Wang, Ming; Roberts, David L.; Paschke, Rosemary; Shea, Thomas M.; Masters, Bettie Sue Siler; Kim, Jung-Ja P.
1997-01-01
Microsomal NADPH–cytochrome P450 reductase (CPR) is one of only two mammalian enzymes known to contain both FAD and FMN, the other being nitric-oxide synthase. CPR is a membrane-bound protein and catalyzes electron transfer from NADPH to all known microsomal cytochromes P450. The structure of rat liver CPR, expressed in Escherichia coli and solubilized by limited trypsinolysis, has been determined by x-ray crystallography at 2.6 Å resolution. The molecule is composed of four structural domains: (from the N- to C- termini) the FMN-binding domain, the connecting domain, and the FAD- and NADPH-binding domains. The FMN-binding domain is similar to the structure of flavodoxin, whereas the two C-terminal dinucleotide-binding domains are similar to those of ferredoxin–NADP+ reductase (FNR). The connecting domain, situated between the FMN-binding and FNR-like domains, is responsible for the relative orientation of the other domains, ensuring the proper alignment of the two flavins necessary for efficient electron transfer. The two flavin isoalloxazine rings are juxtaposed, with the closest distance between them being about 4 Å. The bowl-shaped surface near the FMN-binding site is likely the docking site of cytochrome c and the physiological redox partners, including cytochromes P450 and b5 and heme oxygenase. PMID:9237990
Molecular determinants for FMN-binding in Desulfovibrio gigas flavoredoxin.
Broco, Manuela; Soares, Cláudio M; Oliveira, Solange; Mayhew, Stephen G; Rodrigues-Pousada, Claudina
2007-09-18
Flavoredoxin participates in Desulfovibrio gigas thiosulfate reduction pathway. Its 3-dimensional model was generated allowing the oxidized riboflavin-5'-phosphate (FMN) site to be predicted. Residues likely to be involved in FMN-binding were identified (N29, W35, T56, K92, H131 and F164) and mutated to alanine. Fluorescence titration with apoprotein showed that FMN is strongly bound in the wild-type protein. Comparison of K(d) values for mutants suggests that interactions with the phosphate group of FMN, contribute more to binding than the interactions with the isoalloxazine ring. The redox potential of bound FMN determined for wild-type and mutants revealed shifts to less negative values. These findings were correlated with the protein structure in order to contribute to a better understanding of the structure-function relationships in flavoredoxin.
Sempombe, Joseph; Elmore, Bradley O; Sun, Xi; Dupont, Andrea; Ghosh, Dipak K; Guillemette, J Guy; Kirk, Martin L; Feng, Changjian
2009-05-27
The nitric oxide synthase (NOS) output state for NO production is a complex of the flavin mononucleotide (FMN)-binding domain and the heme domain, and thereby it facilitates the interdomain electron transfer from the FMN to the catalytic heme site. Emerging evidence suggests that interdomain FMN-heme interactions are important in the formation of the output state because they guide the docking of the FMN domain to the heme domain. In this study, notable effects of mutations in the adjacent FMN domain on the heme structure in a human iNOS bidomain oxygenase/FMN construct have been observed by using low-temperature magnetic circular dichroism (MCD) spectroscopy. The comparative MCD study of wild-type and mutant proteins clearly indicates that a properly docked FMN domain contributes to the observed L-Arg perturbation of the heme MCD spectrum in the wild-type protein and that the conserved surface residues in the FMN domain (E546 and E603) play key roles in facilitating a productive alignment of the FMN and heme domains in iNOS.
Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch
DOE Office of Scientific and Technical Information (OSTI.GOV)
Serganov, A.; Huang, L; Patel, D
2009-01-01
The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains.more » FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.« less
Flavin binding to the deca-heme cytochrome MtrC: Insights from computational molecular simulation
Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen
2015-12-15
Here, certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as “extracellular respiration”. Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrCmore » from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (K d) = 490 μM, in good agreement with recent experimental estimates, K d = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration.« less
Okamoto, Akihiro; Kalathil, Shafeer; Deng, Xiao; Hashimoto, Kazuhito; Nakamura, Ryuhei; Nealson, Kenneth H
2014-07-11
The variety of solid surfaces to and from which microbes can deliver electrons by extracellular electron transport (EET) processes via outer-membrane c-type cytochromes (OM c-Cyts) expands the importance of microbial respiration in natural environments and industrial applications. Here, we demonstrate that the bifurcated EET pathway of OM c-Cyts sustains the diversity of the EET surface in Shewanella oneidensis MR-1 via specific binding with cell-secreted flavin mononucleotide (FMN) and riboflavin (RF). Microbial current production and whole-cell differential pulse voltammetry revealed that RF and FMN enhance EET as bound cofactors in a similar manner. Conversely, FMN and RF were clearly differentiated in the EET enhancement by gene-deletion of OM c-Cyts and the dependency of the electrode potential and pH. These results indicate that RF and FMN have specific binding sites in OM c-Cyts and highlight the potential roles of these flavin-cytochrome complexes in controlling the rate of electron transfer to surfaces with diverse potential and pH.
Sheng, Yinghong; Zhong, Linghao; Guo, Dahai; Lau, Gavin; Feng, Changjian
2015-12-01
Calmodulin (CaM) binding to nitric oxide synthase (NOS) enables a conformational change, in which the FMN domain shuttles between the FAD and heme domains to deliver electrons to the active site heme center. A clear understanding of this large conformational change is critical, since this step is the rate-limiting in NOS catalysis. Herein molecular dynamics simulations were conducted on a model of an oxygenase/FMN (oxyFMN) construct of human inducible NOS (iNOS). This is to investigate the structural rearrangements and the domain interactions related to the FMN-heme interdomain electron transfer (IET). We carried out simulations on the iNOS oxyFMN·CaM complex models in [Fe(III)][FMNH(-)] and [Fe(II)][FMNH] oxidation states, the pre- and post-IET states. The comparison of the dynamics and conformations of the iNOS construct at the two oxidation states has allowed us to identify key factors related to facilitating the FMN-heme IET process. The computational results demonstrated, for the first time, that the conformational change is redox-dependent. Predictions of the key interacting sites in optimal interdomain FMN/heme docking are well supported by experimental data in the literature. An intra-subunit pivot region is predicted to modulate the FMN domain motion and correlate with existence of a bottleneck in the conformational sampling that leads to the electron transfer-competent state. Interactions of the residues identified in this work are proposed to ensure that the FMN domain moves with appropriate degrees of freedom and docks to proper positions at the heme domain, resulting in efficient IET and nitric oxide production. Copyright © 2015 Elsevier Inc. All rights reserved.
Rangarajan, Erumbi S.; Li, Yunge; Iannuzzi, Pietro; Tocilj, Ante; Hung, Li-Wei; Matte, Allan; Cygler, Miroslaw
2004-01-01
The crystal structure of the flavoprotein Pad1 from Escherichia coli O157:H7 complexed with the cofactor FMN has been determined by the multiple anomalous diffraction method and refined at 2.0 Å resolution. This protein is a paralog of UbiX (3-octaprenyl-4-hydroxybenzoate carboxylyase, 51% sequence identity) that catalyzes the third step in ubiquinone biosynthesis and to Saccharomyces cerevisiae Pad1 (54% identity), an enzyme that confers resistance to the antimicrobial compounds phenylacrylic acids through decarbox-ylation of these compounds. Each Pad1 monomer consists of a typical Rossmann fold containing a non–covalently bound molecule of FMN. The fold of Pad1 is similar to MrsD, an enzyme associated with lantibiotic synthesis; EpiD, a peptidyl-cysteine decarboxylase; and AtHAL3a, the enzyme, which decarboxylates 4′-phosphopantothenoylcysteine to 4′-phosphopantetheine during coenzyme A biosynthesis, all with a similar location of the FMN binding site at the interface between two monomers, yet each having little sequence similarity to one another. All of these proteins associate into oligomers, with a trimer forming the common structural unit in each case. In MrsD and EpiD, which belong to the homo-dodecameric flavin-containing cysteine decarboxylase (HFCD) family, these trimers associate further into dodecamers. Pad1 also forms dodecamers, although the association of the trimers is completely different, resulting in exposure of a different side of the trimer unit to the solvent. This exposure affects the location of the substrate binding site and, specifically, its access to the FMN cofactor. Therefore, Pad1 forms a separate family, distinguishable from the HFCD family. PMID:15459342
Russell, Thomas R; Tu, Shiao-Chun
2004-10-12
Homodimeric FRD(Aa) Class I is an NADH:flavin oxidoreductase from Aminobacter aminovorans. It is unusual because it contains an FMN cofactor but utilizes a sequential-ordered kinetic mechanism. Because little is known about NADH-specific flavin reductases in general and FRD(Aa) in particular, this study aimed to further explore FRD(Aa) by identifying the functionalities of a key residue. A sequence alignment of FRD(Aa) with several known and hypothetical flavoproteins in the same subfamily reveals within the flavin reductase active-site domain a conserved GDH motif, which is believed to be responsible for the enzyme and NADH interaction. Mutation of the His140 in this GDH motif to alanine reduced FRD(Aa) activity to <3%. An ultrafiltration assay and fluorescence quenching demonstrated that H140A FRD(Aa) binds FMN in the same 1:1 stoichiometric ratio as the wild-type enzyme, but with slightly weakened affinity (K(d) = 0.9 microM). Anaerobic stopped-flow studies were carried out using both the native and mutated FRD(Aa). Similar to the native enzyme, H140A FRD(Aa) was also able to reduce the FMN cofactor by NADH although much less efficiently. Kinetic analysis of anaerobic reduction measurements indicated that the His140 residue of FRD(Aa) was essential to NADH binding, as well as important for the reduction of the FMN cofactor. For the native enzyme, the cofactor reduction was followed by at least one slower step in the catalytic pathway.
Liger, Dominique; Graille, Marc; Zhou, Cong-Zhao; Leulliot, Nicolas; Quevillon-Cheruel, Sophie; Blondeau, Karine; Janin, Joël; van Tilbeurgh, Herman
2004-08-13
Flavodoxins are involved in a variety of electron transfer reactions that are essential for life. Although FMN-binding proteins are well characterized in prokaryotic organisms, information is scarce for eukaryotic flavodoxins. We describe the 2.0-A resolution crystal structure of the Saccharomyces cerevisiae YLR011w gene product, a predicted flavoprotein. YLR011wp indeed adopts a flavodoxin fold, binds the FMN cofactor, and self-associates as a homodimer. Despite the absence of the flavodoxin key fingerprint motif involved in FMN binding, YLR011wp binds this cofactor in a manner very analogous to classical flavodoxins. YLR011wp closest structural homologue is the homodimeric Bacillus subtilis Yhda protein (25% sequence identity) whose homodimer perfectly superimposes onto the YLR011wp one. Yhda, whose function is not documented, has 53% sequence identity with the Bacillus sp. OY1-2 azoreductase. We show that YLR011wp has an NAD(P)H-dependent FMN reductase and a strong ferricyanide reductase activity. We further demonstrate a weak but specific reductive activity on azo dyes and nitrocompounds.
Montaville, Pierre; Kühn, Sonja; Compper, Christel; Carlier, Marie-France
2016-01-01
Formin 2 (Fmn2), a member of the FMN family of formins, plays an important role in early development. This formin cooperates with profilin and Spire, a WASP homology domain 2 (WH2) repeat protein, to stimulate assembly of a dynamic cytoplasmic actin meshwork that facilitates translocation of the meiotic spindle in asymmetric division of mouse oocytes. The kinase-like non-catalytic domain (KIND) of Spire directly interacts with the C-terminal extension of the formin homology domain 2 (FH2) domain of Fmn2, called FSI. This direct interaction is required for the synergy between the two proteins in actin assembly. We have recently demonstrated how Spire, which caps barbed ends via its WH2 domains, activates Fmn2. Fmn2 by itself associates very poorly to filament barbed ends but is rapidly recruited to Spire-capped barbed ends via the KIND domain, and it subsequently displaces Spire from the barbed end to elicit rapid processive assembly from profilin·actin. Here, we address the mechanism by which Spire and Fmn2 compete at barbed ends and the role of FSI in orchestrating this competition as well as in the processivity of Fmn2. We have combined microcalorimetric, fluorescence, and hydrodynamic binding assays, as well as bulk solution and single filament measurements of actin assembly, to show that removal of FSI converts Fmn2 into a Capping Protein. This activity is mimicked by association of KIND to Fmn2. In addition, FSI binds actin at filament barbed ends as a weak capper and plays a role in displacing the WH2 domains of Spire from actin, thus allowing the association of actin-binding regions of FH2 to the barbed end. PMID:26668326
Buttet, Géraldine F.; Willemin, Mathilde S.; Hamelin, Romain; Rupakula, Aamani; Maillard, Julien
2018-01-01
Organohalide respiration (OHR) is the energy metabolism of anaerobic bacteria able to use halogenated organic compounds as terminal electron acceptors. While the terminal enzymes in OHR, so-called reductive dehalogenases, are well-characterized, the identity of proteins potentially involved in electron transfer to the terminal enzymes remains elusive. Among the accessory genes identified in OHR gene clusters, the C subunit (rdhC) could well code for the missing redox protein between the quinol pool and the reductive dehalogenase, although it was initially proposed to act as transcriptional regulator. RdhC sequences are characterized by the presence of multiple transmembrane segments, a flavin mononucleotide (FMN) binding motif and two conserved CX3CP motifs. Based on these features, we propose a curated selection of RdhC proteins identified in general sequence databases. Beside the Firmicutes from which RdhC sequences were initially identified, the identified sequences belong to three additional phyla, the Chloroflexi, the Proteobacteria, and the Bacteriodetes. The diversity of RdhC sequences mostly respects the phylogenetic distribution, suggesting that rdhC genes emerged relatively early in the evolution of the OHR metabolism. PceC, the C subunit of the tetrachloroethene (PCE) reductive dehalogenase is encoded by the conserved pceABCT gene cluster identified in Dehalobacter restrictus PER-K23 and in several strains of Desulfitobacterium hafniense. Surfaceome analysis of D. restrictus cells confirmed the predicted topology of the FMN-binding domain (FBD) of PceC that is the exocytoplasmic face of the membrane. Starting from inclusion bodies of a recombinant FBD protein, strategies for successful assembly of the FMN cofactor and refolding were achieved with the use of the flavin-trafficking protein from D. hafniense TCE1. Mass spectrometry analysis and site-directed mutagenesis of rFBD revealed that threonine-168 of PceC is binding FMN covalently. Our results suggest that PceC, and more generally RdhC proteins, may play a role in electron transfer in the metabolism of OHR. PMID:29740408
Rode, Ambadas B; Endoh, Tamaki; Sugimoto, Naoki
2018-06-04
In bacteria, the binding between the riboswitch aptamer domain and ligand is regulated by environmental cues, such as low Mg 2+ in macrophages during pathogenesis to ensure spatiotemporal expression of virulence genes. Binding was investigated between the flavin mononucleotide (FMN) riboswitch aptamer and its anionic ligand in the presence of molecular crowding agent without Mg 2+ ion, which mimics pathogenic conditions. Structural, kinetic, and thermodynamic analyses under the crowding revealed more dynamic conformational rearrangements of the FMN riboswitch aptamer compared to dilute Mg 2+ -containing solution. It is hypothesized that under crowding conditions FMN binds through an induced fit mechanism in contrast to the conformational selection mechanism previously demonstrated in dilute Mg 2+ solution. Since these two mechanisms involve different conformational intermediates and rate constants, these findings have practical significance in areas such as drug design and RNA engineering. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sengupta, Abhigyan; Sasikala, Wilbee D; Mukherjee, Arnab; Hazra, Partha
2012-06-04
Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) are derivatives of riboflavin (RF), a water-soluble vitamin, more commonly known as vitamin B(2). Flavins have attracted special attention in the last few years because of the recent discovery of a large number of flavoproteins. In this work, these flavins are used as extrinsic fluorescence markers for probing the microheterogeneous environment of a well-known transport protein, human serum albumin (HSA). Steady-state and time-resolved fluorescence experiments confirm that both FMN and FAD bind to the Sudlow's site-1 (SS1) binding pocket of HSA, where Trp214 resides. In the case of RF, a fraction of RF molecules binds at the SS1, whereas the major fraction of RF molecules remains unbound or surface bound to the protein. Moreover, flavin(s)-HSA interactions are monitored with the help of isothermal titration calorimetry, which provides free energy, enthalpy, and entropy changes of binding along with the binding constants. The molecular picture of binding interaction between flavins and HSA is well explored by docking and molecular dynamics studies. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Montaville, Pierre; Kühn, Sonja; Compper, Christel; Carlier, Marie-France
2016-02-12
Formin 2 (Fmn2), a member of the FMN family of formins, plays an important role in early development. This formin cooperates with profilin and Spire, a WASP homology domain 2 (WH2) repeat protein, to stimulate assembly of a dynamic cytoplasmic actin meshwork that facilitates translocation of the meiotic spindle in asymmetric division of mouse oocytes. The kinase-like non-catalytic domain (KIND) of Spire directly interacts with the C-terminal extension of the formin homology domain 2 (FH2) domain of Fmn2, called FSI. This direct interaction is required for the synergy between the two proteins in actin assembly. We have recently demonstrated how Spire, which caps barbed ends via its WH2 domains, activates Fmn2. Fmn2 by itself associates very poorly to filament barbed ends but is rapidly recruited to Spire-capped barbed ends via the KIND domain, and it subsequently displaces Spire from the barbed end to elicit rapid processive assembly from profilin·actin. Here, we address the mechanism by which Spire and Fmn2 compete at barbed ends and the role of FSI in orchestrating this competition as well as in the processivity of Fmn2. We have combined microcalorimetric, fluorescence, and hydrodynamic binding assays, as well as bulk solution and single filament measurements of actin assembly, to show that removal of FSI converts Fmn2 into a Capping Protein. This activity is mimicked by association of KIND to Fmn2. In addition, FSI binds actin at filament barbed ends as a weak capper and plays a role in displacing the WH2 domains of Spire from actin, thus allowing the association of actin-binding regions of FH2 to the barbed end. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Intraprotein Electron Transfer in Inducible Nitric Oxide Synthase Holoenzyme
Feng, Changjian; Dupont, Andrea L.; Nahm, Nickolas J.; Spratt, Donald E.; Hazzard, James T.; Weinberg, J. Brice; Guillemette, J. Guy; Tollin, Gordon; Ghosh, Dipak K.
2008-01-01
Intraprotein electron transfer (IET) from flavin mononucleotide (FMN) to heme is essential in nitric oxide (NO) synthesis by NO synthase (NOS). Our previous laser flash photolysis studies provided a direct determination of the kinetics of the FMN–heme IET in a truncated oxyFMN construct of murine inducible NOS (iNOS), in which only the oxygenase and FMN domains along with the calmodulin (CaM) binding site are present [Feng et al. (2006) J. Am. Chem. Soc. 128, 3808-3811]. Here we report the kinetics of the IET in a human iNOS oxyFMN construct, a human iNOS holoenzyme and a murine iNOS holoenzyme, using CO photolysis in comparative studies on partially reduced NOS and a NOS oxygenase construct that lacks the FMN domain. The IET rate constants for the human and murine iNOS holoenzymes are 34 ± 5 s-1 and 35 ± 3 s-1, respectively, thereby providing a direct measurement of this IET between the catalytically significant redox couples of FMN and heme in the iNOS holoenzyme. These values are approximately an order of magnitude smaller than that in the corresponding iNOS oxyFMN construct, suggesting that in the holoenzyme the rate-limiting step in the IET is the conversion of the shielded electron-accepting (input) state to a new electron-donating (output) state. The fact that there is no rapid IET component in the kinetic traces obtained with the iNOS holoenzyme implies that the enzyme remains mainly in the input state. The IET rate constant value for the iNOS holoenzyme is similar to that obtained for a CaM-bound neuronal NOS (nNOS) holoenzyme, suggesting that CaM activation effectively removes the inhibitory effect of the unique autoregulatory insert in nNOS. PMID:18830722
Megyola, Cynthia; Plummer, Mark; Osterman, David; O'Connell, Tim; Aristoff, Paul; Quinn, Cheryl; Chrusciel, R. Alan; Poel, Toni J.; Schostarez, Heinrich J.; Stewart, Catherine A.; Walker, Daniel P.; Wuts, Peter G. M.
2015-01-01
Novel mechanisms of action and new chemical scaffolds are needed to rejuvenate antibacterial drug discovery, and riboswitch regulators of bacterial gene expression are a promising class of targets for the discovery of new leads. Herein, we report the characterization of 5-(3-(4-fluorophenyl)butyl)-7,8-dimethylpyrido[3,4-b]quinoxaline-1,3(2H,5H)-dione (5FDQD)—an analog of riboflavin that was designed to bind riboswitches that naturally recognize the essential coenzyme flavin mononucleotide (FMN) and regulate FMN and riboflavin homeostasis. In vitro, 5FDQD and FMN bind to and trigger the function of an FMN riboswitch with equipotent activity. MIC and time-kill studies demonstrated that 5FDQD has potent and rapidly bactericidal activity against Clostridium difficile. In C57BL/6 mice, 5FDQD completely prevented the onset of lethal antibiotic-induced C. difficile infection (CDI). Against a panel of bacteria representative of healthy bowel flora, the antibacterial selectivity of 5FDQD was superior to currently marketed CDI therapeutics, with very little activity against representative strains from the Bacteroides, Lactobacillus, Bifidobacterium, Actinomyces, and Prevotella genera. Accordingly, a single oral dose of 5FDQD caused less alteration of culturable cecal flora in mice than the comparators. Collectively, these data suggest that 5FDQD or closely related analogs could potentially provide a high rate of CDI cure with a low likelihood of infection recurrence. Future studies will seek to assess the role of FMN riboswitch binding to the mechanism of 5FDQD antibacterial action. In aggregate, our results indicate that riboswitch-binding antibacterial compounds can be discovered and optimized to exhibit activity profiles that merit preclinical and clinical development as potential antibacterial therapeutic agents. PMID:26169403
Mitochondrial respiratory complex I probed by delayed luminescence spectroscopy
NASA Astrophysics Data System (ADS)
Baran, Irina; Ionescu, Diana; Privitera, Simona; Scordino, Agata; Mocanu, Maria Magdalena; Musumeci, Francesco; Grasso, Rosaria; Gulino, Marisa; Iftime, Adrian; Tofolean, Ioana Teodora; Garaiman, Alexandru; Goicea, Alexandru; Irimia, Ruxandra; Dimancea, Alexandru; Ganea, Constanta
2013-12-01
The role of mitochondrial complex I in ultraweak photon-induced delayed photon emission [delayed luminescence (DL)] of human leukemia Jurkat T cells was probed by using complex I targeting agents like rotenone, menadione, and quercetin. Rotenone, a complex I-specific inhibitor, dose-dependently increased the mitochondrial level of reduced nicotinamide adenine dinucleotide (NADH), decreased clonogenic survival, and induced apoptosis. A strong correlation was found between the mitochondrial levels of NADH and oxidized flavin mononucleotide (FMNox) in rotenone-, menadione- and quercetin-treated cells. Rotenone enhanced DL dose-dependently, whereas quercetin and menadione inhibited DL as well as NADH or FMNox. Collectively, the data suggest that DL of Jurkat cells originates mainly from mitochondrial complex I, which functions predominantly as a dimer and less frequently as a tetramer. In individual monomers, both pairs of pyridine nucleotide (NADH/reduced nicotinamide adenine dinucleotide phosphate) sites and flavin (FMN-a/FMN-b) sites appear to bind cooperatively their specific ligands. Enhancement of delayed red-light emission by rotenone suggests that the mean time for one-electron reduction of ubiquinone or FMN-a by the terminal Fe/S center (N2) is 20 or 284 μs, respectively. All these findings suggest that DL spectroscopy could be used as a reliable, sensitive, and robust technique to probe electron flow within complex I in situ.
N-terminus determines activity and specificity of styrene monooxygenase reductases.
Heine, Thomas; Scholtissek, Anika; Westphal, Adrie H; van Berkel, Willem J H; Tischler, Dirk
2017-12-01
Styrene monooxygenases (SMOs) are two-enzyme systems that catalyze the enantioselective epoxidation of styrene to (S)-styrene oxide. The FADH 2 co-substrate of the epoxidase component (StyA) is supplied by an NADH-dependent flavin reductase (StyB). The genome of Rhodococcus opacus 1CP encodes two SMO systems. One system, which we define as E1-type, displays homology to the SMO from Pseudomonas taiwanensis VLB120. The other system, originally reported as a fused system (RoStyA2B), is defined as E2-type. Here we found that E1-type RoStyB is inhibited by FMN, while RoStyA2B is known to be active with FMN. To rationalize the observed specificity of RoStyB for FAD, we generated an artificial reductase, designated as RoStyBart, in which the first 22 amino acid residues of RoStyB were joined to the reductase part of RoStyA2B, while the oxygenase part (A2) was removed. RoStyBart mainly purified as apo-protein and mimicked RoStyB in being inhibited by FMN. Pre-incubation with FAD yielded a turnover number at 30°C of 133.9±3.5s -1 , one of the highest rates observed for StyB reductases. RoStyBart holo-enzyme switches to a ping-pong mechanism and fluorescence analysis indicated for unproductive binding of FMN to the second (co-substrate) binding site. In summary, it is shown for the first time that optimization of the N-termini of StyB reductases allows the evolution of their activity and specificity. Copyright © 2017 Elsevier B.V. All rights reserved.
Taylor, D G; Trudgill, P W
1986-01-01
The oxygenating component of 2,5-diketocamphane 1,2-monooxygenase from Pseudomonas putida ATCC 17453 was purified to homogeneity by a combination of ammonium sulfate fractionation and chromatography on DEAE-cellulose and polyanion SI-17 columns. It had an Mr of 78,000, bound one molecule of nonautooxidizable flavin mononucleotide (FMN), consisted of two subunits of equal molecular weight, and existed in two electrophoretically distinguishable active forms. The oxygenating complex was constructed from equimolecular amounts of an NADH oxidase, which could be purified separately (Mr, 36,000), and the oxygenating component. Most of the NADH oxidase dissociated from the oxygenating component during purification, although traces remained, to give the final preparation of the oxygenating component significant oxygenase activity. FMN did not dissociate significantly from the oxygenating component during purification, but it was not covalently bound and could be removed under a variety of conditions. Binding between the two proteins that made up the active complex was fairly weak and freely reversible. It probably occurred through the FMN which was strongly bound to the oxygenating component and for which the NADH had a weak binding site. Iron was not present at a significant level in the oxygenating component, and in common with other characterized Baeyer Villiger monooxygenases, 2,5-diketocamphane 1,2-monooxygenase was found to be a simple flavoprotein. Images PMID:3944058
Taylor, D G; Trudgill, P W
1986-02-01
The oxygenating component of 2,5-diketocamphane 1,2-monooxygenase from Pseudomonas putida ATCC 17453 was purified to homogeneity by a combination of ammonium sulfate fractionation and chromatography on DEAE-cellulose and polyanion SI-17 columns. It had an Mr of 78,000, bound one molecule of nonautooxidizable flavin mononucleotide (FMN), consisted of two subunits of equal molecular weight, and existed in two electrophoretically distinguishable active forms. The oxygenating complex was constructed from equimolecular amounts of an NADH oxidase, which could be purified separately (Mr, 36,000), and the oxygenating component. Most of the NADH oxidase dissociated from the oxygenating component during purification, although traces remained, to give the final preparation of the oxygenating component significant oxygenase activity. FMN did not dissociate significantly from the oxygenating component during purification, but it was not covalently bound and could be removed under a variety of conditions. Binding between the two proteins that made up the active complex was fairly weak and freely reversible. It probably occurred through the FMN which was strongly bound to the oxygenating component and for which the NADH had a weak binding site. Iron was not present at a significant level in the oxygenating component, and in common with other characterized Baeyer Villiger monooxygenases, 2,5-diketocamphane 1,2-monooxygenase was found to be a simple flavoprotein.
Evidence for the generation of myristylated FMN by bacterial luciferase.
Tabib, Chaitanya R; Brodl, Eveline; Macheroux, Peter
2017-06-01
The genes responsible for the light production in bioluminescent bacteria are present as an operon, luxCDABEG. Many strains of Photobacteria carry an additional gene, termed luxF. X-ray crystallographic analysis of LuxF revealed the presence of four molecules of a flavin derivative, i.e. 6-(3'-(R)-myristyl) flavin adenine mononucleotide (myrFMN) non-covalently bound to the homodimer. In the present study, we exploited the binding of myrFMN to recombinant apo-LuxF to explore the occurrence of myrFMN in various bioluminescent bacteria. MyrFMN was detected in all bacterial strains tested including Vibrio and Aliivibrio indicating that it is more widely occurring in bioluminescent bacteria than previously assumed. We also show that apo-LuxF captures myrFMN and thereby relieves the inhibitory effect on luciferase activity. Thus our results provide support for the hypothesis that LuxF acts as a scavenger of myrFMN in bioluminescent bacteria. However, the source of myrFMN remained obscure. To address this issue, we established a cofactor regeneration enzyme-catalyzed cascade reaction that supports luciferase activity in vitro for up to 3 days. This approach enabled us to unambiguously demonstrate that myrFMN is generated in the bacterial bioluminescent reaction. Based on this finding we postulate a reaction mechanism for myrFMN generation that is based on the luciferase reaction. © 2017 The Authors Molecular Microbiology Published by John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Howe, John A.; Xiao, Li; Fischmann, Thierry O.
2016-08-02
Bacterial riboswitches are non-coding RNA structural elements that direct gene expression in numerous metabolic pathways. The key regulatory roles of riboswitches, and the urgent need for new classes of antibiotics to treat multi-drug resistant bacteria, has led to efforts to develop small-molecules that mimic natural riboswitch ligands to inhibit metabolic pathways and bacterial growth. Recently, we reported the results of a phenotypic screen targeting the riboflavin biosynthesis pathway in the Gram-negative bacteria Escherichia coli that led to the identification of ribocil, a small molecule inhibitor of the flavin mononucleotide (FMN) riboswitch controlling expression of this biosynthetic pathway. Although ribocil ismore » structurally distinct from FMN, ribocil functions as a potent and highly selective synthetic mimic of the natural ligand to repress riboswitch-mediated ribB gene expression and inhibit bacterial growth both in vitro and in vivo. Herein, we expand our analysis of ribocil; including mode of binding in the FMN binding pocket of the riboswitch, mechanisms of resistance and structure-activity relationship guided efforts to generate more potent analogs.« less
An activity transition from NADH dehydrogenase to NADH oxidase during protein denaturation.
Huston, Scott; Collins, John; Sun, Fangfang; Zhang, Ting; Vaden, Timothy D; Zhang, Y-H Percival; Fu, Jinglin
2018-05-01
A decrease in the specific activity of an enzyme is commonly observed when the enzyme is inappropriately handled or is stored over an extended period. Here, we reported a functional transition of an FMN-bound diaphorase (FMN-DI) that happened during the long-term storage process. It was found that FMN-DI did not simply lose its β-nicotinamide adenine diphosphate (NADH) dehydrogenase activity after a long-time storage, but obtained a new enzyme activity of NADH oxidase. Further mechanistic studies suggested that the alteration of the binding strength of an FMN cofactor with a DI protein could be responsible for this functional switch of the enzyme. © 2017 International Union of Biochemistry and Molecular Biology, Inc.
Montgomery, H J; Romanov, V; Guillemette, J G
2000-02-18
Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.
Duffy, Ellen B.; Barquera, Blanca
2006-01-01
The membrane topologies of the six subunits of Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from Vibrio cholerae were determined by a combination of topology prediction algorithms and the construction of C-terminal fusions. Fusion expression vectors contained either bacterial alkaline phosphatase (phoA) or green fluorescent protein (gfp) genes as reporters of periplasmic and cytoplasmic localization, respectively. A majority of the topology prediction algorithms did not predict any transmembrane helices for NqrA. A lack of PhoA activity when fused to the C terminus of NqrA and the observed fluorescence of the green fluorescent protein C-terminal fusion confirm that this subunit is localized to the cytoplasmic side of the membrane. Analysis of four PhoA fusions for NqrB indicates that this subunit has nine transmembrane helices and that residue T236, the binding site for flavin mononucleotide (FMN), resides in the cytoplasm. Three fusions confirm that the topology of NqrC consists of two transmembrane helices with the FMN binding site at residue T225 on the cytoplasmic side. Fusion analysis of NqrD and NqrE showed almost mirror image topologies, each consisting of six transmembrane helices; the results for NqrD and NqrE are consistent with the topologies of Escherichia coli homologs YdgQ and YdgL, respectively. The NADH, flavin adenine dinucleotide, and Fe-S center binding sites of NqrF were localized to the cytoplasm. The determination of the topologies of the subunits of Na+-NQR provides valuable insights into the location of cofactors and identifies targets for mutagenesis to characterize this enzyme in more detail. The finding that all the redox cofactors are localized to the cytoplasmic side of the membrane is discussed. PMID:17041063
Russell, Thomas R; Demeler, Borries; Tu, Shiao-Chun
2004-02-17
The homodimeric NADH:flavin oxidoreductase from Aminobacter aminovorans is an NADH-specific flavin reductase herein designated FRD(Aa). FRD(Aa) was characterized with respect to purification yields, thermal stability, isoelectric point, molar absorption coefficient, and effects of phosphate buffer strength and pH on activity. Evidence from this work favors the classification of FRD(Aa) as a flavin cofactor-utilizing class I flavin reductase. The isolated native FRD(Aa) contained about 0.5 bound riboflavin-5'-phosphate (FMN) per enzyme monomer, but one bound flavin cofactor per monomer was obtainable in the presence of excess FMN or riboflavin. In addition, FRD(Aa) holoenzyme also utilized FMN, riboflavin, or FAD as a substrate. Steady-state kinetic results of substrate titrations, dead-end inhibition by AMP and lumichrome, and product inhibition by NAD(+) indicated an ordered sequential mechanism with NADH as the first binding substrate and reduced FMN as the first leaving product. This is contrary to the ping-pong mechanism shown by other class I flavin reductases. The FMN bound to the native FRD(Aa) can be fully reduced by NADH and subsequently reoxidized by oxygen. No NADH binding was detected using 90 microM FRD(Aa) apoenzyme and 300 microM NADH. All results favor the interpretation that the bound FMN was a cofactor rather than a substrate. It is highly unusual that a flavin reductase using a sequential mechanism would require a flavin cofactor to facilitate redox exchange between NADH and a flavin substrate. FRD(Aa) exhibited a monomer-dimer equilibrium with a K(d) of 2.7 microM. Similarities and differences between FRD(Aa) and certain flavin reductases are discussed.
