 347 μM) with IBRS-2 cells infected by the FMDV O/SKR/2010 strain. Copyright © 2015. Published by Elsevier Masson SAS.

  20. Association Between Waist-to-Height Ratio and Endothelial Dysfunction in Patients With Morbidity - A Report From the FMD-J Study.

    PubMed

    Tokushige, Akihiro; Ueda, Shinichiro; Tomiyama, Hirofumi; Ohishi, Mituru; Kohro, Takahide; Higashi, Yukihito; Takase, Bonpei; Suzuki, Toru; Ishizu, Tomoko; Yamazaki, Tsutomu; Furumoto, Tomoo; Kario, Kazuomi; Inoue, Teruo; Koba, Shinji; Takemoto, Yasuhiko; Hano, Takuzo; Sata, Masataka; Ishibashi, Yutaka; Node, Koichi; Maemura, Koji; Ohya, Yusuke; Furukawa, Taiji; Ito, Hiroshi; Yamashina, Akira

    2017-07-07

    Waist circumference (WC), waist-to-height ratio (WHtR) and body mass index (BMI) are known as easy anthropometric markers of abnormal obesity and screening tools for predicting cardiovascular outcomes, but which indices are best is unclear. We therefore investigated the superiority and association between each index and low flow-mediated dilatation (FMD) as a surrogate marker for cardiovascular outcomes in patients with morbidity in a large Japanese prospective cohort.Methods and Results:A total of 1,645 Japanese patients who had coronary artery disease and hypertension or diabetes mellitus were enrolled, and 1,087 of them were analyzed. The high-WHtR group (≥0.5) showed greater morbidity and increased inflammation in association with atherosclerosis compared with the low-WHtR group. High WHtR and advanced age were identified as predictors of low FMD (odds ratio (OR) 1.39, 95% confidence interval (CI) 1.02-1.88, P=0.037 and OR 1.55, 95% CI 1.19-2.01, P=0.001, respectively). However, WC was not associated with that risk in either sex (male: OR 1.37, 95% CI 0.97-1.93, P=0.076; female: OR 1.08, 95% CI 0.68-1.73, P=0.74), and no association was evident between high BMI and low FMD (OR 0.92, 95% CI 0.71-1.19, P=0.54). WHtR offers a superior predictor of decreased FMD than other anthropometric indices, and progression of arteriosclerosis might be detected more sensitively. Further study is needed to investigate the relationship between cardiovascular mortality and WHtR.

  1. Evaluation of the efficacy of a new oil-based adjuvant ISA 61 VG FMD vaccine as a potential vaccine for cattle

    PubMed Central

    Khorasani, A.; Madadgar, O.; Soleimanjahi, H.; Keyvanfar, H.; Mahravani, H.

    2016-01-01

    Foot-and-mouth disease is an important viral disease of cloven-hoofed animals. Inactivated whole particle virus vaccines are still widely used in prophylactic vaccination campaigns. The choice of adjuvant is a very important factor in enhancing immune responses and the efficacy of inactivated vaccines. Montanide ISA 61 VG is a new ready-to-use mineral oil-based adjuvant developed by SEPPIC Inc. (SEPPIC, France) with high-potential immune responses needed for clinical protection against FMD infection. In this study, we compared the efficacy of two FMD vaccines either formulated with the new oil-based adjuvant ISA 61 VG and saponin, or with aluminum hydroxide gel and saponin. Both vaccines contained the same antigen payloads of O2010/IR. Two groups of 15 naive cattle received a single vaccination with different doses (full dose, 1/3 dose and 1/9 dose) to calculate their PD50 (50% protective dose) after being challenged with the homologous virulent virus. The mean neutralizing antibody titer was determined at 0, 7, 14 and 21 days after vaccination, measured by a micro neutralization test. The new vaccine improved humoral immune responses by 19%, while inducing a higher geometric mean. The titer for neutralizing antibodies was 2.91 log10 compared to the alum-gel based adjuvant vaccine which was 2.44 log10 (P-value=0.1782). The new vaccine showed a PD50 value of 10.05 as compared to a PD50 value of 4.171, respectively. According to the results, the FMD vaccine formulated with the new oil adjuvant, ISA 61 VG, shows potential as an alternative vaccine for routine and emergency vaccinations in the FMD enzootic region. PMID:27656222

  2. Evaluation of the efficacy of a new oil-based adjuvant ISA 61 VG FMD vaccine as a potential vaccine for cattle.

    PubMed

    Khorasani, A; Madadgar, O; Soleimanjahi, H; Keyvanfar, H; Mahravani, H

    2016-01-01

    Foot-and-mouth disease is an important viral disease of cloven-hoofed animals. Inactivated whole particle virus vaccines are still widely used in prophylactic vaccination campaigns. The choice of adjuvant is a very important factor in enhancing immune responses and the efficacy of inactivated vaccines. Montanide ISA 61 VG is a new ready-to-use mineral oil-based adjuvant developed by SEPPIC Inc. (SEPPIC, France) with high-potential immune responses needed for clinical protection against FMD infection. In this study, we compared the efficacy of two FMD vaccines either formulated with the new oil-based adjuvant ISA 61 VG and saponin, or with aluminum hydroxide gel and saponin. Both vaccines contained the same antigen payloads of O2010/IR. Two groups of 15 naive cattle received a single vaccination with different doses (full dose, 1/3 dose and 1/9 dose) to calculate their PD50 (50% protective dose) after being challenged with the homologous virulent virus. The mean neutralizing antibody titer was determined at 0, 7, 14 and 21 days after vaccination, measured by a micro neutralization test. The new vaccine improved humoral immune responses by 19%, while inducing a higher geometric mean. The titer for neutralizing antibodies was 2.91 log10 compared to the alum-gel based adjuvant vaccine which was 2.44 log10 (P-value=0.1782). The new vaccine showed a PD50 value of 10.05 as compared to a PD50 value of 4.171, respectively. According to the results, the FMD vaccine formulated with the new oil adjuvant, ISA 61 VG, shows potential as an alternative vaccine for routine and emergency vaccinations in the FMD enzootic region.

  3. Evaluation of genetic and non-genetic factors on foot and mouth disease (FMD) virus vaccine-elicited immune response in Hardhenu (Bos taurus x Bos indicus) cattle.

    PubMed

    Manjeet; Pander, B L; Sharma, R; Dhaka, S S; Magotra, Ankit; Dev, Kapil

    2017-08-16

    Foot and mouth disease (FMD) is the most contagious disease of mammals and a major threat to animal husbandry sector. In India, vaccination with the inactivated trivalent (O, A and Asia1) vaccine is one proven way for protecting the livestock from FMD. However, many outbreaks have been reported in different parts of the country. Therefore, present study was aimed at elucidating the effects of genetic and non-genetic factors on FMD viral vaccine-elicited immune response in Hardhenu cattle. The effect of season of vaccination was not consistent. The effect of status of animal was significant for all the pre and post AB titres except for pre AB titre of serotype O and post AB titre of Asia1.The estimates of heritability for response to vaccination were low to high ranging from 0.11 to 0.45. The highest heritability estimate was obtained for serotype O and the lowest for Asia1. The heritability estimates for pre and post AB titres ranged from 0.15 to 0.33. All the pre and post AB titres and responses to vaccination had genetic correlations ranged from high negative to high positive among them. Results of this study highlight the variation in vaccine response which needs to be further exploited on large-scale animal data for better immunization and protection against highly contagious viral vesicular disease of cloven-hoofed animals.

  4. Novel immunogenic baculovirus expressed virus-like particles of foot-and-mouth disease (FMD) virus protect guinea pigs against challenge.

    PubMed

    Bhat, S A; Saravanan, P; Hosamani, M; Basagoudanavar, S H; Sreenivasa, B P; Tamilselvan, R P; Venkataramanan, R

    2013-12-01

    Vaccination is a well accepted strategy for control of foot-and-mouth disease (FMD) in endemic countries. Currently, chemically inactivated virus antigens are used for preparation of FMD vaccine. To develop a non-infectious and safe recombinant vaccine, we expressed structural polypeptide of FMDV (O/IND/R2/75) using baculovirus expression system. We show that inclusion of mutated viral 3C protease in frame with the polypeptide (P1-2A), enhanced the yield of structural proteins. The structural proteins retained antigenicity and assembled into empty virus-like particles (VLPs). Immunization of guinea pigs with purified fractions of the VLPs resulted in humoral and cell mediated immune response by 4 weeks. The VLPs elicited comparable humoral immune response and relatively higher cell mediated immune response, when compared to conventional vaccine in guinea pigs. Further, up to 70% of the VLP immunized guinea pigs were protected against challenge with homologous guinea pig adapted virus. Our results highlight the application of recombinant FMDV VLPs in FMD vaccination. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Intradermal vaccination of pigs against FMD with 1/10 dose results in comparable vaccine efficacy as intramuscular vaccination with a full dose.

    PubMed

    Eblé, P L; Weerdmeester, K; van Hemert-Kluitenberg, F; Dekker, A

    2009-02-18

    The aim of this study was to investigate whether intradermal (ID) vaccination against foot-and-mouth disease (FMD) is suitable as an alternative for the usually used intramuscular (IM) route. We compared vaccine efficacy in groups of pigs in which vaccine administration differed with respect to antigen payload of the vaccine, administrated volume and administration route. When compared with pigs that were IM vaccinated with a full dose vaccine with a standard antigen payload, pigs vaccinated ID with 1/10 dose of the same vaccine were equally protected against clinical disease and subclinical virus shedding. The ID vaccinated pigs were protected against virus shedding at a significant lower VN-titre as compared to IM vaccinated pigs, suggesting that immune responses other than neutralising antibodies also contributed to protection. We conclude that the ID route might be a good alternative for IM application, as ID application might induce a very efficient immunological response against FMD and, moreover, because the dose required by the ID route is lower compared to the IM route, ID application may reduce the production costs per dose of FMD vaccine markedly.

  6. Preliminary Evaluation of Commercial Off the Shelf (COTS) Packing Materials for Flight Medication Dispenser (FMD) Technology Development

    NASA Technical Reports Server (NTRS)

    Du, Brian; Daniels, Vernie; Crady, Camille; Putcha, Lakshmi

    2010-01-01

    With the advent of longer duration space missions, pharmaceutical use in space has increased. During the first 33 space shuttle missions, crew members took more than 500 individual doses of 31 different medications . Anecdotal reports from crew members described medications as generally "well tolerated" and "effective". However, reported use of increased medication doses and discrepancies in ground vs. flight efficacy may result from reduced potency or altered bioavailability due to changes in chemical and/or physical parameters of pharmaceutical stability. Based on preliminary results from a ground-based irradiation and an inflight study on pharmaceutical stability, three susceptible medications, Amoxicillin/Clavulanate and Sulfamethoxazole/trimethoprim antibiotics tablets and promethazine (PMZ), an antihistamine were selected for testing using two types of Oliver-Tolas bags, TPC-1475(Clear) and TPF-0599B (Foil) for radiation Shielding effectiveness. The material composition of the bags included aluminum coated Mylar sheathing coated with multifunctional nanocomposities based on polyethylene with dispersed boron-rich nanophases. Two bags of each medication were irradiated for different time intervals with 14.6 rad/min to achieve 0.1 Gy, 1 Gy and 10 Gy of cumulative radiation dose. Active pharmaceutical content (API) in each medication was determined and results analyzed. No significant difference in API content was observed between control and irradiated samples for both antibiotic tablets suggesting both types of bags may offer protection against gamma radiation; results with PMZ were inconclusive. These preliminary results suggest that Oliver-Tolas TPL-1475 and TPF-0599B materials may possess characteristics suitable for protection against ionizing radiation and can be considered for designing and further testing of FMD technology.

  7. Epi-aortic lesions, pathologic FMD, endothelial activation and inflammatory markers in advanced naïve HIV-infected patients starting ART therapy.

    PubMed

    Bellacosa, Chiara; Maggi, Paolo; Volpe, Anna; Altizio, Sergio; Ladisa, Nicoletta; Cicalini, Silvia; Viglietti, Rosaria; Chirianni, Antonio; Bellazzi, Lara; Zanaboni, Domenico; Maserati, Renato; Martinelli, Canio; Corsi, Paola; Sofia, Silvia; Celesia, Maurizio; Sozio, Ferdinando; Abbrescia, Nicola; Angarano, Gioacchino

    2014-01-01

    PREVALEAT II (PREmature VAscular LEsions and Antiretroviral Therapy II) is an ongoing multicenter, longitudinal cohort study aimed to the evaluation of cardiovascular (CV) risk in advanced HIV-infected antiretroviral (ARV) naïve patients starting their first antiretroviral therapy (ART). All consecutive naïve patients with CD4 cell count<200/mL starting any PI/r-based or NNRTI-based + 2 NRTIs regimen from January 2010 to January 2013 in the participant centres were enrolled. At baseline and after 3 (T1), 6 (T2) and 12 (T3) months patients were subjected to epi-aortic vessels ultrasonography and brachial artery flow mediated dilation (FMD). Viral load, CD4+ cell count, serum lipid values, serum glucose, endothelial activation (ICAM-1 and VCAM-1) and inflammatory markers (IL-6 and hsCRP) values were recorded at the same time. Data about independent risk factors for HIV infection and CV disease are taken at time 0. We enrolled 94 patients: 81% males, 87% caucasians, 40% smokers, 8.2% HCV co-infected and 3.5% with lipodystrophy; 33% of them were homosexuals, 12% drug addicts; 23% were AIDS at presentation. Statistical data analysis has been conducted by the χ(2) nonparametric method. In Table 1 it is reported the percentage of patients with pathologic values, moreover, at T3, 60.46% showed undetectable viraemia and 69.77% had CD4 + > 200. Our data evidence at baseline has a relevant deterioration of CV conditions in terms of ultrasonographic data, FMD, inflammation and cytokine markers among advanced naïves. During follow-up epi-aortic lesions tend to worsen but not significantly, percentage of pathologic FMD remains stable. Regarding markers of endothelial activation ICAM-1 significantly worsens during the period of observation; also VCAM-1 has a trend towards the worsening while not significantly. Conversely, a significant improvement was observed for the markers of inflammation D-dimers and high sensitivity C-reactive protein (hsCRP). IL-6 improved but not

  8. Effect of emergency FMD vaccine antigen payload on protection, sub-clinical infection and persistence following direct contact challenge of cattle.

    PubMed

    Cox, S J; Voyce, C; Parida, S; Reid, S M; Hamblin, P A; Hutchings, G; Paton, D J; Barnett, P V

    2006-04-12

    Previous work, in sheep vaccinated with emergency foot-and-mouth disease (FMD) vaccine, indicated the benefit of increasing the antigen payload in inhibiting local virus replication and consequently persistence following an indirect aerosol challenge with a virus homologous to the vaccine strain. The work presented here investigates this possibility further using cattle and a more severe semi-heterologous direct contact challenge. The quantitative dynamics of virus replication and excretion in both vaccinated and non-vaccinated cattle following challenge are examined. Two experiments were carried out each involving 20 vaccinated and 5 non-vaccinated cattle. An O(1) Manisa vaccine (18 PD(50)) was used for the first, previously reported experiment [Cox SJ, Voyce C, Parida S, Reid SM, Hamblin PA, Paton DJ, et al. Protection against direct contact challenge following emergency FMD vaccination of cattle and the effect on virus excretion from the oropharynx. Vaccine 2005;23:1106-13]. The same vaccine was used for the second experiment described in this paper except the antigen payload was increased 10-fold per bovine dose, resulting in significantly higher FMD virus neutralising antibody titres prior to challenge. Twenty-one days post-vaccination the cattle received a 5-day direct contact challenge with FMD virus from five further non-vaccinated cattle infected 24h earlier with O UKG 34/2001. All vaccinated cattle regardless of antigen payload were protected against clinical disease. Sub-clinical oropharyngeal infection was detected in animals from both experiments but the level of virus replication shortly after direct contact challenge was significantly reduced in vaccinated animals. Cattle immunised with the 10-fold antigen payload cleared the virus more readily and consequently at 28 days post-challenge fewer animals were persistently infected compared to the single strength vaccine. Following a severe challenge, the results from both experiments show that use of

  9. Rotorcraft transmission

    NASA Technical Reports Server (NTRS)

    Coy, John J.

    1987-01-01

    The NASA Lewis Research Center and the U.S. Army Aviation Systems Command share an interest in advancing the technology for helicopter propulsion systems. In particular, this presentation outlines that portion of the program that applies to the drive train and its various mechanical components. The major goals of the program are to increase the life, reliability, and maintainability; reduce the weight, noise, and vibration; and maintain the relatively high mechanical efficiency of the gear train. The current activity emphasizes noise reduction technology and analytical code development followed by experimental verification. Selected significant advances in technology for transmissions are reviewed, including advanced configurations and new analytical tools. Finally, the plan for transmission research in the future is presented.

  10. Modelling foot-and-mouth disease transmission in a wild pig-domestic cattle ecosystem.

    PubMed

    Ward, M P; Garner, M G; Cowled, B D

    2015-01-01

    To use simulation modelling to predict the potential spread and to explore control options for a foot-and-mouth disease (FMD) incursion in a mixed wild pig-domestic cattle ecosystem in northern Australia. Based on aerial surveys, expert opinion and published data, the wild pig and grazing cattle distributions were simulated. A susceptible-infected-resistant disease-spread model was coded and parameterised according to published literature and expert opinion. A baseline scenario was simulated in which infection was introduced via wild pigs, with transmission from pigs to cattle and no disease control. Assumptions regarding disease transmission were investigated via sensitivity analyses. Predicted size and length of outbreaks were compared for different control strategies based on movement standstill, surveillance and depopulation. In most of the simulations, FMD outbreaks were predicted to be ongoing after 6 months, with more cattle herds infected than wild pig herds (median 907 vs. 22, respectively). Assuming only pig-to-pig transmission, the infection routinely died out. In contrast, assuming cattle-to-cattle, cattle-to-pig or pig-to-cattle transmission resulted in FMD establishing and spreading in more than 75% of simulations. A control strategy targeting wild pigs only was not predicted to be successful. Control based on cattle only was successful in eradicating the disease. However, control targeting both pigs and cattle resulted in smaller outbreaks. If FMD is controlled in cattle in the modelled ecosystem, it is likely to be self-limiting in wild pigs. However, to eradicate disease as quickly as possible, both wild pigs and cattle should be targeted for control. © 2015 Australian Veterinary Association.

  11. Manual with auxiliary transmission

    SciTech Connect

    Nishimura, S.

    1987-06-23

    This patent describes a vehicular transmission of the type in which a manual transmission has two parallel shafts. One shaft is connected through a transmission clutch to an engine in which manual transmission is connected in series to an auxiliary transmission having high and low speed transmission lines. The auxiliary transmission has a high speed transmission line equipped with a hydraulic clutch and a low speed transmission line equipped with a one-way clutch for allowing the overrun of the output side of the low speed transmission line so that the low speed transmission line is established when the hydraulic clutch is released. The high speed transmission is established when the hydraulic clutch is applied. A sleeve shaft is on one of the two shafts. A transmission gear mechanism connects the sleeve shaft to the other shaft. One shaft has an extension with a fixed gear. A coacting gear is fixed on the sleeve shaft, the hydraulic clutch and coacting gear positioned on the extension of one shaft, an idle gear mechanism in meshing engagement with both the coacting gear and the fixed gear. The idle gear mechanism has a low speed transmission line one-way clutch, and the hydraulic clutch is operable to connect and disconnect the sleeve shaft to and from the one shaft.

  12. Transmission of foot and mouth disease at the wildlife/livestock interface of the Kruger National Park, South Africa: Can the risk be mitigated?

    PubMed

    Jori, Ferran; Etter, Eric

    2016-04-01

    In Southern Africa, the African buffalo (Syncerus caffer) is the natural reservoir of foot and mouth disease (FMD). Contacts between this species and cattle are responsible for most of the FMD outbreaks in cattle at the edge of protected areas, which generate huge economic losses. During the late 1980's and 90's, the erection of veterinary cordon fences and the regular vaccination of cattle exposed to buffalo contact at the interface of the Kruger National Park (KNP), proved to be efficient to control and prevent FMD outbreaks in South Africa. However, since 2000, the efficiency of those measures has deteriorated, resulting in an increased rate of FMD outbreaks in cattle outside KNP, currently occurring more than once a year. Based on retrospective ecological and epidemiological data, we developed a stochastic quantitative model to assess the annual risk of FMD virus (FMDV) transmission from buffalo to cattle herds present at the KNP interface. The model suggests that good immunization of approximately 75% of the cattle population combined with a reduction of buffalo/cattle contacts is an efficient combination to reduce FMDV transmission to one infective event every 5.5 years, emulating the epidemiological situation observed at the end of the 20th century, before current failure of control measures. The model also indicates that an increasing number of buffalo present in the KNP and crossing its boundaries, combined with a reduction in the vaccination coverage of cattle herds at the interface, increases 3-fold the risk of transmission (one infective event per year).The model proposed makes biological sense and provides a good representation of current knowledge of FMD ecology and epidemiology in Southern Africa which can be used to discuss with stakeholders on different management options to control FMD at the wildlife livestock interface and updated if new information becomes available. It also suggests that the control of FMD at the KNP interface is becoming

  13. Repression vs. activation of MOX, FMD, MPP1 and MAL1 promoters by sugars in Hansenula polymorpha: the outcome depends on cell's ability to phosphorylate sugar.

    PubMed

    Suppi, Sandra; Michelson, Tiina; Viigand, Katrin; Alamäe, Tiina

    2013-03-01

    A high-throughput approach was used to assess the effect of mono- and disaccharides on MOX, FMD, MPP1 and MAL1 promoters in Hansenula polymorpha. Site-specifically designed strains deficient for (1) hexokinase, (2) hexokinase and glucokinase, (3) maltose permease or (4) maltase were used as hosts for reporter plasmids in which β-glucuronidase (Gus) expression was controlled by these promoters. The reporter strains were grown on agar plates containing varied carbon sources and Gus activity was measured in permeabilized cells on microtitre plates. We report that monosaccharides (glucose, fructose) repress studied promoters only if phosphorylated in the cell. Glucose-6-phosphate was proposed as a sugar repression signalling metabolite for H. polymorpha. Intriguingly, glucose and fructose strongly activated expression from these promoters in strains lacking both hexokinase and glucokinase, indicating that unphosphorylated monosaccharides have promoter-derepressing effect. We also show that maltose and sucrose must be internalized and split into monosaccharides to exert repression on MOX promoter. We demonstrate that at yeast growth on glucose-containing agar medium, glucose-limitation is rapidly created that promotes derepression of methanol-specific promoters and that derepression is specifically enhanced in hexokinase-negative strain. We recommend double kinase-negative and hexokinase-negative mutants as hosts for heterologous protein production from MOX and FMD promoters.

  14. Bidirectional flux of fluids and microbiota at implant-abutment connection of FMD Storm implant system: an in vitro stud y using RT-PCR.

    PubMed

    Baj, A; Romano, M; Segna, E; Palmieri, A; Cura, F; Scarano, A; Ottria, L; Giannì, A B

    2017-01-01

    The purpose of the present microbiological study was to evaluate bacterial leakage at implant-abutment connection level of a new type of implant (Storm implant (FMD, Falappa Medical Devices®, Rome, Italy) using Real-Time Polymerase Chain Reaction (RT-PCR). This implant presents a polygonal external implantabutment connection with a geometry that provides a hex on which engage complementary abutments. To identify the capability of the implant to protect the internal space from the external environment, the passage of genetically modified Escherichia coli across implant-abutment interface was evaluated. Four Storm implants (FMD, Falappa Medical Devices®, Rome, Italy) were immerged in a bacterial culture for 24 h and bacteria amount was measured inside implant-abutment interface with Real-time PCR. Bacteria were detected inside all studied implants, with a median percentage of 15% for P. gingivalis and 14% for T. forsythia. Our results are similar to those reported in the English literature. Additional studies are needed to explore the relationship in terms of microbiota between the internal implant and implant-prosthetic connection. In addition, the dynamics of internal colonization needs to be thoroughly documented in longitudinal in vivo studies. As a result, microbial leakage along the implant abutment interface was acceptable and considered the most probable explanation for peri-implantitis.

  15. Alternative way to test the efficacy of swine FMD vaccines: measurement of pigs median infected dose (PID50) and regulation of live virus challenge dose.

    PubMed

    Li, Dong; Lu, Zeng-Jun; Xie, Bao-Xia; Sun, Pu; Chen, Ying-Li; Fu, Yuan-Fang; Liu, Zai-Xin

    2010-09-08

    Foot-and -mouth disease to pigs is serious recently around the world. "Vaccination prevention" is still an important policy. OIE specifies 10,000 TCID50(0.2 ml) of virulent virus for challenge test in pigs to test the potency of FMD vaccine by intradermal route inoculating the virus in the heel bulbs of one foot or by intramuscular route administering into one site of the neck behind the ear. Convenience and speediness are available in the process of potency test of commercial FMD vaccine. We selected the route of "administering into one site of the muscular part of the neck behind the ear" because of convenience and speediness. However, it was difficult to infect control pigs even up to 100,000TCID50, so we changed the challenged virus from cell-passaged strain to suckling mice-passaged one, measured its PID50 (pigs median infected dose) and defined the virus challenge dose as 1000PID50. Meanwhile, we arranged the number of control pigs from two to three for easy evaluation.

  16. Transmission of Foot-and-Mouth Disease Virus during the Incubation Period in Pigs

    PubMed Central

    Stenfeldt, Carolina; Pacheco, Juan M.; Brito, Barbara P.; Moreno-Torres, Karla I.; Branan, Matt A.; Delgado, Amy H.; Rodriguez, Luis L.; Arzt, Jonathan

    2016-01-01

    Understanding the quantitative characteristics of a pathogen’s capability to transmit during distinct phases of infection is important to enable accurate predictions of the spread and impact of a disease outbreak. In the current investigation, the potential for transmission of foot-and-mouth disease virus (FMDV) during the incubation (preclinical) period of infection was investigated in seven groups of pigs that were sequentially exposed to a group of donor pigs that were infected by simulated-natural inoculation. Contact-exposed pigs were comingled with infected donors through successive 8-h time slots spanning from 8 to 64 h post-inoculation (hpi) of the donor pigs. The transition from latent to infectious periods in the donor pigs was clearly defined by successful transmission of foot-and-mouth disease (FMD) to all contact pigs that were exposed to the donors from 24 hpi and later. This onset of infectiousness occurred concurrent with detection of viremia, but approximately 24 h prior to the first appearance of clinical signs of FMD in the donors. Thus, the latent period of infection ended approximately 24 h before the end of the incubation period. There were significant differences between contact-exposed groups in the time elapsed from virus exposure to the first detection of FMDV shedding, viremia, and clinical lesions. Specifically, the onset and progression of clinical FMD were more rapid in pigs that had been exposed to the donor pigs during more advanced phases of disease, suggesting that these animals had received a higher effective challenge dose. These results demonstrate transmission and dissemination of FMD within groups of pigs during the incubation period of infection. Furthermore, these findings suggest that under current conditions, shedding of FMDV in oropharyngeal fluids is a more precise proxy for FMDV infectiousness than clinical signs of infection. These findings may impact modeling of the propagation of FMD outbreaks that initiate

  17. 6D.03: FLOW-MEDIATED DILATATION (FMD) AND ENDOTHELIUM-INDEPENDENT DILATATION (EID) IN PATIENTS WITH MULTIFOCAL FIBROMUSCULAR DYSPLASIA: A CROSS-SECTIONAL STUDY.

    PubMed

    Khettab, H; Lorthior, A; Niarra, R; Chambon, Y; Jeunemaitre, X; Plouin, P F; Laurent, S; Boutouyrie, P; Azizi, M

    2015-06-01

    Fibromuscular dysplasia (FD) is a rare idiopathic, segmental, non-atherosclerotic non-inflammatory vascular disease. We previously showed that FD is a general arterial disease with focal exacerbation of the trait. However, whether endothelial dysfunction may be involved in the pathophysiology of FD is unclear. In a cross sectional study, we compared the endothelial function between 50 patients with multifocal FD of renal/carotid arteries confirmed by CT-angiography, 50 essential hypertensive (EH) patients matched for age, sex, ethnicity and BP and 50 healthy subjects (HS) matched for age, sex and ethnicity. Exclusion criteria were: tobacco consumption, hypercholesterolemia, diabetes, aspirin or statin treatment. Brachial artery (BA) FMD after release of hand ischemia and glyceryl trinitrate (GTN)-induced EID was measured using a high-resolution radiofrequency-based echotracking system blind to the diagnosis. FD, EH and HS were well matched (52yrs, 85% women, 80% caucasian). SBP was higher in FD (125 ± 15mmHg) and EH (121 ± 12mmHg) than EH (113 ± 10mmHg) despite antihypertensive treatments. BA external diameter was significantly lower in FD than in both HS and EH before, during and after hand ischemia and after GTN. BA intima media thickness (IMT), internal diameter did not differ between the 3 groups. FMD (%) or EID (%) did not significantly differ between the 3 groups. BA flow velocity did not significantly differ in any experimental condition.(Figure is included in full-text article.) : In conclusion, despite showing similar acute vasodilatory responses to flow and GTN, FD patients differed from EH and HS in terms of arterial morphology with smaller BA diameter associated with similar IMT. This paradoxical remodeling may suggest a chronic defect in the endothelium-dependent pathways involved in arterial remodeling in FD patients.

  18. Risk factors for the transmission of foot-and-mouth disease during the 2010 outbreak in Japan: a case–control study

    PubMed Central

    2013-01-01

    Background In 2010, foot-and-mouth disease (FMD) occurred for the first time in a decade in Japan. Movement or shipment of people and animals around infected farms was restricted; however these contingency measures proved insufficient to prevent FMD spread. Consequently, a total of 292 farms were confirmed as infected during this outbreak. We conducted a case–control study to identify the risk factors associated with FMD transmission between farms during these restrictions. As there was discordance in the control measures taken, risk factors were examined separately for two areas. Analyses were also performed separately for cattle and pig farms given their different infectivity and susceptibility. Results For cattle farms in the movement restriction area, the odds of having the factor ‘farm equipment was shared with other farms’ was significantly higher for case farms than for control farms. For cattle farms in the shipment restriction area, the odds of having the factors ‘feed transport vehicles visited the farm’ and ‘staff of livestock-related companies visited the farm’ were significantly higher on case farms than control farms. In pig farms in the movement restriction area, the odds of having factor ‘farm staff commuted from outside’ was 20 times higher for case farms than control farms. In addition, case farms were less likely to have the factors ‘fattening farm’ and ‘barn has physical barriers’ compared with control farms. Conclusions In the movement restriction area, the disease was likely to spread regardless of the movement of people and vehicles, and physical barriers were found to be a protective factor. Therefore, physical barriers from the surrounding environments seemed to prevent farms from being infected. Conversely, in the shipment restriction area, movement of people and vehicles was strongly associated with disease spread. These results allow a better understanding of the risk factors associated with FMD transmission and

  19. Transmission of Foot-and-Mouth Disease SAT2 Viruses at the Wildlife–Livestock Interface of Two Major Transfrontier Conservation Areas in Southern Africa

    PubMed Central

    Brito, Barbara P.; Jori, Ferran; Dwarka, Rahana; Maree, Francois F.; Heath, Livio; Perez, Andres M.

    2016-01-01

    Over a decade ago, foot-and-mouth disease (FMD) re-emerged in Southern Africa specifically in beef exporting countries that had successfully maintained disease-free areas in the past. FMD virus (FMDV) serotype SAT2 has been responsible for a majority of these outbreaks. Epidemiological studies have revealed the importance of the African buffalo as the major wildlife FMD reservoir in the region. We used phylogeographic analysis to study dynamics of FMD transmission between buffalo and domestic cattle at the interface of the major wildlife protected areas in the region currently encompassing two largest Transfrontier conservation areas: Kavango–Zambezi (KAZA) and Great Limpopo (GL). Results of this study showed restricted local occurrence of each FMDV SAT2 topotypes I, II, and III, with occasional virus migration from KAZA to GL. Origins of outbreaks in livestock are frequently attributed to wild buffalo, but our results suggest that transmission from cattle to buffalo also occurs. We used coalescent Bayesian skyline analysis to study the genetic variation of the virus in cattle and buffalo, and discussed the association of these genetic changes in the virus and relevant epidemiological events that occurred in this area. Our results show that the genetic diversity of FMDV SAT2 has decreased in buffalo and cattle population during the last decade. This study contributes to understand the major dynamics of transmission and genetic variation of FMDV SAT2 in Southern Africa, which will could ultimately help in designing efficient strategies for the control of FMD at a local and regional level. PMID:27148217

  20. On The Use Of Models To Assess Foot-And-Mouth Disease Transmission And Control

    SciTech Connect

    Kostova-Vassilevska, T

    2004-07-12

    The 2001 outbreaks of foot-and-mouth disease (FMD) in Europe (Ferguson et al. 2001a, 2001b; Bouma et al. 2003) and concern about the possibility of an intentional introduction of a devastating foreign animal disease triggered renewed interest in both theoretical and experimental research related to FMD. Theoretical models of disease transmission, which influenced the tactical decisions of the United Kingdom (UK) government during the epidemic (Taylor 2003), resulted in large numbers of uninfected animals being slaughtered. After the epidemic, the adopted control policies were sharply criticized (Kitching 2004;, Taylor 2003). Still, the role of computationaL modeling for analyzing the scope of the epidemic and devising control strategies was recognized as substantial and necessary.

  1. Three calibration factors, applied to a rapid sweeping method, can accurately estimate Aedes aegypti (Diptera: Culicidae) pupal numbers in large water-storage containers at all temperatures at which dengue virus transmission occurs.

    PubMed

    Romero-Vivas, C M E; Llinás, H; Falconar, A K I

    2007-11-01

    The ability of a simple sweeping method, coupled to calibration factors, to accurately estimate the total numbers of Aedes aegypti (L.) (Diptera: Culicidae) pupae in water-storage containers (20-6412-liter capacities at different water levels) throughout their main dengue virus transmission temperature range was evaluated. Using this method, one set of three calibration factors were derived that could accurately estimate the total Ae. aegypti pupae in their principal breeding sites, large water-storage containers, found throughout the world. No significant differences were obtained using the method at different altitudes (14-1630 m above sea level) that included the range of temperatures (20-30 degrees C) at which dengue virus transmission occurs in the world. In addition, no significant differences were found in the results obtained between and within the 10 different teams that applied this method; therefore, this method was extremely robust. One person could estimate the Ae. aegypti pupae in each of the large water-storage containers in only 5 min by using this method, compared with two people requiring between 45 and 90 min to collect and count the total pupae population in each of them. Because the method was both rapid to perform and did not disturb the sediment layers in these domestic water-storage containers, it was more acceptable by the residents, and, therefore, ideally suited for routine surveillance purposes and to assess the efficacy of Ae. aegypti control programs in dengue virus-endemic areas throughout the world.

  2. MAE-FMD: multi-agent evolutionary method for functional module detection in protein-protein interaction networks.

    PubMed

    Ji, Jun Zhong; Jiao, Lang; Yang, Cui Cui; Lv, Jia Wei; Zhang, Ai Dong

    2014-09-30

    Studies of functional modules in a Protein-Protein Interaction (PPI) network contribute greatly to the understanding of biological mechanisms. With the development of computing science, computational approaches have played an important role in detecting functional modules. We present a new approach using multi-agent evolution for detection of functional modules in PPI networks. The proposed approach consists of two stages: the solution construction for agents in a population and the evolutionary process of computational agents in a lattice environment, where each agent corresponds to a candidate solution to the detection problem of functional modules in a PPI network. First, the approach utilizes a connection-based encoding scheme to model an agent, and employs a random-walk behavior merged topological characteristics with functional information to construct a solution. Next, it applies several evolutionary operators, i.e., competition, crossover, and mutation, to realize information exchange among agents as well as solution evolution. Systematic experiments have been conducted on three benchmark testing sets of yeast networks. Experimental results show that the approach is more effective compared to several other existing algorithms. The algorithm has the characteristics of outstanding recall, F-measure, sensitivity and accuracy while keeping other competitive performances, so it can be applied to the biological study which requires high accuracy.

  3. Antibodies against foot-and-mouth disease (FMD) virus in African buffalos (Syncerus caffer) in selected National Parks in Uganda (2001-2003).

    PubMed

    Ayebazibwe, C; Mwiine, F N; Balinda, S N; Tjørnehøj, K; Masembe, C; Muwanika, V B; Okurut, A R A; Siegismund, H R; Alexandersen, S

    2010-08-01

    In East Africa, the foot-and-mouth disease (FMD) virus (FMDV) isolates have over time included serotypes O, A, C, Southern African Territories (SAT) 1 and SAT 2, mainly from livestock. SAT 3 has only been isolated in a few cases and only in African buffalos (Syncerus caffer). To investigate the presence of antibodies against FMDV serotypes in wildlife in Uganda, serological studies were performed on buffalo serum samples collected between 2001 and 2003. Thirty-eight samples from African buffalos collected from Lake Mburo, Kidepo Valley, Murchison Falls and Queen Elizabeth National Parks were screened using Ceditest FMDV NS to detect antibodies against FMDV non-structural proteins (NSP). The seroprevalence of antibodies against non-structural proteins was 74%. To characterize FMDV antibodies, samples were selected and titrated using serotype-specific solid phase blocking enzyme linked immunosorbent assay (ELISAs). High titres of antibodies (> or =1 : 160) against FMDV serotypes SAT 1, SAT 2 and SAT 3 were identified. This study suggests that African buffalos in the different national parks in Uganda may play an important role in the epidemiology of SAT serotypes of FMDV.

  4. Continuously Variable Transmission

    NASA Technical Reports Server (NTRS)

    Grana, D. C.

    1985-01-01

    Chain slides along two cones, in novel transmission concept. Transmission includes chain drive between two splined shafts. Chain sprockets follow surfaces of two cones. As one chain sprocket moves toward smaller diameter other chain sprocket moves toward larger diameter, thereby changing "gear" ratio. Movement initiated by tension applied to chain by planetary gear mechanism. Device positive, simple, and efficient over wide range of speed ratios.

  5. Endothelial function is impaired in relation to alcohol intake even in the case of light alcohol consumption in Asian men; Flow-mediated Dilation Japan (FMD-J) Study.

    PubMed

    Oda, Nozomu; Kajikawa, Masato; Maruhashi, Tatsuya; Iwamoto, Yumiko; Kishimoto, Shinji; Matsui, Shogo; Hidaka, Takayuki; Kihara, Yasuki; Chayama, Kazuaki; Goto, Chikara; Aibara, Yoshiki; Nakashima, Ayumu; Noma, Kensuke; Tomiyama, Hirofumi; Takase, Bonpei; Yamashina, Akira; Higashi, Yukihito

    2017-03-01

    Heavy drinking should be a predictor of endothelial dysfunction. However, there is little information on the effects of light to moderate alcohol consumption on endothelial function. The purpose of this study was to estimate the effects of dose-dependent alcohol consumption on endothelial function. We measured flow-mediated vasodilation (FMD) in 2734 men aged 21-81years who provided information on alcohol intake at 3 general hospitals. The subjects were divided into 5 groups; non-drinkers (0g/week), light drinkers (>0 to 140g/week), moderate drinkers (>140 to 280g/week), heavy drinkers (>280 to 420g/week), and excessive heavy drinkers (>420g/week). FMD showed a gradual decrease in accordance with alcohol consumption in the entire study population (non-drinkers, 6.6±3.4%; light drinkers, 6.2±3.0%; moderate drinkers, 6.0±3.0%; heavy drinkers, 5.5±2.9%; excessive heavy drinkers, 5.3±3.0%; P<0.001). There was a significant difference in FMD between the light alcohol drinker group and the non-drinker group (P=0.015). After adjustment for other risk factors, the odds of having FMD in the lowest quartile was found to be significantly increased in the 4 drinker groups than in the non-drinker group: light (OR, 1.38; 95% CI, 1.10 to 1.75), moderate (OR, 1.36; 95% CI, 1.01 to 1.82), heavy (OR, 2.05; 95% CI, 1.46 to 2.87), excessive (OR, 2.04; 95% CI, 1.43 to 2.89). These findings suggest that FMD is impaired in relation to alcohol consumption and that FMD is significantly smaller even in light alcohol drinkers than in non-drinkers. Alcohol intake per se may be harmful for vascular function. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. The qualitative f-ratio method applied to electron channelling-induced x-ray imaging with an annular silicon drift detector in a scanning electron microscope in the transmission mode.

