Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

PubMed

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

Structural studies of the 5'-phenazinium-tethered matched and G-A-mismatched DNA duplexes by NMR spectroscopy.

PubMed

Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J

1993-05-01

The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry optimization using ab initio program (3-21G basis set). It has been shown that mismatched G-A bases are in the anti-anti conformation. The mismatched 7G-1A form stable base pairs through inter-strand hydrogen bonds (N7(A)...HN2(G) (1.92 A) with a subtended angle of 176 degrees and N3(G)...HN6(A) (2.01 A) with a subtended angle of 153 degrees (the 'amino-type' hydrogen bond)) and a propeller twist of 36 degrees for 7G-1A residues.(ABSTRACT TRUNCATED AT 400 WORDS)

Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

NASA Astrophysics Data System (ADS)

Mall, Vijaya Shri; Tiwari, Rakesh Kumar

2018-05-01

The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

Structure and conversion kinetics of a bi-stable DNA i-motif: broken symmetry in the [d(5mCCTCC)]4 tetramer.

PubMed

Nonin, S; Leroy, J L

1996-08-23

At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.

Improved Force Fields for Peptide Nucleic Acids with Optimized Backbone Torsion Parameters.

PubMed

Jasiński, Maciej; Feig, Michael; Trylska, Joanna

2018-06-06

Peptide nucleic acids are promising nucleic acid analogs for antisense therapies as they can form stable duplex and triplex structures with DNA and RNA. Computational studies of PNA-containing duplexes and triplexes are an important component for guiding their design, yet existing force fields have not been well validated and parametrized with modern computational capabilities. We present updated CHARMM and Amber force fields for PNA that greatly improve the stability of simulated PNA-containing duplexes and triplexes in comparison with experimental structures and allow such systems to be studied on microsecond time scales. The force field modifications focus on reparametrized PNA backbone torsion angles to match high-level quantum mechanics reference energies for a model compound. The microsecond simulations of PNA-PNA, PNA-DNA, PNA-RNA, and PNA-DNA-PNA complexes also allowed a comprehensive analysis of hydration and ion interactions with such systems.

On the Formation and Properties of Interstrand DNA-DNA Cross-links Forged by Reaction of an Abasic Site With the Opposing Guanine Residue of 5′-CAp Sequences in Duplex DNA

PubMed Central

Johnson, Kevin M.; Price, Nathan E.; Wang, Jin; Fekry, Mostafa I.; Dutta, Sanjay; Seiner, Derrick R.; Wang, Yinsheng; Gates, Kent S.

2014-01-01

We recently reported that the aldehyde residue of an abasic (Ap) site in duplex DNA can generate an interstrand cross-link via reaction with a guanine residue on the opposing strand. This finding is intriguing because the highly deleterious nature of interstrand cross-links suggests that even small amounts of Ap-derived cross-links could make a significant contribution to the biological consequences stemming from the generation of Ap sites in cellular DNA. Incubation of 21-bp duplexes containing a central 5′-CAp sequence under conditions of reductive amination (NaCNBH3, pH 5.2) generated much higher yields of cross-linked DNA than reported previously. At pH 7, in the absence of reducing agents, these Ap-containing duplexes also produced cross-linked duplexes that were readily detected on denaturing polyacrylamide gels. Cross-link formation was not highly sensitive to reaction conditions and, once formed, the cross-link was stable to a variety of work-up conditions. Results of multiple experiments including MALDI-TOF mass spectrometry, gel mobility, methoxyamine capping of the Ap aldehyde, inosine-for-guanine replacement, hydroxyl radical footprinting, and LCMS/MS were consistent with a cross-linking mechanism involving reversible reaction of the Ap aldehyde residue with the N2-amino group of the opposing guanine residue in 5′-CAp sequences to generate hemiaminal, imine, or cyclic hemiaminal cross-links (7-10) that were irreversibly converted under conditions of reductive amination (NaCNBH3/pH 5.2) to a stable amine linkage. Further support for the importance of the exocyclic N2-amino group in this reaction was provided by an experiment showing that installation of a 2-aminopurine-thymine base pair at the cross-linking site produced high yields (15-30%) of a cross-linked duplex at neutral pH, in the absence of NaCNBH3. PMID:23215239

Stable loop in the crystal structure of the intercalated four-stranded cytosine-rich metazoan telomere

NASA Technical Reports Server (NTRS)

Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.

1995-01-01

In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.

Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

PubMed

Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

2010-08-01

Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

Nucleic Acid Chaperone Activity of the ORF1 Protein from the Mouse LINE-1 Retrotransposon

PubMed Central

Martin, Sandra L.; Bushman, Frederic D.

2001-01-01

Non-LTR retrotransposons such as L1 elements are major components of the mammalian genome, but their mechanism of replication is incompletely understood. Like retroviruses and LTR-containing retrotransposons, non-LTR retrotransposons replicate by reverse transcription of an RNA intermediate. The details of cDNA priming and integration, however, differ between these two classes. In retroviruses, the nucleocapsid (NC) protein has been shown to assist reverse transcription by acting as a “nucleic acid chaperone,” promoting the formation of the most stable duplexes between nucleic acid molecules. A protein-coding region with an NC-like sequence is present in most non-LTR retrotransposons, but no such sequence is evident in mammalian L1 elements or other members of its class. Here we investigated the ORF1 protein from mouse L1 and found that it does in fact display nucleic acid chaperone activities in vitro. L1 ORF1p (i) promoted annealing of complementary DNA strands, (ii) facilitated strand exchange to form the most stable hybrids in competitive displacement assays, and (iii) facilitated melting of an imperfect duplex but stabilized perfect duplexes. These findings suggest a role for L1 ORF1p in mediating nucleic acid strand transfer steps during L1 reverse transcription. PMID:11134335

The Dewar photoproduct of thymidylyl(3′→5′)- thymidine (Dewar product) exhibits mutagenic behavior in accordance with the “A rule”

PubMed Central

Lee, Joon-Hwa; Bae, Sung-Hun; Choi, Byong-Seok

2000-01-01

In contrast to the highly mutagenic pyrimidine(6–4)pyrimidone photoproduct, its Dewar valence isomer (Dewar product) has low mutagenic potential and produces a broad range of mutations [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the mutagenic property of the Dewar product, we used experimental NMR restraints and molecular dynamics to determine the solution structure of a Dewar-lesion DNA decamer duplex. This DNA decamer duplex (DW/GA duplex) contains a mismatched base pair between the 3′ T residue of the Dewar lesion (T6) and an opposed G residue (G15). The 3′ T (T6) of the Dewar lesion formed stable hydrogen bonds with the opposing G15 residue. However, the helical bending and unwinding angles of the DW/GA duplex were much larger than those of a second duplex that contains the Dewar lesion and opposing A15 and A16 residues (DW/AA duplex). The DW/GA duplex showed poorer stacking interactions at the two bases of the Dewar product and at the adjacent A7⋅T14 base pair than did the DW/AA duplex. These structural features imply that no thermal stability or conformational benefit is obtained by incorporating a G instead of an A opposite the 3′ T of the Dewar lesion. These properties may thus facilitate the preferential incorporation of an A in accordance with the A rule during translesion replication and lead to the low frequency of 3′ T→C mutations observed at this site. PMID:10758155

Inclusion of methoxy groups inverts the thermodynamic stabilities of DNA-RNA hybrid duplexes: A molecular dynamics simulation study.

PubMed

Suresh, Gorle; Priyakumar, U Deva

2015-09-01

Modified nucleic acids have found profound applications in nucleic acid based technologies such as antisense and antiviral therapies. Previous studies on chemically modified nucleic acids have suggested that modifications incorporated in furanose sugar especially at 2'-position attribute special properties to nucleic acids when compared to other modifications. 2'-O-methyl modification to deoxyribose sugars of DNA-RNA hybrids is one such modification that increases nucleic acid stability and has become an attractive class of compounds for potential antisense applications. It has been reported that modification of DNA strands with 2'-O-methyl group reverses the thermodynamic stability of DNA-RNA hybrid duplexes. Molecular dynamics simulations have been performed on two hybrid duplexes (DR and RD) which differ from each other and 2'-O-methyl modified counterparts to investigate the effect of 2'-O-methyl modification on their duplex stability. The results obtained suggest that the modification drives the conformations of both the hybrid duplexes towards A-RNA like conformation. The modified hybrid duplexes exhibit significantly contrasting dynamics and hydration patterns compared to respective parent duplexes. In line with the experimental results, the relative binding free energies suggest that the introduced modifications stabilize the less stable DR hybrid, but destabilize the more stable RD duplex. Binding free energy calculations suggest that the increased hydrophobicity is primarily responsible for the reversal of thermodynamic stability of hybrid duplexes. Free energy component analysis further provides insights into the stability of modified duplexes. Copyright © 2015 Elsevier Inc. All rights reserved.

Molecular mechanism of DNA replication-coupled inactivation of the initiator protein in Escherichia coli: interaction of DnaA with the sliding clamp-loaded DNA and the sliding clamp-Hda complex.

PubMed

Su'etsugu, Masayuki; Takata, Makoto; Kubota, Toshio; Matsuda, Yusaku; Katayama, Tsutomu

2004-06-01

In Escherichia coli, the ATP-DnaA protein initiates chromosomal replication. After the DNA polymerase III holoenzyme is loaded on to DNA, DnaA-bound ATP is hydrolysed in a manner depending on Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp subunit, which yields ADP-DnaA, an inactivated form for initiation. This regulatory DnaA-inactivation represses extra initiation events. In this study, in vitro replication intermediates and structured DNA mimicking replicational intermediates were first used to identify structural prerequisites in the process of DnaA-ATP hydrolysis. Unlike duplex DNA loaded with sliding clamps, primer RNA-DNA heteroduplexes loaded with clamps were not associated with DnaA-ATP hydrolysis, and duplex DNA provided in trans did not rescue this defect. At least 40-bp duplex DNA is competent for the DnaA-ATP hydrolysis when a single clamp was loaded. The DnaA-ATP hydrolysis was inhibited when ATP-DnaA was tightly bound to a DnaA box-bearing oligonucleotide. These results imply that the DnaA-ATP hydrolysis involves the direct interaction of ATP-DnaA with duplex DNA flanking the sliding clamp. Furthermore, Hda protein formed a stable complex with the sliding clamp. Based on these, we suggest a mechanical basis in the DnaA-inactivation that ATP-DnaA interacts with the Hda-clamp complex with the aid of DNA binding. Copyright Blackwell Publishing Limited

The Role of Structural Enthalpy in Spherical Nucleic Acid Hybridization.

PubMed

Fong, Lam-Kiu; Wang, Ziwei; Schatz, George C; Luijten, Erik; Mirkin, Chad A

2018-05-23

DNA hybridization onto DNA-functionalized nanoparticle surfaces (e.g., in the form of a spherical nucleic acid (SNA)) is known to be enhanced relative to hybridization free in solution. Surprisingly, via isothermal titration calorimetry, we reveal that this enhancement is enthalpically, as opposed to entropically, dominated by ∼20 kcal/mol. Coarse-grained molecular dynamics simulations suggest that the observed enthalpic enhancement results from structurally confining the DNA on the nanoparticle surface and preventing it from adopting enthalpically unfavorable conformations like those observed in the solution case. The idea that structural confinement leads to the formation of energetically more stable duplexes is evaluated by decreasing the degree of confinement a duplex experiences on the nanoparticle surface. Both experiment and simulation confirm that when the surface-bound duplex is less confined, i.e., at lower DNA surface density or at greater distance from the nanoparticle surface, its enthalpy of formation approaches the less favorable enthalpy of duplex formation for the linear strand in solution. This work provides insight into one of the most important and enabling properties of SNAs and will inform the design of materials that rely on the thermodynamics of hybridization onto DNA-functionalized surfaces, including diagnostic probes and therapeutic agents.

G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

PubMed Central

Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

2015-01-01

The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

Probing of miniPEGγ-PNA-DNA Hybrid Duplex Stability with AFM Force Spectroscopy.

PubMed

Dutta, Samrat; Armitage, Bruce A; Lyubchenko, Yuri L

2016-03-15

Peptide nucleic acids (PNA) are synthetic polymers, the neutral peptide backbone of which provides elevated stability to PNA-PNA and PNA-DNA hybrid duplexes. It was demonstrated that incorporation of diethylene glycol (miniPEG) at the γ position of the peptide backbone increased the thermal stability of the hybrid duplexes (Sahu, B. et al. J. Org. Chem. 2011, 76, 5614-5627). Here, we applied atomic force microscopy (AFM) based single molecule force spectroscopy and dynamic force spectroscopy (DFS) to test the strength and stability of the hybrid 10 bp duplex. This hybrid duplex consisted of miniPEGγ-PNA and DNA of the same length (γ(MP)PNA-DNA), which we compared to a DNA duplex with a homologous sequence. AFM force spectroscopy data obtained at the same conditions showed that the γ(MP)PNA-DNA hybrid is more stable than the DNA counterpart, 65 ± 15 pN vs 47 ± 15 pN, respectively. The DFS measurements performed in a range of pulling speeds analyzed in the framework of the Bell-Evans approach yielded a dissociation constant, koff ≈ 0.030 ± 0.01 s⁻¹ for γ(MP)PNA-DNA hybrid duplex vs 0.375 ± 0.18 s⁻¹ for the DNA-DNA duplex suggesting that the hybrid duplex is much more stable. Correlating the high affinity of γ(MP)PNA-DNA to slow dissociation kinetics is consistent with prior bulk characterization by surface plasmon resonance. Given the growing interest in γ(MP)PNA as well as other synthetic DNA analogues, the use of single molecule experiments along with computational analysis of force spectroscopy data will provide direct characterization of various modifications as well as higher order structures such as triplexes and quadruplexes.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

NASA Astrophysics Data System (ADS)

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

PubMed Central

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308

Backbone conformation affects duplex initiation and duplex propagation in hybridisation of synthetic H-bonding oligomers.

PubMed

Iadevaia, Giulia; Núñez-Villanueva, Diego; Stross, Alexander E; Hunter, Christopher A

2018-06-06

Synthetic oligomers equipped with complementary H-bond donor and acceptor side chains form multiply H-bonded duplexes in organic solvents. Comparison of the duplex forming properties of four families of oligomers with different backbones shows that formation of an extended duplex with three or four inter-strand H-bonds is more challenging than formation of complexes that make only two H-bonds. The stabilities of 1 : 1 complexes formed between length complementary homo-oligomers equipped with either phosphine oxide or phenol recognition modules were measured in toluene. When the backbone is very flexible (pentane-1,5-diyl thioether), the stability increases uniformly by an order of magnitude for each additional base-pair added to the duplex: the effective molarities for formation of the first intramolecular H-bond (duplex initiation) and subsequent intramolecular H-bonds (duplex propagation) are similar. This flexible system is compared with three more rigid backbones that are isomeric combinations of an aromatic ring and methylene groups. One of the rigid systems behaves in exactly the same way as the flexible backbone, but the other two do not. For these systems, the effective molarity for formation of the first intramolecular H-bond is the same as that found for the other two backbones, but additional H-bonds are not formed between the longer oligomers. The effective molarities are too low for duplex propagation in these systems, because the oligomer backbones cannot adopt conformations compatible with formation of an extended duplex.

NMR structure of the DNA decamer duplex containing double T*G mismatches of cis-syn cyclobutane pyrimidine dimer: implications for DNA damage recognition by the XPC-hHR23B complex.