Montaville, Pierre; Jégou, Antoine; Pernier, Julien; Compper, Christel; Guichard, Bérengère; Mogessie, Binyam; Schuh, Melina; Romet-Lemonne, Guillaume; Carlier, Marie-France
2014-02-01
In mammalian oocytes, three actin binding proteins, Formin 2 (Fmn2), Spire, and profilin, synergistically organize a dynamic cytoplasmic actin meshwork that mediates translocation of the spindle toward the cortex and is required for successful fertilization. Here we characterize Fmn2 and elucidate the molecular mechanism for this synergy, using bulk solution and individual filament kinetic measurements of actin assembly dynamics. We show that by capping filament barbed ends, Spire recruits Fmn2 and facilitates its association with barbed ends, followed by rapid processive assembly and release of Spire. In the presence of actin, profilin, Spire, and Fmn2, filaments display alternating phases of rapid processive assembly and arrested growth, driven by a "ping-pong" mechanism, in which Spire and Fmn2 alternately kick off each other from the barbed ends. The results are validated by the effects of injection of Spire, Fmn2, and their interacting moieties in mouse oocytes. This original mechanism of regulation of a Rho-GTPase-independent formin, recruited by Spire at Rab11a-positive vesicles, supports a model for modulation of a dynamic actin-vesicle meshwork in the oocyte at the origin of asymmetric positioning of the meiotic spindle.
Xie, Q W; Leung, M; Fuortes, M; Sassa, S; Nathan, C
1996-01-01
For catalytic activity, nitric oxide synthases (NOSs) must be dimeric. Previous work revealed that the requirements for stable dimerization included binding of tetrahydrobiopterin (BH4), arginine, and heme. Here we asked what function is served by dimerization. We assessed the ability of individually inactive mutants of mouse inducible NOS (iNOS; NOS2), each deficient in binding a particular cofactor or cosubstrate, to complement each other by generating NO upon cotransfection into human epithelial cells. The ability of the mutants to homodimerize was gauged by gel filtration and/or PAGE under partially denaturing conditions, both followed by immunoblot. Their ability to heterodimerize was assessed by coimmunoprecipitation. Heterodimers that contained only one COOH-terminal hemimer and only one BH4-binding site could both form and function, even though the NADPH-, FAD-, and FMN-binding domains (in the COOH-terminal hemimer) and the BH4-binding sites (in the NH2-terminal hemimer) were contributed by opposite chains. Heterodimers that contained only one heme-binding site (Cys-194) could also form, either in cis or in trans to the nucleotide-binding domains. However, for NO production, both chains had to bind heme. Thus, NO production by iNOS requires dimerization because the active site requires two hemes. Images Fig. 2 Fig. 3 Fig. 4 Fig. 7 PMID:8643499
Nizam, Shadab; Gazara, Rajesh Kumar; Verma, Sandhya; Singh, Kunal; Verma, Praveen Kumar
2014-01-01
Old Yellow Enzyme (OYE1) was the first flavin-dependent enzyme identified and characterized in detail by the entire range of physical techniques. Irrespective of this scrutiny, true physiological role of the enzyme remains a mystery. In a recent study, we systematically identified OYE proteins from various fungi and classified them into three classes viz. Class I, II and III. However, there is no information about the structural organization of Class III OYEs, eukaryotic Class II OYEs and Class I OYEs of filamentous fungi. Ascochyta rabiei, a filamentous phytopathogen which causes Ascochyta blight (AB) in chickpea possesses six OYEs (ArOYE1-6) belonging to the three OYE classes. Here we carried out comparative homology modeling of six ArOYEs representing all the three classes to get an in depth idea of structural and functional aspects of fungal OYEs. The predicted 3D structures of A. rabiei OYEs were refined and evaluated using various validation tools for their structural integrity. Analysis of FMN binding environment of Class III OYE revealed novel residues involved in interaction. The ligand para-hydroxybenzaldehyde (PHB) was docked into the active site of the enzymes and interacting residues were analyzed. We observed a unique active site organization of Class III OYE in comparison to Class I and II OYEs. Subsequently, analysis of stereopreference through structural features of ArOYEs was carried out, suggesting differences in R/S selectivity of these proteins. Therefore, our comparative modeling study provides insights into the FMN binding, active site organization and stereopreference of different classes of ArOYEs and indicates towards functional differences of these enzymes. This study provides the basis for future investigations towards the biochemical and functional characterization of these enigmatic enzymes.
Yu, Ta-Yi; Mok, Kenny C; Kennedy, Kristopher J; Valton, Julien; Anderson, Karen S; Walker, Graham C; Taga, Michiko E
2012-06-01
The "flavin destructase" enzyme BluB catalyzes the unprecedented conversion of flavin mononucleotide (FMN) to 5,6-dimethylbenzimidazole (DMB), a component of vitamin B(12). Because of its unusual chemistry, the mechanism of this transformation has remained elusive. This study reports the identification of 12 mutant forms of BluB that have severely reduced catalytic function, though most retain the ability to bind flavin. The "flavin destructase" BluB is an unusual enzyme that fragments the flavin cofactor FMNH(2) in the presence of oxygen to produce 5,6-dimethylbenzimidazole (DMB), the lower axial ligand of vitamin B(12) (cobalamin). Despite the similarities in sequence and structure between BluB and the nitroreductase and flavin oxidoreductase enzyme families, BluB is the only enzyme known to fragment a flavin isoalloxazine ring. To explore the catalytic residues involved in this unusual reaction, mutants of BluB impaired in DMB biosynthesis were identified in a genetic screen in the bacterium Sinorhizobium meliloti. Of the 16 unique point mutations identified in the screen, the majority were located in conserved residues in the active site or in the unique "lid" domain proposed to shield the active site from solvent. Steady-state enzyme assays of 12 purified mutant proteins showed a significant reduction in DMB synthesis in all of the mutants, with eight completely defective in DMB production. Ten of these mutants have weaker binding affinities for both oxidized and reduced FMN, though only two have a significant effect on complex stability. These results implicate several conserved residues in BluB's unique ability to fragment FMNH(2) and demonstrate the sensitivity of BluB's active site to structural perturbations. This work lays the foundation for mechanistic studies of this enzyme and further advances our understanding of the structure-function relationship of BluB. Copyright © 2012 The Protein Society.
Montaville, Pierre; Jégou, Antoine; Pernier, Julien; Compper, Christel; Guichard, Bérengère; Mogessie, Binyam; Schuh, Melina; Romet-Lemonne, Guillaume; Carlier, Marie-France
2014-01-01
In mammalian oocytes, three actin binding proteins, Formin 2 (Fmn2), Spire, and profilin, synergistically organize a dynamic cytoplasmic actin meshwork that mediates translocation of the spindle toward the cortex and is required for successful fertilization. Here we characterize Fmn2 and elucidate the molecular mechanism for this synergy, using bulk solution and individual filament kinetic measurements of actin assembly dynamics. We show that by capping filament barbed ends, Spire recruits Fmn2 and facilitates its association with barbed ends, followed by rapid processive assembly and release of Spire. In the presence of actin, profilin, Spire, and Fmn2, filaments display alternating phases of rapid processive assembly and arrested growth, driven by a “ping-pong” mechanism, in which Spire and Fmn2 alternately kick off each other from the barbed ends. The results are validated by the effects of injection of Spire, Fmn2, and their interacting moieties in mouse oocytes. This original mechanism of regulation of a Rho-GTPase–independent formin, recruited by Spire at Rab11a-positive vesicles, supports a model for modulation of a dynamic actin-vesicle meshwork in the oocyte at the origin of asymmetric positioning of the meiotic spindle. PMID:24586110
Discovery of antimicrobial compounds targeting bacterial type FAD synthetases.
Sebastián, María; Anoz-Carbonell, Ernesto; Gracia, Begoña; Cossio, Pilar; Aínsa, José Antonio; Lans, Isaías; Medina, Milagros
2018-12-01
The increase of bacterial strains resistant to most of the available antibiotics shows a need to explore novel antibacterial targets to discover antimicrobial drugs. Bifunctional bacterial FAD synthetases (FADSs) synthesise the flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD). These cofactors act in vital processes as part of flavoproteins, making FADS an essential enzyme. Bacterial FADSs are potential antibacterial targets because of differences to mammalian enzymes, particularly at the FAD producing site. We have optimised an activity-based high throughput screening assay targeting Corynebacterium ammoniagenes FADS (CaFADS) that identifies inhibitors of its different activities. We selected the three best high-performing inhibitors of the FMN:adenylyltransferase activity (FMNAT) and studied their inhibition mechanisms and binding properties. The specificity of the CaFADS hits was evaluated by studying also their effect on the Streptococcus pneumoniae FADS activities, envisaging differences that can be used to discover species-specific antibacterial drugs. The antimicrobial effect of these compounds was also evaluated on C. ammoniagenes, S. pneumoniae, and Mycobacterium tuberculosis cultures, finding hits with favourable antimicrobial properties.
Yokom, Adam L; Morishima, Yoshihiro; Lau, Miranda; Su, Min; Glukhova, Alisa; Osawa, Yoichi; Southworth, Daniel R
2014-06-13
Nitric-oxide synthase (NOS) is required in mammals to generate NO for regulating blood pressure, synaptic response, and immune defense. NOS is a large homodimer with well characterized reductase and oxygenase domains that coordinate a multistep, interdomain electron transfer mechanism to oxidize l-arginine and generate NO. Ca(2+)-calmodulin (CaM) binds between the reductase and oxygenase domains to activate NO synthesis. Although NOS has long been proposed to adopt distinct conformations that alternate between interflavin and FMN-heme electron transfer steps, structures of the holoenzyme have remained elusive and the CaM-bound arrangement is unknown. Here we have applied single particle electron microscopy (EM) methods to characterize the full-length of the neuronal isoform (nNOS) complex and determine the structural mechanism of CaM activation. We have identified that nNOS adopts an ensemble of open and closed conformational states and that CaM binding induces a dramatic rearrangement of the reductase domain. Our three-dimensional reconstruction of the intact nNOS-CaM complex reveals a closed conformation and a cross-monomer arrangement with the FMN domain rotated away from the NADPH-FAD center, toward the oxygenase dimer. This work captures, for the first time, the reductase-oxygenase structural arrangement and the CaM-dependent release of the FMN domain that coordinates to drive electron transfer across the domains during catalysis. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Losi, Aba; Ternelli, Elena; Gärtner, Wolfgang
2004-01-01
The Bacillus subtilis protein YtvA, related to plant phototropins (phot), binds flavin mononucleotide (FMN) within the N-terminal light, oxygen and voltage (LOV) domain. The blue light-triggered photocycle of YtvA and phot involves the reversible formation of a covalent photoadduct between FMN and a cysteine (cys) residue. YtvA contains a single tryptophan, W103, localized on the LOV domain and conserved in all phot-LOV domains. In this study, we show that the fluorescence parameters of W103 in YtvA-LOV are markedly different from those observed in the full-length YtvA. The fluorescence quantum yields are ca 0.03 and 0.08, respectively. In YtvA-LOV, the maximum is redshifted (ca 345 vs 335 nm) and the average fluorescence lifetime shorter (2.7 vs 4.7 ns). These data indicate that W103 is located in a site of tight contact between the two domains of YtvA. In the FMN-cys adduct, selective excitation of W103 at 295 nm results in minimal changes of the fluorescence parameters with respect to the dark state. On 280 nm excitation, however, there is a detectable decrease in the fluorescence emitted from tyrosines, with concomitant increase in W103 fluorescence. This effect is reversible in the dark and might arise from a light-regulated energy transfer process from a yet unidentified tyrosine to W103.
Law, Rosalind; Dixon-Salazar, Tracy; Jerber, Julie; Cai, Na; Abbasi, Ansar A; Zaki, Maha S; Mittal, Kirti; Gabriel, Stacey B; Rafiq, Muhammad Arshad; Khan, Valeed; Nguyen, Maria; Ali, Ghazanfar; Copeland, Brett; Scott, Eric; Vasli, Nasim; Mikhailov, Anna; Khan, Muhammad Nasim; Andrade, Danielle M; Ayaz, Muhammad; Ansar, Muhammad; Ayub, Muhammad; Vincent, John B; Gleeson, Joseph G
2014-12-04
Dendritic spines represent the major site of neuronal activity in the brain; they serve as the receiving point for neurotransmitters and undergo rapid activity-dependent morphological changes that correlate with learning and memory. Using a combination of homozygosity mapping and next-generation sequencing in two consanguineous families affected by nonsyndromic autosomal-recessive intellectual disability, we identified truncating mutations in formin 2 (FMN2), encoding a protein that belongs to the formin family of actin cytoskeleton nucleation factors and is highly expressed in the maturing brain. We found that FMN2 localizes to punctae along dendrites and that germline inactivation of mouse Fmn2 resulted in animals with decreased spine density; such mice were previously demonstrated to have a conditioned fear-learning defect. Furthermore, patient neural cells derived from induced pluripotent stem cells showed correlated decreased synaptic density. Thus, FMN2 mutations link intellectual disability either directly or indirectly to the regulation of actin-mediated synaptic spine density. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Biphasic Kinetic Behavior of E. coli WrbA, an FMN-Dependent NAD(P)H:Quinone Oxidoreductase
Kishko, Iryna; Harish, Balasubramanian; Zayats, Vasilina; Reha, David; Tenner, Brian; Beri, Dhananjay; Gustavsson, Tobias; Ettrich, Rüdiger; Carey, Jannette
2012-01-01
The E. coli protein WrbA is an FMN-dependent NAD(P)H:quinone oxidoreductase that has been implicated in oxidative defense. Three subunits of the tetrameric enzyme contribute to each of four identical, cavernous active sites that appear to accommodate NAD(P)H or various quinones, but not simultaneously, suggesting an obligate tetramer with a ping-pong mechanism in which NAD departs before oxidized quinone binds. The present work was undertaken to evaluate these suggestions and to characterize the kinetic behavior of WrbA. Steady-state kinetics results reveal that WrbA conforms to a ping-pong mechanism with respect to the constancy of the apparent Vmax to Km ratio with substrate concentration. However, the competitive/non-competitive patterns of product inhibition, though consistent with the general class of bi-substrate reactions, do not exclude a minor contribution from additional forms of the enzyme. NMR results support the presence of additional enzyme forms. Docking and energy calculations find that electron-transfer-competent binding sites for NADH and benzoquinone present severe steric overlap, consistent with the ping-pong mechanism. Unexpectedly, plots of initial velocity as a function of either NADH or benzoquinone concentration present one or two Michaelis-Menten phases depending on the temperature at which the enzyme is held prior to assay. The effect of temperature is reversible, suggesting an intramolecular conformational process. WrbA shares these and other details of its kinetic behavior with mammalian DT-diaphorase, an FAD-dependent NAD(P)H:quinone oxidoreductase. An extensive literature review reveals several other enzymes with two-plateau kinetic plots, but in no case has a molecular explanation been elucidated. Preliminary sedimentation velocity analysis of WrbA indicates a large shift in size of the multimer with temperature, suggesting that subunit assembly coupled to substrate binding may underlie the two-plateau behavior. An additional aim of this report is to bring under wider attention the apparently widespread phenomenon of two-plateau Michaelis-Menten plots. PMID:22952804
Rodrigues, Joaquim Rui; Couto, Ana; Cabezas, Alicia; Pinto, Rosa María; Ribeiro, João Meireles; Canales, José; Costas, María Jesús; Cameselle, José Carlos
2014-04-11
Mammalian triokinase, which phosphorylates exogenous dihydroxyacetone and fructose-derived glyceraldehyde, is neither molecularly identified nor firmly associated to an encoding gene. Human FMN cyclase, which splits FAD and other ribonucleoside diphosphate-X compounds to ribonucleoside monophosphate and cyclic X-phosphodiester, is identical to a DAK-encoded dihydroxyacetone kinase. This bifunctional protein was identified as triokinase. It was modeled as a homodimer of two-domain (K and L) subunits. Active centers lie between K1 and L2 or K2 and L1: dihydroxyacetone binds K and ATP binds L in different subunits too distant (≈ 14 Å) for phosphoryl transfer. FAD docked to the ATP site with ribityl 4'-OH in a possible near-attack conformation for cyclase activity. Reciprocal inhibition between kinase and cyclase reactants confirmed substrate site locations. The differential roles of protein domains were supported by their individual expression: K was inactive, and L displayed cyclase but not kinase activity. The importance of domain mobility for the kinase activity of dimeric triokinase was highlighted by molecular dynamics simulations: ATP approached dihydroxyacetone at distances below 5 Å in near-attack conformation. Based upon structure, docking, and molecular dynamics simulations, relevant residues were mutated to alanine, and kcat and Km were assayed whenever kinase and/or cyclase activity was conserved. The results supported the roles of Thr(112) (hydrogen bonding of ATP adenine to K in the closed active center), His(221) (covalent anchoring of dihydroxyacetone to K), Asp(401) and Asp(403) (metal coordination to L), and Asp(556) (hydrogen bonding of ATP or FAD ribose to L domain). Interestingly, the His(221) point mutant acted specifically as a cyclase without kinase activity.
Bifunctional Homodimeric Triokinase/FMN Cyclase
Rodrigues, Joaquim Rui; Couto, Ana; Cabezas, Alicia; Pinto, Rosa María; Ribeiro, João Meireles; Canales, José; Costas, María Jesús; Cameselle, José Carlos
2014-01-01
Mammalian triokinase, which phosphorylates exogenous dihydroxyacetone and fructose-derived glyceraldehyde, is neither molecularly identified nor firmly associated to an encoding gene. Human FMN cyclase, which splits FAD and other ribonucleoside diphosphate-X compounds to ribonucleoside monophosphate and cyclic X-phosphodiester, is identical to a DAK-encoded dihydroxyacetone kinase. This bifunctional protein was identified as triokinase. It was modeled as a homodimer of two-domain (K and L) subunits. Active centers lie between K1 and L2 or K2 and L1: dihydroxyacetone binds K and ATP binds L in different subunits too distant (≈14 Å) for phosphoryl transfer. FAD docked to the ATP site with ribityl 4′-OH in a possible near-attack conformation for cyclase activity. Reciprocal inhibition between kinase and cyclase reactants confirmed substrate site locations. The differential roles of protein domains were supported by their individual expression: K was inactive, and L displayed cyclase but not kinase activity. The importance of domain mobility for the kinase activity of dimeric triokinase was highlighted by molecular dynamics simulations: ATP approached dihydroxyacetone at distances below 5 Å in near-attack conformation. Based upon structure, docking, and molecular dynamics simulations, relevant residues were mutated to alanine, and kcat and Km were assayed whenever kinase and/or cyclase activity was conserved. The results supported the roles of Thr112 (hydrogen bonding of ATP adenine to K in the closed active center), His221 (covalent anchoring of dihydroxyacetone to K), Asp401 and Asp403 (metal coordination to L), and Asp556 (hydrogen bonding of ATP or FAD ribose to L domain). Interestingly, the His221 point mutant acted specifically as a cyclase without kinase activity. PMID:24569995
Marcinkeviciene, J; Jiang, W; Locke, G; Kopcho, L M; Rogers, M J; Copeland, R A
2000-05-01
We report the identification, expression, and characterization of a second Dihydroorotate dehydrogenase (DHODase A) from the human pathogen Enterococcus faecalis. The enzyme consists of a polypeptide chain of 322 amino acids that shares 68% identity with the cognate type A enzyme from the bacterium Lactococcus lactis. E. faecalis DHODase A catalyzed the oxidation of l-dihydroorotate while reducing a number of substrates, including fumarate, coenzyme Q(0), and menadione. The steady-state kinetic mechanism has been determined with menadione as an oxidizing substrate at pH 7.5. Initial velocity and product inhibition data suggest that the enzyme follows a two-site nonclassical ping-pong kinetic mechanism. The absorbance of the active site FMN cofactor is quenched in a concentration-dependent manner by titration with orotate and barbituric acid, two competitive inhibitors with respect to dihydroorotate. In contrast, titration of the enzyme with menadione had no effect on FMN absorbance, consistent with nonoverlapping binding sites for dihyroorotate and menadione, as suggested from the kinetic mechanism. The reductive half-reaction has been shown to be only partially rate limiting, and an attempt to evaluate the slow step in the overall reaction has been made by simulating orotate production under steady-state conditions. Our data indicate that the oxidative half-reaction is a rate-limiting segment, while orotate, most likely, retains significant affinity for the reduced enzyme, as suggested by the product inhibition pattern. Copyright 2000 Academic Press.
Real-time optical studies of respiratory Complex I turnover.
Belevich, Nikolai; Belevich, Galina; Verkhovskaya, Marina
2014-12-01
Reduction of Complex l (NADH:ubiquinone oxidoreductase l) from Escherichia coli by NADH was investigated optically by means of an ultrafast stopped-flow approach. A locally designed microfluidic stopped-flow apparatus with a low volume (0.21Jl) but a long optical path (10 mm) cuvette allowed measurements in the time range from 270 ).IS to seconds. The data acquisition system collected spectra in the visible range every 50 )JS. Analysis of the obtained time-resolved spectral changes upon the reaction of Complex I with NADH revealed three kinetic components with characteristic times of <270 ).IS, 0.45-0.9 ms and 3-6 ms, reflecting reduction of different FeS clusters and FMN. The rate of the major ( T = 0.45-0.9 ms) component was slower than predicted by electron transfer theory for the reduction of all FeS clusters in the intraprotein redox chain. This delay of the reaction was explained by retention of NAD+ in the catalytic site. The fast optical changes in the time range of 0.27- 1.5 ms were not altered significantly in the presence of 1 0-fold excess of NAD+ over NADH. The data obtained on the NuoF E95Q variant of Complex I shows that the single amino acid replacement in the catalytic site caused a strong decrease of NADH binding and/or the hydride transfer from bound NADH to FMN.
Xia, Chuanwu; Hamdane, Djemel; Shen, Anna L.; Choi, Vivian; Kasper, Charles B.; Pearl, Naw May; Zhang, Haoming; Im, Sang-Choul; Waskell, Lucy; Kim, Jung-Ja P.
2011-01-01
The crystal structure of NADPH-cytochrome P450 reductase (CYPOR) implies that a large domain movement is essential for electron transfer from NADPH via FAD and FMN to its redox partners. To test this hypothesis, a disulfide bond was engineered between residues Asp147 and Arg514 in the FMN and FAD domains, respectively. The cross-linked form of this mutant protein, designated 147CC514, exhibited a significant decrease in the rate of interflavin electron transfer and large (≥90%) decreases in rates of electron transfer to its redox partners, cytochrome c and cytochrome P450 2B4. Reduction of the disulfide bond restored the ability of the mutant to reduce its redox partners, demonstrating that a conformational change is essential for CYPOR function. The crystal structures of the mutant without and with NADP+ revealed that the two flavin domains are joined by a disulfide linkage and that the relative orientations of the two flavin rings are twisted ∼20° compared with the wild type, decreasing the surface contact area between the two flavin rings. Comparison of the structures without and with NADP+ shows movement of the Gly631–Asn635 loop. In the NADP+-free structure, the loop adopts a conformation that sterically hinders NADP(H) binding. The structure with NADP+ shows movement of the Gly631–Asn635 loop to a position that permits NADP(H) binding. Furthermore, comparison of these mutant and wild type structures strongly suggests that the Gly631–Asn635 loop movement controls NADPH binding and NADP+ release; this loop movement in turn facilitates the flavin domain movement, allowing electron transfer from FMN to the CYPOR redox partners. PMID:21345800
Martínez-Júlvez, Marta; Rojas, Adriana L.; Olekhnovich, Igor; Angarica, Vladimir Espinosa; Hoffman, Paul S.; Sancho, Javier
2012-01-01
The RdxA oxygen insensitive nitroreductase of the human gastric pathogen Helicobacter pylori is responsible for the susceptibility of this organism to the redox active prodrug metronidazole (MTZ). Loss-of-function mutations in rdxA are primarily responsible for resistance to this therapeutic. RdxA exhibits potent NADPH oxidase activity under aerobic conditions and metronidazole reductase activity under strictly anaerobic conditions. Here we report the crystal structure of RdxA, which is a homodimer exhibiting domain swapping and containing two molecules of FMN bound at the dimer interface. We have found a gap between the side chain of Tyr47 and the isoalloxazine ring of FMN that seems appropriate for substrate binding. The structure does not include residues 97–128, which corresponds to a locally unstable part of the NTR from E. coli, and might be involved in cofactor binding. Comparison of H pylori RdxA to other oxidoreductases of known structure suggests RdxA may belong to a new subgroup of oxidoreductases in which a cysteine sidechain close to the FMN cofactor could be involved in the reductive activity. In this respect, mutation of C159 to A or S (C159A/S) has resulted in loss of MTZ reductase activity, but not NADPH oxidase activity. The RdxA structure allows interpretation of the many loss-of-function mutations previously described, including those affecting C159, a residue whose interaction with FMN is required for nitroreduction of MTZ. Our studies provide unique insights into the redox behavior of the flavin in this key enzyme for metronidazole activation, and with potential use in gene therapy. PMID:23039228
Sebastián, María; Velázquez-Campoy, Adrián; Medina, Milagros
2018-12-01
Emergence of multidrug-resistant bacteria forces us to explore new therapeutic strategies, and proteins involved in key metabolic pathways are promising anti-bacterial targets. Bifunctional flavin-adenine dinucleotide (FAD) synthetases (FADS) are prokaryotic enzymes that synthesise the flavin mononucleotide (FMN) and FAD cofactors. The FADS from the human pathogen Streptococcus pneumoniae (SpnFADS)-causative agent of pneumonia in humans - shows relevant catalytic dissimilarities compared to other FADSs. Here, by integrating thermodynamic and kinetic data, we present a global description of the riboflavin kinase activity of SpnFADS, as well as of the inhibition mechanisms regulating this activity. Our data shed light on biophysical determinants that modulate species-specific conformational changes leading to catalytically competent conformations, as well as binding rates and affinities of substrates versus products. This knowledge paves the way for the development of tools - that taking advantage of the regulatory dissimilarities during FMN biosynthesis in different species - might be used in the discovery of specific anti-pneumococcal drugs.
Unno, Hideaki; Yamashita, Satoshi; Ikeda, Yosuke; Sekiguchi, Shin-ya; Yoshida, Norie; Yoshimura, Tohru; Kusunoki, Masami; Nakayama, Toru; Nishino, Tokuzo; Hemmi, Hisashi
2009-01-01
Using FMN and a reducing agent such as NAD(P)H, type 2 isopentenyl-diphosphate isomerase catalyzes isomerization between isopentenyl diphosphate and dimethylallyl diphosphate, both of which are elemental units for the biosynthesis of highly diverse isoprenoid compounds. Although the flavin cofactor is expected to be integrally involved in catalysis, its exact role remains controversial. Here we report the crystal structures of the substrate-free and complex forms of type 2 isopentenyl-diphosphate isomerase from the thermoacidophilic archaeon Sulfolobus shibatae, not only in the oxidized state but also in the reduced state. Based on the active-site structures of the reduced FMN-substrate-enzyme ternary complexes, which are in the active state, and on the data from site-directed mutagenesis at highly conserved charged or polar amino acid residues around the active site, we demonstrate that only reduced FMN, not amino acid residues, can catalyze proton addition/elimination required for the isomerase reaction. This discovery is the first evidence for this long suspected, but previously unobserved, role of flavins just as a general acid-base catalyst without playing any redox roles, and thereby expands the known functions of these versatile coenzymes. PMID:19158086
Unno, Hideaki; Yamashita, Satoshi; Ikeda, Yosuke; Sekiguchi, Shin-Ya; Yoshida, Norie; Yoshimura, Tohru; Kusunoki, Masami; Nakayama, Toru; Nishino, Tokuzo; Hemmi, Hisashi
2009-04-03
Using FMN and a reducing agent such as NAD(P)H, type 2 isopentenyl-diphosphate isomerase catalyzes isomerization between isopentenyl diphosphate and dimethylallyl diphosphate, both of which are elemental units for the biosynthesis of highly diverse isoprenoid compounds. Although the flavin cofactor is expected to be integrally involved in catalysis, its exact role remains controversial. Here we report the crystal structures of the substrate-free and complex forms of type 2 isopentenyl-diphosphate isomerase from the thermoacidophilic archaeon Sulfolobus shibatae, not only in the oxidized state but also in the reduced state. Based on the active-site structures of the reduced FMN-substrate-enzyme ternary complexes, which are in the active state, and on the data from site-directed mutagenesis at highly conserved charged or polar amino acid residues around the active site, we demonstrate that only reduced FMN, not amino acid residues, can catalyze proton addition/elimination required for the isomerase reaction. This discovery is the first evidence for this long suspected, but previously unobserved, role of flavins just as a general acid-base catalyst without playing any redox roles, and thereby expands the known functions of these versatile coenzymes.
Real-time electron transfer in respiratory complex I
Verkhovskaya, Marina L.; Belevich, Nikolai; Euro, Liliya; Wikström, Mårten; Verkhovsky, Michael I.
2008-01-01
Electron transfer in complex I from Escherichia coli was investigated by an ultrafast freeze-quench approach. The reaction of complex I with NADH was stopped in the time domain from 90 μs to 8 ms and analyzed by electron paramagnetic resonance (EPR) spectroscopy at low temperatures. The data show that after binding of the first molecule of NADH, two electrons move via the FMN cofactor to the iron–sulfur (Fe/S) centers N1a and N2 with an apparent time constant of ≈90 μs, implying that these two centers should have the highest redox potential in the enzyme. The rate of reduction of center N2 (the last center in the electron transfer sequence) is close to that predicted by electron transfer theory, which argues for the absence of coupled proton transfer or conformational changes during electron transfer from FMN to N2. After fast reduction of N1a and N2, we observe a slow, ≈1-ms component of reduction of other Fe/S clusters. Because all elementary electron transfer rates between clusters are several orders of magnitude higher than this observed rate, we conclude that the millisecond component is limited by a single process corresponding to dissociation of the oxidized NAD+ molecule from its binding site, where it prevents entry of the next NADH molecule. Despite the presence of approximately one ubiquinone per enzyme molecule, no transient semiquinone formation was observed, which has mechanistic implications, suggesting a high thermodynamic barrier for ubiquinone reduction to the semiquinone radical. Possible consequences of these findings for the proton translocation mechanism are discussed. PMID:18316732
Deka, Ranjit K.; Brautigam, Chad A.; Liu, Wei Z.
2015-01-01
ABSTRACT The syphilis spirochete Treponema pallidum is an important human pathogen but a highly enigmatic bacterium that cannot be cultivated in vitro. T. pallidum lacks many biosynthetic pathways and therefore has evolved the capability to exploit host-derived metabolites via its periplasmic lipoprotein repertoire. We recently reported a flavin-trafficking protein in T. pallidum (Ftp_Tp; TP0796) as the first bacterial metal-dependent flavin adenine dinucleotide (FAD) pyrophosphatase that hydrolyzes FAD into AMP and flavin mononucleotide (FMN) in the spirochete’s periplasm. However, orthologs of Ftp_Tp from other bacteria appear to lack this hydrolytic activity; rather, they bind and flavinylate subunits of a cytoplasmic membrane redox system (Nqr/Rnf). To further explore this dichotomy, biochemical analyses, protein crystallography, and structure-based mutagenesis were used to show that a single amino acid change (N55Y) in Ftp_Tp converts it from an Mg2+-dependent FAD pyrophosphatase to an FAD-binding protein. We also demonstrated that Ftp_Tp has a second enzymatic activity (Mg2+-FMN transferase); it flavinylates protein(s) covalently with FMN on a threonine side chain of an appropriate sequence motif using FAD as the substrate. Moreover, mutation of a metal-binding residue (D284A) eliminates Ftp_Tp’s dual activities, thereby underscoring the role of Mg2+ in the enzyme-catalyzed reactions. The posttranslational flavinylation activity that can target a periplasmic lipoprotein (TP0171) has not previously been described. The observed activities reveal the catalytic flexibility of a treponemal protein to perform multiple functions. Together, these findings imply mechanisms by which a dynamic pool of flavin cofactor is maintained and how flavoproteins are generated by Ftp_Tp locally in the T. pallidum periplasm. PMID:25944861
Sarapusit, Songklod; Lertkiatmongkol, Panida; Duangkaew, Panida; Rongnoparut, Pornpimol
2013-01-01
Malaria is one of the most dangerous mosquito-borne diseases in many tropical countries, including Thailand. Studies in a deltamethrin resistant strain of Anopheles minimus mosquito, suggest cytochrome P450 enzymes contribute to the detoxification of pyrethroid insecticides. Purified A. minimus CYPOR enzyme (AnCYPOR), which is the redox partner of cytochrome P450s, loses flavin-adenosine di-nucleotide (FAD) and FLAVIN mono-nucleotide (FMN) cofactors that affect its enzyme activity. Replacement of leucine residues at positions 86 and 219 with phenylalanines in FMN binding domain increases FMN binding, enzyme stability, and cytochrome c reduction activity. Membrane-Bound L86F/L219F-AnCYPOR increases A. minimus P450-mediated pyrethroid metabolism in vitro. In this study, we constructed a comparative model structure of AnCYPOR using a rat CYPOR structure as a template. Overall model structure is similar to rat CYPOR, with some prominent differences. Based on primary sequence and structural analysis of rat and A. minimus CYPOR, C427R, W678A, and W678H mutations were generated together with L86F/L219F resulting in three soluble Δ55 triple mutants. The C427R triple AnCYPOR mutant retained a higher amount of FAD binding and increased cytochrome c reduction activity compared to wild-type and L86F/L219F-Δ55AnCYPOR double mutant. However W678A and W678H mutations did not increase FAD and NAD(P)H bindings. The L86F/L219F double and C427R triple membrane-bound AnCYPOR mutants supported benzyloxyresorufin O-deakylation (BROD) mediated by mosquito CYP6AA3 with a two-to three-fold increase in efficiency over wild-type AnCYPOR. The use of rat CYPOR in place of AnCYPOR most efficiently supported CYP6AA3-mediated BROD compared to all AnCYPORs. PMID:23325047
DOE Office of Scientific and Technical Information (OSTI.GOV)
Isupov, Michail N.; Schröder, Ewald; Gibson, Robert P.