    PubMed

    Brodusch, Nicolas; Gauvin, Raynald

    2017-09-01

    Electron channelling is known to affect the x-ray production when an accelerated electron beam is applied to a crystalline material and is highly dependent on the local crystal orientation. This effect, unless very long counting time are used, is barely noticeable on x-ray energy spectra recorded with conventional silicon drift detectors (SDD) located at a small elevation angle. However, the very high count rates provided by the new commercially available annular SDDs permit now to observe this effect routinely and may, in some circumstances, hide the true elemental x-ray variations due to the local true specimen composition. To circumvent this issue, the recently developed f-ratio method was applied to display qualitatively the true net intensity x-ray variations in a thin specimen of a Ti-6Al-4V alloy in a scanning electron microscope in transmission mode. The diffraction contrast observed in the x-ray images was successfully cancelled through the use of f-ratios and the true composition variations at the grain boundaries could be observed in relation to the dislocation alignment prior to the β-phase nucleation. The qualitative effectiveness in removing channelling effects demonstrated in this work makes the f-ratio, in its quantitative form, a possible alternative to the ZAF method in channelling conditions. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

  7. Transmission eigenvalues

    NASA Astrophysics Data System (ADS)

    Cakoni, Fioralba; Haddar, Houssem

    2013-10-01

    In inverse scattering theory, transmission eigenvalues can be seen as the extension of the notion of resonant frequencies for impenetrable objects to the case of penetrable dielectrics. The transmission eigenvalue problem is a relatively late arrival to the spectral theory of partial differential equations. Its first appearance was in 1986 in a paper by Kirsch who was investigating the denseness of far-field patterns for scattering solutions of the Helmholtz equation or, in more modern terminology, the injectivity of the far-field operator [1]. The paper of Kirsch was soon followed by a more systematic study by Colton and Monk in the context of developing the dual space method for solving the inverse scattering problem for acoustic waves in an inhomogeneous medium [2]. In this paper they showed that for a spherically stratified media transmission eigenvalues existed and formed a discrete set. Numerical examples were also given showing that in principle transmission eigenvalues could be determined from the far-field data. This first period of interest in transmission eigenvalues was concluded with papers by Colton et al in 1989 [3] and Rynne and Sleeman in 1991 [4] showing that for an inhomogeneous medium (not necessarily spherically stratified) transmission eigenvalues, if they existed, formed a discrete set. For the next seventeen years transmission eigenvalues were ignored. This was mainly due to the fact that, with the introduction of various sampling methods to determine the shape of an inhomogeneous medium from far-field data, transmission eigenvalues were something to be avoided and hence the fact that transmission eigenvalues formed at most a discrete set was deemed to be sufficient. In addition, questions related to the existence of transmission eigenvalues or the structure of associated eigenvectors were recognized as being particularly difficult due to the nonlinearity of the eigenvalue problem and the special structure of the associated transmission

  8. AQUIFER TRANSMISSIVITY

    EPA Science Inventory

    Evaluation of groundwater resources requires the knowledge of the capacity of aquifers to store and transmit ground water. This requires estimates of key hydraulic parameters, such as the transmissivity, among others. The transmissivity T (m2/sec) is a hydrauli...

  9. Automatic transmission

    SciTech Connect

    Miura, M.; Aoki, H.

    1988-02-02

    An automatic transmission is described comprising: an automatic transmission mechanism portion comprising a single planetary gear unit and a dual planetary gear unit; carriers of both of the planetary gear units that are integral with one another; an input means for inputting torque to the automatic transmission mechanism, clutches for operatively connecting predetermined ones of planetary gear elements of both of the planetary gear units to the input means and braking means for restricting the rotation of predetermined ones of planetary gear elements of both of the planetary gear units. The clutches are disposed adjacent one another at an end portion of the transmission for defining a clutch portion of the transmission; a first clutch portion which is attachable to the automatic transmission mechanism portion for comprising the clutch portion when attached thereto; a second clutch portion that is attachable to the automatic transmission mechanism portion in place of the first clutch portion for comprising the clutch portion when so attached. The first clutch portion comprising first clutch for operatively connecting the input means to a ring gear of the single planetary gear unit and a second clutch for operatively connecting the input means to a single gear of the automatic transmission mechanism portion. The second clutch portion comprising a the first clutch, the second clutch, and a third clutch for operatively connecting the input member to a ring gear of the dual planetary gear unit.

  10. AQUIFER TRANSMISSIVITY

    EPA Science Inventory

    Evaluation of groundwater resources requires the knowledge of the capacity of aquifers to store and transmit ground water. This requires estimates of key hydraulic parameters, such as the transmissivity, among others. The transmissivity T (m2/sec) is a hydrauli...

  11. Infinitely variable steering transmission

    SciTech Connect

    Reed, B.O.

    1989-04-04

    A steering transmission is described comprising: first and second drive units each driven at a substantially constant speed for producing respective first and second unidirectional, continuous outputs infinitely variable between a minimum speed and a maximum speed; a first output planetary gear drivingly connected to a first transmission output; a second output planetary gear set drivingly connected to a second transmission output; an input gear set; means interconnecting the first and second output planetary gear sets; means connecting the first drive unit to the first output planetary gear set; means applying the second drive unit output to the second output planetary gear set; means applying a substantially constant speed input to the input gear set; means for selectively conditioning the input gear set to drive the one output planetary gear set at a speed having a first predetermined fixed ratio to the constant speed input, whereby to operate the transmission in one speed range; and means for selectively applying the first drive unit output to second output planetary gear set, whereby to operate the transmission in another speed range different from the one speed range.

  12. Quantifying Transmission.

    PubMed

    Woolhouse, Mark

    2017-07-01

    Transmissibility is the defining characteristic of infectious diseases. Quantifying transmission matters for understanding infectious disease epidemiology and designing evidence-based disease control programs. Tracing individual transmission events can be achieved by epidemiological investigation coupled with pathogen typing or genome sequencing. Individual infectiousness can be estimated by measuring pathogen loads, but few studies have directly estimated the ability of infected hosts to transmit to uninfected hosts. Individuals' opportunities to transmit infection are dependent on behavioral and other risk factors relevant given the transmission route of the pathogen concerned. Transmission at the population level can be quantified through knowledge of risk factors in the population or phylogeographic analysis of pathogen sequence data. Mathematical model-based approaches require estimation of the per capita transmission rate and basic reproduction number, obtained by fitting models to case data and/or analysis of pathogen sequence data. Heterogeneities in infectiousness, contact behavior, and susceptibility can have substantial effects on the epidemiology of an infectious disease, so estimates of only mean values may be insufficient. For some pathogens, super-shedders (infected individuals who are highly infectious) and super-spreaders (individuals with more opportunities to transmit infection) may be important. Future work on quantifying transmission should involve integrated analyses of multiple data sources.

  13. The impact of within-herd genetic variation upon inferred transmission trees for foot-and-mouth disease virus.

    PubMed

    Valdazo-González, Begoña; Kim, Jan T; Soubeyrand, Samuel; Wadsworth, Jemma; Knowles, Nick J; Haydon, Daniel T; King, Donald P

    2015-06-01

    Full-genome sequences have been used to monitor the fine-scale dynamics of epidemics caused by RNA viruses. However, the ability of this approach to confidently reconstruct transmission trees is limited by the knowledge of the genetic diversity of viruses that exist within different epidemiological units. In order to address this question, this study investigated the variability of 45 foot-and-mouth disease virus (FMDV) genome sequences (from 33 animals) that were collected during 2007 from eight premises (10 different herds) in the United Kingdom. Bayesian and statistical parsimony analysis demonstrated that these sequences exhibited clustering which was consistent with a transmission scenario describing herd-to-herd spread of the virus. As an alternative to analysing all of the available samples in future epidemics, the impact of randomly selecting one sequence from each of these herds was used to assess cost-effective methods that might be used to infer transmission trees during FMD outbreaks. Using these approaches, 85% and 91% of the resulting topologies were either identical or differed by only one edge from a reference tree comprising all of the sequences generated within the outbreak. The sequence distances that accrued during sequential transmission events between epidemiological units was estimated to be 4.6 nucleotides, although the genetic variability between viruses recovered from chronic carrier animals was higher than between viruses from animals with acute-stage infection: an observation which poses challenges for the use of simple approaches to infer transmission trees. This study helps to develop strategies for sampling during FMD outbreaks, and provides data that will guide the development of further models to support control policies in the event of virus incursions into FMD free countries.

  14. Association of BoLA DRB3 alleles with variability in immune response among the crossbred cattle vaccinated for foot-and-mouth disease (FMD).

    PubMed

    Gowane, G R; Sharma, A K; Sankar, M; Narayanan, K; Das, Biswajit; Subramaniam, S; Pattnaik, B

    2013-08-01

    Polymorphism of bovine leukocyte antigen (BoLA) DRB3 gene is being intensively investigated for potential association with economically important diseases of cattle. Accordingly, we investigated the association of DRB3 Exon 2 polymorphism as evidenced by the variation in the binding pockets with variability in immune response to inactivated trivalent (O, A and Asia1) foot and mouth disease virus (FMDV) vaccine in a closed population of crossbred cattle. Antibody titer of ≥ 1.8 was set as the cut off value to distinguish the protected (≥ 1.8) and unprotected (<1.8) animals. Eleven different alleles of over 3% frequency were detected in the population. We found that DRB3 alleles 0201, 0801 and 1501 always ranked high for protective immune response whereas alleles 0701, 1103 and 1101 consistently ranked low for unprotected immune response for all the three serotypes. Rank correlation of DRB3 alleles among the three serotypes was positive, high in magnitude and statistically significant (P<0.05). Logistic regression analysis revealed that odds of protection from the vaccine were highest for all the three serotypes if allele (∗)1501 was present and strengthened the results of allele ranking. Predicted amino acid substitution in the peptide binding pockets revealed that all the important sites had high Wu-Kabat index. Similarly, specific residues in pockets were crucial for immune response to FMD vaccine. There were specific substitutions in un-protected alleles such as absence of acidic amino acids substituted by basic amino acid at β71, presence of non-polar cysteine or basic histidine at β30 and presence of polar tyrosine at β37. From the observations, we hypothesize that the substitutions lead to unique conformational changes in the protein products of the studied alleles that would associate with the protective or unprotective antibody response to FMDV vaccine. The knowledge has potential implications in future selection programs if integrated with the

  15. Evaluation of Infectivity, Virulence and Transmission of FDMV Field Strains of Serotypes O and A Isolated In 2010 from Outbreaks in the Republic of Korea

    PubMed Central

    Pacheco, Juan M.; Lee, Kwang-Nyeong; Eschbaumer, Michael; Bishop, Elizabeth A.; Hartwig, Ethan J.; Pauszek, Steven J.; Smoliga, George R.; Kim, Su-Mi; Park, Jong-Hyeon; Ko, Young-Joon; Lee, Hyang-Sim; Tark, Dongseob; Cho, In-Soo; Kim, Byounghan; Rodriguez, Luis L.; Arzt, Jonathan

    2016-01-01

    Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (South Korea). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in South Korea in 2010/2011. The causative viruses belonged to lineages that had been spreading in South East Asia, far East and East Asia since 2009 and presented a great threat to the countries in that region. Most FMDV strains infect ruminants and pigs, as it happened during the outbreaks of FMDV serotype O in South Korea. Contrastingly, the strain of serotype A affected only ruminants. Based upon these findings, the intention of the work described in the current report was to characterize and compare the infectivity, virulence and transmission of both strains under laboratory conditions in cattle and pigs, by direct inoculation and contact exposure. As expected, FMDV serotype O was highly virulent in both cattle and swine by contact exposure and direct inoculation. Surprisingly, FMDV serotype A was highly virulent in swine, but was less infectious in cattle by contact exposure to infected swine or cattle. Interestingly, similar quantities of aerosolized FMDV RNA were detected during experiments with viruses of serotypes O and A. Specific virus-host interaction of A/SKR/2010 could affect the transmission of this strain to cattle, and this may explain in part the limited spread of the serotype A epizootic. PMID:26735130

  16. Evaluation of Infectivity, Virulence and Transmission of FDMV Field Strains of Serotypes O and A Isolated In 2010 from Outbreaks in the Republic of Korea

    DOE PAGES

    Pacheco, Juan M.; Lee, Kwang -Nyeong; Eschbaumer, Michael; ...

    2016-01-06

    Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (South Korea). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in South Korea in 2010/2011. The causative viruses belonged to lineages that had been spreading in South East Asia, far East and East Asia since 2009 and presented a great threat to the countries in that region. Most FMDV strains infect ruminants and pigs, as it happened during the outbreaks of FMDV serotype O in South Korea. Contrastingly, the strain ofmore » serotype A affected only ruminants. Based upon these findings, the intention of the work described in the current report was to characterize and compare the infectivity, virulence and transmission of both strains under laboratory conditions in cattle and pigs, by direct inoculation and contact exposure. As expected, FMDV serotype O was highly virulent in both cattle and swine by contact exposure and direct inoculation. Surprisingly, FMDV serotype A was highly virulent in swine, but was less infectious in cattle by contact exposure to infected swine or cattle. Interestingly, similar quantities of aerosolized FMDV RNA were detected during experiments with viruses of serotypes O and A. Here, specific virus-host interaction of A/SKR/2010 could affect the transmission of this strain to cattle, and this may explain in part the limited spread of the serotype A epizootic« less

  17. Evaluation of Infectivity, Virulence and Transmission of FDMV Field Strains of Serotypes O and A Isolated In 2010 from Outbreaks in the Republic of Korea

    SciTech Connect

    Pacheco, Juan M.; Lee, Kwang -Nyeong; Eschbaumer, Michael; Bishop, Elizabeth A.; Hartwig, Ethan J.; Pauszek, Steven J.; Smoliga, George R.; Kim, Su -Mi; Park, Jong -Hyeon; Ko, Young -Joon; Lee, Hyang -Sim; Tark, Dongseob; Cho, In -Soo; Kim, Byounghan; Rodriguez, Luis L.; Arzt, Jonathan; Parida, Satya

    2016-01-06

    Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (South Korea). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in South Korea in 2010/2011. The causative viruses belonged to lineages that had been spreading in South East Asia, far East and East Asia since 2009 and presented a great threat to the countries in that region. Most FMDV strains infect ruminants and pigs, as it happened during the outbreaks of FMDV serotype O in South Korea. Contrastingly, the strain of serotype A affected only ruminants. Based upon these findings, the intention of the work described in the current report was to characterize and compare the infectivity, virulence and transmission of both strains under laboratory conditions in cattle and pigs, by direct inoculation and contact exposure. As expected, FMDV serotype O was highly virulent in both cattle and swine by contact exposure and direct inoculation. Surprisingly, FMDV serotype A was highly virulent in swine, but was less infectious in cattle by contact exposure to infected swine or cattle. Interestingly, similar quantities of aerosolized FMDV RNA were detected during experiments with viruses of serotypes O and A. Here, specific virus-host interaction of A/SKR/2010 could affect the transmission of this strain to cattle, and this may explain in part the limited spread of the serotype A epizootic

  18. Power transmission

    SciTech Connect

    Yale, O.S.

    1989-12-12

    This patent describes a power transmission. It comprises: in combination, a master gear having at least one annular tooth set, means for drivingly engaging the master gear with a power source, driven shaft, a yoke member attached to the shaft and including a screw pump housing extending radially with respect to the shaft with a pair of ports in spaced relation, a pump screw rotatable in the housing and a pump gear attached to the screw and engaging the annular tooth set, and a casing for transmission fluid. The pump housing being located for immersion in the fluid.

  19. Natural transmission of foot-and-mouth disease virus between African buffalo (Syncerus caffer) and impala (Aepyceros melampus) in the Kruger National Park, South Africa.

    PubMed

    Bastos, A D; Boshoff, C I; Keet, D F; Bengis, R G; Thomson, G R

    2000-06-01

    VP1 gene sequences of SAT-2 type foot-and-mouth disease (FMD) viruses recovered from impala and African buffalo in the Kruger National Park (KNP) were used to determine intra- and interspecies relationships of viruses circulating in these wildlife populations. On this basis five distinct lineages of SAT-2 virus were identified in routine sampling of oesophageopharyngeal epithelium from buffalo between 1988 and 1996. Different lineages were associated with discrete geographic sampling localities. Over the period 1985-95, four unrelated epizootics occurred in impala in defined localities within the KNP. Evidence for natural transmission of FMD between buffalo and impala is presented for the most recent 1995 outbreak, with data linking the 1985 and 1988/9 impala epizootics to viruses associated with specific buffalo herds.

  20. HIV Transmission

    MedlinePlus

    ... Abroad Treatment Basic Statistics Get Tested Find an HIV testing site near you. Enter ZIP code or city Follow HIV/AIDS CDC HIV CDC HIV/AIDS See RSS | ... on HIV Syndicated Content Website Feedback HIV/AIDS HIV Transmission Language: English (US) Español (Spanish) Recommend ...

  1. Foot-and-mouth disease in feral swine: susceptibility and transmission.

    PubMed

    Mohamed, F; Swafford, S; Petrowski, H; Bracht, A; Schmit, B; Fabian, A; Pacheco, J M; Hartwig, E; Berninger, M; Carrillo, C; Mayr, G; Moran, K; Kavanaugh, D; Leibrecht, H; White, W; Metwally, S

    2011-08-01

    Experimental studies of foot-and-mouth disease (FMD) in feral swine are limited, and data for clinical manifestations and disease transmissibility are lacking. In this report, feral and domestic swine were experimentally infected with FMDV (A24-Cruzeiro), and susceptibility and virus transmission were studied. Feral swine were proved to be highly susceptible to A-24 Cruzeiro FMD virus by intradermal inoculation and by contact with infected domestic and feral swine. Typical clinical signs in feral swine included transient fever, lameness and vesicular lesions in the coronary bands, heel bulbs, tip of the tongue and snout. Domestic swine exhibited clinical signs of the disease within 24 h after contact with feral swine, whereas feral swine did not show clinical signs of FMD until 48 h after contact with infected domestic and feral swine. Clinical scores of feral and domestic swine were comparable. However, feral swine exhibited a higher tolerance for the disease, and their thicker, darker skin made vesicular lesions difficult to detect. Virus titration of oral swabs showed that both feral and domestic swine shed similar amounts of virus, with levels peaking between 2 to 4 dpi/dpc (days post-inoculation/days post-contact). FMDV RNA was intermittently detectable in the oral swabs by real-time RT-PCR of both feral and domestic swine between 1 and 8 dpi/dpc and in some instances until 14 dpi/12 dpc. Both feral and domestic swine seroconverted 6-8 dpi/dpc as measured by 3ABC antibody ELISA and VIAA assays. FMDV RNA levels in animal room air filters were similar in feral and domestic swine animal rooms, and were last detected at 22 dpi, while none were detectable at 28 or 35 dpi. The FMDV RNA persisted in domestic and feral swine tonsils up to 33-36 dpi/dpc, whereas virus isolation was negative. Results from this study will help understand the role feral swine may play in sustaining an FMD outbreak, and may be utilized in guiding surveillance, epidemiologic and economic

  2. Malaria transmission rates estimated from serological data.

    PubMed Central

    Burattini, M. N.; Massad, E.; Coutinho, F. A.

    1993-01-01

    A mathematical model was used to estimate malaria transmission rates based on serological data. The model is minimally stochastic and assumes an age-dependent force of infection for malaria. The transmission rates estimated were applied to a simple compartmental model in order to mimic the malaria transmission. The model has shown a good retrieving capacity for serological and parasite prevalence data. PMID:8270011

  3. Automatic transmission

    SciTech Connect

    Miki, N.

    1988-10-11

    This patent describes an automatic transmission including a fluid torque converter, a first gear unit having three forward-speed gears and a single reverse gear, a second gear unit having a low-speed gear and a high-speed gear, and a hydraulic control system, the hydraulic control system comprising: a source of pressurized fluid; a first shift valve for controlling the shifting between the first-speed gear and the second-speed gear of the first gear unit; a second shift valve for controlling the shifting between the second-speed gear and the third-speed gear of the first gear unit; a third shift valve equipped with a spool having two positions for controlling the shifting between the low-speed gear and the high-speed gear of the second gear unit; a manual selector valve having a plurality of shift positions for distributing the pressurized fluid supply from the source of pressurized fluid to the first, second and third shift valves respectively; first, second and third solenoid valves corresponding to the first, second and third shift valves, respectively for independently controlling the operation of the respective shift valves, thereby establishing a six forward-speed automatic transmission by combining the low-speed gear and the high-speed gear of the second gear unit with each of the first-speed gear, the second speed gear and the third-speed gear of the first gear unit; and means to fixedly position the spool of the third shift valve at one of the two positions by supplying the pressurized fluid to the third shift valve when the manual selector valve is shifted to a particular shift position, thereby locking the second gear unit in one of low-speed gear and the high-speed gear, whereby the six forward-speed automatic transmission is converted to a three forward-speed automatic transmission when the manual selector valve is shifted to the particular shift position.

  4. Automatic transmission

    SciTech Connect

    Ohkubo, M.

    1988-02-16

    An automatic transmission is described combining a stator reversing type torque converter and speed changer having first and second sun gears comprising: (a) a planetary gear train composed of first and second planetary gears sharing one planetary carrier in common; (b) a clutch and requisite brakes to control the planetary gear train; and (c) a speed-increasing or speed-decreasing mechanism is installed both in between a turbine shaft coupled to a turbine of the stator reversing type torque converter and the first sun gear of the speed changer, and in between a stator shaft coupled to a reversing stator and the second sun gear of the speed changer.

  5. Within-farm transmission dynamics of foot and mouth disease as revealed by the 2001 epidemic in Great Britain.

    PubMed

    Chis Ster, Irina; Dodd, Peter J; Ferguson, Neil M

    2012-08-01

    This paper uses statistical and mathematical models to examine the potential impact of within-farm transmission dynamics on the spread of the 2001 foot and mouth disease (FMD) outbreak in Great Britain. We partly parameterize a simple within farm transmission model using data from experimental studies of FMD pathogenesis, embed this model within an existing between-farm transmission model, and then estimate unknown parameters (such as the species-specific within-farm reproduction number) from the 2001 epidemic case data using Markov Chain Monte-Carlo (MCMC) methods. If the probability of detecting an infected premises depends on farm size and species mix then the within-farm species specific basic reproduction ratios for baseline models are estimated to be 21 (16, 25) and 14 (10, 19) for cattle and sheep, respectively. Alternatively, if detection is independent of farm size, then the corresponding estimates are 49 (41, 61) and 10 (1.4, 21). Both model variants predict that the average fraction of total farm infectiousness accumulated prior to detection of infection on an IP is about 30-50% in cattle or mixed farms. The corresponding estimate for sheep farms depended more on the detection model, being 65-80% if detection was linked to the farms' characteristics, but only 25% if not. We highlighted evidence which reinforces the role of within-farm dynamics in contributing to the long tail of the 2001 epidemic. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Transmission Investment: A Primer

    SciTech Connect

    McGarvey, Joe

    2006-10-15

    This primer highlights recent trends in transmission investment, summarizes the division of jurisdictional authority over transmission, and presents four alternative models for transmission ownership. (author)

  7. Automatic transmission

    SciTech Connect

    Aoki, H.

    1989-03-21

    An automatic transmission is described, comprising: a torque converter including an impeller having a connected member, a turbine having an input member and a reactor; and an automatic transmission mechanism having first to third clutches and plural gear units including a single planetary gear unit with a ring gear and a dual planetary gear unit with a ring gear. The single and dual planetary gear units have respective carriers integrally coupled with each other and respective sun gears integrally coupled with each other, the input member of the turbine being coupled with the ring gear of the single planetary gear unit through the first clutch, and being coupled with the sun gear through the second clutch. The connected member of the impeller is coupled with the ring gear of the dual planetary gear of the dual planetary gear unit is made to be and ring gear of the dual planetary gear unit is made to be restrained as required, and the carrier is coupled with an output member.

  8. Vented transmission

    SciTech Connect

    Nguyen, T.H.

    1990-01-29

    This patent describes a vented transmission. It comprises: a housing; a rotary input to the housing; a rotary output from the housing; transmission means within the housing interconnecting the input and the output and including a hollow, rotary shaft journaled within the housing; a vent tube having a first end extending into one end of the hollow shaft and a second end in fluid communication with the exterior of the housing; a shoulder within the hollow shaft and intermediate the ends of the vent tube and defining of relatively smaller diameter section near the first end of the vent tube that is within the hollow shaft and a relatively large diameter section nearer the second end of the vent tube; at least one aperture extending through the hollow shaft from the large diameter section immediately adjacent the shoulder; and a labyrinth seal at the interface of the vent tube and the large diameter section at a location between the aperture (s) and the second end of the vent tube.

  9. Gear transmission

    SciTech Connect

    Takami, A.

    1987-08-11

    A gear transmission is provided with a first rotary shaft, a first non-circular gear fixed thereto, a second rotary shaft, and a second non-circular gear fixed thereto, the first non-circular gear and the second non-circular gear being continuously engageably rotated, thereby transmitting a rotational driving force between the first rotary shaft and the second rotary shaft. The gear transmission is characterized in that when the absolute value vertical bar..omega..2/..omega..1vertical bar of a ratio of an angular velocity of ..omega..2 of the second rotary shaft with respect to an angular velocity of ..omega..1 of the first rotary shaft is represented by F(theta) as the function of the angular displacement theta of the first rotary shaft, an engageably rotary portion where a differential value K given in a differential equation as to the angular displacement thetaK=d log F(theta)/dtheta presents a positive or negative constant value in continuation is provided in the shape of intermeshing pitch curves of the first non-circular gear and the second non-circular gear.

  10. Automatic transmission

    SciTech Connect

    Meyman, U.

    1987-03-10

    An automatic transmission is described comprising wheel members each having discs defining an inner space therebetween; turnable blades and vane members located in the inner space between the discs of at least one of the wheel members, the turnable blades being mechanically connected with the vane members. Each of the turnable blades has an inner surface and an outer surface formed by circular cylindrical surfaces having a common axis, each of the turnable blades being turnable about the common axis of the circular cylindrical surfaces forming the inner and outer surfaces of the respective blade; levers turnable about the axes and supporting the blades; the discs having openings extending coaxially with the surfaces which describe the blades. The blades are partially received in the openings of the discs; and a housing accommodating the wheel members and the turnable blades and the vane members.

  11. Automatic transmission

    SciTech Connect

    Hamane, M.; Ohri, H.

    1989-03-21

    This patent describes an automatic transmission connected between a drive shaft and a driven shaft and comprising: a planetary gear mechanism including a first gear driven by the drive shaft, a second gear operatively engaged with the first gear to transmit speed change output to the driven shaft, and a third gear operatively engaged with the second gear to control the operation thereof; centrifugally operated clutch means for driving the first gear and the second gear. It also includes a ratchet type one-way clutch for permitting rotation of the third gear in the same direction as that of the drive shaft but preventing rotation in the reverse direction; the clutch means comprising a ratchet pawl supporting plate coaxially disposed relative to the drive shaft and integrally connected to the third gear, the ratchet pawl supporting plate including outwardly projection radial projections united with one another at base portions thereof.

  12. Planetary transmission

    SciTech Connect

    Nerstad, K.A.; Windish, W.E.

    1987-04-21

    A planetary transmission is described comprising: an input shaft; a first planetary gear set having a first sun gear driven by the input shaft, a first planet carrier serving as the output, a first ring gear, and first brake means for selectively holding the fist ring gear stationary; a second planetary gear set having a second sun gear driven by the input shaft, a second planet carrier connected for joint rotation to the first ring gear, a second ring gear, and second brake means for selectively holding the second ring gear stationary; a third planetary gear set having a third sun gear connected for joint rotation to the second planet carrier, a third planet carrier connected for joint rotation to the second ring gear, a third ring gear, and third brake means for selectively holding the third ring gear stationary; and clutch means for connecting the third sun gear to the input shaft and providing a direct drive mode of operation.

  13. Overdrive transmission

    SciTech Connect

    Miller, G.F.

    1986-02-04

    This patent describes an overdrive transmission device for use with a motor vehicle. It consists of: a housing; a driving shaft rotatably mounted within the housing; a planetary gear-train; a driven shaft rotatably mounted in the housing and driven by the planetary gear train; and, a device for selectively connecting the planetary gear carrier to the housing or to the driven shaft for rotation; a hydraulically actuated piston adapted to forcibly contact the clutch friction members of the second clutch; a source of working fluid; a pump in fluid flow communication with the source of working fluid; a first valve downstream of the pump and in fluid flow communication with the pump and the hydraulically activated piston.

  14. Phasing transmission

    SciTech Connect

    Himmelein, M.K.; Haaser, J.D.

    1992-06-23

    This patent describes a mechanical power transmission. It comprises a pair of axially aligned rotatable shaft members, a motor member, having a motor housing of thin axial width located within the central housing, fixed to one of the shaft members and axially aligned to rotate wherewith, and a harmonic drive member of thin axial width positioned within the central housing in axial alignment between the motor member and the remaining shaft member, a circular spline fixed to the motor housing for rotation therewith, a flex spline engaged with the dynamic spline and the circular spline, and a wave generator in communication with the flex spline and a wave generator in communication with the flex spline and engaged with the center shaft of the motor member.

  15. Data transmission networks

    NASA Technical Reports Server (NTRS)

    Alexovich, Robert

    1990-01-01

    A task order was written by the High Resolution, High Frame Rate Video Technology (HHVT) project engineers to investigate data compression techniques that could be applied to the HHVT system, and both existing and planned downlink/uplink capabilities of the Space Shuttle and Space Station Freedom. The following tasks were included: (1) Investigate signal channel availability and determine both the maximum possible data rate and the average data rate; (2) Identify time blocks for HHVT video transmission assuming time sharing and interruptions in the communication links; (3) Determine the bit error rates to be expected; and (4) Define the transmit and receive interfaces. A summary chart of the data transmission capabilities for Tracking and Data Relay Satellite System (TDRSS), the Space Shuttle, Space Station Freedom, Spacelab, and USLab are also presented.

  16. HVDC power transmission technology assessment

    SciTech Connect

    Hauth, R.L.; Tatro, P.J.; Railing, B.D.; Johnson, B.K.; Stewart, J.R.; Fink, J.L.

    1997-04-01

    The purpose of this study was to develop an assessment of the national utility system`s needs for electric transmission during the period 1995-2020 that could be met by future reduced-cost HVDC systems. The assessment was to include an economic evaluation of HVDC as a means for meeting those needs as well as a comparison with competing technologies such as ac transmission with and without Flexible AC Transmission System (FACTS) controllers. The role of force commutated dc converters was to be assumed where appropriate. The assessment begins by identifying the general needs for transmission in the U.S. in the context of a future deregulated power industry. The possible roles for direct current transmission are then postulated in terms of representative scenarios. A few of the scenarios are illustrated with the help of actual U.S. system examples. non-traditional applications as well as traditional applications such as long lines and asynchronous interconnections are discussed. The classical ``break-even distance`` concept for comparing HVDC and ac lines is used to assess the selected scenarios. The impact of reduced-cost converters is reflected in terms of the break-even distance. This report presents a comprehensive review of the functional benefits of HVDC transmission and updated cost data for both ac and dc system components. It also provides some provocative thoughts on how direct current transmission might be applied to better utilize and expand our nation`s increasingly stressed transmission assets.

  17. Hydromechanical transmission

    DOEpatents

    Orshansky, Jr. deceased, Elias; Weseloh, William E.

    1978-01-01

    A power transmission having three planetary assemblies, each having its own carrier and its own planet, sun, and ring gears. A speed-varying module is connected in driving relation to the input shaft and in driving relationship to the three sun gears, all of which are connected together. The speed-varying means may comprise a pair of hydraulic units hydraulically interconnected so that one serves as a pump while the other serves as a motor and vice versa, one of the units having a variable stroke and being connected in driving relation to the input shaft, the other unit, which may have a fixed stroke, being connected in driving relation to the sun gears. The input shaft also drives the carrier of the third planetary assembly. A brake grounds the first carrier in the first range and in reverse and causes drive to be delivered to the output through the first ring gear in a hydrostatic mode. The carrier of the third planetary assembly drives the ring gear of the second planetary assembly, and a first clutching means connects the second carrier with the output in a second range, the brake for grounding the first carrier then being released. A second clutching means enables the third ring gear to drive the output shaft in a third range.

  18. Structures of three members of Pfam PF02663 (FmdE) implicated in microbial methanogenesis reveal a conserved α+β core domain and an auxiliary C-terminal treble-clef zinc finger

    PubMed Central

    Axelrod, Herbert L.; Das, Debanu; Abdubek, Polat; Astakhova, Tamara; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Lam, Winnie W.; Marciano, David; McMullan, Daniel; Miller, Mitchell D.; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Puckett, Christina; Reyes, Ron; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Weekes, Dana; Wooten, Tiffany; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

    2010-01-01

    Examination of the genomic context for members of the FmdE Pfam family (PF02663), such as the protein encoded by the fmdE gene from the methanogenic archaeon Methanobacterium thermoautotrophicum, indicates that 13 of them are co-transcribed with genes encoding subunits of molybdenum formylmethanofuran dehydrogenase (EC 1.2.99.5), an enzyme that is involved in microbial methane production. Here, the first crystal structures from PF02663 are described, representing two bacterial and one archaeal species: B8FYU2_DESHY from the anaerobic dehalogenating bacterium Desulfito­bacterium hafniense DCB-2, Q2LQ23_SYNAS from the syntrophic bacterium Syntrophus aciditrophicus SB and Q9HJ63_THEAC from the thermoacidophilic archaeon Thermoplasma acidophilum. Two of these proteins, Q9HJ63_THEAC and Q2LQ23_SYNAS, contain two domains: an N-terminal thioredoxin-like α+β core domain (NTD) consisting of a five-stranded, mixed β-sheet flanked by several α-helices and a C-terminal zinc-finger domain (CTD). B8FYU2_DESHY, on the other hand, is composed solely of the NTD. The CTD of Q9HJ63_THEAC and Q2LQ23_SYNAS is best characterized as a treble-clef zinc finger. Two significant structural differences between Q9HJ63_THEAC and Q2LQ23_SYNAS involve their metal binding. First, zinc is bound to the putative active site on the NTD of Q9HJ63_THEAC, but is absent from the NTD of Q2LQ23_SYNAS. Second, whereas the structure of the CTD of Q2LQ23_SYNAS shows four Cys side chains within coordination distance of the Zn atom, the structure of Q9HJ63_THEAC is atypical for a treble-cleft zinc finger in that three Cys side chains and an Asp side chain are within coordination distance of the zinc. PMID:20944230

  19. The possibility of applying spectral redundancy in DWDM systems on existing long-distance FOCLs for increasing the data transmission rate and decreasing nonlinear effects and double Rayleigh scattering without changes in the communication channel

    NASA Astrophysics Data System (ADS)

    Nekuchaev, A. O.; Shuteev, S. A.

    2014-04-01

    A new method of data transmission in DWDM systems along existing long-distance fiber-optic communication lines is proposed. The existing method, e.g., uses 32 wavelengths in the NRZ code with an average power of 16 conventional units (16 units and 16 zeros on the average) and transmission of 32 bits/cycle. In the new method, one of 124 wavelengths with a duration of one cycle each (at any time instant, no more than 16 obligatory different wavelengths) and capacity of 4 bits with an average power of 15 conventional units and rate of 64 bits/cycle is transmitted at every instant of a 1/16 cycle. The cross modulation and double Rayleigh scattering are significantly decreased owing to uniform distribution of power over time at different wavelengths. The time redundancy (forward error correction (FEC)) is about 7% and allows one to achieve a coding enhancement of about 6 dB by detecting and removing deletions and errors simultaneously.

  20. Comparative efficacy of oral administrated afoxolaner (NexGard™) and fluralaner (Bravecto™) with topically applied permethrin/imidacloprid (Advantix(®)) against transmission of Ehrlichia canis by infected Rhipicephalus sanguineus ticks to dogs.

    PubMed

    Jongejan, Frans; Crafford, Dionne; Erasmus, Heidi; Fourie, Josephus J; Schunack, Bettina

    2016-06-17

    The ability of the topical spot-on Advantix(®) (50 % permethrin/10 % imidacloprid) to prevent transmission of Ehrlichia canis by infected Rhipicephalus sanguineus ticks to dogs has previously been reported. The recent market introduction of chewable tablets containing the novel compounds, afoxolaner (NexGard™) and fluralaner (Bravecto™) enabled us to conduct a comparative efficacy study with respect to the ability of these three products to block transmission of E. canis by ticks to dogs. The speed of kill, immediate drop-off rate and anti-attachment efficacy of the respective products were also studied. The study was a blinded parallel group design, wherein 32 dogs were randomised into four different groups of eight dogs. Group 1 served as negative placebo control, group 2 and 3 were treated on Days 0, 28 and 56 with NexGard™ and Advantix(®), respectively. Group 4 was dosed once on Day 0 with Bravecto™. For tick efficacy assessments 50 non-infected ticks were placed onto the dogs on Days 30, 35, 42, 49, 56, 63, 70, 77 and 84 and on animal tick counts were performed at 3 h, 6 h and 12 h after infestation. To evaluate the ability to block transmission of E. canis, each dog was challenged by releasing 80 adult E. canis-infected R. sanguineus ticks into their sleeping kennels on Days 31, 38, 45 and 52. The animals were monitored for clinical signs of monocytic ehrlichiosis (pyrexia and thrombocytopenia) and were tested for E. canis DNA by PCR and for specific antibodies using IFA. A dog was considered infected with E. canis if both PCR and IFA yielded positive test results up to Day 84. Mean arithmetic tick counts on dogs treated with the Advantix(®) spot-on were significantly (P < 0.0005) lower throughout the study as compared with the negative controls and was, with respect to the speed of kill and resulting onset of acaricidal efficacy, superior over NexGard™ and Bravecto™ at all time points in the 12 h period observed (3 h, 6 h and 12

  1. Power transmission

    SciTech Connect

    Ordo, J.P.; Raszkowski, J.A.; Klemen, D.

    1991-04-23

    This patent describes a transmission. It comprises a housing having first and second end covers; an input shaft rotatably mounted in the first end cover; an output shaft rotatably supported on the input shaft and in the second end cover; first and second countershafts rotatably supported in the end covers for rotation on respective axis parallel with the input shaft and the output shaft; a first head gear continuously rotatable with the input shaft; second and third head gears meshing with the first head gear and continuously rotatable with the first and second countershafts respectively; ratio gears rotatably supported on each of the countershafts including a first ratio gear on the first countershaft and a second ratio gear on the second countershaft; reverse gear means including a first ratio gear on the first countershaft and a second ratio gear on the second countershaft; reverse gear means including a first member rotatable with the first ratio gear means including a first member rotatable with the first ratio gear and a second member rotatably supported on the second countershaft; synchronizer clutch means selectively and alternatively connectible with the second ratio gear and the second member of the reverse gear means; output gear means drivingly connected with the output shaft and including a first ratio output gear meshing with the second ratio gear; first selectively engageable friction clutch means for connecting the first ratio gear with the first countershaft for completing a low forward drive ratio between the input and output shafts; and second selectively engageable friction clutch means for selectively connecting the synchronizer clutch means to the second countershaft and cooperating therewith to selectively alternatively complete a reverse drive ratio between the input shaft and the output shaft and another forward drive ratio between the input and output shafts.

  2. Automatic transmission

    SciTech Connect

    Miura, M.; Inuzuka, T.

    1986-08-26

    1. An automatic transmission with four forward speeds and one reverse position, is described which consists of: an input shaft; an output member; first and second planetary gear sets each having a sun gear, a ring gear and a carrier supporting a pinion in mesh with the sun gear and ring gear; the carrier of the first gear set, the ring gear of the second gear set and the output member all being connected; the ring gear of the first gear set connected to the carrier of the second gear set; a first clutch means for selectively connecting the input shaft to the sun gear of the first gear set, including friction elements, a piston selectively engaging the friction elements and a fluid servo in which hydraulic fluid is selectively supplied to the piston; a second clutch means for selectively connecting the input shaft to the sun gear of the second gear set a third clutch means for selectively connecting the input shaft to the carrier of the second gear set including friction elements, a piston selectively engaging the friction elements and a fluid servo in which hydraulic fluid is selectively supplied to the piston; a first drive-establishing means for selectively preventing rotation of the ring gear of the first gear set and the carrier of the second gear set in only one direction and, alternatively, in any direction; a second drive-establishing means for selectively preventing rotation of the sun gear of the second gear set; and a drum being open to the first planetary gear set, with a cylindrical intermediate wall, an inner peripheral wall and outer peripheral wall and forming the hydraulic servos of the first and third clutch means between the intermediate wall and the inner peripheral wall and between the intermediate wall and the outer peripheral wall respectively.

  3. Is Hiding Foot and Mouth Disease Sensitive Behavior for Farmers? A Survey Study in Sri Lanka

    PubMed Central

    Gunarathne, Anoma; Kubota, Satoko; Kumarawadu, Pradeep; Karunagoda, Kamal; Kon, Hiroichi

    2016-01-01

    Foot and mouth disease (FMD) has a long history in Sri Lanka and was found to be endemic in various parts of the country and constitutes a constant threat to farmers. In Sri Lanka, currently there is no regular, nationwide vaccination programme devised to control FMD. Therefore, improving farmers’ knowledge regarding distinguishing FMD from other diseases and ensuring prompt reporting of any suspicion of FMD as well as restricting movement of animals are critical activities for an effective FMD response effort. Therefore, the main purpose of this study was to clarify the relationship between farmers’ knowledge levels and their behaviors to establish a strategy to control FMD. In our study, item count technique was applied to estimate the number of farmers that under-report and sell FMD-infected animals, although to do so is prohibited by law. The following findings were observed: about 63% of farmers have very poor knowledge of routes of FMD transmission; ‘under-reporting’ was found to be a sensitive behavior and nearly 23% of the farmers were reluctant to report FMD-infected animals; and ‘selling FMD-infected animals’ is a sensitive behavior among high-level knowledge group while it is a non-sensitive behavior among the low-level knowledge group. If farmers would understand the importance of prompt reporting, they may report any suspected cases of FMD to veterinary officials. However, even if farmers report honestly, they do not want to cull FMD-infected animals. Thus, education programs should be conducted not only on FMD introduction and transmission, but also its impact. Furthermore, consumers may criticize the farmers for culling their infected animals. Hence, not only farmers, but also consumers need to be educated on the economic impact of FMD and the importance of controlling an outbreak. If farmers have a high knowledge of FMD transmission, they consider selling FMD-infected animals as a sensitive behavior. Therefore, severe punishment should

  4. Survey of Transmission Cost Allocation Methodologies for Regional Transmission Organizations

    SciTech Connect

    Fink, S.; Porter, K.; Mudd, C.; Rogers, J.

    2011-02-01

    The report presents transmission cost allocation methodologies for reliability transmission projects, generation interconnection, and economic transmission projects for all Regional Transmission Organizations.

  5. Foot-and-Mouth Disease Virus-Associated Abortion and Vertical Transmission following Acute Infection in Cattle under Natural Conditions.