PubMed

Lee, Joon-Hwa; Park, Chin-Ju; Shin, Jae-Sun; Ikegami, Takahisa; Akutsu, Hideo; Choi, Byong-Seok

2004-01-01

The cis-syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC-hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC-hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC-hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC-hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3' T*G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T*G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T*G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6-4) adduct, which is efficiently recognized by the XPC-hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC-hHR23B complex to DNA.

Structural variations of single and tandem mismatches in RNA duplexes: a joint MD simulation and crystal structure database analysis.

PubMed

Halder, Sukanya; Bhattacharyya, Dhananjay

2012-10-04

Internal loops within RNA duplex regions are formed by single or tandem basepairing mismatches with flanking canonical Watson-Crick basepairs on both sides. They are the most common motif observed in RNA secondary structures and play integral functional and structural roles. In this report, we have studied the structural features of 1 × 1, 2 × 2, and 3 × 3 internal loops using all-atom molecular dynamics (MD) simulation technique with explicit solvent model. As MD simulation is intricately dependent on the choice of force-field and these are often rather approximate, we have used both the most popular force-fields for nucleic acids-CHARMM27 and AMBER94-for a comparative analysis. We find that tandem noncanonical basepairs forming 2 × 2 and 3 × 3 internal loops are considerably more stable than the single mismatches forming 1 × 1 internal loops, irrespective of the force field. We have also analyzed crystal structure database to study the conservation of these helical fragments in the corresponding sets of RNA structures. We observe that the nature of stability in MD simulations mimic their fluctuating natures in crystal data sets also, probably indicating reliable natures of both the force fields to reproduce experimental results. We also notice significant structural changes in the wobble G:U basepairs present in these double helical stretches, leading to a biphasic stability for these wobble pairs to release the deformational strains introduced by internal loops within duplex regions.

DNA triplex structure, thermodynamics, and destabilisation: insight from molecular simulations.

PubMed

Boehm, Belinda J; Whidborne, Charles; Button, Alexander L; Pukala, Tara L; Huang, David M

2018-05-23

Molecular dynamics simulations are used to elucidate the structure and thermodynamics of DNA triplexes associated with the neurodegenerative disease Friedreich's ataxia (FRDA), as well as complexes of these triplexes with the small molecule netropsin, which is known to destabilise triplexes. The ability of molecular simulations in explicit solvent to accurately capture triplex thermodynamics is verified for the first time, with the free energy to dissociate a 15-base antiparallel purine triplex-forming oligomer (TFO) from the duplex found to be slightly higher than reported experimentally. The presence of netropsin in the minor groove destabilises the triplex as expected, reducing the dissociation free energy by approximately 50%. Netropsin binding is associated with localised narrowing of the minor groove near netropsin, an effect that has previously been under contention. This leads to localised widening of the major groove, weakening hydrogen bonds between the TFO and duplex. Consequently, destabilisation is found to be highly localised, occurring only when netropsin is bound directly opposite the TFO. The simulations also suggest that near saturation of the minor groove with ligand is required for complete triplex dissociation. A structural analysis of the DNA triplexes that can form with the FRDA-related duplex sequence indicates that the triplex with a parallel homopyrimidine TFO is likely to be more stable than the antiparallel homopurine-TFO triplex, which may have implications for disease onset and treatment.

Impact deformation behavior of duplex and superaustenitic stainless steels welds by split Hopkinson pressure bar

NASA Astrophysics Data System (ADS)

Wang, Shing-Hoa; Huang, Chih-Sheng; Lee, Woei-Shyan; Chen, Tao-Hsing; Wu, Chia-Chang; Lien, Charles; Tsai, Hung-Yin

2009-12-01

A considerable volume of γ phase increases in the fusion zone (weld metal) for two duplex stainless steels after a high-strain-rate impact. The strain-induced γ phase formation in the fusion zone results in local hardness variation depending on the strain rate. The α phase content in the fusion zone decreases as the impact strain rate increases for SAF 2205 DSS and SAF 2507 DSS. The results of the two-phase content measured by Ferritoscope correspond to that assessed by image analyses. In contrast, superaustenite stainless steel is unaffected by such an impact owing to its fully stable austenization. Impacted welds at a high strain rate of 5 × 103 s-1 reveal feather-like surface creases along the solidified curved columnar grain boundaries. The apparent surface creases are formed due to the presence of diffuse Lüders bands, which are caused by heavy plastic deformation in coarse-grain materials.

3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

NASA Astrophysics Data System (ADS)

Konforti, Boyana B.; Davis, Ronald W.

1987-02-01

The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

The high stability of the triple helices formed between short purine oligonucleotides and SIV/HIV-2 vpx genes is determined by the targeted DNA structure.

PubMed Central

Svinarchuk, F; Monnot, M; Merle, A; Malvy, C; Fermandjian, S

1995-01-01

In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex. Images PMID:7479024

Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

PubMed Central

Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

2015-01-01

Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

Molecular basis for methoxyamine initiated mutagenesis. 1H nuclear magnetic resonance studies of base-modified oligodeoxynucleotides.

PubMed

Stone, M J; Nedderman, A N; Williams, D H; Lin, P K; Brown, D M

1991-12-05

In order to reach a more detailed understanding of the mechanism of the mutagenic action of methoxyamine and of N4-methoxycytidine and its 2'-deoxyribo-analogue, the solution structures of the self-complementary octanucleotide, d(CGAATTCG) and its analogues, d(CGAATCCG), d(CGAATMCG) and d(CGAATPCG) (designated 8mer-AT, 8mer-AC, 8mer-AM, and 8mer-AP, respectively), were investigated by 1H nuclear magnetic resonance spectroscopy; M is N4-methoxycytosine (mo4C) and P is an analogue, the bicyclic dihydropyrimido[4,5-c][1,2]oxazin-7-one, in which the N-O bond is held in the anti configuration with respect to N3 of the cytosine ring. Correlated spectroscopy and nuclear Overhauser spectroscopy allowed assignment of the base, anomeric and H2'/H2" protons in 8mers-AT, -AM and -AP, and showed that all three had features consistent with a regular B-DNA duplex structure. Duplex-to-coil transition temperatures were determined to be 52(+/- 2) degrees C (8mer-AT), 51(+/- 2) degrees C (8mer-AP), 32(+/- 2) degrees C (8mer-AM); on the chemical shift timescale, the melting transition was fast for 8mer-AT and 8mer-AP, but slow for 8mer-AM. Imino proton spectra were indicative of Watson-Crick base-pairing in 8mers-AT, -AP and -AM. The 8mer-AP duplex had a structure and melting characteristics virtually identical with those of the 8mer-AT duplex. The preferred syn configuration of the methoxyl group in M had a destabilising effect on the 8mer-AM duplex. At low temperatures, the A.M base-pair was in fast equilibrium between Watson-Crick and wobble configurations, with the methoxyl function anti-oriented, but the melting transition was accompanied by isomerization of the methoxyl group to the syn conformation. This syn-anti isomerization was the rate-determining step in the duplex-to-coil transition. The 8mer-AC oligomer did not form a stable duplex.

Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

PubMed

Moreira, Bernardo G; You, Yong; Owczarzy, Richard

2015-03-01

Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†

PubMed Central

Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.

2010-01-01

Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443

Small molecule-mediated duplex formation of nucleic acids with 'incompatible' backbones.

PubMed

Cafferty, Brian J; Musetti, Caterina; Kim, Keunsoo; Horowitz, Eric D; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

2016-04-07

Proflavine, a known intercalator of DNA and RNA, promotes duplex formation by nucleic acids with natural and non-natural backbones that otherwise form duplexes with low thermal stability, and even some that show no sign of duplex formation in the absence of proflavine. These findings demonstrate the potential for intercalators to be used as cofactors for the assembly of rationally designed nucleic acid structures, and could provide fundamental insights regarding intercalation of natural nucleic acid duplexes.

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

PubMed

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

H-Bond Self-Assembly: Folding versus Duplex Formation.

PubMed

Núñez-Villanueva, Diego; Iadevaia, Giulia; Stross, Alexander E; Jinks, Michael A; Swain, Jonathan A; Hunter, Christopher A

2017-05-17

Linear oligomers equipped with complementary H-bond donor (D) and acceptor (A) sites can interact via intermolecular H-bonds to form duplexes or fold via intramolecular H-bonds. These competing equilibria have been quantified using NMR titration and dilution experiments for seven systems featuring different recognition sites and backbones. For all seven architectures, duplex formation is observed for homo-sequence 2-mers (AA·DD) where there are no competing folding equilibria. The corresponding hetero-sequence AD 2-mers also form duplexes, but the observed self-association constants are strongly affected by folding equilibria in the monomeric states. When the backbone is flexible (five or more rotatable bonds separating the recognition sites), intramolecular H-bonding is favored, and the folded state is highly populated. For these systems, the stability of the AD·AD duplex is 1-2 orders of magnitude lower than that of the corresponding AA·DD duplex. However, for three architectures which have more rigid backbones (fewer than five rotatable bonds), intramolecular interactions are not observed, and folding does not compete with duplex formation. These systems are promising candidates for the development of longer, mixed-sequence synthetic information molecules that show sequence-selective duplex formation.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

Synthesis and antisense properties of fluoro cyclohexenyl nucleic acid (F-CeNA), a nuclease stable mimic of 2'-fluoro RNA.

PubMed

Seth, Punit P; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S; Allerson, Charles R; Østergaard, Michael E; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E

2012-06-01

We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F-CeNA gapmer ASO showed similar RNA affinity but significantly improved activity compared to that of a sequence matched MOE ASO, thus establishing F-CeNA as a useful modification for antisense applications.

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

PubMed

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

Four highly pseudosymmetric and/or twinned structures of d(CGCGCG) 2 extend the repertoire of crystal structures of Z-DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, Zhipu; Dauter, Zbigniew; Gilski, Miroslaw

DNA oligomer duplexes containing alternating cytosines and guanines in their sequences tend to form left-handed helices of the Z-DNA type, with the sugar and phosphate backbone in a zigzag conformation and a helical repeat of two successive nucleotides. Z-DNA duplexes usually crystallize as hexagonally arranged parallel helical tubes, with various relative orientations and translation of neighboring duplexes. Four novel high-resolution crystal structures of d(CGCGCG) 2duplexes are described here. They are characterized by a high degree of pseudosymmetry and/or twinning, with three or four independent duplexes differently oriented in a monoclinicP2 1lattice of hexagonal metric. The various twinning criteria give somewhatmore » conflicting indications in these complicated cases of crystal pathology. The details of molecular packing in these crystal structures are compared with other known crystal forms of Z-DNA.« less

Synthesis, structure and imaging of oligodeoxyribonucleotides with tellurium-nucleobase derivatization.

PubMed

Sheng, Jia; Hassan, Abdalla E A; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S; Huang, Zhen

2011-05-01

We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. © The Author(s) 2011. Published by Oxford University Press.

Synthesis, structure and imaging of oligodeoxyribonucleotides with tellurium-nucleobase derivatization

PubMed Central

Sheng, Jia; Hassan, Abdalla E. A.; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S.; Huang, Zhen

2011-01-01

We report here the first synthesis of 5-phenyl–telluride–thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. PMID:21245037

Synthesis Structure and Imaging of Oligodeoxyribonucleotides with Tellurium-nucleobase Derivatization

DOE Office of Scientific and Technical Information (OSTI.GOV)

J Sheng; A Hassan; W Zhang

2011-12-31

We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less

Synthesis, structure and imaging of oligodeoxyribonucleotides with tellurium-nucleobase derivatization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, J.; Soares, A.; Hassan, A. E. A.

2011-05-01

We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less

Insights into the structural features and stability of peptide nucleic acid with a D-prolyl-2-aminocyclopentane carboxylic acid backbone that binds to DNA and RNA.

PubMed

Poomsuk, Nattawee; Vilaivan, Tirayut; Siriwong, Khatcharin

2018-06-12

Peptide nucleic acid (PNA) is a powerful biomolecule with a wide variety of important applications. In this work, the molecular structures and binding affinity of PNA with a D-prolyl-2-aminocyclopentane carboxylic acid backbone (acpcPNA) that binds to both DNA and RNA were studied using molecular dynamics simulations. The simulated structures of acpcPNA-DNA and acpcPNA-RNA duplexes more closely resembled the typical structures of B-DNA and A-RNA than the corresponding duplexes of aegPNA. The calculated binding free energies are in good agreement with the experimental results that the acpcPNA-DNA duplex is more stable than the acpcPNA-RNA duplex regardless of the base sequences. The results provide further insights in the relationship between structure and stability of this unique PNA system. Copyright © 2018 Elsevier Inc. All rights reserved.

Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

DTIC Science & Technology

2007-10-01

reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

DTIC Science & Technology

2007-01-01

reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

Molecular dynamics correctly models the unusual major conformation of the GAGU RNA internal loop and with NMR reveals an unusual minor conformation.

PubMed

Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H

2018-05-01

The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Enhancing the corrosion resistance of the 2205 duplex stainless steel bipolar plates in PEMFCs environment by surface enriched molybdenum

NASA Astrophysics Data System (ADS)

Jinlong, Lv; Zhuqing, Wang; Tongxiang, Liang; Ken, Suzuki; Hideo, Miura

Surface molybdenum enrichment on 2205 duplex stainless steel was obtained by the ball milling technique. The electrochemical results showed molybdenum enrichment on the surface of 2205 duplex stainless steel improved its corrosion resistance in a typical proton exchange membrane fuel cell environment. This was mainly attributed to higher molybdenum content in the passive film formed on 2205 duplex stainless steel after ball milling. The decreased donor and acceptor concentrations improved significantly the corrosion resistance of surface molybdenum-enriched 2205 duplex stainless steel bipolar plates in the simulated cathodic proton exchange membrane fuel cells environment. In addition, the interfacial contact resistance of the 2205 duplex stainless steel bipolar plates slightly decreased due to surface molybdenum enrichment.

The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

NASA Astrophysics Data System (ADS)

Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

2018-02-01

DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

Multistory duplexes with forward dipping roofs, north central Brooks Range, Alaska

USGS Publications Warehouse

Wallace, W.K.; Moore, Thomas E.; Plafker, G.

1997-01-01

The Endicott Mountains allochthon has been thrust far northward over the North Slope parautochthon in the northern Brooks Range. Progressively younger units are exposed northward within the allochthon. To the south, the incompetent Hunt Fork Shale has thickened internally by asymmetric folds and thrust faults. Northward, the competent Kanayut Conglomerate forms a duplex between a floor thrust in Hunt Fork and a roof thrust in the Kayak Shale. To the north, the competent Lisburne Group forms a duplex between a floor thrust in Kayak and a roof thrust in the Siksikpuk Formation. Both duplexes formed from north vergent detachment folds whose steep limbs were later truncated by south dipping thrust faults that only locally breach immediately overlying roof thrusts. Within the parautochthon, the Kayak, Lisburne, and Siksikpuk-equivalent Echooka Formation form a duplex identical to that in the allochthon. This duplex is succeeded abruptly northward by detachment folds in Lisburne. These folds are parasitic to an anticlinorium interpreted to reflect a fault-bend folded horse in North Slope "basement," with a roof thrust in Kayak and a floor thrust at depth. These structures constitute two northward tapered, internally deformed wedges that are juxtaposed at the base of the allochthon. Within each wedge, competent units have been shortened independently between detachments, located mainly in incompetent units. The basal detachment of each wedge cuts upsection forward (northward) to define a wedge geometry within which units dip regionally forward. These dips reflect forward decrease in internal structural thickening by forward vergent folds and hindward dipping thrust faults. Copyright 1997 by the American Geophysical Union.