The first crystal structure of a type II Baeyer–Villiger monooxygenase reveals a different ring orientation of its FMN cofactor compared with other related bacterial luciferase-family enzymes. The three-dimensional structures of the native enzyme and the FMN complex of the overexpressed form of the oxygenating component of the type II Baeyer–Villiger 3,6-diketocamphane monooxygenase have been determined to 1.9 Å resolution. The structure of this dimeric FMN-dependent enzyme, which is encoded on the large CAM plasmid of Pseudomonas putida, has been solved by a combination of multiple anomalous dispersion from a bromine crystal soak and molecular replacement using a bacterial luciferase model.more » The orientation of the isoalloxazine ring of the FMN cofactor in the active site of this TIM-barrel fold enzyme differs significantly from that previously observed in enzymes of the bacterial luciferase-like superfamily. The Ala77 residue is in a cis conformation and forms a β-bulge at the C-terminus of β-strand 3, which is a feature observed in many proteins of this superfamily.« less
Deka, Ranjit K; Brautigam, Chad A; Liu, Wei Z; Tomchick, Diana R; Norgard, Michael V
2016-02-01
We recently reported a flavin-trafficking protein (Ftp) in the syphilis spirochete Treponema pallidum (Ftp_Tp) as the first bacterial metal-dependent FAD pyrophosphatase that hydrolyzes FAD into AMP and FMN in the periplasm. Orthologs of Ftp_Tp in other bacteria (formerly ApbE) appear to lack this hydrolytic activity; rather, they flavinylate the redox subunit, NqrC, via their metal-dependent FMN transferase activity. However, nothing has been known about the nature or mechanism of metal-dependent Ftp catalysis in either Nqr- or Rnf-redox-containing bacteria. In the current study, we identified a bimetal center in the crystal structure of Escherichia coli Ftp (Ftp_Ec) and show via mutagenesis that a single amino acid substitution converts it from an FAD-binding protein to a Mg(2+)-dependent FAD pyrophosphatase (Ftp_Tp-like). Furthermore, in the presence of protein substrates, both types of Ftps are capable of flavinylating periplasmic redox-carrying proteins (e.g., RnfG_Ec) via the metal-dependent covalent attachment of FMN. A high-resolution structure of the Ftp-mediated flavinylated protein of Shewanella oneidensis NqrC identified an essential lysine in phosphoester-threonyl-FMN bond formation in the posttranslationally modified flavoproteins. Together, these discoveries broaden our understanding of the physiological capabilities of the bacterial periplasm, and they also clarify a possible mechanism by which flavoproteins are generated. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Engineering an FMN-based iLOV protein for the detection of arsenic ions.
Ravikumar, Yuvaraj; Nadarajan, Saravanan Prabhu; Lee, Chong-Soon; Yun, Hyungdon
2017-05-15
Over the past few decades, genetically encoded fluorescent proteins have been widely used as efficient probes to explore and investigate the roles of metal ions in biological processes. The discovery of small FMN-based fluorescent proteins, such as iLOV and FbFP, has enabled researchers to exploit these fluorescent reporter proteins for metal-sensing applications. In this study, we report the inherent binding properties of iLOV towards arsenic ions. The fluorescence quenching of iLOV was linearly related to the concentration of arsenic ions, and engineered proteins showed better sensitivity than the wild-type protein. Engineering key residues around the chromophore converted the iLOV protein into a highly sensitive sensor for As 3+ ions. iLOV N468S exhibited an improved binding affinity with a dissociation constant of 1.5 μM. Furthermore, the circular dichroism spectra indicated that the fluorescence quenching mechanism might be related to arsenic-protein complex formation. Thus, the reagentless sensing of arsenic can potentially be exploited to determine intracellular or environmental arsenic using a genetically encoded biosensing approach. Copyright © 2017 Elsevier Inc. All rights reserved.
Structure and function of NADPH-cytochrome P450 reductase and nitric oxide synthase reductase domain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iyanagi, Takashi
2005-12-09
NADPH-cytochrome P450 reductase (CPR) and the nitric oxide synthase (NOS) reductase domains are members of the FAD-FMN family of proteins. The FAD accepts two reducing equivalents from NADPH (dehydrogenase flavin) and FMN acts as a one-electron carrier (flavodoxin-type flavin) for the transfer from NADPH to the heme protein, in which the FMNH {sup {center_dot}}/FMNH{sub 2} couple donates electrons to cytochrome P450 at constant oxidation-reduction potential. Although the interflavin electron transfer between FAD and FMN is not strictly regulated in CPR, electron transfer is activated in neuronal NOS reductase domain upon binding calmodulin (CaM), in which the CaM-bound activated form canmore » function by a similar mechanism to that of CPR. The oxygenated form and spin state of substrate-bound cytochrome P450 in perfused rat liver are also discussed in terms of stepwise one-electron transfer from CPR. This review provides a historical perspective of the microsomal mixed-function oxidases including CPR and P450. In addition, a new model for the redox-linked conformational changes during the catalytic cycle for both CPR and NOS reductase domain is also discussed.« less
Bertsova, Yulia V.; Fadeeva, Maria S.; Kostyrko, Vitaly A.; Serebryakova, Marina V.; Baykov, Alexander A.; Bogachev, Alexander V.
2013-01-01
Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) contains two flavin residues as redox-active prosthetic groups attached by a phosphoester bond to threonine residues in subunits NqrB and NqrC. We demonstrate here that flavinylation of truncated Vibrio harveyi NqrC at Thr-229 in Escherichia coli cells requires the presence of a co-expressed Vibrio apbE gene. The apbE genes cluster with genes for Na+-NQR and other FMN-binding flavoproteins in bacterial genomes and encode proteins with previously unknown function. Experiments with isolated NqrC and ApbE proteins confirmed that ApbE is the only protein factor required for NqrC flavinylation and also indicated that the reaction is Mg2+-dependent and proceeds with FAD but not FMN. Inactivation of the apbE gene in Klebsiella pneumoniae, wherein the nqr operon and apbE are well separated in the chromosome, resulted in a complete loss of the quinone reductase activity of Na+-NQR, consistent with its dependence on covalently bound flavin. Our data thus identify ApbE as a novel modifying enzyme, flavin transferase. PMID:23558683
Covès, J; Lebrun, C; Gervasi, G; Dalbon, P; Fontecave, M
1999-01-01
SiR-FP43, the NADPH- and FAD-binding domain of the Escherichia coli sulphite reductase flavoprotein component (SiR-FP), has been overexpressed and characterized. It folds independently, retaining FAD as a cofactor and the catalytic properties associated with the presence of this cofactor. Iodonium diphenyl chloride (IDP) was shown to be a very efficient inhibitor of SiR-FP43 and SiR-FP60, the monomeric form of SiR-FP, containing both FMN and FAD as cofactors (K(i) = 18.5 +/- 5 microM, maximal inactivation rate = 0.053 +/- 0.005 s(-1)). In both cases, inactivation was shown to result from covalent binding of a phenyl group to FAD exclusively, in marked contrast with previous results obtained with cytochrome P450 reductase (CPR), where FMN and a tryptophan were phenylated, but not FAD. However, our kinetic analyses are in agreement with the inhibition mechanism demonstrated with CPR [Tew (1993) Biochemistry 32, 10209-10215]. Nine different FAD phenylated adducts were isolated and, for the first time, two FAD phenylated adducts were identified directly after extraction from a protein. Taken together, our results have shown that flavoprotein inactivation by IDP is not a reliable indicator for a flavin radical intermediate in catalysis. PMID:10455035
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deka, Ranjit K.; Brautigam, Chad A.; Liu, Wei Z.
The syphilis spirochete Treponema pallidum is an important human pathogen but a highly enigmatic bacterium that cannot be cultivated in vitro. T. pallidum lacks many biosynthetic pathways and therefore has evolved the capability to exploit host-derived metabolites via its periplasmic lipoprotein repertoire. We recently reported a flavin-trafficking protein in T. pallidum (Ftp_Tp; TP0796) as the first bacterial metal-dependent flavin adenine dinucleotide (FAD) pyrophosphatase that hydrolyzes FAD into AMP and flavin mononucleotide (FMN) in the spirochete’s periplasm. However, orthologs of Ftp_Tp from other bacteria appear to lack this hydrolytic activity; rather, they bind and flavinylate subunits of a cytoplasmic membrane redoxmore » system (Nqr/Rnf). To further explore this dichotomy, biochemical analyses, protein crystallography, and structure-based mutagenesis were used to show that a single amino acid change (N55Y) in Ftp_Tp converts it from an Mg²⁺-dependent FAD pyrophosphatase to an FAD-binding protein. We also demonstrated that Ftp_Tp has a second enzymatic activity (Mg²⁺-FMN transferase); it flavinylates protein(s) covalently with FMN on a threonine side chain of an appropriate sequence motif using FAD as the substrate. Moreover, mutation of a metal-binding residue (D284A) eliminates Ftp_Tp’s dual activities, thereby underscoring the role of Mg²⁺ in the enzyme-catalyzed reactions. The posttranslational flavinylation activity that can target a periplasmic lipoprotein (TP0171) has not previously been described. The observed activities reveal the catalytic flexibility of a treponemal protein to perform multiple functions. Together, these findings imply mechanisms by which a dynamic pool of flavin cofactor is maintained and how flavoproteins are generated by Ftp_Tp locally in the T. pallidum periplasm.« less
Deka, Ranjit K.; Brautigam, Chad A.; Liu, Wei Z.; ...
2015-05-05
The syphilis spirochete Treponema pallidum is an important human pathogen but a highly enigmatic bacterium that cannot be cultivated in vitro. T. pallidum lacks many biosynthetic pathways and therefore has evolved the capability to exploit host-derived metabolites via its periplasmic lipoprotein repertoire. We recently reported a flavin-trafficking protein in T. pallidum (Ftp_Tp; TP0796) as the first bacterial metal-dependent flavin adenine dinucleotide (FAD) pyrophosphatase that hydrolyzes FAD into AMP and flavin mononucleotide (FMN) in the spirochete’s periplasm. However, orthologs of Ftp_Tp from other bacteria appear to lack this hydrolytic activity; rather, they bind and flavinylate subunits of a cytoplasmic membrane redoxmore » system (Nqr/Rnf). To further explore this dichotomy, biochemical analyses, protein crystallography, and structure-based mutagenesis were used to show that a single amino acid change (N55Y) in Ftp_Tp converts it from an Mg²⁺-dependent FAD pyrophosphatase to an FAD-binding protein. We also demonstrated that Ftp_Tp has a second enzymatic activity (Mg²⁺-FMN transferase); it flavinylates protein(s) covalently with FMN on a threonine side chain of an appropriate sequence motif using FAD as the substrate. Moreover, mutation of a metal-binding residue (D284A) eliminates Ftp_Tp’s dual activities, thereby underscoring the role of Mg²⁺ in the enzyme-catalyzed reactions. The posttranslational flavinylation activity that can target a periplasmic lipoprotein (TP0171) has not previously been described. The observed activities reveal the catalytic flexibility of a treponemal protein to perform multiple functions. Together, these findings imply mechanisms by which a dynamic pool of flavin cofactor is maintained and how flavoproteins are generated by Ftp_Tp locally in the T. pallidum periplasm.« less
Isupov, Michail N; Schröder, Ewald; Gibson, Robert P; Beecher, Jean; Donadio, Giuliana; Saneei, Vahid; Dcunha, Stephlina A; McGhie, Emma J; Sayer, Christopher; Davenport, Colin F; Lau, Peter C; Hasegawa, Yoshie; Iwaki, Hiroaki; Kadow, Maria; Balke, Kathleen; Bornscheuer, Uwe T; Bourenkov, Gleb; Littlechild, Jennifer A
2015-11-01
The three-dimensional structures of the native enzyme and the FMN complex of the overexpressed form of the oxygenating component of the type II Baeyer-Villiger 3,6-diketocamphane monooxygenase have been determined to 1.9 Å resolution. The structure of this dimeric FMN-dependent enzyme, which is encoded on the large CAM plasmid of Pseudomonas putida, has been solved by a combination of multiple anomalous dispersion from a bromine crystal soak and molecular replacement using a bacterial luciferase model. The orientation of the isoalloxazine ring of the FMN cofactor in the active site of this TIM-barrel fold enzyme differs significantly from that previously observed in enzymes of the bacterial luciferase-like superfamily. The Ala77 residue is in a cis conformation and forms a β-bulge at the C-terminus of β-strand 3, which is a feature observed in many proteins of this superfamily.
Ngo, Tri Duc; Van Le, Binh; Subramani, Vinod Kumar; Thi Nguyen, Chi My; Lee, Hyun Sook; Cho, Yona; Kim, Kyeong Kyu; Hwang, Hye-Yeon
2015-05-22
Proteins in the haloalkaloic acid dehalogenase (HAD) superfamily, which is one of the largest enzyme families, is generally composed of a catalytic core domain and a cap domain. Although proteins in this family show broad substrate specificities, the mechanisms of their substrate recognition are not well understood. In this study, we identified a new substrate binding motif of HAD proteins from structural and functional analyses, and propose that this motif might be crucial for interacting with hydrophobic rings of substrates. The crystal structure of TON_0338, one of the 17 putative HAD proteins identified in a hyperthermophilic archaeon, Thermococcus onnurineus NA1, was determined as an apo-form at 2.0 Å resolution. In addition, we determined the crystal structure TON_0338 in complex with Mg(2+) or N-cyclohexyl-2-aminoethanesulfonic acid (CHES) at 1.7 Å resolution. Examination of the apo-form and CHES-bound structures revealed that CHES is sandwiched between Trp58 and Trp61, suggesting that this Trp sandwich might function as a substrate recognition motif. In the phosphatase assay, TON_0338 was shown to have high activity for flavin mononucleotide (FMN), and the docking analysis suggested that the flavin of FMN may interact with Trp58 and Trp61 in a way similar to that observed in the crystal structure. Moreover, the replacement of these tryptophan residues significantly reduced the phosphatase activity for FMN. Our results suggest that WxxW may function as a substrate binding motif in HAD proteins, and expand the diversity of their substrate recognition mode. Copyright © 2015 Elsevier Inc. All rights reserved.
Structure and Mechanism of a Eukaryotic FMN Adenylyltransferase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huerta, Carlos; Borek, Dominika; Machius, Mischa
2009-12-01
Flavin mononucleotide adenylyltransferase (FMNAT) catalyzes the formation of the essential flavocoenzyme flavin adenine dinucleotide (FAD) and plays an important role in flavocoenzyme homeostasis regulation. By sequence comparison, bacterial and eukaryotic FMNAT enzymes belong to two different protein superfamilies and apparently utilize different sets of active-site residues to accomplish the same chemistry. Here we report the first structural characterization of a eukaryotic FMNAT from the pathogenic yeast Candida glabrata. Four crystal structures of C. glabrata FMNAT in different complexed forms were determined at 1.20-1.95 A resolutions, capturing the enzyme active-site states prior to and after catalysis. These structures reveal a novelmore » flavin-binding mode and a unique enzyme-bound FAD conformation. Comparison of the bacterial and eukaryotic FMNATs provides a structural basis for understanding the convergent evolution of the same FMNAT activity from different protein ancestors. Structure-based investigation of the kinetic properties of FMNAT should offer insights into the regulatory mechanisms of FAD homeostasis by FMNAT in eukaryotic organisms.« less
Wong, Tak-Wah; Cheng, Chien-Wei; Hsieh, Zong-Jhe; Liang, Ji-Yuan
2017-08-01
The light sensitive compound riboflavin-5'-phosphate (or flavin mononucleotide, FMN) generates reactive oxygen species (ROS) upon photo-irradiation. FMN is required by all flavoproteins because it is a cofactor of biological blue-light receptors. The photochemical effects of FMN after irradiation by blue or violet light on the inactivation of Staphylococcus aureus strains, including a methicillin-resistant strain (MRSA), were investigated in this study. Upon blue- or violet-light photo-treatment, FMN was shown to inactivate S. aureus due to the generated ROS. Effective bacterial inactivation can be achieved by FMN photolysis without an exogenous electron provider. Inactivation rates of 94.9 and 95.2% in S. aureus and MRSA, respectively, can be reached by blue light irradiation (2.0mW/cm 2 ) with 120μM FMN for 120min. A lower FMN concentration and a shorter time are required to reach similar effects by violet light irradiation. Inactivation rates of 96.3 and 97.0% in S. aureus and MRSA, respectively, can be reached by violet light irradiation (1.0mW/cm 2 ) with 30μM FMN for 30min. The sensitivity of the inherent photosensitizers is lower under blue-light irradiation. A long exposure photolytic treatment of FMN by blue light is required to inactivate S. aureus. Violet light was found to be more efficient in S. aureus inactivation at the same radiant intensity. FMN photolysis with blue or violet light irradiation enhanced the inactivation rates of S. aureus and MRSA. FMN photochemical treatment could be a supplemental technique in hygienic decontamination processes. Copyright © 2017 Elsevier B.V. All rights reserved.
UbiX is a flavin prenyltransferase required for bacterial ubiquinone biosynthesis
White, Mark D.; Payne, Karl A.P.; Fisher, Karl; Marshall, Stephen A.; Parker, David; Rattray, Nicholas J.W.; Trivedi, Drupad K.; Goodacre, Royston; Rigby, Stephen E.J.; Scrutton, Nigel S.; Hay, Sam; Leys, David
2016-01-01
Ubiquinone, or coenzyme Q, is a ubiquitous lipid-soluble redox cofactor that is an essential component of electron transfer chains1. Eleven genes have been implicated in bacterial ubiquinone biosynthesis, including ubiX and ubiD, which are responsible for decarboxylation of the 3-octaprenyl-4-hydroxybenzoate precursor2. Despite structural and biochemical characterization of UbiX as an FMN-binding protein, no decarboxylase activity has been detected3–4. We report here that UbiX produces a novel flavin-derived cofactor required for the decarboxylase activity of UbiD5. UbiX acts as a flavin prenyltransferase, linking a dimethylallyl moiety to the flavin N5 and C6 atoms. This adds a fourth non-aromatic ring to the flavin isoalloxazine group. In contrast to other prenyltransferases6–7, UbiX is metal-independent and requires dimethylallyl-monophosphate as substrate. Kinetic crystallography reveals that the prenyl transferase mechanism of UbiX resembles that of the terpene synthases8. The active site environment is dominated by π-systems, which assist phosphate-C1’ bond breakage following FMN reduction, leading to formation of the N5-C1’ bond. UbiX then acts as a chaperone for adduct reorientation, via transient carbocation species, leading ultimately to formation of the dimethylallyl C3’-C6 bond. The study establishes the mechanism for formation of a new flavin-derived cofactor, extending both flavin and terpenoid biochemical repertoire. PMID:26083743
Zoltowski, Brian D.; Nash, Abigail I.; Gardner, Kevin H.
2011-01-01
Light Oxygen Voltage (LOV) domains utilize a conserved blue light-dependent mechanism to control a diverse array of effector domains in biological and engineered proteins. Variations in the kinetics and efficiency of LOV photochemistry fine tune various aspects of the photic response. Characterization of the kinetics of a key aspect of this photochemical mechanism in EL222, a blue-light responsive DNA binding protein from Erythrobacter litoralis HTCC2594, reveals unique non-Arrhenius behavior in the rate of dark state cleavage of the photochemically-generated adduct. Sequence analysis and mutagenesis studies establish that this effect stems from a Gln to Ala mutation unique to EL222 and homologous proteins from marine bacteria. Kinetic and spectroscopic analyses reveal that hydrogen bonding interactions between the FMN N1, O2 and ribityl hydroxyls with the surrounding protein regulate photocycle kinetics and stabilize the LOV active site from temperature-induced alteration in local structure. Substitution of residues interacting with the N1-O2 locus modulates adduct stability, structural flexibility and sequestration of the active site from bulk solvent without perturbation of light-activated DNA binding. Together, these variants link non-Arrhenius behavior to specific alteration of an H-bonding network, while affording tunability of photocycle kinetics. PMID:21923139
Zoltowski, Brian D; Nash, Abigail I; Gardner, Kevin H
2011-10-18
Light, oxygen, voltage (LOV) domains utilize a conserved blue light-dependent mechanism to control a diverse array of effector domains in biological and engineered proteins. Variations in the kinetics and efficiency of LOV photochemistry fine-tune various aspects of the photic response. Characterization of the kinetics of a key aspect of this photochemical mechanism in EL222, a blue light responsive DNA binding protein from Erythrobacter litoralis HTCC2594, reveals unique non-Arrhenius behavior in the rate of dark-state cleavage of the photochemically generated adduct. Sequence analysis and mutagenesis studies establish that this effect stems from a Gln to Ala mutation unique to EL222 and homologous proteins from marine bacteria. Kinetic and spectroscopic analyses reveal that hydrogen bonding interactions between the FMN N1, O2, and ribityl hydroxyls and the surrounding protein regulate photocycle kinetics and stabilize the LOV active site from temperature-induced alteration in local structure. Substitution of residues interacting with the N1-O2 locus modulates adduct stability, structural flexibility, and sequestration of the active site from bulk solvent without perturbation of light-activated DNA binding. Together, these variants link non-Arrhenius behavior to specific alteration of an H-bonding network, while affording tunability of photocycle kinetics. © 2011 American Chemical Society
A conserved glutamine plays a central role in LOV domain signal transmission and duration
Nash, Abigail I.; Ko, Wen-Huang; Harper, Shannon M.; Gardner, Kevin H.
2009-01-01
Light is a key stimulus for plant biological functions, several of which are controlled by light-activated kinases known as phototropins, a group of kinases that contain two light-sensing domains (LOV, Light-Oxygen-Voltage domains) and a C-terminal serine/threonine kinase domain. The second sensory domain, LOV2, plays a key role in regulating kinase enzymatic activity via the photochemical formation of a covalent adduct between a LOV2 cysteine residue and an internally-bound flavin mononucleotide (FMN) chromophore. Subsequent conformational changes in LOV2 lead to the unfolding of a peripheral Jα helix, and ultimately, phototropin kinase activation. To date, the mechanism coupling bond formation and helix dissociation has remained unclear. Previous studies found that a conserved glutamine residue (Q513 in the Avena sativa phototropin 1 LOV2 (AsLOV2) domain) switches its hydrogen-bonding pattern with FMN upon light stimulation. Located in the immediate vicinity of the FMN binding site, this Gln residue is provided by the Iβ strand that interacts with the Jα helix, suggesting a route for signal propagation from the core of the LOV domain to its peripheral Jα helix. To test whether Q513 plays a key role in tuning the photochemical and transduction properties of AsLOV2, we designed two point mutations, Q513L and Q513N, and monitored the effects on the chromophore and protein using a combination of UV-visible absorbance and circular dichroism spectroscopy, limited proteolysis, and solution NMR. The results show that these mutations significantly dampen the changes between the dark and lit state AsLOV2 structures, leaving the protein in a pseudo-dark state (Q513L) or a pseudo-lit state (Q513N) conformation. Further, both mutations changed the photochemical properties of this receptor, particularly the lifetime of the photoexcited signaling states. Together, these data establish that this residue plays a central role in both spectral tuning and signal propagation from the core of the LOV domain through the Iβ strand to the peripheral Jα helix. PMID:19063612
Ultrafast fluorescence upconversion technique and its applications to proteins.
Chosrowjan, Haik; Taniguchi, Seiji; Tanaka, Fumio
2015-08-01
The basic principles and main characteristics of the ultrafast time-resolved fluorescence upconversion technique (conventional and space-resolved), including requirements for nonlinear crystals, mixing spectral bandwidth, acceptance angle, etc., are presented. Applications to flavoproteins [wild-type (WT) FMN-binding protein and its W32Y, W32A, E13R, E13K, E13Q and E13T mutants] and photoresponsive proteins [WT photoactive yellow protein and its R52Q mutant in solution and as single crystals] are demonstrated. For flavoproteins, investigations elucidating the effects of ionic charges on ultrafast electron transfer (ET) dynamics are summarized. It is shown that replacement of the ionic amino acid Glu13 and the resulting modification of the electrostatic charge distribution in the protein chromphore-binding pocket substantially alters the ultrafast fluorescence quenching dynamics and ET rate in FMN-binding protein. It is concluded that, together with donor-acceptor distances, electrostatic interactions between ionic photoproducts and other ionic groups in the proteins are important factors influencing the ET rates. In WT photoactive yellow protein and the R52Q mutant, ultrafast photoisomerization dynamics of the chromophore (deprotonated trans-p-coumaric acid) in liquid and crystal phases are investigated. It is shown that the primary dynamics in solution and single-crystal phases are quite similar; hence, the photocycle dynamics and structural differences observed at longer time scales arise mostly from the structural restraints imposed by the crystal lattice rigidity versus the flexibility in solution. © 2014 FEBS.
Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong
2015-03-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.
DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG
2015-01-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630
NASA Astrophysics Data System (ADS)
Evstigneev, M. P.; Mukhina, Yu. V.; Davies, D. B.
The hetero-association of the vitamin B2 derivative, flavin-mononucleotide (FMN), with a mutagenic dye, ethidium bromide (EB) or proflavine (PF), has been studied by 1D and 2D 500 MHz 1H NMR spectroscopy. The variations of proton chemical shifts of both the vitamin and dye as a function of concentration and temperature were analysed in terms of the structural and thermodynamical properties of the FMN-EB and FMN-PF complexes in solution. The structures of the complexes were also investigated by observed intermolecular ROE contacts and molecular mechanics calculations. The results show that the 1 : 1 hetero-association complexes in solution are more stable than the self-association complexes, which is consistent with formation of an intermolecular hydrogen-bond in the hetero-complexes of FMN-EB and FMN-PF. Hence it is possible that the toxicity of aromatic molecules such as EB and PF may be reduced in vitro by the presence of FMN, partly because of the known antimutagenic action of FMN and partly because it has been shown in this work that there is an effective intermolecular association between the mutagens and the vitamin.
The crystal structure of NADPH:ferredoxin reductase from Azotobacter vinelandii.
Sridhar Prasad, G.; Kresge, N.; Muhlberg, A. B.; Shaw, A.; Jung, Y. S.; Burgess, B. K.; Stout, C. D.
1998-01-01
NADPH:ferredoxin reductase (AvFPR) is involved in the response to oxidative stress in Azotobacter vinelandii. The crystal structure of AvFPR has been determined at 2.0 A resolution. The polypeptide fold is homologous with six other oxidoreductases whose structures have been solved including Escherichia coli flavodoxin reductase (EcFldR) and spinach, and Anabaena ferredoxin:NADP+ reductases (FNR). AvFPR is overall most homologous to EcFldR. The structure is comprised of a N-terminal six-stranded antiparallel beta-barrel domain, which binds FAD, and a C-terminal five-stranded parallel beta-sheet domain, which binds NADPH/NADP+ and has a classical nucleotide binding fold. The two domains associate to form a deep cleft where the NADPH and FAD binding sites are juxtaposed. The structure displays sequence conserved motifs in the region surrounding the two dinucleotide binding sites, which are characteristic of the homologous enzymes. The folded over conformation of FAD in AvFPR is similar to that in EcFldR due to stacking of Phe255 on the adenine ring of FAD, but it differs from that in the FNR enzymes, which lack a homologous aromatic residue. The structure of AvFPR displays three unique features in the environment of the bound FAD. Two features may affect the rate of reduction of FAD: the absence of an aromatic residue stacked on the isoalloxazine ring in the NADPH binding site; and the interaction of a carbonyl group with N10 of the flavin. Both of these features are due to the substitution of a conserved C-terminal tyrosine residue with alanine (Ala254) in AvFPR. An additional unique feature may affect the interaction of AvFPR with its redox partner ferredoxin I (FdI). This is the extension of the C-terminus by three residues relative to EcFldR and by four residues relative to FNR. The C-terminal residue, Lys258, interacts with the AMP phosphate of FAD. Consequently, both phosphate groups are paired with a basic group due to the simultaneous interaction of the FMN phosphate with Arg51 in a conserved FAD binding motif. The fourth feature, common to homologous oxidoreductases, is a concentration of 10 basic residues on the face of the protein surrounding the active site, in addition to Arg51 and Lys258. PMID:9865948
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Zheming; Shi, Zhi; Shi, Liang
2015-08-25
Dissimilatory iron-reducing bacteria can utilize insoluble Fe(Mn)-oxides as a terminal electron acceptor under anaerobic conditions. For Shewanella species specifically, some evidence suggests that iron reduction is associated with the secretion of flavin mononucleotide (FMN) and riboflavin that are proposed to mediate electron transfer (Marsili et al., 2008). In this work, we used methyl viologen (MV•+)-encapsulated, porin-cytochrome complex (MtrCAB) embedded liposomes (MELs) as a synthetic model of the Shewanella outer membrane to investigate the proposed mediating behavior of secreted flavins. The reduction kinetics of goethite, hematite and lepidocrocite (200 µM) by MELs ([MV•+] ~ 42 µM and MtrABC ≤ 1 nM)more » were determined in the presence FMN at pH 7.0 in N2 atmosphere by monitoring the concentrations of MV•+ and FMN through their characteristic UV-visible absorption spectra. Experiments were performed where i) FMN and Fe(III)-oxide were mixed and then reacted with the reduced MELs and ii) FMN was reacted with the reduced MELs followed by addition of Fe(III)-oxide. The redox reactions proceeded in two steps: a fast step that was completed in a few seconds, and a slower one lasting over 400 seconds. For all three Fe(III)-oxides, the initial reaction rate in the presence of a low concentration of FMN (≤ 1 µM) was at least a factor of five faster than those with MELs alone, and orders of magnitude faster than those by FMNH2, suggesting that FMN may serve as a co-factor that enhances electron transfer from outer-membrane c-cytochromes to Fe(III)-oxides. The rate and extent of the initial reaction followed the order of lepidocrocite > hematite > goethite, the same as their reduction potentials, implying thermodynamic control on reaction rate. However, at higher FMN concentrations (> 1 µM), the reaction rates for both steps decreased and varied inversely with FMN concentration, indicating that FMN inhibited the MEL to Fe(III)-oxide electron transfer reaction. The implications of the observed kinetic behaviors to flavin-mediated Fe(III) oxide reduction in natural environments are discussed.« less
Formononetin protects against acetaminophen-induced hepatotoxicity through enhanced NRF2 activity.
Jin, Fen; Wan, Chunpeng; Li, Weifang; Yao, Liangliang; Zhao, Hongqian; Zou, Yuan; Peng, Dewei; Huang, Weifeng
2017-01-01
To examine the effects of formononetin (FMN) on Acetaminophen (APAP)-induced liver injury in vitro and in vivo. Human non-tumor hepatic cells LO2 were pretreated with either vehicle or FMN (20, 40 μM), for 6 h, followed by incubation with or without APAP (10 mM) for 24 h. In an in vivo assay, male BALB/c mice were randomly divided into four groups: (1) control group; (2) APAP group; (3) APAP + FMN (50 mg/Kg); (4) APAP + FMN (100 mg/Kg). The mice in the control and APAP groups were pre-treated with vehicle; the other two groups were pretreated daily with FMN (50, 100 mg/Kg) orally for 7 consecutive days. After the final treatment, acute liver injury was induced in all groups, except the control group, by intraperitoneal (i.p.) injection of 300 mg/Kg APAP. In LO2 cells, APAP exposure decreased the cell viability and glutathione (GSH) content, which were both greatly restored by FMN pretreatment. Overdose of APAP increased hepatic malondialdehyde (MDA) content, serum alanine aminotransferase (ALT), and aspartate aminotransferase (AST) activity in experimental mice. Supplementation with 100 mg/Kg FMN significantly reduced APAP-induced elevated levels of MDA (1.97 ± 0.27 vs 0.55 ± 0.14 nmol/mg protein, p < 0.001), ALT (955.80 ± 209.40 vs 46.90 ± 20.40 IU/L, p < 0.001) and AST (1533.80 ± 244.80 vs 56.70 ± 28.80 IU/L, p < 0.001), and hepatic GSH level (5.54 ± 0.93 vs 8.91 ± 1.11 μmol/mg protein, p < 0.001) was significantly increased. These results were further validated by histopathology and TdT-mediated biotin-dUTP nick-endlabeling (TUNEL) staining, pretreatment with 100 mg/Kg FMN significant decreased APAP-induced hepatocellular damage and cell apoptosis (36.55 ± 3.82 vs 2.58 ± 1.80%, p < 0.001). Concomitantly, FMN stimulated the expression of Nrf2 and antioxidant gene expression in the presence of APAP. These data provide an experimental basis for the use of FMN in the treatment of patients with APAP-induced hepatotoxicity.
Formononetin protects against acetaminophen-induced hepatotoxicity through enhanced NRF2 activity
Li, Weifang; Yao, Liangliang; Zhao, Hongqian; Zou, Yuan; Peng, Dewei; Huang, Weifeng
2017-01-01
To examine the effects of formononetin (FMN) on Acetaminophen (APAP)-induced liver injury in vitro and in vivo. Human non-tumor hepatic cells LO2 were pretreated with either vehicle or FMN (20, 40 μM), for 6 h, followed by incubation with or without APAP (10 mM) for 24 h. In an in vivo assay, male BALB/c mice were randomly divided into four groups: (1) control group; (2) APAP group; (3) APAP + FMN (50 mg/Kg); (4) APAP + FMN (100 mg/Kg). The mice in the control and APAP groups were pre-treated with vehicle; the other two groups were pretreated daily with FMN (50, 100 mg/Kg) orally for 7 consecutive days. After the final treatment, acute liver injury was induced in all groups, except the control group, by intraperitoneal (i.p.) injection of 300 mg/Kg APAP. In LO2 cells, APAP exposure decreased the cell viability and glutathione (GSH) content, which were both greatly restored by FMN pretreatment. Overdose of APAP increased hepatic malondialdehyde (MDA) content, serum alanine aminotransferase (ALT), and aspartate aminotransferase (AST) activity in experimental mice. Supplementation with 100 mg/Kg FMN significantly reduced APAP-induced elevated levels of MDA (1.97 ± 0.27 vs 0.55 ± 0.14 nmol/mg protein, p < 0.001), ALT (955.80 ± 209.40 vs 46.90 ± 20.40 IU/L, p < 0.001) and AST (1533.80 ± 244.80 vs 56.70 ± 28.80 IU/L, p < 0.001), and hepatic GSH level (5.54 ± 0.93 vs 8.91 ± 1.11 μmol/mg protein, p < 0.001) was significantly increased. These results were further validated by histopathology and TdT-mediated biotin-dUTP nick-endlabeling (TUNEL) staining, pretreatment with 100 mg/Kg FMN significant decreased APAP-induced hepatocellular damage and cell apoptosis (36.55 ± 3.82 vs 2.58 ± 1.80%, p < 0.001). Concomitantly, FMN stimulated the expression of Nrf2 and antioxidant gene expression in the presence of APAP. These data provide an experimental basis for the use of FMN in the treatment of patients with APAP-induced hepatotoxicity. PMID:28234915
Covalent Binding of Flavins to RnfG and RnfD in the Rnf Complex from Vibrio cholerae
Backiel, Julianne; Juárez, Oscar; Zagorevski, Dmitri V.; Wang, Zhenyu; Nilges, Mark J.; Barquera, Blanca
2009-01-01
Enzymes of the Rnf family are believed to be bacterial redox-driven ion pumps, coupling an oxidoreduction process to the translocation of Na+ across the cell membrane. Here we show for the first time that Rnf is a flavoprotein, with FMN covalently bound to threonine-175 in RnfG and a second flavin bound to threonine-187 in RnfD. Rnf subunits D and G are homologous to subunits B and C of Na+-NQR, respectively. Each of these Na+-NQR subunits includes a conserved S(T)GAT motif, with FMN covalently bound to the final threonine. RnfD and RnfG both contain the same motif, suggesting that they bind flavins in a similar way. In order to investigate this, the genes for RnfD and RnfG from Vibrio cholerae were cloned and expressed individually in that organism. In both cases the produced protein fluoresced under UV illumination on an SDS gel, further indicating the presence of flavin. However, analysis of the mutants RnfG-T175L, RnfD-T278L, and RnfD-T187V showed that RnfG-T175 and RnfD-T187 are the likely flavin ligands. This indicates that, in the case of RnfD, the flavin is bound, not to the SGAT sequence but to the final residues of a TMAT sequence, a novel variant of the flavin binding motif. In the case of RnfG, flavin analysis, followed by MALDI-TOF-TOF mass spectrometry, showed that an FMN is covalently attached to threonine-175, the final threonine of the S(T)GAT sequence. Studies by visible, EPR, and ENDOR spectroscopy showed that, upon partial reduction, the isolated RnfG produces a neutral semiquinone intermediate. The semiquinone species disappeared upon full reduction and was not observed in the denatured protein. A topological analysis combining reporter protein fusion and computer predictions indicated that the flavins in RnfG and RnfD are localized in the periplasmic space. In contrast, in NqrC and NqrB the flavins are located in a cytoplasmic loop. This topological analysis suggests that there may be mechanistic differences between the Rnf and Na+-NQR complexes. PMID:18831535
NASA Astrophysics Data System (ADS)
Wang, Zheming; Shi, Zhi; Shi, Liang; White, Gaye F.; Richardson, David J.; Clarke, Thomas A.; Fredrickson, Jim K.; Zachara, John M.