    PubMed

    Ranjan, Rajeev; Biswal, Jitendra K; Subramaniam, Saravanan; Singh, Karam Pal; Stenfeldt, Carolina; Rodriguez, Luis L; Pattnaik, Bramhadev; Arzt, Jonathan

    2016-01-01

    Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic and wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. The current study was an opportunistic investigation of these naturally occurring bovine abortions to assess causality of abortion and vertical transmission of FMDV from infected cows to fetuses. For this purpose, fetal tissue samples of eight abortuses (heart, liver, kidney, spleen, palatine tonsil, umbilical cord, soft palate, tongue, lungs, and submandibular lymph node) were collected and screened by various detection methods, including viral genome detection, virus isolation, and immunomicroscopy. Amongst these cases, gross pathological changes were observed in 3 abortuses. Gross pathological findings included blood-tinged peritoneal and pleural effusions and myocarditis. Hearts of infected calves had mild to moderate degeneration and necrosis of the myocardium with moderate infiltration by mixed inflammatory cells. Localization of FMDV antigen was demonstrated in lungs and soft palate by immunomicroscopy. FMDV serotype O viral genome was recovered from 7 of 8 cases. Infectious FMDV serotype O was rescued by chemical transfection of the total RNA extracted from three soft palate samples and was sequenced to confirm 100% identity of the VP1 (capsid) coding region with isolates collected from infected cattle during the acute phase of infection. Based upon these findings, it may be concluded that FMDV-associated abortion occurred among the infected pregnant cows included within this study and FMDV was subsequently transmitted vertically to fetuses. This is the first documentation of FMDV-associated abortions in cattle.

  6. Foot-and-Mouth Disease Virus-Associated Abortion and Vertical Transmission following Acute Infection in Cattle under Natural Conditions

    PubMed Central

    Ranjan, Rajeev; Biswal, Jitendra K.; Subramaniam, Saravanan; Singh, Karam Pal; Stenfeldt, Carolina; Rodriguez, Luis L.; Pattnaik, Bramhadev; Arzt, Jonathan

    2016-01-01

    Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic and wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. The current study was an opportunistic investigation of these naturally occurring bovine abortions to assess causality of abortion and vertical transmission of FMDV from infected cows to fetuses. For this purpose, fetal tissue samples of eight abortuses (heart, liver, kidney, spleen, palatine tonsil, umbilical cord, soft palate, tongue, lungs, and submandibular lymph node) were collected and screened by various detection methods, including viral genome detection, virus isolation, and immunomicroscopy. Amongst these cases, gross pathological changes were observed in 3 abortuses. Gross pathological findings included blood-tinged peritoneal and pleural effusions and myocarditis. Hearts of infected calves had mild to moderate degeneration and necrosis of the myocardium with moderate infiltration by mixed inflammatory cells. Localization of FMDV antigen was demonstrated in lungs and soft palate by immunomicroscopy. FMDV serotype O viral genome was recovered from 7 of 8 cases. Infectious FMDV serotype O was rescued by chemical transfection of the total RNA extracted from three soft palate samples and was sequenced to confirm 100% identity of the VP1 (capsid) coding region with isolates collected from infected cattle during the acute phase of infection. Based upon these findings, it may be concluded that FMDV-associated abortion occurred among the infected pregnant cows included within this study and FMDV was subsequently transmitted vertically to fetuses. This is the first documentation of FMDV-associated abortions in cattle. PMID:27977708

  7. Foot-and-Mouth Disease Virus-Associated Abortion and Vertical Transmission following Acute Infection in Cattle under Natural Conditions

    DOE PAGES

    Ranjan, Rajeev; Biswal, Jitendra K.; Subramaniam, Saravanan; ...

    2016-12-15

    Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic and wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. The current study was an opportunistic investigation of these naturally occurring bovine abortions to assess causality of abortion and vertical transmission of FMDV from infected cows to fetuses. For this purpose, fetal tissue samples of eight abortuses (heart, liver, kidney, spleen, palatine tonsil, umbilical cord, soft palate, tongue, lungs, and submandibular lymph node) were collected and screened by various detection methods, including viral genomemore » detection, virus isolation, and immunomicroscopy. Amongst these cases, gross pathological changes were observed in 3 abortuses. Gross pathological findings included blood-tinged peritoneal and pleural effusions and myocarditis. Hearts of infected calves had mild to moderate degeneration and necrosis of the myocardium with moderate infiltration by mixed inflammatory cells. Localization of FMDV antigen was demonstrated in lungs and soft palate by immunomicroscopy. FMDV serotype O viral genome was recovered from 7 of 8 cases. Infectious FMDV serotype O was rescued by chemical transfection of the total RNA extracted from three soft palate samples and was sequenced to confirm 100% identity of the VP1 (capsid) coding region with isolates collected from infected cattle during the acute phase of infection. Based upon these findings, it may be concluded that FMDV-associated abortion occurred among the infected pregnant cows included within this study and FMDV was subsequently transmitted vertically to fetuses. This is the first documentation of FMDV-associated abortions in cattle.« less

  8. Foot-and-Mouth Disease Virus-Associated Abortion and Vertical Transmission following Acute Infection in Cattle under Natural Conditions

    SciTech Connect

    Ranjan, Rajeev; Biswal, Jitendra K.; Subramaniam, Saravanan; Singh, Karam Pal; Stenfeldt, Carolina; Rodriguez, Luis L.; Pattnaik, Bramhadev; Arzt, Jonathan

    2016-12-15

    Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic and wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. The current study was an opportunistic investigation of these naturally occurring bovine abortions to assess causality of abortion and vertical transmission of FMDV from infected cows to fetuses. For this purpose, fetal tissue samples of eight abortuses (heart, liver, kidney, spleen, palatine tonsil, umbilical cord, soft palate, tongue, lungs, and submandibular lymph node) were collected and screened by various detection methods, including viral genome detection, virus isolation, and immunomicroscopy. Amongst these cases, gross pathological changes were observed in 3 abortuses. Gross pathological findings included blood-tinged peritoneal and pleural effusions and myocarditis. Hearts of infected calves had mild to moderate degeneration and necrosis of the myocardium with moderate infiltration by mixed inflammatory cells. Localization of FMDV antigen was demonstrated in lungs and soft palate by immunomicroscopy. FMDV serotype O viral genome was recovered from 7 of 8 cases. Infectious FMDV serotype O was rescued by chemical transfection of the total RNA extracted from three soft palate samples and was sequenced to confirm 100% identity of the VP1 (capsid) coding region with isolates collected from infected cattle during the acute phase of infection. Based upon these findings, it may be concluded that FMDV-associated abortion occurred among the infected pregnant cows included within this study and FMDV was subsequently transmitted vertically to fetuses. This is the first documentation of FMDV-associated abortions in cattle.

  9. Reconstructing the origin and transmission dynamics of the 1967-68 foot-and-mouth disease epidemic in the United Kingdom.

    PubMed

    Wright, Caroline F; Knowles, Nick J; Di Nardo, Antonello; Paton, David J; Haydon, Daniel T; King, Donald P

    2013-12-01

    A large epidemic of foot-and-mouth disease (FMD) occurred in the United Kingdom (UK) over a seven month period in Northwest England from late 1967 to the summer of 1968. This was preceded by a number of smaller FMD outbreaks in the country, two in 1967, in Hampshire and Warwickshire and one in Northumberland during 1966. The causative agent of all four events was identified as FMD virus (FMDV) serotype O and the source of the large epidemic was attributed to infected bone marrow in lamb products imported from Argentina. However, the diagnostic tools available at the time were unable to entirely rule out connections with the earlier UK FMD outbreaks, as well as other potential sources from Europe. The aim of this study was to apply molecular sequencing to investigate the likely source of this epidemic using VP1 region and full genome (FG) sequences determined directly from clinical epithelium samples (n=13) or cell culture isolates (n=6), from this and contemporary outbreaks in the UK, Europe and South America. Analysis of the VP1 sequences provided evidence for at least three separate incursions of FMDV into the UK including one independent introduction that was responsible for the main 1967/68 epidemic. Analysis of FG sequences from the main 1967/68 outbreak (n=10) revealed nucleotide substitutions at 94 genomic sites providing evidence for the linear accumulation of nucleotide substitutions (rate=2.42 × 10(-)(5)nt substitutions/site/day). However, there were five samples where this linear relationship was absent, indicating evolutional dormancy of the virus, presumably outside a host. These results help define the evolutionary dynamics of FMDV during an epidemic and contribute to the knowledge and understanding from which to base future outbreak control strategies.

  10. Foot-and-mouth disease virus-associated abortion and vertical transmission following acute infection in cattle under natural conditions

    USDA-ARS?s Scientific Manuscript database

    Foot-and-mouth disease (FMD) is a highly contagious and economically important viral disease of cloven-hoofed animals, including domestic as well as more than 70 wild host species. During recent FMD outbreaks in India, spontaneous abortions were reported amongst FMD-affected and asymptomatic cows. T...

  11. Applied Stratigraphy

    NASA Astrophysics Data System (ADS)

    Lucas, Spencer G.

    Stratigraphy is a cornerstone of the Earth sciences. The study of layered rocks, especially their age determination and correlation, which are integral parts of stratigraphy, are key to fields as diverse as geoarchaeology and tectonics. In the Anglophile history of geology, in the early 1800s, the untutored English surveyor William Smith was the first practical stratigrapher, constructing a geological map of England based on his own applied stratigraphy. Smith has, thus, been seen as the first “industrial stratigrapher,” and practical applications of stratigraphy have since been essential to most of the extractive industries from mining to petroleum. Indeed, gasoline is in your automobile because of a tremendous use of applied stratigraphy in oil exploration, especially during the latter half of the twentieth century. Applied stratigraphy, thus, is a subject of broad interest to Earth scientists.

  12. Applied oceanography

    SciTech Connect

    Bishop, J.M.

    1984-01-01

    This book combines oceanography principles and applications such as marine pollution, resources, and transportation. It is divided into two main parts treating the basic principles of physical oceanography, and presenting a unique systems framework showing how physical oceanography, marine ecology, economics, and government policy may be combined to define the newly developing field of applied oceanography.

  13. Applied Enzymology.

    ERIC Educational Resources Information Center

    Manoharan, Asha; Dreisbach, Joseph H.

    1988-01-01

    Describes some examples of chemical and industrial applications of enzymes. Includes a background, a discussion of structure and reactivity, enzymes as therapeutic agents, enzyme replacement, enzymes used in diagnosis, industrial applications of enzymes, and immobilizing enzymes. Concludes that applied enzymology is an important factor in…

  14. Applied Enzymology.

    ERIC Educational Resources Information Center

    Manoharan, Asha; Dreisbach, Joseph H.

    1988-01-01

    Describes some examples of chemical and industrial applications of enzymes. Includes a background, a discussion of structure and reactivity, enzymes as therapeutic agents, enzyme replacement, enzymes used in diagnosis, industrial applications of enzymes, and immobilizing enzymes. Concludes that applied enzymology is an important factor in…

  15. Nonlinear transmission sputtering

    NASA Astrophysics Data System (ADS)

    Bitensky, I. S.; Sigmund, P.

    1996-05-01

    General expressions have been derived for the nonlinear yield of transmission sputtering for an incident polyatomic ion under the assumption that the molecule breaks up on entering the target and that sputter yields are enhanced due to proximity of atomic trajectories. Special attention is given to the case of negligible Coulomb explosion where projectile atoms penetrate independently. For weakly overlapping trajectories, the yield enhancement factor of a polyatomic molecule can be expressed by that of a diatom, amended with a correction for triple correlations if necessary. This expression is in good agreement with recent experimental findings on phenylalanine targets. Pertinent results on multiple scattering of atomic ions are reviewed and applied to independently-moving fragment atoms. The merits of measurements at variable layer thickness in addition to variable projectile energy are mentioned.

  16. Interferon-γ induced by in vitro re-stimulation of CD4+ T-cells correlates with in vivo FMD vaccine induced protection of cattle against disease and persistent infection.

    PubMed

    Oh, Yooni; Fleming, Lucy; Statham, Bob; Hamblin, Pip; Barnett, Paul; Paton, David J; Park, Jong-Hyeon; Joo, Yi Seok; Parida, Satya

    2012-01-01

    The immune defense against FMDV has been correlated to the antibody mediated component. However, there are occasions when some animals with high virus neutralising (VN) antibody are not protected following challenge and some with low neutralising antibody which do not succumb to disease. The importance of cell mediated immunity in clinical protection is less clear and so we investigated the source and production of interferon-gamma (IFN-γ) in re-stimulated whole blood of FMDV immunized cattle and its correlation to vaccine induced protection and FMDV persistence. We were able to show a positive correlation between IFN-γ response and vaccine induced protection as well as reduction of long term persistence of FMD virus. When combining this IFN-γ response in re-stimulated blood with virus neutralizing antibody titer in serum on the day of challenge, a better correlation of vaccine-induced protection with IFN-γ and VN antibody was predicted. Our investigations also showed that CD4+ T-cells are the major proliferating phenotype and IFN-γ producing cells.

  17. Essays on electricity transmission investment and financial transmission rights

    NASA Astrophysics Data System (ADS)

    Shang, Wenzhuo

    The U.S. electric power industry has been going through fundamental restructuring and realignment since the 1990's. Many issues and problems have emerged during the transition, and both economists and engineers have been looking for the solutions fervently. In this dissertation, which consists primarily of three essays, we apply economics theory and techniques to the power industry and address two related issues, transmission investment and financial transmission rights (FTRs). The first essay takes the decentralized perspective and investigates the efficiency attribute of market-based transmission investment under perfect competition. We clarify, for the first time, the nature of the externality created by loop flows that causes transmission investment to be inefficient. Our findings have important implications for better understanding of transmission market design and creating incentives for efficient transmission investment. In the second essay, we define several rules for allocating transmission investment cost within the framework of cooperative game theory. These rules provide fair, stable or efficient cost allocations in theory and are good benchmarks against which the allocation mechanism in practice can be compared and improved upon. In the last essay, we make exploratory efforts in analyzing and assessing empirically the performance of the Midwest independent system operator (MISO) FTR auction market. We reveal some stylized facts about this young market and find that it is not efficient under the risk-neutrality assumption. We also point out and correct the drawbacks in previous related work and suggest about more complete empirical work in future. In all, this dissertation makes both theoretic and empirical analysis of the two hot issues related to the power industry and comes up with findings that have important implications for the development of this industry.

  18. Direct contact transmission of three different foot-and-mouth disease virus strains in swine demonstrates important strain-specific differences.

    PubMed

    Pacheco, Juan M; Tucker, Meghan; Hartwig, Ethan; Bishop, Elizabeth; Arzt, Jonathan; Rodriguez, Luis L

    2012-08-01

    A novel direct contact transmission model for the study of foot-and-mouth disease virus (FMDV) infection of swine was utilized to investigate transmission characteristics of three FMDV strains belonging to serotypes A, O and Asia1. Each strain demonstrated distinct transmission characteristics and required different exposure times to achieve successful contact transmission. While a 4h exposure was sufficient for strain A24 Cruzeiro (A24Cru), both O1 Manisa and Asia1 Shamir transmission required 18 h or more. Viral excretion levels from donors (for all three strains) and virus present in room air (for A24Cru and O1 Manisa) were evaluated and associated with clinical signs and observed transmission pattern. Although all directly inoculated donor animals showed acute FMD, A24Cru had the highest levels of viral shedding in saliva and nasal swabs followed by O1 Manisa and Asia1 Shamir. Virus levels in room air were higher and were detected longer for A24Cru than for O1 Manisa. These results provide direct evidence for important strain-specific variation in transmission characteristics and emphasize the need for thorough evaluation of different FMDV viral strains using a well defined contact transmission methodology. This information is critical for vaccine and biotherapeutic efficacy testing, pathogenesis and disease modeling of FMDV transmission. Published by Elsevier Ltd.

  19. Applied Nanotoxicology.

    PubMed

    Hobson, David W; Roberts, Stephen M; Shvedova, Anna A; Warheit, David B; Hinkley, Georgia K; Guy, Robin C

    2016-01-01

    Nanomaterials, including nanoparticles and nanoobjects, are being incorporated into everyday products at an increasing rate. These products include consumer products of interest to toxicologists such as pharmaceuticals, cosmetics, food, food packaging, household products, and so on. The manufacturing of products containing or utilizing nanomaterials in their composition may also present potential toxicologic concerns in the workplace. The molecular complexity and composition of these nanomaterials are ever increasing, and the means and methods being applied to characterize and perform useful toxicologic assessments are rapidly advancing. This article includes presentations by experienced toxicologists in the nanotoxicology community who are focused on the applied aspect of the discipline toward supporting state of the art toxicologic assessments for food products and packaging, pharmaceuticals and medical devices, inhaled nanoparticle and gastrointestinal exposures, and addressing occupational safety and health issues and concerns. This symposium overview article summarizes 5 talks that were presented at the 35th Annual meeting of the American College of Toxicology on the subject of "Applied Nanotechnology." © The Author(s) 2016.

  20. Applied Nanotoxicology

    PubMed Central

    Hobson, David W.; Roberts, Stephen M.; Shvedova, Anna A.; Warheit, David B.; Hinkley, Georgia K.; Guy, Robin C.

    2016-01-01

    Nanomaterials, including nanoparticles and nanoobjects, are being incorporated into everyday products at an increasing rate. These products include consumer products of interest to toxicologists such as pharmaceuticals, cosmetics, food, food packaging, household products, and so on. The manufacturing of products containing or utilizing nanomaterials in their composition may also present potential toxicologic concerns in the workplace. The molecular complexity and composition of these nanomaterials are ever increasing, and the means and methods being applied to characterize and perform useful toxicologic assessments are rapidly advancing. This article includes presentations by experienced toxicologists in the nanotoxicology community who are focused on the applied aspect of the discipline toward supporting state of the art toxicologic assessments for food products and packaging, pharmaceuticals and medical devices, inhaled nanoparticle and gastrointestinal exposures, and addressing occupational safety and health issues and concerns. This symposium overview article summarizes 5 talks that were presented at the 35th Annual meeting of the American College of Toxicology on the subject of “Applied Nanotechnology.” PMID:26957538

  1. Aerosol transmission of foot-and-mouth disease virus Asia-1 under experimental conditions.

    PubMed

    Colenutt, C; Gonzales, J L; Paton, D J; Gloster, J; Nelson, N; Sanders, C

    2016-06-30

    Foot-and-mouth disease virus (FMDV) control measures rely on understanding of virus transmission mechanisms. Direct contact between naïve and infected animals or spread by contaminated fomites is prevented by quarantines and rigorous decontamination procedures during outbreaks. Transmission of FMDV by aerosol may not be prevented by these control measures and this route of transmission may allow infection of animals at distance from the infection source. Understanding the potential for aerosol spread of specific FMDV strains is important for informing control strategies in an outbreak. Here, the potential for transmission of an FMDV Asia 1 strain between pigs and cattle by indirect aerosol exposure was evaluated in an experimental setting. Four naïve calves were exposed to aerosols emitted from three infected pigs in an adjacent room for a 10h period. Direct contact between pigs and cattle and fomite transfer between rooms was prevented. Viral titres in aerosols emitted by the infected pigs were measured to estimate the dose that calves were exposed to. One of the calves developed clinical signs of FMD, whilst there was serological evidence for spread to cattle by aerosol transmission in the remaining three calves. This highlights the possibility that this FMDV Asia 1 strain could be spread by aerosol transmission given appropriate environmental conditions should an outbreak occur in pigs. Our estimates suggest the exposure dose required for aerosol transmission was higher than has been previously quantified for other serotypes, implying that aerosols are less likely to play a significant role in transmission and spread of this FMDV strain.

  2. Heterogeneity in schistosomiasis transmission dynamics.

    PubMed

    Mari, Lorenzo; Ciddio, Manuela; Casagrandi, Renato; Perez-Saez, Javier; Bertuzzo, Enrico; Rinaldo, Andrea; Sokolow, Susanne H; De Leo, Giulio A; Gatto, Marino

    2017-11-07

    Simple models of disease propagation often disregard the effects of transmission heterogeneity on the ecological and epidemiological dynamics associated with host-parasite interactions. However, for some diseases like schistosomiasis, a widespread parasitic infection caused by Schistosoma worms, accounting for heterogeneity is crucial to both characterize long-term dynamics and evaluate opportunities for disease control. Elaborating on the classic Macdonald model for macroparasite transmission, we analyze families of models including explicit descriptions of heterogeneity related to differential transmission risk within a community, water contact patterns, the distribution of the snail host population, human mobility, and the seasonal fluctuations of the environment. Through simple numerical examples, we show that heterogeneous multigroup communities may be more prone to schistosomiasis than homogeneous ones, that the availability of multiple water sources can hinder parasite transmission, and that both spatial and temporal heterogeneities may have nontrivial implications for disease endemicity. Finally, we discuss the implications of heterogeneity for disease control. Although focused on schistosomiasis, results from this study may apply as well to other parasitic infections with complex transmission cycles, such as cysticercosis, dracunculiasis and fasciolosis. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Applied Geophysics

    NASA Astrophysics Data System (ADS)

    Telford, W. M.; Geldart, L. P.; Sheriff, R. E.

    1990-10-01

    Completely revised and updated, this new edition of the popular and highly regarded textbook, Applied Geophysics, describes the physical methods involved in exploration for hydrocarbons and minerals. These tools include gravity, magnetic, seismic, electrical, electromagnetic, and radioactivity studies. All aspects of these methods are described, including theoretical considerations, data acquisition, and data processing and interpretation, with the objective of locating concentrations of natural resources and defining their extent. In the past fourteen years or so since the writing of Applied Geophysics, there have been many changes in the field of exploration geophysics. The authors give full treatment to changes in this field, which include improved techniques for calculating gravity fields, the use of proton-precession and optically-pumped magnetometers, improved quality of seismic data, magnetotelluric as a practical exploration method, new electromagnetic exploration methods, the use of gamma-ray spectrometers in radioactive exploration, and improved well-logging techniques. The intent is to be practical, and thus many actual examples and problems are given. Moreover, wherever possible in this edition the authors adopt the use of Système Internationale (SI) units, which were not in standared use at the time of the first edition. The reader needs only a general background knowledge of geology, physics, and mathematics. Most of the math can be skipped by those interested only in the results. Advanced mathematical concepts are explained in the appendix.

  4. Zika and Sexual Transmission

    MedlinePlus

    ... Address What's this? Submit What's this? Submit Button Zika and Sexual Transmission Language: English Español Português ... 1 page] Portuguese [PDF - 1 page] Basics of Zika Virus and Sex Transmission Zika can be passed ...

  5. Automatic transmission adapter kit

    SciTech Connect

    Stich, R.L.; Neal, W.D.

    1987-02-10

    This patent describes, in a four-wheel-drive vehicle apparatus having a power train including an automatic transmission and a transfer case, an automatic transmission adapter kit for installation of a replacement automatic transmission of shorter length than an original automatic transmission in the four-wheel-drive vehicle. The adapter kit comprises: an extension housing interposed between the replacement automatic transmission and the transfer case; an output shaft, having a first end which engages the replacement automatic transmission and a second end which engages the transfer case; first sealing means for sealing between the extension housing and the replacement automatic transmission; second sealing means for sealing between the extension housing and the transfer case; and fastening means for connecting the extension housing between the replacement automatic transmission and the transfer case.

  6. Applied geodesy

    SciTech Connect

    Turner, S.

    1987-01-01

    This volume is based on the proceedings of the CERN Accelerator School's course on Applied Geodesy for Particle Accelerators held in April 1986. The purpose was to record and disseminate the knowledge gained in recent years on the geodesy of accelerators and other large systems. The latest methods for positioning equipment to sub-millimetric accuracy in deep underground tunnels several tens of kilometers long are described, as well as such sophisticated techniques as the Navstar Global Positioning System and the Terrameter. Automation of better known instruments such as the gyroscope and Distinvar is also treated along with the highly evolved treatment of components in a modern accelerator. Use of the methods described can be of great benefit in many areas of research and industrial geodesy such as surveying, nautical and aeronautical engineering, astronomical radio-interferometry, metrology of large components, deformation studies, etc.

  7. Value Transmissions between Parents and Children: Gender and Developmental Phase as Transmission Belts

    ERIC Educational Resources Information Center

    Roest, Annette M. C.; Dubas, Judith Semon; Gerris, Jan R. M.

    2010-01-01

    This study applied the gender role model of socialization theory, the developmental aging theory, and the topic salience perspective to the investigation of parent-child value transmissions. Specifically, we examined whether the bi-directionality and selectivity of value transmissions differed as a function of parents' and children's gender and…

  8. Laptop image transmission equipment

    NASA Astrophysics Data System (ADS)

    Mocenter, Michael M.

    1991-12-01

    Imagery and other visual information have become a critical element in planning and performing modern military operations. The effectiveness of this imagery information is often directly tied to the time it takes to get from the collector of this imagery to the user of the imagery. Hard copy distribution of annotated imagery to the tactical commander is hampered by the lack of effective communications paths, and the tactical use of hand held imagery is restricted by the lack of film processing facilities. The military has begun to rely on electronic imagery and digital communications technology for answers, with some success. The new obstacles created by applied electronic imagery are interoperability standards and effective use of communications bandwidth in a tactical environment. New technological developments in computer hardware/software have changed this situation by allowing for the gathering, dissemination, and transfer of near-real-time information to various intelligence audiences at any location. The Naval Air Development Center (NAVAIRDEVCEN) has coupled commercial-off-the-shelf (COTS) technology with National Image Transmission Formats (NITF) Standards to develop a Secondary Imagery Dissemination System (SIDS) package that is designed to meet the flexibility challenge of the tactical military environment. This tailorable SIDS package is called Laptop Image Transmission Equipment (LITE). The LITE system is an extension of the Navy's existing Fleet Imagery Support Terminal (FIST) into the man-portable tactical environment. As such, LITE development is focused on developing flexible imagery input (from sources such as filmless cameras) and connectivity to tactical communications paths and ruggedization/miniaturization issues. The LITE system, in prototype form, has already found application through operational use in special operations, counter narcotics operations, and classic air/ground/sea military operations. This paper provides an overview of the

  9. Hybrid powertrain system including smooth shifting automated transmission

    DOEpatents

    Beaty, Kevin D.; Nellums, Richard A.

    2006-10-24

    A powertrain system is provided that includes a prime mover and a change-gear transmission having an input, at least two gear ratios, and an output. The powertrain system also includes a power shunt configured to route power applied to the transmission by one of the input and the output to the other one of the input and the output. A transmission system and a method for facilitating shifting of a transmission system are also provided.

  10. Automated manual transmission controller

    DOEpatents

    Lawrie, Robert E.; Reed, Jr., Richard G.; Bernier, David R.

    1999-12-28

    A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.

  11. Bordetella pertussis transmission.

    PubMed

    Trainor, Elizabeth A; Nicholson, Tracy L; Merkel, Tod J

    2015-11-01

    Bordetella pertussis and B. bronchiseptica are Gram-negative bacterial respiratory pathogens. Bordetella pertussis is the causative agent of whooping cough and is considered a human-adapted variant of B. bronchiseptica. Bordetella pertussis and B. bronchiseptica share mechanisms of pathogenesis and are genetically closely related. However, despite the close genetic relatedness, these Bordetella species differ in several classic fundamental aspects of bacterial pathogens such as host range, pathologies and persistence. The development of the baboon model for the study of B. pertussis transmission, along with the development of the swine and mouse model for the study of B. bronchiseptica, has enabled the investigation of different aspects of transmission including the route, attack rate, role of bacterial and host factors, and the impact of vaccination on transmission. This review will focus on B. pertussis transmission and how animal models of B. pertussis transmission and transmission models using the closely related B. bronchiseptica have increased our understanding of B. pertussis transmission.

  12. Robust hyperchaotic synchronization via analog transmission line

    NASA Astrophysics Data System (ADS)

    Sadoudi, S.; Tanougast, C.

    2016-02-01

    In this paper, a novel experimental chaotic synchronization technique via analog transmission is discussed. We demonstrate through Field-Programmable Gate Array (FPGA) implementation design the robust synchronization of two embedded hyperchaotic Lorenz generators interconnected with an analog transmission line. The basic idea of this work consists in combining a numerical generation of chaos and transmitting it with an analog signal. The numerical chaos allows to overcome the callback parameter mismatch problem and the analog transmission offers robust data security. As application, this technique can be applied to all families of chaotic systems including time-delayed chaotic systems.

  13. Evaluation of infectivity, virulence and transmission of FDMV field strains of serotypes O and A isolated in 2010 from outbreaks in the Republic of Korea

    USDA-ARS?s Scientific Manuscript database

    Since the early 2000s outbreaks of foot-and-mouth disease (FMD) have been described in several previously FMD-free Asian nations, including the Republic of Korea (ROK). One outbreak with FMD virus (FDMV) serotype A and two with serotype O occurred in ROK in 2010/2011. The causative viruses belong t...

  14. Estimation of the transmission of foot-and-mouth disease virus from infected sheep to cattle.

    PubMed

    Bravo de Rueda, Carla; de Jong, Mart C M; Eblé, Phaedra L; Dekker, Aldo

    2014-05-27

    The quantitative role of sheep in the transmission of foot-and-mouth disease virus (FMDV) is not well known. To estimate the role of sheep in the transmission of FMDV, a direct contact transmission experiment with 10 groups of animals each consisting of 2 infected lambs and 1 contact calf was performed. Secretions and excretions (oral swabs, blood, urine, faeces and probang samples) from all animals were tested for the presence of FMDV by virus isolation (VI) and/or RT-PCR. Serum was tested for the presence of antibodies against FMDV. To estimate FMDV transmission, the VI, RT-PCR and serology results were used. The partial reproduction ratio R0p i.e. the average number of new infections caused by one infected sheep introduced into a population of susceptible cattle, was estimated using either data of the whole infection chain of the experimental epidemics (the transient state method) or the final sizes of the experimental epidemics (the final size method). Using the transient state method, R0p was estimated as 1.0 (95% CI 0.2 - 6.0) using virus isolation results and 1.4 (95% CI 0.3 - 8.0) using RT-PCR results. Using the final size method, R0p was estimated as 0.9 (95% CI 0.2 - 3.0). Finally, R0p was compared to the R0's obtained in previous transmission studies with sheep or cattle only. This comparison showed that the infectivity of sheep is lower than that of cattle and that sheep and cattle are similarly susceptible to FMD. These results indicate that in a mixed population of sheep and cattle, sheep play a more limited role in the transmission of FMDV than cattle.

  15. Estimation of the transmission of foot-and-mouth disease virus from infected sheep to cattle

    PubMed Central

    2014-01-01

    The quantitative role of sheep in the transmission of foot-and-mouth disease virus (FMDV) is not well known. To estimate the role of sheep in the transmission of FMDV, a direct contact transmission experiment with 10 groups of animals each consisting of 2 infected lambs and 1 contact calf was performed. Secretions and excretions (oral swabs, blood, urine, faeces and probang samples) from all animals were tested for the presence of FMDV by virus isolation (VI) and/or RT-PCR. Serum was tested for the presence of antibodies against FMDV. To estimate FMDV transmission, the VI, RT-PCR and serology results were used. The partial reproduction ratio R0p i.e. the average number of new infections caused by one infected sheep introduced into a population of susceptible cattle, was estimated using either data of the whole infection chain of the experimental epidemics (the transient state method) or the final sizes of the experimental epidemics (the final size method). Using the transient state method, R0p was estimated as 1.0 (95% CI 0.2 - 6.0) using virus isolation results and 1.4 (95% CI 0.3 - 8.0) using RT-PCR results. Using the final size method, R0p was estimated as 0.9 (95% CI 0.2 - 3.0). Finally, R0p was compared to the R0’s obtained in previous transmission studies with sheep or cattle only. This comparison showed that the infectivity of sheep is lower than that of cattle and that sheep and cattle are similarly susceptible to FMD. These results indicate that in a mixed population of sheep and cattle, sheep play a more limited role in the transmission of FMDV than cattle. PMID:24886222

  16. Transmission Planning Analysis Tool

    SciTech Connect

    2015-06-23

    Developed to solve specific problem: Assist transmission planning for regional transfers in interconnected power systems. This work was originated in a study for the U.S. Department of State, to recommend transmission reinforcements for the Central American regional system that interconnects 6 countries. Transmission planning analysis is currently performed by engineers with domainspecific and systemspecific knowledge without a unique methodology. The software codes of this disclosure assists engineers by defining systematic analysis procedures to help identify weak points and make decisions on transmission planning of regional interconnected power systems. Transmission Planning Analysis Tool groups PSS/E results of multiple AC contingency analysis and voltage stability analysis and QV analysis of many scenarios of study and arrange them in a systematic way to aid power system planning engineers or transmission operators in effective decision]making process or in the off]line study environment.

  17. Series Transmission Line Transformer

    DOEpatents

    Buckles, Robert A.; Booth, Rex; Yen, Boris T.

    2004-06-29

    A series transmission line transformer is set forth which includes two or more of impedance matched sets of at least two transmissions lines such as shielded cables, connected in parallel at one end ans series at the other in a cascading fashion. The cables are wound about a magnetic core. The series transmission line transformer (STLT) which can provide for higher impedance ratios and bandwidths, which is scalable, and which is of simpler design and construction.

  18. Understanding Ebola Virus Transmission

    PubMed Central

    Judson, Seth; Prescott, Joseph; Munster, Vincent

    2015-01-01

    An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus. PMID:25654239

  19. Understanding ebola virus transmission.

    PubMed

    Judson, Seth; Prescott, Joseph; Munster, Vincent

    2015-02-03

    An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus.

  20. Quantifying Transmission Investment in Malaria Parasites

    PubMed Central

    Greischar, Megan A.; Mideo, Nicole; Read, Andrew F.; Bjørnstad, Ottar N.

    2016-01-01

    Many microparasites infect new hosts with specialized life stages, requiring a subset of the parasite population to forgo proliferation and develop into transmission forms. Transmission stage production influences infectivity, host exploitation, and the impact of medical interventions like drug treatment. Predicting how parasites will respond to public health efforts on both epidemiological and evolutionary timescales requires understanding transmission strategies. These strategies can rarely be observed directly and must typically be inferred from infection dynamics. Using malaria as a case study, we test previously described methods for inferring transmission stage investment against simulated data generated with a model of within-host infection dynamics, where the true transmission investment is known. We show that existing methods are inadequate and potentially very misleading. The key difficulty lies in separating transmission stages produced by different generations of parasites. We develop a new approach that performs much better on simulated data. Applying this approach to real data from mice infected with a single Plasmodium chabaudi strain, we estimate that transmission investment varies from zero to 20%, with evidence for variable investment over time in some hosts, but not others. These patterns suggest that, even in experimental infections where host genetics and other environmental factors are controlled, parasites may exhibit remarkably different patterns of transmission investment. PMID:26890485

  1. Quantifying Transmission Investment in Malaria Parasites.

    PubMed

    Greischar, Megan A; Mideo, Nicole; Read, Andrew F; Bjørnstad, Ottar N

    2016-02-01

    Many microparasites infect new hosts with specialized life stages, requiring a subset of the parasite population to forgo proliferation and develop into transmission forms. Transmission stage production influences infectivity, host exploitation, and the impact of medical interventions like drug treatment. Predicting how parasites will respond to public health efforts on both epidemiological and evolutionary timescales requires understanding transmission strategies. These strategies can rarely be observed directly and must typically be inferred from infection dynamics. Using malaria as a case study, we test previously described methods for inferring transmission stage investment against simulated data generated with a model of within-host infection dynamics, where the true transmission investment is known. We show that existing methods are inadequate and potentially very misleading. The key difficulty lies in separating transmission stages produced by different generations of parasites. We develop a new approach that performs much better on simulated data. Applying this approach to real data from mice infected with a single Plasmodium chabaudi strain, we estimate that transmission investment varies from zero to 20%, with evidence for variable investment over time in some hosts, but not others. These patterns suggest that, even in experimental infections where host genetics and other environmental factors are controlled, parasites may exhibit remarkably different patterns of transmission investment.

  2. Transmission Line Security Monitor

    ScienceCinema

    None

    2016-07-12

    The Transmission Line Security Monitor is a multi-sensor monitor that mounts directly on high-voltage transmission lines to detect, characterize and communicate terrorist activity, human tampering and threatening conditions around support towers. For more information about INL's critical infrastructure protection research, visit http://www.facebook.com/idahonationallaboratory.

  3. Transmission Line Security Monitor

    SciTech Connect

    2011-01-01

    The Transmission Line Security Monitor is a multi-sensor monitor that mounts directly on high-voltage transmission lines to detect, characterize and communicate terrorist activity, human tampering and threatening conditions around support towers. For more information about INL's critical infrastructure protection research, visit http://www.facebook.com/idahonationallaboratory.

  4. Data Transmission Concepts.

    ERIC Educational Resources Information Center

    Christenson, Chris

    1995-01-01

    Introduces some basic concepts related to the transmission of data from a computer to its peripherals to help distance educators make decisions regarding computer equipment purchases for their institutions. The following data transmission concepts are described: cables, serial and parallel, synchronous and asynchronous, bandwidth, and analog and…

  5. Passenger car transmissions

    SciTech Connect

    Not Available

    1990-01-01

    This book is organized under the following headings. The Mercedes-Benz 5-speed automatic transmission targets and comparison of concepts. 1991 model year Chrysler mini-van all wheel drive vehicle. Mesh stiffness and transmission error of spur and helical gears. High precision cutting tool system for the manufacture of world class powertrain components.

  6. Automatic transmission control method

    SciTech Connect

    Hasegawa, H.; Ishiguro, T.

    1989-07-04

    This patent describes a method of controlling an automatic transmission of an automotive vehicle. The transmission has a gear train which includes a brake for establishing a first lowest speed of the transmission, the brake acting directly on a ring gear which meshes with a pinion, the pinion meshing with a sun gear in a planetary gear train, the ring gear connected with an output member, the sun gear being engageable and disengageable with an input member of the transmission by means of a clutch. The method comprises the steps of: detecting that a shift position of the automatic transmission has been shifted to a neutral range; thereafter introducing hydraulic pressure to the brake if present vehicle velocity is below a predetermined value, whereby the brake is engaged to establish the first lowest speed; and exhausting hydraulic pressure from the brake if present vehicle velocity is higher than a predetermined value, whereby the brake is disengaged.

  7. Tractor Transmissions. A Teaching Reference.

    ERIC Educational Resources Information Center

    American Association for Agricultural Engineering and Vocational Agriculture, Athens, GA.

    The manual was developed as a reference for teaching students about transmissions in farm tractors. The manual is divided into five sections: (1) transmission history, (2) gears and bearings in transmission, (3) sliding-gear transmissions, (4) planetary gearing, and (5) glossary. The working principles of the sliding-gear transmission, the most…

  8. Hybrid geared traction transmissions

    NASA Technical Reports Server (NTRS)

    Nasvytis, A. L.; White, G.

    1983-01-01

    The basic configuration of geared traction drives, geometric and structural factors to be considered in their construction, and current work on hybrid helicopter transmissions rated at 500 and 3000 hp are discussed.

  9. Down hole transmission system

    DOEpatents

    Hall, David R.; Hall, Jr., H. Tracy

    2007-07-24

    A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. The electrically conducting coil comprises at least two generally fractional loops. In the preferred embodiment, the transmission elements are connected by an electrical conductor. Preferably, the electrical conductor is a coaxial cable. Preferably, the MCEI trough comprises ferrite. In the preferred embodiment, the fractional loops are connected by a connecting cable. In one aspect of the present invention, the connecting cable is a pair of twisted wires. In one embodiment the connecting cable is a shielded pair of twisted wires. In another aspect of the present invention, the connecting cable is a coaxial cable. The connecting cable may be disposed outside of the MCEI circular trough.

  10. Downhole transmission system

    DOEpatents

    Hall, David R [Provo, UT; Fox, Joe [Spanish Fork, UT

    2008-01-15

    A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. An electrical conductor connects both the transmission elements. The electrical conductor comprises at least three electrically conductive elements insulated from each other. In the preferred embodiment the electrical conductor comprises an electrically conducting outer shield, an electrically conducting inner shield and an electrical conducting core. In some embodiments of the present invention, the electrical conductor comprises an electrically insulating jacket. In other embodiments, the electrical conductor comprises a pair of twisted wires. In some embodiments, the electrical conductor comprises semi-conductive material.

  11. Pregnancy & perinatal transmission update.

    PubMed

    Denison, R

    1998-09-01

    According to a June 1998 report from UNAIDS, the majority of children infected with HIV acquired it from their mothers during or near birth. One way to prevent perinatal transmission of HIV is to increase prevention efforts for women. Other ways to prevent perinatal transmission include using AZT treatment, avoiding breastfeeding, and choosing a C-section delivery instead of a vaginal delivery. One important study, called the Thai study, promoted a shorter course of AZT therapy that was less expensive, more accessible, and still prevented transmission in many cases. Several reasons are cited for why some women continue breastfeeding, despite the increased risk of transmitting HIV to their babies. An important factor in preventing perinatal transmission is the overall health of the mother, and her ability to maintain her health and treatment regimen while caring for a newborn.

  12. Multiplex television transmission system

    NASA Technical Reports Server (NTRS)

    Reed, W. R.

    1967-01-01

    Time-multiplexing system enables several cameras to share a single commercial television transmission channel. This system is useful in industries for visually monitoring several operating areas or instrument panels from a remote location.

  13. 47 CFR 80.89 - Unauthorized transmissions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE... transmissions. Stations must not: (a) Engage in superfluous radio-communication. (b) Use telephony on 243 MHz... communications not addressed to a particular station or stations. This provision does not apply to...

  14. Datacast: The transmission system

    NASA Astrophysics Data System (ADS)

    Chambers, J. P.

    1988-03-01

    The BBC Datacast service allows one-way transmission of general data services for public service data broadcasting or for commercial purposes using the existing teletext system as the carrier. Such uses were anticipated when the 1976 UK teletext specification was written, so Datacast can co-exist with the normal teletext service (Ceefax) without problems. This Report provides a detailed specification of the Datacast transmission standard.