Duplex development and abandonment during evolution of the Lewis thrust system, southern Glacier National Park, Montana

NASA Astrophysics Data System (ADS)

Yin, An; Kelty, Thomas K.; Davis, Gregory A.

1989-09-01

Geologic mapping in southern Glacier National Park, Montana, reveals the presence of two duplexes sharing the same floor thrust fault, the Lewis thrust. The westernmost duplex (Brave Dog Mountain) includes the low-angle Brave Dog roof fault and Elk Mountain imbricate system, and the easternmost (Rising Wolf Mountain) duplex includes the low-angle Rockwell roof fault and Mt. Henry imbricate system. The geometry of these duplexes suggests that they differ from previously described geometric-kinematic models for duplex development. Their low-angle roof faults were preexisting structures that were locally utilized as roof faults during the formation of the imbricate systems. Crosscutting of the Brave Dog fault by the Mt. Henry imbricate system indicates that the two duplexes formed at different times. The younger Rockwell-Mt. Henry duplex developed 20 km east of the older Brave Dog-Elk Mountain duplex; the roof fault of the former is at a higher structural level. Field relations confirm that the low-angle Rockwell fault existed across the southern Glacier Park area prior to localized formation of the Mt. Henry imbricate thrusts beneath it. These thrusts kinematically link the Rockwell and Lewis faults and may be analogous to P shears that form between two synchronously active faults bounding a simple shear system. The abandonment of one duplex and its replacement by another with a new and higher roof fault may have been caused by (1) warping of the older and lower Brave Dog roof fault during the formation of the imbricate system (Elk Mountain) beneath it, (2) an upward shifting of the highest level of a simple shear system in the Lewis plate to a new decollement level in subhorizontal belt strata (= the Rockwell fault) that lay above inclined strata within the first duplex, and (3) a reinitiation of P-shear development (= Mt. Henry imbricate faults) between the Lewis thrust and the subparallel, synkinematic Rockwell fault.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less

Response of duplex Cr(N)/S and Cr(C)/S coatings on 316L stainless steel to tribocorrosion in 0.89% NaCl solution under plastic contact conditions.

PubMed

Sun, Y; Dearnley, P A; Mallia, Bertram

2017-08-01

Two duplex coatings, Cr(N)/S and Cr(C)/S, were deposited on 316 L stainless steel by magnetron sputtering. The effectiveness of these duplex coatings in improving the tribocorrosion behavior of medical alloys under elastic contact conditions has been demonstrated in a recent publication. The present work focused on the response of these duplex coatings to tribocorrosion under plastic contact conditions. Tribocorrosion tests were conducted in 0.89% NaCl solution at 37°C at an initial contact pressure of 740 MPa and under unidirectional sliding conditions for sliding duration up to 24 h. The results showed that during sliding in the corrosive solution, the duplex coatings were plastically deformed into the substrate to a depth about 1 μm. The Cr(C)/S duplex coating had sufficient ductility to accommodate the deformation without cracking, such that it was worn through gradually, leading to the gradual increase in open circuit potential (OCP) and coefficient of friction (COF). On the other hand, the Cr(N)/S duplex coating suffered from cracking at all tested potentials, leading to coating blistering after prolonged sliding at OCP and stable pit formation in the substrate beneath the coating at applied anodic potentials. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1503-1513, 2017. © 2016 Wiley Periodicals, Inc.

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription.

PubMed

Kogoma, T

1997-06-01

Chromosome replication in Escherichia coli is normally initiated at oriC, the origin of chromosome replication. E. coli cells possess at least three additional initiation systems for chromosome replication that are normally repressed but can be activated under certain specific conditions. These are termed the stable DNA replication systems. Inducible stable DNA replication (iSDR), which is activated by SOS induction, is proposed to be initiated from a D-loop, an early intermediate in homologous recombination. Thus, iSDR is a form of recombination-dependent DNA replication (RDR). Analysis of iSDR and RDR has led to the proposal that homologous recombination and double-strand break repair involve extensive semiconservative DNA replication. RDR is proposed to play crucial roles in homologous recombination, double-strand break repair, restoration of collapsed replication forks, and adaptive mutation. Constitutive stable DNA replication (cSDR) is activated in mhA mutants deficient in RNase HI or in recG mutants deficient in RecG helicase. cSDR is proposed to be initiated from an R-loop that can be formed by the invasion of duplex DNA by an RNA transcript, which most probably is catalyzed by RecA protein. The third form of SDR is nSDR, which can be transiently activated in wild-type cells when rapidly growing cells enter the stationary phase. This article describes the characteristics of these alternative DNA replication forms and reviews evidence that has led to the formulation of the proposed models for SDR initiation mechanisms. The possible interplay between DNA replication, homologous recombination, DNA repair, and transcription is explored.

DNA octaplex formation with an I-motif of water-mediated A-quartets: reinterpretation of the crystal structure of d(GCGAAAGC).

PubMed

Sato, Yoshiteru; Mitomi, Kenta; Sunami, Tomoko; Kondo, Jiro; Takénaka, Akio

2006-12-01

The crystal structure of the tetragonal form of d(gcGAAAgc) has been revised and reasonably refined including the disordered residues. The two DNA strands form a base-intercalated duplex, and the four duplexes are assembled according to the crystallographic 222 symmetry to form an octaplex. In the central region, the eight strands are associated by I-motif of double A-quartets. Furthermore, eight hydrated-magnesium cations link the four duplexes to support the octaplex formation. Based on these structural features, a proposal that folding of d(GAAA)n, found in the non-coding region of genomes, into an octaplex can induce slippage during replication to facilitate length polymorphism is presented.

Thermodynamic and hydration effects for the incorporation of a cationic 3-aminopropyl chain into DNA

PubMed Central

Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.

2002-01-01

The introduction of cationic 5-(ω-aminoalkyl)-2′-deoxypyrimidines into duplex DNA has been shown to induce DNA bending. In order to understand the energetic and hydration contributions for the incorporation of a cationic side chain in DNA a combination of spectroscopy, calorimetry and density techniques were used. Specifically, the temperature unfolding and isothermal formation was studied for a pair of duplexes with sequence d(CGTAGUCG TGC)/d(GCACGACTACG), where U represents 2′-deoxyuridine (‘control’) or 5-(3-aminopropyl)-2′-deoxyuridine (‘modified’). Continuous variation experiments confirmed 1:1 stoichiometries for each duplex and the circular dichroism spectra show that both duplexes adopted the B conformation. UV and differential scanning calorimetry melting experiments reveal that each duplex unfolds in two-state transitions. In low salt buffer, the ‘modified’ duplex is more stable and unfolds with a lower endothermic heat and lower release of counterion and water. This electrostatic stabilization is entropy driven and disappears at higher salt concentrations. Complete thermodynamic profiles at 15°C show that the favorable formation of each duplex results from the compensation of a favorable exothermic heat with an unfavorable entropy contribution. However, the isothermal profiles yielded a differential enthalpy of 8.8 kcal/mol, which is 4.3 kcal/mol higher than the differential enthalpy observed in the unfolding profiles. This indicates that the presence of the aminopropyl chain induces an increase in base stacking interactions in the modified single strand and a decrease in base stacking interactions in the modified duplex. Furthermore, the formation of the ‘control’ duplex releases water while the ‘modified’ duplex takes up water. Relative to the control duplex, formation of the modified duplex at 15°C yielded a marginal differential ΔG° term, positive ΔΔHITC–Δ(TΔS) compensation, negative ΔΔV and a net release of counterions. The opposite signs of the differential enthalpy–entropy compensation and differential volume change terms show a net uptake of structural water around polar and non-polar groups. This indicates that incorporation of the aminopropyl chain induces a higher exposure of aromatic bases to the solvent, which may be consistent with a small and local bend in the ‘modified’ duplex. PMID:12136099

Recognition of O6-benzyl-2′-deoxyguanosine by a perimidinone-derived synthetic nucleoside: a DNA interstrand stacking interaction

PubMed Central

Kowal, Ewa A.; Lad, Rahul R.; Pallan, Pradeep S.; Dhummakupt, Elizabeth; Wawrzak, Zdzislaw; Egli, Martin; Sturla, Shana J.; Stone, Michael P.

2013-01-01

The 2′-deoxynucleoside containing the synthetic base 1-[(2R,4S,5R)-4-hydroxy-5-(hydroxymethyl)-tetrahydrofuran-2-yl)-1H-perimidin-2(3H)-one] (dPer) recognizes in DNA the O6-benzyl-2′-deoxyguanosine nucleoside (O6-Bn-dG), formed by exposure to N-benzylmethylnitrosamine. Herein, we show how dPer distinguishes between O6-Bn-dG and dG in DNA. The structure of the modified Dickerson–Drew dodecamer (DDD) in which guanine at position G4 has been replaced by O6-Bn-dG and cytosine C9 has been replaced with dPer to form the modified O6-Bn-dG:dPer (DDD-XY) duplex [5′-d(C1G2C3X4A5A6T7T8Y9G10C11G12)-3′]2 (X = O6-Bn-dG, Y = dPer) reveals that dPer intercalates into the duplex and adopts the syn conformation about the glycosyl bond. This provides a binding pocket that allows the benzyl group of O6-Bn-dG to intercalate between Per and thymine of the 3′-neighbor A:T base pair. Nuclear magnetic resonance data suggest that a similar intercalative recognition mechanism applies in this sequence in solution. However, in solution, the benzyl ring of O6-Bn-dG undergoes rotation on the nuclear magnetic resonance time scale. In contrast, the structure of the modified DDD in which cytosine at position C9 is replaced with dPer to form the dG:dPer (DDD-GY) [5′-d(C1G2C3G4A5A6T7T8Y9G10C11G12)-3′]2 duplex (Y = dPer) reveals that dPer adopts the anti conformation about the glycosyl bond and forms a less stable wobble pairing interaction with guanine. PMID:23748954

Methods And Devices For Characterizing Duplex Nucleic Acid Molecules

DOEpatents

Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen

2005-08-30

Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

Intramolecular electrocatalysis of 8-oxo-guanine oxidation: secondary structure control of electron transfer in osmium-labeled oligonucleotides.

PubMed

Holmberg, Rebecca C; Tierney, Mark T; Ropp, Patricia A; Berg, Eric E; Grinstaff, Mark W; Thorp, H Holden

2003-10-06

A phosphoramidite containing Os(bpy)(3)(2+) (Os; bpy, 2,2'-bipyridine) with a three-carbon linker was synthesized and used to prepare oligonucleotides with the Os redox catalyst appended to the 5'-end. The electrogenerated Os(III) is capable of oxidizing 7,8-dihydro-8-oxo-guanine (8G), but 8G is not electrochemically reactive at indium tin oxide electrodes because of poor electrode kinetics for the direct reaction. The hairpin-forming oligonucleotide Os-5'-ATG TCA GAT TAG CAG GCC TGA CAT 8G was synthesized and characterized by thermal denaturation and native gel electrophoresis both in the hairpin form and when hybridized to its Watson-Crick complement. The redox potential in both forms of the appended Os(III/II) couple was 0.63 V (all potentials vs Ag/AgCl), which is identical to that for the free complex. The diffusion coefficients of the hairpin form (10.2 x 10(-)(7) cm(2)/s) and the duplex form (8.7 x 10(-)(7) cm(2)/s) were consistent with values expected from studies of noncovalently bound redox labels, which suggest that the measured diffusion coefficient should be that of the appended DNA molecule. The oligonucleotide was designed such that in the duplex form, the 8G is far from the Os(III/II) couple, but in the hairpin form, the 8G is situated close to the redox center. For the duplex form, cyclic voltammetry studies showed that mediated oxidation of the 8G nucleobase occurred only through bimolecular reaction of the electrogenerated Os(III) of one duplex with the 8G of another duplex. However, in the hairpin form, intramolecular electron transfer from 8G to Os(III) in the same molecule was apparent in both chronoamperometry and cyclic voltammetry.

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

PubMed Central

Pilch, D S; Brousseau, R; Shafer, R H

1990-01-01

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2006-01-01

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

Construction of an infectious genomic clone of porcine parvovirus: effect of the 5'-end on DNA replication.

PubMed

Casal, J I; Diaz-Aroca, E; Ranz, A I; Manclus, J J

1990-08-01

The linear single-stranded DNA genome of the porcine parvovirus, an autonomous parvovirus, was cloned in duplex form into the bacterial plasmid pUC18 using a simple and reliable method. These clones were stable during propagation in Escherichia coli JM109. The recombinant clones of porcine parvovirus were infectious when transfected into monolayers of swine testes cells as identified by the development of cytopathic effect, indirect immunofluorescence with specific antiserum, and hemagglutination assays. DNA isolated from progeny virus arising from transfected infectious clones was found to be indistinguishable from wild-type DNA by restriction enzyme analysis. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. The presence of the turn of the 5'-end loop seems to be necessary to get stable infectious clones.

G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

PubMed Central

Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

2016-01-01

Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

Synthesis of native-like crosslinked duplex RNA and study of its properties.

PubMed

Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

2017-04-01

A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA. Copyright © 2017. Published by Elsevier Ltd.

Grain Boundary Engineering and Air Oxidation Behavior of Alloy 690

NASA Astrophysics Data System (ADS)

Xu, Peng; Zhao, Liang Y.; Sridharan, Kumar; Allen, Todd R.

Grain boundary engineering (GBE) was performed on nickel-based alloy 690 by thermomechanical processing (TMP) to alter the grain boundary character distribution (GBCD). It was found that 5% and 35% thickness reduction in single and multiple steps followed by solution annealing and water quench yielded a high fraction of special boundaries. The total length fraction of the low ∑ CSL (coincidence site lattice) was as high as 87.2%. The grain boundary network was disrupted after the TMP treatment, and the average grain size calculated after exclusion of special twin boundaries can be as much as 5 times larger than the as-received (AR) sample. The GBE sample showed better oxidation resistance compared to the AR sample during the long term air oxidation. In the cyclic oxidation test, both AR and GBE samples showed a mass gain at the beginning of the test which was then followed by a mass loss. The mass change of GBE samples oscillated after the first couple cycles, while the AR sample became relatively stable. The oxide film most likely consists of duplex structures with one stable layer that was formed inside and one unstable layer that was formed outside. The stable inner layer was the protective layer and prevented alloy 690 from further oxidation.

Thermal stability of DNA quadruplex-duplex hybrids.

PubMed

Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

2014-01-14

DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

Contributions of 3'-overhang to the dissociation of small interfering RNAs from the PAZ domain: molecular dynamics simulation study.

PubMed

Lee, Hui Sun; Lee, Soo Nam; Joo, Chul Hyun; Lee, Heuiran; Lee, Han Saem; Yoon, Seung Yong; Kim, Yoo Kyum; Choe, Han

2007-03-01

RNA interference (RNAi) is a 'knock-down' reaction to reduce expression of a specific gene through highly regulated, enzyme-mediated processes. Small interfering RNAs (siRNAs) are RNA molecules that play an effector role in RNAi and can bind the PAZ domains present in Dicer and RISC. We investigated the interaction between the PAZ domain and the siRNA-like duplexes through dissociation molecular dynamics (DMD) simulations. Specifically, we focused on the response of the PAZ domain to various 3'-overhang structures of the siRNA-like duplexes. We found that the siRNA-like duplex with the 3' UU-overhang made relatively more stable complex with the PAZ domain compared to those with 3' CC-, AA-, and GG-overhangs. The siRNA-like duplex with UU-overhang was easily dissociated from the PAZ domain once the structural stability of the complex is impaired. Interestingly, the 3' UU-overhang spent the least time at the periphery region of the binding pocket during the dissociation process, which can be mainly attributable to UU-overhang's smallest number of hydrogen bonds.