2015-08-01
Dissimilatory iron-reducing bacteria can utilize insoluble Fe(Mn)-oxides as a terminal electron acceptor under anaerobic conditions. For Shewanella species specifically, evidence suggests that iron reduction is associated with the secretion of flavin mononucleotide (FMN) and riboflavin. However, the exact mechanism of flavin involvement is unclear; while some indicate that flavins mediate electron transfer (Marsili et al., 2008), others point to flavin serving as co-factors to outer membrane proteins (Okamoto et al., 2013). In this work, we used methyl viologen (MVrad +)-encapsulated, porin-cytochrome complex (MtrCAB) embedded liposomes (MELs) as a synthetic model of the Shewanella outer membrane to investigate the proposed mediating behavior of microbially produced flavins. The reduction kinetics of goethite, hematite and lepidocrocite (200 μM) by MELs ([MVrad +] ∼ 40 μM and MtrABC ⩽ 1 nM) were determined in the presence FMN at pH 7.0 in N2 atmosphere by monitoring the concentrations of MVrad + and FMN through their characteristic UV-visible absorption spectra. Experiments were performed where (i) FMN and Fe(III)-oxide were mixed and then reacted with the reduced MELs and (ii) FMN was reacted with the reduced MELs followed by addition of Fe(III)-oxide. The redox reactions proceeded in two steps: a fast step that was completed in a few seconds, and a slower one lasting over 400 s. For all three Fe(III)-oxides, the initial reaction rate in the presence of a low concentration of FMN (⩽1 μM) was at least a factor of five faster than those with MELs alone, and orders of magnitude faster than those by FMNH2, suggesting that FMN may serve as a co-factor that enhances electron transfer from outer-membrane c-cytochromes to Fe(III)-oxides. The rate and extent of the initial reaction followed the order of lepidocrocite > hematite > goethite, the same as their reduction potentials, implying thermodynamic control on reaction rate. For LEP, with the highest reduction potential among the three Fe(III)-oxides, its reduction by FMNH2 was completed in less than 10 min, suggesting that FMN was capable of mediating electron transfer to LEP. At higher FMN concentrations (>1 μM), the reaction rates for both steps decreased and varied inversely with FMN concentration, indicating that FMN inhibited the MEL to Fe(III)-oxide electron transfer reaction under these conditions. The implications of the observed kinetic behaviors to flavin-mediated Fe(III)-oxide reduction in natural environments are discussed.
Astashkin, Andrei V.; Fan, Weihong; Elmore, Bradley O.; Guillemette, J. Guy; Feng, Changjian
2011-01-01
Mammalian nitric oxide synthase (NOS) is a flavo-hemoprotein that catalyzes the oxidation of L-arginine to nitric oxide. Information about the relative alignment of the heme and FMN domains of NOS is important for understanding the electron transfer between the heme and FMN centers, but no crystal structure data for NOS holoenzyme are available. In our previous work [Astashkin, A. V.; Elmore, B. O.; Fan, W.; Guillemette, J. G.; Feng, C. J. Am. Chem. Soc. 2010, 132, 12059–12067], the distance between the imidazole-coordinated low-spin Fe(III) heme and FMN semiquinone in a human inducible NOS (iNOS) oxygenase/FMN construct has been determined by pulsed electron paramagnetic resonance (EPR). The orientation of the Fe – FMN radius-vector, RFe-FMN, with respect to the heme g-frame was also determined. In the present study, pulsed electron-nuclear double resonance (ENDOR) investigation of the deuterons at carbons C2 and C5 in the deuterated coordinated imidazole was used to determine the relative orientation of the heme g- and molecular frames, from which RFe-FMN can be referenced to the heme molecular frame. Numerical simulations of the ENDOR spectra showed that the g-factor axis corresponding to the low-field EPR turning point is perpendicular to the heme plane, while the axis corresponding to the high-field turning point is in the heme plane and makes an angle of about 80° with the coordinated imidazole plane. The FMN-heme domain docking model obtained in the previous work was found to be in qualitative agreement with the combined experimental results of the two pulsed EPR works. PMID:21834532
Liang, Ji-Yuan; Cheng, Chien-Wei; Yu, Chin-Hao; Chen, Liang-Yü
2015-02-01
The micronutrients in many cellular processes, riboflavin, flavin mononucleotide (FMN), and flavin adenine dinucleotide (FAD) are photo-sensitive to UV and visible light for generating reactive oxygen species (ROS). Produced from phosphorylation of riboflavin, FMN is more water-soluble and rapidly transformed into free riboflavin after ingestion. This study investigated the application of visible blue light with FMN to development of an effective antimicrobial treatment. The photosensitization of bacterial viability with FMN was investigated by light quality, intensity, time, and irradiation dosage. The blue light-induced photochemical reaction with FMN could inactivate Escherichiacoli by the generated ROS in damaging nucleic acids, which was validated. This novel photodynamic technique could be a safe practice for photo-induced inactivation of environmental microorganism to achieve hygienic requirements in food processing. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Yukun; Yuan, Guoliang; Yuan, Shaohua; Duan, Wenjing; Wang, Peng; Bai, Jianfang; Zhang, Fengting; Gao, Shiqing; Zhang, Liping; Zhao, Changping
2016-01-29
The 12-oxo-phytodienoic acid reductases (OPRs) are involved in the various processes of growth and development in plants, and classified into the OPRⅠ and OPRⅡ subgroups. In higher plants, only OPRⅡ subgroup genes take part in the biosynthesis of endogenous jasmonic acid. In this study, we isolated a novel OPRⅡ subgroup gene named TaOPR2 (GeneBank accession: KM216389) from the thermo-sensitive genic male sterile (TGMS) wheat cultivar BS366. TaOPR2 was predicted to encode a protein with 390 amino acids. The encoded protein contained the typical oxidored_FMN domain, the C-terminus peroxisomal-targeting signal peptide, and conserved FMN-binding sites. TaOPR2 was mapped to wheat chromosome 7B and located on peroxisome. Protein evolution analysis revealed that TaOPR2 belongs to the OPRⅡ subgroup and shares a high degree of identity with other higher plant OPR proteins. The quantitative real-time PCR results indicated that the expression of TaOPR2 is inhibited by abscisic acid (ABA), salicylic acid (SA), gibberellic acid (GA3), low temperatures and high salinity. In contrast, the expression of TaOPR2 can be induced by wounding, drought and methyl jasmonate (MeJA). Furthermore, the transcription level of TaOPR2 increased after infection with Puccinia striiformis f. sp. tritici and Puccinia recondite f. sp. tritici. TaOPR2 has NADPH-dependent oxidoreductase activity. In addition, the constitutive expression of TaOPR2 can rescue the male sterility phenotype of Arabidopsis mutant opr3. These results suggest that TaOPR2 is involved in the biosynthesis of jasmonic acid (JA) in wheat. Copyright © 2016 Elsevier Inc. All rights reserved.
Photo-induced degradation of some flavins in aqueous solution
NASA Astrophysics Data System (ADS)
Holzer, W.; Shirdel, J.; Zirak, P.; Penzkofer, A.; Hegemann, P.; Deutzmann, R.; Hochmuth, E.
2005-01-01
The blue-light induced photo-degradation of FMN, FAD, riboflavin, lumiflavin, and lumichrome in aqueous solution at pH 8 is studied by measurement of absorption coefficient spectral changes due to continuous excitation at 428 nm. The quantum yields of photo-degradation determined are ϕD(riboflavin, pH 8) ≈ 7.8 × 10 -3, ϕD(FMN, pH 5.6) ≈ 7.3 × 10 -3, ϕD(FMN, pH 8) ≈ 4.6 × 10 -3, ϕD(FAD, pH 8) ≈ 3.7 × 10 -4, ϕD(lumichrome, pH 8) ≈ 1.8 × 10 -4, and ϕD(lumiflavin, pH 8) ⩽ 1.1 × 10 -5. In a mass-spectroscopic analysis, the photo-products of FMN dissolved in water (solution pH is 5.6) were identified to be lumichrome and the lumiflavin derivatives dihydroxymethyllumiflavin, formyllumiflavin, and lumiflavin-hydroxy-acetaldehyde. An absorption and emission spectroscopic characterisation of the primary photoproducts of FMN at pH 8 is carried out.
NASA Astrophysics Data System (ADS)
Meyer, Andreas; Pellaux, René; Potot, Sébastien; Becker, Katja; Hohmann, Hans-Peter; Panke, Sven; Held, Martin
2015-08-01
Microcompartmentalization offers a high-throughput method for screening large numbers of biocatalysts generated from genetic libraries. Here we present a microcompartmentalization protocol for benchmarking the performance of whole-cell biocatalysts. Gel capsules served as nanolitre reactors (nLRs) for the cultivation and analysis of a library of Bacillus subtilis biocatalysts. The B. subtilis cells, which were co-confined with E. coli sensor cells inside the nLRs, converted the starting material cellobiose into the industrial product vitamin B2. Product formation triggered a sequence of reactions in the sensor cells: (1) conversion of B2 into flavin mononucleotide (FMN), (2) binding of FMN by a RNA riboswitch and (3) self-cleavage of RNA, which resulted in (4) the synthesis of a green fluorescent protein (GFP). The intensity of GFP fluorescence was then used to isolate B. subtilis variants that convert cellobiose into vitamin B2 with elevated efficiency. The underlying design principles of the assay are general and enable the development of similar protocols, which ultimately will speed up the optimization of whole-cell biocatalysts.
A base-catalyzed mechanism for dark state recovery in the Avena sativa phototropin-1 LOV2 domain.
Alexandre, Maxime T A; Arents, Jos C; van Grondelle, Rienk; Hellingwerf, Klaas J; Kennis, John T M
2007-03-20
Phototropins are autophosphorylating serine/threonine kinases responsible for blue-light perception in plants; their action gives rise to phototropism, chloroplast relocation, and opening of stomatal guard cells. The kinase domain constitutes the C-terminal part of Avena sativa phototropin 1. The N-terminal part contains two light, oxygen, or voltage (LOV) sensing domains, LOV1 and LOV2; each binds a flavin mononucleotide (FMN) chromophore (lambdamax = 447 nm, termed D447) and forms the light-sensitive domains, of which LOV2 is the principal component. Blue-light absorption produces a covalent adduct between a very conserved nearby cysteine residue and the C(4a) atom of the FMN moiety via the triplet state of the flavin. The covalent adduct thermally decays to regenerate the D447 dark state, with a rate that may vary by several orders of magnitude between different species. We report that the imidazole base can act as a very efficient enhancer of the dark recovery of A. sativa phot1 LOV2 (AsLOV2) and some other well-characterized LOV domains. Imidazole accelerates the thermal decay of AsLOV2 by 3 orders of magnitude in the submolar concentration range, via a base-catalyzed mechanism involving base abstraction of the FMN N(5)-H adduct state and subsequent reprotonation of the reactive cysteine. The LOV2 crystal structure suggests that the imidazole molecules may act from a cavity located in the vicinity of the FMN, explaining its high efficiency, populated through a channel connecting the cavity to the protein surface. Use of pH titration and chemical inactivation by diethyl pyrocarbonate (DEPC) suggests that histidines located at the surface of the LOV domain act as base catalysts via an as yet unidentified H-bond network, operating at a rate of (55 s)-1 at pH 8. In addition, molecular processes other than histidine-mediated base catalysis contibute significantly to the total thermal decay rate of the adduct and operate at a rate constant of (65 s)-1, leading to a net adduct decay time constant of 30 s at pH 8.
Tomiki, Takeshi; Saitou, Naruya
2004-08-01
The four electron transfer energy metabolism systems, photosynthesis, aerobic respiration, denitrification, and sulfur respiration, are thought to be evolutionarily related because of the similarity of electron transfer patterns and the existence of some homologous proteins. How these systems have evolved is elusive. We therefore conducted a comprehensive homology search using PSI-BLAST, and phylogenetic analyses were conducted for the three homologous groups (groups 1-3) based on multiple alignments of domains defined in the Pfam database. There are five electron transfer types important for catalytic reaction in group 1, and many proteins bind molybdenum. Deletions of two domains led to loss of the function of binding molybdenum and ferredoxin, and these deletions seem to be critical for the electron transfer pattern changes in group 1. Two types of electron transfer were found in group 2, and all its member proteins bind siroheme and ferredoxin. Insertion of the pyridine nucleotide disulfide oxidoreductase domain seemed to be the critical point for the electron transfer pattern change in this group. The proteins belonging to group 3 are all flavin enzymes, and they bind flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN). Types of electron transfer in this group are divergent, but there are two common characteristics. NAD(P)H works as an electron donor or acceptor, and FAD or FMN transfers electrons from/to NAD(P)H. Electron transfer functions might be added to these common characteristics by the addition of functional domains through the evolution of group 3 proteins. Based on the phylogenetic analyses in this study and previous studies, we inferred the phylogeny of the energy metabolism systems as follows: photosynthesis (and possibly aerobic respiration) and the sulfur/nitrogen assimilation system first diverged, then the sulfur/nitrogen dissimilation system was produced from the latter system.
Crystal structure of heterotetrameric sarcosine oxidase from Corynebacterium sp. U-96
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ida, Koh; E-mail: idakoh@sci.kitasato-u.ac.jp; Moriguchi, Tomotaka
2005-07-29
Sarcosine oxidase from Corynebacterium sp. U-96 is a heterotetrameric enzyme. Here we report the crystal structures of the enzyme in complex with dimethylglycine and folinic acid. The {alpha} subunit is composed of two domains, contains NAD{sup +}, and binds folinic acid. The {beta} subunit contains dimethylglycine, FAD, and FMN, and these flavins are approximately 10 A apart. The {gamma} subunit is in contact with two domains of {alpha} subunit and has possibly a folate-binding structure. The {delta} subunit contains a single atom of zinc and has a Cys{sub 3}His zinc finger structure. Based on the structures determined and on themore » previous works, the structure-function relationship on the heterotetrameric sarcosine oxidase is discussed.« less
Wu, Jianming; Ke, Xiao; Ma, Na; Wang, Wei; Fu, Wei; Zhang, Hongcheng; Zhao, Manxi; Gao, Xiaoping; Hao, Xiaofeng; Zhang, Zhirong
2016-01-01
It has been reported that formononetin (FMN), one of the main ingredients from famous traditional Chinese medicine "Huang-qi" ( Astragalus membranaceus [Fisch] Bunge) for Qi-tonifying, exhibits the effects of immunomodulation and tumor growth inhibition via antiangiogenesis. Furthermore, A. membranaceus may alleviate the retinal neovascularization (NV) of diabetic retinopathy. However, the information of FMN on retinal NV is limited so far. In the present study, we investigated the effects of FMN on the hypoxia-induced retinal NV and the possible related mechanisms. The VEGF secretion model of acute retinal pigment epithelial-19 (ARPE-19) cells under chemical hypoxia was established by the exposure of cells to 150 μM CoCl 2 and then cells were treated with 3-(5'-hydroxymethyl-2'-furyl)-1-benzylindazole (YC-1, a potent HIF-1α inhibitor, 1.0 μg/mL) or different concentrations of FMN (0.2 μg/mL, 1.0 μg/mL, and 5.0 μg/mL). The supernatants of cells were collected 48 hours later to measure the VEGF concentrations, following the manufacturer's instruction. The mRNA expressions of VEGF, HIF-1α, PHD-2, and β-actin were analyzed by quantitative reverse transcription polymerase chain reaction, and the protein expressions of HIF-1α and PHD-2 were determined by Western blot analysis. Furthermore, the rats with retinopathy were treated by intraperitoneal administration of conbercept injection (1.0 mg/kg) or FMN (5.0 mg/kg and 10.0 mg/kg) in an 80% oxygen atmosphere. The retinal avascular areas were assessed through visualization of the retinal vasculature by adenosine diphosphatase staining and hematoxylin and eosin staining. FMN can indeed inhibit the VEGF secretion of ARPE-19 cells under hypoxia, downregulate the mRNA expression of VEGFA and PHD-2, and decrease the protein expression of VEGF, HIF-1α, and PHD-2 in vitro. Furthermore, FMN can prevent hypoxia-induced retinal NV in vivo. FMN can ameliorate retinal NV via the HIF-1α/VEGF signaling pathway, and it may become a potential drug for the prevention and treatment of diabetic retinopathy.
Matern, Andreas; Pedrolli, Danielle; Großhennig, Stephanie; Johansson, Jörgen; Mack, Matthias
2016-12-01
The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are produced by the bacteria Streptomyces davawensis and Streptomyces cinnabarinus Riboflavin analogs have the potential to be used as broad-spectrum antibiotics, and we therefore studied the metabolism of riboflavin (vitamin B 2 ), RoF, and AF in the human pathogen Listeria monocytogenes, a bacterium which is a riboflavin auxotroph. We show that the L. monocytogenes protein Lmo1945 is responsible for the uptake of riboflavin, RoF, and AF. Following import, these flavins are phosphorylated/adenylylated by the bifunctional flavokinase/flavin adenine dinucleotide (FAD) synthetase Lmo1329 and adenylylated by the unique FAD synthetase Lmo0728, the first monofunctional FAD synthetase to be described in bacteria. Lmo1329 generates the cofactors flavin mononucleotide (FMN) and FAD, whereas Lmo0728 produces FAD only. The combined activities of Lmo1329 and Lmo0728 are responsible for the intracellular formation of the toxic cofactor analogs roseoflavin mononucleotide (RoFMN), roseoflavin adenine dinucleotide (RoFAD), 8-demethyl-8-aminoriboflavin mononucleotide (AFMN), and 8-demethyl-8-aminoriboflavin adenine dinucleotide (AFAD). In vivo reporter gene assays and in vitro transcription/translation experiments show that the L. monocytogenes FMN riboswitch Rli96, which controls expression of the riboflavin transport gene lmo1945, is negatively affected by riboflavin/FMN and RoF/RoFMN but not by AF/AFMN. Treatment of L. monocytogenes with RoF or AF leads to drastically reduced FMN/FAD levels. We suggest that the reduced flavin cofactor levels in combination with concomitant synthesis of inactive cofactor analogs (RoFMN, RoFAD, AFMN, and AFAD) explain why RoF and AF contribute to antibiotic activity in L. monocytogenes IMPORTANCE: The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are small molecules which are produced by Streptomyces davawensis and Streptomyces cinnabarinus RoF and AF were reported to have antibacterial activity, and we studied how these compounds are metabolized by the human bacterial pathogen Listeria monocytogenes We found that the L. monocytogenes protein Lmo1945 mediates uptake of AF and RoF and that the combined activities of the enzymes Lmo1329 and Lmo0728 are responsible for the conversion of AF and RoF to toxic cofactor analogs. Comparative studies with RoF and AF (a weaker antibiotic) suggest that the reduction in FMN/FAD levels and the formation of inactive FMN/FAD analogs explain to a large extent the antibiotic activity of AF and RoF. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
[Research on the cytotoxic and genotoxic effects of rare-earth element holmium to Vicia faba].
Qu, Ai; Wang, Cheng-Run; Bo, Jun
2004-03-01
Crystal of nitrate, made by the reaction of holmium trioxide and nitric acid, was dissolved in distilled water, thus diluted into gradient solution. Soaked in the solution for 6 hours (6h), the root tips of Vicia faba were then recovered and cultivated for 22 h and 24 h, respectively. By observing the change of root tips and calculating the frequency of micronucleus (FMN), the frequency of chromosomal aberrations(CAF) and mitosis index (MI),we find that the dosage below 4mg/L (expressed by concentration of holmium trioxide) could accelerate the growth of root tips of Vicia faba. CAF and FMN increased while MI decreased with the rise of concentrations. From it a dosage effect relationship is clearly seen. And it indicated that the rare earth element holmium has certain cytotoxic and genotoxic effects. Furthermore, the different recovery groups have different FMN, CAF and MI, and the difference lies in the fact that FMN of 22 h recovery group was lower than that of 24 h recovery group, while CAF and MI were higher than those of 24 h recovery group. The results suggest that the statistics of FMN should be made after that of CAF.
Purification and Characterization of EDTA Monooxygenase from the EDTA-Degrading Bacterium BNC1
Payne, Jason W.; Bolton, Harvey; Campbell, James A.; Xun, Luying
1998-01-01
The synthetic chelating agent EDTA can mobilize radionuclides and heavy metals in the environment. Biodegradation of EDTA should reduce this mobilization. Although several bacteria have been reported to mineralize EDTA, little is known about the biochemistry of EDTA degradation. Understanding the biochemistry will facilitate the removal of EDTA from the environment. EDTA-degrading activities were detected in cell extracts of bacterium BNC1 when flavin mononucleotide (FMN), NADH, and O2 were present. The degradative enzyme system was separated into two different enzymes, EDTA monooxygenase and an FMN reductase. EDTA monooxygenase oxidized EDTA to glyoxylate and ethylenediaminetriacetate (ED3A), with the coconsumption of FMNH2 and O2. The FMN reductase provided EDTA monooxygenase with FMNH2 by reducing FMN with NADH. The FMN reductase was successfully substituted in the assay mixture by other FMN reductases. EDTA monooxygenase was purified to greater than 95% homogeneity and had a single polypeptide with a molecular weight of 45,000. The enzyme oxidized both EDTA complexed with various metal ions and uncomplexed EDTA. The optimal conditions for activity were pH 7.8 and 35°C. Kms were 34.1 μM for uncomplexed EDTA and 8.5 μM for MgEDTA2−; this difference in Km indicates that the enzyme has greater affinity for MgEDTA2−. The enzyme also catalyzed the release of glyoxylate from nitrilotriacetate and diethylenetriaminepentaacetate. EDTA monooxygenase belongs to a small group of FMNH2-utilizing monooxygenases that attack carbon-nitrogen, carbon-sulfur, and carbon-carbon double bonds. PMID:9683478
Arora, Sumit; Taneja, Isha; Challagundla, Muralikrishna; Raju, Kanumuri Siva Rama; Singh, Sheelendra Pratap; Wahajuddin, Muhammad
2015-11-19
Formononetin (FMN) and Biochanin A (BCA) are the principal isoflavones present in commercially available extracts of red clover that are widely been consumed for various health benefits. We investigated the in vitro effects of FMN and BCA on catalytic activity of human/rat cytochrome P450 enzymes to assess the drug interaction potential of red clover. IC50 and Ki values of FMN and BCA for CYPs were determined in human/rat liver microsomes. FMN and BCA showed concentration-dependent inhibition of CYP1A2 activity with IC50 values of 13.42 and 24.98μM in human liver microsomes and 38.57 and 11.86μM in rat liver microsomes, respectively. The mode of inhibition of human CYP1A2 by FMN was found to be competitive with apparent Ki value of 10.13±1.96μM. FMN also inhibited human CYP2D6. BCA exerted moderately inhibitory effects on human CYP2C9. The predicted in vivo inhibition for CYP1A2 was insignificant (R value <1.1) at hepatic level while at intestinal level, it was significant (R value >11). The inhibitory effects on other CYPs were found to be minimal. Red clover may be considered safe to be consumed along with co-prescribed medications; however, precaution must be taken while co-administering it with CYP1A2 substrates. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Wu, Jianming; Ke, Xiao; Ma, Na; Wang, Wei; Fu, Wei; Zhang, Hongcheng; Zhao, Manxi; Gao, Xiaoping; Hao, Xiaofeng; Zhang, Zhirong
2016-01-01
Background It has been reported that formononetin (FMN), one of the main ingredients from famous traditional Chinese medicine “Huang-qi” (Astragalus membranaceus [Fisch] Bunge) for Qi-tonifying, exhibits the effects of immunomodulation and tumor growth inhibition via antiangiogenesis. Furthermore, A. membranaceus may alleviate the retinal neovascularization (NV) of diabetic retinopathy. However, the information of FMN on retinal NV is limited so far. In the present study, we investigated the effects of FMN on the hypoxia-induced retinal NV and the possible related mechanisms. Materials and methods The VEGF secretion model of acute retinal pigment epithelial-19 (ARPE-19) cells under chemical hypoxia was established by the exposure of cells to 150 μM CoCl2 and then cells were treated with 3-(5′-hydroxymethyl-2′-furyl)-1-benzylindazole (YC-1, a potent HIF-1α inhibitor, 1.0 μg/mL) or different concentrations of FMN (0.2 μg/mL, 1.0 μg/mL, and 5.0 μg/mL). The supernatants of cells were collected 48 hours later to measure the VEGF concentrations, following the manufacturer’s instruction. The mRNA expressions of VEGF, HIF-1α, PHD-2, and β-actin were analyzed by quantitative reverse transcription polymerase chain reaction, and the protein expressions of HIF-1α and PHD-2 were determined by Western blot analysis. Furthermore, the rats with retinopathy were treated by intraperitoneal administration of conbercept injection (1.0 mg/kg) or FMN (5.0 mg/kg and 10.0 mg/kg) in an 80% oxygen atmosphere. The retinal avascular areas were assessed through visualization of the retinal vasculature by adenosine diphosphatase staining and hematoxylin and eosin staining. Results FMN can indeed inhibit the VEGF secretion of ARPE-19 cells under hypoxia, downregulate the mRNA expression of VEGFA and PHD-2, and decrease the protein expression of VEGF, HIF-1α, and PHD-2 in vitro. Furthermore, FMN can prevent hypoxia-induced retinal NV in vivo. Conclusion FMN can ameliorate retinal NV via the HIF-1α/VEGF signaling pathway, and it may become a potential drug for the prevention and treatment of diabetic retinopathy. PMID:27729769
Functional Insights from Structural Genomics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Forouhar,F.; Kuzin, A.; Seetharaman, J.
2007-01-01
Structural genomics efforts have produced structural information, either directly or by modeling, for thousands of proteins over the past few years. While many of these proteins have known functions, a large percentage of them have not been characterized at the functional level. The structural information has provided valuable functional insights on some of these proteins, through careful structural analyses, serendipity, and structure-guided functional screening. Some of the success stories based on structures solved at the Northeast Structural Genomics Consortium (NESG) are reported here. These include a novel methyl salicylate esterase with important role in plant innate immunity, a novel RNAmore » methyltransferase (H. influenzae yggJ (HI0303)), a novel spermidine/spermine N-acetyltransferase (B. subtilis PaiA), a novel methyltransferase or AdoMet binding protein (A. fulgidus AF{_}0241), an ATP:cob(I)alamin adenosyltransferase (B. subtilis YvqK), a novel carboxysome pore (E. coli EutN), a proline racemase homolog with a disrupted active site (B. melitensis BME11586), an FMN-dependent enzyme (S. pneumoniae SP{_}1951), and a 12-stranded {beta}-barrel with a novel fold (V. parahaemolyticus VPA1032).« less
Quantitative bioluminescent detection of bacteria
NASA Technical Reports Server (NTRS)
Chappelle, E. W.; Picciolo, G. L.
1976-01-01
Phosphoflavins in sample are measured using photobacterial luciferase assay technique for flavin mononucleotide (FMN). Boiling perchloric acid is used to rupture cells to free bound flavin and to hydrolyze flavin adenine dinucleotide to FMN. Base-stabilized water solution of sodium borohydride is used as reactant.
Zhu, Fang; Sams, Sarah; Moural, Tim; Haynes, Kenneth F.; Potter, Michael F.; Palli, Subba R.
2012-01-01
Background NADPH-cytochrome P450 reductase (CPR) plays a central role in cytochrome P450 action. The genes coding for P450s are not yet fully identified in the bed bug, Cimex lectularius. Hence, we decided to clone cDNA and knockdown the expression of the gene coding for CPR which is suggested to be required for the function of all P450s to determine whether or not P450s are involved in resistance of bed bugs to insecticides. Methodology/Principal Findings The full length Cimex lectularius CPR (ClCPR) cDNA was isolated from a deltamethrin resistant bed bug population (CIN-1) using a combined PCR strategy. Bioinformatics and in silico modeling were employed to identify three conserved binding domains (FMN, FAD, NADP), a FAD binding motif, and the catalytic residues. The critical amino acids involved in FMN, FAD, NADP binding and their putative functions were also analyzed. No signal peptide but a membrane anchor domain with 21 amino acids which facilitates the localization of ClCPR on the endoplasmic reticulum was identified in ClCPR protein. Phylogenetic analysis showed that ClCPR is closer to the CPR from the body louse, Pediculus humanus corporis than to the CPRs from the other insect species studied. The ClCPR gene was ubiquitously expressed in all tissues tested but showed an increase in expression as immature stages develop into adults. We exploited the traumatic insemination mechanism of bed bugs to inject dsRNA and successfully knockdown the expression of the gene coding for ClCPR. Suppression of the ClCPR expression increased susceptibility to deltamethrin in resistant populations but not in the susceptible population of bed bugs. Conclusions/Significance These data suggest that P450-mediated metabolic detoxification may serve as one of the resistance mechanisms in bed bugs. PMID:22347424
Zhu, Fang; Sams, Sarah; Moural, Tim; Haynes, Kenneth F; Potter, Michael F; Palli, Subba R
2012-01-01
NADPH-cytochrome P450 reductase (CPR) plays a central role in cytochrome P450 action. The genes coding for P450s are not yet fully identified in the bed bug, Cimex lectularius. Hence, we decided to clone cDNA and knockdown the expression of the gene coding for CPR which is suggested to be required for the function of all P450s to determine whether or not P450s are involved in resistance of bed bugs to insecticides. The full length Cimex lectularius CPR (ClCPR) cDNA was isolated from a deltamethrin resistant bed bug population (CIN-1) using a combined PCR strategy. Bioinformatics and in silico modeling were employed to identify three conserved binding domains (FMN, FAD, NADP), a FAD binding motif, and the catalytic residues. The critical amino acids involved in FMN, FAD, NADP binding and their putative functions were also analyzed. No signal peptide but a membrane anchor domain with 21 amino acids which facilitates the localization of ClCPR on the endoplasmic reticulum was identified in ClCPR protein. Phylogenetic analysis showed that ClCPR is closer to the CPR from the body louse, Pediculus humanus corporis than to the CPRs from the other insect species studied. The ClCPR gene was ubiquitously expressed in all tissues tested but showed an increase in expression as immature stages develop into adults. We exploited the traumatic insemination mechanism of bed bugs to inject dsRNA and successfully knockdown the expression of the gene coding for ClCPR. Suppression of the ClCPR expression increased susceptibility to deltamethrin in resistant populations but not in the susceptible population of bed bugs. These data suggest that P450-mediated metabolic detoxification may serve as one of the resistance mechanisms in bed bugs.
Ayuso-Tejedor, Sara; Angarica, Vladimir Espinosa; Bueno, Marta; Campos, Luis A; Abián, Olga; Bernadó, Pau; Sancho, Javier; Jiménez, M Angeles
2010-07-23
Partly unfolded protein conformations close to the native state may play important roles in protein function and in protein misfolding. Structural analyses of such conformations which are essential for their fully physicochemical understanding are complicated by their characteristic low populations at equilibrium. We stabilize here with a single mutation the equilibrium intermediate of apoflavodoxin thermal unfolding and determine its solution structure by NMR. It consists of a large native region identical with that observed in the X-ray structure of the wild-type protein plus an unfolded region. Small-angle X-ray scattering analysis indicates that the calculated ensemble of structures is consistent with the actual degree of expansion of the intermediate. The unfolded region encompasses discontinuous sequence segments that cluster in the 3D structure of the native protein forming the FMN cofactor binding loops and the binding site of a variety of partner proteins. Analysis of the apoflavodoxin inner interfaces reveals that those becoming destabilized in the intermediate are more polar than other inner interfaces of the protein. Natively folded proteins contain hydrophobic cores formed by the packing of hydrophobic surfaces, while natively unfolded proteins are rich in polar residues. The structure of the apoflavodoxin thermal intermediate suggests that the regions of natively folded proteins that are easily responsive to thermal activation may contain cores of intermediate hydrophobicity. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Haulcomb, Melissa M.; Mesnard, Nichole A.; Batka, Richard J.; Alexander, Thomas D.; Sanders, Virginia M.; Jones, Kathryn J.