  15. 77 FR 6554 - Zephyr Power Transmission, LLC; Pathfinder Power Transmission, LLC; Duke-American Transmission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-08

    ... Energy Regulatory Commission Zephyr Power Transmission, LLC; Pathfinder Power Transmission, LLC; Duke-American Transmission Company, LLC; Notice of Petition for Declaratory Order Take notice that on January 30... (Commission), 18 CFR 381.302, Zephyr Power Transmission, LLC (Zephyr), Pathfinder Power Transmission, LLC...

  16. Multistate differential transmission

    SciTech Connect

    Whalen, B.

    1987-09-01

    A multistate transmission is described having an input shaft and an output shaft comprising: a. planetary gear train means having a ring gear, planetary gears with planetary gear carrier, and a sun gear, the planetary gear train means connected to the output shaft; b. first bypass means connecting the input shaft to the planetary gear train means; c. differential transmission means for receiving its input from the input shaft and having means to adjust the torque and speed output infinitely variable over its range of operation for each state of the transmission; d. power return means for receiving the output of the differential transmission means; e. means including clutch operated speed reversing means for interconnecting the sun gear in the planetary gear train means with the power return means; f. the power return means including a first gear to receive the output of the differential transmission means; g. first multispeed transmission means connecting the means for supporting the carrier shaft to the first bypass means.

  17. National transmission grid study

    SciTech Connect

    Abraham, Spencer

    2003-05-31

    The National Energy Policy Plan directed the U.S. Department of Energy (DOE) to conduct a study to examine the benefits of establishing a national electricity transmission grid and to identify transmission bottlenecks and measures to address them. DOE began by conducting an independent analysis of U.S. electricity markets and identifying transmission system bottlenecks using DOE’s Policy Office Electricity Modeling System (POEMS). DOE’s analysis, presented in Section 2, confirms the central role of the nation’s transmission system in lowering costs to consumers through increased trade. More importantly, DOE’s analysis also confirms the results of previous studies, which show that transmission bottlenecks and related transmission system market practices are adding hundreds of millions of dollars to consumers’ electricity bills each year. A more detailed technical overview of the use of POEMS is provided in Appendix A. DOE led an extensive, open, public input process and heard a wide range of comments and recommendations that have all been considered.1 More than 150 participants registered for three public workshops held in Detroit, MI (September 24, 2001); Atlanta, GA (September 26, 2001); and Phoenix, AZ (September 28, 2001).

  18. Review of the transmissions of the Soviet helicopters

    NASA Technical Reports Server (NTRS)

    Chaiko, Lev I.

    1990-01-01

    A review of the following aspects of Soviet helicopter transmissions is presented: transmitted power, weight, reduction ratio, RPM, design configuration, comparison of different type of manufacturing methods, and a description of the materials and technologies applied to critical transmission components. Included are mechanical diagrams of the gearboxes of the Soviet helicopters and test stands for testing gearbox and main shaft. The quality of Soviet helicopter transmissions and their Western counterparts are assessed and compared.

  19. Economic analysis of transmission line engineering based on industrial engineering

    NASA Astrophysics Data System (ADS)

    Li, Yixuan

    2017-05-01

    The modern industrial engineering is applied to the technical analysis and cost analysis of power transmission and transformation engineering. It can effectively reduce the cost of investment. First, the power transmission project is economically analyzed. Based on the feasibility study of power transmission and transformation project investment, the proposal on the company system cost management is put forward through the economic analysis of the effect of the system. The cost management system is optimized. Then, through the cost analysis of power transmission and transformation project, the new situation caused by the cost of construction is found. It is of guiding significance to further improve the cost management of power transmission and transformation project. Finally, according to the present situation of current power transmission project cost management, concrete measures to reduce the cost of power transmission project are given from the two aspects of system optimization and technology optimization.

  20. 47 CFR 73.322 - FM stereophonic sound transmission standards.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false FM stereophonic sound transmission standards... SERVICES RADIO BROADCAST SERVICES FM Broadcast Stations § 73.322 FM stereophonic sound transmission... modulation levels apply: (i) When a signal exists in only one channel of a two channel (biphonic)...

  1. 47 CFR 73.322 - FM stereophonic sound transmission standards.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false FM stereophonic sound transmission standards... SERVICES RADIO BROADCAST SERVICES FM Broadcast Stations § 73.322 FM stereophonic sound transmission... modulation levels apply: (i) When a signal exists in only one channel of a two channel (biphonic)...

  2. 47 CFR 73.322 - FM stereophonic sound transmission standards.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 4 2012-10-01 2012-10-01 false FM stereophonic sound transmission standards... SERVICES RADIO BROADCAST SERVICES FM Broadcast Stations § 73.322 FM stereophonic sound transmission... modulation levels apply: (i) When a signal exists in only one channel of a two channel (biphonic)...

  3. 47 CFR 73.322 - FM stereophonic sound transmission standards.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 4 2013-10-01 2013-10-01 false FM stereophonic sound transmission standards... SERVICES RADIO BROADCAST SERVICES FM Broadcast Stations § 73.322 FM stereophonic sound transmission... modulation levels apply: (i) When a signal exists in only one channel of a two channel (biphonic)...

  4. 47 CFR 73.322 - FM stereophonic sound transmission standards.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 4 2014-10-01 2014-10-01 false FM stereophonic sound transmission standards... SERVICES RADIO BROADCAST SERVICES FM Broadcast Stations § 73.322 FM stereophonic sound transmission... modulation levels apply: (i) When a signal exists in only one channel of a two channel (biphonic)...

  5. 8 CFR 217.7 - Electronic data transmission requirement.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Electronic data transmission requirement. 217.7 Section 217.7 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies...

  6. 8 CFR 217.7 - Electronic data transmission requirement.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Electronic data transmission requirement. 217.7 Section 217.7 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies...

  7. 8 CFR 217.7 - Electronic data transmission requirement.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Electronic data transmission requirement. 217.7 Section 217.7 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies...

  8. 8 CFR 217.7 - Electronic data transmission requirement.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Electronic data transmission requirement. 217.7 Section 217.7 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies...

  9. 8 CFR 217.7 - Electronic data transmission requirement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...

  10. Torque feedback transmission

    SciTech Connect

    Whalen, B.L.

    1987-01-20

    This patent describes an infinitely variable transmission of inline configuration for interconnecting a primer mover with a load for clutch free operation in a range of speed including hydraulic neutral comprising: a. planetary gear train means having a ring gear, planetary gears supported by a planetary gear carrier, and a sun gear, the sun gear being connected mechanically to the load, output shaft means for joining the sun gear to the load; b. variable torque feedback means comprising (i) a variable displacement hydraulic motor whose rotor shaft is in line with the output shaft means and drivingly connected to the prime mover and the planetary gear carrier during the full range of operation of the transmission, and (ii) a fixed displacement hydraulic pump connected hydraulically to the motor, the rotor shaft of the pump being connected mechanically to the ring gear and being axially displaced from the output shaft means; c. means for adjusting the displacement volume within the hydraulic motor for controlling the torque feedback in the transmission to provide infinitely variable coupling between the prime mover and the load over the full range of the transmission including hydraulic neutral; d. a speed reducer between the primer mover and the motor rotor shaft and a speed multiplier between the sun gear and the load; and e. mechanical transmission assembly means between the speed multiplier and the load in line with the motor rotor shaft and the output shaft means for providing selection of drive, reverse, park, and neutral.

  11. Contrast Transmission In Rain

    NASA Astrophysics Data System (ADS)

    Winchester, L. W., Jr.; Gimmestad, G. G.; Jackovich, J. E.

    1983-09-01

    While the propagation of visible and infrared radiation in adverse weather has been studied by many investigators, the effect of rain on contrast transmission or visual range have received little attention. A theoretical and experimental program examining contrast transmission in adverse weather will be described in this paper. Measurements of contrast transmission were made using bar targets consisting of parallel flourescent light bulbs. The bulb spacing is four times the bulb diameter. Data is obtained by photographing the target from a distance of two hundred meters using a camera fitted with an eight-hundred millimeter lens under both clear and obscured conditions. The negatives are then analyzed using a microdensitometer and contrast is defined by C = (I MAX - i MAX + i MIN)-1 where I-MAX and I-MIN are the intensity maximum and minimum, respectively. In addition to contrast measurements, simultaneous measurements of atmospheric transmission, snow particle phase function, and all relevant weather parameters are made. A computer model, based on scattering theory, has been developed for predicting contrast transmission. The model computes zero, first and second order scattering contributions in a three-dimensional atmosphere using phase function computations based on Mie theory.

  12. Flux cloning in Josephson transmission lines.

    PubMed

    Gulevich, D R; Kusmartsev, F V

    2006-07-07

    We describe a novel effect related to the controlled birth of a single Josephson vortex. In this phenomenon, the vortex is created in a Josephson transmission line at a T-shaped junction. The "baby" vortex arises at the moment when a "mother" vortex propagating in the adjacent transmission line passes the T-shaped junction. In order to give birth to a new vortex, the mother vortex must have enough kinetic energy. Its motion can also be supported by an externally applied driving current. We determine the critical velocity and the critical driving current for the creation of the baby vortices and briefly discuss the potential applications of the found effect.

  13. Processor Reformats Data For Transmission In Bursts

    NASA Technical Reports Server (NTRS)

    Steele, Glen F.

    1991-01-01

    Data-processor-and-buffer electronic system receives audio signals digitized in first standard format at relatively low data rate, rearranges data for transmission in bursts in second standard format at relatively high rate, stores second-format bursts, and releases them at higher rate upon request. Conceived for asynchronous, one-way transmission of digitized speech in outer-space communications, concept of system applied in other digital communication systems in which data transmitted from low-rate sources to high-rate sinks not synchronized with sources.

  14. Transmission of polarized light in skeletal muscle

    NASA Astrophysics Data System (ADS)

    Shuaib, Ali; Li, Xin; Yao, Gang

    2011-02-01

    Experiments were conducted to study polarized light transmission in fresh bovine skeletal muscle of varying thicknesses. Two-dimensional polarization-sensitive transmission images were acquired and analyzed using a numerical parametric fitting algorithm. The total transmittance intensity and degree-of-polarization were calculated for both central ballistic and surrounding scattering regions. Full Mueller matrix images were derived from the raw polarization images and the polar decomposition algorithm was applied to extract polarization parameters. The results suggest that polarized light propagation through skeletal muscle is affected by strong birefringence, diattenuation, multiple scattering induced depolarization and the sarcomere diffraction effect.

  15. Flux Cloning in Josephson Transmission Lines

    SciTech Connect

    Gulevich, D.R.; Kusmartsev, F.V.

    2006-07-07

    We describe a novel effect related to the controlled birth of a single Josephson vortex. In this phenomenon, the vortex is created in a Josephson transmission line at a T-shaped junction. The 'baby' vortex arises at the moment when a 'mother' vortex propagating in the adjacent transmission line passes the T-shaped junction. In order to give birth to a new vortex, the mother vortex must have enough kinetic energy. Its motion can also be supported by an externally applied driving current. We determine the critical velocity and the critical driving current for the creation of the baby vortices and briefly discuss the potential applications of the found effect.

  16. Small passenger car transmission test: Mercury Lynx ATX transmission

    NASA Technical Reports Server (NTRS)

    Bujold, M. P.

    1981-01-01

    The testing of a Mercury Lynx automatic transmission is reported. The transmission was tested in accordance with a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these conditions, the transmission attained maximum efficiencies in the mid-ninety percent range both for drive performance test and coast performance tests. The torque, speed, and efficiency curves are presented, which provide the complete performance characteristics for the Mercury Lynx automatic transmission.

  17. Small passenger car transmission test: Dodge Omni A-404 transmission

    NASA Technical Reports Server (NTRS)

    Bujold, M. P.

    1980-01-01

    The small passenger car transmission test was initiated to supply electric vehicle manufacturers with technical information regarding the performance of commercially available transmissions. This transmission was tested in accordance with a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the mid eighty percent range for both drive performance test and coast performance tests.

  18. Disease transmission in horses.

    PubMed

    Samper, Juan C; Tibary, Ahmed

    2006-08-01

    Bacterial, viral and protozoal infections may cause severe reproductive losses. The present paper reviews the risk factors, clinical signs and preventive measures for the most important venereal or potential sexually transmitted diseases in horses. The stallion and use of semen for artificial insemination represent major risk factors for the transmission of bacterial contaminants of the penis, including Streptococcus equi subspecies zooepidemicus, Pseudomonas aeruginosa and Klebsiella pneumoniae, known to cause endometritis and infertility in the mare. The role of the stallion in disease transmission is also due to the non-clinical manifestation of diseases such as contagious equine metritis and equine viral arteritis. Dourine has been eradicated from many countries, but continues to be a problem in other areas of the globe. Strategies for the prevention of introduction and transmission of diseases in breeding operation are discussed.

  19. Aerosol Transmission of Filoviruses.

    PubMed

    Mekibib, Berhanu; Ariën, Kevin K

    2016-05-23

    Filoviruses have become a worldwide public health concern because of their potential for introductions into non-endemic countries through international travel and the international transport of infected animals or animal products. Since it was first identified in 1976, in the Democratic Republic of Congo (formerly Zaire) and Sudan, the 2013-2015 western African Ebola virus disease (EVD) outbreak is the largest, both by number of cases and geographical extension, and deadliest, recorded so far in medical history. The source of ebolaviruses for human index case(s) in most outbreaks is presumptively associated with handling of bush meat or contact with fruit bats. Transmission among humans occurs easily when a person comes in contact with contaminated body fluids of patients, but our understanding of other transmission routes is still fragmentary. This review deals with the controversial issue of aerosol transmission of filoviruses.

  20. Automotive transmission linkage system

    SciTech Connect

    Yen, F.Y.; Ardayfio, D.D.

    1990-10-02

    This patent describes a system for converting a manual multi-speed transmission to operate as an automatic-manual transmission, the system being disposed within a vehicle, the transmission having a conventional gearshift lever and a clutch pedal. It comprises: a gearshift position selection panel, the panel being located apart from the gearshift lever, the panel enabling a driver to select the desired gear position of the gearshift lever by manipulating the panel without the necessity of the driver handling the gearshift lever; a controller which transforms the gearshift selection of the driver to an output signal, the signal corresponding to the gearshift position selected by the driver; and actuating means for mechanically repositioning the gearshift lever automatically in accordance with the output signal.

  1. Aerosol Transmission of Filoviruses

    PubMed Central

    Mekibib, Berhanu; Ariën, Kevin K.

    2016-01-01

    Filoviruses have become a worldwide public health concern because of their potential for introductions into non-endemic countries through international travel and the international transport of infected animals or animal products. Since it was first identified in 1976, in the Democratic Republic of Congo (formerly Zaire) and Sudan, the 2013–2015 western African Ebola virus disease (EVD) outbreak is the largest, both by number of cases and geographical extension, and deadliest, recorded so far in medical history. The source of ebolaviruses for human index case(s) in most outbreaks is presumptively associated with handling of bush meat or contact with fruit bats. Transmission among humans occurs easily when a person comes in contact with contaminated body fluids of patients, but our understanding of other transmission routes is still fragmentary. This review deals with the controversial issue of aerosol transmission of filoviruses. PMID:27223296

  2. Fire retardancy using applied materials

    NASA Technical Reports Server (NTRS)

    Feldman, R.

    1971-01-01

    An example of advanced technology transfer from the Little Joe, Surveyor, Comsat, re-entry and Apollo age to everyday fire protection needs is presented. Utilizing the principle of sublimation cooling for thermostatic temperature control, the material meets a wide range of fire retardancy and heat transmission control requirements. Properties vary from flexible tape for conduits and electrical cables to rigid coatings for column protection, with a broad spectrum of sublimation temperatures available. The material can be applied in the field or in the factory, utilizing mass production techniques, yielding a product that is reliable, effective, widely available and low in cost.

  3. Transmission line capital costs

    SciTech Connect

    Hughes, K.R.; Brown, D.R.

    1995-05-01

    The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy`s Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs.

  4. Heterosexual transmission of HIV.

    PubMed

    Johnson, A M; Laga, M

    1988-01-01

    Recent developments concerning heterosexual transmission of HIV (review of 1988 literature only) suggest improved understanding of the pattern of spread and role of risk behaviors and biological cofactors in its transmission. 3 distinct patterns if HIV infection are known: heterosexual spread in sub-Saharan Africa and the Caribbean, spread primarily among homosexuals and injecting drug users in Europe, North American and much of Latin America and Australia, and both homosexual and heterosexual transmission in Asia, the Pacific, the Middle East and Eastern Europe, where prevalence is low. In Africa an estimated 80% of cases are acquired heterosexually. Important risk factors are number of sex partners, sex with prostitutes, being a prostitute, being a sex partner of an infected person, and having a history of other sexually transmitted diseases. Prevalence rates have risen rapidly in Zaire and Kenya. In Africa, acquisition of HIV is related to sexual activity only. In contrast, in the U.S., heterosexual cases make up only 4% of all cases, and in Europe only 6%. Data on types of sexual transmission of HIV are mounting, in aggregate suggestive of a marked heterogeneity in infectivity and possibly susceptibility between individuals. Among couples where the man is positive, in some places individuals appear to be highly infective, notably those from Kinshasa, Zaire and Haiti, while other series of discordant couples the receptive partner remained seronegative for several years. Transmission from women to men appears to be less efficient than from men to women, as has been observed with other STDs such as gonorrhea. Biological cofactors implicated in enhanced HIV transmission appear to be advanced CDC Stage IV AIDS disease, with low T-helper lymphocyte counts and high antigenemia; concomitant STDS, especially those with genital ulceration; lack of circumcision; oral contraceptive use; practice of anal intercourse; inconsistent or no use of condoms. Theoretical models for

  5. Advanced rotorcraft transmission program

    NASA Technical Reports Server (NTRS)

    Bill, Robert C.

    1990-01-01

    The Advanced Rotorcraft Transmission (ART) program is an Army-funded, joint Army/NASA program to develop and demonstrate lightweight, quiet, durable drivetrain systems for next generation rotorcraft. ART addresses the drivetrain requirements of two distinct next generation aircraft classes: Future Air Attack Vehicle, a 10,000 to 20,000 lb. aircraft capable of undertaking tactical support and air-to-air missions; and Advanced Cargo Aircraft, a 60,000 to 80,000 lb. aircraft capable of heavy life field support operations. Both tiltrotor and more conventional helicopter configurations are included in the ART program. Specific objectives of ART include reduction of drivetrain weight by 25 percent compared to baseline state-of-the-art drive systems configured and sized for the next generation aircraft, reduction of noise level at the transmission source by 10 dB relative to a suitably sized and configured baseline, and attainment of at least a 5000 hr mean-time-between-removal. The technical approach for achieving the ART goals includes application of the latest available component, material, and lubrication technology to advanced concept drivetrains that utilize new ideas in gear configuration, transmission layout, and airframe/drivetrain integration. To date, candidate drivetrain systems were carried to a conceptual design stage, and tradeoff studies were conducted resulting in selection of an ART transmission configuration for each of the four contractors. The final selection was based on comparative weight, noise, and reliability studies. A description of each of the selected ART designs is included. Preliminary design of each of the four selected ART transmission was completed, as have mission impact studies wherein comparisons of aircraft mission performance and life cycle costs are undertaken for the next generation aircraft with ART and with the baseline transmission.

  6. Licklider Transmission Protocol Implementation

    NASA Technical Reports Server (NTRS)

    Burleigh, Scott C.; Krupiarz, Chris

    2011-01-01

    This software is an implementation of the Licklider Transmission Protocol (LTP), a communications protocol intended to support the Bundle Protocol in Delay-Tolerant Network (DTN) operations. LTP is designed to provide retransmission-based reliability over links characterized by extremely long message round-trip times and/or frequent interruptions in connectivity. Communication in interplanetary space is the most prominent example of this sort of environment, and LTP is principally aimed at supporting long-haul reliable transmission over deep-space RF links. Like any reliable transport service employing ARQ (Automatic Repeat re-Quests), LTP is stateful. In order to assure the reception of a block of data it has sent, LTP must retain for possible retransmission all portions of that block which might not have been received yet. In order to do so, it must keep track of which portions of the block are known to have been received so far, and which are not, together with any additional information needed for purposes of retransmitting part, or all, of the block. Long round-trip times mean substantial delay between the transmission of a block of data and the reception of an acknowledgement from the block s destination, signaling arrival of the block. If LTP postponed transmission of additional blocks of data until it received acknowledgement of the arrival of all prior blocks, valuable opportunities to use what little deep space transmission bandwidth is available would be forever lost. For this reason, LTP is based in part on a notion of massive state retention. Any number of requested transmission conversations (sessions) may be concurrently in flight at various displacements along the link between two LTP engines, and the LTP engines must necessarily retain transmission status and retransmission resources for all of them. Moreover, if any of the data of a given block are lost en route, it will be necessary to retain the state of that transmission during an additional

  7. Printed circuit dispersive transmission line

    DOEpatents

    Ikezi, Hiroyuki; Lin-Liu, Yuh-Ren; DeGrassie, John S.

    1991-01-01

    A printed circuit dispersive transmission line structure is disclosed comprising an insulator, a ground plane formed on one surface of the insulator, a first transmission line formed on a second surface of the insulator, and a second transmission line also formed on the second surface of the insulator and of longer length than the first transmission line and periodically intersecting the first transmission line. In a preferred embodiment, the transmission line structure exhibits highly dispersive characteristics by designing the length of one of the transmission line between two adjacent periodic intersections to be longer than the other.

  8. Printed circuit dispersive transmission line

    DOEpatents

    Ikezi, H.; Lin-Liu, Y.R.; DeGrassie, J.S.

    1991-08-27

    A printed circuit dispersive transmission line structure is disclosed comprising an insulator, a ground plane formed on one surface of the insulator, a first transmission line formed on a second surface of the insulator, and a second transmission line also formed on the second surface of the insulator and of longer length than the first transmission line and periodically intersecting the first transmission line. In a preferred embodiment, the transmission line structure exhibits highly dispersive characteristics by designing the length of one of the transmission line between two adjacent periodic intersections to be longer than the other. 5 figures.

  9. Detecting social transmission in networks.

    PubMed

    Hoppitt, William; Boogert, Neeltje J; Laland, Kevin N

    2010-04-21

    In recent years researchers have drawn attention to a need for new methods with which to identify the spread of behavioural innovations through social transmission in animal populations. Network-based analyses seek to recognise diffusions mediated by social learning by detecting a correspondence between patterns of association and the flow of information through groups. Here we introduce a new order of acquisition diffusion analysis (OADA) and develop established time of acquisition diffusion analysis (TADA) methods further. Through simulation we compare the merits of these and other approaches, demonstrating that OADA and TADA have greater power and lower Type I error rates than available alternatives, and specifying when each approach should be deployed. We illustrate the new methods by applying them to reanalyse an established dataset corresponding to the diffusion of foraging innovations in starlings, where OADA and TADA detect social transmission that hitherto had been missed. The methods are potentially widely applicable by researchers wishing to detect social learning in natural and captive populations of animals, and to facilitate this we provide code to implement OADA and TADA in the statistical package R.

  10. How vinculin regulates force transmission.

    PubMed

    Dumbauld, David W; Lee, Ted T; Singh, Ankur; Scrimgeour, Jan; Gersbach, Charles A; Zamir, Evan A; Fu, Jianping; Chen, Christopher S; Curtis, Jennifer E; Craig, Susan W; García, Andrés J

    2013-06-11

    Focal adhesions mediate force transfer between ECM-integrin complexes and the cytoskeleton. Although vinculin has been implicated in force transmission, few direct measurements have been made, and there is little mechanistic insight. Using vinculin-null cells expressing vinculin mutants, we demonstrate that vinculin is not required for transmission of adhesive and traction forces but is necessary for myosin contractility-dependent adhesion strength and traction force and for the coupling of cell area and traction force. Adhesion strength and traction forces depend differentially on vinculin head (V(H)) and tail domains. V(H) enhances adhesion strength by increasing ECM-bound integrin-talin complexes, independently from interactions with vinculin tail ligands and contractility. A full-length, autoinhibition-deficient mutant (T12) increases adhesion strength compared with VH, implying roles for both vinculin activation and the actin-binding tail. In contrast to adhesion strength, vinculin-dependent traction forces absolutely require a full-length and activated molecule; V(H) has no effect. Physical linkage of the head and tail domains is required for maximal force responses. Residence times of vinculin in focal adhesions, but not T12 or V(H), correlate with applied force, supporting a mechanosensitive model for vinculin activation in which forces stabilize vinculin's active conformation to promote force transfer.

  11. Thermal and Structural Analysis of Helicopter Transmission Housings Using NASTRAN

    NASA Technical Reports Server (NTRS)

    Howells, R. W.; Sciarra, J. J.; Ng, G. S.

    1976-01-01

    The application of NASTRAN to improve the design of helicopter transmission housings is described. A finite element model of the complete forward rotor transmission housing for the Boeing Vertol CH-47C helicopter was used to study thermal distortion and stress, stress and deflection due to static and dynamic loads, load paths, and design optimization by the control of structural energy distribution. The analytical results are correlated with test data and used to reduce weight and to improve strength, service life, failsafety, and reliability. The techniques presented, although applied herein to helicopter transmissions, are sufficiently general to be applicable to any power transmission system.

  12. Transmission overhaul and replacement predictions using Weibull and renewal theory

    NASA Technical Reports Server (NTRS)

    Savage, M.; Lewicki, D. G.

    1989-01-01

    A method to estimate the frequency of transmission overhauls is presented. This method is based on the two-parameter Weibull statistical distribution for component life. A second method is presented to estimate the number of replacement components needed to support the transmission overhaul pattern. The second method is based on renewal theory. Confidence statistics are applied with both methods to improve the statistical estimate of sample behavior. A transmission example is also presented to illustrate the use of the methods. Transmission overhaul frequency and component replacement calculations are included in the example.

  13. Transmission overhaul and replacement predictions using Weibull and renewel theory

    NASA Technical Reports Server (NTRS)

    Savage, M.; Lewicki, D. G.

    1989-01-01

    A method to estimate the frequency of transmission overhauls is presented. This method is based on the two-parameter Weibull statistical distribution for component life. A second method is presented to estimate the number of replacement components needed to support the transmission overhaul pattern. The second method is based on renewal theory. Confidence statistics are applied with both methods to improve the statistical estimate of sample behavior. A transmission example is also presented to illustrate the use of the methods. Transmission overhaul frequency and component replacement calculations are included in the example.

  14. Magnetically insulated transmission line oscillator

    DOEpatents

    Bacon, Larry D.; Ballard, William P.; Clark, M. Collins; Marder, Barry M.

    1988-01-01

    A magnetically insulated transmission line oscillator employs self-generated magnetic fields to generate microwave energy. An anode of the oscillator includes slow-wave structures which are formed of a plurality of thin conductive vanes defining cavities therebetween, and a gap is formed between the anode and a cathode of the oscillator. In response to a pulsed voltage applied to the anode and cathode, self-generated magnetic fields arfe produced in a cross-field orientation with respect to the orientation of the electric field between the anode and the cathode. The cross-field magnetic fields insulate the flow of electrons in the gap and confine the flow of electrons within the gap.

  15. Magnetically insulated transmission line oscillator

    DOEpatents

    Bacon, L.D.; Ballard, W.P.; Clark, M.C.; Marder, B.M.

    1987-05-19

    A magnetically insulated transmission line oscillator employs self-generated magnetic fields to generate microwave energy. An anode of the oscillator includes slow-wave structures which are formed of a plurality of thin conductive vanes defining cavities therebetween, and a gap is formed between the anode and a cathode of the oscillator. In response to a pulsed voltage applied to the anode and cathode, self-generated magnetic fields are produced in a cross-field orientation with respect to the orientation of the electric field between the anode and the cathode. The cross-field magnetic fields insulate the flow of electrons in the gap and confine the flow of electrons within the gap. 11 figs.

  16. Measurement of Transmission Error Including Backlash in Angle Transmission Mechanisms for Mechatronic Systems

    NASA Astrophysics Data System (ADS)

    Ming, Aiguo; Kajitani, Makoto; Kanamori, Chisato; Ishikawa, Jiro

    The characteristics of angle transmission mechanisms exert a great influence on the servo performance in the robotic or mechatronic mechanism. Especially, the backlash of angle transmission mechanism is preferable the small amount. Recently, some new types of gear reducers with non-backlash have been developed for robots. However, the measurement and evaluation method of the backlash of gear trains has not been considered except old methods which can statically measure at only several meshing points of gears. This paper proposes an overall performance testing method of angle transmission mechanisms for the mechatronic systems. This method can measure the angle transmission error both clockwise and counterclockwise. In addition the backlash can be continuously measured in all meshing positions automatically. This system has been applied to the testing process in the production line of gear reducers for robots, and it has been effective for reducing the backlash of the gear trains.

  17. Automatic Transmission Vehicle Injuries

    PubMed Central

    Fidler, Malcolm

    1973-01-01

    Four drivers sustained severe injuries when run down by their own automatic cars while adjusting the carburettor or throttle linkages. The transmission had been left in the “Drive” position and the engine was idling. This accident is easily avoidable. PMID:4695693

  18. Transmission planning in China

    SciTech Connect

    Dong, Jun; Zhang, Jing

    2009-07-15

    Though China is well along in restructuring its power markets, it still has some way to travel before economic considerations receive adequate weight in transmission planning decisions. Adoption of more sophisticated tools such as multi-agent modeling will help China continue in its progress in achieving this. (author)

  19. Categories and Music Transmission

    ERIC Educational Resources Information Center

    Gatien, Greg

    2009-01-01

    Lucy Green's (2008) "Music, Informal Learning, and the School: A New Classroom Pedagogy" gives rise to an interesting corollary. Does the manner of music's transmission inform one's understanding of a musical category? While categories of music can be difficult to define according to strict musical characteristics, a better understanding of…

  20. Autonomous data transmission apparatus

    DOEpatents

    Kotlyar, O.M.

    1997-03-25

    A autonomous borehole data transmission apparatus is described for transmitting measurement data from measuring instruments at the downhole end of a drill string by generating pressure pulses utilizing a transducer longitudinally responsive to magnetic field pulses caused by electrical pulses corresponding to the measured downhole parameters. 4 figs.

  1. Facsimile Transmission Standards

    DTIC Science & Technology

    1993-10-01

    transmettre les cartes tactiques et les compte rendu de situation. La presente note technique expose les 6lements nec~ssaires A la transmission de t~l6copies...Group MI machines introduced digital scanning techniques in which the single photoelectric cell was replaced with a Charged Coupled Device (CCD) array

  2. Continuously variable transmission

    SciTech Connect

    Itoh, H.; Okada, M.

    1986-11-25

    This patent describes a continuously variable transmission for transmitting a torque from an engine to a final reduction gear, comprising: an input shaft connected with the engine at one end thereof; a continuously variable transmission means having a driving pulley with a fixed member and a movable member, the movable member being actuated by an hydraulic cylinder to form a V-shaped opening between the fixed member and movable member, a driven pulley with another fixed member and another movable member. The other movable member is similarly actuated by another hydraulic cylinder to form another V-shaped opening between the other fixed member and the other movable member, and a belt member spanning the pulleys provides for a continuously variable transmission ratio; a planetary gear unit including a sun gear, a plurality of pinion gears which mesh with the sun gear and are connected with the driven pulley and a ring gear which meshes with the plurality of pinion gears; and a rotation transmitting means for transmitting rotation of the input shaft to the planetary gear unit. The rotation transmitting means is provided between the input shaft and the planetary gear unit and includes a shaft connected with the sun gear of the planetary gear unit and a first gear connected with the input shaft. The first gear is located between the engine and the continuously variable transmission means.

  3. Laser power transmission

    NASA Technical Reports Server (NTRS)

    Conway, Edmund J.

    1992-01-01

    An overview of previous studies related to laser power transmission is presented. Particular attention is given to the use of solar pumped lasers for space power applications. Three general laser mechanisms are addressed: photodissociation lasing driven by sunlight, photoexcitation lasing driven directly by sunlight, and photoexcitation lasing driven by thermal radiation.

  4. Automatic transmission line monitor

    NASA Technical Reports Server (NTRS)

    Parsons, W. E.; Richards, L. O.

    1971-01-01

    Monitor improves complex network reliability in computer data links and command transmission lines. System evaluates circuit performance against preselected criteria, identifies and stores data indicating out-of-tolerance conditions, conducts closed loop testing, and provides for operation under command of digital computer that determines restoration priorities.

  5. Autonomous data transmission apparatus

    DOEpatents

    Kotlyar, Oleg M.

    1997-01-01

    A autonomous borehole data transmission apparatus for transmitting measurement data from measuring instruments at the downhole end of a drill string by generating pressure pulses utilizing a transducer longitudinally responsive to magnetic field pulses caused by electrical pulses corresponding to the measured downhole parameters.

  6. Categories and Music Transmission

    ERIC Educational Resources Information Center

    Gatien, Greg

    2009-01-01

    Lucy Green's (2008) "Music, Informal Learning, and the School: A New Classroom Pedagogy" gives rise to an interesting corollary. Does the manner of music's transmission inform one's understanding of a musical category? While categories of music can be difficult to define according to strict musical characteristics, a better understanding of…

  7. Dilemmas of Cultural Transmission

    ERIC Educational Resources Information Center

    Kováts-Németh, Mária

    2016-01-01

    The fundamental problem of the 21st century is that in the modern civilization "the transmission of values is not stable." There is nothing, except for the natural sense of justice and some legal traditions, which would exercise selective power on social behavior. At a critical time in 1949 Albert Szent-Györgyi drew the attention to the…

  8. Multistage Planetary Power Transmissions

    NASA Technical Reports Server (NTRS)

    Hadden, G. B.; Dyba, G. J.; Ragen, M. A.; Kleckner, R. J.; Sheynin, L.

    1986-01-01

    PLANETSYS simulates thermomechanical performance of multistage planetary performance of multistage planetary power transmission. Two versions of code developed, SKF version and NASA version. Major function of program: compute performance characteristics of planet bearing for any of six kinematic inversions. PLANETSYS solves heat-balance equations for either steadystate or transient thermal conditions, and produces temperature maps for mechanical system.

  9. Borehole data transmission apparatus

    DOEpatents

    Kotlyar, O.M.

    1993-03-23

    A borehole data transmission apparatus is described whereby a centrifugal pump impeller(s) is used to provide a turbine stage having substantial pressure characteristics in response to changing rotational speed of a shaft for the pressure pulsing of data from the borehole through the drilling mud to the surface of the earth.

  10. Borehole data transmission apparatus

    DOEpatents

    Kotlyar, Oleg M.

    1993-01-01

    A borehole data transmission apparatus whereby a centrifugal pump impeller(s) is used to provide a turbine stage having substantial pressure characteristics in response to changing rotational speed of a shaft for the pressure pulsing of data from the borehole through the drilling mud to the surface of the earth.

  11. Life and reliability models for helicopter transmissions

    NASA Technical Reports Server (NTRS)

    Savage, M.; Knorr, R. J.; Coy, J. J.

    1982-01-01

    Computer models of life and reliability are presented for planetary gear trains with a fixed ring gear, input applied to the sun gear, and output taken from the planet arm. For this transmission the input and output shafts are co-axial and the input and output torques are assumed to be coaxial with these shafts. Thrust and side loading are neglected. The reliability model is based on the Weibull distributions of the individual reliabilities of the in transmission components. The system model is also a Weibull distribution. The load versus life model for the system is a power relationship as the models for the individual components. The load-life exponent and basic dynamic capacity are developed as functions of the components capacities. The models are used to compare three and four planet, 150 kW (200 hp), 5:1 reduction transmissions with 1500 rpm input speed to illustrate their use.

  12. Technique and test of packet transmission network

    NASA Astrophysics Data System (ADS)

    Feng, Xiancheng; Duan, Wenxiao; Luo, Fan

    2011-11-01

    With the rapid development of telecommunication service, the broadband amalgamation of full service is becoming the main theme in the development of communication industry. The Packet Transmission Network adopts the technique of T-MPLS to meet next generation's demand on high speed, various services and high quality. Firstly, Requirements of PTN (Packet Transmission Network)are analyzed. Then, by deep analysis the key technology of PTN on MAN. At the same time, PTN technologies have been applied in multi-service's adaptation and transmission which are carried out by communication each other of MSTP and PTN, T-MPLS and IP/MPLS, PBT and IP/MPLS. At last, test of PTN are analyzed in detail. Test results of PTN show that PTN can replace core router to provide highly-efficient packet forward service in core network.

  13. Acoustic Power Transmission Through a Ducted Fan

    NASA Technical Reports Server (NTRS)

    Envia, Ed

    2016-01-01

    For high-speed ducted fans, when the rotor flowfield is shock-free, the main contribution to the inlet radiated acoustic power comes from the portion of the rotor stator interaction sound field that is transmitted upstream through the rotor. As such, inclusion of the acoustic transmission is an essential ingredient in the prediction of the fan inlet noise when the fan tip relative speed is subsonic. This paper describes a linearized Euler based approach to computing the acoustic transmission of fan tones through the rotor. The approach is embodied in a code called LINFLUX was applied to a candidate subsonic fan called the Advanced Ducted Propulsor (ADP). The results from this study suggest that it is possible to make such prediction with sufficient fidelity to provide an indication of the acoustic transmission trends with the fan tip speed.

  14. Seasonal forecast of St. Louis encephalitis virus transmission, Florida.

    PubMed

    Shaman, Jeffrey; Day, Jonathan F; Stieglitz, Marc; Zebiak, Stephen; Cane, Mark

    2004-05-01

    Disease transmission forecasts can help minimize human and domestic animal health risks by indicating where disease control and prevention efforts should be focused. For disease systems in which weather-related variables affect pathogen proliferation, dispersal, or transmission, the potential for disease forecasting exists. We present a seasonal forecast of St. Louis encephalitis virus transmission in Indian River County, Florida. We derive an empiric relationship between modeled land surface wetness and levels of SLEV transmission in humans. We then use these data to forecast SLEV transmission with a seasonal lead. Forecast skill is demonstrated, and a real-time seasonal forecast of epidemic SLEV transmission is presented. This study demonstrates how weather and climate forecast skill-verification analyses may be applied to test the predictability of an empiric disease forecast model.

  15. Seasonal Forecast of St. Louis Encephalitis Virus Transmission, Florida

    PubMed Central

    Day, Jonathan F.; Stieglitz, Marc; Zebiak, Stephen; Cane, Mark

    2004-01-01

    Disease transmission forecasts can help minimize human and domestic animal health risks by indicating where disease control and prevention efforts should be focused. For disease systems in which weather-related variables affect pathogen proliferation, dispersal, or transmission, the potential for disease forecasting exists. We present a seasonal forecast of St. Louis encephalitis virus transmission in Indian River County, Florida. We derive an empirical relationship between modeled land surface wetness and levels of SLEV transmission in humans. We then use these data to forecast SLEV transmission with a seasonal lead. Forecast skill is demonstrated, and a real-time seasonal forecast of epidemic SLEV transmission is presented. This study demonstrates how weather and climate forecast skill verification analyses may be applied to test the predictability of an empirical disease forecast model. PMID:15200812

  16. [Transmission and prevention].

    PubMed

    Reboulot, B

    1992-01-01

    This work provides an overview of current knowledge of AIDS transmission and attitudes toward prevention in France. Most HIV infections are transmitted sexually. AIDS became established in the homosexual community in California because of mutual infection by members of the community with large numbers of sexual partners. The possibility of heterosexual transmission was not immediately recognized by all observers. Different publications estimate the risk of seroconversion after 1 episode of heterosexual coitus at between 1:100 and 1:1000/ Heterosexual transmission is bidirectional, but male-female transmission appears easier. Factors favoring transmission identified in AFrican studies include multiple partners, sexually transmitted diseases, anal penetration, relations during menstruation, and age. No epidemiologic study has concluded that kissing with mutual salivary contact can lead to infection, but oral-genital sex may pose a risk. As of October 1991, 966 cases of posttransfusion AIDS had been diagnosed in France, and an estimated 6000-9000 HIV seropositive persons were infected through transfusion. 239 AIDS cases were reported in hemophiliacs and others with coagulation disorders. 1200 of 3500 French hemophiliacs receiving transfusions before 1985 are seropositive. The risk of developing AIDS from a transfusions in France is currently estimated at 1/250,000. HIV transmission among drug addicts results from sharing contaminated needles and syringes. The risk of infection for health workers treating those who are HIV positive appears small; only about 30 documented cases have been reported worldwide, including 3 of 10,000 cases in France. The risk that an infected mother will have a seropositive baby is estimated at 25% in France. The number of seropositive women in the world is estimated at over 3 million, with 80% in sub-Saharan Africa. As of October 1991, 16,0000-36,000 seropositive women and 1500 seropositive children were estimated to live in France

  17. Dynamics of Mechanical Signal Transmission through Prestressed Stress Fibers

    PubMed Central

    Hwang, Yongyun; Barakat, Abdul I.