Fabrication and life testing of thermionic converters

NASA Technical Reports Server (NTRS)

Yang, L.; Bruce, R.

1973-01-01

An unfueled converter containing a chloride-fluoride duplex tungsten emitter of 4.78 eV vacuum work function was tested for 46,647 hours at an emitter temperature of 1973 K and an electrode power output of about 8 watts/sq cm. The test demonstrated the superior and stable performance of the (110) oriented tungsten emitter at high temperatures. Three 90 UC-10 ZrC(C/U = 1.04, tungsten additive = 4 wt %) fueled converters were fabricated and tested at an emitter temperature of 1873 K. Converter containing chloride-arc-cast duplex tungsten cladding showed temperature thermionic performance and slower rate of performance drop than converter containing chloride-fluoride duplex tungsten cladding. This is believed to be due to the superior fuel component diffusion resistance of the arc-cast tungsten substrate used in the fuel cladding. It was shown that a converter containing a carbide fueled chloride-arc-cast duplex tungsten emitter with an initial electrode power output of 6.80 watts/sq cm could still deliver an electrode power output of 6.16 watts/sq cm after 18,632 hours of operation at an emitter temperature of 1873 K.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

An intercalation-locked parallel-stranded DNA tetraplex

DOE PAGES

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

2015-01-27

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

PubMed

Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

2017-02-20

The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

The minute virus of mice (MVM) nonstructural protein NS1 induces nicking of MVM DNA at a unique site of the right-end telomere in both hairpin and duplex conformations in vitro.

PubMed

Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J

1997-10-01

The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).

Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

PubMed

Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

2016-04-19

2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

Stability of miRNA 5′terminal and seed regions is correlated with experimentally observed miRNA-mediated silencing efficacy

PubMed Central

Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko

2012-01-01

MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

Base opening in RNA and DNA duplexes: implication for RNA stability.

PubMed

Chen, Y Z; Mohan, V; Griffey, R H

2000-05-01

The energetics of a low-energy single base opening in several RNA duplex crystal structures has been calculated and compared to DNA duplexes. Base opening in RNA appears to have an overall preference towards the major groove, similar to results previously reported for B-DNA. Movement of each of the adenine, uracil, and cytosine bases into the minor groove is blocked by a high-energy barrier due to severe close contact with neighboring bases. Guanine bases are able to open towards both grooves because of the unique orientation of the base that avoids steric clash along the opening pathway. RNA bases are found to have a substantially smaller major groove opening extent than that of their B-DNA counterparts. A comparison with base opening behavior of A-DNA duplexes suggests that this difference results from helix constraint associated with A-form backbone conformation. The reduced opening extent correlates with the RNA duplex stability and is consistent with observed slower imino proton exchange rates in RNA duplexes.

Normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1997-06-10

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

A Selective Surface-Enhanced Raman Scattering Sensor for Mercury(II) Based on a Porous Polymer Material and the Target-Mediated Displacement of a T-Rich Strand

NASA Astrophysics Data System (ADS)

Kang, Y.; Zhang, L.; Zhang, H.; Wu, T.; Du, Y.

2017-05-01

A sensitive and selective surface-enhanced Raman scattering (SERS) sensor for mercury(II) was fabricated based on the target-mediated displacement of a T-rich oligonucleotide strand. A DNA/aptamer duplex was prepared by the hybridization between a tetramethylrhodamine(TMR)-labeled thymine(T)-rich Hg2+-specific aptamer (denoted as TMR-aptamer) and a thiolated adenine-rich capturing DNA. The duplex can be immobilized onto the SERS substrate of the Ag-moiety modified glycidyl methacrylate-ethylene dimethacrylate (denoted as Ag-GMA-EDMA) via self-assembly by the thiol anchor, in which the TMR-aptamer exists in a double-stranded chain. In this case, the label of the TMR moiety approaches the substrate surface and produces a strong SERS signal. Upon the addition of the target, a pair of TMR-aptamers could cooperatively coordinate with Hg2+ to form a stable duplex-like structure mediated by the T-Hg2+-T complex between two adjacent strands, which triggers the release of the TMR-aptamer from the SERS substrate surface, thus drawing the TMR tags away from the substrate with a significant decrease in the SERS signal. This optical sensor shows a sensitive response to Hg2+ in a concentration from 5 nM to 2.0 μM with a detection limit of 2.5 nM. The prepared sensor is negligibly responsive to other metal ions, can be easily regenerated, and shows good performance in real sample analysis.

Quantum dot-DNA aptamer conjugates coupled with capillary electrophoresis: A universal strategy for ratiometric detection of organophosphorus pesticides.

PubMed

Tang, Tingting; Deng, Jingjing; Zhang, Min; Shi, Guoyue; Zhou, Tianshu

2016-01-01

Based on the highly sensitivity and stable-fluorescence of water-soluble CdTe/CdS core-shell quantum dots (QDs) with broad-specificity DNA aptamers, a novel ratiometric detection strategy was proposed for the sensitive detection of organophosphorus pesticides by capillary electrophoresis with laser-induced fluorescence (CE-LIF). The as-prepared QDs were first conjugated with the amino-modified oligonucleotide (AMO) by amidation reaction, which is partial complementary to the DNA aptamer of organophosphorus pesticides. Then QD-labeled AMO (QD-AMO) was incubated with the DNA aptamer to form QD-AMO-aptamer duplex. When the target organophosphorus pesticides were added, they could specifically bind the DNA aptamer, leading to the cleavage of QD-AMO-aptamer duplex, accompany with the release of QD-AMO. As a result, the ratio of peak height between QD-AMO and QD-AMO-aptamer duplex changed in the detection process of CE-LIF. This strategy was subsequently applied for the detection of phorate, profenofos, isocarbophos, and omethoate with the detection limits of 0.20, 0.10, 0.17, and 0.23μM, respectively. This is the first report about using QDs as the signal indicators for organophosphorus pesticides detection based on broad-specificity DNA aptamers by CE-LIF, thus contributing to extend the scope of application of QDs in different fields. The proposed method has great potential to be a universal strategy for rapid detection of aptamer-specific small molecule targets by simply changing the types of aptamer sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

Ligand-Induced Stabilization of a Duplex-like Architecture Is Crucial for the Switching Mechanism of the SAM-III Riboswitch.

PubMed

Suresh, Gorle; Srinivasan, Harini; Nanda, Shivani; Priyakumar, U Deva

2016-06-21

Riboswitches are structured RNA motifs that control gene expression by sensing the concentrations of specific metabolites and make up a promising new class of antibiotic targets. S-Adenosylmethionine (SAM)-III riboswitch, mainly found in lactic acid bacteria, is involved in regulating methionine and SAM biosynthetic pathways. SAM-III riboswitch regulates the gene expression by switching the translation process on and off with respect to the absence and presence of the SAM ligand, respectively. In this study, an attempt is made to understand the key conformational transitions involved in ligand binding using atomistic molecular dynamics (MD) simulations performed in an explicit solvent environment. G26 is found to recognize the SAM ligand by forming hydrogen bonds, whereas the absence of the ligand leads to opening of the binding pocket. Consistent with experimental results, the absence of the SAM ligand weakens the base pairing interactions between the nucleobases that are part of the Shine-Dalgarno (SD) and anti-Shine-Dalgarno (aSD) sequences, which in turn facilitates recognition of the SD sequence by ribosomes. Detailed analysis reveals that a duplex-like structure formed by nucleotides from different parts of the RNA and the adenine base of the ligand is crucial for the stability of the completely folded state in the presence of the ligand. Previous experimental studies have shown that the SAM-III riboswitch exists in equilibrium between the unfolded and partially folded states in the absence of the ligand, which completely folds upon binding of the ligand. Comparison of the results presented here to the available experimental data indicates the structures obtained using the MD simulations resemble the partially folded state. Thus, this study provides a detailed understanding of the fully and partially folded structures of the SAM-III riboswitch in the presence and absence of the ligand, respectively. This study hypothesizes a dual role for the SAM ligand, which facilitates conformational switching between partially and fully folded states by forming a stable duplex-like structure and strengthening the interactions between SD and aSD nucleotides.

Effect of the 3-halo substitution of the 2'-deoxy aminopyridinyl-pseudocytidine derivatives on the selectivity and stability of antiparallel triplex DNA with a CG inversion site.

PubMed

Wang, Lei; Taniguchi, Yosuke; Okamura, Hidenori; Sasaki, Shigeki

2017-07-15

Triplex formation against a target duplex DNA has the potential to become a tool for the genome research. However, there is an intrinsic restriction on the duplex DNA sequences capable of forming the triplex DNA. Recently, we demonstrated the selective formation of the stable antiparallel triplexes containing the CG inversion sites using the 2'-deoxy-1-methylpseudocytidine derivative (ΨdC), whose amino group was conjugated with the 2-aminopyridine at its 5-position as an additional hydrogen bonding unit (AP-ΨdC). The 1-N of 2-aminopyridine was supposed to be protonated to form the hydrogen bond with the guanine of the CG inversion site. In this study, to test the effect of the 3-substitution of the 2-aminopyridine unit of AP-ΨdC on the triplex stability, we synthesized the 3-halogenated 2-aminopyridine derivatives of AP-ΨdC. The pKa values 1-N of the 2-aminopyridine unit of AP-ΨdC as the monomer nucleoside were determined to be 6.3 for 3-CH 3 ( Me AP-ΨdC), 6.1 for 3-H (AP-ΨdC), 4.3 for 3-Cl ( Cl AP-ΨdC), 4.4 for 3-Br ( Br AP-ΨdC), and 4.7 for 3-I ( I AP-ΨdC), suggesting that all the halogenated AP-ΨdCs are not protonated under neutral conditions. Interestingly, although the recognition selectivity depends on the sequence context, the TFO having the sequence of the 3'-G-( I AP-ΨdC)-A-5' context showed the selective triplex formation with the CG inversion site. These results suggest that the protonation at the 1-N position plays an important role in the stable and selective triplex formation of AP-ΨdC derivatives in any sequences. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural model of the p14/SF3b155 · branch duplex complex.

PubMed

Schellenberg, Matthew J; Dul, Erin L; MacMillan, Andrew M

2011-01-01

Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14 · bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein-RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14 · duplex interaction must be disrupted before the first step of splicing.

Structural model of the p14/SF3b155·branch duplex complex

PubMed Central

Schellenberg, Matthew J.; Dul, Erin L.; MacMillan, Andrew M.

2011-01-01

Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14•bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein–RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14•duplex interaction must be disrupted before the first step of splicing. PMID:21062891

Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

PubMed Central

Pasternak, Anna; Wengel, Jesper

2010-01-01

Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222

Maximizing synchronizability of duplex networks

NASA Astrophysics Data System (ADS)

Wei, Xiang; Emenheiser, Jeffrey; Wu, Xiaoqun; Lu, Jun-an; D'Souza, Raissa M.

2018-01-01

We study the synchronizability of duplex networks formed by two randomly generated network layers with different patterns of interlayer node connections. According to the master stability function, we use the smallest nonzero eigenvalue and the eigenratio between the largest and the second smallest eigenvalues of supra-Laplacian matrices to characterize synchronizability on various duplexes. We find that the interlayer linking weight and linking fraction have a profound impact on synchronizability of duplex networks. The increasingly large inter-layer coupling weight is found to cause either decreasing or constant synchronizability for different classes of network dynamics. In addition, negative node degree correlation across interlayer links outperforms positive degree correlation when most interlayer links are present. The reverse is true when a few interlayer links are present. The numerical results and understanding based on these representative duplex networks are illustrative and instructive for building insights into maximizing synchronizability of more realistic multiplex networks.

Water-evaporation reduction by duplex films: application to the human tear film.

PubMed

Cerretani, Colin F; Ho, Nghia H; Radke, C J

2013-09-01

Water-evaporation reduction by duplex-oil films is especially important to understand the physiology of the human tear film. Secreted lipids, called meibum, form a duplex film that coats the aqueous tear film and purportedly reduces tear evaporation. Lipid-layer deficiency is correlated with the occurrence of dry-eye disease; however, in-vitro experiments fail to show water-evaporation reduction by tear-lipid duplex films. We review the available literature on water-evaporation reduction by duplex-oil films and outline the theoretical underpinnings of spreading and evaporation kinetics that govern behavior of these systems. A dissolution-diffusion model unifies the data reported in the literature and identifies dewetting of duplex films into lenses as a key challenge to obtaining significant evaporation reduction. We develop an improved apparatus for measuring evaporation reduction by duplex-oil films including simultaneous assessment of film coverage, stability, and temperature, all under controlled external mass transfer. New data reported in this study fit into the larger body of work conducted on water-evaporation reduction by duplex-oil films. Duplex-oil films of oxidized mineral oil/mucin (MOx/BSM), human meibum (HM), and bovine meibum (BM) reduce water evaporation by a dissolution-diffusion mechanism, as confirmed by agreement between measurement and theory. The water permeability of oxidized-mineral-oil duplex films agrees with those reported in the literature, after correction for the presence of mucin. We find that duplex-oil films of bovine and human meibum at physiologic temperature reduce water evaporation only 6-8% for a 100-nm film thickness pertinent to the human tear film. Comparison to in-vivo human tear-evaporation measurements is inconclusive because evaporation from a clean-water surface is not measured and because the mass-transfer resistance is not characterized. Copyright © 2013 Elsevier B.V. All rights reserved.

Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

PubMed

Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

2011-07-21

Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

M-DNA is stabilised in G•C tracts or by incorporation of 5-fluorouracil

PubMed Central

Wood, David O.; Dinsmore, Michael J.; Bare, Grant A.; Lee, Jeremy S.

2002-01-01

M-DNA is a complex between the divalent metal ions Zn2+, Ni2+ and Co2+ and duplex DNA which forms at a pH of ∼8.5. The stability and formation of M-DNA was monitored with an ethidium fluorescence assay in order to assess the relationship between pH, metal ion concentration, DNA concentration and the base composition. The dismutation of calf thymus DNA exhibits hysteresis with the formation of M-DNA occurring at a higher pH than the reconversion of M-DNA back to B-DNA. Hysteresis is most prominent with the Ni form of M-DNA where complete reconversion to B-DNA takes several hours even in the presence of EDTA. Increasing the DNA concentration leads to an increase in the metal ion concentration required for M-DNA formation. Both poly(dG)•poly(dC) and poly(dA)•poly(dT) formed M-DNA more readily than the corresponding mixed sequence DNAs. For poly(dG)•(poly(dC) M-DNA formation was observed at pH 7.4 with 0.5 mM ZnCl2. Modified bases were incorporated into a 500 bp fragment of phage λ DNA by polymerase chain reaction. DNAs in which guanine was replaced with hypoxanthine or thymine with 5-fluorouracil formed M-DNA at pHs below 8 whereas substitutions such as 2-aminoadenine and 5-methylcytosine had little effect. Poly[d(A5FU)] also formed a very stable M-DNA duplex as judged from Tm measurements. It is evident that the lower the pKa of the imino proton of the base, the lower the pH at which M-DNA will form; a finding that is consistent with the replacement of the imino proton with the metal ion. PMID:12000844

Food grade duplex emulsions designed and stabilised with different osmotic pressures.