2014-01-01
The target disconnection theory of amyotrophic lateral sclerosis (ALS) pathogenesis suggests disease onset is initiated by a peripheral pathological event resulting in neuromuscular junction loss and motoneuron (MN) degeneration. Pre-symptomatic mSOD1G93A mouse facial MN (FMN) are more susceptible to axotomy-induced cell death than wild-type (WT) FMN, which suggests additional CNS pathology. We have previously determined that the mSOD1 molecular response to facial nerve axotomy is phenotypically regenerative and indistinguishable from WT, whereas the surrounding microenvironment shows significant dysregulation in the mSOD1 facial nucleus. To elucidate the mechanisms underlying the enhanced mSOD1 FMN loss after axotomy, we superimposed the facial nerve axotomy model on pre-symptomatic mSOD1 mice and investigated gene expression for death receptor pathways after target disconnection by axotomy vs. disease progression. We determined that the TNFR1 death receptor pathway is involved in axotomy-induced FMN death in WT, and partially responsible for the mSOD1 FMN death. In contrast, an inherent mSOD1 CNS pathology resulted in a suppressed glial reaction and an upregulation in the Fas death pathway after target disconnection. We propose that the dysregulated mSOD1 glia fail to provide support to injured MN, leading to Fas-induced FMN death. Finally, we demonstrated that during disease progression, the mSOD1 facial nucleus displays target disconnection-induced gene expression changes that mirror those induced by axotomy. This validates the use of axotomy as an investigative tool in understanding the role of peripheral target disconnection in the pathogenesis of ALS. PMID:24424947
Deka, Ranjit K; Brautigam, Chad A; Liu, Wei Z; Tomchick, Diana R; Norgard, Michael V
2015-05-05
The syphilis spirochete Treponema pallidum is an important human pathogen but a highly enigmatic bacterium that cannot be cultivated in vitro. T. pallidum lacks many biosynthetic pathways and therefore has evolved the capability to exploit host-derived metabolites via its periplasmic lipoprotein repertoire. We recently reported a flavin-trafficking protein in T. pallidum (Ftp_Tp; TP0796) as the first bacterial metal-dependent flavin adenine dinucleotide (FAD) pyrophosphatase that hydrolyzes FAD into AMP and flavin mononucleotide (FMN) in the spirochete's periplasm. However, orthologs of Ftp_Tp from other bacteria appear to lack this hydrolytic activity; rather, they bind and flavinylate subunits of a cytoplasmic membrane redox system (Nqr/Rnf). To further explore this dichotomy, biochemical analyses, protein crystallography, and structure-based mutagenesis were used to show that a single amino acid change (N55Y) in Ftp_Tp converts it from an Mg(2+)-dependent FAD pyrophosphatase to an FAD-binding protein. We also demonstrated that Ftp_Tp has a second enzymatic activity (Mg(2+)-FMN transferase); it flavinylates protein(s) covalently with FMN on a threonine side chain of an appropriate sequence motif using FAD as the substrate. Moreover, mutation of a metal-binding residue (D284A) eliminates Ftp_Tp's dual activities, thereby underscoring the role of Mg(2+) in the enzyme-catalyzed reactions. The posttranslational flavinylation activity that can target a periplasmic lipoprotein (TP0171) has not previously been described. The observed activities reveal the catalytic flexibility of a treponemal protein to perform multiple functions. Together, these findings imply mechanisms by which a dynamic pool of flavin cofactor is maintained and how flavoproteins are generated by Ftp_Tp locally in the T. pallidum periplasm. Treponema pallidum, the syphilis spirochete, exploits its periplasmic lipoproteins for a number of essential physiologic processes. One of these, flavin-trafficking protein (Ftp), not only exploits its catalytic center to mediate posttranslational flavinylation of proteins (to create flavoproteins) but also likely maintains the periplasmic flavin pool via its unique ability to hydrolyze FAD. This functional diversity within a single lipoprotein is quite remarkable and reflects the enzymatic versatility of the treponemal lipoproteins, as well as molecular parsimony in an organism with a limited genome. Ftp-mediated protein flavinylation in the periplasm also likely is a key aspect of a predicted flavin-dependent Rnf-based redox homeostasis system at the cytoplasmic membrane of T. pallidum. In addition to its importance in T. pallidum physiology, Ftp homologs exist in other bacteria, thereby expanding our understanding of the bacterial periplasm as a metabolically active subcellular compartment for flavoprotein biogenesis as well as flavin homeostasis. Copyright © 2015 Deka et al.
Fei, Hong-Xin; Zhang, Ying-Bo; Liu, Ting; Zhang, Xiao-Jie; Wu, Shu-Liang
2018-01-01
Alzheimer's disease (AD) is the most common cause of dementia among elderly population. Deranged β-amyloid (Aβ) trafficking across the blood-brain barrier is known to be a critical element in the pathogenesis of AD. In the vascular endothelial cells of hippocampus, Aβ transport is mainly mediated by low-density lipoprotein-associated protein 1 (LRP1) and the receptor for advanced glycation end (RAGE) products; therefore, LRP1 and RAGE endothelial cells are potential therapeutic targets for AD. In this study, we explored the effects of Formononetin (FMN) on learning and memory improvement in APP/PS1 mice and the related mechanisms. We found that FMN significantly improved learning and memory ability by suppressing Aβ production from APP processing, RAGE-dependent inflammatory signaling and promoted LRP1-dependent cerebral Aβ clearance pathway. Moreover, FMN treatment alleviated ultrastructural changes in hippocampal vascular endothelial cells. In conclusion, we believe that FMN may be an efficacious and promising treatment for AD.
Martínez-Júlvez, Marta; Medina, Milagros; Velázquez-Campoy, Adrián
2009-01-01
Abstract The thermodynamics of the formation of binary and ternary complexes between Anabaena PCC 7119 FNR and its substrates, NADP+ and Fd, or Fld, has been studied by ITC. Despite structural dissimilarities, the main difference between Fd and Fld binding to FNR relates to hydrophobicity, reflected in different binding heat capacity and number of water molecules released from the interface. At pH 8, the formation of the binary complexes is both enthalpically and entropically driven, accompanied by the protonation of at least one ionizable group. His299 FNR has been identified as the main responsible for the proton exchange observed. However, at pH 10, where no protonation occurs and intrinsic binding parameters can be obtained, the formation of the binary complexes is entropically driven, with negligible enthalpic contribution. Absence of the FMN cofactor in Fld does not alter significantly the strength of the interaction, but considerably modifies the enthalpic and entropic contributions, suggesting a different binding mode. Ternary complexes show negative cooperativity (6-fold and 11-fold reduction in binding affinity, respectively), and an increase in the enthalpic contribution (more favorable) and a decrease in the entropic contribution (less favorable), with regard to the binary complexes energetics. PMID:19527656
Bashiri, Ghader; Rehan, Aisyah M.; Sreebhavan, Sreevalsan; Baker, Heather M.; Baker, Edward N.; Squire, Christopher J.
2016-01-01
Cofactor F420 is an electron carrier with a major role in the oxidoreductive reactions of Mycobacterium tuberculosis, the causative agent of tuberculosis. A γ-glutamyl ligase catalyzes the final steps of the F420 biosynthesis pathway by successive additions of l-glutamate residues to F420-0, producing a poly-γ-glutamate tail. The enzyme responsible for this reaction in archaea (CofE) comprises a single domain and produces F420-2 as the major species. The homologous M. tuberculosis enzyme, FbiB, is a two-domain protein and produces F420 with predominantly 5–7 l-glutamate residues in the poly-γ-glutamate tail. The N-terminal domain of FbiB is homologous to CofE with an annotated γ-glutamyl ligase activity, whereas the C-terminal domain has sequence similarity to an FMN-dependent family of nitroreductase enzymes. Here we demonstrate that full-length FbiB adds multiple l-glutamate residues to F420-0 in vitro to produce F420-5 after 24 h; communication between the two domains is critical for full γ-glutamyl ligase activity. We also present crystal structures of the C-terminal domain of FbiB in apo-, F420-0-, and FMN-bound states, displaying distinct sites for F420-0 and FMN ligands that partially overlap. Finally, we discuss the features of a full-length structural model produced by small angle x-ray scattering and its implications for the role of N- and C-terminal domains in catalysis. PMID:26861878
Wang, Bing; Powell, Samantha M.; Hessami, Neda; Najar, Fares Z.; Thomas, Leonard M.; Karr, Elizabeth A.; West, Ann H.; Richter-Addo, George B.
2016-01-01
Nitroreductases (NRs) are flavin mononucleotide (FMN)-dependent enzymes that catalyze the biotransformation of organic nitro compounds (RNO2; R = alkyl, aryl) to the nitroso RN=O, hydroxylamino RNHOH, or amine RNH2 derivatives. Metronidazole (Mtz) is a nitro-containing antibiotic that is commonly prescribed for lower-gut infections caused by the anaerobic bacterium Clostridium difficile. C. difficile infections rank number one among hospital acquired infections, and can result in diarrhea, severe colitis, or even death. Although NRs have been implicated in Mtz resistance of C. difficile, no NRs have been characterized from the hypervirulent R20291 strain of C. difficile. We report the first expression, purification, and three-dimensional X-ray crystal structures of two NRs from the C. difficile R20291 strain. The X-ray crystal structures of the two NRs were solved to 2.1 Å resolution. Their homodimeric structures exhibit the classic NR α+β fold, with each protomer binding one FMN cofactor near the dimer interface. Functional assays demonstrate that these two NRs metabolize Mtz with associated re-oxidation of the proteins. Importantly, these results represent the first isolation and characterization of NRs from the hypervirulent R20291 strain of relevance to organic RNO2 (e.g., Mtz) metabolism. PMID:27623089
Elucidating nitric oxide synthase domain interactions by molecular dynamics.
Hollingsworth, Scott A; Holden, Jeffrey K; Li, Huiying; Poulos, Thomas L
2016-02-01
Nitric oxide synthase (NOS) is a multidomain enzyme that catalyzes the production of nitric oxide (NO) by oxidizing L-Arg to NO and L-citrulline. NO production requires multiple interdomain electron transfer steps between the flavin mononucleotide (FMN) and heme domain. Specifically, NADPH-derived electrons are transferred to the heme-containing oxygenase domain via the flavin adenine dinucleotide (FAD) and FMN containing reductase domains. While crystal structures are available for both the reductase and oxygenase domains of NOS, to date there is no atomic level structural information on domain interactions required for the final FMN-to-heme electron transfer step. Here, we evaluate a model of this final electron transfer step for the heme-FMN-calmodulin NOS complex based on the recent biophysical studies using a 105-ns molecular dynamics trajectory. The resulting equilibrated complex structure is very stable and provides a detailed prediction of interdomain contacts required for stabilizing the NOS output state. The resulting equilibrated complex model agrees well with previous experimental work and provides a detailed working model of the final NOS electron transfer step required for NO biosynthesis. © 2015 The Protein Society.
van der Linden, Eddy; Burgdorf, Tanja; de Lacey, Antonio L; Buhrke, Thorsten; Scholte, Marcel; Fernandez, Victor M; Friedrich, Bärbel; Albracht, Simon P J
2006-03-01
Infrared (IR) spectra in combination with chemical analyses have recently shown that the active Ni-Fe site of the soluble NAD(+)-reducing [NiFe]-hydrogenase from Ralstonia eutropha contains four cyanide groups and one carbon monoxide as ligands. Experiments presented here confirm this result, but show that a variable percentage of enzyme molecules loses one or two of the cyanide ligands from the active site during routine purification. For this reason the redox conditions during the purification have been optimized yielding hexameric enzyme preparations (HoxFUYHI(2)) with aerobic specific H(2)-NAD(+) activities of 150-185 mumol/min/mg of protein (up to 200% of the highest activity previously reported in the literature). The preparations were highly homogeneous in terms of the active site composition and showed superior IR spectra. IR spectro-electrochemical studies were consistent with the hypothesis that only reoxidation of the reduced enzyme with dioxygen leads to the inactive state, where it is believed that a peroxide group is bound to nickel. Electron paramagnetic resonance experiments showed that the radical signal from the NADH-reduced enzyme derives from the semiquinone form of the flavin (FMN-a) in the hydrogenase module (HoxYH dimer), but not of the flavin (FMN-b) in the NADH-dehydrogenase module (HoxFU dimer). It is further demonstrated that the hexameric enzyme remains active in the presence of NADPH and air, whereas NADH and air lead to rapid destruction of enzyme activity. It is proposed that the presence of NADPH in cells keeps the enzyme in the active state.
Zhang, Lin; Trncik, Christian; Andrade, Susana L A; Einsle, Oliver
2017-02-01
The copper-containing enzyme nitrous oxide reductase (N 2 OR) catalyzes the transformation of nitrous oxide (N 2 O) to dinitrogen (N 2 ) in microbial denitrification. Several accessory factors are essential for assembling the two copper sites Cu A and Cu Z , and for maintaining the activity. In particular, the deletion of either the transmembrane iron-sulfur flavoprotein NosR or the periplasmic protein NosX, a member of the ApbE family, abolishes N 2 O respiration. Here we demonstrate through biochemical and structural studies that the ApbE protein from Pseudomonas stutzeri, where the nosX gene is absent, is a monomeric FAD-binding protein that can serve as the flavin donor for NosR maturation via covalent flavinylation of a threonine residue. The flavin transfer reaction proceeds both in vivo and in vitro to generate post-translationally modified NosR with covalently bound FMN. Only FAD can act as substrate and the reaction requires a divalent cation, preferably Mg 2+ that was also present in the crystal structure. In addition, the reaction is species-specific to a certain extent. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Semenov, M. A.; Blyzniuk, Iu. N.; Bolbukh, T. V.; Shestopalova, A. V.; Evstigneev, M. P.; Maleev, V. Ya.
2012-09-01
By the methods of vibrational spectroscopy (Infrared and Raman) the investigation of the hetero-association of biologically active aromatic compounds: flavin-mononucleotide (FMN), ethidium bromide (EB) and proflavine (PRF) was performed in aqueous solutions. It was shown that between the functional groups (Cdbnd O and NH2) the intermolecular hydrogen bonds are formed in the hetero-complexes FMN-EB and FMN-PRF, additionally stabilizing these structures. An estimation of the enthalpy of Н-bonding obtained from experimental shifts of carbonyl vibrational frequencies has shown that the H-bonds do not dominate in the magnitude of experimentally measured total enthalpy of the hetero-association reactions. The main stabilization is likely due to intermolecular interactions of the molecules in these complexes and their interaction with water environment.
NIR fluorescent dyes: versatile vehicles for marker and probe applications
NASA Astrophysics Data System (ADS)
Patonay, Gabor; Chapman, Gala; Beckford, Garfield; Henary, Maged
2013-02-01
The use of the NIR spectral region (650-900 nm) is advantageous due to the inherently lower background interference and the high molar absorptivities of NIR chromophores. Near-Infrared (NIR) dyes are increasingly used in the biological and medical field. The binding characteristics of NIR dyes to biomolecules are possibly controlled by several factors, including hydrophobicity, size and charge just to mention a few parameters. Binding characteristics of symmetric carbocyanines and found that the hydrophobic nature of the NIR dye is only partially responsible for the binding strength. Upon binding to biomolecules significant fluorescence enhancement can be observed for symmetrical carbocyanines. This fluorescence amplification facilitates the detection of the NIR dye and enhances its utility as NIR reporter. This manuscript discusses some probe and marker applications of such NIR fluorescent dyes. One application discussed here is the use of NIR dyes as markers. For labeling applications the fluorescence intensity of the NIR fluorescent label can significantly be increased by enclosing several dye molecules in nanoparticles. To decrease self quenching dyes that have relatively large Stokes' shift needs to be used. This is achieved by substituting meso position halogens with amino moiety. This substitution can also serve as a linker to covalently attach the dye molecule to the nanoparticle backbone. We report here on the preparation of NIR fluorescent silica nanoparticles. Silica nanoparticles that are modified with aminoreactive moieties can be used as bright fluorescent labels in bioanalytical applications. A new bioanalytical technique to detect and monitor the catalytic activity of the sulfur assimilating enzyme using NIR dyes is reported as well. In this spectroscopic bioanalytical assay a family of Fischer based n-butyl sulfonate substituted dyes that exhibit distinct variation in absorbance and fluorescence properties and strong binding to serum albumin as its sulfonic acid moiety is modified to less water soluble moiety was identified. In polar solvents, these water soluble compounds are strongly fluorescent, however form the less soluble aggregated species with virtual loss of fluorescence when the sulfonate groups are cleaved by enzymatic activity to form the corresponding straight chain alkyl aldehyde derivatives. To achieve this conversion in vitro photo-reduced riboflavin mononucleotide (FMN) with a glucose/ glucose-oxygenase oxygen scavenging system was utilized. The reduced FMN serves as a key substrate in the enzymatic desulfonation. Once the FMNH2 was produced the desulfonation reaction was characterized by using Laser Induced Fluorescence Capillary Zone Electropheresis (LIF-CZE). This method can be utilized as an assay to detect the enzyme activity in vitro with the possibilities of in vivo applications.
Casutt, Marco S; Schlosser, Andreas; Buckel, Wolfgang; Steuber, Julia
2012-10-01
The Na(+)-translocating NADH:quinone oxidoreductase (Na(+)-NQR) is the prototype of a novel class of flavoproteins carrying a riboflavin phosphate bound to serine or threonine by a phosphodiester bond to the ribityl side chain. This membrane-bound, respiratory complex also contains one non-covalently bound FAD, one non-covalently bound riboflavin, ubiquinone-8 and a [2Fe-2S] cluster. Here, we report the quantitative analysis of the full set of flavin cofactors in the Na(+)-NQR and characterize the mode of linkage of the riboflavin phosphate to the membrane-bound NqrB and NqrC subunits. Release of the flavin by β-elimination and analysis of the cofactor demonstrates that the phosphate group is attached at the 5'-position of the ribityl as in authentic FMN and that the Na(+)-NQR contains approximately 1.7mol covalently bound FMN per mol non-covalently bound FAD. Therefore, each of the single NqrB and NqrC subunits in the Na(+)-NQR carries a single FMN. Elimination of the phosphodiester bond yields a dehydro-2-aminobutyrate residue, which is modified with β-mercaptoethanol by Michael addition. Proteolytic digestion followed by mass determination of peptide fragments reveals exclusive modification of threonine residues, which carry FMN in the native enzyme. The described reactions allow quantification and localization of the covalently attached FMNs in the Na(+)-NQR and in related proteins belonging to the Rhodobacter nitrogen fixation (RNF) family of enzymes. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.
Semenov, M A; Blyzniuk, Iu N; Bolbukh, T V; Shestopalova, A V; Evstigneev, M P; Maleev, V Ya
2012-09-01
By the methods of vibrational spectroscopy (Infrared and Raman) the investigation of the hetero-association of biologically active aromatic compounds: flavin-mononucleotide (FMN), ethidium bromide (EB) and proflavine (PRF) was performed in aqueous solutions. It was shown that between the functional groups (CO and NH(2)) the intermolecular hydrogen bonds are formed in the hetero-complexes FMN-EB and FMN-PRF, additionally stabilizing these structures. An estimation of the enthalpy of Н-bonding obtained from experimental shifts of carbonyl vibrational frequencies has shown that the H-bonds do not dominate in the magnitude of experimentally measured total enthalpy of the hetero-association reactions. The main stabilization is likely due to intermolecular interactions of the molecules in these complexes and their interaction with water environment. Copyright © 2012 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yokoyama, K.; Kusumoto, T.; Nakamura, J.
X rays were directed to the liver region of albino rats. The distribution of vitamin B/sub 2/ in the liver, kidney, intestine, heart, spleen, and blood was investigated 6, 12, 18, and 24 hr after the irradiation. Total vitamin B/sub 2/ increased in these organs except in the blood; flavin mononucleotide (FMN) and free riboflavin (FR) increased without exception, and flavin adenine dinucleotide (FAD) decreased except in the spleen, that is, abnormal distribution of vitamin B/sub 2/ fractions was significant except in the spleen. Successive estimations of the fractions suggest that the metabolic disturbances by irradiation occur in the reactionmore » FMN - FAD initially, then in FR - FMN and FR - FAD. (Absts. Japan. Med., 1: No. 7, 1960.)« less
ERIC Educational Resources Information Center
Crowley, Thomas E.
2010-01-01
In "Photobacterium," the flavin reductase encoded by "lux"G regenerates the reduced form of flavin mononucleotide (FMN). Reduced FMN is one of the substrates of the luciferase enzyme that catalyzes a light-emitting reaction. A set of experiments, that employs a "lux"G-expression plasmid construct (pGhis) and is suitable for an undergraduate…
Zhang, Liwen; Xu, Hua; Chen, Chwen-Lih; Green-Church, Kari B.; Freitas, Michael A.; Chen, Yeong-Renn
2008-01-01
Protein thiols with regulatory functions play a critical role in maintaining the homeostasis of the redox state in mitochondria. One major host of regulatory cysteines in mitochondria is complex I, with the thiols primarily located on its 51 kDa FMN-binding subunit. In response to oxidative stress, these thiols are expected to form intra-molecular disulfide bridges as one of their oxidative post-translational modifications. Here, to test this hypothesis and gain insights into the molecular pattern of disulfide in complex I, the isolated bovine complex I was prepared. Superoxide (O2•−) is generated by complex I under the conditions of enzyme turnover. O2•−-induced intra-molecular disulfide formation at the 51 kDa subunit was determined by tandem mass spectrometry and database searching, with the latter accomplished by adaptation of the in-house developed database search engine, MassMatrix [Xu H., et. al J. Proteome Res. (2008) 7, 138–44]. LC/MS/MS analysis of tryptic/chymotryptic digests of the 51 kDa subunit from alkylated complex I revealed that four specific cysteines (C125, C142, C187, and C206) of the 51 kDa subunit were involved in the formation of mixed intra-molecular disulfide linkages. In all, three cysteine pairs were observed: C125/C142, C187/C206, and C142/C206. The formation of disulfide bond was subsequently inhibited by superoxide dismutase, indicating the involvement of O2•−. These results elucidated by mass spectrometry indicates that the residues of C125, C142, C187, and C206 are the specific regulatory cysteines of complex I, and they participate in the oxidative modification with disulfide formation under the physiological or pathophysiological conditions of oxidative stress. PMID:18789718
A Hidden Transhydrogen Activity of a FMN-Bound Diaphorase under Anaerobic Conditions
2016-05-04
RESEARCH ARTICLE A Hidden Transhydrogen Activity of a FMN- Bound Diaphorase under Anaerobic Conditions John Collins1, Ting Zhang1, Scott Huston1... metabolic pathways for facilitating the electron transfer from one molecule to another in redox reactions. Transhy- drogenase plays an important role in...March 2, 2016 Accepted: April 20, 2016 Published: May 4, 2016 Copyright: © 2016 Collins et al. This is an open access article distributed under the
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herrou, Julien; Czyż, Daniel M.; Willett, Jonathan W.
ABSTRACT The general stress response (GSR) system of the intracellular pathogenBrucella abortuscontrols the transcription of approximately 100 genes in response to a range of stress cues. The core genetic regulatory components of the GSR are required forB. abortussurvival under nonoptimal growth conditionsin vitroand for maintenance of chronic infection in anin vivomouse model. The functions of the majority of the genes in the GSR transcriptional regulon remain undefined.bab1_1070is among the most highly regulated genes in this regulon: its transcription is activated 20- to 30-fold by the GSR system under oxidative conditionsin vitro. We have solved crystal structures of Bab1_1070 and demonstratemore » that it forms a homotetrameric complex that resembles those of WrbA-type NADH:quinone oxidoreductases, which are members of the flavodoxin protein family. However,B. abortusWrbA-relatedprotein (WrpA) does not bind flavin cofactors with a high affinity and does not function as an NADH:quinone oxidoreductasein vitro. Soaking crystals with flavin mononucleotide (FMN) revealed a likely low-affinity binding site adjacent to the canonical WrbA flavin binding site. Deletion ofwrpA(ΔwrpA) does not compromise cell survival under acute oxidative stressin vitroor attenuate infection in cell-based or mouse models. However, a ΔwrpAstrain does elicit increased splenomegaly in a mouse model, suggesting that WrpA modulatesB. abortusinteraction with its mammalian host. Despite high structural homology with canonical WrbA proteins, we propose thatB. abortusWrpA represents a functionally distinct member of the diverse flavodoxin family. IMPORTANCEBrucella abortusis an etiological agent of brucellosis, which is among the most common zoonotic diseases worldwide. The general stress response (GSR) regulatory system ofB. abortuscontrols the transcription of approximately 100 genes and is required for maintenance of chronic infection in a murine model; the majority of GSR-regulated genes remain uncharacterized. We presentin vitroandin vivofunctional and structural analyses of WrpA, whose expression is strongly induced by GSR under oxidative conditions. Though WrpA is structurally related to NADH:quinone oxidoreductases, it does not bind redox cofactors in solution, nor does it exhibit oxidoreductase activityin vitro. However, WrpA does affect spleen inflammation in a murine infection model. Our data provide evidence that WrpA forms a new functional class of WrbA/flavodoxin family proteins.« less
Ultrafast Excited-state Deactivation of Flavins Bound to Dodecin*
Staudt, Heike; Oesterhelt, Dieter; Grininger, Martin; Wachtveitl, Josef
2012-01-01
Dodecins, a group of flavin-binding proteins with a dodecameric quaternary structure, are able to incorporate two flavins within each of their six identical binding pockets building an aromatic tetrade with two tryptophan residues. Dodecin from the archaeal Halobacterium salinarum is a riboflavin storage device. We demonstrate that unwanted side reactions induced by reactive riboflavin species and degradation of riboflavin are avoided by ultrafast depopulation of the reactive excited state of riboflavin. Intriguingly, in this process, the staggered riboflavin dimers do not interact in ground and photoexcited states. Rather, within the tetrade assembly, each riboflavin is kept under the control of the respective adjacent tryptophan, which suggests that the stacked arrangement is a matter of optimizing the flavin load. We further identify an electron transfer in combination with a proton transfer as a central element of the effective excited state depopulation mechanism. Structural and functional comparisons of the archaeal dodecin with bacterial homologs reveal diverging evolution. Bacterial dodecins bind the flavin FMN instead of riboflavin and exhibit a clearly different binding pocket design with inverse incorporations of flavin dimers. The different adoption of flavin changes photochemical properties, making bacterial dodecin a comparably less efficient quencher of flavins. This supports a functional role different for bacterial and archaeal dodecins. PMID:22451648
Flavins in Coastal Marine Sediments: New Perspectives on Diagenetic Electron Transfer
NASA Astrophysics Data System (ADS)
Monteverde, D.; Berelson, W.; Baronas, J. J.; Sanudo-Wilhelmy, S. A.
2016-02-01
Coastal marine sediments play a critical role in the global cycling of metals and nutrients, many of which undergo diagenetic alteration. Central to these transformations are redox reactions where electron-rich organic matter is oxidized via transfer to terminal electron acceptors (NO3-, MnOx, FeOx, SO42-). The flavins (flavin adenine dinucleotide [FAD], flavin mononucleotide [FMN], and riboflavin [B2]) are microbially synthesized organic coenzymes that perform both single and double electron transfer and are known to mediate reduction of insoluble metal oxides. Culture experiments have found high rates of flavin excretion in metal-reducing Shewanella and Geobacter species, however environmental measurements of these highly labile molecules have not been previously reported. Here we present porewater measurements of FAD, FMN, and B2 from San Pedro Basin. This California Borderland basin is silled, suboxic, 900 m deep, and experiences high sedimentation. Flavin concentrations ranged from pico- (FAD: 0- 60 pM; B2: 40 - 90 pM) to nanomolar (FMN: 0.4 - 1.2 nM). The concentration cascade of FMN>B2>FAD fits well within culture experiments. Interestingly, profiles of all three flavins show a near linear increase with depth from 0-30 cm and a relatively steady concentration from 30-45 cm, supporting likely in situ production. Additionally, the flavins showed a negative correlation with dissolved Fe (R2 = 0.7 for FMN, 0.8 for FAD, and 0.9 for B2), which decreased linearly with depth from 160µM to 65µM. We discuss hypothesized mechanisms controlling flavin concentrations based on a suite of sediment geochemical parameters (dissolved Fe, Mn, TCO2, δ13C, NH3, DOM, and SO42-) as well as implications for microbial redox syntrophy. These data provide a critical link between the extensive culture-based mechanistic understanding of flavin function and the sedimentary environment. Furthermore, these results demonstrate that flavins likely serve as a significant electron transfer intermediaries in the marine sediment carbon cycle.
Murray, Michael S; Holmes, Ross P; Lowther, W Todd
2008-02-26
Human glycolate oxidase (GO) catalyzes the FMN-dependent oxidation of glycolate to glyoxylate and glyoxylate to oxalate, a key metabolite in kidney stone formation. We report herein the structures of recombinant GO complexed with sulfate, glyoxylate, and an inhibitor, 4-carboxy-5-dodecylsulfanyl-1,2,3-triazole (CDST), determined by X-ray crystallography. In contrast to most alpha-hydroxy acid oxidases including spinach glycolate oxidase, a loop region, known as loop 4, is completely visible when the GO active site contains a small ligand. The lack of electron density for this loop in the GO-CDST complex, which mimics a large substrate, suggests that a disordered to ordered transition may occur with the binding of substrates. The conformational flexibility of Trp110 appears to be responsible for enabling GO to react with alpha-hydroxy acids of various chain lengths. Moreover, the movement of Trp110 disrupts a hydrogen-bonding network between Trp110, Leu191, Tyr134, and Tyr208. This loss of interactions is the first indication that active site movements are directly linked to changes in the conformation of loop 4. The kinetic parameters for the oxidation of glycolate, glyoxylate, and 2-hydroxy octanoate indicate that the oxidation of glycolate to glyoxylate is the primary reaction catalyzed by GO, while the oxidation of glyoxylate to oxalate is most likely not relevant under normal conditions. However, drugs that exploit the unique structural features of GO may ultimately prove to be useful for decreasing glycolate and glyoxylate levels in primary hyperoxaluria type 1 patients who have the inability to convert peroxisomal glyoxylate to glycine.
The prokaryotic FAD synthetase family: a potential drug target.
Serrano, Ana; Ferreira, Patricia; Martínez-Júlvez, Marta; Medina, Milagros
2013-01-01
Disruption of cellular production of the flavin cofactors, flavin adenine mononucleotide (FMN) and flavin adenine dinucleotide(FAD) will prevent the assembly of a large number of flavoproteins and flavoenzymes involved in key metabolic processes in all types of organisms. The enzymes responsible for FMN and FAD production in prokaryotes and eukaryotes exhibit various structural characteristics to catalyze the same chemistry, a fact that converts the prokaryotic FAD synthetase (FADS) in a potential drug target for the development of inhibitors endowed with anti-pathogenic activity. The first step before searching for selective inhibitors of FADS is to understand the structural and functional mechanisms for the riboflavin kinase and FMN adenylyltransferase activities of the prokaryotic enzyme, and particularly to identify their differential functional characteristics with regard to the enzymes performing similar functions in other organisms, particularly humans. In this paper, an overview of the current knowledge of the structure-function relationships in prokaryotic FADS has been presented, as well as of the state of the art in the use of these enzymes as drug targets.
Applications of luminescent systems to infectious disease methodology
NASA Technical Reports Server (NTRS)
Picciolo, G. L.; Chappelle, E. W.; Deming, J. W.; Mcgarry, M. A.; Nibley, D. A.; Okrend, H.; Thomas, R. R.
1976-01-01
The characterization of a clinical sample by a simple, fast, accurate, automatable analytical measurement is important in the management of infectious disease. Luminescence assays offer methods rich with options for these measurements. The instrumentation is common to each assay, and the investment is reasonable. Three general procedures were developed to varying degrees of completeness which measure bacterial levels by measuring their ATP, FMN and iron porphyrins. Bacteriuria detection and antibiograms can be determined within half a day. The characterization of the sample for its soluble ATP, FMN or prophyrins was also performed.
Phototropin and light-signaling in phototropism.
Kimura, Mitsuhiro; Kagawa, Takatoshi
2006-10-01
Blue-light-induced phototropism in higher plants is regulated by phototropin, which is a photoreceptor kinase that contains a flavin mononucleotide (FMN). Recently, it was found that this kinase is inhibited by the binding of the LOV2 (light-oxygen-voltage2) domain in the dark but that its activity is increased in the light by the release of the LOV2 domain. Phototropin-associated proteins have been identified, although the proteins that are phosphorylated by phototropin are still unknown. The asymmetrical auxin distribution caused by unilateral irradiation suggests that differential growth is induced by a difference in auxin-regulated gene expression between the shaded and illuminated sides of plant organs. Transcription-related factors, such as NPH4/ARF7, MSG2/IAA19 and SCF(TIR1), play key roles in this process.
Remaining challenges in cellular flavin cofactor homeostasis and flavoprotein biogenesis
Giancaspero, Teresa A.; Colella, Matilde; Brizio, Carmen; Difonzo, Graziana; Fiorino, Giuseppina M.; Leone, Piero; Brandsch, Roderich; Bonomi, Francesco; Iametti, Stefania; Barile, Maria
2015-01-01
The primary role of the water-soluble vitamin B2 (riboflavin) in cell biology is connected with its conversion into FMN and FAD, the cofactors of a large number of dehydrogenases, oxidases and reductases involved in a broad spectrum of biological activities, among which energetic metabolism and chromatin remodeling. Subcellular localisation of FAD synthase (EC 2.7.7.2, FADS), the second enzyme in the FAD forming pathway, is addressed here in HepG2 cells by confocal microscopy, in the frame of its relationships with kinetics of FAD synthesis and delivery to client apo-flavoproteins. FAD synthesis catalyzed by recombinant isoform 2 of FADS occurs via an ordered bi-bi mechanism in which ATP binds prior to FMN, and pyrophosphate is released before FAD. Spectrophotometric continuous assays of the reconstitution rate of apo-D-aminoacid oxidase with its cofactor, allowed us to propose that besides its FAD synthesizing activity, hFADS is able to operate as a FAD “chaperone.” The physical interaction between FAD forming enzyme and its clients was further confirmed by dot blot and immunoprecipitation experiments carried out testing as a client either a nuclear lysine-specific demethylase 1 (LSD1) or a mitochondrial dimethylglycine dehydrogenase (Me2GlyDH, EC 1.5.8.4). Both enzymes carry out similar reactions of oxidative demethylation, in which tetrahydrofolate is converted into 5,10-methylene-tetrahydrofolate. A direct transfer of the cofactor from hFADS2 to apo-dimethyl glycine dehydrogenase was also demonstrated. Thus, FAD synthesis and delivery to these enzymes are crucial processes for bioenergetics and nutri-epigenetics of liver cells. PMID:25954742
Active site architecture of a sugar N-oxygenase.
Thoden, James B; Branch, Megan C; Zimmer, Alex L; Bruender, Nathan A; Holden, Hazel M
2013-05-14
KijD3 is a flavin-dependent N-oxygenase implicated in the formation of the nitro-containing sugar d-kijanose, found attached to the antibiotic kijanimicin. For this investigation, the structure of KijD3 in complex with FMN and its dTDP-sugar substrate was solved to 2.1 Å resolution. In contrast to the apoenzyme structure, the C-terminus of the protein becomes ordered and projects into the active site cleft [Bruender, N. A., Thoden, J. B., and Holden, H. M. (2010) Biochemistry 49, 3517-3524]. The amino group of the dTDP-aminosugar that is oxidized is located 4.9 Å from C4a of the flavin ring. The model provides a molecular basis for understanding the manner in which KijD3 catalyzes its unusual chemical transformation.