    2012-01-01

    Transmission of mechanical stimuli through the actin cytoskeleton has been proposed as a mechanism for rapid long-distance mechanotransduction in cells; however, a quantitative understanding of the dynamics of this transmission and the physical factors governing it remains lacking. Two key features of the actin cytoskeleton are its viscoelastic nature and the presence of prestress due to actomyosin motor activity. We develop a model of mechanical signal transmission through prestressed viscoelastic actin stress fibers that directly connect the cell surface to the nucleus. The analysis considers both temporally stationary and oscillatory mechanical signals and accounts for cytosolic drag on the stress fibers. To elucidate the physical parameters that govern mechanical signal transmission, we initially focus on the highly simplified case of a single stress fiber. The results demonstrate that the dynamics of mechanical signal transmission depend on whether the applied force leads to transverse or axial motion of the stress fiber. For transverse motion, mechanical signal transmission is dominated by prestress while fiber elasticity has a negligible effect. Conversely, signal transmission for axial motion is mediated uniquely by elasticity due to the absence of a prestress restoring force. Mechanical signal transmission is significantly delayed by stress fiber material viscosity, while cytosolic damping becomes important only for longer stress fibers. Only transverse motion yields the rapid and long-distance mechanical signal transmission dynamics observed experimentally. For simple networks of stress fibers, mechanical signals are transmitted rapidly to the nucleus when the fibers are oriented largely orthogonal to the applied force, whereas the presence of fibers parallel to the applied force slows down mechanical signal transmission significantly. The present results suggest that cytoskeletal prestress mediates rapid mechanical signal transmission and allows

  18. Transmission of foot-and-mouth disease virus from experimentally infected Indian buffalo (Bubalus bubalis) to in-contact naïve and vaccinated Indian buffalo and cattle.

    PubMed

    Madhanmohan, M; Yuvaraj, S; Nagendrakumar, S B; Srinivasan, V A; Gubbins, Simon; Paton, David James; Parida, Satya

    2014-09-03

    This study investigated the transmission of foot-and-mouth disease virus (FMDV) from experimentally infected Indian buffalo to in-contact naïve and vaccinated cattle and buffalo. In each of six rooms, two donor buffalo that had been inoculated with FMDV were housed for five days with four recipient animals, comprising one vaccinated buffalo, one vaccinated calf, one unvaccinated buffalo and one unvaccinated calf. Vaccination was carried out with current Indian vaccine strain (O/IND/R2/75) and challenged on 28 days post-vaccination with an antigenically similar strain (O/HAS/34/05). All 12 donor buffalo and the six unvaccinated cattle and six unvaccinated calves developed clinical signs of foot-and-mouth disease (FMD). In contrast, all six vaccinated cattle (100%) and four out of six vaccinated buffalo (66.6%) were protected from disease but all became infected with FMDV. This confirms that buffalo have the potential to spread FMD by direct contact and that vaccination can block this spread. The numbers of animals in the study were too small to determine if the differences in clinical protection afforded by vaccination of cattle and buffalo are significant and warrant a different dose regime. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  19. Economic analysis for transmission operation and planning

    NASA Astrophysics Data System (ADS)

    Zhou, Qun

    2011-12-01

    Restructuring of the electric power industry has caused dramatic changes in the use of transmission system. The increasing congestion conditions as well as the necessity of integrating renewable energy introduce new challenges and uncertainties to transmission operation and planning. Accurate short-term congestion forecasting facilitates market traders in bidding and trading activities. Cost sharing and recovery issue is a major impediment for long-term transmission investment to integrate renewable energy. In this research, a new short-term forecasting algorithm is proposed for predicting congestion, LMPs, and other power system variables based on the concept of system patterns. The advantage of this algorithm relative to standard statistical forecasting methods is that structural aspects underlying power market operations are exploited to reduce the forecasting error. The advantage relative to previously proposed structural forecasting methods is that data requirements are substantially reduced. Forecasting results based on a NYISO case study demonstrate the feasibility and accuracy of the proposed algorithm. Moreover, a negotiation methodology is developed to guide transmission investment for integrating renewable energy. Built on Nash Bargaining theory, the negotiation of investment plans and payment rate can proceed between renewable generation and transmission companies for cost sharing and recovery. The proposed approach is applied to Garver's six bus system. The numerical results demonstrate fairness and efficiency of the approach, and hence can be used as guidelines for renewable energy investors. The results also shed light on policy-making of renewable energy subsidies.

  20. Transmission Line Adapted Analytical Power Charts Solution

    NASA Astrophysics Data System (ADS)

    Sakala, Japhet D.; Daka, James S. J.; Setlhaolo, Ditiro; Malichi, Alec Pulu

    2017-08-01

    The performance of a transmission line has been assessed over the years using power charts. These are graphical representations, drawn to scale, of the equations that describe the performance of transmission lines. Various quantities that describe the performance, such as sending end voltage, sending end power and compensation to give zero voltage regulation, may be deduced from the power charts. Usually required values are read off and then converted using the appropriate scales and known relationships. In this paper, the authors revisit this area of circle diagrams for transmission line performance. The work presented here formulates the mathematical model that analyses the transmission line performance from the power charts relationships and then uses them to calculate the transmission line performance. In this proposed approach, it is not necessary to draw the power charts for the solution. However the power charts may be drawn for the visual presentation. The method is based on applying derived equations and is simple to use since it does not require rigorous derivations.

  1. Transmission Line Adapted Analytical Power Charts Solution

    NASA Astrophysics Data System (ADS)

    Sakala, Japhet D.; Daka, James S. J.; Setlhaolo, Ditiro; Malichi, Alec Pulu

    2016-08-01

    The performance of a transmission line has been assessed over the years using power charts. These are graphical representations, drawn to scale, of the equations that describe the performance of transmission lines. Various quantities that describe the performance, such as sending end voltage, sending end power and compensation to give zero voltage regulation, may be deduced from the power charts. Usually required values are read off and then converted using the appropriate scales and known relationships. In this paper, the authors revisit this area of circle diagrams for transmission line performance. The work presented here formulates the mathematical model that analyses the transmission line performance from the power charts relationships and then uses them to calculate the transmission line performance. In this proposed approach, it is not necessary to draw the power charts for the solution. However the power charts may be drawn for the visual presentation. The method is based on applying derived equations and is simple to use since it does not require rigorous derivations.

  2. Hydraulic system for a ratio change transmission

    DOEpatents

    Kalns, Ilmars

    1981-01-01

    Disclosed is a drive assembly (10) for an electrically powered vehicle (12). The assembly includes a transaxle (16) having a two-speed transmission (40) and a drive axle differential (46) disposed in a unitary housing assembly (38), an oil-cooled prime mover or electric motor (14) for driving the transmission input shaft (42), an adapter assembly (24) for supporting the prime mover on the transaxle housing assembly, and a hydraulic system (172) providing pressurized oil flow for cooling and lubricating the electric motor and transaxle and for operating a clutch (84) and a brake (86) in the transmission to shift between the two-speed ratios of the transmission. The adapter assembly allows the prime mover to be supported in several positions on the transaxle housing. The brake is spring-applied and locks the transmission in its low-speed ratio should the hydraulic system fail. The hydraulic system pump is driven by an electric motor (212) independent of the prime mover and transaxle.

  3. Advanced transmission studies

    NASA Technical Reports Server (NTRS)

    Coy, John J.; Bill, Robert C.

    1988-01-01

    The NASA Lewis Research Center and the U.S. Army Aviation Systems Command share an interest in advancing the technology for helicopter propulsion systems. In particular, this paper presents highlights from that portion of the program in drive train technology and the related mechanical components. The major goals of the program are to increase the life, reliability, and maintainability; reduce the weight, noise, and vibration; and maintain the relatively high mechanical efficiency of the gear train. The current activity emphasizes noise reduction technology and analytical code development followed by experimental verification. Selected significant advances in technology for transmissions are reviewed, including advanced configurations and new analytical tools. Finally, the plan for future transmission research is presented.

  4. Continuously variable transmission

    SciTech Connect

    Tatara, Y.; Okawa, S.; Matsui, H.; Nakawaki, Y.

    1987-04-28

    A continuously variable transmission means is described for motor vehicles including a driving pulley with a fixed member and a movable member. The movable member is actuated by a hydraulic cylinder to form a V-shaped opening, a driven pulley with another fixed member and another movable member. Another movable member is actuated by another hydraulic cylinder to form another V-shaped opening, and a flexible endless member spans the driving and driven pulleys. The continuously variable transmission means comprises such items as: a first output shaft; a first gear; a second gear; a reverse gear; a second output shaft; a third gear; a jaw clutch mounted; a first one-way clutch; a fourth gear; a hydraulic clutch means; and a second one-way clutch.

  5. Drill string transmission line

    DOEpatents

    Hall, David R.; Hall, Jr., H. Tracy; Pixton, David S.; Bradford, Kline; Fox, Joe

    2006-03-28

    A transmission line assembly for transmitting information along a downhole tool comprising a pin end, a box end, and a central bore traveling between the pin end and the box end, is disclosed in one embodiment of the invention as including a protective conduit. A transmission line is routed through the protective conduit. The protective conduit is routed through the central bore and the ends of the protective conduit are routed through channels formed in the pin end and box end of the downhole tool. The protective conduit is elastically forced into a spiral or other non-linear path along the interior surface of the central bore by compressing the protective conduit to a length within the downhole tool shorter than the protective conduit.

  6. Sixteen speed powershift transmission

    SciTech Connect

    McAskill, J.P.

    1991-06-25

    This patent describes a transmission. It includes a transmission housing; a first shaft rotatably mounted in the housing and having a third gear fixed for rotation therewith and fourth and fifth gears rotatably mounted thereto, the fourth and fifth gears meshing with the first and second gears, respectively; first and second clutch means for selectively fixing the fourth and fifth gears, respectively, for rotation with the second shaft; a third shaft rotatably mounted in the housing and having a sixth gear fixed for rotation therewith and seventh and eighth gears rotatably mounted thereto, the seventh and eighth gears meshing with the first and second gears, respectively; third and fourth clutch means for selectively fixing the seventh and eighth gears respectively, for rotation with the third shaft.

  7. Advanced Rotorcraft Transmission Program

    NASA Technical Reports Server (NTRS)

    Bill, Robert C.

    1990-01-01

    The U.S. Army/NASA Advanced Rotorcraft Transmission (ART) program is charged with developing and demonstrating a light, quiet, and durable drivetrain for next-generation rotorcraft in two classes: a 10,000-20,000 Future Attack Air Vehicle capable of both tactical ground support and air-to-air missions, and a 60,000-80,000 lb Advanced Cargo Aircraft, for heavy-lift field-support operations. Specific ART objectives encompass a 25-percent reduction in drivetrain weight, a 10-dB noise level reduction at the transmission source, and the achievement of a 5000-hr MTBF. Four candidate drivetrain systems have been carried to a conceptual design stage, together with projections of their mission performance and life-cycle costs.

  8. Drive transmission means

    SciTech Connect

    Marsh, M. R.

    1985-01-15

    This invention provides apparatus for use in a drive transmission system comprising a pump adapted to perform work on a medium and means repetitively and automatically to unload the pump. When connected with a flywheel driven by a prime mover an embodiment alternately performs work and then is unloaded to permit acceleration of the flywheel. In use in a driven transmission system there is provided a flywheel driven by an engine, a pump driven by the flywheel, powered by the pump, and means repetitively to unload the pump permitting the engine to accelerate the flywheel and compensation means to power the hydraulic motor while the pump is unloaded. The pump is preferably a rotary positive displacement pump having relief galleries eliminating the seal between pumping elements driving each cycle.

  9. Small passenger car transmission test; Chevrolet LUV transmission

    NASA Technical Reports Server (NTRS)

    Bujold, M. P.

    1980-01-01

    A 1978 Chevrolet LUV manual transmission tested per the applicable portions of a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the upper ninety percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Chevrolet LUV transmission.

  10. Small passenger car transmission test; Ford C4 transmission

    NASA Technical Reports Server (NTRS)

    Bujold, M. P.

    1980-01-01

    A 1979 Ford C4 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Ford C4 transmission.

  11. Facsimile transmission standards

    NASA Astrophysics Data System (ADS)

    Mudry, Andrew; Poulin, Brad

    1993-10-01

    Modern tactical communications systems are becoming increasingly compatible with existing civilian systems. This compatibility allows the military to take advantage of the equipment available commercially and spare the expense of developing costly customized systems. It also increases the interoperability of various communications systems employed by allies involved in multinational operations. Finally, the compatibility allows the military to augment its telecommunications assets with existing commercial equipment and networks during times of conflict. One civilian communication standard that has recently been adopted by the military for tactical communications is that of facsimile. Facsimile is now commonly used on the battlefield for the transmission of tactical maps and situation reports. This technical note examines the requirements for facsimile transmission. An overview of the various facsimile standards are given, followed by a detailed description of the most commonly used standard; CCITT Group III. The Group III specifications are a composite of various CCITT modulation and encoding standards. These consist of V.21, V.27ter, and V.29 modulations, as well as T.4 image encoding standards, and T.30 signalling specifications. Each of these standards is described in the context of facsimile transmissions. A complete description of the handshaking which occurs between the facsimile transmitter and receiver is given.

  12. Compact change speed transmission

    SciTech Connect

    Iwanaga, K.; Yamaguchi, T.

    1989-06-06

    A change speed transmission is described comprising: a stationary part; an input member; an output member; first and second planetary gear sets; clutch and brake means for selectively controlling the first and second planetary gear sets to provide a plurality of forward speed rations and a reverse speed ratio between the input and output member; the clutch and brake means including a first clutch, a first one-way clutch, and a second one-way clutch which, when the first clutch is engaged, provide a path of transmission of reaction to the stationary part thereby establishing a path of transmission of torque through at least a part of the first and second planetary gear sets to achieve a predetermined one speed ratio of the forward speed ratios; the clutch and brake means including also a brake and a second slutch which, when both of the brake and the second clutch are engaged, hinder the action of the second one-way clutch and that of the first one-way clutch, respectively, thereby providing engine braking during running with the predetermined one speed ratio; the first clutch including means forming a drum-shaped member disposed radially outwardly of and receiving at least one of the first and second planetary gear sets, and an actuating piston of the first clutch; and the second clutch including an actuating piston slidably disposed within the actuating piston of the first clutch.

  13. Intercultural Transmission of Values: The Role of Transmission Belts.

    ERIC Educational Resources Information Center

    Schonpflug, Ute

    2001-01-01

    Explored the effect of "transmission belts" (conditions favorable to cultural transmission within particular socioeconomic and cultural contexts) on the similarity of values between Turkish fathers and their sons. Data from father-son dyads in Germany indicated that transmission of values related to the collective value categories of…

  14. Gamma radiation transmission along the multibend mazes.

    PubMed

    Kim, Sangrok

    2016-08-01

    Installing a maze on the corridor reduces much shielding materials in shielding door at the end of the pathway. In this study, gamma transmission was measured along single-, double-, and triple-bend mazes, which were applied to nondestructive test workplace by Monte Carlo method. In the facility using (192)Ir 1.85TBq, the lengths of corridors to reduce the effective dose under the limitation without shielding door were 10 and 6m in double- and triple-bend mazes, respectively.

  15. 37 CFR 386.2 - Royalty fee for secondary transmission by satellite carriers.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... transmission by satellite carriers. 386.2 Section 386.2 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY... SECONDARY TRANSMISSIONS BY SATELLITE CARRIERS § 386.2 Royalty fee for secondary transmission by satellite... paragraph (b) of this section shall apply to each digital stream that a satellite carrier or...

  16. 37 CFR 386.2 - Royalty fee for secondary transmission by satellite carriers.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... transmission by satellite carriers. 386.2 Section 386.2 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY... SECONDARY TRANSMISSIONS BY SATELLITE CARRIERS § 386.2 Royalty fee for secondary transmission by satellite... paragraph (b) of this section shall apply to each digital stream that a satellite carrier or...

  17. 37 CFR 386.2 - Royalty fee for secondary transmission by satellite carriers.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... transmission by satellite carriers. 386.2 Section 386.2 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY... SECONDARY TRANSMISSIONS BY SATELLITE CARRIERS § 386.2 Royalty fee for secondary transmission by satellite... paragraph (b) of this section shall apply to each digital stream that a satellite carrier or...

  18. Transmission speed sensor arrangement

    SciTech Connect

    Nogle, T.D.

    1986-05-06

    In an engine driven vehicle having an engine extending transversely with respect to the vehicle at one end thereof, a pair of wheels at the same end of the vehicle, and automatic drive transmission means connecting the engine to the wheels, the automatic drive transmission means includes a housing attached to the vehicle. The housing has a torque converter section, a speed change section adjacent the torque converter section, and a differential and transfer section; the engine having a crankshaft, a torque converter in the torque converter section of the housing rotatable on the same axis as the crankshaft and adapted to be driven by the engine crankshaft, the torque converter drivingly connected to one outer end of a transmission input shaft, the input shaft having its other inner end located about midway through the speed change section, a speed change section output shaft mounted coaxial with the input shaft in the speed change section with its inner end adjacent the input shaft inner end and its outer free end extending beyond the speed change section, an output gear having peripheral teeth formed thereon, the output gear connected on the output shaft outer free end such that the output shaft and the output gear rotate on the input shaft axis, a transfer shaft having a transfer gear engaged with the output gear, the output shaft having a bore extending axially therethrough, the improvement wherein; a speed sensor shaft having a speed sensor wheel with peripheral teeth formed thereon fixed on the free outer end thereof, means journally supporting the speed shaft concentrically within the output shaft bore such that the speed wheel is axially spaced closely adjacent to the output gear.

  19. Planetary Transmission Diagnostics

    NASA Technical Reports Server (NTRS)

    Lewicki, David G. (Technical Monitor); Samuel, Paul D.; Conroy, Joseph K.; Pines, Darryll J.

    2004-01-01

    This report presents a methodology for detecting and diagnosing gear faults in the planetary stage of a helicopter transmission. This diagnostic technique is based on the constrained adaptive lifting algorithm. The lifting scheme, developed by Wim Sweldens of Bell Labs, is a time domain, prediction-error realization of the wavelet transform that allows for greater flexibility in the construction of wavelet bases. Classic lifting analyzes a given signal using wavelets derived from a single fundamental basis function. A number of researchers have proposed techniques for adding adaptivity to the lifting scheme, allowing the transform to choose from a set of fundamental bases the basis that best fits the signal. This characteristic is desirable for gear diagnostics as it allows the technique to tailor itself to a specific transmission by selecting a set of wavelets that best represent vibration signals obtained while the gearbox is operating under healthy-state conditions. However, constraints on certain basis characteristics are necessary to enhance the detection of local wave-form changes caused by certain types of gear damage. The proposed methodology analyzes individual tooth-mesh waveforms from a healthy-state gearbox vibration signal that was generated using the vibration separation (synchronous signal-averaging) algorithm. Each waveform is separated into analysis domains using zeros of its slope and curvature. The bases selected in each analysis domain are chosen to minimize the prediction error, and constrained to have the same-sign local slope and curvature as the original signal. The resulting set of bases is used to analyze future-state vibration signals and the lifting prediction error is inspected. The constraints allow the transform to effectively adapt to global amplitude changes, yielding small prediction errors. However, local wave-form changes associated with certain types of gear damage are poorly adapted, causing a significant change in the

  20. Transmissible cancers in an evolutionary context.

    PubMed

    Ujvari, Beata; Papenfuss, Anthony T; Belov, Katherine

    2016-07-01

    Cancer is an evolutionary and ecological process in which complex interactions between tumour cells and their environment share many similarities with organismal evolution. Tumour cells with highest adaptive potential have a selective advantage over less fit cells. Naturally occurring transmissible cancers provide an ideal model system for investigating the evolutionary arms race between cancer cells and their surrounding micro-environment and macro-environment. However, the evolutionary landscapes in which contagious cancers reside have not been subjected to comprehensive investigation. Here, we provide a multifocal analysis of transmissible tumour progression and discuss the selection forces that shape it. We demonstrate that transmissible cancers adapt to both their micro-environment and macro-environment, and evolutionary theories applied to organisms are also relevant to these unique diseases. The three naturally occurring transmissible cancers, canine transmissible venereal tumour (CTVT) and Tasmanian devil facial tumour disease (DFTD) and the recently discovered clam leukaemia, exhibit different evolutionary phases: (i) CTVT, the oldest naturally occurring cell line is remarkably stable; (ii) DFTD exhibits the signs of stepwise cancer evolution; and (iii) clam leukaemia shows genetic instability. While all three contagious cancers carry the signature of ongoing and fairly recent adaptations to selective forces, CTVT appears to have reached an evolutionary stalemate with its host, while DFTD and the clam leukaemia appear to be still at a more dynamic phase of their evolution. Parallel investigation of contagious cancer genomes and transcriptomes and of their micro-environment and macro-environment could shed light on the selective forces shaping tumour development at different time points: during the progressive phase and at the endpoint. A greater understanding of transmissible cancers from an evolutionary ecology perspective will provide novel avenues for

  1. Dynamically prioritized progressive transmission

    NASA Astrophysics Data System (ADS)

    Blanford, Ronald

    1992-04-01

    Retrieval of image data from a centralized database may be subject to bandwidth limitations, whether due to a low-bandwidth communications link or to contention from simultaneous accesses over a high-bandwidth link. Progressive transmission can alleviate this problem by encoding image data so that any prefix of the data stream approximates the complete image at a coarse level of resolution. The longer the prefix, the finer the resolution. In many cases, as little at 1 percent of the image data may be sufficient to decide whether to discard the image, to permit the retrieval to continue, or to restrict retrieval to a subsection of the image. Our approach treats resolution not as a fixed attribute of the image, but rather as a resource which may be allocated to portions of the image at the direction of a user-specified priority function. The default priority function minimizes error by allocating more resolution to regions of high variance. The user may also point to regions of interest requesting priority transmission. More advanced target recognition strategies may be incorporated at the user's discretion. Multispectral imagery is supported. The user engineering implications are profounded. There is immediate response to a query that might otherwise take minutes to complete. The data is transmitted in small increments so that no single user dominates the communications bandwidth. The user-directed improvement means that bandwidth is focused on interesting information. The user may continue working with the first coarse approximations while further image data is still arriving. The algorithm has been implemented in C on Sun, Silicon Graphics, and NeXT workstations, and in Lisp on a Symbolics. Transmission speeds reach as high as 60,000 baud using a Sparc or 68040 processor when storing data to memory; somewhat less if also updating a graphical display. The memory requirements are roughly five bytes per image pixel. Both computational and memory costs may be reduced

  2. Conventional transmission electron microscopy

    PubMed Central

    Winey, Mark; Meehl, Janet B.; O'Toole, Eileen T.; Giddings, Thomas H.

    2014-01-01

    Researchers have used transmission electron microscopy (TEM) to make contributions to cell biology for well over 50 years, and TEM continues to be an important technology in our field. We briefly present for the neophyte the components of a TEM-based study, beginning with sample preparation through imaging of the samples. We point out the limitations of TEM and issues to be considered during experimental design. Advanced electron microscopy techniques are listed as well. Finally, we point potential new users of TEM to resources to help launch their project. PMID:24482357

  3. Frictionless continuously variable transmission

    SciTech Connect

    Korban, J.F.; Korban, N.F.

    1989-07-25

    This patent describes an infinitely variable speed transmission. It comprises: an input shaft; a drive plate having a plurality of radial slots therein, the drive plate fixed to the input shaft; an output shaft parallel to the input shaft; a bevel gear fixed to the output shaft; a plurality if independently rotatable sprocketed pinions freely rotatable about and meshing with the bevel gear. The pinions also engaging the drive plate by projections from the pinions slidably mounted in the radial slots in the drive plate; and clutching means for selectively locking and unlocking the pinions in sequence to effect driving of the bevel gear.

  4. Offset Waveguide Transmission Measurements

    NASA Technical Reports Server (NTRS)

    Cravey, Robin

    1997-01-01

    This report describes measurements to determine transmission losses in S-band (2.60-3.95 GHz) waveguide sections due to misalignment of the sections relative to each other. The experiments were performed in support of the Hydrostar program to determine the feasibility of using deployable waveguide sections in a large space radiometer. The waveguide sections would possibly be hinged and folded for launch, then deployed in space to form long sections of waveguide. Since very low losses are required for radiometer applications, the effects of potential misalignment after deployment of the waveguide sections may be significant. These measurements were performed in the Electromagnetic Properties Measurement Laboratory in the Electromagnetics Research Branch.

  5. Within herd transmission and evaluation of the performance of clinical and serological diagnosis of foot-and-mouth disease in partially immune cattle herds.

    PubMed

    Gonzales, J L; Barrientos, M A; Quiroga, J L; Ardaya, D; Daza, O; Martinez, C; Orozco, C; Crowther, J; Paton, D J

    2014-10-29

    The control of foot-and-mouth disease (FMD) in vaccinated populations relies upon surveillance activities such as clinical inspections (CI) and serological monitoring. New evidence to refine current surveillance guidelines has been provided by evaluating (1) the diagnostic performance of CI and serological tests for detection of FMD virus (FMDV) non-structural proteins (NSP), and (2) the within-herd transmission of the virus in partially immune cattle. Data came from 23 affected herds during an epidemic of FMDV type O in Bolivia, in 2007. All cattle (n=957) in these herds were clinically inspected and serum samples were collected one month after the last animal with clinical signs was detected. Samples were tested for the presence of antibodies against NSP using the PANAFTOSA 3ABC-ELISA test and a subset of samples were tested using the enzyme-linked immunoelectrotransfer blot assay (EITB). Data from clinical and serological diagnoses were analysed using a Bayesian model. The sensitivity Se and specificity Sp of the tests, as well as the prevalence and the within-herd reproduction ratio R of FMDV were estimated. In addition, risk factors for infection were identified. The Se of CI, the 3ABC-ELISA and the EITB tests were estimated to be 0.30, 0.88 and 0.96 respectively. The estimated Sp, in the same order, were 0.88, 0.93 and 0.97. The within-herd prevalence of infected animals ranged from 0.04 to 0.91 and R ranged from 1.02 to 2.68. It was observed that cattle coming from areas with high vaccination coverage had a lower risk of becoming infected than home-bred cattle from the affected herds, where vaccination coverage was thought to be low. Although these estimates come from herds kept under specific conditions, they provide a reference for future surveillance design and can inform simulation models for surveillance and control of FMD in similar cattle populations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. The Born transmission eigenvalue problem

    NASA Astrophysics Data System (ADS)

    Cakoni, Fioralba; Colton, David; Rezac, Jacob D.

    2016-10-01

    In this paper we study the distribution of transmission eigenvalues in the complex plane for obstacles whose contrast is small in magnitude. We use a first order approximation of the refractive index to derive and study an approximate interior transmission problem. In the case of spherically stratified media, we prove existence and discreteness of transmission eigenvalues and derive a condition under which the complex part of transmission eigenvalues cannot lie in a strip parallel to the real axis. For obstacles with general shape, we demonstrate that if transmission eigenvalues exist then they form a discrete set.

  7. Household Transmission of Influenza Virus.

    PubMed

    Tsang, Tim K; Lau, Lincoln L H; Cauchemez, Simon; Cowling, Benjamin J

    2016-02-01

    Human influenza viruses cause regular epidemics and occasional pandemics with a substantial public health burden. Household transmission studies have provided valuable information on the dynamics of influenza transmission. We reviewed published studies and found that once one household member is infected with influenza, the risk of infection in a household contact can be up to 38%, and the delay between onset in index and secondary cases is around 3 days. Younger age was associated with higher susceptibility. In the future, household transmission studies will provide information on transmission dynamics, including the correlation of virus shedding and symptoms with transmission, and the correlation of new measures of immunity with protection against infection.

  8. [Oral transmission of Chagas' disease].

    PubMed

    Toso M, Alberto; Vial U, Felipe; Galanti, Norbel

    2011-02-01

    The traditional transmission pathways of Chagas' disease are vectorial, transfusional, transplacental and organ transplantation. However, oral transmission is gaining importance. The first evidence of oral transmission was reported in Brazil in 1965. Nowadays the oral route is the transmission mode in 50% of cases in the Amazon river zone. Oral infection is produced by the ingestion of infected triatomine bugs or their feces, undercooked meat from infested host animals and food contaminated with urine or anal secretion of infected marsupials. Therefore travelers to those zones should be advised about care to be taken with ingested food. In Chile, this new mode of transmission should be considered in public health policies.

  9. Automated manual transmission clutch controller

    DOEpatents

    Lawrie, Robert E.; Reed, Jr., Richard G.; Rausen, David J.

    1999-11-30

    A powertrain system for a hybrid vehicle. The hybrid vehicle includes a heat engine, such as a diesel engine, and an electric machine, which operates as both an electric motor and an alternator, to power the vehicle. The hybrid vehicle also includes a manual-style transmission configured to operate as an automatic transmission from the perspective of the driver. The engine and the electric machine drive an input shaft which in turn drives an output shaft of the transmission. In addition to driving the transmission, the electric machine regulates the speed of the input shaft in order to synchronize the input shaft during either an upshift or downshift of the transmission by either decreasing or increasing the speed of the input shaft. When decreasing the speed of the input shaft, the electric motor functions as an alternator to produce electrical energy which may be stored by a storage device. Operation of the transmission is controlled by a transmission controller which receives input signals and generates output signals to control shift and clutch motors to effect smooth launch, upshift shifts, and downshifts of the transmission, so that the transmission functions substantially as an automatic transmission from the perspective of the driver, while internally substantially functioning as a manual transmission.

  10. A study of methods of prediction and measurement of the transmission of sound through the walls of light aircraft

    NASA Technical Reports Server (NTRS)

    Forssen, B.; Wang, Y. S.; Raju, P. K.; Crocker, M. J.

    1981-01-01

    The acoustic intensity technique was applied to the sound transmission loss of panel structures (single, composite, and stiffened). A theoretical model of sound transmission through a cylindrical shell is presented.

  11. Colorado Electrical Transmission Grid

    DOE Data Explorer

    Zehner, Richard E.

    2012-02-01

    Citation Information: Originator: Earth Science &Observation Center (ESOC), CIRES, University of Colorado at Boulder Originator: Xcel Energy Publication Date: 2012 Title: Colorado XcelEnergy NonXcel Transmission Network Edition: First Publication Information: Publication Place: Earth Science & Observation Center, Cooperative Institute for Research in Environmental Science (CIRES), University of Colorado, Boulder Publisher: Earth Science &Observation Center (ESOC), CIRES, University of Colorado at Boulder Description: This layer contains transmission network of Colorado Spatial Domain: Extent: Top: 4540689.017558 m Left: 160606.141934 m Right: 758715.946645 m Bottom: 4098910.893397m Contact Information: Contact Organization: Earth Science &Observation Center (ESOC), CIRES, University of Colorado at Boulder Contact Person: Khalid Hussein Address: CIRES, Ekeley Building Earth Science & Observation Center (ESOC) 216 UCB City: Boulder State: CO Postal Code: 80309-0216 Country: USA Contact Telephone: 303-492-6782 Spatial Reference Information: Coordinate System: Universal Transverse Mercator (UTM) WGS’1984 Zone 13N False Easting: 500000.00000000 False Northing: 0.00000000 Central Meridian: -105.00000000 Scale Factor: 0.99960000 Latitude of Origin: 0.00000000 Linear Unit: Meter Datum: World Geodetic System ’1984 (WGS ’1984) Prime Meridian: Greenwich Angular Unit: Degree Digital Form: Format Name: Shapefile

  12. Transmissible encephalopathies in animals.

    PubMed Central

    Kimberlin, R H

    1990-01-01

    Scrapie in sheep and goats is the best known of the transmissible encephalopathies of animals. The combination of maternal transmission of infection and long incubation periods effectively maintains the infection in flocks. A single sheep gene (Sip) controls both experimental and natural scrapie and the discovery of allelic markers could enable the use of sire selection in the control of the natural disease. Studies of experimental rodent scrapie show that neuroinvasion occurs by spread of infection from visceral lymphoreticular tissues along nerve fibers to mid-thoracic cord. The slowness of scrapie is due to restrictions on replication and cell-to-cell spread of infection affecting neuroinvasion and subsequent neuropathogenesis. Probably both stages in mice are controlled by Sinc gene, the murine equivalent of Sip. The glycoprotein PrP may be the normal product of Sinc gene. Posttranslationally modified PrP forms the disease specific "scrapie associated fibrils" and may also be a constituent of the infectious agent. Scrapie-like diseases have been reported in mink and several species of ruminants including cattle. All of them may be caused by the recycling of scrapie infected sheep material in animal feed. The human health implications are discussed. PMID:2407328

  13. Transmission shift mechanism

    SciTech Connect

    Smith, R.R.

    1989-06-20

    This patent describes a mechanism for selecting the gear of an automatic transmission in a vehicle. The mechanism consists of: a pressure source; a gear selection valve having an inlet means for receiving fluid from the pressure source, first outlet ports, and second outlet ports; a manual override means for opening and blocking communication between the pressure source and the first ports and for simultaneously opening and blocking communication between the pressure source and the second outlet ports; a port selector means within the valve for controlling flow through the second ports, the port selector means being movable to a plurality of positions, each position permitting a selected second outlet port to open; a selector control mans for moving the port selector means from one position to another, the selector control means including a planetary gear set connected by an input shaft to the transmission and connected to a vehicle load by an output shaft, the planetary gear set having a ring gear whose angular position is a function of reaction torque imposed by the load on the output shaft, the selector control means further including an arm assembly connected between the ring gear and the port selector means so that the position of the port selector means is a function of the reaction torque on the output shaft.

  14. Simplified power shift transmission

    SciTech Connect

    Michael, R.A.

    1987-04-21

    A multi-speed transmission is described for transferring power between a first shaft and a second shaft, the transmission comprising: a compound planetary assembly including a sun gear, a ring gear concentric with the sun gear, a reaction gear concentric with the ring gear, a planetary gear carrier rotatably supporting first and second sets of planet gears, the first planet gear set intermeshing with the ring gear. The sun gear and the second planet gear set intermesh with the first planet gear set and the reaction gear, means for selectively coupling the first shaft with the sun gear and the reaction gear, and means for selectively preventing rotation of the ring gear, and reaction gear and the planetary carrier; a simple planetary assembly comprising a sun gear component concentric with the sun gear of the compound planetary assembly, a ring gear component concentric with both of the sun gears, and a planetary gear carrier component rotatably supporting a set of planet gears, the planet gear set meshing with the sun gear and the ring gear of the simple planetary.

  15. Automatic transmission structure

    SciTech Connect

    Iwase, Y.; Morisawa, K.

    1987-03-24

    An automatic transmission is described comprising: an output shaft of the transmission including a stepped portion; a parking gear spline-connected with the output shaft on a first side of the stepped portion; a plurality of governor values mounted on a rear side of the parking gear and radially disposed around the output shaft on the first side of the stepped portion; a speed meter drive gear spline-connected with the output shaft on a second side of the stepped portion and on a rear side of the governor valves; and an annular spacer fitted on the output shaft on the second side of the stepped portion between the governor valves and the speed meter drive gear to abut on each of the governor valves and the speed meter drive gear. The annular member is constructed separately from the speed meter drive gear and has an outer diameter larger than an outer diameter of the speed meter drive gear thereby resulting in a contact area between the annular space and the speed meter drive gear which is smaller than a contact area between the annular spacer and the rear side of the governor valves; the drive gear being axially secured relative to the output shaft by a bearing thereby enabling a fixed axial positioning of the annular spacer on the output shaft.

  16. Broadband transmission EPR spectroscopy.

    PubMed

    Hagen, Wilfred R

    2013-01-01

    EPR spectroscopy employs a resonator operating at a single microwave frequency and phase-sensitive detection using modulation of the magnetic field. The X-band spectrometer is the general standard with a frequency in the 9-10 GHz range. Most (bio)molecular EPR spectra are determined by a combination of the frequency-dependent electronic Zeeman interaction and a number of frequency-independent interactions, notably, electron spin - nuclear spin interactions and electron spin - electron spin interactions, and unambiguous analysis requires data collection at different frequencies. Extant and long-standing practice is to use a different spectrometer for each frequency. We explore the alternative of replacing the narrow-band source plus single-mode resonator with a continuously tunable microwave source plus a non-resonant coaxial transmission cell in an unmodulated external field. Our source is an arbitrary wave digital signal generator producing an amplitude-modulated sinusoidal microwave in combination with a broadband amplifier for 0.8-2.7 GHz. Theory is developed for coaxial transmission with EPR detection as a function of cell dimensions and materials. We explore examples of a doublet system, a high-spin system, and an integer-spin system. Long, straigth, helical, and helico-toroidal cells are developed and tested with dilute aqueous solutions of spin label hydroxy-tempo. A detection limit of circa 5 µM HO-tempo in water at 800 MHz is obtained for the present setup, and possibilities for future improvement are discussed.

  17. Transmission shift control assembly

    SciTech Connect

    Dzioba, D.L.

    1989-04-18

    This patent describes a transmission shift control assembly mounted on a steering column having a longitudinal axis comprising: bracket means secured to the steering column; transmission shift cable means having a portion secured to the bracket means and a portion linearly movable relative to the secured portion; mounting means on the bracket cable drive arm means having an axis and being rotatably mounted on the rotary axis on the mounting means oblique to the longitudinal axis and including a cable connecting portion secured to the movable portion of the cable means and lever mounting means adjacent the mounting means; operator control means including lever means, pin means for pivotally mounting the lever means on the lever mounting means on an axis substantially perpendicular to the rotary axis and positioning arm means formed on the lever means and extending from the pin means; and detent gate means disposed on the bracket means in position to abut the positioning arm means for limiting the extent of pivotal movement of the lever means.

  18. Phylogeographic analysis of the 2000-2002 foot-and-mouth disease epidemic in Argentina

    USDA-ARS?s Scientific Manuscript database

    Foot-and-mouth disease (FMD) is a highly transmissible disease of livestock. FMD has been eradicated from many countries and the consequences of FMD epidemics are, in some cases, devastating. That was the case of Argentina in 2000-2002, where within few months, FMD virus spread throughout most of t...

  19. Data Understanding Applied to Optimization

    NASA Technical Reports Server (NTRS)

    Buntine, Wray; Shilman, Michael

    1998-01-01

    The goal of this research is to explore and develop software for supporting visualization and data analysis of search and optimization. Optimization is an ever-present problem in science. The theory of NP-completeness implies that the problems can only be resolved by increasingly smarter problem specific knowledge, possibly for use in some general purpose algorithms. Visualization and data analysis offers an opportunity to accelerate our understanding of key computational bottlenecks in optimization and to automatically tune aspects of the computation for specific problems. We will prototype systems to demonstrate how data understanding can be successfully applied to problems characteristic of NASA's key science optimization tasks, such as central tasks for parallel processing, spacecraft scheduling, and data transmission from a remote satellite.

  20. Analysis of planetary gear transmission in non-stationary operations

    NASA Astrophysics Data System (ADS)

    Chaari, Fakher; Abbes, Mohamed Slim; Rueda, Fernando Viadero; del Rincon, Alfonso Fernandez; Haddar, Mohamed

    2013-03-01

    Planetary gearboxes operate usually in nonstationary conditions generated mainly by variable loads applied to these transmissions. In order to understand the dynamic behavior of planetary gearboxes in such conditions, a mathematic model is developed including driving unit, transmission and load. The variability of load induces a variable speed of the transmission which is taken into account when characterizing the main dynamic parameter of the transmission which is the mesh stiffness function. This function is not periodic following the variability of the transmission speed. The computation of the dynamic response shows an intimate relation between the vibration amplitude level and the load value. As the load increase the vibration level increase. A combined amplitude and frequency modulation is observed which is well characterized using Short Time Fourier transform more suited than the spectral analysis.

  1. Small passenger car transmission test: Mercury Lynx ATX transmission

    SciTech Connect

    Bujold, M P

    1981-09-01

    The small passenger car transmission test was initiated to supply electric vehicle manufacturers with technical information regarding the performance of commercially available transmissions. This information would enable EV manufacturers to design a more energy efficient vehicle. With this information the manufacturers would be able to estimate vehicle driving range as well as speed and torque requirements for specific road load performance characteristics. This report covers the 1981 Mercury Lynx ATX transaxle. This transmission was tested per a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions the transmission attained maximum efficiencies in the 93% range for drive performance tests. The major results of this test are the torque, speed and efficiency curves which are located in the data section of this report. These graphs map performance characteristics for the Mercury Lynx ATX transmission.

  2. Small passenger car transmission test-Chevrolet 200 transmission

    NASA Technical Reports Server (NTRS)

    Bujold, M. P.

    1980-01-01

    The small passenger car transmission was tested to supply electric vehicle manufacturers with technical information regarding the performance of commerically available transmissions which would enable them to design a more energy efficient vehicle. With this information the manufacturers could estimate vehicle driving range as well as speed and torque requirements for specific road load performance characteristics. A 1979 Chevrolet Model 200 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. The transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. Torque, speed and efficiency curves map the complete performance characteristics for Chevrolet Model 200 transmission.

  3. Efficiency testing of a helicopter transmission planetary reduction stage

    NASA Technical Reports Server (NTRS)

    Handschuh, R. F.; Rohn, D. A.

    1989-01-01

    A parametric study of the efficiency of a 310-kW (420-hp) helicopter transmission planetary test section (four planets) was performed. The purpose was to determine the planetary contribution to the overall transmission power loss. Test parameters varied were oil flow rate, oil inlet temperature, lubricant type, shaft speed, and applied torque. The measured efficiency over all the test variables ranged from 99.44 to 99.75 percent. These experimental results were compared with other experimental and computational results.

  4. Efficiency testing of a helicopter transmission planetary reduction stage

    NASA Technical Reports Server (NTRS)

    Handschuh, Robert F.; Rohn, Douglas A.

    1988-01-01

    A parametric study of the efficiency of a 310-kW (420-hp) helicopter transmission planetary test section (four planets) was performed. The purpose was to determine the planetary contribution to the overall transmission power loss. Test parameters varied were oil flow rate, oil inlet temperature, lubricant type, shaft speed, and applied torque. The measured efficiency over all the test variables ranged from 99.44 to 99.75 percent. These experimental results were compared with other experimental and computational results.

  5. The automated command transmission

    NASA Astrophysics Data System (ADS)

    Inoue, Y.; Satoh, S.

    A technique for automated command transmission (ACT) to GEO-stationed satellites is presented. The system is intended for easing the command center workload. The ACT system determines the relation of the commands to on-board units, connects the telemetry with on-board units, defines the control path on the spacecraft, identifies the correspondence of back-up units to primary units, and ascertains sunlight or eclipse conditions. The system also has the address of satellite and command decoders, the ID and content for the mission command sequence, group and inhibit codes, a listing of all available commands, and restricts the data to a command sequence. Telemetry supplies data for automated problem correction. All other missions operations are terminated during system recovery data processing after a crash. The ACT system is intended for use with the GMS spacecraft.