PubMed

Pawlik, Aleksandra; Cox, Philip W; Norton, Ian T

2010-12-01

In this study we have investigated the production of food grade W(1)/O/W(2) duplex emulsions with salt partitioned into one water phase but not the other. Investigations were carried out with and without balancing osmotic pressures with glucose. A stable 30% primary W(1)/O emulsions containing salt could be produced with more than or equal to 2% polyglycerol polyricinoleate (PGPR) in the oil phase. We suggest that the addition of salt strengthens the interactions between surfactant molecules in the adsorbed film. This is supported by interfacial viscosity and elasticity measurements both of which increased on addition of salt and the fact that in the presence of salt the emulsion was more stable. These simple emulsions were then processed to construct duplex emulsions. When osmotic pressures were balanced with glucose there was still a release of salt in storage. The extent and rate of release was proportional to glucose concentration. This effect was followed over a period of 60days. These data suggest that the release is driven by the chemical potential difference between the two water compartments rather than the unbalanced osmotic pressures. These observations are explained in the context of a water structuring effect from the added glucose, which lowers the interfacial tension of oil-water interface and thus facilitates micellar transport of hydrated salt ions across the oil layer. Copyright © 2010 Elsevier Inc. All rights reserved.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1996-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1996-01-09

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Comparative NMR analysis of the decadeoxynucleotide d-(GCATTAATGC)2 and an analogue containing 2-aminoadenine.

PubMed Central

Chazin, W J; Rance, M; Chollet, A; Leupin, W

1991-01-01

The dodecadeoxynucleotide duplex d-(GCATTAATGC)2 has been prepared with all adenine bases replaced by 2-NH2-adenine. This modified duplex has been characterized by nuclear magnetic resonance (NMR) spectroscopy. Complete sequence-specific 1H resonance assignments have been obtained by using a variety of 2D NMR methods. Multiple quantum-filtered and multiple quantum experiments have been used to completely assign all sugar ring protons, including 5'H and 5'H resonances. The assignments form the basis for a detailed comparative analysis of the 1H NMR parameters of the modified and parent duplex. The structural features of both decamer duplexes in solution are characteristic of the B-DNA family. The spin-spin coupling constants in the sugar rings and the relative spatial proximities of protons in the bases and sugars (as determined from the comparison of corresponding nuclear Overhauser effects) are virtually identical in the parent and modified duplexes. Thus, substitution by this adenine analogue in oligonucleotides appears not to disturb the global or local conformation of the DNA duplex. PMID:1945828

Circularly polarized luminescence of helically assembled pyrene π-stacks on RNA and DNA duplexes.

PubMed

Nakamura, Mitsunobu; Ota, Fuyuki; Takada, Tadao; Akagi, Kazuo; Yamana, Kazushige

2018-05-01

In this report, we describe the circularly polarized luminescence (CPL) of the RNA duplexes having one to four 2'-O-pyrene modified uridines (Upy) and the DNA duplexes having two, four, and six pyrene modified non-nucleosidic linkers (Py). Both the pyrene π-stack arrays formed on the RNA and DNA double helical structures exhibited pyrene excimer fluorescence. In the pyrene-modified RNA systems, the RNA duplex having four Upys gives CPL emission with g lum value of <0.01 at 480 nm. The structure of pyrene stacks on the RNA duplex may be rigidly regulated with increase in the Upy domains, which resulted in the CPL emission. In the DNA systems, the pyrene-modified duplexes containing two and four Pys exhibited CPL emission with g lum values of <0.001 at 505 nm. The pyrene π-stack arrays presented here show CPL emission. However, the g lum values are relatively small when compared with our previous system consisting of the pyrene-zipper arrays on RNA. © 2018 Wiley Periodicals, Inc.

The effect of nonenzymatic glycation on the stability and conformation of two deoxyoligonucleotide duplexes: a spectroscopic analysis by circular dichroism.

PubMed

Dutta, Udayan; Cohenford, Menashi A; Dain, Joel A

2007-01-15

Advanced glycation end products (AGEs) play a significant role in the pathophysiology of diabetes leading to such conditions as atherosclerosis, cataract formation, and renal dysfunction. While the formation of nucleoside AGEs was previously demonstrated, no extensive studies have been performed to assess the effect of AGEs on DNA structure and folding. The objective of this study was to investigate the nonenzymatic glycation of two DNA oligonucleotide duplexes with one duplex consisting of deoxy-poly(A)15 and deoxy-poly(T)15 and the other consisting of deoxy-poly(GA)15 and deoxy-poly(CT)15. With D-glucose, D-galactose, D/L-glyceraldehyde, and D-glucosamine serving as the model glycating carbohydrates, D-glucosamine was found to exhibit the greatest effect on the stability and structure of the oligonucleotide duplexes, a finding that was confirmed by circular dichroism. The nonenzymatic glycation of deoxy-poly(AT) by D-glucosamine destabilized the deoxy-poly(AT) structure and changed its conformation from A form to X form. D-glucosamine also altered the conformation of deoxy-poly(GA)15 and deoxy-poly(CT)15 from A form to B form. Capillary electrophoresis and ultraviolet and fluorescence spectroscopy revealed that, of the various purines and pyrimidines, 2'-deoxyguanosine and guanine were most reactive with D-glucosamine. The nonenzymatic modification of nucleic acids warrants further investigation because this phenomenon may occur in vivo, altering DNA structure and/or function.

Influence of PNA containing 8-aza-7-deazaadenine on structure stability and binding affinity of PNA·DNA duplex: insights from thermodynamics, counter ion, hydration and molecular dynamics analysis.

PubMed

Gupta, Sharad K; Sur, Souvik; Prasad Ojha, Rajendra; Tandon, Vibha

2013-07-01

This paper describes the synthesis of a novel 8-aza-7-deazapurin-2,6-diamine (DPP)-containing peptide nucleic acid (PNA) monomer and Boc protecting group-based oligomerization of PNA, replacing adenine (A) with DPP monomers in the PNA strand. The PNA oligomers were synthesized against the biologically relevant SV40 promoter region (2494-AATTTTTTTTATTTA-2508) of pEGFP-N3 plasmid. The DPP-PNA·DNA duplex showed enhanced stability as compared to normal duplex (A-PNA·DNA). The electronic distribution of DPP monomer suggested that DPP had better electron donor properties over 2,6-diamino purine. UV melting and thermodynamic analysis revealed that the PNA oligomer containing a diaminopyrazolo(3,4-d)pyrimidine moiety (DPP) stabilized the PNA·DNA hybrids compared to A-PNA·DNA. DPP-PNA·DNA duplex showed higher water activity (Δnw = 38.5) in comparison to A-PNA·DNA duplex (Δnw = 14.5). The 50 ns molecular dynamics simulations of PNA·DNA duplex containing DPP or unmodified nucleobase-A showed average H-bond distances in the DPP-dT base pair of 2.90 Å (OH-N bond) and 2.91 Å (NH-N bond), which were comparably shorter than in the A-dT base pair, in which the average distances were 3.18 Å (OH-N bond) and 2.97 Å (NH-N bond), and there was one additional H-bond in the DPP-dT base pair of around 2.98 Å (O2H-N2 bond), supporting the higher stability of DPP-PNA·DNA. The analysis of molecular dynamics simulation data showed that the system binding free energy increased at a rate of approximately -4.5 kcal mol(-1) per DPP base of the PNA·DNA duplex. In summary, increased thermal stability, stronger hydrogen bonding and more stable conformation in the DPP-PNA·DNA duplex make it a better candidate as antisense/antigene therapeutic agents.

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

PubMed Central

Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

PubMed

Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Stereospecific Formation of Interstrand Carbinolamine DNA Crosslinks by Crotonaldehyde- and Acetaldehyde-Derived α-CH3-γ-OH-1,N2-Propano-2’-deoxyguanosine Adducts in the 5′-CpG-3′ Sequence

PubMed Central

Cho, Young-Jin; Wang, Hao; Kozekov, Ivan D.; Kurtz, Andrew J.; Jacob, Jaison; Voehler, Markus; Smith, Jarrod; Harris, Thomas M.; Lloyd, R. Stephen; Rizzo, Carmelo J.; Stone, Michael P.

2008-01-01

The crotonaldehyde- and acetaldehyde-derived R- and S-α-CH3-γ-OH-1,N2-propanodeoxyguanosine adducts were monitored in single-stranded and duplex oligodeoxynucleotides using NMR spectroscopy. In both instances the cis and trans diastereomers of the α-CH3 and γ-OH groups underwent slow exchange, with the trans diastereomers being favored. In single-stranded oligodeoxynucleotides, the aldehyde intermediates were not detected spectroscopically, but their presence was revealed through the formation of N-terminal conjugates with the tetrapeptide KWKK. When annealed into 5′-d(GCTAGCXAGTCC)-3′•5′-d(GGACTCYCTAGC)-3′ containing the 5′-CpG-3′ sequence context (X=R- or S-α-CH3-γ-13C-OH-PdG; Y=15N2-dG), at pH 7, partial opening of the R- or S-α-CH3-γ-13C-OH-PdG adducts to the corresponding N2-(3-oxo-1-methyl-propyl)-dG aldehydes was observed at temperatures below the Tm of the duplexes. These aldehydes equilibrated with their geminal diol hydrates; higher temperatures favored the aldehydes. When annealed opposite to T, the S-α-CH3-γ-13C-OH-PdG adduct was stable. At 37 °C, an interstrand DNA crosslink was observed spectroscopically only for the R-α-CH3-γ-OH-PdG adduct. Molecular modeling predicted that the interstrand crosslink formed by the R-α-CH3-γ-OH-PdG adduct introduced less disruption into the duplex structure than did the crosslink arising from the S-α-CH3-γ-OH-PdG adduct, due to differing orientations of the R- and S-CH3 groups. Modeling also predicted that the α-methyl group of the aldehyde arising from the R-α-CH3-γ-OH-PdG adduct oriented in the 3′ direction in the minor groove, facilitating crosslinking. In contrast, the α-methyl group of the aldehyde arising from the S-α-CH3-γ-OH-PdG adduct oriented in the 5′ direction within the minor groove potentially hindering crosslinking. NMR revealed that for the R-α-CH3-γ-OH-PdG adduct, the carbinolamine form of the crosslink was favored in duplex DNA, in situ, with the imine or Schiff base form of the crosslink remaining below the level of spectroscopic detection. Molecular modeling predicted that the carbinolamine linkage maintained Watson-Crick hydrogen bonding at both of the tandem C•G base pairs. Dehydration of the carbinolamine crosslink to an imine, or cyclization of the latter to form a pyrimidopurinone crosslink, required disruption of Watson-Crick hydrogen bonding at one or both of the crosslinked base pairs. PMID:16485895

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

PubMed Central

Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

2016-01-01

RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

Synthesis of peptide nucleic acids containing pyridazine derivatives as cytosine and thymine analogs, and their duplexes with complementary oligodeoxynucleotides.

PubMed

Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

2015-03-20

Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Crosslinking reactions of 4-amino-6-oxo-2-vinylpyrimidine with guanine derivatives and structural analysis of the adducts

PubMed Central

Kusano, Shuhei; Ishiyama, Shogo; Lam, Sik Lok; Mashima, Tsukasa; Katahira, Masato; Miyamoto, Kengo; Aida, Misako; Nagatsugi, Fumi

2015-01-01

DNA interstrand crosslinks (ICLs) are the primary mechanism for the cytotoxic activity of many clinical anticancer drugs, and numerous strategies for forming ICLs have been developed. One such method is using crosslink-forming oligonucleotides (CFOs). In this study, we designed a 4-amino-6-oxo-2-vinylpyrimidine (AOVP) derivative with an acyclic spacer to react selectively with guanine. The AOVP CFO exhibited selective crosslinking reactivity with guanine and thymine in DNA, and with guanine in RNA. These crosslinking reactions with guanine were accelerated in the presence of CoCl2, NiCl2, ZnCl2 and MnCl2. In addition, we demonstrated that the AOVP CFO was reactive toward 8-oxoguanine opposite AOVP in the duplex DNA. The structural analysis of each guanine and 8-oxoguanine adduct in the duplex DNA was investigated by high-resolution NMR. The results suggested that AOVP reacts at the N2 amine in guanine and at the N1 or N2 amines in 8-oxoguanine in the duplex DNA. This study demonstrated the first direct determination of the adduct structure in duplex DNA without enzyme digestion. PMID:26245348

An enhanced chemiluminescence resonance energy transfer system based on target recycling G-guadruplexes/hemin DNAzyme catalysis and its application in ultrasensitive detection of DNA.

PubMed

Chen, Jia; Huang, Yong; Vdovenko, Marina; Sakharov, Ivan Yu; Su, Guifa; Zhao, Shulin

2015-06-01

An enhanced chemiluminescence resonance energy transfer (CRET) system based on target recycling G-guadruplexes/hemin DNAzyme catalysis was developed for ultrasensitive detection of DNA. CRET system consists of luminol as chemiluminescent donor, and fluorescein isothiocyanate (FITC) as acceptor. The sensitive detection was achieved by using the system consisted of G-riched DNA, blocker DNA, and the Nb.BbvCI biocatalyst. Upon addition of target DNA to the system, target DNA hybridizes with the quasi-circular DNA structure, and forms a DNA duplex. The formation of DNA duplex triggers selective enzymatic cleavage of quasi-circular DNA by Nb.BbvCI, resulting in the release of target DNA and two G-riched DNAzyme segments. Released target DNA then hybridizes with another quasi-circular DNA structure to initiate the cleavage of the quasi-circular DNA structure. Eventually, each target DNA can go through many cycles, resulting in the digestion of many quasi-circular DNA structures, generating many G-riched DNAzyme segments. G-riched DNAzyme segment products assemble with hemin to form stable hemin/G-quadruplexes that exhibit peroxidase-like activity which can catalyze the oxidation of luminol by H2O2 to produce CL signals. In the presence of FITC, CL of luminol can excite FITC molecules, and thus produced CRET between the luminol and FITC. This unique analysis strategy gives a detection limit down to 80 fM, which is at least four orders of magnitude lower than that of unamplified DNA detection methods. Copyright © 2015 Elsevier B.V. All rights reserved.

All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model

PubMed Central

Savelyev, Alexey; MacKerell, Alexander D.

2014-01-01

Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978

Covalent Incorporation of Selenium into Oligonucleotides for X-ray Crystal Structure Determination via MAD: Proof of Principle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Teplova, M.; Wilds, C.J.; Wawrzak, Z.