Kotova, Natalia; Frostne, Cecilia; Abramsson-Zetterberg, Lilianne; Tareke, Eden; Bergman, Rolf; Haghdoost, Siamak; Paulsson, Birgit; Törnqvist, Margareta; Segerbäck, Dan; Jenssen, Dag; Grawé, Jan
2015-10-01
Nutrients and food constituents can prevent or contribute to genotoxicity. In this study, the possible influence of a vegetarian/non-vegetarian diet on genotoxic effects was investigated in 58 non-smoking healthy vegetarians (V) and non-vegetarians (NV), age 21-37 years from the Stockholm area in Sweden. Physical activity and dietary habits were similar in both groups, with the exception of the intake of meat and fish. Using flow cytometry, we determined the formation of micronuclei (MN) in transferrin-positive immature peripheral blood reticulocytes (Trf-Ret) (Total: n = 53; V: n = 27; NV: n = 26). Dietary exposure to acrylamide was measured through hemoglobin (Hb) adducts in peripheral erythrocytes (Total: n = 53; V: n = 29; NV: n = 24). Hb adducts of both acrylamide and its genotoxic metabolite glycidamide were monitored as a measure of the corresponding in vivo doses. Our data demonstrated that compared with the non-vegetarians, the vegetarians exhibited lower frequencies of MN (fMN) in the Trf-Ret (p < 0.01, Student's t test). A multivariate analysis demonstrated that there was no association between the fMN and factors such as age, sex, intake of vitamins/minerals, serum folic acid and vitamin B12 levels, physical activity, and body mass index. The mean Hb adduct levels of acrylamide and glycidamide showed no significant differences between vegetarians and non-vegetarians. Furthermore, there were no significant relationships between the adduct levels and fMN in the individuals. The ratio of the Hb adduct levels from glycidamide and acrylamide, however, showed a significant difference (p < 0.04) between the two groups. These data suggest that the vegetarian diet might be beneficial in lowering genomic instability in healthy individuals. The measured Hb adduct levels indicate that the total intake of acrylamide does not differ between the two studied groups and does not contribute to the observed difference in fMN, although an influence of the diet on the metabolic rates of acrylamide was indicated. In addition, the observed significant difference in the background fMN in the two groups demonstrated that the MN analysis method has a sensitivity applicable to the biomonitoring of human lifestyle factors.
Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Zhi; Kim, David D.; Nelson, Ornella D.
2015-10-08
Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation.We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fee4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain andmore » investigated their iron reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fee4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the ironereductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have.« less
Yi, Kexi; Rubinstein, Boris; Unruh, Jay R; Guo, Fengli; Slaughter, Brian D; Li, Rong
2013-03-04
Polar body extrusion during oocyte maturation is critically dependent on asymmetric positioning of the meiotic spindle, which is established through migration of the meiosis I (MI) spindle/chromosomes from the oocyte interior to a subcortical location. In this study, we show that MI chromosome migration is biphasic and driven by consecutive actin-based pushing forces regulated by two actin nucleators, Fmn2, a formin family protein, and the Arp2/3 complex. Fmn2 was recruited to endoplasmic reticulum structures surrounding the MI spindle, where it nucleated actin filaments to initiate an initially slow and poorly directed motion of the spindle away from the cell center. A fast and highly directed second migration phase was driven by actin-mediated cytoplasmic streaming and occurred as the chromosomes reach a sufficient proximity to the cortex to activate the Arp2/3 complex. We propose that decisive symmetry breaking in mouse oocytes results from Fmn2-mediated perturbation of spindle position and the positive feedback loop between chromosome signal-induced Arp2/3 activation and Arp2/3-orchestrated cytoplasmic streaming that transports the chromosomes.
NAD(P)H:Flavin Mononucleotide Oxidoreductase Inactivation during 2,4,6-Trinitrotoluene Reduction
Riefler, R. Guy; Smets, Barth F.
2002-01-01
Bacteria readily transform 2,4,6-trinitrotoluene (TNT), a contaminant frequently found at military bases and munitions production facilities, by reduction of the nitro group substituents. In this work, the kinetics of nitroreduction were investigated by using a model nitroreductase, NAD(P)H:flavin mononucleotide (FMN) oxidoreductase. Under mediation by NAD(P)H:FMN oxidoreductase, TNT rapidly reacted with NADH to form 2-hydroxylamino-4,6-dinitrotoluene and 4-hydroxylamino-2,6-dinitrotoluene, whereas 2-amino-4,6-dinitrotoluene and 4-amino-2,6-dinitrotoluene were not produced. Progressive loss of activity was observed during TNT reduction, indicating inactivation of the enzyme during transformation. It is likely that a nitrosodinitrotoluene intermediate reacted with the NAD(P)H:FMN oxidoreductase, leading to enzyme inactivation. A half-maximum constant with respect to NADH, KN, of 394 μM was measured, indicating possible NADH limitation under typical cellular conditions. A mathematical model that describes the inactivation process and NADH limitation provided a good fit to TNT reduction profiles. This work represents the first step in developing a comprehensive enzyme level understanding of nitroarene biotransformation. PMID:11916686
Yi, Kexi; Rubinstein, Boris; Unruh, Jay R.; Guo, Fengli; Slaughter, Brian D.
2013-01-01
Polar body extrusion during oocyte maturation is critically dependent on asymmetric positioning of the meiotic spindle, which is established through migration of the meiosis I (MI) spindle/chromosomes from the oocyte interior to a subcortical location. In this study, we show that MI chromosome migration is biphasic and driven by consecutive actin-based pushing forces regulated by two actin nucleators, Fmn2, a formin family protein, and the Arp2/3 complex. Fmn2 was recruited to endoplasmic reticulum structures surrounding the MI spindle, where it nucleated actin filaments to initiate an initially slow and poorly directed motion of the spindle away from the cell center. A fast and highly directed second migration phase was driven by actin-mediated cytoplasmic streaming and occurred as the chromosomes reach a sufficient proximity to the cortex to activate the Arp2/3 complex. We propose that decisive symmetry breaking in mouse oocytes results from Fmn2-mediated perturbation of spindle position and the positive feedback loop between chromosome signal-induced Arp2/3 activation and Arp2/3-orchestrated cytoplasmic streaming that transports the chromosomes. PMID:23439682
Sedzinski, Jakub; Hannezo, Edouard; Tu, Fan; Biro, Maté
2017-01-01
ABSTRACT Homeostatic replacement of epithelial cells from basal precursors is a multistep process involving progenitor cell specification, radial intercalation and, finally, apical surface emergence. Recent data demonstrate that actin-based pushing under the control of the formin protein Fmn1 drives apical emergence in nascent multiciliated epithelial cells (MCCs), but little else is known about this actin network or the control of Fmn1. Here, we explore the role of the small GTPase RhoA in MCC apical emergence. Disruption of RhoA function reduced the rate of apical surface expansion and decreased the final size of the apical domain. Analysis of cell shapes suggests that RhoA alters the balance of forces exerted on the MCC apical surface. Finally, quantitative time-lapse imaging and fluorescence recovery after photobleaching studies argue that RhoA works in concert with Fmn1 to control assembly of the specialized apical actin network in MCCs. These data provide new molecular insights into epithelial apical surface assembly and could also shed light on mechanisms of apical lumen formation. PMID:28089989
Sedzinski, Jakub; Hannezo, Edouard; Tu, Fan; Biro, Maté; Wallingford, John B
2017-01-15
Homeostatic replacement of epithelial cells from basal precursors is a multistep process involving progenitor cell specification, radial intercalation and, finally, apical surface emergence. Recent data demonstrate that actin-based pushing under the control of the formin protein Fmn1 drives apical emergence in nascent multiciliated epithelial cells (MCCs), but little else is known about this actin network or the control of Fmn1. Here, we explore the role of the small GTPase RhoA in MCC apical emergence. Disruption of RhoA function reduced the rate of apical surface expansion and decreased the final size of the apical domain. Analysis of cell shapes suggests that RhoA alters the balance of forces exerted on the MCC apical surface. Finally, quantitative time-lapse imaging and fluorescence recovery after photobleaching studies argue that RhoA works in concert with Fmn1 to control assembly of the specialized apical actin network in MCCs. These data provide new molecular insights into epithelial apical surface assembly and could also shed light on mechanisms of apical lumen formation. © 2017. Published by The Company of Biologists Ltd.
Structure and function of the interacting domains of Spire and Fmn-family formins.
Vizcarra, Christina L; Kreutz, Barry; Rodal, Avital A; Toms, Angela V; Lu, Jun; Zheng, Wei; Quinlan, Margot E; Eck, Michael J
2011-07-19
Evidence for cooperation between actin nucleators is growing. The WH2-containing nucleator Spire and the formin Cappuccino interact directly, and both are essential for assembly of an actin mesh during Drosophila oogenesis. Their interaction requires the kinase noncatalytic C-lobe domain (KIND) domain of Spire and the C-terminal tail of the formin. Here we describe the crystal structure of the KIND domain of human Spir1 alone and in complex with the tail of Fmn2, a mammalian ortholog of Cappuccino. The KIND domain is structurally similar to the C-lobe of protein kinases. The Fmn2 tail is coordinated in an acidic cleft at the base of the domain that appears to have evolved via deletion of a helix from the canonical kinase fold. Our functional analysis of Cappuccino reveals an unexpected requirement for its tail in actin assembly. In addition, we find that the KIND/tail interaction blocks nucleation by Cappuccino and promotes its displacement from filament barbed ends providing insight into possible modes of cooperation between Spire and Cappuccino.
Wang, Hao; Mann, Paul A; Xiao, Li; Gill, Charles; Galgoci, Andrew M; Howe, John A; Villafania, Artjohn; Barbieri, Christopher M; Malinverni, Juliana C; Sher, Xinwei; Mayhood, Todd; McCurry, Megan D; Murgolo, Nicholas; Flattery, Amy; Mack, Matthias; Roemer, Terry
2017-05-18
Riboswitches are bacterial-specific, broadly conserved, non-coding RNA structural elements that control gene expression of numerous metabolic pathways and transport functions essential for cell growth. As such, riboswitch inhibitors represent a new class of potential antibacterial agents. Recently, we identified ribocil-C, a highly selective inhibitor of the flavin mononucleotide (FMN) riboswitch that controls expression of de novo riboflavin (RF, vitamin B2) biosynthesis in Escherichia coli. Here, we provide a mechanistic characterization of the antibacterial effects of ribocil-C as well as of roseoflavin (RoF), an antimetabolite analog of RF, among medically significant Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus (MRSA) and Enterococcus faecalis. We provide genetic, biophysical, computational, biochemical, and pharmacological evidence that ribocil-C and RoF specifically inhibit dual FMN riboswitches, separately controlling RF biosynthesis and uptake processes essential for MRSA growth and pathogenesis. Such a dual-targeting mechanism is specifically required to develop broad-spectrum Gram-positive antibacterial agents targeting RF metabolism. Copyright © 2017 Elsevier Ltd. All rights reserved.
de la Cruz, Ignacio Perez; Ma, Long; Horvitz, H. Robert
2014-01-01
Loss-of-function mutations in the Caenorhabditis elegans gene sup-18 suppress the defects in muscle contraction conferred by a gain-of-function mutation in SUP-10, a presumptive regulatory subunit of the SUP-9 two-pore domain K+ channel associated with muscle membranes. We cloned sup-18 and found that it encodes the C. elegans ortholog of mammalian iodotyrosine deiodinase (IYD), an NADH oxidase/flavin reductase that functions in iodine recycling and is important for the biosynthesis of thyroid hormones that regulate metabolism. The FMN-binding site of mammalian IYD is conserved in SUP-18, which appears to require catalytic activity to function. Genetic analyses suggest that SUP-10 can function with SUP-18 to activate SUP-9 through a pathway that is independent of the presumptive SUP-9 regulatory subunit UNC-93. We identified a novel evolutionarily conserved serine-cysteine-rich region in the C-terminal cytoplasmic domain of SUP-9 required for its specific activation by SUP-10 and SUP-18 but not by UNC-93. Since two-pore domain K+ channels regulate the resting membrane potentials of numerous cell types, we suggest that the SUP-18 IYD regulates the activity of the SUP-9 channel using NADH as a coenzyme and thus couples the metabolic state of muscle cells to muscle membrane excitability. PMID:24586202
Temperature Sensitive Singlet Oxygen Photosensitization by LOV-Derived Fluorescent Flavoproteins.
Westberg, Michael; Bregnhøj, Mikkel; Etzerodt, Michael; Ogilby, Peter R
2017-03-30
Optogenetic sensitizers that selectively produce a given reactive oxygen species (ROS) constitute a promising tool for studying cell signaling processes with high levels of spatiotemporal control. However, to harness the full potential of this tool for live cell studies, the photophysics of currently available systems need to be explored further and optimized. Of particular interest in this regard, are the flavoproteins miniSOG and SOPP, both of which (1) contain the chromophore flavin mononucleotide, FMN, in a LOV-derived protein enclosure, and (2) photosensitize the production of singlet oxygen, O 2 (a 1 Δ g ). Here we present an extensive experimental study of the singlet and triplet state photophysics of FMN in SOPP and miniSOG over a physiologically relevant temperature range. Although changes in temperature only affect the singlet excited state photophysics slightly, the processes that influence the deactivation of the triplet excited state are more sensitive to temperature. Most notably, for both proteins, the rate constant for quenching of 3 FMN by ground state oxygen, O 2 (X 3 Σ g - ), increases ∼10-fold upon increasing the temperature from 10 to 43 °C, while the oxygen-independent channels of triplet state deactivation are less affected. As a consequence, this increase in temperature results in higher yields of O 2 (a 1 Δ g ) formation for both SOPP and miniSOG. We also show that the quantum yields of O 2 (a 1 Δ g ) production by both miniSOG and SOPP are mainly limited by the fraction of FMN triplet states quenched by O 2 (X 3 Σ g - ). The results presented herein provide a much-needed quantitative framework that will facilitate the future development of optogenetic ROS sensitizers.
The study of riboflavin requirement in broiler chickens.
Olkowski, A A; Classen, H L
1998-01-01
Riboflavin status indices in tissues (brain, liver, heart) and blood plasma, and performance parameters were studied in male and female broiler chickens in response to a wide range of dietary supplementation of riboflavin in order to establish the requirement for riboflavin in fast growing modern broilers. The birds fed riboflavin supplemented diets were increasing their body weight at a higher rate than those fed the unsupplemented diet, but this was apparent only during the first stage of growth (days 1 to 21). Supplementation of 2 mg riboflavin per kg was sufficient to support the maximum growth rate. Feed consumption was not affected by different levels of dietary supplementation of riboflavin. The supplementation of riboflavin in the diet increased (p < 0.001) plasma riboflavin level, but the magnitude of response decreased with age. The main component in the tissues was FAD, followed by FMN and riboflavin. Overall, the dietary riboflavin supplementation had highly significant (p < 0.001) effects on tissue FAD, FMN, and riboflavin status, but the effect of supplementation was clearly pronounced only at days 7 and 14, and thereafter the status of FAD, FMN, and riboflavin in the tissues did not differ between unsupplemented and supplemented birds. Neither FAD, FMN, and riboflavin nor GSSG-RED activity correlate with the level of supplementation. Saturation levels of riboflavin in the blood plasma and tissues, corresponded with dietary riboflavin levels of supplementation at 1 to 2 mg per kg. Based on the performance and biochemical data, the dietary requirement of riboflavin for fast growing broilers should be set at a level of 5 mg/kg. The currently recommended allowance of 3.6 mg riboflavin per kg of ration is not sufficient for modern breeds of broiler chickens.
Remaining challenges in cellular flavin cofactor homeostasis and flavoprotein biogenesis
NASA Astrophysics Data System (ADS)
Giancaspero, Teresa Anna; Colella, Matilde; Brizio, Carmen; Difonzo, Graziana; Fiorino, Giuseppina Maria; Leone, Piero; Brandsch, Roderich; Bonomi, Francesco; Iametti, Stefania; Barile, Maria
2015-04-01
The primary role of the water-soluble vitamin B2 (riboflavin) in cell biology is connected with its conversion into FMN and FAD, the cofactors of a large number of dehydrogenases, oxidases and reductases involved in energetic metabolism, epigenetics, protein folding, as well as in a number of diverse regulatory processes. The problem of localisation of flavin cofactor synthesis events and in particular of the FAD synthase (EC 2.7.7.2) in HepG2 cells is addressed here by confocal microscopy in the frame of its relationships with kinetics of FAD synthesis and delivery to client apo-flavoproteins. FAD synthesis catalysed by recombinant isoform 2 of FADS occurs via an ordered bi-bi mechanism in which ATP binds prior to FMN, and pyrophosphate is released before FAD. Spectrophotometric continuous assays of the reconstitution rate of apo-D-aminoacid oxidase with its cofactor, allowed us to propose that besides its FAD synthesising activity, hFADS is able to operate as a FAD "chaperone". The physical interaction between FAD forming enzyme and its clients was further confirmed by dot blot and immunoprecipitation experiments carried out testing as a client either a nuclear or a mitochondrial enzyme that is lysine specific demethylase 1 (LSD1, EC 1.-.-.-) and dimethylglycine dehydrogenase (Me2GlyDH, EC 1.5.8.4), respectively which carry out similar reactions of oxidative demethylation, assisted by tetrahydrofolate used to form 5,10-methylene-tetrahydrofolate. A direct transfer of the cofactor from hFADS2 to apo-dimethyl glycine dehydrogenase was also demonstrated. Thus, FAD synthesis and delivery to these enzymes are crucial processes for bioenergetics and nutri-epigenetics of liver cells.
Belevich, Nikolai P; Bertsova, Yulia V; Verkhovskaya, Marina L; Baykov, Alexander A; Bogachev, Alexander V
2016-02-01
Bacterial Na(+)-translocating NADH:quinone oxidoreductase (Na(+)-NQR) uses a unique set of prosthetic redox groups-two covalently bound FMN residues, a [2Fe-2S] cluster, FAD, riboflavin and a Cys4[Fe] center-to catalyze electron transfer from NADH to ubiquinone in a reaction coupled with Na(+) translocation across the membrane. Here we used an ultra-fast microfluidic stopped-flow instrument to determine rate constants and the difference spectra for the six consecutive reaction steps of Vibrio harveyi Na(+)-NQR reduction by NADH. The instrument, with a dead time of 0.25 ms and optical path length of 1 cm allowed collection of visible spectra in 50-μs intervals. By comparing the spectra of reaction steps with the spectra of known redox transitions of individual enzyme cofactors, we were able to identify the chemical nature of most intermediates and the sequence of electron transfer events. A previously unknown spectral transition was detected and assigned to the Cys4[Fe] center reduction. Electron transfer from the [2Fe-2S] cluster to the Cys4[Fe] center and all subsequent steps were markedly accelerated when Na(+) concentration was increased from 20 μM to 25 mM, suggesting coupling of the former step with tight Na(+) binding to or occlusion by the enzyme. An alternating access mechanism was proposed to explain electron transfer between subunits NqrF and NqrC. According to the proposed mechanism, the Cys4[Fe] center is alternatively exposed to either side of the membrane, allowing the [2Fe-2S] cluster of NqrF and the FMN residue of NqrC to alternatively approach the Cys4[Fe] center from different sides of the membrane. Copyright © 2015 Elsevier B.V. All rights reserved.
Sainz, Martha; Pérez-Rontomé, Carmen; Ramos, Javier; Mulet, Jose Miguel; James, Euan K; Bhattacharjee, Ujjal; Petrich, Jacob W; Becana, Manuel
2013-12-01
The heme of bacteria, plant and animal hemoglobins (Hbs) must be in the ferrous state to bind O(2) and other physiological ligands. Here we have characterized the full set of non-symbiotic (class 1 and 2) and 'truncated' (class 3) Hbs of Lotus japonicus. Class 1 Hbs are hexacoordinate, but class 2 and 3 Hbs are pentacoordinate. Three of the globins, Glb1-1, Glb2 and Glb3-1, are nodule-enhanced proteins. The O(2) affinity of Glb1-1 (50 pm) was the highest known for any Hb, and the protein may function as an O(2) scavenger. The five globins were reduced by free flavins, which transfer electrons from NAD(P)H to the heme iron under aerobic and anaerobic conditions. Class 1 Hbs were reduced at very fast rates by FAD, class 2 Hbs at slower rates by both FMN and FAD, and class 3 Hbs at intermediate rates by FMN. The members of the three globin classes were immunolocalized predominantly in the nuclei. Flavins were quantified in legume nodules and nuclei, and their concentrations were sufficient to maintain Hbs in their functional state. All Hbs, except Glb1-1, were expressed in a flavohemoglobin-deficient yeast mutant and found to confer tolerance to oxidative stress induced by methyl viologen, copper or low temperature, indicating an anti-oxidative role for the hemes. However, only Glb1-2 and Glb2 afforded protection against nitrosative stress induced by S-nitrosoglutathione. Because this compound is specifically involved in transnitrosylation reactions with thiol groups, our results suggest a contribution of the single cysteine residues of both proteins in the stress response. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Yorita, Kazuko; Misaki, Hideo; Palfey, Bruce A.; Massey, Vincent
2000-01-01
The native flavin, FMN, has been removed from the l-lactate oxidase of Aerococcus viridans, and the apoprotein reconstituted with 12 FMN derivatives with various substituents at the flavin 6- and 8-positions. Impressive linear relationships are exhibited between the sum of the Hammett σpara and σortho parameters and the redox potentials of the free flavins, and between the redox potentials of the free and enzyme-bound flavins. Rapid reaction kinetics studies of the reconstituted enzymes with the substrates l-lactate and l-mandelate show an increase in the reduction rate constant with increasing redox potential, except that, with lactate, a limiting rate constant of ≈700 s−1 is obtained with flavins of high potential. Similar breakpoints are found in plots of the rate constants for flavin N5-sulfite adduct formation and for the reaction of the reduced enzymes with molecular oxygen. These results are interpreted in terms of a two-step equilibrium preceding the chemical reaction step, in which the second equilibrium step provides an upper limit to the rate with which the particular substrate or ligand is positioned with the flavin in the correct fashion for the observed chemical reaction to occur. The relationship of rate constants for flavin reduction and N5-sulfite adduct formation with flavin redox potential below the observed breakpoint indicate development of significant negative charge in the transition states of the reactions. In the case of reduction by substrate, the results are consistent either with a hydride transfer mechanism or with the so called “carbanion” mechanism, in which the substrate α-proton is abstracted by an enzyme base protected from exchange with solvent. These conclusions are supported by substrate α-deuterium isotope effects and by solvent viscosity effects on sulfite binding. PMID:10706608
Pinto, John T.; Cooper, Arthur J. L.
2014-01-01
Flavin-dependent monooxygenases and oxidoreductases are located at critical branch points in the biosynthesis and metabolism of cholesterol and vitamin D. These flavoproteins function as obligatory intermediates that accept 2 electrons from NAD(P)H with subsequent 1-electron transfers to a variety of cytochrome P450 (CYP) heme proteins within the mitochondria matrix (type I) and the (microsomal) endoplasmic reticulum (type II). The mode of electron transfer in these systems differs slightly in the number and form of the flavin prosthetic moiety. In the type I mitochondrial system, FAD-adrenodoxin reductase interfaces with adrenodoxin before electron transfer to CYP heme proteins. In the microsomal type II system, a diflavin (FAD/FMN)-dependent cytochrome P450 oxidoreductase [NAD(P)H-cytochrome P450 reductase (CPR)] donates electrons to a multitude of heme oxygenases. Both flavoenzyme complexes exhibit a commonality of function with all CYP enzymes and are crucial for maintaining a balance of cholesterol and vitamin D metabolites. Deficits in riboflavin availability, imbalances in the intracellular ratio of FAD to FMN, and mutations that affect flavin binding domains and/or interactions with client proteins result in marked structural alterations within the skeletal and central nervous systems similar to those of disorders (inborn errors) in the biosynthetic pathways that lead to cholesterol, steroid hormones, and vitamin D and their metabolites. Studies of riboflavin deficiency during embryonic development demonstrate congenital malformations similar to those associated with genetic alterations of the flavoenzymes in these pathways. Overall, a deeper understanding of the role of riboflavin in these pathways may prove essential to targeted therapeutic designs aimed at cholesterol and vitamin D metabolism. PMID:24618756
Natural Indices for the Chemical Hardness/Softness of Metal Cations and Ligands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Huifang; Xu, David C.; Wang, Yifeng
Quantitative understanding of reactivity and stability for a chemical species is fundamental to chemistry. The concept has undergone many changes and additions throughout the history of chemistry, stemming from the ideas such as Lewis acids and bases. For a given complexing ligand (Lewis base) and a group of isovalent metal cations (Lewis acids), the stability constants of metal–ligand (ML) complexes can simply correlate to the known properties of metal ions [ionic radii (r Mn+), Gibbs free energy of formation (ΔG° f,Mn+), and solvation energy (ΔG° s,Mn+)] by 2.303RT log K ML = (α* MLΔG° f,Mn+ – β* MLr Mn+ +more » γ* MLΔG° s,Mn+ – δ* ML), where the coefficients (α* ML, β* ML, γ* ML, and intercept δ* ML) are determined by fitting the equation to the existing experimental data. Coefficients β* ML and γ* ML have the same sign and are in a linear relationship through the origin. Gibbs free energies of formation of cations (ΔG° f,Mn+) are found to be natural indices for the softness or hardness of metal cations, with positive values corresponding to soft acids and negative values to hard acids. The coefficient α* ML is an index for the softness or hardness of a complexing ligand. Proton (H +) with the softness index of zero is a unique acid that has strong interactions with both soft and hard bases. The stability energy resulting from the acid–base interactions is determined by the term α* MLΔG° f,Mn+; a positive product of α* ML and ΔG° f,Mn+ indicates that the acid–base interaction between the metal cation and the complexing ligand stabilizes the complex. The terms β* MLr Mn+ and γ* MLΔG° s,Mn+, which are related to ionic radii of metal cations, represent the steric and solvation effects of the cations. The new softness indices proposed here will help to understand the interactions of ligands (Lewis bases) with metal cations (Lewis acids) and provide guidelines for engineering materials with desired chemical reactivity and selectivity. As a result, the new correlation can also enhance our ability for predicting the speciation, mobility, and toxicity of heavy metals in the earth environments and biological systems.« less
Natural Indices for the Chemical Hardness/Softness of Metal Cations and Ligands
Xu, Huifang; Xu, David C.; Wang, Yifeng
2017-10-26
Quantitative understanding of reactivity and stability for a chemical species is fundamental to chemistry. The concept has undergone many changes and additions throughout the history of chemistry, stemming from the ideas such as Lewis acids and bases. For a given complexing ligand (Lewis base) and a group of isovalent metal cations (Lewis acids), the stability constants of metal–ligand (ML) complexes can simply correlate to the known properties of metal ions [ionic radii (r Mn+), Gibbs free energy of formation (ΔG° f,Mn+), and solvation energy (ΔG° s,Mn+)] by 2.303RT log K ML = (α* MLΔG° f,Mn+ – β* MLr Mn+ +more » γ* MLΔG° s,Mn+ – δ* ML), where the coefficients (α* ML, β* ML, γ* ML, and intercept δ* ML) are determined by fitting the equation to the existing experimental data. Coefficients β* ML and γ* ML have the same sign and are in a linear relationship through the origin. Gibbs free energies of formation of cations (ΔG° f,Mn+) are found to be natural indices for the softness or hardness of metal cations, with positive values corresponding to soft acids and negative values to hard acids. The coefficient α* ML is an index for the softness or hardness of a complexing ligand. Proton (H +) with the softness index of zero is a unique acid that has strong interactions with both soft and hard bases. The stability energy resulting from the acid–base interactions is determined by the term α* MLΔG° f,Mn+; a positive product of α* ML and ΔG° f,Mn+ indicates that the acid–base interaction between the metal cation and the complexing ligand stabilizes the complex. The terms β* MLr Mn+ and γ* MLΔG° s,Mn+, which are related to ionic radii of metal cations, represent the steric and solvation effects of the cations. The new softness indices proposed here will help to understand the interactions of ligands (Lewis bases) with metal cations (Lewis acids) and provide guidelines for engineering materials with desired chemical reactivity and selectivity. As a result, the new correlation can also enhance our ability for predicting the speciation, mobility, and toxicity of heavy metals in the earth environments and biological systems.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Chin -Yuan; Lohman, Jeremy; Cao, Hongnan
C-1027 is a chromoprotein enediyne antitumor antibiotic produced by Streptomyces globisporus. In the last step of biosynthesis of the (S)-3-chloro-5-hydroxy-beta-tyrosine moiety of the C-1027 enediyne chromophore, SgcE6 and SgcC compose a two-component monooxygenase that hydroxylates the C-5 position of (S)-3-chloro-beta-tyrosine. This two-component monooxygenase is remarkable for two reasons. (i) SgcE6 specifically reacts with FAD and NADH, and (ii) SgcC is active with only the peptidyl carrier protein (PCP)-tethered substrate. To address the molecular details of substrate specificity, we determined the crystal structures of SgcE6 and SgcC at 1.66 and 2.63 A resolution, respectively. SgcE6 shares a similar β-barrel fold withmore » the class I HpaC-like flavin reductases. A flexible loop near the active site of SgcE6 plays a role in FAD binding, likely by providing sufficient space to accommodate the AMP moiety of FAD, when compared to that of FMN-utilizing homologues. SgcC shows structural similarity to a few, other known FADH 2-dependent monooxygenases and sheds light on some biochemically but not structurally characterized homologues. In conclusion, the crystal structures reported here provide insights into substrate specificity, and comparison with homologues provides a catalytic mechanism of the two-component, FADH 2-dependent monooxygenase (SgcE6 and SgcC) that catalyzes the hydroxylation of a PCP-tethered substrate.« less
Singlet Oxygen Generation by UVA Light Exposure of Endogenous Photosensitizers
Baier, Jürgen; Maisch, Tim; Maier, Max; Engel, Eva; Landthaler, Michael; Bäumler, Wolfgang
2006-01-01
UVA light (320–400 nm) has been shown to produce deleterious biological effects in tissue due to the generation of singlet oxygen by substances like flavins or urocanic acid. Riboflavin, flavin mononucleotide (FMN), flavin adenine dinucleotide (FAD), β-nicotinamide adenine dinucleotide (NAD), and β-nicotinamide adenine dinucleotide phosphate (NADP), urocanic acid, or cholesterol in solution were excited at 355 nm. Singlet oxygen was directly detected by time-resolved measurement of its luminescence at 1270 nm. NAD, NADP, and cholesterol showed no luminescence signal possibly due to the very low absorption coefficient at 355 nm. Singlet oxygen luminescence of urocanic acid was clearly detected but the signal was too weak to quantify a quantum yield. The quantum yield of singlet oxygen was precisely determined for riboflavin (ΦΔ = 0.54 ± 0.07), FMN (ΦΔ = 0.51 ± 0.07), and FAD (ΦΔ = 0.07 ± 0.02). In aerated solution, riboflavin and FMN generate more singlet oxygen than exogenous photosensitizers such as Photofrin, which are applied in photodynamic therapy to kill cancer cells. With decreasing oxygen concentration, the quantum yield of singlet oxygen generation decreased, which must be considered when assessing the role of singlet oxygen at low oxygen concentrations (inside tissue). PMID:16751234
Hühner, Jens; Ingles-Prieto, Álvaro; Neusüß, Christian; Lämmerhofer, Michael; Janovjak, Harald
2015-02-01
Cultured mammalian cells essential are model systems in basic biology research, production platforms of proteins for medical use, and testbeds in synthetic biology. Flavin cofactors, in particular flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD), are critical for cellular redox reactions and sense light in naturally occurring photoreceptors and optogenetic tools. Here, we quantified flavin contents of commonly used mammalian cell lines. We first compared three procedures for extraction of free and noncovalently protein-bound flavins and verified extraction using fluorescence spectroscopy. For separation, two CE methods with different BGEs were established, and detection was performed by LED-induced fluorescence with limit of detections (LODs 0.5-3.8 nM). We found that riboflavin (RF), FMN, and FAD contents varied significantly between cell lines. RF (3.1-14 amol/cell) and FAD (2.2-17.0 amol/cell) were the predominant flavins, while FMN (0.46-3.4 amol/cell) was found at markedly lower levels. Observed flavin contents agree with those previously extracted from mammalian tissues, yet reduced forms of RF were detected that were not described previously. Quantification of flavins in mammalian cell lines will allow a better understanding of cellular redox reactions and optogenetic tools. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Do residents in a northern program have better quality lives than their counterparts in a city?
Johnsen, J. H.
2001-01-01
OBJECTIVE: To determine whether McMaster University's family medicine residents training in the Family Medicine North (FMN) program have better quality lives than those based in Hamilton, Ont (urban). DESIGN: Residents at both sites were simultaneously given the Quality of Life Questionnaire, a standardized measurement tool. They were asked to complete the questionnaire anonymously and to provide demographic data. SETTING: Family practice residencies in Ontario. PARTICIPANTS: McMaster University's family medicine residents. Of 66 residents living in Hamilton, 36 completed the questionnaire; five respondents were ineligible. Of 25 residents living in Thunder Bay, Ont, 24 completed the questionnaire; none were ineligible. MAIN OUTCOME MEASURES: Total quality-of-life score. Score was divided into five major domains, each with several subdomains: general well-being (material, physical, and personal growth), interpersonal relations (marital, parent-child, extended family, and extramarital), organizational activity (altruistic and political behaviour), occupational activity (job characteristics, occupational relations, and job satisfiers), and leisure and recreational activity (creative/esthetic behaviour, sports activity, vacation behaviour). RESULTS: The FMN residents scored significantly higher than the Hamilton-based residents on overall quality of life (124.7 vs 112.5, P < .05) and tended to score higher in the five major domains. The trend reached statistical significance in general well-being and occupational activity; it was also apparent in various subdomains, with statistically significant differences in material well-being, marital relations, job characteristics, job satisfiers, and vacation behaviour. CONCLUSION: Family Medicine North residents enjoy better quality of life than their urban counterparts based on responses to a standardized questionnaire. PMID:11398733
Ahmed, Bulbul; Cao, Bin; McLean, Jeffrey S; Ica, Tuba; Dohnalkova, Alice; Istanbullu, Ozlem; Paksoy, Akin; Fredrickson, Jim K; Beyenal, Haluk
2012-11-01
A facultative iron-reducing [Fe(III)-reducing] Paenibacillus sp. strain was isolated from Hanford 300A subsurface sediment biofilms that was capable of reducing soluble Fe(III) complexes [Fe(III)-nitrilotriacetic acid and Fe(III)-citrate] but unable to reduce poorly crystalline ferrihydrite (Fh). However, Paenibacillus sp. 300A was capable of reducing Fh in the presence of low concentrations (2 μM) of either of the electron transfer mediators (ETMs) flavin mononucleotide (FMN) or anthraquinone-2,6-disulfonate (AQDS). Maximum initial Fh reduction rates were observed at catalytic concentrations (<10 μM) of either FMN or AQDS. Higher FMN concentrations inhibited Fh reduction, while increased AQDS concentrations did not. We also found that Paenibacillus sp. 300A could reduce Fh in the presence of natural ETMs from Hanford 300A subsurface sediments. In the absence of ETMs, Paenibacillus sp. 300A was capable of immobilizing U(VI) through both reduction and adsorption. The relative contributions of adsorption and microbial reduction to U(VI) removal from the aqueous phase were ∼7:3 in PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)] and ∼1:4 in bicarbonate buffer. Our study demonstrated that Paenibacillus sp. 300A catalyzes Fe(III) reduction and U(VI) immobilization and that these reactions benefit from externally added or naturally existing ETMs in 300A subsurface sediments.