  6. Television Transmission Technology

    NASA Technical Reports Server (NTRS)

    1996-01-01

    The VKP-7990 Multistage Depressed Collector (MDC) Klystron is a result of cooperative development by Varian Associates, Inc., the National Association of Broadcasters, Lewis Research Center, the Public Broadcasting System and TV transmitter manufacturers. The effort was initiated to make power amplifying devices with efficiencies comparable to VHF available to UHF operators. The klystron is a vacuum tube used to generate and amplify ultrahigh frequencies but at low efficiencies because most of the energy is dissipated as waste heat. Lewis had earlier developed the MDC to enhance the efficiency of communications satellite transmissions. Varian Microwave Power Tube Products, which has since become Communications and Power Industries, and Lewis combined the MDC and the klystron, resulting in a product which increases efficiency by recovering some of the residual energy that normally would be lost as heat. The MDC klystron cuts the electric power consumption of UHF-TV transmitters in half; there are 90 units in operation in 36 UHF-TV stations.

  7. Transmission seal development

    NASA Technical Reports Server (NTRS)

    Brien, M.

    1977-01-01

    An experimental evaluation was performed on a high-speed (72.9 m/s, 14,349 ft/min) transmission seal of the synergistic type. During testing of the seal, oil leakage occurred at positive bearing cavity pressures. Modifications were made in an attempt to eliminate the leakage but none were completely successful. Leakage appears to be the result of questionable positioning of the sealing elements resulting in inadequate shaft contact by the oil side sealing element. This condition may be related to the nonsymmetrical shape of the elastomeric retainer and to dimensional changes caused by swelling of the elastomeric retainer from exposure to the sealed fluid. Indications of a speed dependent leakage characteristic were also observed.

  8. Astrocytes Potentiate Synaptic Transmission

    NASA Astrophysics Data System (ADS)

    Nadkarni, Suhita

    2005-03-01

    A recent experimental study shows that astrocytes, a subtype of glia, are able to influence the spontaneous activity in the brain via calcium dependent glutamate release. We model the coupling mechanism between an astrocyte and a neuron based on experimental data. This coupling is dynamic and bi-directional, such that the modulations in intracellular calcium concentrations in astrocytes affect neuronal excitability and vice versa via a glutamatergic pathway. We demonstrate through simple neural-glial circuits that increases in the intracellular calcium concentration in astrocytes nearby can enhance spontaneous activity in a neuron, a significant mechanism said to be involved in plasticity and learning. The pattern of this marked increase in spontaneous firing rate in our model quantitatively follows that observed in the experiment. Further, depending on the type of synaptic connections diverging from the neuron, it can either inhibit or excite the ensuing dynamics and potentiate synaptic transmission, thus reinstating the integral role played by astrocytes in normal neuronal dynamics.

  9. Flywheel electric transmission apparatus

    SciTech Connect

    Bock, D.H.

    1982-01-05

    In a preferred embodiment, the flywheel electric transmission system is made up of three electric machines and a flywheel and is adapted for use in an automobile. The first electric machine is driven or energized by a prime mover such as a heat engine and is selectively clutched to the second machine. The flywheel and the armatures for both the first and second machines rotate as a unit. The third machine is connected to the second machine through gearing and, under the control of a computer, supplies excess electrical power to or consumes excess electrical power from the first and second machines that are functioning as either a motor or generator as required. In a second embodiment, the energy source is a battery pack.

  10. Liquid Cell Transmission Electron Microscopy.

    PubMed

    Liao, Hong-Gang; Zheng, Haimei

    2016-05-27

    Liquid cell transmission electron microscopy (TEM) has attracted significant interest in recent years. With nanofabricated liquid cells, it has been possible to image through liquids using TEM with subnanometer resolution, and many previously unseen materials dynamics have been revealed. Liquid cell TEM has been applied to many areas of research, ranging from chemistry to physics, materials science, and biology. So far, topics of study include nanoparticle growth and assembly, electrochemical deposition and lithiation for batteries, tracking and manipulation of nanoparticles, catalysis, and imaging of biological materials. In this article, we first review the development of liquid cell TEM and then highlight progress in various areas of research. In the study of nanoparticle growth, the electron beam can serve both as the illumination source for imaging and as the input energy for reactions. However, many other research topics require the control of electron beam effects to minimize electron beam damage. We discuss efforts to understand electron beam-liquid matter interactions. Finally, we provide a perspective on future challenges and opportunities in liquid cell TEM.

  11. Stress Transmission within the Cell

    PubMed Central

    Stamenović, Dimitrije; Wang, Ning

    2014-01-01

    An outstanding problem in cell biology is how cells sense mechanical forces and how those forces affect cellular functions. During past decades, it has become evident that the deformable cytoskeleton (CSK), an intracellular network of various filamentous biopolymers, provides a physical basis for transducing mechanical signals into biochemical responses. To understand how mechanical forces regulate cellular functions, it is necessary to first understand how the CSK develops mechanical stresses in response to applied forces, and how those stresses are propagated through the CSK where various signaling molecules are immobilized. New experimental techniques have been developed to quantify cytoskeletal mechanics, which together with new computational approaches have given rise to new theories and models for describing mechanics of living cells. In this article, we discuss current understanding of cell biomechanics by focusing on the biophysical mechanisms that are responsible for the development and transmission of mechanical stresses in the cell and their effect on cellular functions. We compare and contrast various theories and models of cytoskeletal mechanics, emphasizing common mechanisms that those theories are built upon, while not ignoring irreconcilable differences. We highlight most recent advances in the understanding of mechanotransduction in the cytoplasm of living cells and the central role of the cytoskeletal prestress in propagating mechanical forces along the cytoskeletal filaments to activate cytoplasmic enzymes. It is anticipated that advances in cell mechanics will help developing novel therapeutics to treat pulmonary diseases like asthma, pulmonary fibrosis, and chronic obstructive pulmonary disease. PMID:23737186

  12. Liquid Cell Transmission Electron Microscopy

    NASA Astrophysics Data System (ADS)

    Liao, Hong-Gang; Zheng, Haimei

    2016-05-01

    Liquid cell transmission electron microscopy (TEM) has attracted significant interest in recent years. With nanofabricated liquid cells, it has been possible to image through liquids using TEM with subnanometer resolution, and many previously unseen materials dynamics have been revealed. Liquid cell TEM has been applied to many areas of research, ranging from chemistry to physics, materials science, and biology. So far, topics of study include nanoparticle growth and assembly, electrochemical deposition and lithiation for batteries, tracking and manipulation of nanoparticles, catalysis, and imaging of biological materials. In this article, we first review the development of liquid cell TEM and then highlight progress in various areas of research. In the study of nanoparticle growth, the electron beam can serve both as the illumination source for imaging and as the input energy for reactions. However, many other research topics require the control of electron beam effects to minimize electron beam damage. We discuss efforts to understand electron beam-liquid matter interactions. Finally, we provide a perspective on future challenges and opportunities in liquid cell TEM.

  13. Stress transmission within the cell.

    PubMed

    Stamenović, Dimitrije; Wang, Ning

    2011-01-01

    An outstanding problem in cell biology is how cells sense mechanical forces and how those forces affect cellular functions. During past decades, it has become evident that the deformable cytoskeleton (CSK), an intracellular network of various filamentous biopolymers, provides a physical basis for transducing mechanical signals into biochemical responses. To understand how mechanical forces regulate cellular functions, it is necessary to first understand how the CSK develops mechanical stresses in response to applied forces, and how those stresses are propagated through the CSK where various signaling molecules are immobilized. New experimental techniques have been developed to quantify cytoskeletal mechanics, which together with new computational approaches have given rise to new theories and models for describing mechanics of living cells. In this article, we discuss current understanding of cell biomechanics by focusing on the biophysical mechanisms that are responsible for the development and transmission of mechanical stresses in the cell and their effect on cellular functions. We compare and contrast various theories and models of cytoskeletal mechanics, emphasizing common mechanisms that those theories are built upon, while not ignoring irreconcilable differences. We highlight most recent advances in the understanding of mechanotransduction in the cytoplasm of living cells and the central role of the cytoskeletal prestress in propagating mechanical forces along the cytoskeletal filaments to activate cytoplasmic enzymes. It is anticipated that advances in cell mechanics will help developing novel therapeutics to treat pulmonary diseases like asthma, pulmonary fibrosis, and chronic obstructive pulmonary disease. © 2011 American Physiological Society.

  14. Statistical Inference of Biometrical Genetic Model With Cultural Transmission.

    PubMed

    Guo, Xiaobo; Ji, Tian; Wang, Xueqin; Zhang, Heping; Zhong, Shouqiang

    2013-01-01

    Twin and family studies establish the foundation for studying the genetic, environmental and cultural transmission effects for phenotypes. In this work, we make use of the well established statistical methods and theory for mixed models to assess cultural transmission in twin and family studies. Specifically, we address two critical yet poorly understood issues: the model identifiability in assessing cultural transmission for twin and family data and the biases in the estimates when sub-models are used. We apply our models and theory to two real data sets. A simulation is conducted to verify the bias in the estimates of genetic effects when the working model is a sub-model.

  15. Broadband Transmission EPR Spectroscopy

    PubMed Central

    Hagen, Wilfred R.

    2013-01-01

    EPR spectroscopy employs a resonator operating at a single microwave frequency and phase-sensitive detection using modulation of the magnetic field. The X-band spectrometer is the general standard with a frequency in the 9–10 GHz range. Most (bio)molecular EPR spectra are determined by a combination of the frequency-dependent electronic Zeeman interaction and a number of frequency-independent interactions, notably, electron spin – nuclear spin interactions and electron spin – electron spin interactions, and unambiguous analysis requires data collection at different frequencies. Extant and long-standing practice is to use a different spectrometer for each frequency. We explore the alternative of replacing the narrow-band source plus single-mode resonator with a continuously tunable microwave source plus a non-resonant coaxial transmission cell in an unmodulated external field. Our source is an arbitrary wave digital signal generator producing an amplitude-modulated sinusoidal microwave in combination with a broadband amplifier for 0.8–2.7 GHz. Theory is developed for coaxial transmission with EPR detection as a function of cell dimensions and materials. We explore examples of a doublet system, a high-spin system, and an integer-spin system. Long, straigth, helical, and helico-toroidal cells are developed and tested with dilute aqueous solutions of spin label hydroxy-tempo. A detection limit of circa 5 µM HO-tempo in water at 800 MHz is obtained for the present setup, and possibilities for future improvement are discussed. PMID:23555819

  16. Technology of optical azimuth transmission

    NASA Astrophysics Data System (ADS)

    Lu, Honggang; Hu, Chunsheng; Wang, Xingshu; Gao, Yang

    2012-11-01

    It often needs transfer a reference from one place to another place in aerospace and guided missile launching. At first, principles of several typical optical azimuth transmission methods are presented. Several typical methods are introduced, such as Theodolite (including gyro-theodolite) collimation method, Camera series method, Optical apparatus for azimuth method and polarization modulated light transmission method. For these typical azimuth transmission methods, their essential theories are elaborated. Then the devices, the application fields and limitations of these typical methods' are presented. Theodolite (including gyro-theodolite) collimation method is used in the ground assembly of spacecraft. Camera series method and optical apparatus for azimuth method are used in azimuth transmission between different decks of ship. Polarization modulated light transmission method is used in azimuth transmission of rocket and guided missile. At the last, the further developments of these methods are discussed.

  17. Dielectric Nonlinear Transmission Line (Postprint)

    DTIC Science & Technology

    2011-12-01

    Technical Paper 3. DATES COVERED (From - To) 2011 4. TITLE AND SUBTITLE Dielectric Nonlinear Transmission Line (POSTPRINT) 5a. CONTRACT NUMBER...14. ABSTRACT A parallel plate nonlinear transmission line (NLTL) was constructed. Periodic loading of nonlinear dielectric slabs provides the...846-9101 Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. 239.18 Dielectric Nonlinear Transmission Line David M. French, Brad W. Hoff

  18. Climate and Dengue Transmission: Evidence and Implications

    PubMed Central

    Comrie, Andrew C.; Ernst, Kacey

    2013-01-01

    Background: Climate influences dengue ecology by affecting vector dynamics, agent development, and mosquito/human interactions. Although these relationships are known, the impact climate change will have on transmission is unclear. Climate-driven statistical and process-based models are being used to refine our knowledge of these relationships and predict the effects of projected climate change on dengue fever occurrence, but results have been inconsistent. Objective: We sought to identify major climatic influences on dengue virus ecology and to evaluate the ability of climate-based dengue models to describe associations between climate and dengue, simulate outbreaks, and project the impacts of climate change. Methods: We reviewed the evidence for direct and indirect relationships between climate and dengue generated from laboratory studies, field studies, and statistical analyses of associations between vectors, dengue fever incidence, and climate conditions. We assessed the potential contribution of climate-driven, process-based dengue models and provide suggestions to improve their performance. Results and Discussion: Relationships between climate variables and factors that influence dengue transmission are complex. A climate variable may increase dengue transmission potential through one aspect of the system while simultaneously decreasing transmission potential through another. This complexity may at least partly explain inconsistencies in statistical associations between dengue and climate. Process-based models can account for the complex dynamics but often omit important aspects of dengue ecology, notably virus development and host–species interactions. Conclusion: Synthesizing and applying current knowledge of climatic effects on all aspects of dengue virus ecology will help direct future research and enable better projections of climate change effects on dengue incidence. Citation: Morin CW, Comrie AC, Ernst KC. 2013. Climate and dengue transmission

  19. Multi-speed powershift transmission

    SciTech Connect

    Horsch, J.

    1989-08-22

    This patent describes a multi-speed powershift transmission for connection to a driven power shift. The transmission comprising: a speed transmission assembly including a speed input section connectable to the power shaft for selectively producing either of at least two forward input speed ratios having a relatively small speed ratio differential therebetween; a speed output section for selectively producing any one of at least three equally different forward output speed ratios and at least one reverse speed ratio. The input section comprising a pair of clutch operated drive gears mounted on a speed input shaft and hydraulically actuated in an alternative manner. The output section comprising a plurality of driven gears including a reverse gear mounted on a common speed output shaft, each driven gear having a hydraulically actuated clutch for connecting a selected driven gear to the speed output shaft; and a cluster gear assembly interconnecting the input and output section. The cluster gear assembly being selectively driven by either of the clutch operated drive gears, and a range transmission assembly for selectively producing any one of at least three equally different forward speed ranges. The range transmission assembly including a range input shaft which is operably coupled to the speed output shaft of the speed transmission assembly, a transmission output shaft, and a plurality of hydraulic clutch actuated gears interposed between the range input shaft and the transmissions output shaft and a master clutch assembly selectively interconnecting the speed and range transmission assemblies.

  20. Airborne transmission of Bordetella pertussis.

    PubMed

    Warfel, Jason M; Beren, Joel; Merkel, Tod J

    2012-09-15

    Pertussis is a contagious, acute respiratory illness caused by the bacterial pathogen Bordetella pertussis. Although it is widely believed that transmission of B. pertussis occurs via aerosolized respiratory droplets, no controlled study has ever documented airborne transmission of pertussis. We set out to determine if airborne transmission occurs between infected and naive animals, utilizing the baboon model of pertussis. Our results showed that 100% of exposed naive animals became infected even when physical contact was prevented, demonstrating that pertussis transmission occurs via aerosolized respiratory droplets.

  1. Networks and the ecology of parasite transmission: A framework for wildlife parasitology☆

    PubMed Central

    Godfrey, Stephanie S.

    2013-01-01

    Social network analysis has recently emerged as a popular tool for understanding disease transmission in host populations. Although social networks have most extensively been applied to modelling the transmission of diseases through human populations, more recently the method has been applied to wildlife populations. The majority of examples from wildlife involve modelling the transmission of contagious microbes (mainly viruses and bacteria), normally in context of understanding wildlife disease epidemics. However, a growing number of studies have used networks to explore the ecology of parasite transmission in wildlife populations for a range of endemic parasites representing a diversity of life cycles and transmission methods. This review addresses the application of network models in representing the transmission of parasites with more complex life cycles, and illustrates the way in which this approach can be used to answer ecological questions about the transmission of parasites in wildlife populations. PMID:24533342

  2. Transmissive Microshutter Arrays

    NASA Astrophysics Data System (ADS)

    Kutyrev, A. S.; Moseley, H. S.; Fettig, R. K.; Kuhn, J. L.; Woodgate, B. E.; Kimble, R. A.; Orloff, J. H.

    1999-12-01

    We report further progress on the development of a two-dimensional array of microshutters, which can be used as a high efficiency, high contrast field selection device for a multi-object spectrometer for the Next Generation Space Telescope (NGST). The device is a close packed array of shutters, with a typical size of 100 microns square and an area filling factor of up to 80%. Each shutter, made of single crystal silicon or silicon nitride with an appropriate optical coating, pivots on a torsion flexure along one edge. Each of the shutters is individually selectable. Although these devices can be used as reflection devices, their primary mode of operation is in transmission, which provides the minimum possible level of scattered light. An original double-shutter mechanism is employed for actuation. Small shutter arrays have been built using a Focus Ion Beam milling machine is a 3 x 3 double shutter actuation with a micro-manipulator under electron microscope observation has been demonstrated. An important aspect of this study has been to demonstrate the reliability of the structures over its expected lifetime. We analyzed stiffness, strength and fatigue issues of two good candidate materials, single crystal silicon and silicon nitride. Both appear to be suitable from the mechanical point of view. This project is supported by NASA grants.

  3. Transmission of digital data

    USGS Publications Warehouse

    Showen, Charles R.

    1971-01-01

    The Geological Survey, Water Resources Division, established a pilot project to evaluate equipment that would transmit date recorded on 16-channel paper tapes over voice-grade telephone lines from field offices to the Washington, D.C., Automatic Data Processing Unit (A.D.P. Unit). Such equipment would allow computer-processed data for current-purpose hydrologic data stations to be made available in a more timely manner. The specifications for the equipment were prepared in March 1970; invitations to bid were solicited, a contract was awarded and the equipment was delivered in November 1970. The equipment included two reader/transmitter units, and one receiver/recorder unit. The reader/transmitter units transmit manually entered fixed information, i.e. station number, beginning date and time, and ending date and time, and photoelectrically read and transmit the 16-channel paper tape data. The receiver/recorder unit records the transmitted information on IBM-compatible magnetic tape. This report summarizes the information gained from a year of pilot operation of the equipment, with and without a computer terminal at the field level, and makes recommendations for establishing a data-transmission system in the Water Resources Division.

  4. Multi-speed transmission

    SciTech Connect

    Ashikawa, N.; Nakayama, H.; Sumi, M.

    1986-12-02

    This patent describes a multi-speed transmission having forward speed gear trains and at least one reverse speed gear train, comprising, a pair of parallel fork shafts, one the shaft being fixed, the other the shaft being slidable along its axial direction, means to selectively engage the gear trains and means to retain the selective engagement means in the selected position. The means selectively engages the gear trains including a first shift fork connected to the fixed fork shaft so as to slide to either side of its disengaged neutral position, a second shift fork connected to the slideable fork shaft so as to slide to either side of its disengaged neutral position, and a third shift fork connected to the slidable fork shaft so as to slide in one direction by motion of the slideable fork shaft to only one side of its disengaged neutral position. Also included is a reverse shift fork connected to the slideable fork shaft and adapted to be actuated by motion of the slideable fork shaft in a direction opposite to the direction of the motion which engages the third shift fork.

  5. EC Transmission Line Materials

    SciTech Connect

    Bigelow, Tim S

    2012-05-01

    The purpose of this document is to identify materials acceptable for use in the US ITER Project Office (USIPO)-supplied components for the ITER Electron cyclotron Heating and Current Drive (ECH&CD) transmission lines (TL), PBS-52. The source of material property information for design analysis shall be either the applicable structural code or the ITER Material Properties Handbook. In the case of conflict, the ITER Material Properties Handbook shall take precedence. Materials selection, and use, shall follow the guidelines established in the Materials Assessment Report (MAR). Materials exposed to vacuum shall conform to the ITER Vacuum Handbook. [Ref. 2] Commercial materials shall conform to the applicable standard (e.g., ASTM, JIS, DIN) for the definition of their grade, physical, chemical and electrical properties and related testing. All materials for which a suitable certification from the supplier is not available shall be tested to determine the relevant properties, as part of the procurement. A complete traceability of all the materials including welding materials shall be provided. Halogenated materials (example: insulating materials) shall be forbidden in areas served by the detritiation systems. Exceptions must be approved by the Tritium System and Safety Section Responsible Officers.

  6. Virus transmission via food.

    PubMed

    Cliver, D O

    1997-01-01

    Viruses are transmitted to humans via foods as a result of direct or indirect contamination of the foods with human faeces. Viruses transmitted by a faecal-oral route are not strongly dependent on foods as vehicles of transmission, but viruses are important among agents of foodborne disease. Vehicles are most often molluscs from contaminated waters, but many other foods are contaminated directly by infected persons. The viruses most often foodborne are the hepatitis A virus and the Norwalk-like gastroenteritis viruses. Detection methods for these viruses in foods are very difficult and costly; the methods are not routine. Indicators that would rapidly and reliably suggest the presence of viral contamination of foods are still being sought. Contamination can be prevented by keeping faeces out of food or by treating vehicles such as water in order to inactivate virus that might be carried to food in this way. Virus cannot multiply in food, but can usually be inactivated by adequate heating. Other methods of inactivating viruses within a food are relatively unreliable, but viruses in water and on exposed surfaces can be inactivated with ultraviolet light or with strong oxidizing agents.

  7. Transmission diamond imaging detector

    SciTech Connect

    Smedley, John Pinelli, Don; Gaoweia, Mengjia; Muller, Erik; Ding, Wenxiang; Zhou, Tianyi; Bohon, Jen

    2016-07-27

    Many modern synchrotron techniques are trending toward use of high flux beams and/or beams which require enhanced stability and precise understanding of beam position and intensity from the front end of the beamline all the way to the sample. For high flux beams, major challenges include heat load management in optics (including the vacuum windows) and a mechanism of real-time volumetric measurement of beam properties such as flux, position, and morphology. For beam stability in these environments, feedback from such measurements directly to control systems for optical elements or to sample positioning stages would be invaluable. To address these challenges, we are developing diamond-based instrumented vacuum windows with integrated volumetric x-ray intensity, beam profile and beam-position monitoring capabilities. A 50 µm thick single crystal diamond has been lithographically patterned to produce 60 µm pixels, creating a >1kilopixel free-standing transmission imaging detector. This device, coupled with a custom, FPGA-based readout, has been used to image both white and monochromatic x-ray beams and capture the last x-ray photons at the National Synchrotron Light Source (NSLS). This technology will form the basis for the instrumented end-station window of the x-ray footprinting beamline (XFP) at NSLS-II.

  8. Electronically controlled automatic transmission

    SciTech Connect

    Ohkubo, M.; Shiba, H.; Nakamura, K.

    1989-03-28

    This patent describes an electronically controlled automatic transmission having a manual valve working in connection with a manual shift lever, shift valves operated by solenoid valves which are driven by an electronic control circuit previously memorizing shift patterns, and a hydraulic circuit controlled by these manual valve and shift valves for driving brakes and a clutch in order to change speed. Shift patterns of 2-range and L-range, in addition to a shift pattern of D-range, are memorized previously in the electronic control circuit, an operation switch is provided which changes the shift pattern of the electronic control circuit to any shift pattern among those of D-range, 2-range and L-range at time of the manual shift lever being in a D-range position, a releasable lock mechanism is provided which prevents the manual shift lever from entering 2-range and L-range positions, and the hydraulic circuit is set to a third speed mode when the manual shift lever is in the D-range position. The circuit is set to a second speed mode when it is in the 2-range position, and the circuit is set to a first speed mode when it is in the L-range position, respectively, in case where the shift valves are not working.

  9. Aerosol transmission is an important mode of influenza A virus spread

    PubMed Central

    Cowling, Benjamin J.; Ip, Dennis K. M.; Fang, Vicky J.; Suntarattiwong, Piyarat; Olsen, Sonja J.; Levy, Jens; Uyeki, Timothy M.; Leung, Gabriel M.; Malik Peiris, J. S.; Chotpitayasunondh, Tawee; Nishiura, Hiroshi; Simmerman, J. Mark

    2013-01-01

    Influenza A viruses are believed to spread between humans through contact, large respiratory droplets and small particle droplet nuclei (aerosols), but the relative importance of each of these modes of transmission is unclear. Volunteer studies suggest that infections via aerosol transmission may have a higher risk of febrile illness. Here we apply a mathematical model to data from randomized controlled trials of hand hygiene and surgical face masks in Hong Kong and Bangkok households. In these particular environments, inferences on the relative importance of modes of transmission are facilitated by information on the timing of secondary infections and apparent differences in clinical presentation of secondary infections resulting from aerosol transmission. We find that aerosol transmission accounts for approximately half of all transmission events. This implies that measures to reduce transmission by contact or large droplets may not be sufficient to control influenza A virus transmission in households. PMID:23736803

  10. Bovine Tuberculosis Risk Factors for British Herds Before and After the 2001 Foot-and-Mouth Epidemic: What have we Learned from the TB99 and CCS2005 Studies?

    PubMed

    Vial, F; Miguel, E; Johnston, W T; Mitchell, A; Donnelly, C A

    2015-10-01

    Over the last couple of decades, the UK experienced a substantial increase in the incidence and geographical spread of bovine tuberculosis (TB), in particular since the epidemic of foot-and-mouth disease (FMD) in 2001. The initiation of the Randomized Badger Culling Trial (RBCT) in 1998 in south-west England provided an opportunity for an in-depth collection of questionnaire data (covering farming practices, herd management and husbandry, trading and wildlife activity) from herds having experienced a TB breakdown between 1998 and early 2006 and randomly selected control herds, both within and outside the RBCT (the so-called TB99 and CCS2005 case-control studies). The data collated were split into four separate and comparable substudies related to either the pre-FMD or post-FMD period, which are brought together and discussed here for the first time. The findings suggest that the risk factors associated with TB breakdowns may have changed. Higher Mycobacterium bovis prevalence in badgers following the FMD epidemic may have contributed to the identification of the presence of badgers on a farm as a prominent TB risk factor only post-FMD. The strong emergence of contact/trading TB risk factors post-FMD suggests that the purchasing and movement of cattle, which took place to restock FMD-affected areas after 2001, may have exacerbated the TB problem. Post-FMD analyses also highlighted the potential impact of environmental factors on TB risk. Although no unique and universal solution exists to reduce the transmission of TB to and among British cattle, there is an evidence to suggest that applying the broad principles of biosecurity on farms reduces the risk of infection. However, with trading remaining as an important route of local and long-distance TB transmission, improvements in the detection of infected animals during pre- and post-movement testing should further reduce the geographical spread of the disease.

  11. Direct current power transmission systems

    SciTech Connect

    Padiyar, K.R.

    1991-01-01

    This book represents text on HVDC transmission available. It deals with the various aspects of the state of the art in HVDC transmission technology. This book presents many aspects of interactions of AC/DC systems. Modeling and analysis of DC systems are also discussed in detail.

  12. Hendra virus ecology and transmission.

    PubMed

    Field, Hume E

    2016-02-01

    Hendra virus causes acute and highly fatal infection in horses and humans. Pteropid bats (flying-foxes) are the natural host of the virus, with age and species being risk factors for infection. Urine is the primary route of excretion in flying-foxes, with viral RNA more frequently detected in Pteropus alecto and P. conspicillatus than other species. Infection prevalence in flying-foxes can vary between and within years, with a winter peak of excretion occurring in some regions. Vertical transmission and recrudescing infection has been reported in flying-foxes, but horizontal transmission is evidently the primary mode of transmission. The most parsimonious mode of flying-fox to horse transmission is equine contact (oro-nasal, conjunctival) with infected flying-fox urine, either directly, or via urine-contaminated pasture or surfaces. Horse to horse transmission is inefficient, requiring direct contact with infected body fluids. Flying-fox to human transmission has not been recorded; all human cases have been associated with close and direct contact with infected horses. Canine cases (subclinical) have also been limited to equine case properties. Notwithstanding the recent availability of an effective vaccine for horses, a comprehensive understanding of Hendra virus ecology and transmission is essential to limit inter-species transmission.

  13. A Quantitative Transmission Line Experiment

    ERIC Educational Resources Information Center

    Johnston, D. C.; Silbernagel, B. G.

    1969-01-01

    Describes modifications of a commercially available strip-type transmission line, which makes possible reproducible measurements of standing waves on the line. Experimental data yield values for the characteristic impedance, phase velocity and line wavelength of radiation in the transmission line, and the dielectric constant of material in the…

  14. Automatic transmission for motor vehicles

    SciTech Connect

    Miura, M.; Sakakibara, S.

    1989-06-27

    An automatic transmission for a motor vehicle is described, comprising: a transmission housing; a hydraulic torque converter having rotational axes, an input shaft, an output shaft and a direct coupling clutch for directly coupling the input shaft to the output shaft; an auxiliary transmission mechanism provided coaxially with the hydraulic torque converter and having an input shaft, an output shaft with an input end and an output end and an overdrive mechanism of planetary gear type having a reduction ratio smaller than 1, the input shaft and the output shaft of the auxiliary transmission being located close to and on the side of the hydraulic torque converter with respect to the auxiliary transmission, respectively, and being coupled with a planetary gear carrier and a ring gear of the overdrive mechanism, respectively, a one-way clutch being provided between the planetary gear carrier and a sun gear of the overdrive mechanism, a clutch being provided between the planetary gear carrier and a position radially and outwardly of the one-way clutch for engaging the disengaging the planetary carrier and the sun gear, a brake being provided between the transmission housing and the sun gear and positioned radially and outwardly of the clutch for controlling engagement of the sun gear with a stationary portion of the transmission housing, and the output end of the output shaft being disposed between the auxiliary transmission mechanism and the hydraulic torque converter.

  15. A Quantitative Transmission Line Experiment

    ERIC Educational Resources Information Center

    Johnston, D. C.; Silbernagel, B. G.

    1969-01-01

    Describes modifications of a commercially available strip-type transmission line, which makes possible reproducible measurements of standing waves on the line. Experimental data yield values for the characteristic impedance, phase velocity and line wavelength of radiation in the transmission line, and the dielectric constant of material in the…

  16. Results of NASA/Army transmission research

    NASA Technical Reports Server (NTRS)

    Coy, John J.; Townsend, Dennis P.; Coe, Harold H.

    1988-01-01

    Since 1970 the NASA Lewis Research Center and the U.S. Army Aviation Systems Command have shared an interest in advancing the technology for helicopter propulsion systems. In particular, that portion of the program that applies to the drive train and its various mechanical components are outlined. The major goals of the program were (and continue to be) to increase the life, reliability, and maintainability, reduce the weight, noise, and vibration, and maintain the relatively high mechanical efficiency of the gear train. Major historical milestones are reviewed, significant advances in technology for bearings, gears, and transmissions are discussed, and the outlook for the future is presented. The reference list is comprehensive.

  17. Sound transmission reduction with intelligent panel systems

    NASA Technical Reports Server (NTRS)

    Fuller, Chris R.; Clark, Robert L.

    1992-01-01

    Experimental and theoretical investigations are performed of the use of intelligent panel systems to control the sound transmission and radiation. An intelligent structure is defined as a structural system with integrated actuators and sensors under the guidance of an adaptive, learning type controller. The system configuration is based on the Active Structural Acoustic Control (ASAC) concept where control inputs are applied directly to the structure to minimize an error quantity related to the radiated sound field. In this case multiple piezoelectric elements are employed as sensors. The importance of optimal shape and location is demonstrated to be of the same order of influence as increasing the number of channels of control.

  18. Does horizontal transmission invalidate cultural phylogenies?

    PubMed Central

    Greenhill, Simon J.; Currie, Thomas E.; Gray, Russell D.

    2009-01-01

    Phylogenetic methods have recently been applied to studies of cultural evolution. However, it has been claimed that the large amount of horizontal transmission that sometimes occurs between cultural groups invalidates the use of these methods. Here, we use a natural model of linguistic evolution to simulate borrowing between languages. The results show that tree topologies constructed with Bayesian phylogenetic methods are robust to realistic levels of borrowing. Inferences about divergence dates are slightly less robust and show a tendency to underestimate dates. Our results demonstrate that realistic levels of reticulation between cultures do not invalidate a phylogenetic approach to cultural and linguistic evolution. PMID:19324763

  19. Transmission characteristics and optimal diagnostic samples to detect an FMDV infection in vaccinated and non-vaccinated sheep.

    PubMed

    Eblé, P L; Orsel, K; van Hemert-Kluitenberg, F; Dekker, A

    2015-05-15

    We wanted to quantify transmission of FMDV Asia-1 in sheep and to evaluate which samples would be optimal for detection of an FMDV infection in sheep. For this, we used 6 groups of 4 non-vaccinated and 6 groups of 4 vaccinated sheep. In each group 2 sheep were inoculated and contact exposed to 2 pen-mates. Viral excretion was detected for a long period (>21 days post-inoculation, dpi). Transmission of FMDV occurred in the non-vaccinated groups (R0=1.14) but only in the first week after infection, when virus shedding was highest. In the vaccinated groups no transmission occurred (Rv<1, p=0.013). The viral excretion of the vaccinated sheep and the viral load in their pens was significantly lower than that of the non-vaccinated sheep. FMDV could be detected in plasma samples from 12 of 17 infected non-vaccinated sheep, for an average of 2.1 days, but in none of the 10 infected vaccinated sheep. In contrast, FMDV could readily be isolated from mouth swab samples from both non-vaccinated and vaccinated infected sheep starting at 1-3 dpi and in 16 of 27 infected sheep up till 21 dpi. Serologically, after 3-4 weeks, all but one of the infected sheep were detected using the NS-ELISA. We conclude that vaccination of a sheep population would likely stop an epidemic of FMDV and that the use of mouth swab samples would be a good alternative (instead of using vesicular lesions or blood samples) to detect an FMD infection in a sheep population both early and prolonged after infection.

  20. Regional Transmission Projects: Finding Solutions

    SciTech Connect

    The Keystone Center

    2005-06-15

    The Keystone Center convened and facilitated a year-long Dialogue on "Regional Transmission Projects: Finding Solutions" to develop recommendations that will help address the difficult and contentious issues related to expansions of regional electric transmission systems that are needed for reliable and economic transmission of power within and across regions. This effort brought together a cross-section of affected stakeholders and thought leaders to address the problem with the collective wisdom of their experience and interests. Transmission owners sat at the table with consumer advocates and environmental organizations. Representatives from regional transmission organizations exchanged ideas with state and federal regulators. Generation developers explored common interests with public power suppliers. Together, the Dialogue participants developed consensus solutions about how to begin unraveling some of the more intractable issues surrounding identification of need, allocation of costs, and reaching consensus on siting issues that can frustrate the development of regional transmission infrastructure. The recommendations fall into three broad categories: 1. Recommendations on appropriate institutional arrangements and processes for achieving regional consensus on the need for new or expanded transmission infrastructure 2. Recommendations on the process for siting of transmission lines 3. Recommendations on the tools needed to support regional planning, cost allocation, and siting efforts. List of Dialogue participants: List of Dialogue Participants: American Electric Power American Transmission Company American Wind Energy Association California ISO Calpine Corporation Cinergy Edison Electric Institute Environmental Defense Federal Energy Regulatory Commission Great River Energy International Transmission Company ISO-New England Iowa Public Utility Board Kanner & Associates Midwest ISO National Association of Regulatory Utility Commissioners National Association

  1. Energy Transmission and Infrastructure

    SciTech Connect

    Mathison, Jane

    2012-12-31

    The objective of Energy Transmission and Infrastructure Northern Ohio (OH) was to lay the conceptual and analytical foundation for an energy economy in northern Ohio that will: • improve the efficiency with which energy is used in the residential, commercial, industrial, agricultural, and transportation sectors for Oberlin, Ohio as a district-wide model for Congressional District OH-09; • identify the potential to deploy wind and solar technologies and the most effective configuration for the regional energy system (i.e., the ratio of distributed or centralized power generation); • analyze the potential within the district to utilize farm wastes to produce biofuels; • enhance long-term energy security by identifying ways to deploy local resources and building Ohio-based enterprises; • identify the policy, regulatory, and financial barriers impeding development of a new energy system; and • improve energy infrastructure within Congressional District OH-09. This objective of laying the foundation for a renewable energy system in Ohio was achieved through four primary areas of activity: 1. district-wide energy infrastructure assessments and alternative-energy transmission studies; 2. energy infrastructure improvement projects undertaken by American Municipal Power (AMP) affiliates in the northern Ohio communities of Elmore, Oak Harbor, and Wellington; 3. Oberlin, OH-area energy assessment initiatives; and 4. a district-wide conference held in September 2011 to disseminate year-one findings. The grant supported 17 research studies by leading energy, policy, and financial specialists, including studies on: current energy use in the district and the Oberlin area; regional potential for energy generation from renewable sources such as solar power, wind, and farm-waste; energy and transportation strategies for transitioning the City of Oberlin entirely to renewable resources and considering pedestrians, bicyclists, and public transportation as well as drivers

  2. Multi-ratio transmission

    SciTech Connect

    Polak, J.C.

    1987-07-14

    A preselected multi-ratio power transmission is described comprising: input means for transmitting drive forces; output means; first, second and third friction clutch means each selectively engageable with the input means for accepting drive forces. First input gear means drivingly connects with the first friction clutch means; second input gear means drivingly connects with the second friction clutch means; third input gear means drivingly connects with the third clutch means; first output gear means drivingly connects with the first input gear means; second output gear means drivingly connects with the first and second input gear means; third output means drivingly connects between the third input gear means and the output means; and one double-acting synchronizer clutch for selectively engaging the first output gear means with the output means and alternately the second output gear means with the output means. The first friction clutch means and the one double-acting synchronizer clutch cooperates during engagement to establish two forward drive ratios between the input and output means. The second friction clutch means and the one double-acting synchronizer clutch cooperates during engagement to establish two other forward drive ratios between the input and output means. The third friction clutch means is engageable to provide another forward drive ratio between the input means and the output means; and the one double-acting synchronizer clutch is relieved of transmitting drive forces during the engagement of the third friction clutch means and being manipulable for alternate connection with either the first output gear or the second output gear while the third friction clutch means is engaged.

  3. [Mentalization and attachment transmission].

    PubMed

    Böhmann, Johann; Fritsch, Sophia; Lück, Monika; Stumpe, Anna; Taubner, Svenja; Vesterling, Christina

    2014-01-01

    The present study was investigating the predictive role of maternal mentalizing and general as well as depressive symptom burden for attachment security at the end of the first year on a sample of 44 mother-child-dyads from a low-risk community study. Maternal mentalizing was assessed in a multidimensional way as Reflective Functioning (off-line) and Mind-Mindedness (on-line). The design was longitudinal measuring maternal Mind-Mindedness from a videotaped mother-child-play-interaction at the age of three months. General and depressive symptom burden was assessed using the SCL-90-R when the children were nine months old. Maternal attachment and Reflective-Functioning, using the Adult-Attachment-Interview, as well as children's attachment behavior, using the Strange-Situation-Test, were investigated at the age of twelve months. Secure maternal attachment was associated with higher Reflective Functioning, higher frequency of Mind-Mindedness and lower general and depressive symptom burden. A moderation-analysis showed a statistical trend (p = .08) that the interaction of the frequency of mind-related comments, general symptom severity and maternal attachment has a predictive value for infantile attachment security. Results can be tentatively interpreted that mothers with insecure attachment who had a lower general symptom burden and who related to their three-months old babies with a high frequency of mind-related-comments were more likely to have securely attached children. Thus, results may serve as a groundwork for projects aiming to prevent the transmission of insecure attachment by strengthening maternal Mind-Mindedness and working on the reduction of maternal general symptom burden.

  4. Transmission gearing arrangement

    SciTech Connect

    Klemen, D.

    1987-08-04

    A gearing arrangement is described for an automotive power transmission comprising: an input shaft and an output shaft; first, second, and third simple planetary gear sets. Each has a sun gear, a ring gear, and a planet gears meshing with the sun and the ring gears and rotatably supported on a planet carrier; means rigidly interconnecting the ring gear of the third gear set and the carrier of the second gear set; means rigidly interconnecting the ring gear of the second gear set and the carrier of the first gear set; means rigidly connecting the output shaft and the carrier of the third gear set; a first intermediate shaft rigidly interconnecting the sun gears of the second and the third gear sets for unitary rotation; a second intermediate shaft rigidly connected to the carrier of the second gear set; a third intermediate shaft continuously connected to the input shaft and to the sun gear of the first gear set; first, second, and third brake means operative to selectively brake rotation of the ring gears of the first, the second, and the third gear sets, respectively; a first rotating clutch selectively operable to connect the input shaft and the first intermediate shaft for unitary rotation; a second rotating clutch selectively operable to connect the input shaft and the second intermediate shaft for unitary rotation; a fourth simple planetary gear set including a sun gear and a ring gear and planet gears meshing with the sun and the ring gears and rotatably supported on a planet carrier; means rigidly connecting the sun gear of the fourth gear set to the third intermediate shaft; means rigidly connecting the ring gear of the fourth gear set to the carrier of the first gear set; and a fourth brake means selectively operable to brake the carrier of the fourth gear set. The nine forward ratios are obtainable while preserving a single transition shifting over the entire nine forward ratios.

  5. Multistate differential transmission

    SciTech Connect

    Whalen, B.L.