2010-03-08

Selenium was incorporated into an oligodeoxynucleotide in the form of 2'-methylseleno-uridine (U{sub Se}). The X-ray crystal structure of the duplex d(GCGTA)U{sub Se}d(ACGC){sub 2} was determined by the multiwavelength anomalous dispersion (MAD) technique and refined to a resolution of 1.3 {angstrom}, demonstrating that selenium can selectively substitute oxygen in DNA and that the resulting compounds are chemically stable. Since derivatization at the 2'-{alpha}-position with selenium does not affect the preference of the sugar for the C3'-endo conformation, this strategy is suitable for incorporating selenium into RNA. The availability of selenium-containing nucleic acids for crystallographic phasing offers an attractive alternative to themore » commonly used halogenated pyrimidines.« less

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1998-11-03

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

PubMed

Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

2016-09-01

Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

Influence of nucleotide modifications at the C2’ position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA

PubMed Central

Copp, William; Denisov, Alexey Y.; Xie, Jingwei; Noronha, Anne M.; Liczner, Christopher; Safaee, Nozhat

2017-01-01

Abstract Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2′-deoxyribose, 2′-O-methyl-ribose, 2′-deoxy-2′-fluoro-ribose, arabinose and 2′-deoxy-2′-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2’ modifications gave a variety of effects. Arabinose and 2′-deoxy-2′-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2′-O-methyl and 2′-deoxy-2′-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. PMID:28973475

Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

PubMed

Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

2017-09-29

Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes

PubMed Central

Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina

2011-01-01

Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethlyl-glycine backbone. The crystal structure of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATCGG)2 (pdb: 3MBS), and the other containing the same nucleobase pairs and a central pair of bipyridine ligands (pdb: 3MBU), has been solved with a resolution of 1.2 Å and 1.05 Å, respectively. The non-modified PNA duplex adopts a P-type helical structure s i m i l a r t o that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. These results support the notion that while PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines are bulged out of the duplex and are aligned parallel to the minor groove of the PNA. In the case of the bipyridine-containing PNA, two bipyridines from adjacent PNA duplexes form a π-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are π-stacking with adjacent nucleobase pairs and adopt an intrahelical geometry [Johar et al., Chem. Eur. J., 2008, 14, 2080]. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes. PMID:20859960

Department of Defense Gateway Information System (DGIS) Users’ Guide

DTIC Science & Technology

1993-10-01

all citations about any or all of ’he search terms of interest . Usually, all of the search terms combined using the OR operator are different ways to...Form at ........................................................................ 5-6 Baud Rate ...Set parity to none Set duplex (or echo)to full or Set duplex (or echo)to full Set baud rate to 300, 1200, 2400, 9600 Set baud rate to

NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

PubMed

Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

2014-03-07

Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

2002-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Defined presentation of carbohydrates on a duplex DNA scaffold.

PubMed

Schlegel, Mark K; Hütter, Julia; Eriksson, Magdalena; Lepenies, Bernd; Seeberger, Peter H

2011-12-16

A new method for the spatially defined alignment of carbohydrates on a duplex DNA scaffold is presented. The use of an N-hydroxysuccinimide (NHS)-ester phosphoramidite along with carbohydrates containing an alkylamine linker allows for on-column labeling during solid-phase oligonucleotide synthesis. This modification method during solid-phase synthesis only requires the use of minimal amounts of complex carbohydrates. The covalently attached carbohydrates are presented in the major groove of the B-form duplex DNA as potential substrates for murine type II C-type lectin receptors mMGL1 and mMGL2. CD spectroscopy and thermal melting revealed only minimal disturbance of the overall helical structure. Surface plasmon resonance and cellular uptake studies with bone-marrow-derived dendritic cells were used to assess the capability of these carbohydrate-modified duplexes to bind to mMGL receptors. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

N(4)C-ethyl-N(4)C cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of different orientations.

PubMed

Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S

2002-01-22

The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross-link, in which the cross-linked base pairs can still maintain hydrogen bond contacts, molecular models suggest that formation of the -GC- staggered cross-link disrupts hydrogen bonding and may also perturb adjacent base pairs leading to an overall reduction in helix stability. Duplexes with specifically positioned and oriented cross-links can be used as substrates to study DNA repair mechanisms.

Molecular dynamics simulations of DNA-polycation complexes

NASA Astrophysics Data System (ADS)

Ziebarth, Jesse; Wang, Yongmei

2008-03-01

A necessary step in the preparation of DNA for use in gene therapy is the packaging of DNA with a vector that can condense DNA and provide protection from degrading enzymes. Because of the immunoresponses caused by viral vectors, there has been interest in developing synthetic gene therapy vectors, with polycations emerging as promising candidates. Molecular dynamics simulations of the DNA duplex CGCGAATTCGCG in the presence of 20 monomer long sequences of the polycations, poly-L-lysine (PLL) and polyethyleneimine (PEI), with explicit counterions and TIP3P water, are performed to provide insight into the structure and formation of DNA polyplexes. After an initial separation of approximately 50 å, the DNA and polycation come together and form a stable complex within 10 ns. The DNA does not undergo any major structural changes upon complexation and remains in the B-form. In the formed complex, the charged amine groups of the polycation mainly interact with DNA phosphate groups, and rarely occupy electronegative sites in either the major or minor grooves. Differences between complexation with PEI and PLL will be discussed.

Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

PubMed

Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

2018-02-01

Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

Srs2 prevents Rad51 filament formation by repetitive motion on DNA.

PubMed

Qiu, Yupeng; Antony, Edwin; Doganay, Sultan; Koh, Hye Ran; Lohman, Timothy M; Myong, Sua

2013-01-01

Srs2 dismantles presynaptic Rad51 filaments and prevents its re-formation as an anti-recombinase. However, the molecular mechanism by which Srs2 accomplishes these tasks remains unclear. Here we report a single-molecule fluorescence study of the dynamics of Rad51 filament formation and its disruption by Srs2. Rad51 forms filaments on single-stranded DNA by sequential binding of primarily monomers and dimers in a 5'-3' direction. One Rad51 molecule binds to three nucleotides, and six monomers are required to achieve a stable nucleation cluster. Srs2 exhibits ATP-dependent repetitive motion on single-stranded DNA and this activity prevents re-formation of the Rad51 filament. The same activity of Srs2 cannot prevent RecA filament formation, indicating its specificity for Rad51. Srs2's DNA-unwinding activity is greatly suppressed when Rad51 filaments form on duplex DNA. Taken together, our results reveal an exquisite and highly specific mechanism by which Srs2 regulates the Rad51 filament formation.

Non-Enzymatic Synthesis of Duplex Nucleic Acid

NASA Astrophysics Data System (ADS)

Panchal, Z.; Oye, M.; Deamer, D.; Vercoutere, W.

2017-07-01

The earliest forms of life would likely have a protocellular form, with a membrane encapsulating some form of linear charged polymer that would have genetic properties; we simulate the plausible prebiotic conditions and use a nanopore for analysis.

Development and application of absolute quantitative detection by duplex chamber-based digital PCR of genetically modified maize events without pretreatment steps.

PubMed

Zhu, Pengyu; Fu, Wei; Wang, Chenguang; Du, Zhixin; Huang, Kunlun; Zhu, Shuifang; Xu, Wentao

2016-04-15

The possibility of the absolute quantitation of GMO events by digital PCR was recently reported. However, most absolute quantitation methods based on the digital PCR required pretreatment steps. Meanwhile, singleplex detection could not meet the demand of the absolute quantitation of GMO events that is based on the ratio of foreign fragments and reference genes. Thus, to promote the absolute quantitative detection of different GMO events by digital PCR, we developed a quantitative detection method based on duplex digital PCR without pretreatment. Moreover, we tested 7 GMO events in our study to evaluate the fitness of our method. The optimized combination of foreign and reference primers, limit of quantitation (LOQ), limit of detection (LOD) and specificity were validated. The results showed that the LOQ of our method for different GMO events was 0.5%, while the LOD is 0.1%. Additionally, we found that duplex digital PCR could achieve the detection results with lower RSD compared with singleplex digital PCR. In summary, the duplex digital PCR detection system is a simple and stable way to achieve the absolute quantitation of different GMO events. Moreover, the LOQ and LOD indicated that this method is suitable for the daily detection and quantitation of GMO events. Copyright © 2016 Elsevier B.V. All rights reserved.

Characterizing AISI 1045 steel surface duplex-treated by alternating current field enhanced pack aluminizing and nitriding

NASA Astrophysics Data System (ADS)

Xie, Fei; Zhang, Ge; Pan, Jianwei

2018-02-01

Thin cases and long treating time are shortcomings of conventional duplex treatment of aluminizing followed by nitriding (DTAN). Alternating current field (ACF) enhanced DTAN was carried out on AISI 1045 steel by applying an ACF to treated samples and treating agents with a pair of electrodes for overcoming those shortcomings. By investigating cases' structures, phases, composition and hardness distributions of differently treated samples, preliminary studies were made on characterizations of the ACF enhanced duplex treatment to AISI 1045 steel. The results show that, with the help of the ACF, the surface Al-rich phase Al5Fe2 formed in conventional pack aluminizing can be easily avoided and the aluminizing process is dramatically promoted. The aluminizing case can be nitrided either with conventional pack nitriding or ACF enhanced pack nitriding. By applying ACF to pack nitriding, the diffusion of nitrogen into the aluminizing case is promoted. AlN, Fe2∼3N and solid solution of N in iron are efficiently formed as a result of reactions of N with the aluminizing case. A duplex treated case with an effective thickness of more than 170 μm can be obtained by the alternating current field enhanced 4 h pack aluminizing plus 4 h pack nitriding.

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

Stabilizing effect of propionic acid derivative of anthraquinone--polyamine conjugate incorporated into α-β chimeric oligonucleotides on the alternate-stranded triple helix.

PubMed

Moriguchi, Tomohisa; Azam, A T M Zafrul; Shinozuka, Kazuo

2011-06-15

Two types of anthraquinone conjugates were synthesized as non-nucleosidic oligonucleotide components. These include an anthraquinone derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid and an anthraquinone--polyamine derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid. The conjugates were successfully incorporated into the "linking-region" of the α-β chimeric oligonucleotides via phosphoramidite method as non-nucleosidic backbone units. The resultant novel α-β chimeric oligonucleotides possessed two diastereomers that were generated by the introduction of the anthraquinone conjugate with a stereogenic carbon atom. The isomers were successfully separated by a reversed-phase HPLC. UV-melting experiments revealed that both stereoisomers formed a substantially stable alternate-strand triple helix, irrespective of the stereochemistry of the incorporated non-nucleosidic backbone unit. However, the enhancing effect on thermal stability depended on the length of the alkyl linker connecting anthraquinone moiety and the propionic acid moiety. The sequence discrimination ability of the chimeric oligonucleotides toward mismatch target duplex was also examined. The T(m) values of the triplexes containing the mismatch target were substantially lower than the T(m) values of those containing the full-match target. The thermodynamic parameters (ΔH°, ΔS°, and ΔG°) required for the dissociation of the triplexes into the third strand and target duplex were also measured.

Derivatization of DNAs with Selenium at 6-Position of Guanine for Function and Crystal Structure Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salon, J.; Jiang, J; Sheng, J

2008-01-01

To investigate nucleic acid base pairing and stacking via atom-specific mutagenesis and crystallography, we have synthesized for the first time the 6-Se-deoxyguanosine phosphoramidite and incorporated it into DNAs via solid-phase synthesis with a coupling yield over 97%. We found that the UV absorption of the Se-DNAs red-shifts over 100 nm to 360 nm ({Epsilon} = 2.3 x 10{sup 4} M{sup -1} cm{sup -1}), the Se-DNAs are yellow colored, and this Se modification is relatively stable in water and at elevated temperature. Moreover, we successfully crystallized a ternary complex of the Se-G-DNA, RNA and RNase H. The crystal structure determination andmore » analysis reveal that the overall structures of the native and Se-modified nucleic acid duplexes are very similar, the selenium atom participates in a Se-mediated hydrogen bond (Se H-N), and the {sup Se}G and C form a base pair similar to the natural G-C pair though the Se-modification causes the base-pair to shift (approximately 0.3 {angstrom}). Our biophysical and structural studies provide new insights into the nucleic acid flexibility, duplex recognition and stability. Furthermore, this novel selenium modification of nucleic acids can be used to investigate chemogenetics and structure of nucleic acids and their protein complexes.« less

Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

PubMed

Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

2015-10-12

A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Characterization of rodlike structures in Si-Ge-GaP alloys

NASA Astrophysics Data System (ADS)

Srikant, V.; Jesser, W. A.; Rosi, F. D.

1996-07-01

High-temperature microstructure of Si-Ge alloys containing 10-15 mole % GaP were studied. Quenching the 80/20 Si-Ge alloy (80 at. % Si) from above 1125 °C and the 50/50 Si-Ge alloy (50 at. % Si) from above 1025 °C resulted in a duplex microstructure. The two-phase regions consisted of a regular array of rodlike structures (GaP) in a Si-Ge matrix whereas the monophase regions were pure Si-Ge. These rodlike structures were found to lie along the [001] direction and result in {002} spots in a [100] electron diffraction pattern. The ``rods'' were about 35 and 45 nm in diameter in the case of the 80/20 and 50/50 alloy, respectively. These structures are not stable on annealing and do not form when the solidification rate is decreased.

A novel high-speed PLC communication modem

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abraham, K.C.; Roy, S.

1992-10-01

In this paper an innovative design for power line carrier (PLC) communication using digitally modulated signals is presented. The major contribution consists of a new signal coupler to the power line that achieves a stable transmission bandwidth of 4 KHz on distribution lines over long distances. Preliminary field tests achieved half-duplex operation at 1.2 Kbaud over a distribution power line to the 120V network and back with a symbol error rate of about 2% using less than about 10 W of average transmitted power, which is considerably superior to the present state-of-the-art PLC modems. Full-duplex operation over 120/240V intra-building wiringmore » has also been field tested at 9.6 Kbaud over distances of 3000 ft. using 1W of average transmitted power.« less

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing

DTIC Science & Technology

2008-01-01

complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING

Tricriticality in the q-neighbor Ising model on a partially duplex clique.

PubMed

Chmiel, Anna; Sienkiewicz, Julian; Sznajd-Weron, Katarzyna

2017-12-01

We analyze a modified kinetic Ising model, a so-called q-neighbor Ising model, with Metropolis dynamics [Phys. Rev. E 92, 052105 (2015)PLEEE81539-375510.1103/PhysRevE.92.052105] on a duplex clique and a partially duplex clique. In the q-neighbor Ising model each spin interacts only with q spins randomly chosen from its whole neighborhood. In the case of a duplex clique the change of a spin is allowed only if both levels simultaneously induce this change. Due to the mean-field-like nature of the model we are able to derive the analytic form of transition probabilities and solve the corresponding master equation. The existence of the second level changes dramatically the character of the phase transition. In the case of the monoplex clique, the q-neighbor Ising model exhibits a continuous phase transition for q=3, discontinuous phase transition for q≥4, and for q=1 and q=2 the phase transition is not observed. On the other hand, in the case of the duplex clique continuous phase transitions are observed for all values of q, even for q=1 and q=2. Subsequently we introduce a partially duplex clique, parametrized by r∈[0,1], which allows us to tune the network from monoplex (r=0) to duplex (r=1). Such a generalized topology, in which a fraction r of all nodes appear on both levels, allows us to obtain the critical value of r=r^{*}(q) at which a tricriticality (switch from continuous to discontinuous phase transition) appears.

Solution structure of a DNA decamer duplex containing the stable 3′ T⋅G base pair of the pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct]: Implications for the highly specific 3′ T → C transition of the (6–4) adduct

PubMed Central

Lee, Joon-Hwa; Hwang, Geum-Sook; Choi, Byong-Seok

1999-01-01

The pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct] is one of the major photoproducts induced by UV irradiation of DNA and occurs at TpT sites. The (6–4) adduct is highly mutagenic and leads most often to a 3′ T → C transition with 85% replicating error frequency [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the specific 3′ T → C transition of the (6–4) adduct, we have used experimental NMR restraints and molecular dynamics to determine the solution structure of a (6–4)-lesion DNA decamer duplex that contains a mismatched base pair between the 3′ T residue and an opposed G residue. Normal Watson–Crick-type hydrogen bonding is retained at the 5′ T of the lesion site. The O2 carbonyl of the 3′ T residue forms hydrogen bonds with the imino and amino protons of the opposed G residue. This potential hydrogen bonding stabilizes the overall helix and restores the highly distorted conformation of the (6–4) adduct to the typical B-form-like DNA structure. This structural feature can explain the marked preference for the insertion of an A residue opposite the 5′ T and a G residue opposite the 3′ T of the (6–4) lesion during trans-lesion synthesis. Thus these insertions yield the predominant 3′ T → C transition. PMID:10359763

Local electrical properties of thermally grown oxide films formed on duplex stainless steel surfaces

NASA Astrophysics Data System (ADS)

Guo, L. Q.; Yang, B. J.; He, J. Y.; Qiao, L. J.