Ahmed, Bulbul; Cao, Bin; McLean, Jeffrey S.; Ica, Tuba; Dohnalkova, Alice; Istanbullu, Ozlem; Paksoy, Akin; Fredrickson, Jim K.
2012-01-01
A facultative iron-reducing [Fe(III)-reducing] Paenibacillus sp. strain was isolated from Hanford 300A subsurface sediment biofilms that was capable of reducing soluble Fe(III) complexes [Fe(III)-nitrilotriacetic acid and Fe(III)-citrate] but unable to reduce poorly crystalline ferrihydrite (Fh). However, Paenibacillus sp. 300A was capable of reducing Fh in the presence of low concentrations (2 μM) of either of the electron transfer mediators (ETMs) flavin mononucleotide (FMN) or anthraquinone-2,6-disulfonate (AQDS). Maximum initial Fh reduction rates were observed at catalytic concentrations (<10 μM) of either FMN or AQDS. Higher FMN concentrations inhibited Fh reduction, while increased AQDS concentrations did not. We also found that Paenibacillus sp. 300A could reduce Fh in the presence of natural ETMs from Hanford 300A subsurface sediments. In the absence of ETMs, Paenibacillus sp. 300A was capable of immobilizing U(VI) through both reduction and adsorption. The relative contributions of adsorption and microbial reduction to U(VI) removal from the aqueous phase were ∼7:3 in PIPES [piperazine-N,N′-bis(2-ethanesulfonic acid)] and ∼1:4 in bicarbonate buffer. Our study demonstrated that Paenibacillus sp. 300A catalyzes Fe(III) reduction and U(VI) immobilization and that these reactions benefit from externally added or naturally existing ETMs in 300A subsurface sediments. PMID:22961903
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmed, B.; Cao, B.; McLean, Jeffrey S.
2012-11-07
A facultative iron-reducing (Fe(III)-reducing) Paenibacillus sp. strain was isolated from Hanford 300A subsurface sediment biofilms that was capable of reducing soluble Fe(III) complexes (Fe(III)-NTA and Fe(III)-citrate) but unable to reduce poorly crystalline ferrihydrite (Fh). However, Paenibacillus sp. 300A was capable of reducing Fh in the presence of low concentrations (2 µM) of either of electron transfer mediators (ETMs) flavin mononucleotide (FMN) or anthraquinone-2,6-disulfonate (AQDS). Maximum initial Fh reduction rates were observed at catalytic concentrations (<10 µM) of either FMN or AQDS. Higher FMN concentrations inhibited Fh reduction, while increased AQDS concentrations did not. We found that Paenibacillus sp. 300A alsomore » could reduce Fh in the presence of natural ETMs from Hanford 300A subsurface sediments. In the absence of ETMs, Paenibacillus sp. 300A was capable of immobilizing U(VI) through both reduction and adsorption. The relative contributions of adsorption and microbial reduction to U(VI) removal from the aqueous phase were ~7:3 in PIPES and ~1:4 in bicarbonate buffer. Our study demonstrated that Paenibacillus sp. 300A catalyzes Fe(III) reduction and U(VI) immobilization and that these reactions benefit from externally added or naturally existing ETMs in 300A subsurface sediments.« less
Solving Biology's Iron Chemistry Problem with Ferritin Protein Nanocages.
Theil, Elizabeth C; Tosha, Takehiko; Behera, Rabindra K
2016-05-17
Ferritins reversibly synthesize iron-oxy(ferrihydrite) biominerals inside large, hollow protein nanocages (10-12 nm, ∼480 000 g/mol); the iron biominerals are metabolic iron concentrates for iron protein biosyntheses. Protein cages of 12- or 24-folded ferritin subunits (4-α-helix polypeptide bundles) self-assemble, experimentally. Ferritin biomineral structures differ among animals and plants or bacteria. The basic ferritin mineral structure is ferrihydrite (Fe2O3·H2O) with either low phosphate in the highly ordered animal ferritin biominerals, Fe/PO4 ∼ 8:1, or Fe/PO4 ∼ 1:1 in the more amorphous ferritin biominerals of plants and bacteria. While different ferritin environments, plant bacterial-like plastid organelles and animal cytoplasm, might explain ferritin biomineral differences, investigation is required. Currently, the physiological significance of plant-specific and animal-specific ferritin iron minerals is unknown. The iron content of ferritin in living tissues ranges from zero in "apoferritin" to as high as ∼4500 iron atoms. Ferritin biomineralization begins with the reaction of Fe(2+) with O2 at ferritin enzyme (Fe(2+)/O oxidoreductase) sites. The product of ferritin enzyme activity, diferric oxy complexes, is also the precursor of ferritin biomineral. Concentrations of Fe(3+) equivalent to 2.0 × 10(-1) M are maintained in ferritin solutions, contrasting with the Fe(3+) Ks ∼ 10(-18) M. Iron ions move into, through, and out of ferritin protein cages in structural subdomains containing conserved amino acids. Cage subdomains include (1) ion channels for Fe(2+) entry/exit, (2) enzyme (oxidoreductase) site for coupling Fe(2+) and O yielding diferric oxy biomineral precursors, and (3) ferric oxy nucleation channels, where diferric oxy products from up to three enzyme sites interact while moving toward the central, biomineral growth cavity (12 nm diameter) where ferric oxy species, now 48-mers, grow in ferric oxy biomineral. High ferritin protein cage symmetry (3-fold and 4-fold axes) and amino acid conservation coincide with function, shown by amino acid substitution effects. 3-Fold symmetry axes control Fe(2+) entry (enzyme catalysis of Fe(2+)/O2 oxidoreduction) and Fe(2+) exit (reductive ferritin mineral dissolution); 3-fold symmetry axes influence Fe(2+)exit from dissolved mineral; bacterial ferritins diverge slightly in Fe/O2 reaction mechanisms and intracage paths of iron-oxy complexes. Biosynthesis rates of ferritin protein change with Fe(2+) and O2 concentrations, dependent on DNA-binding, and heme binding protein, Bach 1. Increased cellular O2 indirectly stabilizes ferritin DNA/Bach 1 interactions. Heme, Fe-protoporphyrin IX, decreases ferritin DNA-Bach 1 binding, causing increased ferritin mRNA biosynthesis (transcription). Direct Fe(2+) binding to ferritin mRNA decreases binding of an inhibitory protein, IRP, causing increased ferritin mRNA translation (protein biosynthesis). Newly synthesized ferritin protein consumes Fe(2+) in biomineral, decreasing Fe(2)(+) and creating a regulatory feedback loop. Ferritin without iron is "apoferritin". Iron removal from ferritin, experimentally, uses biological reductants, for example, NADH + FMN, or chemical reductants, for example, thioglycolic acid, with Fe(2+) chelators; physiological mechanism(s) are murky. Clear, however, is the necessity of ferritin for terrestrial life by conferring oxidant protection (plants, animals, and bacteria), virulence (bacteria), and embryonic survival (mammals). Future studies of ferritin structure/function and Fe(2+)/O2 chemistry will lead to new ferritin uses in medicine, nutrition, and nanochemistry.
Campelo, Diana; Lautier, Thomas; Urban, Philippe; Esteves, Francisco; Bozonnet, Sophie; Truan, Gilles; Kranendonk, Michel
2017-01-01
NADPH-cytochrome P450 reductase (CPR) is a redox partner of microsomal cytochromes P450 and is a prototype of the diflavin reductase family. CPR contains 3 distinct functional domains: a FMN-binding domain (acceptor reduction), a linker (hinge), and a connecting/FAD domain (NADPH oxidation). It has been demonstrated that the mechanism of CPR exhibits an important step in which it switches from a compact, closed conformation (locked state) to an ensemble of open conformations (unlocked state), the latter enabling electron transfer to redox partners. The conformational equilibrium between the locked and unlocked states has been shown to be highly dependent on ionic strength, reinforcing the hypothesis of the presence of critical salt interactions at the interface between the FMN and connecting FAD domains. Here we show that specific residues of the hinge segment are important in the control of the conformational equilibrium of CPR. We constructed six single mutants and two double mutants of the human CPR, targeting residues G240, S243, I245 and R246 of the hinge segment, with the aim of modifying the flexibility or the potential ionic interactions of the hinge segment. We measured the reduction of cytochrome c at various salt concentrations of these 8 mutants, either in the soluble or membrane-bound form of human CPR. All mutants were found capable of reducing cytochrome c yet with different efficiency and their maximal rates of cytochrome c reduction were shifted to lower salt concentration. In particular, residue R246 seems to play a key role in a salt bridge network present at the interface of the hinge and the connecting domain. Interestingly, the effects of mutations, although similar, demonstrated specific differences when present in the soluble or membrane-bound context. Our results demonstrate that the electrostatic and flexibility properties of the hinge segment are critical for electron transfer from CPR to its redox partners. PMID:29163152
Ichinose, H; Wariishi, H; Tanaka, H
2002-09-01
A cDNA encoding cytochrome P450 oxidoreductase (CPR) from the lignin-degrading basidiomycete Coriolus versicolor was identified using RT-PCR. The full-length cDNA consisted of 2,484 nucleotides with a poly(A) tail, and contained an open reading frame. The G+C content of the cDNA isolated was 60%. A deduced protein contained 730 amino acid residues with a calculated molecular weight of 80.7 kDa. The conserved amino acid residues involved in functional domains such as FAD-, FMN-, and NADPH-binding domains, were all found in the deduced protein. A phylogenetic analysis demonstrated that C. versicolor CPR is significantly similar to CPR of the basidiomycete Phanerochaete chrysosporium and that they share the same major branch in the fungal cluster. A recombinant CPR protein was expressed using a pET/ Escherichia coli system. The recombinant CPR protein migrated at 81 kDa on SDS polyacrylamide gel electrophoresis. It exhibited an NADPH-dependent cytochrome c reducing activity.
NASA Astrophysics Data System (ADS)
Lantushenko, Anastasia O.; Mukhina, Yulia V.; Veselkov, Kyrill A.; Davies, David B.; Veselkov, Alexei N.
2004-07-01
NMR spectroscopy has been used to elucidate the molecular mechanism of solubilization action of hydrotropic agents nicotinamide (NA) and caffeine (CAF). Hetero-association of NA with riboflavine-mononucleotide (FMN) and CAF with low soluble in aqueous solution synthetic analogue of antibiotic actinomycin D, actinocyl-bis-(3-dimethylaminopropyl) amine (Actill), has been investigated by 500 MHz 1H NMR spectroscopy. Concentration and temperature dependences of proton chemical shifts have been analysed in terms of a statistical-thermodynamic model of indefinite self- and heteroassociation of aromatic molecules. The obtained results enable to conclude that NA-FMN and CAF-Actill intermolecular complexes are mainly stabilized by the stacking interactions of the aromatic chromophores. Hetero-association of the investigated molecules plays an important role in solubilization of aromatic drugs by hydrotropic agents nicotinamide and caffeine.
Ge, Jinlian; Xu, Dacheng; Peng, Youfan; Zhang, Mingchen; Cao, Wenyan
2015-11-01
To test the feasibility of using 1,5-anhydroglucose alcohol (1,5-AG) as a diagnostic indicator of fulminant type 1 diabetes (FT1DM). Fifteen patients with newly diagnosed FT1DM and 52 with type 2 diabetes (T2DM) were examined for serum biochemistry, glycosylated hemoglobin (HbAlc), and serum 1, 5-AG level. The patients with FT1DM and T2DM showed significantly different fasting levels of blood glucose (FBG), fructosamine (FMN), creatinine (Cr), urea, HbAlc and serum 1,5-AG (P<0.05). In FT1DM patients, serum 1,5-AG was found to inversely correlate with FBG (r=-0.646, P=0.032) and FMN (r=-0.680, P=0.021), and in T2DM patients, serum 1,5-AG was inversely correlated with FBG (r=-0.407, P=0.001), FMN (r=-0.314, P=0.01) and HbAlc (r=-0.576, P<0.01). Receiver-operating characteristic (ROC) curve analysis showed an area under the curve of serum 1,5-AG of 0.804 with a cutoff value of 67.95, a sensitivity of 82.9% and a specificity of 60% for FT1DM diagnosis. Serum 1, 5-AG can reflect acute blood glucose fluctuation in FT1DM patients and is useful for differential diagnosis of FT1DM when combined with evaluations of the clinical characteristics of the patients and other related indicators.
Hertzberger, Rosanne; Arents, Jos; Dekker, Henk L.; Pridmore, R. David; Gysler, Christof; Kleerebezem, Michiel
2014-01-01
Hydrogen peroxide production is a well-known trait of many bacterial species associated with the human body. In the presence of oxygen, the probiotic lactic acid bacterium Lactobacillus johnsonii NCC 533 excretes up to 1 mM H2O2, inducing growth stagnation and cell death. Disruption of genes commonly assumed to be involved in H2O2 production (e.g., pyruvate oxidase, NADH oxidase, and lactate oxidase) did not affect this. Here we describe the purification of a novel NADH-dependent flavin reductase encoded by two highly similar genes (LJ_0548 and LJ_0549) that are conserved in lactobacilli belonging to the Lactobacillus acidophilus group. The genes are predicted to encode two 20-kDa proteins containing flavin mononucleotide (FMN) reductase conserved domains. Reductase activity requires FMN, flavin adenine dinucleotide (FAD), or riboflavin and is specific for NADH and not NADPH. The Km for FMN is 30 ± 8 μM, in accordance with its proposed in vivo role in H2O2 production. Deletion of the encoding genes in L. johnsonii led to a 40-fold reduction of hydrogen peroxide formation. H2O2 production in this mutant could only be restored by in trans complementation of both genes. Our work identifies a novel, conserved NADH-dependent flavin reductase that is prominently involved in H2O2 production in L. johnsonii. PMID:24487531
Yang, Ming-Yeh; Chang, Chih-Jui; Chen, Liang-Yü
2017-08-01
Photodynamic therapy (PDT) is a safe and non-invasive treatment for cancers and microbial infections. Various photosensitizers and light sources have been developed for clinical cancer therapies. Flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) are the cofactor of enzymes and are used as photosensitizers in this study. Targeting hypoxia and light-triggering reactive oxygen species (ROS) are experimental strategies for poisoning tumor cells in vitro. HeLa cells are committed to apoptosis when treated with FMN or FAD and exposed to visible blue light (the maximum emitted wavelength of blue light is 462nm). Under blue light irradiation at 3.744J/cm 2 (=0.52mW/cm 2 irradiated for 2h), the minimal lethal dose is 3.125μM and the median lethal doses (LD 50 ) for FMN and FAD are 6.5μM and 7.2μM, respectively. Individual exposure to visible blue light irradiation or riboflavin photosensitizers does not produce cytotoxicity and no side effects are observed in this study. The western blotting results also show that an intrinsic apoptosis pathway is activated by the ROS during photolysis of riboflavin analogues. Blue light triggers the cytotoxicity of riboflavins on HeLa cells in vitro. Based on these results, this is a feasible and efficient of PDT with an intrinsic photosensitizer for cancer research. Copyright © 2017 Elsevier B.V. All rights reserved.
Riboflavin Responsive Mitochondrial Dysfunction in Neurodegenerative Diseases
Udhayabanu, Tamilarasan; Manole, Andreea; Rajeshwari, Mohan; Varalakshmi, Perumal; Houlden, Henry; Ashokkumar, Balasubramaniem
2017-01-01
Mitochondria are the repository for various metabolites involved in diverse energy-generating processes, like the TCA cycle, oxidative phosphorylation, and metabolism of amino acids, fatty acids, and nucleotides, which rely significantly on flavoenzymes, such as oxidases, reductases, and dehydrogenases. Flavoenzymes are functionally dependent on biologically active flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN), which are derived from the dietary component riboflavin, a water soluble vitamin. Riboflavin regulates the structure and function of flavoenzymes through its cofactors FMN and FAD and, thus, protects the cells from oxidative stress and apoptosis. Hence, it is not surprising that any disturbance in riboflavin metabolism and absorption of this vitamin may have consequences on cellular FAD and FMN levels, resulting in mitochondrial dysfunction by reduced energy levels, leading to riboflavin associated disorders, like cataracts, neurodegenerative and cardiovascular diseases, etc. Furthermore, mutations in either nuclear or mitochondrial DNA encoding for flavoenzymes and flavin transporters significantly contribute to the development of various neurological disorders. Moreover, recent studies have evidenced that riboflavin supplementation remarkably improved the clinical symptoms, as well as the biochemical abnormalities, in patients with neuronopathies, like Brown-Vialetto-Van-Laere syndrome (BVVLS) and Fazio-Londe disease. This review presents an updated outlook on the cellular and molecular mechanisms of neurodegenerative disorders in which riboflavin deficiency leads to dysfunction in mitochondrial energy metabolism, and also highlights the significance of riboflavin supplementation in aforementioned disease conditions. Thus, the outcome of this critical assessment may exemplify a new avenue to enhance the understanding of possible mechanisms in the progression of neurodegenerative diseases and may provide new rational approaches of disease surveillance and treatment. PMID:28475111
Contributions to the study of the mechanisms of photodynamic cross-linking of proteins
NASA Astrophysics Data System (ADS)
Shen, Hui-Rong
The illumination of proteins in solution and in cells in the presence of photosensitizers may lead to the inter- and/or intramolecular crosslinking of the proteins (photosensitized or photodynamic crosslinking). This phenomenon appears to be involved in the photohemolysis of red cells, cataract development, skin photoaging, photodynamic therapy for cancers, laser welding of tissues, biomaterial modification, and other biological situations. Although the processes involved in the photocrosslinking of proteins have been extensively studied, the mechanisms involved are still largely unknown. The main objectives of the studies reported in this dissertation were to investigate the detailed mechanisms involved in the photocrosslinking of proteins and to determine the chemical nature of the crosslinks formed. The first part of this study was devoted to the verification of the roles of His, Lys and Tyr in the photodynamic crosslinking of proteins. The crosslinking reaction was modeled using tailor-made water-soluble synthetic N-(2-hydroxypropyl)methacrylamide (HPMA) copolymers containing epsilon-aminocaproic acid side chains terminating in His, Lys or tyrosinamide residues photosensitized by rose bengal (RB) and flavin mononucleotide (FMN). RB typically produces singlet oxygen, whereas FMN produces both singlet oxygen and radicals. His-His and His-Lys crosslinks were formed with RB as the sensitizer. RB-sensitization did not crosslink Tyr residues, whereas FMN coupled two Tyr residues via a radical pathway. Protection of the His and/or Lys residues in ribonuclease A (RNase A) significantly inhibited the extent of intermolecular crosslinking, and confirmed the key roles played by His and Lys in crosslinking reactions. The second part of this study involved the elucidation of the detailed reaction mechanisms and the chemical structures of His-His and Tyr-Tyr crosslinks. N-benzoyl-histidine (Bz-His) and N-acetyl-tyrosine (Ac-Tyr) were used to model the photosensitized crosslinking of proteins involving His and Tyr residues. Photocrosslinking of Bz-His was performed in phosphate buffer at pH 7.4 with immobilized RB beads as sensitizer. The main dimerized product was isolated and characterized. Its chemical structure was established by MS and NMR methods. Ac-Tyr was photocrosslinked with FMN as the sensitizer at pH 6.0; oxygen was necessary. Three main crosslinked dimers were obtained. Their chemical structures were determined by MS and NMR data.
Chang, Chin -Yuan; Lohman, Jeremy; Cao, Hongnan; ...
2016-08-25
C-1027 is a chromoprotein enediyne antitumor antibiotic produced by Streptomyces globisporus. In the last step of biosynthesis of the (S)-3-chloro-5-hydroxy-beta-tyrosine moiety of the C-1027 enediyne chromophore, SgcE6 and SgcC compose a two-component monooxygenase that hydroxylates the C-5 position of (S)-3-chloro-beta-tyrosine. This two-component monooxygenase is remarkable for two reasons. (i) SgcE6 specifically reacts with FAD and NADH, and (ii) SgcC is active with only the peptidyl carrier protein (PCP)-tethered substrate. To address the molecular details of substrate specificity, we determined the crystal structures of SgcE6 and SgcC at 1.66 and 2.63 A resolution, respectively. SgcE6 shares a similar β-barrel fold withmore » the class I HpaC-like flavin reductases. A flexible loop near the active site of SgcE6 plays a role in FAD binding, likely by providing sufficient space to accommodate the AMP moiety of FAD, when compared to that of FMN-utilizing homologues. SgcC shows structural similarity to a few, other known FADH 2-dependent monooxygenases and sheds light on some biochemically but not structurally characterized homologues. In conclusion, the crystal structures reported here provide insights into substrate specificity, and comparison with homologues provides a catalytic mechanism of the two-component, FADH 2-dependent monooxygenase (SgcE6 and SgcC) that catalyzes the hydroxylation of a PCP-tethered substrate.« less
Flavins in Marine Sediments: A Potentially Ubiquitous Intermediary In Microbial Electron Transfer
NASA Astrophysics Data System (ADS)
Monteverde, D.; Sylvan, J. B.; Suffridge, C.; Berelson, W.; Sanudo-Wilhelmy, S. A.; Baronas, J. J.
2016-12-01
The flavins (riboflavin, flavin mononucleotide [FMN], flavin adenine dinucleotide [FAD]) are a class of organic compounds synthesized by organisms to assist in redox reactions. They represent the largest class of required coenzymes, rivaled only by iron in the number of unique enzymes they bind. In addition to internal use, cultured metal-reducing organisms such as Shewanella and Geobacter have been known to release flavins into the extracellular pool to aid in external electron transfer. So called "electron shuttles" can allow organisms to overcome unfavorable geochemical zonation by transferring electrons onto a relatively distant insoluble acceptor. Despite the extensive culture work, flavins have not been systematically measured in the environment. Here we present the first set of flavin profiles from the water column and pore waters of a marine environment. Samples were taken from San Pedro Basin, a 900 meter deep, silled basin, with high seasonal inputs of organic carbon, low bottom water oxygen concentrations, and laminated sediments - making it ideal to explore variations in sediment geochemical zonations. Dissolved flavin concentrations in the water column and pore waters collected from two cores were preconcentrated via solid phase extraction and measured via LC/MS. Flavin profiles are compared to a suite of geochemical parameters as well as sediment microbial 16s rRNA data. Preliminary results show that FMN is typically an order of magnitude higher concentration than riboflavin (800-300pM versus 100-50pM). Porewater concentrations were elevated over water column values for all analytes (ranging from 100-2000pM) and displayed an increasing trend with depth in both cores. This increasing trend correlated with a decrease in dissolved Fe (ranging from 160 µM in surface sediments to 65 µM at 40 cm) and shifts in microbial diversity from sediments shallower than 5 cm depth dominated by Delta- and Gammaproteobacteria to subsurface sediments dominated by Chloroflexi and Archaea at 20-40 cm. These first environmental profiles of flavins in the marine environmental support previous observations of the importance of electron transfer intermediaries in culture and point to an important role for flavins in modern marine microbial communities.
Lauterbach, Lars; Idris, Zulkifli; Vincent, Kylie A; Lenz, Oliver
2011-01-01
The NAD+-reducing soluble hydrogenase (SH) from Ralstonia eutropha H16 catalyzes the H₂-driven reduction of NAD+, as well as reverse electron transfer from NADH to H+, in the presence of O₂. It comprises six subunits, HoxHYFUI₂, and incorporates a [NiFe] H+/H₂ cycling catalytic centre, two non-covalently bound flavin mononucleotide (FMN) groups and an iron-sulfur cluster relay for electron transfer. This study provides the first characterization of the diaphorase sub-complex made up of HoxF and HoxU. Sequence comparisons with the closely related peripheral subunits of Complex I in combination with UV/Vis spectroscopy and the quantification of the metal and FMN content revealed that HoxFU accommodates a [2Fe2S] cluster, FMN and a series of [4Fe4S] clusters. Protein film electrochemistry (PFE) experiments show clear electrocatalytic activity for both NAD+ reduction and NADH oxidation with minimal overpotential relative to the potential of the NAD+/NADH couple. Michaelis-Menten constants of 56 µM and 197 µM were determined for NADH and NAD+, respectively. Catalysis in both directions is product inhibited with K(I) values of around 0.2 mM. In PFE experiments, the electrocatalytic current was unaffected by O₂, however in aerobic solution assays, a moderate superoxide production rate of 54 nmol per mg of protein was observed, meaning that the formation of reactive oxygen species (ROS) observed for the native SH can be attributed mainly to HoxFU. The results are discussed in terms of their implications for aerobic functioning of the SH and possible control mechanism for the direction of catalysis.
Yamada, Kazuhiro; Gherasim, Carmen; Banerjee, Ruma; Koutmos, Markos
2015-12-04
In mammals, B12 (or cobalamin) is an essential cofactor required by methionine synthase and methylmalonyl-CoA mutase. A complex intracellular pathway supports the assimilation of cobalamin into its active cofactor forms and delivery to its target enzymes. MMADHC (the methylmalonic aciduria and homocystinuria type D protein), commonly referred to as CblD, is a key chaperone involved in intracellular cobalamin trafficking, and mutations in CblD cause methylmalonic aciduria and/or homocystinuria. Herein, we report the first crystal structure of the globular C-terminal domain of human CblD, which is sufficient for its interaction with MMADHC (the methylmalonic aciduria and homocystinuria type C protein), or CblC, and for supporting the cytoplasmic cobalamin trafficking pathway. CblD contains an α+β fold that is structurally reminiscent of the nitro-FMN reductase superfamily. Two of the closest structural relatives of CblD are CblC, a multifunctional enzyme important for cobalamin trafficking, and the activation domain of methionine synthase. CblD, CblC, and the activation domain of methionine synthase share several distinguishing features and, together with two recently described corrinoid-dependent reductive dehalogenases, constitute a new subclass within the nitro-FMN reductase superfamily. We demonstrate that CblD enhances oxidation of cob(II)alamin bound to CblC and that disease-causing mutations in CblD impair the kinetics of this reaction. The striking structural similarity of CblD to CblC, believed to be contiguous in the cobalamin trafficking pathway, suggests the co-option of molecular mimicry as a strategy for achieving its function. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Dell'Osso, Louis F; Orge, Faruk H; Jacobs, Jonathan B; Wang, Zhong I
2014-01-01
To examine the waveform and clinical effects of the four-muscle tenotomy and reattachment procedure in fusion maldevelopment nystagmus syndrome (FMNS) and to compare them to those documented in infantile nystagmus syndrome (INS) and acquired nystagmus. Both infrared reflection and high-speed digital video systems were used to record the eye movements in a patient with FMNS (before and after tenotomy and reattachment). Data were analyzed using the eXpanded Nystagmus Acuity Function (NAFX) that is part of the OMtools software. Model simulations and predictions were performed using the authors' behavioral ocular motor system model in MATLAB Simulink (The MathWorks, Inc., Natick, MA). The model predicted, and the patient's data confirmed, that the tenotomy and reattachment procedure produces improvements in FMN waveforms across a broader field of gaze and decreases the Alexander's law variation. The patient's tenotomy and reattachment plots of NAFX after surgery versus gaze angle were higher and had lower slope than before surgery. Clinically, despite moderate improvements in both peak measured acuity and stereoacuity, dramatic improvements in the patient's abilities and lifestyle resulted. The four-muscle tenotomy and reattachment nystagmus surgery produced beneficial therapeutic effects on FMN waveforms that are similar to those demonstrated in INS and acquired nystagmus. These results support the authors' prior recommendation that tenotomy and reattachment nystagmus should be added to required strabismus procedures in patients who also have FMNS (ie, perform tenotomy and reattachment on all unoperated muscles in the plane of the nystagmus). Furthermore, when strabismus surgery is not required, four-muscle tenotomy and reattachment may be used to improve FMN waveforms and visual function. Copyright 2014, SLACK Incorporated.
Fu, Zi-Ying; Zeng, Hong; Tang, Jia; Li, Jie; Li, Juan; Chen, Qi-Cai
2013-06-25
It has been reported that the frequency modulation (FM) or FM direction sensitivity and forward masking of central auditory neurons are related with the neural inhibition, but there are some arguments, because no direct evidence of inhibitory synaptic input was obtained in previous studies using extracellular recording. In the present study, we studied the relation between FM direction sensitivity and forward masking of the inferior collicular (IC) neurons using in vivo intracellular recordings in 20 Mus musculus Km mice. Thirty seven with complete data among 93 neurons were analyzed and discussed. There was an inhibitory area which consisted of inhibitory postsynaptic potentials (IPSP) at high frequency side of frequency tuning of up-sweep FM (FMU) sensitive neurons (n = 12) and at low frequency side of frequency tuning of down-sweep FM (FMD) selective neurons (n = 8), while there was no any inhibitory area at both sides of frequency tuning of non-FM sweep direction (FMN) sensitive neurons (n = 17). Therefore, these results show that the inhibitory area at low or high frequency side of frequency tuning is one of the mechanisms for forming FM sweep direction sensitivity of IC neurons. By comparison of forward masking produced by FMU and FMD sound stimuli in FMU, FMD and FMN neurons, the selective FM sounds could produce stronger forward masking than the non-selective in FMU and FMD neurons, while there was no forward masking difference between FMU and FMD stimuli in the FMN neurons. We suggest that the post-action potential IPSP is a potential mechanism for producing stronger forward masking in FMU and FMD neurons.
Valladares, Ricardo B.; Graves, Christina; Wright, Kaitlyn; Gardner, Christopher L.; Lorca, Graciela L.; Gonzalez, Claudio F.
2015-01-01
Host and commensals crosstalk, mediated by reactive oxygen species (ROS), has triggered a growing scientific interest to understand the mechanisms governing such interaction. However, the majority of the scientific studies published do not evaluate the ROS production by commensals bacteria. In this context we recently showed that Lactobacillus johnsonii N6.2, a strain of probiotic value, modulates the activity of the critical enzymes 2,3-indoleamine dioxygenase via H2O2 production. L. johnsonii N6.2 by decreasing IDO activity, is able to modify the tryptophan/kynurenine ratio in the host blood with further systemic consequences. Understanding the mechanisms of H2O2 production is critical to predict the probiotic value of these strains and to optimize bacterial biomass production in industrial processes. We performed a transcriptome analysis to identify genes differentially expressed in L. johnsonii N6.2 cells collected from cultures grown under different aeration conditions. Herein we described the biochemical characteristics of a heterodimeric FMN reductase (FRedA/B) whose in vitro activity is controlled by LjPAS protein with a typical Per-Arnst-Sim (PAS) sensor domain. Interestingly, LjPAS is fused to the FMN reductase domains in other lactobacillaceae. In L. johnsonii, LjPAS is encoded by an independent gene which expression is repressed under anaerobic conditions (>3 fold). Purified LjPAS was able to slow down the FRedA/B initial activity rate when the holoenzyme precursors (FredA, FredB, and FMN) were mixed in vitro. Altogether the results obtained suggest that LjPAS module regulates the H2O2 production helping the cells to minimize oxidative stress in response to environmental conditions. PMID:26236298
Valladares, Ricardo B; Graves, Christina; Wright, Kaitlyn; Gardner, Christopher L; Lorca, Graciela L; Gonzalez, Claudio F
2015-01-01
Host and commensals crosstalk, mediated by reactive oxygen species (ROS), has triggered a growing scientific interest to understand the mechanisms governing such interaction. However, the majority of the scientific studies published do not evaluate the ROS production by commensals bacteria. In this context we recently showed that Lactobacillus johnsonii N6.2, a strain of probiotic value, modulates the activity of the critical enzymes 2,3-indoleamine dioxygenase via H2O2 production. L. johnsonii N6.2 by decreasing IDO activity, is able to modify the tryptophan/kynurenine ratio in the host blood with further systemic consequences. Understanding the mechanisms of H2O2 production is critical to predict the probiotic value of these strains and to optimize bacterial biomass production in industrial processes. We performed a transcriptome analysis to identify genes differentially expressed in L. johnsonii N6.2 cells collected from cultures grown under different aeration conditions. Herein we described the biochemical characteristics of a heterodimeric FMN reductase (FRedA/B) whose in vitro activity is controlled by LjPAS protein with a typical Per-Arnst-Sim (PAS) sensor domain. Interestingly, LjPAS is fused to the FMN reductase domains in other lactobacillaceae. In L. johnsonii, LjPAS is encoded by an independent gene which expression is repressed under anaerobic conditions (>3 fold). Purified LjPAS was able to slow down the FRedA/B initial activity rate when the holoenzyme precursors (FredA, FredB, and FMN) were mixed in vitro. Altogether the results obtained suggest that LjPAS module regulates the H2O2 production helping the cells to minimize oxidative stress in response to environmental conditions.
Crankshaw, D L; Hetnarski, K; Wilkinson, C F
1979-09-01
1. NADPH-cytochrome c reductase was solubilized with bromelain and purified about 400-fold from sucrose/pyrophosphate-washed microsomal fractions from southern armyworm (Spodoptera eridania) larval midguts. 2. The enzyme has a mol.wt. of 70 035 +/- 1300 and contained 2 mol of flavin/mol of enzyme consisting of almost equimolar amounts of FMN and FAD. 3. Aerobic titration of the enzyme with NADPH caused the formation of a stable half-reduced state at 0.5 mol of NADPH/mol of flavin. 4. Kinetic analysis showed that the reduction of cytochrome c proceeded by a Bi Bi Ping Pong mechanism. 5. Apparent Km values for NADPH and cytochrome c and Ki values for NADP+ and 2'-AMP were considerably higher for the insect reductase than for the mammalian liver enzyme. 6. These are discussed in relation to possible differences in the active sites of the enzymes.