    1989-05-30

    This patent describes a multistate transmission suitable for a colinear configuration having a stationary housing and an input shaft and an output shaft comprising: a first pair of planetary gear trains comprising a first common ring gear having a torque reducing gear train consisting of a sun gear and a planetary gears connected by way of a carrier to the output shaft and a reversing planetary gear train consisting of a sun gear and planetary gears; a second pair of planetary a trains comprising a second common ring gear having a torque reducing gear train consisting of a sun gear and planetary gears connected by way of a carrier to the sun gear in the reversing planetary gear train in the first pair of planetary gear trains and a reversing planetary gear train consisting of a sun gear and planetary gears; carrier means connecting the sun gears in the first pair of planetary gear trains to the housing through a free wheeling clutch to provide for rotation in one direction only and to one side of a first operational clutch. The other side of the clutch is connected to the sun gear in the reversing planetary gear train in the first pair of planetary gear trains; means connecting the planetary gears in the reversing mechanism of the second pair of planetary gear trains to the housing through a second operational clutch and to one side of a third operational clutch. The other side of the third operational clutch is connected to the sun gear in the reversing planetary gear grain in the second pair of planetary gear trains.

  6. The Applied Mathematics Laboratory.

    ERIC Educational Resources Information Center

    Siegel, Martha J.

    This report describes the Applied Mathematics Laboratory (AML) operated by the Department of Mathematics at Towson State University, Maryland. AML is actually a course offered to selected undergraduates who are given the opportunity to apply their skills in investigating industrial and governmental problems. By agreement with sponsoring…

  7. Quantification of transmission of foot-and-mouth disease virus caused by an environment contaminated with secretions and excretions from infected calves.

    PubMed

    Bravo de Rueda, Carla; de Jong, Mart C M; Eblé, Phaedra L; Dekker, Aldo

    2015-04-17

    Foot-and-mouth disease virus (FMDV) infected animals can contaminate the environment with their secretions and excretions. To quantify the contribution of a contaminated environment to the transmission of FMDV, this study used calves that were not vaccinated and calves that were vaccinated 1 week prior to inoculation with the virus in direct and indirect contact experiments. In direct contact experiments, contact calves were exposed to inoculated calves in the same room. In indirect contact experiments, contact calves were housed in rooms that previously had held inoculated calves for three days (either from 0 to 3 or from 3 to 6 days post inoculation). Secretions and excretions from all calves were tested for the presence of FMDV by virus isolation; the results were used to quantify FMDV transmission. This was done using a generalized linear model based on a 2 route (2R, i.e. direct contact and environment) SIR model that included information on FMDV survival in the environment. The study shows that roughly 44% of transmission occurs via the environment, as indicated by the reproduction ratio R0(2R)environment that equalled 2.0, whereas the sum of R0(2R)contact and R0(2R)environment equalled 4.6. Because vaccination 1 week prior to inoculation of the calves conferred protective immunity against FMDV infection, no transmission rate parameters could be estimated from the experiments with vaccinated calves. We conclude that a contaminated environment contributes considerably to the transmission of FMDV therefore that hygiene measures can play a crucial role in FMD control.

  8. 47 CFR 25.212 - Narrowband analog transmissions, digital transmissions, and video transmissions in the GSO Fixed...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... transmissions, and video transmissions in the GSO Fixed-Satellite Service. 25.212 Section 25.212... Technical Standards § 25.212 Narrowband analog transmissions, digital transmissions, and video transmissions... narrowband and/or wideband digital services, including digital video services, if the maximum input spectral...

  9. 47 CFR 25.212 - Narrowband analog transmissions, digital transmissions, and video transmissions in the GSO Fixed...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... transmissions, and video transmissions in the GSO Fixed-Satellite Service. 25.212 Section 25.212... Technical Standards § 25.212 Narrowband analog transmissions, digital transmissions, and video transmissions... narrowband and/or wideband digital services, including digital video services, if the maximum input spectral...

  10. NWCC Transmission Case Study III

    SciTech Connect

    Terry Allison, Steve Wiese

    2000-03-01

    OAK-B135 Transmission System Improvements for Wind Energy Development in the Upper Midwest and Great Plains: Opportunities and Obstacles. This case study set out to ascertain the validity of three assumptions from the perspectives of stakeholders involved in wind energy and transmission issues in the Upper Midwest and Great Plains. The assumptions, and the stakeholders' reactions to each, are summarized below: Assumption 1--Transmission system improvements would provide significant benefits to the electricity network and its customers. Respondents acknowledge the potential for overall system benefits in the form of reduced line losses, improved grid stability and reliability, and enhanced ability to conduct spot market transactions. They also agree that these benefits relate to specific regional needs. However, there is disagreement over the extent of other benefits such as efficiency gains and cost savings from reduced line losses. Further, environmental and community interest groups point out that none of these benefits are realized without significant financial, environmental and social costs. Assumption 2--The benefits of transmission improvements would be helpful, but not confined, to wind power. All respondents agree that wind energy could benefit from transmission system improvements. But they also acknowledge, reluctantly, in the case of environmental stakeholders, that the benefits of an improved transmission system cannot be limited to environmentally preferable forms of generation. Some environmental and community advocate respondents also feel that transmission system improvement projects can be avoided altogether through energy conservation and efficiency measures, and by substituting wind energy for fossil generation. Assumption 3--Transmission alliances among stakeholders within and external to the wind community can provide benefits in the public interest. The fractured, multi-jurisdictional governance of the regional transmission system, and the

  11. What are applied ethics?

    PubMed

    Allhoff, Fritz

    2011-03-01

    This paper explores the relationships that various applied ethics bear to each other, both in particular disciplines and more generally. The introductory section lays out the challenge of coming up with such an account and, drawing a parallel with the philosophy of science, offers that applied ethics may either be unified or disunified. The second section develops one simple account through which applied ethics are unified, vis-à-vis ethical theory. However, this is not taken to be a satisfying answer, for reasons explained. In the third section, specific applied ethics are explored: biomedical ethics; business ethics; environmental ethics; and neuroethics. These are chosen not to be comprehensive, but rather for their traditions or other illustrative purposes. The final section draws together the results of the preceding analysis and defends a disunity conception of applied ethics.

  12. System life and reliability modeling for helicopter transmissions

    NASA Technical Reports Server (NTRS)

    Savage, M.; Brikmanis, C. K.

    1986-01-01

    A computer program which simulates life and reliability of helicopter transmissions is presented. The helicopter transmissions may be composed of spiral bevel gear units and planetary gear units - alone, in series or in parallel. The spiral bevel gear units may have either single or dual input pinions, which are identical. The planetary gear units may be stepped or unstepped and the number of planet gears carried by the planet arm may be varied. The reliability analysis used in the program is based on the Weibull distribution lives of the transmission components. The computer calculates the system lives and dynamic capacities of the transmission components and the transmission. The system life is defined as the life of the component or transmission at an output torque at which the probability of survival is 90 percent. The dynamic capacity of a component or transmission is defined as the output torque which can be applied for one million output shaft cycles for a probability of survival of 90 percent. A complete summary of the life and dynamic capacity results is produced by the program.

  13. Mechanisms of cytoskeleton-mediated mechanical signal transmission in cells

    PubMed Central

    Hwang, Yongyun; Gouget, Cecile L.M.; Barakat, Abdul I.

    2012-01-01

    Recent experiments have demonstrated very rapid long-distance transmission of mechanical forces within cells. Because the speed of this transmission greatly exceeds that of reaction-diffusion signaling, it has been conjectured that it occurs via the propagation of elastic waves through the actin stress fiber network. To explore the plausibility of this conjecture, we recently developed a model of small amplitude stress fiber deformations in prestressed viscoelastic stress fibers subjected to external forces. The model results demonstrated that rapid mechanical signal transmission is only possible when the external force is applied orthogonal to the stress fiber axis and that the dynamics of this transmission are governed by a balance between the prestress in the stress fiber and the stress fiber's material viscosity. The present study, which is a follow-up on our previous model, uses dimensional analysis to: (1) further evaluate the plausibility of the elastic wave conjecture and (2) obtain insight into mechanical signal transmission dynamics in simple stress fiber networks. We show that the elastic wave scenario is likely not the mechanism of rapid mechanical signal transmission in actin stress fibers due to the highly viscoelastic character of these fibers. Our analysis also demonstrates that the time constant characterizing mechanical stimulus transmission is strongly dependent on the topology of the stress fiber network, implying that network organization plays an important role in determining the dynamics of cellular responsiveness to mechanical stimulation. PMID:23336020

  14. Cost estimation of HVDC transmission system of Bangka's NPP candidates

    NASA Astrophysics Data System (ADS)

    Liun, Edwaren; Suparman

    2014-09-01

    Regarding nuclear power plant development in Bangka Island, it can be estimated that produced power will be oversupply for the Bangka Island and needs to transmit to Sumatra or Java Island. The distance between the regions or islands causing considerable loss of power in transmission by alternating current, and a wide range of technical and economical issues. The objective of this paper addresses to economics analysis of direct current transmission system to overcome those technical problem. Direct current transmission has a stable characteristic, so that the power delivery from Bangka to Sumatra or Java in a large scale efficiently and reliably can be done. HVDC system costs depend on the power capacity applied to the system and length of the transmission line in addition to other variables that may be different.

  15. Data transmission via erasure type channels protected by linear codes

    NASA Astrophysics Data System (ADS)

    Wacker, H. D.; Pendli, P.; Börcsök, J.

    2012-05-01

    The paper is concerned with data transmission via channels composed of a memoryless binary symmetric channel and the erasure channel of Peter Elias. Channels of this type play an important role in modelling different types of networks especially wireless networks, and have been investigated using, amongst others, the theory of Markov chains. Channel Capacities and network flows have been determined. The authors focus their interest on some aspects of coding theory. They assume the data transmission to be protected by a linear code, a CRC for example, and determine the probability of undetected error of the code. They then consider redundant transmission via two or more channels with bit inversion, and calculate the probability of undetected error. They prove some inequalities that are useful instruments to estimate the rate of transmission errors and to determine safety integrity levels according to the standards. Finally the authors apply their results to Bluetooth channels suffering from different types of noise.

  16. Ultrasound transmission attenuation tomography using energy-scaled amplitude ratios

    NASA Astrophysics Data System (ADS)

    Chen, Ting; Shin, Junseob; Huang, Lianjie

    2016-04-01

    Ultrasound attenuation of breast tumors is related to their types and pathological states, and can be used to detect and characterize breast cancer. Particularly, ultrasound scattering attenuation can infer the margin properties of breast tumors. Ultrasound attenuation tomography quantitatively reconstructs the attenuation properties of the breast. Our synthetic-aperture breast ultrasound tomography system with two parallel transducer arrays records both ultrasound reflection and transmission signals. We develop an ultrasound attenuation tomography method using ultrasound energy-scaled amplitude decays of ultrasound transmission signals and conduct ultrasound attenuation tomography using a known sound-speed model. We apply our ultrasound transmission attenuation tomography method to a breast phantom dataset, and compare the ultrasound attenuation tomography results with conventional beamforming ultrasound images obtained using reflection signals. We show that ultrasound transmission attenuation tomography complements beamforming images in identifying breast lesions.

  17. Household transmission of SARS, 2003

    PubMed Central

    Wilson-Clark, Samantha D.; Deeks, Shelley L.; Gournis, Effie; Hay, Karen; Bondy, Susan; Kennedy, Erin; Johnson, Ian; Rea, Elizabeth; Kuschak, Theodore; Green, Diane; Abbas, Zahid; Guarda, Brenda

    2006-01-01

    Background In the 2003 outbreak in Toronto (in Ontario, Canada) of severe acute respiratory syndrome (SARS), about 20% of cases resulted from household transmission. The purpose of our study was to determine characteristics associated with the transmission of SARS within households. Methods A retrospective cohort of SARS-affected households was studied to determine risk factors for household transmission. Questionnaires addressed characteristics of the index case, the household and behaviours among household members. Potential risk factors for secondary transmission of infection were assessed in regression models appropriate to the outcome (secondary cases) and nonindependence of household members. Results The 74 households that participated included 18 secondary cases and 158 uninfected household members in addition to the 74 index cases. The household secondary attack rate was 10.2% (95% confidence interval [CI] 6.7%–23.5%). There was a linear association between the time the index patient spent at home after symptom onset and the secondary attack rate. Infected health care workers who were index cases had lower rates of household transmission. Interpretation SARS transmission in households is complex and increases with the length of time an ill person spends at home. Risk of transmission was lower when the index case was a health care worker. Rapid case identification is the public health measure most useful in minimizing exposure in the home. PMID:17098951

  18. Biology of HIV Mucosal Transmission

    PubMed Central

    Wu, Li

    2008-01-01

    Purpose of review HIV-1 mucosal transmission plays a critical role in HIV-1 infection and AIDS pathogenesis. This review summarizes the latest advances in biological studies of HIV-1 mucosal transmission, highlighting the implications of these studies in the development of microbicides to prevent HIV-1 transmission. Recent findings New studies of initial HIV-1 infection using improved culture models updated the current view of mucosal transmission. Mechanistic studies enhanced our understanding of cell-cell transmission of HIV-1 mediated by the major target cells, including dendritic cells, CD4+ T cells, and macrophages. Increasing evidence indicated the significance of host factors and immune responses in HIV-1 mucosal infection and transmission. Summary Recent progress in HIV-1 mucosal infection and transmission enriches our knowledge of virus-host interactions and viral pathogenesis. Functional studies of HIV-1 interactions with host cells can provide new insights into the design of more effective approaches to combat HIV-1 infection and AIDS. PMID:18802490

  19. The evolution of transmission mode

    PubMed Central

    Forbes, Mark R.; Hauffe, Heidi C.; Kallio, Eva R.; Okamura, Beth; Sait, Steven M.

    2017-01-01

    This article reviews research on the evolutionary mechanisms leading to different transmission modes. Such modes are often under genetic control of the host or the pathogen, and often in conflict with each other via trade-offs. Transmission modes may vary among pathogen strains and among host populations. Evolutionary changes in transmission mode have been inferred through experimental and phylogenetic studies, including changes in transmission associated with host shifts and with evolution of the unusually complex life cycles of many parasites. Understanding the forces that determine the evolution of particular transmission modes presents a fascinating medley of problems for which there is a lack of good data and often a lack of conceptual understanding or appropriate methodologies. Our best information comes from studies that have been focused on the vertical versus horizontal transmission dichotomy. With other kinds of transitions, theoretical approaches combining epidemiology and population genetics are providing guidelines for determining when and how rapidly new transmission modes may evolve, but these are still in need of empirical investigation and application to particular cases. Obtaining such knowledge is a matter of urgency in relation to extant disease threats. This article is part of the themed issue ‘Opening the black box: re-examining the ecology and evolution of parasite transmission’. PMID:28289251

  20. Parameterizing Spatial Models of Infectious Disease Transmission that Incorporate Infection Time Uncertainty Using Sampling-Based Likelihood Approximations.

    PubMed

    Malik, Rajat; Deardon, Rob; Kwong, Grace P S

    2016-01-01

    A class of discrete-time models of infectious disease spread, referred to as individual-level models (ILMs), are typically fitted in a Bayesian Markov chain Monte Carlo (MCMC) framework. These models quantify probabilistic outcomes regarding the risk of infection of susceptible individuals due to various susceptibility and transmissibility factors, including their spatial distance from infectious individuals. The infectious pressure from infected individuals exerted on susceptible individuals is intrinsic to these ILMs. Unfortunately, quantifying this infectious pressure for data sets containing many individuals can be computationally burdensome, leading to a time-consuming likelihood calculation and, thus, computationally prohibitive MCMC-based analysis. This problem worsens when using data augmentation to allow for uncertainty in infection times. In this paper, we develop sampling methods that can be used to calculate a fast, approximate likelihood when fitting such disease models. A simple random sampling approach is initially considered followed by various spatially-stratified schemes. We test and compare the performance of our methods with both simulated data and data from the 2001 foot-and-mouth disease (FMD) epidemic in the U.K. Our results indicate that substantial computation savings can be obtained--albeit, of course, with some information loss--suggesting that such techniques may be of use in the analysis of very large epidemic data sets.

  1. Climate and dengue transmission: evidence and implications.

    PubMed

    Morin, Cory W; Comrie, Andrew C; Ernst, Kacey

    2013-01-01

    Climate influences dengue ecology by affecting vector dynamics, agent development, and mosquito/human interactions. Although these relationships are known, the impact climate change will have on transmission is unclear. Climate-driven statistical and process-based models are being used to refine our knowledge of these relationships and predict the effects of projected climate change on dengue fever occurrence, but results have been inconsistent. We sought to identify major climatic influences on dengue virus ecology and to evaluate the ability of climate-based dengue models to describe associations between climate and dengue, simulate outbreaks, and project the impacts of climate change. We reviewed the evidence for direct and indirect relationships between climate and dengue generated from laboratory studies, field studies, and statistical analyses of associations between vectors, dengue fever incidence, and climate conditions. We assessed the potential contribution of climate-driven, process-based dengue models and provide suggestions to improve their performance. Relationships between climate variables and factors that influence dengue transmission are complex. A climate variable may increase dengue transmission potential through one aspect of the system while simultaneously decreasing transmission potential through another. This complexity may at least partly explain inconsistencies in statistical associations between dengue and climate. Process-based models can account for the complex dynamics but often omit important aspects of dengue ecology, notably virus development and host-species interactions. Synthesizing and applying current knowledge of climatic effects on all aspects of dengue virus ecology will help direct future research and enable better projections of climate change effects on dengue incidence.

  2. Modeling Malaria Transmission in Thailand and Indonesia

    NASA Technical Reports Server (NTRS)

    Kiang, Richard; Adimi, Farida; Nigro, Joseph

    2007-01-01

    Malaria Modeling and Surveillance is a project in the NASA Applied Sciences Public Health Applications Program. The main objectives of this project are: 1) identification of the potential breeding sites for major vector species: 2) implementation of a malaria transmission model to identify they key factors that sustain or intensify malaria transmission; and 3) implementation of a risk algorithm to predict the occurrence of malaria and its transmission intensity. Remote sensing and GIs are the essential elements of this project. The NASA Earth science data sets used in this project include AVHRR Pathfinder, TRMM, MODIS, NSIPP and SIESIP. Textural-contextual classifications are used to identify small larval habitats. Neural network methods are used to model malaria cases as a function of precipitation, temperatures, humidity and vegetation. Hindcastings based on these environmental parameters have shown good agreement to epidemiological records. Examples for spatio-temporal modeling of malaria transmissions in Southeast Asia are given. Discrete event simulations were used for modeling the detailed interactions among the vector life cycle, sporogonic cycle and human infection cycle, under the explicit influences of selected extrinsic and intrinsic factors. The output of the model includes the individual infection status and the quantities normally observed in field studies, such as mosquito biting rates, sporozoite infection rates, gametocyte prevalence and incidence. Results are in good agreement with mosquito vector and human malaria data acquired by Coleman et al. over 4.5 years in Kong Mong Tha, a remote village in western Thailand. Application of our models is not restricted to Southeast Asia. The model and techniques are equally applicable to other regions of the world, when appropriate epidemiological and vector ecological parameters are used as input.

  3. 76 FR 49762 - FirstEnergy Service Co. v. Midwest Independent Transmission System Operator, Inc.; Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-11

    ... Multi-Value Project (MVP) transmission usage charges proposed by the Midwest Independent Transmission... Practice and Procedure, alleging that it is unjust and unreasonable to apply MVP transmission usage charges... filing is accessible on-line at http://www.ferc.gov , using the ``eLibrary'' link and is available...

  4. Endoscopic transmission of Helicobacter pylori.

    PubMed

    Tytgat, G N

    1995-01-01

    The contamination of endoscopes and biopsy forceps with Helicobacter pylori occurs readily after endoscopic examination of H. pylori-positive patients. Unequivocal proof of iatrogenic transmission of the organism has been provided. Estimates for transmission frequency approximate to 4 per 1000 endoscopies when the infection rate in the endoscoped population is about 60%. Iatrogenic transmission has also been shown to be the cause of the so-called 'acute mucosal lesion' syndrome in Japan. Traditional cleaning and alcohol rinsing is insufficient to eliminate endoscope/forceps contamination. Only meticulous adherence to disinfection recommendations guarantees H. pylori elimination.

  5. Electrical transmission line diametrical retainer

    DOEpatents

    Hall, David R.; Hall, Jr., H. Tracy; Pixton, David; Dahlgren, Scott; Sneddon, Cameron; Briscoe, Michael; Fox, Joe

    2004-12-14

    The invention is a mechanism for retaining an electrical transmission line. In one embodiment of the invention it is a system for retaining an electrical transmission line within down hole components. In accordance with one aspect of the invention, the system includes a plurality of downhole components, such as sections of pipe in a drill string. The system also includes a coaxial cable running between the first and second end of a drill pipe, the coaxial cable having a conductive tube and a conductive core within it. The invention allows the electrical transmission line to with stand the tension and compression of drill pipe during routine drilling cycles.

  6. Midwest Transmission Workshop I Summary

    SciTech Connect

    Kevin Bryan

    2001-05-01

    OAK-B135 The meeting was opened with a review of the purposes of the workshop: (1) Present and discuss key studies and assessments of transmission upgrades, additions and related issues for the upper Midwest, including work that addresses the full range of views on these topics; (2) Understand the various transmission issues in the upper Midwest and discuss options for addressing the issues; and (3) Identify the decision makers and entities that need to play an active role if transmission issues are to be resolved, and agree on next steps for engaging these individuals and organizations through education, outreach, and information dissemination.

  7. Hidden hazards of HCV transmission.

    PubMed

    Pondé, Robério Amorim de Almeida

    2011-02-01

    Hepatitis C virus infection is a global health problem that has important epidemiological and clinical consequences. It has been well established that exposure to infected blood is the main risk factor for HCV transmission. However, in 20% of cases the agent transmission occurs by unknown route or in the presence of an unidentified source of infection. Understanding of the epidemiology of HCV is needed to help us define future control and preventive strategies. Herein, we discuss about diagnosis of HCV infection and hepatitis C surveillance in the context of its transmission.

  8. Load Distribution in Transmissions "Split"

    NASA Technical Reports Server (NTRS)

    Krantz, Timothy L.; Delgado, Irebert R.

    1998-01-01

    The transmission system of a helicopter must meet particularly critical requirements. It must transmit engine power to the rotor, at the same time ensuring a typical speed reduction of 60 to 1. It must also be safe, reliable, light, and reach a high level of performance while, at the same time, it must produce few vibrations and little noise. Helicopter transmissions have achieved high-level performances thanks to the combination of analyses, experiments, and the application of practical field experience. However, the new generation of helicopters will require transmission systems that are even safer, lighter, less noisy, and more reliable.

  9. The evolution of plant virus transmission pathways

    Treesearch

    Frédéric M. Hamelin; Linda J.S. Allen; Holly R. Prendeville; M. Reza Hajimorad; Michael J. Jeger

    2016-01-01

    The evolution of plant virus transmission pathways is studied through transmission via seed, pollen, oravector. We address the questions: under what circumstances does vector transmission make pollen transmission redundant? Can evolution lead to the coexistence of multiple virus transmission pathways? We restrict the analysis to an annual plant population in which...

  10. Downhole Data Transmission System

    DOEpatents

    Hall, David R.; Hall, Jr., H. Tracy; Pixton, David; Dahlgren, Scott; Fox, Joe

    2003-12-30

    A system for transmitting data through a string of downhole components. In one aspect, the system includes first and second magnetically conductive, electrically insulating elements at both ends of the component. Each element includes a first U-shaped trough with a bottom, first and second sides and an opening between the two sides. Electrically conducting coils are located in each trough. An electrical conductor connects the coils in each component. In operation, a varying current applied to a first coil in one component generates a varying magnetic field in the first magnetically conductive, electrically insulating element, which varying magnetic field is conducted to and thereby produces a varying magnetic field in the second magnetically conductive, electrically insulating element of a connected component, which magnetic field thereby generates a varying electrical current in the second coil in the connected component.

  11. Downhole data transmission system

    DOEpatents

    Hall, David R.; Hall, Jr., H. Tracy; Pixton, David S; Dahlgren, Scott; Fox, Joe

    2006-06-20

    A system for transmitting data through a string of downhole components. In one aspect, the system includes first and second magnetically conductive, electrically insulating elements at both ends of the component. Each element includes a first U-shaped trough with a bottom, first and second sides and an opening between the two sides. Electrically conducting coils are located in each trough. An electrical conductor connects the coils in each component. In operation, a varying current applied to a first coil in one component generates a varying magnetic field in the first magnetically conductive, electrically insulating element, which varying magnetic field is conducted to and thereby produces a varying magnetic field in the second magnetically conductive, electrically insulating element of a connected component, which magnetic field thereby generates a varying electrical current in the second coil in the connected component.

  12. Intertwined arbovirus transmission activity: reassessing the transmission cycle paradigm

    PubMed Central

    Diaz, Luis A.; Flores, Fernando S.; Quaglia, Agustín; Contigiani, Marta S.

    2013-01-01

    Arboviruses are emerging/reemerging infectious agents worldwide. The factors within this scenario include vector and host population fluctuations, climatic changes, anthropogenic activities that disturb ecosystems, an increase in international flights, human mobility, and genetic mutations that allow spill-over phenomenon. Arboviruses are maintained by biologic transmission among vectors and hosts. Sometimes this biological transmission is specific and includes one vector and host species such as Chikungunya (CHIKV), Dengue (DENV), and urban Yellow Fever (YFV). However, most of the arboviruses are generalist and they use many vectors and hosts species. From this perspective, arboviruses are maintained through a transmission network rather than a transmission cycle. This allows us to understand the complexity and dynamics of the transmission and maintenance of arboviruses in the ecosystems. The old perspective that arboviruses are maintained in close and stable transmission cycles should be modified by a new more integrative and dynamic idea, representing the real scenario where biological interactions have a much broader representation, indicating the constant adaptability of the biological entities. PMID:23335900

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. Applied Physics at Strathclyde.

    ERIC Educational Resources Information Center

    Patterson, H.; Twidell, J. W.

    1979-01-01

    Outlines and describes the content of an applied physics course offered for the four year honors and the three year pass degrees. The course stresses three components: principal subjects, industrial projects, and subsidiary subjects. (GA)

  15. Mesothelioma Applied Research Foundation

    MedlinePlus

    ... Percentage Donations Tribute Wall Other Giving/Fundraising Opportunities Bitcoin Donation Form FAQs Mesothelioma Awareness Day: Find out ... Percentage Donations Tribute Wall Other Giving/Fundraising Opportunities Bitcoin Donation Form FAQs © 2017 Mesothelioma Applied Research Foundation, ...

  16. Geomorphology: Pure and applied

    SciTech Connect

    Hart, M.G.

    1986-01-01

    The book summarizes the history of intellectual debate in geomorphology and describes modern developments both ''pure'' and ''applied.'' The history begins well before W.M. Davis and follows through to such debates as those concerned with the Pleistocene. Modern developments in pure geomorphology are cast in terms of chapters on form, process, materials, and methods analysis. The applied chapters concentrate on environmental hazards and resources, and their management.

  17. Applied Learning Networks (ALN)

    DTIC Science & Technology

    2007-01-01

    AFRL-IF-RS-TR-2007-7 Final Technical Report January 2007 APPLIED LEARNING NETWORKS (ALN) University of Southern California...any other person or corporation; or convey any rights or permission to manufacture, use, or sell any patented invention that may relate to them...1-0051 4. TITLE AND SUBTITLE APPLIED LEARNING NETWORKS (ALN) 5c. PROGRAM ELEMENT NUMBER 62301E 5d. PROJECT NUMBER T981 5e. TASK NUMBER US

  18. Transmission of Information: An Overview.

    ERIC Educational Resources Information Center

    Thoma, George R.

    1981-01-01

    Outlines the basic principles underlying the transmission of information, including analog and digital modulation, limitations to communications, configurations of communications networks, optical fiber cables, and earth satellites. Six references are cited. (FM)

  19. Automatic transmission for electric wheelchairs.

    PubMed

    Reswick, J B

    1985-07-01

    A new infinitely variable automatic transmission called the RESATRAN that automatically changes its speed ratio in response to load torque being transmitted is presented. A prototype has been built and tested on a conventional three-wheeled electric motor propelled wheelchair. It is shown theoretically that more than 50 percent reduction in power during hill climbing may be expected when a transmission-equipped wheelchair is compared to a direct-drive vehicle operating at the same voltage. It is suggested that with such a transmission, wheelchairs can use much smaller motors and associated electronic controls, while at the same time gaining in efficiency that results in longer operating distances for the same battery charge. Design details of the transmission and test results are presented. These results show a substantial reduction in operating current and increased distance of operation over a test course.

  20. Cultural transmission of civic attitudes.

    PubMed

    Miles-Touya, Daniel; Rossi, Máximo

    2016-01-01

    In this empirical paper we attempt to measure the separate influence on civic engagement of educational attainment and cultural transmission of civic attitudes. Unlike most of the previous empirical works on this issue, we are able to approximate the cultural transmission of civic attitudes. We observe that civic returns to education are overstated when the transmission of civic attitudes is ignored. Moreover, the transmission of civic attitudes significantly enhances civic involvement and reinforces civic returns to education. Our findings are in line with the proposals of civic virtue theorists or grass movements who suggest that citizenship education should be included in the compulsory school curricula since, if not, families or local communities will only transmit their particular view of the world.

  1. Transmission of Information: An Overview.

    ERIC Educational Resources Information Center

    Thoma, George R.

    1981-01-01

    Outlines the basic principles underlying the transmission of information, including analog and digital modulation, limitations to communications, configurations of communications networks, optical fiber cables, and earth satellites. Six references are cited. (FM)

  2. Light aircraft sound transmission study

    NASA Technical Reports Server (NTRS)

    Heitman, K.; Bernhard, R. J.

    1983-01-01

    The plausibility of using the two microphone sound intensity technique to study noise transmission into light aircraft was investigated. In addition, a simple model to predict the interior sound pressure level of the cabin was constructed.

  3. Modeling the Transmission of Sound.

    ERIC Educational Resources Information Center

    Palmer, David H.

    2003-01-01

    Introduces a functional model of sound transmission through solids and gases. Describes procedures of an activity to model how sound travels faster through solid materials than gases. Use dominoes to represent the particles of solids and gases. (KHR)

  4. Fomite transmission in head lice.

    PubMed

    Burkhart, Craig N; Burkhart, Craig G

    2007-06-01

    Control of various infestations requires an accurate understanding of transmission. After thousands of years of lice infestation, scientific documentation of indirect contact transmission has been substantiated. Lice can be transferred in the egg, instar, and adult stages. Lice have now been shown in the laboratory to be readily dislodged by air movements such as blow-drying one's hair, combing, and toweling. Moreover, passive transfer to adjoining fabric is also frequently observed. Louse transmission by fomites occurs more frequently than has been commonly believed. Close proximity suffices to increase the likeliness of a new infestation. Thus louse control measures should take account of fomite transmission and include screening of all individuals within an infested person's immediate circle of contact, laundering of everything within the infested individuals' bed or quarantining of such material for 10 days, thorough vacuuming of floors, carpets, upholstery, with a standard vacuum cleaner.

  5. Hybrid-Vehicle Transmission System

    NASA Technical Reports Server (NTRS)

    Lupo, G.; Dotti, G.

    1985-01-01

    Continuously-variable transmission system for hybrid vehicles couples internal-combustion engine and electric motor section, either individually or in parallel, to power vehicle wheels during steering and braking.

  6. Transmission series power flow control

    SciTech Connect

    Nelson, R.J.; Bian, J.; Williams, S.L.

    1995-01-01

    This paper presents the characteristics of two gate turn-off (GTO) thyristor voltage-sourced inverter based series power flow control devices, namely the Series Power Flow Controller (SPFC) and the Unified Power Flow Controller (UPFC). These devices represent series extensions of the STATCON, an inverter-based shunt device developed under a tailored collaboration by EPRI, TVA and the Westinghouse Science and Technology Center, which will soon be placed in service on the TVA 161kV transmission system for transmission voltage control. Operation of the SPFC and UPFC is illustrated through the use of easily-constructed circle diagrams on the P-Q plane. The circle diagrams provide the transmission planning engineer with a simple means to assess the performance of these devices on the transmission system. A concluding example illustrates that the UPFC provides a level of power now control which is unattainable with more conventional devices.

  7. Transmission series power flow control

    SciTech Connect

    Nelson, R.J.; Bian, J.; Williams, S.L.

    1994-12-31

    This paper presents the characteristics of two gate turn-off (GTO) thyristor voltage-sourced inverter-based series power flow control devices, namely the Series Power Flow Controller (SPFC) and the Unified Power Flow Controller (UPFC). These devices represent series extensions of the STATCON, an inverter-based shunt device developed under a tailored collaboration by EPRI, TVA and the Westinghouse Science and Technology Center, which will soon be placed in service on the TVA 161kV transmission system for transmission voltage control. Operation of the SPFC and UPFC is illustrated through the use of easily-constructed circle diagrams on the P-Q plane. The circle diagrams provide the transmission planning engineer with a simple means to assess the performance of these devices on the transmission system. A concluding example illustrates that the UPFC provides a level of power flow control which is unattainable with more conventional devices.

  8. Hybrid-Vehicle Transmission System

    NASA Technical Reports Server (NTRS)

    Lupo, G.; Dotti, G.

    1985-01-01

    Continuously-variable transmission system for hybrid vehicles couples internal-combustion engine and electric motor section, either individually or in parallel, to power vehicle wheels during steering and braking.

  9. Bearings and gears for advanced turbine engines and transmissions

    NASA Technical Reports Server (NTRS)

    Parker, R. J.

    1975-01-01

    The improved technology is discussed of engine main-shaft ball bearings, and spur gears in power transmission drive trains. Much of the technology can be applied to other ball and roller bearings, and to other spur and bevel gears throughout the engine, drive train, and accessory systems.

  10. Diversified transmission multichannel detection system

    SciTech Connect

    Tournois, P.; Engelhard, P.

    1984-07-03

    A detection system for imaging by sonar or radar signals. The system associates diversified transmissions with an interferometric base. This base provides an angular channel formation means and each signal formed in this way is processed by matched filtering in a circuit containing copy signals characterizing the space coloring obtained by the diversified transmission means. The invention is particularly applicable to side or front looking detection sonars.

  11. Free-Space Power Transmission

    NASA Technical Reports Server (NTRS)

    1989-01-01

    NASA Lewis Research Center organized a workshop on technology availability for free-space power transmission (beam power). This document contains a collection of viewgraph presentations that describes the effort by academia, industry, and the national laboratories in the area of high-frequency, high-power technology applicable to free-space power transmission systems. The areas covered were rectenna technology, high-frequency, high-power generation (gyrotrons, solar pumped lasers, and free electron lasers), and antenna technology.

  12. Data compression applied to HHVT

    NASA Technical Reports Server (NTRS)

    Thompson, William K.

    1990-01-01

    A task order was written by the High Resolution, High Frame Rate Video Technology (HHVT) project engineers to study data compression techniques that could be applied to the HHVT system. Specifically, the goals of the HHVT data compression study are to accomplish the following: (1) Determine the downlink capabilities of the Space Shuttle and Space Station Freedom to support HHVT data (i.e., determine the maximum data rates and link availability); (2) Determine current and projected capabilities of high speed storage media to support HHVT data by determining their maximum data acquisition/transmission rates and volumes; (3) Identify which experiment in the HHVT Users' Requirement data base need data compression, based on the experiments' imaging requirements; (4) Select the best data compression technique for each of these users by identifying a technique that provides compression but minimizes distortion; and (5) Investigate state-of-the-art technologies for possible implementation of selected data compression techniques. Data compression will be needed because of the high data rates and larger volumes of data that will result from the use of digitized video onboard the Space Shuttle and Space Station Freedom.

  13. Advanced Rotorcraft Transmission (ART) program

    NASA Technical Reports Server (NTRS)

    Heath, Gregory F.; Bossler, Robert B., Jr.

    1993-01-01

    Work performed by the McDonnell Douglas Helicopter Company and Lucas Western, Inc. within the U.S. Army/NASA Advanced Rotorcraft Transmission (ART) Program is summarized. The design of a 5000 horsepower transmission for a next generation advanced attack helicopter is described. Government goals for the program were to define technology and detail design the ART to meet, as a minimum, a weight reduction of 25 percent, an internal noise reduction of 10 dB plus a mean-time-between-removal (MTBR) of 5000 hours compared to a state-of-the-art baseline transmission. The split-torque transmission developed using face gears achieved a 40 percent weight reduction, a 9.6 dB noise reduction and a 5270 hour MTBR in meeting or exceeding the above goals. Aircraft mission performance and cost improvements resulting from installation of the ART would include a 17 to 22 percent improvement in loss-exchange ratio during combat, a 22 percent improvement in mean-time-between-failure, a transmission acquisition cost savings of 23 percent of $165K, per unit, and an average transmission direct operating cost savings of 33 percent, or $24K per flight hour. Face gear tests performed successfully at NASA Lewis are summarized. Also, program results of advanced material tooth scoring tests, single tooth bending tests, Charpy impact energy tests, compact tension fracture toughness tests and tensile strength tests are summarized.

  14. Transmission probability of poly(dA)-poly(dT) DNA in electric field

    NASA Astrophysics Data System (ADS)

    Rahmi, K. A.; Yudiarsah, E.

    2017-07-01

    Transmission probability of poly(dA)-poly(dT) DNA in electric field for several voltages has been studied. The DNA molecule is modeled by using tight binding Hamiltonian model. It is contacted to electrodes at both sides with 32 long base pairs. The voltage is applied at the electrodes and assumed it can change base onsite energy linearly, so can influence charge transmission in DNA chain. The transmission probability is calculated using transfer matrix and scattering matrix method. The transmission probability results also be compared at different temperatures and twisting motion frequencies. The results show that as the voltage increases, the transmission probability at transmission region with energy higher energy than Fermi energy increases. The increment of transmission probability with voltage increment becomes larger at higher twisting motion frequency, but it becomes smaller at higher temperature.

  15. PSYCHOANALYSIS AS APPLIED AESTHETICS.

    PubMed

    Richmond, Stephen H

    2016-07-01

    The question of how to place psychoanalysis in relation to science has been debated since the beginning of psychoanalysis and continues to this day. The author argues that psychoanalysis is best viewed as a form of applied art (also termed applied aesthetics) in parallel to medicine as applied science. This postulate draws on a functional definition of modernity as involving the differentiation of the value spheres of science, art, and religion. The validity criteria for each of the value spheres are discussed. Freud is examined, drawing on Habermas, and seen to have erred by claiming that the psychoanalytic method is a form of science. Implications for clinical and metapsychological issues in psychoanalysis are discussed. © 2016 The Psychoanalytic Quarterly, Inc.

  16. Applied Astronomy: Asteroid Prospecting

    NASA Astrophysics Data System (ADS)

    Elvis, M.

    2013-09-01

    In the age of asteroid mining the ability to find promising ore-bearing bodies will be valuable. This will give rise to a new discipline- "Applied Astronomy". Just as most geologists work in industry, not in academia, the same will be true of astronomers. Just how rare or common ore-rich asteroids are likely to be, and the skills needed to assay their value, are discussed here, with an emphasis on remote - telescopic - methods. Also considered are the resources needed to conduct extensive surveys of asteroids for prospecting purposes, and the cost and timescale involved. The longer-term need for applied astronomers is also covered.

  17. On applying cognitive psychology.

    PubMed

    Baddeley, Alan

    2013-11-01

    Recent attempts to assess the practical impact of scientific research prompted my own reflections on over 40 years worth of combining basic and applied cognitive psychology. Examples are drawn principally from the study of memory disorders, but also include applications to the assessment of attention, reading, and intelligence. The most striking conclusion concerns the many years it typically takes to go from an initial study, to the final practical outcome. Although the complexity and sheer timescale involved make external evaluation problematic, the combination of practical satisfaction and theoretical stimulation make the attempt to combine basic and applied research very rewarding. © 2013 The British Psychological Society.

  18. Sound Transmission through Two Concentric Cylindrical Sandwich Shells

    NASA Technical Reports Server (NTRS)

    Tang, Yvette Y.; Silcox, Richard J.; Robinson, Jay H.

    1996-01-01

    This paper solves the problem of sound transmission through a system of two infinite concentric cylindrical sandwich shells. The shells are surrounded by external and internal fluid media and there is fluid (air) in the annular space between them. An oblique plane sound wave is incident upon the surface of the outer shell. A uniform flow is moving with a constant velocity in the external fluid medium. Classical thin shell theory is applied to the inner shell and first-order shear deformation theory is applied to the outer shell. A closed form for transmission loss is derived based on modal analysis. Investigations have been made for the impedance of both shells and the transmission loss through the shells from the exterior into the interior. Results are compared for double sandwich shells and single sandwich shells. This study shows that: (1) the impedance of the inner shell is much smaller than that of the outer shell so that the transmission loss is almost the same in both the annular space and the interior cavity of the shells; (2) the two concentric sandwich shells can produce an appreciable increase of transmission loss over single sandwich shells especially in the high frequency range; and (3) design guidelines may be derived with respect to the noise reduction requirement and the pressure in the annular space at a mid-frequency range.

  19. 75 FR 62809 - Transmission Vegetation Management Practices; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-13

    ... Commission approved Reliability Standard FAC-003-1--Transmission Vegetation Management Program.\\1\\ Reliability Standard FAC-003-1 applies to all transmission lines operated at 200 kV and above, and to lower...; Order on reh'g, Order No. 693-A, 120 FERC ] 61,053 at P 95-99 (2007). \\2\\ Reliability Standard FAC-003-1...

  20. 47 CFR 80.104 - Identification of radar transmissions not authorized.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

  1. 47 CFR 80.104 - Identification of radar transmissions not authorized.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 5 2011-10-01 2011-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

  2. 75 FR 66752 - Transmission Vegetation Management Practices; Supplemental Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-29

    .... Anyone with Internet access who desires to listen to this event can do so by navigating to http://www... practices as required under the Commission- approved Reliability Standard FAC-003-1--Transmission Vegetation Management Program (TVMP).\\1\\ Reliability Standard FAC-003-1 applies to all transmission lines operated...