2018-06-01

The local electrical properties of thermally grown oxide films formed on ferrite and austenite surfaces of duplex stainless steel at different temperatures were investigated by Current sensing atomic force microscopy, X-ray Photoelectron Spectroscopy (XPS) and Auger Electron Spectroscopy (AES). The current maps and XPS/AES analyses show that the oxide films covering austenite and ferrite surfaces formed at different temperatures exhibit different local electrical characteristics, thickness and composition. The dependence of electrical conductivity of oxide films covering austenite and ferrite surface on the formation temperature is attributed to the film thickness and semiconducting structures, which is intrinsically related to thermodynamics and kinetics process of film grown at different temperature. This is well elucidated by corresponding semiconductor band structures of oxide films formed on austenite and ferrite phases at different temperature.

Chirality- and sequence-selective successive self-sorting via specific homo- and complementary-duplex formations

PubMed Central

Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji

2015-01-01

Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291

M-DNA: a self-assembling molecular wire for nanoelectronics and biosensing.

PubMed

Wettig, Shawn D; Li, Chen-Zhong; Long, Yi-Tao; Kraatz, Heinz-Bernhard; Lee, Jeremy S

2003-01-01

M-DNA is a complex between divalent metal ions such as Zn2+ and duplex DNA which forms at pH 8.5. Unlike B-DNA, M-DNA does not bind ethidium so that M-DNA formation can be monitored conveniently by an ethidium fluorescence assay. M-DNA was shown to be a better conductor than B-DNA by fluorometric measurements of electron transport in donor-acceptor labelled duplexes; by direct conductivity measurements of M-DNA bound between gold electrodes and by cyclic voltammetric studies on ferrocene labelled duplexes attached to gold microelectrodes. As is the case with B-DNA, M-DNA can self-assemble into a variety of structures and is anticipated to find widespread use in nanoelectronics and biosensing.

Temperature and electrolyte optimization of the α-hemolysin latch sensing zone for detection of base modification in double-stranded DNA.

PubMed

Johnson, Robert P; Fleming, Aaron M; Jin, Qian; Burrows, Cynthia J; White, Henry S

2014-08-19

The latch region of the wild-type protein pore α-hemolysin (α-HL) constitutes a sensing zone for individual abasic sites (and furan analogs) in double-stranded DNA (dsDNA). The presence of an abasic site or furan within a DNA duplex, electrophoretically captured in the α-HL vestibule and positioned at the latch region, can be detected based on the current blockage prior to duplex unzipping. We investigated variations in blockage current as a function of temperature (12-35°C) and KCl concentration (0.15-1.0 M) to understand the origin of the current signature and to optimize conditions for identifying the base modification. In 1 M KCl solution, substitution of a furan for a cytosine base in the latch region results in an ∼ 8 kJ mol(-1) decrease in the activation energy for ion transport through the protein pore. This corresponds to a readily measured ∼ 2 pA increase in current at room temperature. Optimal resolution for detecting the presence of a furan in the latch region is achieved at lower KCl concentrations, where the noise in the measured blockage current is significantly lower. The noise associated with the blockage current also depends on the stability of the duplex (as measured from the melting temperature), where a greater noise in the measured blockage current is observed for less stable duplexes. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

50 years of DNA ‘Breathing’: Reflections on Old and New Approaches

PubMed Central

von Hippel, Peter H.; Johnson, Neil P.; Marcus, Andrew H.

2015-01-01

Summary The coding sequences for genes, and much other regulatory information involved in genome expression, are located ‘inside’ the DNA duplex. Thus the ‘macromolecular machines’ that read-out this information from the base sequence of the DNA must somehow access the DNA ‘interior’. Double-stranded (ds) DNA is a highly structured and cooperatively stabilized system at physiological temperatures, but is also only marginally stable and undergoes a cooperative ‘melting phase transition’ at temperatures not far above physiological. Furthermore, due to its length and heterogeneous sequence, with AT-rich segments being less stable than GC-rich segments, the DNA genome ‘melts’ in a multistate fashion. Therefore the DNA genome must also manifest thermally driven structural (‘breathing’) fluctuations at physiological temperatures that should reflect the heterogeneity of the dsDNA stability near the melting temperature. Thus many of the breathing fluctuations of dsDNA are likely also to be sequence dependent, and could well contain information that should be ‘readable’ and useable by regulatory proteins and protein complexes in site-specific binding reactions involving dsDNA ‘opening’. Our laboratory has been involved in studying the breathing fluctuations of duplex DNA for about 50 years. In this ‘Reflections’ article we present a relatively chronological overview of these studies, starting with the use of simple chemical probes (such as hydrogen exchange, formaldehyde and simple DNA ‘melting’ proteins) to examine the local stability of the dsDNA structure, and culminating in sophisticated spectroscopic approaches that can be used to monitor the breathing-dependent interactions of regulatory complexes with their duplex DNA targets in ‘real time’. PMID:23840028

A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

PubMed

Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

1987-09-15

We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.

6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

PubMed

Marathias, V M; Sawicki, M J; Bolton, P H

1999-07-15

The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

Triplex-forming oligonucleotides: a third strand for DNA nanotechnology

PubMed Central

2018-01-01

Abstract DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical (‘triplex’) structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone. PMID:29228337

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

AgI -Induced Switching of DNA Binding Modes via Formation of a Supramolecular Metallacycle.

PubMed

Basak, Shibaji; Léon, J Christian; Ferranco, Annaleizle; Sharma, Renu; Hebenbrock, Marian; Lough, Alan; Müller, Jens; Kraatz, Heinz-Bernhard

2018-03-12

The histidine derivative L1 of the DNA intercalator naphthalenediimide (NDI) forms a triangular Ag I complex (C2). The interactions of L1 and of C2 with DNA were studied by circular dichroism (CD) and UV/Vis spectroscopy and by viscosity studies. Different binding modes were observed for L1 and for C2, as the Ag I complex C2 is too large in size to act as an intercalator. If Ag I is added to the NDI molecule that is already intercalated into a duplex, higher order complexes are formed within the DNA duplex and cause disruptions in the helical duplex structure, which leads to a significant decrease in the characteristic CD features of B-DNA. Thus, via addition of a metal we show how a classic and well-known organic intercalator unit can be turned into a partial metallo insertor. We also show how electrochemical impedance spectroscopy (EIS) can be used to probe DNA binding modes on DNA films that are immobilized on gold surfaces. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Microstructural design of functionally graded coatings composed of suspension plasma sprayed hydroxyapatite and bioactive glass.

PubMed

Cattini, Andrea; Bellucci, Devis; Sola, Antonella; Pawłowski, Lech; Cannillo, Valeria

2014-04-01

Various bioactive glass/hydroxyapatite (HA) functional coatings were designed by the suspension plasma spraying (SPS) technique. Their microstructure, scratch resistance, and apatite-forming ability in a simulated body fluid (SBF) were compared. The functional coatings design included: (i) composite coating, that is, randomly distributed constituent phases; (ii) duplex coating with glass top layer onto HA layer; and (iii) graded coating with a gradual changing composition starting from pure HA at the interface with the metal substrate up to pure glass on the surface. The SPS was a suitable coating technique to produce all the coating designs. The SBF tests revealed that the presence of a pure glass layer on the working surface significantly improved the reactivity of the duplex and graded coatings, but the duplex coating suffered a relatively low scratch resistance because of residual stresses. The graded coating therefore provided the best compromise between mechanical reliability and apatite-forming ability in SBF. © 2013 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 102B: 551-560, 2014. Copyright © 2013 Wiley Periodicals, Inc.

Influence of 5-N-carboxamide modifications on the thermodynamic stability of oligonucleotides

PubMed Central

Wolk, Steven K.; Shoemaker, Richard K.; Mayfield, Wes S.; Mestdagh, Andrew L.; Janjic, Nebojsa

2015-01-01

We have recently shown that the incorporation of modified nucleotides such as 5-N-carboxamide-deoxyuridines into random nucleic acid libraries improves success rates in SELEX experiments and facilitates the identification of ligands with slow off-rates. Here we report the impact of these modifications on the thermodynamic stability of both duplexes and intramolecular ‘single-stranded’ structures. Within duplexes, large, hydrophobic naphthyl groups were destabilizing relative to the all natural DNA duplex, while the hydrophilic groups exhibited somewhat improved duplex stability. All of the significant changes in stability were driven by opposing contributions from the enthalpic and entropic terms. In contrast, both benzyl and naphthyl modifications stabilized intramolecular single-stranded structures relative to their natural DNA analogs, consistent with the notion that intramolecular folding allows formation of novel, stabilizing hydrophobic interactions. Imino proton NMR data provided evidence that elements of the folded structure form at temperatures well below the Tm, with a melting transition that is distinctly less cooperative when compared to duplex DNA. Although there are no data to suggest that the unmodified DNA sequences fold into structures similar to their modified analogs, this still represents clear evidence that these modifications impart thermodynamic stability to the folded structure not achievable with unmodified DNA. PMID:26438535

Stabilization of RNA hairpins using non-nucleotide linkers and circularization.

PubMed

Kiliszek, Agnieszka; Blaszczyk, Leszek; Kierzek, Ryszard; Rypniewski, Wojciech

2017-06-02

An RNA hairpin is an essential structural element of RNA. Hairpins play crucial roles in gene expression and intermolecular recognition but are also involved in the pathogenesis of some congenital diseases. Structural studies of the hairpin motifs are impeded by their thermodynamic instability, as they tend to unfold to form duplexes, especially at high concentrations required for crystallography or nuclear magnetic resonance spectroscopy. We have elaborated techniques to stabilize the RNA hairpins by linking the free ends of the RNA strand at the base of the hairpin stem. One method involves stilbene diether or hexaethylene glycol linkers and circularization by T4 RNA ligase. Another method uses click chemistry to stitch the RNA ends with a triazole linker. Both techniques are efficient and easy to perform. They should be useful in making stable, biologically relevant RNA constructs for structural studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synthesis and monitored selection of nucleotide surrogates for binding T:A base pairs in homopurine-homopyrimidine DNA triple helices.

PubMed

Mokhir, A A; Connors, W H; Richert, C

2001-09-01

A total of 16 oligodeoxyribonucleotides of general sequence 5'-TCTTCTZTCTTTCT-3', where Z denotes an N-acyl-N-(2-hydroxyethyl)glycine residue, were prepared via solid phase synthesis. The ability of these oligonucleotides to form triplexes with the duplex 5'-AGAAGATAGAAAGA-HEG-TCTTTCTATCTTCT-3', where HEG is a hexaethylene glycol linker, was tested. In these triplexes, an 'interrupting' T:A base pair faces the Z residue in the third strand. Among the acyl moieties of Z tested, an anthraquinone carboxylic acid residue linked via a glycinyl group gave the most stable triplex, whose UV melting point was 8.4 degrees C higher than that of the triplex with 5'-TCTTCTGTCTTTCT-3' as the third strand. The results from exploratory nuclease selection experiments suggest that a combinatorial search for strands capable of recognizing mixed sequences by triple helix formation is feasible.

Structure-based cleavage mechanism of Thermus thermophilus Argonaute DNA guide strand-mediated DNA target cleavage

PubMed Central

Sheng, Gang; Zhao, Hongtu; Wang, Jiuyu; Rao, Yu; Tian, Wenwen; Swarts, Daan C.; van der Oost, John; Patel, Dinshaw J.; Wang, Yanli

2014-01-01

We report on crystal structures of ternary Thermus thermophilus Argonaute (TtAgo) complexes with 5′-phosphorylated guide DNA and a series of DNA targets. These ternary complex structures of cleavage-incompatible, cleavage-compatible, and postcleavage states solved at improved resolution up to 2.2 Å have provided molecular insights into the orchestrated positioning of catalytic residues, a pair of Mg2+ cations, and the putative water nucleophile positioned for in-line attack on the cleavable phosphate for TtAgo-mediated target cleavage by a RNase H-type mechanism. In addition, these ternary complex structures have provided insights into protein and DNA conformational changes that facilitate transition between cleavage-incompatible and cleavage-compatible states, including the role of a Glu finger in generating a cleavage-competent catalytic Asp-Glu-Asp-Asp tetrad. Following cleavage, the seed segment forms a stable duplex with the complementary segment of the target strand. PMID:24374628

NMR structural studies of the ionizing radiation adduct 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) opposite deoxyadenosine in a DNA duplex. 8-oxo-7H-dG(syn)ter dot dA(anti) alignment at lesion site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kouchakdjian, M.; Patel, D.J.; Bodepudi, V.

1991-02-05

Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12){center dot}d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG{center dot}dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH{submore » 2}-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG{center dot}dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H{sub 2}O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8){center dot}d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn){center dot}dA(anti) pair between stable Watson-Crick dA6{center dot}dT19 and dT8{center dot}A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn){center dot}dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base.« less

A Raman spectroscopic analysis of the sequence-dependent structures of oligo-DNA duplexes: d(CGCG) 2, d(GCGC) 2, d(GGCC) 2, and d(CCGG) 2 in aqueous solution

NASA Astrophysics Data System (ADS)

Torigoe, Chikako; Nishimura, Yoshifumi; Tsuboi, Masamichi; Matsuzaki, Jun-ichi; Hotoda, Hitoshi; Sekine, Mitsuo; Hata, Tsujiaki

Raman spectra of four self-complementary tetradeoxyribonucleoside triphosphates containing only guanosine and cytidine residues have been examined in aqueous solutions of different ionic strengths and at different temperatures. Both in low salt (0.15 M NaCl) and in high salt (4 M NaCl) solutions (at -2°C) all of the four duplexes have different conformations, distinguishable by Raman spectroscopy from one another. Thus, the duplex conformation is sequence-dependent. On the basis of several rules proposed recently for structure—spectrum correlations, new information was provided on the local conformations of the duplexes of these oligo-DNAs. In the low-salt solution, d(CCGG) 2 is B-DNA like in its overall conformation, but in detail the backbone conformation of the CpC portion is considered to be different from that in the GpG portion. In either one of these two portions, the torsion angle (β) around the O5'C5' bond must be somewhat higher than the usual values for B-DNA (150-170°), so that it causes a 815 cm -1 Raman line instead of the usual B marker 830 cm -1 line. This may be related to the peculiar circular dichroism spectrum of d(CCGG) 2. On going to the high-salt solution, about 5% of the d(CCGG) 2 molecules are converted into the A form. In the high-salt form (Z form) of d(CGCG) 2, the terminal guanosine was concluded to be in a C2' endo-syn conformation, whereas the internal one is in C3' endo-syn.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

Why double-stranded RNA resists condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.

2014-09-15

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less

Molecular architecture: construction of self-assembled organophosphonate duplexes and their electrochemical characterization.