Serebryakova, Marina V; Bertsova, Yulia V; Sokolov, Svyatoslav S; Kolesnikov, Alexander A; Baykov, Alexander A; Bogachev, Alexander V
2018-06-01
One of the three domains of kinetoplastid NADH:fumarate oxidoreductase (FRD) is homologous to bacterial flavin transferase that catalyzes transfer of FMN residue from FAD to threonine in flavoproteins. Leptomonas pyrrhocoris FRD produced in yeast cells, which lack flavin transferase gene in their proteome, reduces fumarate in the presence of NADH and contains an FMN residue covalently linked to a Ser9 residue. The conserved flavinylation motif of FRD, D 3 (g/s)x(s/t)(s/g)AS 9 , is similar to the Dxx(s/t)gAT motif recognized by flavin transferase in prokaryotic proteins. Ser9 replacement abolished the flavinylation and fumarate reductase activity of FRD. These findings suggest that the flavinylation is important for the activity of FRD and that this post-translational modification is carried out by the own flavin transferase domain. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Outer membrane cytochromes/flavin interactions in Shewanella spp.—A molecular perspective
Babanova, Sofia; Matanovic, Ivana; Cornejo, Jose; ...
2017-05-31
Extracellular electron transfer (EET) is intrinsically associated with the core phenomena of energy harvesting/energy conversion in natural ecosystems and biotechnology applications. But, the mechanisms associated with EET are complex and involve molecular interactions that take place at the “bionano interface” where biotic/abiotic interactions are usually explored. Our work provides molecular perspective on the electron transfer mechanism(s) employed by Shewanella oneidensis MR-1. Molecular docking simulations were used to explain the interfacial relationships between two outer-membrane cytochromes (OMC) OmcA and MtrC and riboflavin (RF) and flavin mononucleotide (FMN), respectively. OMC-flavin interactions were analyzed by studying the electrostatic potential, the hydrophilic/hydrophobic surface properties,more » and the van der Waals surface of the OMC proteins. As a result, it was proposed that the interactions between flavins and OMCs are based on geometrical recognition event. The possible docking positions of RF and FMN to OmcA and MtrC were also shown.« less
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
NASA Astrophysics Data System (ADS)
Shkolyar, S.; Farmer, J. D.
2016-05-01
We studied evaporite subfacies in the Verde Fmn., AZ. We identified diagenetic pathways and assessed how diagenesis affected biosignature preservation potential (BPP) in each. Results revealed eight pathways, each with diverse impacts on BPP.
Kähönen, Mika; Raitakari, Olli; Laaksonen, Marika; Sievänen, Harri; Viikari, Jorma; Lyytikäinen, Leo-Pekka; Mellström, Dan; Karlsson, Magnus; Ljunggren, Östen; Grundberg, Elin; Kemp, John P.; Sayers, Adrian; Nethander, Maria; Evans, David M.; Vandenput, Liesbeth; Tobias, Jon H.; Ohlsson, Claes
2013-01-01
Most previous genetic epidemiology studies within the field of osteoporosis have focused on the genetics of the complex trait areal bone mineral density (aBMD), not being able to differentiate genetic determinants of cortical volumetric BMD (vBMD), trabecular vBMD, and bone microstructural traits. The objective of this study was to separately identify genetic determinants of these bone traits as analysed by peripheral quantitative computed tomography (pQCT). Separate GWA meta-analyses for cortical and trabecular vBMDs were performed. The cortical vBMD GWA meta-analysis (n = 5,878) followed by replication (n = 1,052) identified genetic variants in four separate loci reaching genome-wide significance (RANKL, rs1021188, p = 3.6×10−14; LOC285735, rs271170, p = 2.7×10−12; OPG, rs7839059, p = 1.2×10−10; and ESR1/C6orf97, rs6909279, p = 1.1×10−9). The trabecular vBMD GWA meta-analysis (n = 2,500) followed by replication (n = 1,022) identified one locus reaching genome-wide significance (FMN2/GREM2, rs9287237, p = 1.9×10−9). High-resolution pQCT analyses, giving information about bone microstructure, were available in a subset of the GOOD cohort (n = 729). rs1021188 was significantly associated with cortical porosity while rs9287237 was significantly associated with trabecular bone fraction. The genetic variant in the FMN2/GREM2 locus was associated with fracture risk in the MrOS Sweden cohort (HR per extra T allele 0.75, 95% confidence interval 0.60–0.93) and GREM2 expression in human osteoblasts. In conclusion, five genetic loci associated with trabecular or cortical vBMD were identified. Two of these (FMN2/GREM2 and LOC285735) are novel bone-related loci, while the other three have previously been reported to be associated with aBMD. The genetic variants associated with cortical and trabecular bone parameters differed, underscoring the complexity of the genetics of bone parameters. We propose that a genetic variant in the RANKL locus influences cortical vBMD, at least partly, via effects on cortical porosity, and that a genetic variant in the FMN2/GREM2 locus influences GREM2 expression in osteoblasts and thereby trabecular number and thickness as well as fracture risk. PMID:23437003
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sloan, J.W.
1984-01-01
These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less
Galano-Frutos, Juan J; Morón, M Carmen; Sancho, Javier
2015-11-21
Binding/unbinding of small ligands, such as ions, to/from proteins influences biochemical processes such as protein folding, enzyme catalysis or protein/ligand recognition. We have investigated the mechanism of chloride/water exchange at a protein surface (that of the apoflavodoxin from Helicobacter pylori) using classical all-atom molecular dynamics simulations. They reveal a variety of chloride exit routes and residence times; the latter is related to specific coordination modes of the anion. The role of solvent molecules in the mechanism of chloride unbinding has been studied in detail. We see no temporary increase in chloride coordination along the release process. Instead, the coordination of new water molecules takes place in most cases after the chloride/protein atom release event has begun. Moreover, the distribution function of water entrance events into the first chloride solvation shell peaks after chloride protein atom dissociation events. All these observations together seem to indicate that water molecules simply fill the vacancies left by the previously coordinating protein residues. We thus propose a step-by-step dissociation pathway in which protein/chloride interactions gradually break down before new water molecules progressively fill the vacant positions left by protein atoms. As observed for other systems, water molecules associated with bound chloride or with protein atoms have longer residence times than those bound to the free anion. The implications of the exchange mechanism proposed for the binding of the FMN (Flavin Mononucleotide) protein cofactor are discussed.
Huang, Yong; Lu, Xue-Ping; Wang, Luo-Luo; Wei, Dong; Feng, Zi-Jiao; Zhang, Qi; Xiao, Lin-Fan; Dou, Wei; Wang, Jin-Jun
2015-01-01
NADPH cytochrome P450 reductase (CPR) is essential for cytochrome P450 catalysis, which is important in the detoxification and activation of xenobiotics. In this study, two transcripts of Bactrocera dorsalis CPR (BdCPR) were cloned, and the deduced amino-acid sequence had an N-terminus membrane anchor for BdCPR-X1 and three conserved binding domains (FMN, FAD, and NADP), as well as an FAD binding motif and catalytic residues for both BdCPR-X1 and BdCPR-X2. BdCPR-X1 was detected to have the high expression levels in adults and in Malpighian tubules, fat bodies, and midguts of adults, but BdCPR-X2 expressed lowly in B. dorsalis. The levels of BdCPRs were similar in malathion-resistant strain compared to susceptible strain. However, injecting adults with double-stranded RNA against BdCPR significantly reduced the transcript levels of the mRNA, and knockdown of BdCPR increased adult susceptibility to malathion. Expressing complete BdCPR-X1 cDNA in Sf9 cells resulted in high activity determined by cytochrome c reduction and these cells had higher viability after exposure to malathion than control. The results suggest that BdCPR could affect the susceptibility of B. dorsalis to malathion and eukaryotic expression of BdCPR would lay a solid foundation for further investigation of P450 in B. dorsalis. PMID:26681597
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
An Electrostatic Funnel in the GABA-Binding Pathway
Lightstone, Felice C.
2016-01-01
The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
A tool for calculating binding-site residues on proteins from PDB structures.
Hu, Jing; Yan, Changhui
2009-08-03
In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase
NASA Astrophysics Data System (ADS)
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-01
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-05
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Allosteric binding sites in Rab11 for potential drug candidates
2018-01-01
Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, A.M.; Vandesande, F.; Orban, G.A.
1991-03-08
The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less
Nontraditional carbon reducing agents in smelting FMn78B ferromanganese and valuable manganese slag
DOE Office of Scientific and Technical Information (OSTI.GOV)
P.A. Kravchenko; O.N. Sezonenko; O.L. Bespalov
The smelting of FeMn78B ferromanganese (0.7% P) by a flux-free method, with the production of valuable slag (36-38% Mn), is considered in the case where some of the coke nuts are replaced by anthracite and sometimes by long-flame coal.
Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A
1999-01-01
A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
NASA Astrophysics Data System (ADS)
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
Nakajima, Hiroaki; Terazawa, Shuko; Niwano, Takao; Yamamoto, Yorihiro; Imokawa, Genji
2016-01-01
We recently reported that the over-expression of skin fibroblast-derived neutral endopeptidase (NEP) plays a pivotal role in impairing the three-dimensional architecture of dermal elastic fibers during the biological mechanism of ultraviolet (UV)-induced skin wrinkling. In that process, a UVB-associated epithelial-mesenchymal cytokine interaction as well as a direct UVA-induced cellular stimulation are associated with the up-regulation of NEP in human fibroblasts. In this study, we characterized the mode of action of ubiquinol10 which may abrogate the up-regulation of NEP by dermal fibroblasts, resulting in a reported in vivo anti-wrinkling action, and compared that with 3 other anti-oxidants, astaxanthin (AX), riboflavin (RF) and flavin mononucleotide (FMN). Post-irradiation treatment with all 4 of those anti-oxidants elicited an interrupting effect on the UVB-associated epithelial-mesenchymal cytokine interaction leading to the up-regulation of NEP in human fibroblasts but with different modes of action. While AX mainly served as an inhibitor of the secretion of wrinkle-inducing cytokines, such as interleukin-1α (IL-1α) and granulocyte macrophage colony stimulatory factor (GM-CSF) in UVB-exposed epidermal keratinocytes, ubiquinol10, RF and FMN predominantly interrupted the IL-1α and GM-CSF-stimulated expression of NEP in dermal fibroblasts. On the other hand, as for the UVA-associated mechanism, similar to the abrogating effects reported for AX and FMN, ubiquinol10 but not RF had the potential to abrogate the increased expression of NEP and matrix-metalloproteinase-1 in UVA-exposed human fibroblasts. Our findings strongly support the in vivo anti-wrinkling effects of ubiquinol10 and AX on human and animal skin and provide convincing proof of the UV-induced wrinkling mechanism that essentially focuses on the over-expression of NEP by dermal fibroblasts as an intrinsic causative factor. PMID:27648570
Thibodeaux, Christopher J.; Mansoorabadi, Steven O.; Kittleman, William; Chang, Wei-chen; Liu, Hung-wen
2011-01-01
The type II isopentenyl diphosphate/dimethylallyl diphosphate isomerase (IDI-2) is a flavin mononucleotide (FMN)-dependent enzyme that catalyzes the reversible isomerization of isopentenyl pyrophosphate (IPP) to dimethylallyl pyrophosphate (DMAPP), a reaction with no net change in redox state of the coenzyme or substrate. Here, UV-vis spectral analysis of the IDI-2 reaction revealed the accumulation of a reduced neutral dihydroflavin intermediate when the reduced enzyme was incubated with IPP or DMAPP. When IDI-2 was reconstituted with 1-deazaFMN and 5-deazaFMN, similar reduced neutral forms of the deazaflavin analogues were observed in the presence of IPP. Single turnover stopped-flow absorbance experiments indicated that this flavin intermediate formed and decayed at kinetically competent rates in the pre-steady-state and, thus, most likely represents a true intermediate in the catalytic cycle. UV-vis spectra of the reaction mixtures reveal trace amounts of a neutral semiquinone, but evidence for the presence of IPP-based radicals could not be obtained by EPR spectroscopy. Rapid-mix chemical quench experiments show no burst in DMAPP formation, suggesting that the rate determining step in the forward direction (IPP to DMAPP) occurs prior to DMAPP formation. A solvent deuterium kinetic isotope effect (D2OVmax = 1.5) was measured on vo in steady-state kinetic experiments at saturating substrate concentrations. A substrate deuterium kinetic isotope effect was also measured on the initital velocity (DVmax = 1.8) and on the decay rate of the flavin intermediate (Dks = 2.3) in single-turnover stopped-flow experiments using (R)-[2-2H]-IPP. Taken together, these data suggest that the C2–H bond of IPP is cleaved in the rate determining step and that general acid/base catalysis may be involved during turnover. Possible mechanisms for the IDI-2 catalyzed reaction are presented and discussed in terms of the available X-ray crystal structures. PMID:18229948
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.
Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen
2017-01-01
Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1 h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .
NASA Astrophysics Data System (ADS)
Zirak, P.; Penzkofer, A.; Schiereis, T.; Hegemann, P.; Jung, A.; Schlichting, I.
2005-08-01
The BLUF domain of the transcriptional anti-repressor protein AppA from the non-sulfur anoxyphototrophic purple bacterium Rhodobacter sphaeroides was characterized by absorption and emission spectroscopy. The BLUF domain constructs AppA 148 (consisting of amino-acid residues 1-148) and AppA 126 (amino-acid residues 1-126) are investigated. The cofactor of the investigated domains is found to consist of a mixture of the flavins riboflavin, FMN, and FAD. The dark-adapted domains exist in two different active receptor conformations (receptor states) with different sub-nanosecond fluorescence lifetimes (BLUF r,f and BLUF r,sl) and a small non-interacting conformation (BLUF nc). The active receptor conformations are transformed to putative signalling states (BLUF s,f and BLUF s,sl) of low fluorescence efficiency and picosecond fluorescence lifetime by blue-light excitation (light-adapted domains). In the dark at room temperature both signalling states recover back to the initial receptor states with a time constant of about 17 min. A quantum yield of signalling state formation of about 25% was determined by intensity dependent transmission measurements. A photo-cycle scheme is presented including photo-induced charge transfer complex formation, charge recombination, and protein binding pocket reorganisation.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less
NASA Astrophysics Data System (ADS)
Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong
2013-08-01
The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Jacobson, A.E.; Rice, K.C.
1987-11-01
Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.
Pikler, G M; Webster, R A; Spelsberg, T C
1976-01-01
Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147
Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo
NASA Astrophysics Data System (ADS)
Schwartz, Rochelle D.; Kellar, Kenneth J.
1983-04-01
Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.
Crankshaw, D L; Hetnarski, K; Wilkinson, C F
1979-01-01
1. NADPH-cytochrome c reductase was solubilized with bromelain and purified about 400-fold from sucrose/pyrophosphate-washed microsomal fractions from southern armyworm (Spodoptera eridania) larval midguts. 2. The enzyme has a mol.wt. of 70 035 +/- 1300 and contained 2 mol of flavin/mol of enzyme consisting of almost equimolar amounts of FMN and FAD. 3. Aerobic titration of the enzyme with NADPH caused the formation of a stable half-reduced state at 0.5 mol of NADPH/mol of flavin. 4. Kinetic analysis showed that the reduction of cytochrome c proceeded by a Bi Bi Ping Pong mechanism. 5. Apparent Km values for NADPH and cytochrome c and Ki values for NADP+ and 2'-AMP were considerably higher for the insect reductase than for the mammalian liver enzyme. 6. These are discussed in relation to possible differences in the active sites of the enzymes. Images Fig. 3. PMID:117798
DOE Office of Scientific and Technical Information (OSTI.GOV)
Edwards, Marcus J.; White, Gaye F.; Norman, Michael
2015-07-01
Extracellular microbe-mineral electron transfer is a major driving force for the oxidation of organic carbon in many subsurface environments. Extracellular multi-heme cytochromes of the Shewenella genus play a major role in this process but the mechanism of electron exchange at the interface between cytochrome and acceptor is widely debated. The 1.8 Å x-ray crystal structure of the decaheme MtrC revealed a highly conserved CX₈C disulfide that, when substituted for AX₈A, severely compromised the ability of S. oneidensis to grow under aerobic conditions. Reductive cleavage of the disulfide in the presence of flavin mononucleotide (FMN) resulted in the reversible formation ofmore » a stable flavocytochrome. Similar results were also observed with other decaheme cytochromes, OmcA, MtrF and UndA. The data suggest that these decaheme cytochromes can transition between highly reactive flavocytochromes or less reactive cytochromes, and that this transition is controlled by a redox active disulfide that responds to the presence of oxygen.« less
Substance P binding sites in the nucleus tractus solitarius of the cat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maley, B.E.; Sasek, C.A.; Seybold, V.S.
1988-11-01
Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less
USDA-ARS?s Scientific Manuscript database
Phenazine compounds produced by certain species of bacteria have antibiotic activity against a wide range of bacterial and fungal pathogens including many that cause important root diseases of plants. The antibiotic activity of these compounds has long been known but the mechanism of synthesis is po...
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.
1991-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Kawasaki, Kazuyoshi; Ogawa, Seturou
2003-01-01
NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine
Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.
2015-01-01
Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-05-01
Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCann, D.J.; Su, T.P.
1991-05-01
The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less
Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.
Suzuki, N; Mihashi, K
1991-01-01
The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthin, G.R.; Wolfe, B.B.
The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Chen, Zhi-wei; Vignaud, Caroline; Jaafar, Adil; Lévy, Bernard; Guéritte, Françoise; Guénard, Daniel; Lederer, Florence; Mathews, F Scott
2012-05-01
Long chain hydroxy acid oxidase (LCHAO) is responsible for the formation of methylguanidine, a toxic compound with elevated serum levels in patients with chronic renal failure. Its isozyme glycolate oxidase (GOX), has a role in the formation of oxalate, which can lead to pathological deposits of calcium oxalate, in particular in the disease primary hyperoxaluria. Inhibitors of these two enzymes may have therapeutic value. These enzymes are the only human members of the family of FMN-dependent l-2-hydroxy acid-oxidizing enzymes, with yeast flavocytochrome b(2) (Fcb2) among its well studied members. We screened a chemical library for inhibitors, using in parallel rat LCHAO, human GOX and the Fcb2 flavodehydrogenase domain (FDH). Among the hits was an inhibitor, CCPST, with an IC(50) in the micromolar range for all three enzymes. We report here the crystal structure of a complex between this compound and LCHAO at 1.3 Å resolution. In comparison with a lower resolution structure of this enzyme, binding of the inhibitor induces a conformational change in part of the TIM barrel loop 4, as well as protonation of the active site histidine. The CCPST interactions are compared with those it forms with human GOX and those formed by two other inhibitors with human GOX and spinach GOX. These compounds differ from CCPST in having the sulfur replaced with a nitrogen in the five-membered ring as well as different hydrophobic substituents. The possible reason for the ∼100-fold difference in affinity between these two series of inhibitors is discussed. The present results indicate that specificity is an issue in the quest for therapeutic inhibitors of either LCHAO or GOX, but they may give leads for this quest. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Existence of three subtypes of bradykinin B2 receptors in guinea pig.
Seguin, L; Widdowson, P S; Giesen-Crouse, E
1992-12-01
We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Nguyen, T V; Juorio, A V
1989-10-01
The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
NASA Technical Reports Server (NTRS)
D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.
2002-01-01
Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.
Functional identification and characterization of sodium binding sites in Na symporters
Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.
2013-01-01
Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006
Navé, Jean-François; Benveniste, Pierre
1984-01-01
The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.
The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less
Autoradiographic localization of endothelin-1 binding sites in porcine skin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Y.D.; Springall, D.R.; Wharton, J.
Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Astashkin, Andrei V; Feng, Changjian
2015-11-12
The production of nitric oxide by the nitric oxide synthase (NOS) enzyme depends on the interdomain electron transfer (IET) between the flavin mononucleotide (FMN) and heme domains. Although the rate of this IET has been measured by laser flash photolysis (LFP) for various NOS proteins, no rigorous analysis of the relevant kinetic equations was performed so far. In this work, we provide an analytical solution of the kinetic equations underlying the LFP approach. The derived expressions reveal that the bulk IET rate is significantly affected by the conformational dynamics that determines the formation and dissociation rates of the docking complex between the FMN and heme domains. We show that in order to informatively study the electron transfer across the NOS enzyme, LFP should be used in combination with other spectroscopic methods that could directly probe the docking equilibrium and the conformational change rate constants. The implications of the obtained analytical expressions for the interpretation of the LFP results from various native and modified NOS proteins are discussed. The mathematical formulas derived in this work should also be applicable for interpreting the IET kinetics in other modular redox enzymes.
Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Amato, R.J.; Largent, B.L.; Snowman, A.M.
1987-07-01
Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Tam, S W; Cook, L
1984-01-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Discovering amino acid patterns on binding sites in protein complexes
Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng
2011-01-01
Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin
Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.
2011-01-01
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.
Dubois, B W; Cherian, S F; Evers, A S
1993-01-01
There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Rainbow, T.C.
1983-05-01
The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY
Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.
2008-01-01
The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.
Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu
2014-01-01
We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Binding Leverage as a Molecular Basis for Allosteric Regulation
Mitternacht, Simon; Berezovsky, Igor N.
2011-01-01
Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347
Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi
2016-12-15
The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R
2003-01-01
Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
RBind: computational network method to predict RNA binding sites.
Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie
2018-04-26
Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, S.W.; Cook, L.
1984-09-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less
Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A
1996-01-04
In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U
2014-06-02
The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Warfield, Becka M.
2017-01-01
RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Computational Optimization and Characterization of Molecularly Imprinted Polymers
NASA Astrophysics Data System (ADS)
Terracina, Jacob J.
Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.
Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki
2017-01-01
Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, S.K.
1987-01-01
Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less
Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther
2011-05-01
The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Influence of sulfhydryl sites on metal binding by bacteria
NASA Astrophysics Data System (ADS)
Nell, Ryan M.; Fein, Jeremy B.
2017-02-01
The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.
Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.
Liaw, S. H.; Kuo, I.; Eisenberg, D.
1995-01-01
Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Acceleration of Binding Site Comparisons by Graph Partitioning.
Krotzky, Timo; Klebe, Gerhard
2015-08-01
The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Mühlmann, Martina; Regestein, Lars; Büchs, Jochen
2017-02-17
Oxygen limitation can be used as a simple environmental inducer for the expression of target genes. However, there is scarce information on the characteristics of microaerobic promoters potentially useful for cell engineering and synthetic biology applications. Here, we characterized the Vitreoscilla hemoglobin promoter (P vgb ) and a set of microaerobic endogenous promoters in Escherichia coli. Oxygen-limited cultures at different maximum oxygen transfer rates were carried out. The FMN-binding fluorescent protein (FbFP), which is a nonoxygen dependent marker protein, was used as a reporter. Fluorescence and fluorescence emission rates under oxygen-limited conditions were the highest when FbFP was under transcriptional control of P adhE , P pfl and P vgb . The lengths of the E. coli endogenous promoters were shortened by 60%, maintaining their key regulatory elements. This resulted in improved promoter activity in most cases, particularly for P adhE , P pfl and P narK . Selected promoters were also evaluated using an engineered E. coli strain expressing Vitreoscilla hemoglobin (VHb). The presence of the VHb resulted in a better repression using these promoters under aerobic conditions, and increased the specific growth and fluorescence emission rates under oxygen-limited conditions. These results are useful for the selection of promoters for specific applications and for the design of modified artificial promoters.
Zirak, P; Penzkofer, A; Lehmpfuhl, C; Mathes, T; Hegemann, P
2007-01-03
The BLUF protein Slr1694 from the cyanobacterium Synechocystis sp. PCC6803 is characterized by absorption and emission spectroscopy. Slr1694 expressed from E. coli which non-covalently binds FAD, FMN, and riboflavin (called Slr1694(I)), and reconstituted Slr1694 which dominantly contains FAD (called Slr1694(II)) are investigated. The receptor conformation of Slr1694 (dark adapted form Slr1694(r)) is transformed to the putative signalling state (light adapted form Slr1694(s)) with red-shifted absorption and decreased fluorescence efficiency by blue-light excitation. In the dark at 22 degrees C, the signalling state recovers back to the initial receptor state with a time constants of about 14.2s for Slr1694(I) and 17s for Slr1694(II). Quantum yields of signalling state formation of approximately 0.63+/-0.07 for both Slr1694(I) and Slr1694(II) were determined by transient transmission measurements and intensity dependent steady-state transmission measurements. Extended blue-light excitation causes some bound flavin conversion to the hydroquinone form and some photo-degradation, both with low quantum efficiency. The flavin-hydroquinone re-oxidizes slowly back (time constant 5-9 min) to the initial flavoquinone form in the dark. A photo-cycle dynamics scheme is presented.
Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe
2011-01-01
Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967
Interaction between phloretin and the red blood cell membrane
1976-01-01
Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575
A peek into tropomyosin binding and unfolding on the actin filament.
Singh, Abhishek; Hitchcock-Degregori, Sarah E
2009-07-24
Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.
sc-PDB: a 3D-database of ligandable binding sites--10 years on.
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.
Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta
2013-07-01
Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.
Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.
Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin
2017-09-14
U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew
2015-11-01
Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L
2008-12-09
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.
Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.
2009-01-01
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330
Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.
Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael
2013-01-01
Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
[3H]MK-801 binding sites in post-mortem human frontal cortex.
Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P
1989-03-29
The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-03-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-01-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513
sc-PDB: a 3D-database of ligandable binding sites—10 years on
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483
Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A
2018-05-29
Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.
2008-01-01
The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando
2018-03-23
The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M
2011-01-01
Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less
NASA Astrophysics Data System (ADS)
Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh
2017-06-01
In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.
A deep learning framework for modeling structural features of RNA-binding protein targets
Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang
2016-01-01
RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Middendorf, Thomas R.
2017-01-01
A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951
Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.
Mizuno, S; Ogawa, N; Mori, A
1982-12-01
Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng
2014-03-01
Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.
Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.
Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry
2006-07-01
High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.
Streiff, John H; Jones, Keith A
2008-10-01
The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Efficient Use and Recycling of the Micronutrient Iodide in Mammals
Rokita, Steven E.; Adler, Jennifer M.; McTamney, Patrick M.; Watson, James A.
2010-01-01
Daily ingestion of iodide alone is not adequate to sustain production of the thyroid hormones, tri- and tetraiodothyronine. Proper maintenance of iodide in vivo also requires its active transport into the thyroid and its salvage from mono- and diiodotyrosine that are formed in excess during hormone biosynthesis. The enzyme iodotyrosine deiodinase responsible for this salvage is unusual in its ability to catalyze a reductive dehalogenation reaction dependent on a flavin cofactor, FMN. Initial characterization of this enzyme was limited by its membrane association, difficult purification and poor stability. The deiodinase became amenable to detailed analysis only after identification and heterologous expression of its gene. Site-directed mutagenesis recently demonstrated that cysteine residues are not necessary for enzymatic activity in contrast to precedence set by other reductive dehalogenases. Truncation of the N-terminal membrane anchor of the deiodinase has provided a soluble and stable source of enzyme sufficient for crystallographic studies. The structure of an enzyme•substrate co-crystal has become invaluable for understanding the origins of substrate selectivity and the mutations causing thyroid disease in humans. PMID:20167242
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannopoulos, G.; Jackson, K.; Kredentser, J.
The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less
Genetic biomarkers for neoplastic colorectal cancer in peripheral lymphocytes.
Ionescu, Mirela; Ciocirlan, Mihai; Ionescu, Cristina; Becheanu, Gabriel; Gologan, Serban; Teiusanu, Adriana; Arbanas, Tudor; Mircea, Diculescu
2011-04-01
Loss of genomic stability appears as a key step in colorectal carcinogenesis. Micronucleus (MN) designates a chromosome fragment or an entire chromosme which lags behind mitosis. MN may be noticed as an additional nucleus within the cytoplasm cell during the intermediate mitosis phases. We tested the hypothesis that MN and its related anomalies may be associated with the presence of neoplastic colorectal lesions. Peripheral blood lymphocytes were cultured and microscopically examined. The frequency of micronuclei (FMN) and the presence of nucleoplasmic bridges (NPB) in binucleated cells were compared in patients with of without colorectal neoplastic lesions. We included 45 patients undergoing colonoscopy, 23 males and 22 females, with a median age of 59. 17 patients had polyps, 11 colorectal cancer (CRC) and 17 had a normal colonoscopy. The FMN was significantly higher in women than in men (8.14 vs 4.17, p=0.008); NPB were significantly less frequent in patients with advanced adenomas (>10mm or vilous) or CRC (p=0.044) when compared with patients with normal colonoscopy, hiperplastic polyps or non-advanced adenomas. Micronuclei are more frequent in women, but its frequency was not significantly different in patients with advanced adenomas or CRC. Null or low frequency values for nucleoplasmic bridges presence in peripheral lymphocyte may be predictive for advanced adenomas and colorectal cancer.
Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.
Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain
2014-11-18
Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.
Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies
NASA Astrophysics Data System (ADS)
Pang, Yuan-Ping; Kozikowski, Alan P.
1994-12-01
We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.
The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Energetics and kinetics of cooperative cofilin-actin filament interactions.
Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M
2006-08-11
We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.
Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.
2008-08-19
Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trong, I.Le; Stenkamp, R.E.; Ibarra, C.
2005-08-22
Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less
Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing
Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav
2007-01-01
In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Anisotropic energy flow and allosteric ligand binding in albumin
NASA Astrophysics Data System (ADS)
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin.
Li, Guifeng; Magana, Donny; Dyer, R Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265
Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.
2012-01-01
An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Morley, B J; Garner, L L
1990-06-11
Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose
Jalak, Jürgen; Väljamäe, Priit
2014-01-01
Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy
Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming
2014-01-01
A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.
Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E
2018-02-01
Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.
Elimination of a ligand gating site generates a supersensitive olfactory receptor.
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I
2016-06-21
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.
Elimination of a ligand gating site generates a supersensitive olfactory receptor
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.
2016-01-01
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants
Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander
2013-01-01
Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-05-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less
Purification of L-( sup 3 H) Nicotine eliminates low affinity binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romm, E.; Marks, M.J.; Collins, A.C.
1990-01-01
Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Yokoyama, Ken Daigoro; Pollock, David D
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, M.E.; Mallorga, P.; Pettibone, D.J.
1988-01-01
(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis
2011-11-14
The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.
Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter
2001-01-01
Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nye, J.S.
The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less
Gillard, Michel; Chatelain, Pierre; Fuks, Bruno
2006-04-24
A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.
The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.
positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP
Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas
2010-01-01
Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca
2011-01-01
The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis
2017-03-16
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gundlach, A.L.; Largent, B.L.; Snyder, S.H.
1986-06-01
(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.
Salter, Jason D; Smith, Harold C
2018-05-23
The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.
The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, M.W.; Chen, J.P.; Wallis, C.
1992-02-26
({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less
Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.
2015-01-01
Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613
Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M
1998-01-01
The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514
Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N
1991-11-01
The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.
Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua
2016-07-19
The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.
Barnert, R H; Zeichhardt, H; Habermehl, K O
1992-02-01
Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.
Cooperative interplay of let-7 mimic and HuR with MYC RNA.
Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A
2015-01-01
Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.
Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen
2018-06-06
Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary
2015-12-01
CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.
FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1
Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.
2007-01-01
Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863
Investigation of glucose binding sites on insulin.
Zoete, Vincent; Meuwly, Markus; Karplus, Martin
2004-05-15
Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.
James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha
2015-01-01
Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488
Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen
2017-01-01
Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946
Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.
Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J
1988-01-01
The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.
2008-01-01
Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991
An additional substrate binding site in a bacterial phenylalanine hydroxylase
Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan
2014-01-01
Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686
NASA Astrophysics Data System (ADS)
Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.
2018-03-01
To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.
Keck, P C; Huston, J S
1996-01-01
Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174
Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma
2017-09-01
Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Catalytic site interactions in yeast OMP synthase.
Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R
2014-01-15
The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.
Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min
2006-01-01
Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).
Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muccioli, G.; Guardabassi, A.; Pattono, P.
1990-03-01
The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less
Study of DNA binding sites using the Rényi parametric entropy measure.
Krishnamachari, A; moy Mandal, Vijnan; Karmeshu
2004-04-07
Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.
SITEHOUND-web: a server for ligand binding site identification in protein structures.
Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto
2009-07-01
SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.
Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.
Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei
2016-03-01
Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.
Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H
1994-01-01
Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896
Binding site and affinity prediction of general anesthetics to protein targets using docking.
Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G
2012-05-01
The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.
Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking
Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.
2012-01-01
Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968
Ravindranath, Pradeep Anand; Sanner, Michel F.
2016-01-01
Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702
Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1
Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.
2008-01-01
Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268
Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter
2006-04-15
We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.
Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C
1992-01-01
Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867
Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site
Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.
2015-01-01
Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702
Mechanism of human antibody-mediated neutralization of Marburg virus.
Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E
2015-02-26
The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.
Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans
2013-02-21
Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.
Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Souza, E.B.; Kuyatt, B.L.
1987-01-01
Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less
Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.
2002-01-01
The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.
Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin
NASA Astrophysics Data System (ADS)
Dyer, Brian
2014-03-01
Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.
The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen
2010-04-26
Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less
Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli
2016-12-21
Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.
Selection of the simplest RNA that binds isoleucine
LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL
2003-01-01
We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881
Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shima, K.; Kitayama, S.; Nakano, R.
Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less
Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA
NASA Astrophysics Data System (ADS)
Aalberts, Daniel P.; Garland, Jeffrey A.
2004-03-01
When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Reid, A.; Mahboubi, A.
1991-02-01
Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less
Brierley, I; Hoggett, J G
1992-07-01
The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.
Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.
1988-09-01
To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less
NASA Astrophysics Data System (ADS)
Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.
2010-01-01
The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.
Cooperative interplay of let-7 mimic and HuR with MYC RNA
Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A
2015-01-01
Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105
Two classes of binding sites for [3H]substance P in rat cerebral cortex.
Geraghty, D P; Burcher, E
1993-01-22
The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)
A web server for analysis, comparison and prediction of protein ligand binding sites.
Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S
2016-03-25
One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .
Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh
Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar
2011-01-01
Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736
Meng, Xiangzhi; Leman, Michael; Xiang, Yan
2007-01-01
Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683
Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi
2018-05-16
Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.
Subrahmanyam, S; Cronan, J E
1999-01-21
We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.
NASA Astrophysics Data System (ADS)
Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John
1986-07-01
The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.
Marsh, Lorraine
2015-01-01
Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.
Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.
Fehr, Marcus; Wolf, Antje; Stammler, Gerd
2016-03-01
Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.
NASA Astrophysics Data System (ADS)
Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai
1985-05-01
The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).
DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P
2003-07-08
Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.
Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A
1997-10-28
Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.
Jayasena, S D; Johnston, B H
1992-01-01
tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648
Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G
2010-04-01
Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.
Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050
Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.