  3. New lidar concept for measuring the slant range transmission in aircraft landing approaches

    NASA Technical Reports Server (NTRS)

    Kohl, R. H.

    1977-01-01

    The single-scatter, single-wavelength, scalar-backscatter lidar equation is investigated to determine the transmission along a line from a point on the ground to what is known as the decision point on the 3 degree aircraft glide slope. It may be applied in aircraft landing approaches for measuring the slant range transmission.

  4. 47 CFR 80.104 - Identification of radar transmissions not authorized.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 5 2013-10-01 2013-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

  5. 47 CFR 80.104 - Identification of radar transmissions not authorized.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 5 2014-10-01 2014-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

  6. 47 CFR 80.104 - Identification of radar transmissions not authorized.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 5 2012-10-01 2012-10-01 false Identification of radar transmissions not... Procedures-General § 80.104 Identification of radar transmissions not authorized. This section applies to all maritime radar transmitters except radar beacon stations. (a) Radar transmitters must not transmit station...

  7. Global Transmission Dynamics of Measles in the Measles Elimination Era.

    PubMed

    Furuse, Yuki; Oshitani, Hitoshi

    2017-04-16

    Although there have been many epidemiological reports of the inter-country transmission of measles, systematic analysis of the global transmission dynamics of the measles virus (MV) is limited. In this study, we applied phylogeographic analysis to characterize the global transmission dynamics of the MV using large-scale genetic sequence data (obtained for 7456 sequences) from 115 countries between 1954 and 2015. These analyses reveal the spatial and temporal characteristics of global transmission of the virus, especially in Australia, China, India, Japan, the UK, and the USA in the period since 1990. The transmission is frequently observed, not only within the same region but also among distant and frequently visited areas. Frequencies of export from measles-endemic countries, such as China, India, and Japan are high but decreasing, while the frequencies from countries where measles is no longer endemic, such as Australia, the UK, and the USA, are low but slightly increasing. The world is heading toward measles eradication, but the disease is still transmitted regionally and globally. Our analysis reveals that countries wherein measles is endemic and those having eliminated the disease (apart from occasional outbreaks) both remain a source of global transmission in this measles elimination era. It is therefore crucial to maintain vigilance in efforts to monitor and eradicate measles globally.

  8. Optical properties of actively controlled reflection and transmission gratings

    NASA Astrophysics Data System (ADS)

    Rodriguez, Miguel Angel

    2001-05-01

    Reflection and transmission gratings have found a wide variety of applications as optical filters and beam steering elements. In this work we have studied the optical properties of reflection and transmission gratings whose diffraction properties could be actively controlled. Two different material systems were utilized for the study. Reflection gratings in optical fibers were used and reflection and transmission gratings were fabricated holographically in a polymer dispersed liquid crystal (PDLC) material. The optical properties of refractive index-shifted gratings were studied using the fiber Bragg gratings. It was found that narrow, high transmission spikes developed inside a high reflectivity stopgap when the refractive index of a section of the grating is shifted. The refractive index-shift was achieved using the thermo- optic effect. Experimental as well as theoretical results are presented and discussed. The optical properties of electrically switchable reflection and transmission gratings fabricated in polymer dispersed liquid crystal materials were also studied. The PDLC material is electro-optic and therefore by applying an external electric field to the gratings the diffraction properties are modified. Gratings were fabricated holographically. From the study of the transmission properties of the reflection gratings we found that the reflection of the structures can be switched off by applying an external electric field and that the reflectivity is polarization insensitive for normal incidence. We also studied the diffraction properties of PDLC transmission gratings. In our analysis of the diffraction properties of these electrically- switchable liquid crystal gratings we found that it was necessary to use a generalized two-wave coupled mode theory that includes the effects of the optical anisotropy of the liquid crystal. We found that the morphology of the PDLC gratings depends on the specific PDLC mixture used to fabricate the grating.

  9. Resonant Transmissive Modulator Construction for Use in Beam Steering Array

    NASA Technical Reports Server (NTRS)

    Keys, Andrew S.; Fork, Richard L.; Nelson, Thomas R.; Loehr, John P.

    1999-01-01

    An agile electronically configurable optical beam steering device for use in directional free-space transmission of optical signals is described. The device design employs an array of tunable resonant transmissive modulators constructed from multi-layered stacks of electro-optically active dielectric materials. Each modulator may be individually configured to transmit an optical signal with a specific amount of phase and group velocity modulation. The resulting diffractive interactions between modulator outputs provide a method for directional optical signal transmission. Of particular focus within this presentation is the optimized design of the individual modulator. It is widely known that periodic multi-layered stacks of dielectric materials exhibit reflective and transmissive resonances as described by the stack's transmission function. If an electric field is applied normal to the stack's layers, phenomena such as the electro-optic effect and/or the quantum-confined Stark effect may be employed to change the effective refractive index within the stack. This refractive index change alters the stack's transmission function and modulates the phase and group velocity of the transmitted optical signal. By varying the parameters that describe the stack's specific construction and operation, such as number of layers within the stack, refractive indexes of stack materials, layer thicknesses, and combinations of periodic verses non-periodic layer repetitions, custom transmittance functions may be generated. The transmitted optical signal carrier frequency and bandwidth must be carefully selected to maximize transmission and to minimize absorption. A computational optimization of the variables describing the stack's construction strives to maximize the amount of optical signal modulation verses applied voltage. Trade-offs between methods of increasing device performance verses the limitations of fabrication technologies are considered.

  10. Applied Music (Individual Study).

    ERIC Educational Resources Information Center

    Texas Education Agency, Austin.

    Background information and resources to help students in grades 9-12 in Texas pursue an individual study contract in applied music is presented. To fulfill a contract students must publicly perform from memory, with accompaniment as specified, three selections from a list of approved music for their chosen field (instrument or voice). Material…

  11. Essays on Applied Microeconomics

    ERIC Educational Resources Information Center

    Mejia Mantilla, Carolina

    2013-01-01

    Each chapter of this dissertation studies a different question within the field of Applied Microeconomics. The first chapter examines the mid- and long-term effects of the 1998 Asian Crisis on the educational attainment of Indonesian children ages 6 to 18, at the time of the crisis. The effects are identified as deviations from a linear trend for…

  12. Applied research on glucansucrases

    USDA-ARS?s Scientific Manuscript database

    Although glycansucrases have been known for over 70 years, they remain relatively unknown except to a small group of researchers. Practical, applied research on glycansucrases has been focused on certain key areas. The earliest of these was the development of blood plasma extenders from dextran, d...

  13. Applied Vocational Mathematics.

    ERIC Educational Resources Information Center

    South Carolina State Dept. of Education, Columbia. Office of Vocational Education.

    Developed for use in teaching a two-semester, one-unit course, this course guide is intended to aid the high school instructor in teaching mathematical problem-solving and computational skills to vocational education students. The state-adopted textbook for general mathematics III, "Applied General Mathematics" serves as the major…

  14. Applied Linguistics in Europe

    ERIC Educational Resources Information Center

    de Bot, Kees

    2004-01-01

    In this contribution developments in Applied Linguistics in Europe are linked to major social changes that have taken place over the last decades. These include: The decline of the USSR and the end of the cold war; The development of the EEC and the EU and fading of borders; The economic growth of Western Europe; Labor migration from the south to…

  15. Applied Music (Individual Study).

    ERIC Educational Resources Information Center

    Texas Education Agency, Austin.

    Background information and resources to help students in grades 9-12 in Texas pursue an individual study contract in applied music is presented. To fulfill a contract students must publicly perform from memory, with accompaniment as specified, three selections from a list of approved music for their chosen field (instrument or voice). Material…

  16. Applied Behavior Analysis

    ERIC Educational Resources Information Center

    Szapacs, Cindy

    2006-01-01

    Teaching strategies that work for typically developing children often do not work for those diagnosed with an autism spectrum disorder. However, teaching strategies that work for children with autism do work for typically developing children. In this article, the author explains how the principles and concepts of Applied Behavior Analysis can be…

  17. Africa and Applied Linguistics.

    ERIC Educational Resources Information Center

    Makoni, Sinfree, Ed.; Meinhof, Ulrike H., Ed.

    2003-01-01

    This collection of articles includes: "Introducing Applied Linguistics in Africa" (Sinfree Makoni and Ulrike H. Meinhof); "Language Ideology and Politics: A Critical Appraisal of French as Second Official Language in Nigeria" (Tope Omoniyi); "The Democratisation of Indigenous Languages: The Case of Malawi" (Themba…

  18. Applied Statistics with SPSS

    ERIC Educational Resources Information Center

    Huizingh, Eelko K. R. E.

    2007-01-01

    Accessibly written and easy to use, "Applied Statistics Using SPSS" is an all-in-one self-study guide to SPSS and do-it-yourself guide to statistics. What is unique about Eelko Huizingh's approach is that this book is based around the needs of undergraduate students embarking on their own research project, and its self-help style is designed to…

  19. Applied Linguistics in Europe

    ERIC Educational Resources Information Center

    de Bot, Kees

    2004-01-01

    In this contribution developments in Applied Linguistics in Europe are linked to major social changes that have taken place over the last decades. These include: The decline of the USSR and the end of the cold war; The development of the EEC and the EU and fading of borders; The economic growth of Western Europe; Labor migration from the south to…

  20. Africa and Applied Linguistics.

    ERIC Educational Resources Information Center

    Makoni, Sinfree, Ed.; Meinhof, Ulrike H., Ed.

    2003-01-01

    This collection of articles includes: "Introducing Applied Linguistics in Africa" (Sinfree Makoni and Ulrike H. Meinhof); "Language Ideology and Politics: A Critical Appraisal of French as Second Official Language in Nigeria" (Tope Omoniyi); "The Democratisation of Indigenous Languages: The Case of Malawi" (Themba…

  1. Signals: Applying Academic Analytics

    ERIC Educational Resources Information Center

    Arnold, Kimberly E.

    2010-01-01

    Academic analytics helps address the public's desire for institutional accountability with regard to student success, given the widespread concern over the cost of higher education and the difficult economic and budgetary conditions prevailing worldwide. Purdue University's Signals project applies the principles of analytics widely used in…

  2. Essays on Applied Microeconomics

    ERIC Educational Resources Information Center

    Mejia Mantilla, Carolina

    2013-01-01

    Each chapter of this dissertation studies a different question within the field of Applied Microeconomics. The first chapter examines the mid- and long-term effects of the 1998 Asian Crisis on the educational attainment of Indonesian children ages 6 to 18, at the time of the crisis. The effects are identified as deviations from a linear trend for…

  3. Signals: Applying Academic Analytics

    ERIC Educational Resources Information Center

    Arnold, Kimberly E.

    2010-01-01

    Academic analytics helps address the public's desire for institutional accountability with regard to student success, given the widespread concern over the cost of higher education and the difficult economic and budgetary conditions prevailing worldwide. Purdue University's Signals project applies the principles of analytics widely used in…

  4. Applied Statistics with SPSS

    ERIC Educational Resources Information Center

    Huizingh, Eelko K. R. E.

    2007-01-01

    Accessibly written and easy to use, "Applied Statistics Using SPSS" is an all-in-one self-study guide to SPSS and do-it-yourself guide to statistics. What is unique about Eelko Huizingh's approach is that this book is based around the needs of undergraduate students embarking on their own research project, and its self-help style is designed to…

  5. Monolithic high voltage nonlinear transmission line fabrication process

    DOEpatents

    Cooper, G.A.

    1994-10-04

    A process for fabricating sequential inductors and varistor diodes of a monolithic, high voltage, nonlinear, transmission line in GaAs is disclosed. An epitaxially grown laminate is produced by applying a low doped active n-type GaAs layer to an n-plus type GaAs substrate. A heavily doped p-type GaAs layer is applied to the active n-type layer and a heavily doped n-type GaAs layer is applied to the p-type layer. Ohmic contacts are applied to the heavily doped n-type layer where diodes are desired. Multiple layers are then either etched away or Oxygen ion implanted to isolate individual varistor diodes. An insulator is applied between the diodes and a conductive/inductive layer is thereafter applied on top of the insulator layer to complete the process. 6 figs.

  6. Monolithic high voltage nonlinear transmission line fabrication process

    DOEpatents

    Cooper, Gregory A.

    1994-01-01

    A process for fabricating sequential inductors and varactor diodes of a monolithic, high voltage, nonlinear, transmission line in GaAs is disclosed. An epitaxially grown laminate is produced by applying a low doped active n-type GaAs layer to an n-plus type GaAs substrate. A heavily doped p-type GaAs layer is applied to the active n-type layer and a heavily doped n-type GaAs layer is applied to the p-type layer. Ohmic contacts are applied to the heavily doped n-type layer where diodes are desired. Multiple layers are then either etched away or Oxygen ion implanted to isolate individual varactor diodes. An insulator is applied between the diodes and a conductive/inductive layer is thereafter applied on top of the insulator layer to complete the process.

  7. Applied study of optical interconnection link in computer cluster

    NASA Astrophysics Data System (ADS)

    Zhou, Ge; Tian, Jindong; Zhang, Nan; Jing, Wencai; Li, Haifeng

    2000-10-01

    In this paper, some study results to apply fiber link to a computer cluster are presented. The research is based on a ring network topology for a cluster system, which is connected by gigabit/s virtual parallel optical fiber link (VPOFLink) and its driver is for Linux Operating System, the transmission protocol of VPOFLink is compliant with Ethernet standard. We have studied the effect of different types of motherboard on transmission rate of the VPOFLink, and have analyzed the influence of optical interconnection network topology and computer networks protocol on the performance of this optical interconnection computer cluster. The round-trip transmission bandwidth of the VPOFLink have been tested, and the factors that limit transmission bandwidth, such as modes of forwarding data packets in the optical interconnection ring networks, and the size of the link buffer etc., are investigated.

  8. Relevance of Indirect Transmission for Wildlife Disease Surveillance

    PubMed Central

    Lange, Martin; Kramer-Schadt, Stephanie; Thulke, Hans-Hermann

    2016-01-01

    Epidemiological models of infectious diseases are essential tools in support of risk assessment, surveillance design, and contingency planning in public and animal health. Direct pathogen transmission from host to host is an essential process of each host–pathogen system and respective epidemiological modeling concepts. It is widely accepted that numerous diseases involve indirect transmission (IT) through pathogens shed by infectious hosts to their environment. However, epidemiological models largely do not represent pathogen persistence outside the host explicitly. We hypothesize that this simplification might bias management-related model predictions for disease agents that can persist outside their host for a certain time span. We adapted an individual-based, spatially explicit epidemiological model that can mimic both transmission processes. One version explicitly simulated indirect pathogen transmission through a contaminated environment. The second version simulated direct host-to-host transmission only. We aligned the model variants by the transmission potential per infectious host (i.e., basic reproductive number R0) and the spatial transmission kernel of the infection to allow unbiased comparison of predictions. The quantitative model results are provided for the example of surveillance plans for early detection of foot-and-mouth disease in wild boar, a social host. We applied systematic sampling strategies on the serological status of randomly selected host individuals in both models. We compared between the model variants the time to detection and the area affected prior to detection, measures that strongly influence mitigation costs. Moreover, the ideal sampling strategy to detect the infection in a given time frame was compared between both models. We found the simplified, direct transmission model to underestimate necessary sample size by up to one order of magnitude but to overestimate the area put under control measures. Thus, the model

  9. Relevance of Indirect Transmission for Wildlife Disease Surveillance.

    PubMed

    Lange, Martin; Kramer-Schadt, Stephanie; Thulke, Hans-Hermann

    2016-01-01

    Epidemiological models of infectious diseases are essential tools in support of risk assessment, surveillance design, and contingency planning in public and animal health. Direct pathogen transmission from host to host is an essential process of each host-pathogen system and respective epidemiological modeling concepts. It is widely accepted that numerous diseases involve indirect transmission (IT) through pathogens shed by infectious hosts to their environment. However, epidemiological models largely do not represent pathogen persistence outside the host explicitly. We hypothesize that this simplification might bias management-related model predictions for disease agents that can persist outside their host for a certain time span. We adapted an individual-based, spatially explicit epidemiological model that can mimic both transmission processes. One version explicitly simulated indirect pathogen transmission through a contaminated environment. The second version simulated direct host-to-host transmission only. We aligned the model variants by the transmission potential per infectious host (i.e., basic reproductive number R0) and the spatial transmission kernel of the infection to allow unbiased comparison of predictions. The quantitative model results are provided for the example of surveillance plans for early detection of foot-and-mouth disease in wild boar, a social host. We applied systematic sampling strategies on the serological status of randomly selected host individuals in both models. We compared between the model variants the time to detection and the area affected prior to detection, measures that strongly influence mitigation costs. Moreover, the ideal sampling strategy to detect the infection in a given time frame was compared between both models. We found the simplified, direct transmission model to underestimate necessary sample size by up to one order of magnitude but to overestimate the area put under control measures. Thus, the model predictions

  10. Enhancement of transmission rates in quantum memory channels with damping.

    PubMed

    Benenti, Giuliano; D'Arrigo, Antonio; Falci, Giuseppe

    2009-07-10

    We consider the transfer of quantum information down a single-mode quantum transmission line. Such a quantum channel is modeled as a damped harmonic oscillator, the interaction between the information carriers -a train of N qubits- and the oscillator being of the Jaynes-Cummings kind. Memory effects appear if the state of the oscillator is not reset after each channel use. We show that the setup without resetting is convenient in order to increase the transmission rates, both for the transfer of quantum and classical private information. Our results can be applied to the micromaser.

  11. Transmission dynamics of cholera: Mathematical modeling and control strategies

    NASA Astrophysics Data System (ADS)

    Sun, Gui-Quan; Xie, Jun-Hui; Huang, Sheng-He; Jin, Zhen; Li, Ming-Tao; Liu, Liqun

    2017-04-01

    Cholera, as an endemic disease around the world, has generated great threat to human society and caused enormous morbidity and mortality with weak surveillance system. In this paper, we propose a mathematical model to describe the transmission of Cholera. Moreover, basic reproduction number and the global dynamics of the dynamical model are obtained. Then we apply our model to characterize the transmission process of Cholera in China. It was found that, in order to avoid its outbreak in China, it may be better to increase immunization coverage rate and make effort to improve environmental management especially for drinking water. Our results may provide some new insights for elimination of Cholera.

  12. A Generalized Lossy Transmission-Line Model for Tunable Graphene-Based Transmission Lines with Attenuation Phenomenon

    PubMed Central

    Wu, Yongle; Qu, Meijun; Liu, Yuanan

    2016-01-01

    To investigate the frequency shift phenomenon by inserting graphene, a generalized lossy transmission-line model and the related electrical parameter-extraction theory are proposed in this paper. Three kinds of graphene-based transmission lines with attenuation phenomenon including microstrip line, double-side parallel strip line, and uniplanar coplanar waveguide are analyzed under the common conditions where different chemical potentials are loaded on graphene. The values of attenuation constant and phase constant, and the real and imaginary parts of the characteristic impedance of transmission lines are extracted to analyze in details. When the attenuation constant and the reactance part of the characteristic impedance are approximately equal to zero, this kind of transmission line has low or zero insertion loss. On the contrary, the transmission line is under the radiation mode with obvious insertion loss. The phase constant changes linearly under the transmission mode and can be varied with changing of chemical potentials which attributes to the property of frequency tunability. Furthermore, a bandwidth reconfigurable uniplanar coplanar waveguide power divider is simulated to demonstrate that this theory can be applied to the design of three-port devices. In summary, this work provides a strong potential approach and design theory to help design other kinds of terahertz and mid-infrared reconfigurable devices. PMID:27553759

  13. A Generalized Lossy Transmission-Line Model for Tunable Graphene-Based Transmission Lines with Attenuation Phenomenon

    NASA Astrophysics Data System (ADS)

    Wu, Yongle; Qu, Meijun; Liu, Yuanan

    2016-08-01

    To investigate the frequency shift phenomenon by inserting graphene, a generalized lossy transmission-line model and the related electrical parameter-extraction theory are proposed in this paper. Three kinds of graphene-based transmission lines with attenuation phenomenon including microstrip line, double-side parallel strip line, and uniplanar coplanar waveguide are analyzed under the common conditions where different chemical potentials are loaded on graphene. The values of attenuation constant and phase constant, and the real and imaginary parts of the characteristic impedance of transmission lines are extracted to analyze in details. When the attenuation constant and the reactance part of the characteristic impedance are approximately equal to zero, this kind of transmission line has low or zero insertion loss. On the contrary, the transmission line is under the radiation mode with obvious insertion loss. The phase constant changes linearly under the transmission mode and can be varied with changing of chemical potentials which attributes to the property of frequency tunability. Furthermore, a bandwidth reconfigurable uniplanar coplanar waveguide power divider is simulated to demonstrate that this theory can be applied to the design of three-port devices. In summary, this work provides a strong potential approach and design theory to help design other kinds of terahertz and mid-infrared reconfigurable devices.

  14. A Generalized Lossy Transmission-Line Model for Tunable Graphene-Based Transmission Lines with Attenuation Phenomenon.

    PubMed

    Wu, Yongle; Qu, Meijun; Liu, Yuanan

    2016-08-24

    To investigate the frequency shift phenomenon by inserting graphene, a generalized lossy transmission-line model and the related electrical parameter-extraction theory are proposed in this paper. Three kinds of graphene-based transmission lines with attenuation phenomenon including microstrip line, double-side parallel strip line, and uniplanar coplanar waveguide are analyzed under the common conditions where different chemical potentials are loaded on graphene. The values of attenuation constant and phase constant, and the real and imaginary parts of the characteristic impedance of transmission lines are extracted to analyze in details. When the attenuation constant and the reactance part of the characteristic impedance are approximately equal to zero, this kind of transmission line has low or zero insertion loss. On the contrary, the transmission line is under the radiation mode with obvious insertion loss. The phase constant changes linearly under the transmission mode and can be varied with changing of chemical potentials which attributes to the property of frequency tunability. Furthermore, a bandwidth reconfigurable uniplanar coplanar waveguide power divider is simulated to demonstrate that this theory can be applied to the design of three-port devices. In summary, this work provides a strong potential approach and design theory to help design other kinds of terahertz and mid-infrared reconfigurable devices.

  15. Midwest Transmission Workshop III Summary

    SciTech Connect

    Kevin Bryan

    2003-03-12

    OAK-B135 On March 12-13, 2002, the National Wind Coordinating Committee (NWCC), in cooperation with regional stakeholders, held a two-day workshop: Planning for Electrical Transmission Needs in the Upper Midwest. The workshop was the outgrowth of an effort to develop a forum and process for consideration of transmission options that strives for equitable allocation of benefits and impacts among all affected parties. The goal of this workshop was to provide a catalyst for an enhanced, inclusive process for transmission planning with participation of and acceptance by all affected stakeholders. Participants in the meeting included representatives of state and regional regulatory agencies, utilities and power generators, the wind industry, environmental and landowner interests, and other interested parties (see Attachment A for a list of meeting participants).

  16. Clustering, climate and dengue transmission.

    PubMed

    Junxiong, Pang; Yee-Sin, Leo

    2015-06-01

    Dengue is currently the most rapidly spreading vector-borne disease, with an increasing burden over recent decades. Currently, neither a licensed vaccine nor an effective anti-viral therapy is available, and treatment largely remains supportive. Current vector control strategies to prevent and reduce dengue transmission are neither efficient nor sustainable as long-term interventions. Increased globalization and climate change have been reported to influence dengue transmission. In this article, we reviewed the non-climatic and climatic risk factors which facilitate dengue transmission. Sustainable and effective interventions to reduce the increasing threat from dengue would require the integration of these risk factors into current and future prevention strategies, including dengue vaccination, as well as the continuous support and commitment from the political and environmental stakeholders.

  17. Transmission lines emulating moving media

    NASA Astrophysics Data System (ADS)

    Vehmas, J.; Hrabar, S.; Tretyakov, S.

    2014-09-01

    In this paper, we show how the electromagnetic phenomena in moving magnetodielectric media can be emulated using artificial composite structures at rest. In particular, we introduce nonreciprocal periodically loaded transmission lines, which support waves obeying the same rules as plane electromagnetic waves in moving media. Because the actual physical structure is at rest, in these transmission lines there are no fundamental limitations on the velocity values, which may take values larger than the speed of light or even complex values (considering complex amplitudes in the time-harmonic regime). An example circuit of a unit cell of a ‘moving’ transmission line is presented and analyzed both numerically and experimentally. The special case of a composite right-/left- handed host line is also studied numerically. Besides the fundamental interest, the study is relevant for potential applications in realizing engineered materials for various transformations of electromagnetic fields.

  18. Remote control apparatus for transmission

    SciTech Connect

    Ebina, A.

    1989-01-10

    A remote control apparatus for a transmission is described, comprising: means for sending a signal representing an operation state of a change lever; auxiliary power means, remote-controlled by the change lever, for changing a gear position of the transmission and sending a signal representing the gear position; and control means for controlling an operation of the auxiliary power means in accordance with the change lever operation state signal and gear position signal, the control means being provided with neutral position holding means comprises signal transmission delay means. This comprises means for detecting that the shift path on which the striker presently exists is different from the shift path instructed according to the change lever operating signal, then detecting that the striker has reached the first neutral position according to the neutral position signal and generating a neutral position detection signal.

  19. Plasmodium vivax Transmission in Africa

    PubMed Central

    Howes, Rosalind E.; Reiner Jr., Robert C.; Battle, Katherine E.; Longbottom, Joshua; Mappin, Bonnie; Ordanovich, Dariya; Tatem, Andrew J.; Drakeley, Chris; Gething, Peter W.; Zimmerman, Peter A.; Smith, David L.; Hay, Simon I.

    2015-01-01

    Malaria in sub-Saharan Africa has historically been almost exclusively attributed to Plasmodium falciparum (Pf). Current diagnostic and surveillance systems in much of sub-Saharan Africa are not designed to identify or report non-Pf human malaria infections accurately, resulting in a dearth of routine epidemiological data about their significance. The high prevalence of Duffy negativity provided a rationale for excluding the possibility of Plasmodium vivax (Pv) transmission. However, review of varied evidence sources including traveller infections, community prevalence surveys, local clinical case reports, entomological and serological studies contradicts this viewpoint. Here, these data reports are weighted in a unified framework to reflect the strength of evidence of indigenous Pv transmission in terms of diagnostic specificity, size of individual reports and corroboration between evidence sources. Direct evidence was reported from 21 of the 47 malaria-endemic countries studied, while 42 countries were attributed with infections of visiting travellers. Overall, moderate to conclusive evidence of transmission was available from 18 countries, distributed across all parts of the continent. Approximately 86.6 million Duffy positive hosts were at risk of infection in Africa in 2015. Analysis of the mechanisms sustaining Pv transmission across this continent of low frequency of susceptible hosts found that reports of Pv prevalence were consistent with transmission being potentially limited to Duffy positive populations. Finally, reports of apparent Duffy-independent transmission are discussed. While Pv is evidently not a major malaria parasite across most of sub-Saharan Africa, the evidence presented here highlights its widespread low-level endemicity. An increased awareness of Pv as a potential malaria parasite, coupled with policy shifts towards species-specific diagnostics and reporting, will allow a robust assessment of the public health significance of Pv, as well

  20. Plasmodium vivax Transmission in Africa.

    PubMed

    Howes, Rosalind E; Reiner, Robert C; Battle, Katherine E; Longbottom, Joshua; Mappin, Bonnie; Ordanovich, Dariya; Tatem, Andrew J; Drakeley, Chris; Gething, Peter W; Zimmerman, Peter A; Smith, David L; Hay, Simon I

    2015-11-01

    Malaria in sub-Saharan Africa has historically been almost exclusively attributed to Plasmodium falciparum (Pf). Current diagnostic and surveillance systems in much of sub-Saharan Africa are not designed to identify or report non-Pf human malaria infections accurately, resulting in a dearth of routine epidemiological data about their significance. The high prevalence of Duffy negativity provided a rationale for excluding the possibility of Plasmodium vivax (Pv) transmission. However, review of varied evidence sources including traveller infections, community prevalence surveys, local clinical case reports, entomological and serological studies contradicts this viewpoint. Here, these data reports are weighted in a unified framework to reflect the strength of evidence of indigenous Pv transmission in terms of diagnostic specificity, size of individual reports and corroboration between evidence sources. Direct evidence was reported from 21 of the 47 malaria-endemic countries studied, while 42 countries were attributed with infections of visiting travellers. Overall, moderate to conclusive evidence of transmission was available from 18 countries, distributed across all parts of the continent. Approximately 86.6 million Duffy positive hosts were at risk of infection in Africa in 2015. Analysis of the mechanisms sustaining Pv transmission across this continent of low frequency of susceptible hosts found that reports of Pv prevalence were consistent with transmission being potentially limited to Duffy positive populations. Finally, reports of apparent Duffy-independent transmission are discussed. While Pv is evidently not a major malaria parasite across most of sub-Saharan Africa, the evidence presented here highlights its widespread low-level endemicity. An increased awareness of Pv as a potential malaria parasite, coupled with policy shifts towards species-specific diagnostics and reporting, will allow a robust assessment of the public health significance of Pv, as well

  1. Intercultural Transmission and Intergenerational Transmission in Immigrant Families.

    ERIC Educational Resources Information Center

    Nauck, Bernhard

    2001-01-01

    Examined the impact of intergenerational transmission processes on the intercultural contact and ethnic identification of second generation adolescents from five migrant groups in Germany, distinguishing four possible outcomes of intercultural contact (integration, assimilation, segregation, and marginalization). Data from interviews with same-sex…

  2. Electrical Transmission on the Lunar Surface. Part 1; DC Transmission

    NASA Technical Reports Server (NTRS)

    Gordon, Lloyd B.

    2001-01-01

    This report summarizes a portion of the results from a grant at Auburn University to study the electrical and thermal energy management for lunar facilities. Over the past year (June 1989 to May 1990) the following topics have been investigated: June 1989 to November 1989 - Literature survey, assessment of lunar power needs, and overview study of the requirements of a lunar power system; November 1989 to April 1990 - Develop models for the study of dc electrical power transmission lines for the lunar surface; March 1990 to May 1990 - Develop models for the study of ac electrical power transmission lines for the lunar surface. Because of the large amount of information in the model development and application to a wide parameter space this report is being bound separately. This report specifically contains the model development and parameter study for dc electrical power transmission lines. The end of the funding year (May 1990) will conclude with an annual report including the literature survey, the overview of the requirements of a lunar power system, and summaries of the dc and ac models of electrical transmission lines.

  3. Intercultural Transmission and Intergenerational Transmission in Immigrant Families.

    ERIC Educational Resources Information Center

    Nauck, Bernhard

    2001-01-01

    Examined the impact of intergenerational transmission processes on the intercultural contact and ethnic identification of second generation adolescents from five migrant groups in Germany, distinguishing four possible outcomes of intercultural contact (integration, assimilation, segregation, and marginalization). Data from interviews with same-sex…

  4. Auctionable fixed transmission rights for congestion management

    NASA Astrophysics Data System (ADS)

    Alomoush, Muwaffaq Irsheid

    Electric power deregulation has proposed a major change to the regulated utility monopoly. The change manifests the main part of engineers' efforts to reshape three components of today's regulated monopoly: generation, distribution and transmission. In this open access deregulated power market, transmission network plays a major role, and transmission congestion is a major problem that requires further consideration especially when inter-zonal/intra-zonal scheme is implemented. Declaring that engineering studies and experience are the criteria to define zonal boundaries or defining a zone based on the fact that a zone is a densely interconnected area (lake) and paths connecting these densely interconnected areas are inter-zonal lines will render insufficient and fuzzy definitions. Moreover, a congestion problem formulation should take into consideration interactions between intra-zonal and inter-zonal flows and their effects on power systems. In this thesis, we introduce a procedure for minimizing the number of adjustments of preferred schedules to alleviate congestion and apply control schemes to minimize interactions between zones. In addition, we give the zone definition a certain criterion based on the Locational Marginal Price (LMP). This concept will be used to define congestion zonal boundaries and to decide whether any zone should be merged with another zone or split into new zones. The thesis presents a unified scheme that combines zonal and FTR schemes to manage congestion. This combined scheme is utilized with LMPs to define zonal boundaries more appropriately. The presented scheme gains the best features of the FTR scheme, which are providing financial certainty, maximizing the efficient use of the system and making users pay for the actual use of congested paths. LMPs may give an indication of the impact of wheeling transactions, and calculations of and comparisons of LMPs with and without wheeling transactions should be adequate criteria to approve

  5. Quality in applied science

    NASA Astrophysics Data System (ADS)

    Sten, T.

    1993-12-01

    Science is in many senses a special kind of craft and only skilled craftsmen are able to distinguish good work from bad. Due to the variation in approaches, methods and even philosophical basis, it is nearly impossible to derive a general set of quality criteria for scientific work outside specific research traditions. Applied science introduces a new set of quality criteria having to do with the application of results in practical situations and policy making. A scientist doing basic research relates mainly to the scientific community of which he is a member, while in applied contract research the scientist has to consider the impact of his results both for the immediate users and upon interest groups possibly being affected. Application thus raises a whole new set of requirements having to do with business ethics, policy consequences and societal ethics in general.

  6. Equalization of data transmission cable

    NASA Technical Reports Server (NTRS)

    Zobrist, G. W.

    1975-01-01

    The paper describes an equalization approach utilizing a simple RLC network which can obtain a maximum slope of -12dB/octave for reshaping the frequency characteristics of a data transmission cable, so that data may be generated and detected at the receiver. An experimental procedure for determining equalizer design specifications using distortion analysis is presented. It was found that for lengths of 16 PEV-L cable of up to 5 miles and data transmission rates of up to 1 Mbs, the equalization scheme proposed here is sufficient for generation of the data with acceptable error rates.

  7. Power transmission line monitoring system

    SciTech Connect

    Seppa, T.O.

    1993-08-17

    A method for monitoring the sag of an overhead power transmission line comprising the steps of: measuring the tension of the power line; producing an electrical signal representative of the tension measurement; processing said electrical signal in accordance with a predetermined tension-sag relationship to produce a second signal which is a function of sag of the power line; transmitting said second electrical signal to a distant location in a predetermined transmission mode; receiving the second signal at the distant location whereby current in the power line is adjusted in accordance with the received second signal.

  8. Electromagnetic Transmission Through Resonant Structures

    NASA Astrophysics Data System (ADS)

    Young, Steven M.

    Electromagnetic resonators store energy in the form of oscillatory electric and magnetic fields and gradually exchange that energy by coupling with their environment. This coupling process can have profound effects on the transmission and reflection properties of nearby interfaces, with rapid transitions from high transmittance to high reflectance over narrow frequency ranges, and has been exploited to design useful optical components such as spectral filters and dielectric mirrors. This dissertation includes analytic, numeric, and experimental investigations of three different electromagnetic resonators, each based on a different method of confining electromagnetic fields near the region of interest. First, we show that a structure with two parallel conducting plates, each containing a subwavelength slit, supports a localized resonant mode bound to the slits and therefore exhibits (in the absence of nonradiative losses), perfect resonant transmission over a narrow frequency range. In practice, the transmission is limited by conduction losses in the sidewalls; nevertheless, experimental results at 10 GHz show a narrowband transmission enhancement by a factor of 104 compared to the non-resonant transmission, with quality factor (ratio of frequency to peak width) Q ~ 3000. Second, we describe a narrowband transmission filter based on a single-layer dielectric grating. We use a group theory analysis to show that, due to their symmetry, several of the grating modes cannot couple to light at normal incidence, while several others have extremely large coupling. We then show how selectively breaking the system symmetry using off-normal light incidence can produce transmission peaks by enabling weak coupling to some of the previously protected modes. The narrowband filtering capabilities are validated by an experimental demonstration in the long wavelength infrared, showing transmission peaks of quality factor Q ~ 100 within a free-spectral range of 8-15 mum. Third, we

  9. 47 CFR 80.89 - Unauthorized transmissions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 5 2013-10-01 2013-10-01 false Unauthorized transmissions. 80.89 Section 80.89... transmissions. Stations must not: (a) Engage in superfluous radio-communication. (b) Use telephony on 243 MHz... transmission of distress, alarm, urgency, or safety signals or messages, or to test transmissions. (e)...

  10. 40 CFR 86.128-79 - Transmissions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 19 2013-07-01 2013-07-01 false Transmissions. 86.128-79 Section 86...-Duty Vehicles; Test Procedures § 86.128-79 Transmissions. (a) All test conditions, except as noted... automatic transmissions in “Drive” and the wheels braked; manual transmissions shall be in gear with...

  11. 47 CFR 80.89 - Unauthorized transmissions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 5 2014-10-01 2014-10-01 false Unauthorized transmissions. 80.89 Section 80.89... transmissions. Stations must not: (a) Engage in superfluous radio-communication. (b) Use telephony on 243 MHz... transmission of distress, alarm, urgency, or safety signals or messages, or to test transmissions. (e)...

  12. 40 CFR 86.128-79 - Transmissions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 19 2014-07-01 2014-07-01 false Transmissions. 86.128-79 Section 86...-Duty Vehicles; Test Procedures § 86.128-79 Transmissions. (a) All test conditions, except as noted... automatic transmissions in “Drive” and the wheels braked; manual transmissions shall be in gear with...

  13. 47 CFR 80.89 - Unauthorized transmissions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 5 2011-10-01 2011-10-01 false Unauthorized transmissions. 80.89 Section 80.89... transmissions. Stations must not: (a) Engage in superfluous radio-communication. (b) Use telephony on 243 MHz... transmission of distress, alarm, urgency, or safety signals or messages, or to test transmissions. (e)...

  14. 40 CFR 86.128-79 - Transmissions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 19 2012-07-01 2012-07-01 false Transmissions. 86.128-79 Section 86...-Duty Vehicles; Test Procedures § 86.128-79 Transmissions. (a) All test conditions, except as noted... automatic transmissions in “Drive” and the wheels braked; manual transmissions shall be in gear with...

  15. 47 CFR 80.89 - Unauthorized transmissions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 5 2012-10-01 2012-10-01 false Unauthorized transmissions. 80.89 Section 80.89... transmissions. Stations must not: (a) Engage in superfluous radio-communication. (b) Use telephony on 243 MHz... transmission of distress, alarm, urgency, or safety signals or messages, or to test transmissions. (e)...

  16. Omega time transmissions and receiving requirements

    NASA Technical Reports Server (NTRS)

    Chi, A. R.; Fletcher, L. A.; Casselman, C. J.

    1971-01-01

    A short history is given of the development of dual VLF time transmission techniques. The theory of time recovery from the relative phase of the dual frequency transmission is presented. The transmission and receiving requirements for cycle identification and cycle ambiguity resolution are described. Finally, an experiment to test the capability of time transmission of the OMEGA system is proposed

  17. Applied Meteorology Unit (AMU)

    NASA Technical Reports Server (NTRS)

    Bauman, William; Lambert, Winifred; Wheeler, Mark; Barrett, Joe; Watson, Leela

    2007-01-01

    This report summarizes the Applied Meteorology Unit (AMU) activities for the second quarter of Fiscal Year 2007 (January - March 2007). Tasks reported on are: Obiective Lightning Probability Tool, Peak Wind Tool for General Forecasting, Situational Lightning Climatologies for Central Florida, Anvil Threat Corridor Forecast Tool in AWIPS, Volume Averaqed Heiqht lnteq rated Radar Reflectivity (VAHIRR), Tower Data Skew-t Tool, and Weather Research and Forecastini (WRF) Model Sensitivity Study

  18. Nanoengineering Applied to Tungsten

    DTIC Science & Technology

    2006-05-01

    and R. Z. Valiev ARL-RP- 123 May 2006 A reprint from the Proceedings of the Sixth International Conference on Tungsten, Refractory...Ground, MD 21005-5066 ARL-RP- 123 May 2006 Nanoengineering Applied to Tungsten Q. Wei University of North Carolina-Charlotte B. E...ORGANIZATION REPORT NUMBER ARL-RP- 123 10. SPONSOR/MONITOR’S ACRONYM(S) 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 11. SPONSOR

  19. Applied Cognitive Science.

    DTIC Science & Technology

    1983-12-01

    Cognitive Science Inter action lReplacement Focus on Person Focus on System m~odels ~Ment Models M;7l t Systems change Explanation and Cognitive Undestanding ... relationships between elements but leaves specific attributes of the elements behind. Hence it is a mapping only of the Applied Cognitive Science 12...structural relationships between elements rather than a complete mapping of all the properties of elements in the two systems. We can illustrate these ideas

  20. Applied biotechnology in nematology.

    PubMed

    Caswell-Chen, E P; Williamson, V M; Westerdahl, B B

    1993-12-01

    During the past two decades, rapid advances in biotechnology and molecular biology have affected the understanding and treatment of human and plant diseases. The human and Caenorhabditis elegans genome-sequencing projects promise further techniques and results useful to applied nematology. Of course, biotechnology is not a panacea for nematological problems, but it provides many powerful tools that have potential use in applied biology and nematode management. The tools will facilitate research on a range of previously intractable problems in nematology, from identification of species and pathotypes to the development of resistant cultivars that have been inaccessible because of technical limitations. However, to those unfamiliar or not directly involved with the new technologies and their extensive terminology, the benefits of the advances in biotechnology may not be readily discerned. The sustainable agriculture of the future will require ecology-based management, and successful integrated nematode management will depend on combinations of control tactics to reduce nematode numbers. In this review we discuss how biotechnology may influence nematode management, define terminology relative to potential applications, and present current and future avenues of research in applied nematology, including species identification, race and pathotype identification, development of resistant cultivars, definition of nematode-host interactions, nematode population dynamics, establishment of optimal rotations, the ecology of biological control and development of useful biological control agents, and the design of novel nematicides.