PubMed

Cattani-Scholz, Anna; Liao, Kung-Ching; Bora, Achyut; Pathak, Anshuma; Hundschell, Christian; Nickel, Bert; Schwartz, Jeffrey; Abstreiter, Gerhard; Tornow, Marc

2012-05-22

Self-assembled monolayers of phosphonates (SAMPs) of 11-hydroxyundecylphosphonic acid, 2,6-diphosphonoanthracene, 9,10-diphenyl-2,6-diphosphonoanthracene, and 10,10'-diphosphono-9,9'-bianthracene and a novel self-assembled organophosphonate duplex ensemble were synthesized on nanometer-thick SiO(2)-coated, highly doped silicon electrodes. The duplex ensemble was synthesized by first treating the SAMP prepared from an aromatic diphosphonic acid to form a titanium complex-terminated one; this was followed by addition of a second equivalent of the aromatic diphosphonic acid. SAMP homogeneity, roughness, and thickness were evaluated by AFM; SAMP film thickness and the structural contributions of each unit in the duplex were measured by X-ray reflection (XRR). The duplex was compared with the aliphatic and aromatic monolayer SAMPs to determine the effect of stacking on electrochemical properties; these were measured by impedance spectroscopy using aqueous electrolytes in the frequency range 20 Hz to 100 kHz, and data were analyzed using resistance-capacitance network based equivalent circuits. For the 11-hydroxyundecylphosphonate SAMP, C(SAMP) = 2.6 ± 0.2 μF/cm(2), consistent with its measured layer thickness (ca. 1.1 nm). For the anthracene-based SAMPs, C(SAMP) = 6-10 μF/cm(2), which is attributed primarily to a higher effective dielectric constant for the aromatic moieties (ε = 5-10) compared to the aliphatic one; impedance spectroscopy measured the additional capacitance of the second aromatic monolayer in the duplex (2ndSAMP) to be C(Ti/2ndSAMP) = 6.8 ± 0.7 μF/cm(2), in series with the first.

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

NASA Technical Reports Server (NTRS)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

Control of the photocatalytic activity of bimetallic complexes of pyropheophorbide-a by nucleic acids.

PubMed

Arian, Dumitru; Kovbasyuk, Larisa; Mokhir, Andriy

2011-12-05

Photocatalytic activity of a photosensitizer (PS) in an oligodeoxyribonucleotide duplex 5'-PS~ODN1/ODN2~Q-3' is inhibited because of close proximity of a quencher Q. The ODN2 in this duplex is selected to be longer than the ODN1. Therefore, in the presence of a nucleic acid (analyte), which is fully complementary to the ODN2 strand, the duplex is decomposed with formation of an analyte/ODN2~Q duplex and a catalytically active, single stranded PS~ODN1. In this way the catalytic activity of the PS can be controlled by the specific nucleic acids. We applied this reaction earlier for the amplified detection of ribonucleic acids in live cells (Arian, D.; Cló, E.; Gothelf, K.; Mokhir, A. Chem.-Eur. J.2010, 16(1), 288). As a photosensitizer (PS) we used In(3+)(pyropheophorbide-a)chloride and as a quencher (Q)--Black-Hole-Quencher-3 (BHQ-3). The In(3+) complex is a highly active photocatalyst in aqueous solution. However, it can coordinate additional ligands containing thiols (e.g., proteins, peptides, and aminoacids), that modulate properties of the complex itself and of the corresponding bio- molecules. These possible interactions can lead to undesired side effects of nucleic acid controlled photocatalysts (PS~ODN1/ODN2∼Q) in live cells. In this work we explored the possibility to substitute the In(3+) complex for those ones of divalent metal ions, Zn(2+) and Pd(2+), which exhibit lower or no tendency to coordinate the fifth ligand. We found that one of the compounds tested (Pd(pyropheophorbide-a) is as potent and as stable photosensitizer as its In(3+) analogue, but does not coordinate additional ligands that makes it more suitable for cellular applications. When the Pd complex was introduced in the duplex PS~ODN1/ODN2~Q as a PS, its photocatalytic activity could be controlled by nucleic acids as efficiently as that of the corresponding In(3+) complex.

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

PubMed Central

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

The usefulness of Duplex Doppler ultrasound in the angiological and dermatological diagnosis of patients with blue toe syndrome.

PubMed

Pawlaczyk, Katarzyna; Gabriel, Marcin; Strzelecka-Węklar, Daria A; Krasiński, Zbigniew; Stanisic, Michal; Gabriel, Zofia; Dzieciuchowicz, Łukasz; Adamski, Zygmunt

2017-10-01

Peripheral microembolism is one of the most frequent causes of acute limb ischemia. In order to effectively prevent relapses it is essential to localize and eliminate the source of embolism. To evaluate the role of Duplex Doppler ultrasound examination in identifying the causes of blue toe syndrome (BTS). The group of 165 patients with clinical symptoms of BTS on their upper limbs ( n = 16) and lower limbs ( n = 149) was investigated. They all underwent Duplex Doppler ultrasound of the major arteries of the extremities, where ischemic changes occurred. Morphological and functional changes which might be potential sources of microembolism were identified in 146 patients. These changes included significant short-length stenoses or unstable atherosclerotic plaque ( n = 73), true aneurysms ( n = 42) and pseudoaneurysms ( n = 17). In 11 cases, pathology of vascular prostheses in the form of anastomotic aneurysms, infection and residual thrombi after fibrinolysis was detected. In all cases, Duplex diagnosis was confirmed by other imaging and intraoperative tests. Duplex Doppler ultrasound of the arteries in the affected limb with a full length view should be the first-line examination in diagnosing patients with BTS. In the absence of hemodynamic blood flow disturbances in the major arteries in patients with symptoms of BTS, it is advisable to start haematological tests to identify/exclude congenital or acquired thrombophilia.

Molecular Recognition and Structural Influences on Function in Bio-nanosystems of Nucleic Acids and Proteins

NASA Astrophysics Data System (ADS)

Sethaphong, Latsavongsakda

This work examines smart material properties of rational self-assembly and molecular recognition found in nano-biosystems. Exploiting the sequence and structural information encoded within nucleic acids and proteins will permit programmed synthesis of nanomaterials and help create molecular machines that may carry out new roles involving chemical catalysis and bioenergy. Responsive to different ionic environments thru self-reorgnization, nucleic acids (NA) are nature's signature smart material; organisms such as viruses and bacteria use features of NAs to react to their environment and orchestrate their lifecycle. Furthermore, nucleic acid systems (both RNA and DNA) are currently exploited as scaffolds; recent applications have been showcased to build bioelectronics and biotemplated nanostructures via directed assembly of multidimensional nanoelectronic devices 1. Since the most stable and rudimentary structure of nucleic acids is the helical duplex, these were modeled in order to examine the influence of the microenvironment, sequence, and cation-dependent perturbations of their canonical forms. Due to their negatively charged phosphate backbone, NA's rely on counterions to overcome the inherent repulsive forces that arise from the assembly of two complementary strands. As a realistic model system, we chose the HIV-TAR helix (PDB ID: 397D) to study specific sequence motifs on cation sequestration. At physiologically relevant concentrations of sodium and potassium ions, we observed sequence based effects where purine stretches were adept in retaining high residency cations. The transitional space between adenine and guanosine nucleotides (ApG step) in a sequence proved the most favorable. This work was the first to directly show these subtle interactions of sequence based cationic sequestration and may be useful for controlling metallization of nucleic acids in conductive nanowires. Extending the study further, we explored the degree to which the structure of NA duplexes alone interacted with cations distinct from a specific sequence. Under physiologically relevant conditions, a duplex of RNA polyguanine-polycitidine was highly responsive and able to sequester cations to the middle of the purine stretches. The least responsive structure was a DNA polyadenine-polythymine duplex. A random sequence DNA duplex contorted into an RNA-like helix resulted in cationic dynamics similar to RNA systems. These studies showed that cation diffusive binding events in nucleic acid duplex structures are sequence specific and heavily influenced by structural aspects helical forms to account for much of the differences observed. Although structural information in nucleic acids is encoded within their sequence, linking amino acid sequence to protein structure is murkier; the structural information within proteins is encoded by the folding process itself: a complex phenomenon driven toward the equilibrium state of the active conformation. Upwards of two thirds of a protein's sequence can be substituted with similar amino acids without significantly perturbing its function; conserved residues of about 10% seem to be vital; since evolutionary selection pressure in proteins operates 3-dimenionally, a linear sequence is partially informative. We explored this problem by folding de-novo the cytosolic portion of the membrane protein, cellulose synthase, CESA1 from upland cotton, Gossypium hirsutum (Ghcesa1). The cytoplasmic region was generated by homology modeling and refined with molecular dynamics. These mutations impair local structural flexibility which likely results in cellulose that is produced at a lower rate and is less crystalline. Additional modeling of fragments of cellulose synthases from the model plant, Arabidopsis thaliana, offered novel insights into the function of conserved cytosolic domains within plant cellulose synthases. Transport mechanisms related to the transmembrane region revealed significant differences between plants and a bacterial complex. These studies generated possible mutations that may allow for the creation of new synthases and identified other avenues of research in order to develop technologies that may alter the crystallinity and other useful properties of cellulose. 1. Karplus, K., SAM-T08, HMM-based protein structure prediction. Nucleic Acids Research, 2009. 37: p. W492-W497.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

pH-independent triple-helix formation with 6-oxocytidine as cytidine analogue.

PubMed

Parsch, U; Engels, J W

2000-07-03

The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap.

Relationship between cavitation and loss of echogenicity from ultrasound contrast agents

NASA Astrophysics Data System (ADS)

Radhakrishnan, Kirthi; Bader, Kenneth B.; Haworth, Kevin J.; Kopechek, Jonathan A.; Raymond, Jason L.; Huang, Shao-Ling; McPherson, David D.; Holland, Christy K.

2013-09-01

Ultrasound contrast agents (UCAs) have the potential to nucleate cavitation and promote both beneficial and deleterious bioeffects in vivo. Previous studies have elucidated the pulse-duration-dependent pressure amplitude threshold for rapid loss of echogenicity due to UCA fragmentation. Previous studies have demonstrated that UCA fragmentation was concomitant with inertial cavitation. The purpose of this study was to evaluate the relationship between stable and inertial cavitation thresholds and loss of echogenicity of UCAs as a function of pulse duration. Determining the relationship between cavitation thresholds and loss of echogenicity of UCAs would enable monitoring of cavitation based upon the onscreen echogenicity in clinical applications. Two lipid-shelled UCAs, echogenic liposomes (ELIP) and Definity®, were insonified by a clinical ultrasound scanner in duplex spectral Doppler mode at four pulse durations (‘sample volumes’) in both a static system and a flow system. Cavitation emissions from the UCAs insonified by Doppler pulses were recorded using a passive cavitation detection system and stable and inertial cavitation thresholds ascertained. Loss of echogenicity from ELIP and Definity® was assessed within regions of interest on B-mode images. A numerical model based on UCA rupture predicted the functional form of the loss of echogenicity from ELIP and Definity®. Stable and inertial cavitation thresholds were found to have a weak dependence on pulse duration. Stable cavitation thresholds were lower than inertial cavitation thresholds. The power of cavitation emissions was an exponential function of the loss of echogenicity over the investigated range of acoustic pressures. Both ELIP and Definity® lost more than 80% echogenicity before the onset of stable or inertial cavitation. Once this level of echogenicity loss occurred, both stable and inertial cavitation were detected in the physiologic flow phantom. These results imply that stable and inertial cavitation are necessary in order to trigger complete loss of echogenicity acoustically from UCAs and this finding can be used when planning diagnostic and therapeutic applications.

Relationship between cavitation and loss of echogenicity from ultrasound contrast agents

PubMed Central

Radhakrishnan, Kirthi; Bader, Kenneth B; Haworth, Kevin J; Kopechek, Jonathan A; Raymond, Jason L; Huang, Shao-Ling; McPherson, David D; Holland, Christy K

2014-01-01

Ultrasound contrast agents (UCAs) have the potential to nucleate cavitation and promote both beneficial and deleterious bioeffects in vivo. Previous studies have elucidated the pulse-duration dependent pressure amplitude threshold for rapid loss of echogenicity due to UCA fragmentation. Previous studies have demonstrated that UCA fragmentation was concomitant with inertial cavitation. The purpose of this study was to evaluate the relationship between stable and inertial cavitation thresholds and loss of echogenicity of UCAs as a function of pulse duration. Determining the relationship between cavitation thresholds and loss of echogenicity of UCAs would enable monitoring of cavitation based upon the on-screen echogenicity in clinical applications. Two lipid-shelled UCAs, echogenic liposomes (ELIP) and Definity®, were insonified by a clinical ultrasound scanner in duplex spectral Doppler mode at four pulse durations (“sample volumes”) in both a static system and a flow system. Cavitation emissions from the UCAs insonified by Doppler pulses were recorded using a passive cavitation detection system and stable and inertial cavitation thresholds ascertained. Loss of echogenicity from ELIP and Definity® was assessed within regions of interest on B-mode images. A numerical model based on UCA rupture predicted the functional form of the loss of echogenicity from ELIP and Definity®. Stable and inertial cavitation thresholds were found to have a weak dependence on pulse duration. Stable cavitation thresholds were lower than inertial cavitation thresholds. The power of cavitation emissions was an exponential function of the loss of echogenicity over the investigated range of acoustic pressures. Both ELIP and Definity® lost more than 80% echogenicity before the onset of stable or inertial cavitation. Once this level of echogenicity loss occurred, both stable and inertial cavitation were detected in the physiologic flow phantom. These results imply that stable and inertial cavitation are necessary in order to trigger complete loss of echogenicity acoustically from UCAs and this finding can be used when planning diagnostic and therapeutic applications. PMID:24002637

Relationship between cavitation and loss of echogenicity from ultrasound contrast agents.

PubMed

Radhakrishnan, Kirthi; Bader, Kenneth B; Haworth, Kevin J; Kopechek, Jonathan A; Raymond, Jason L; Huang, Shao-Ling; McPherson, David D; Holland, Christy K

2013-09-21

Ultrasound contrast agents (UCAs) have the potential to nucleate cavitation and promote both beneficial and deleterious bioeffects in vivo. Previous studies have elucidated the pulse-duration-dependent pressure amplitude threshold for rapid loss of echogenicity due to UCA fragmentation. Previous studies have demonstrated that UCA fragmentation was concomitant with inertial cavitation. The purpose of this study was to evaluate the relationship between stable and inertial cavitation thresholds and loss of echogenicity of UCAs as a function of pulse duration. Determining the relationship between cavitation thresholds and loss of echogenicity of UCAs would enable monitoring of cavitation based upon the onscreen echogenicity in clinical applications. Two lipid-shelled UCAs, echogenic liposomes (ELIP) and Definity®, were insonified by a clinical ultrasound scanner in duplex spectral Doppler mode at four pulse durations ('sample volumes') in both a static system and a flow system. Cavitation emissions from the UCAs insonified by Doppler pulses were recorded using a passive cavitation detection system and stable and inertial cavitation thresholds ascertained. Loss of echogenicity from ELIP and Definity® was assessed within regions of interest on B-mode images. A numerical model based on UCA rupture predicted the functional form of the loss of echogenicity from ELIP and Definity®. Stable and inertial cavitation thresholds were found to have a weak dependence on pulse duration. Stable cavitation thresholds were lower than inertial cavitation thresholds. The power of cavitation emissions was an exponential function of the loss of echogenicity over the investigated range of acoustic pressures. Both ELIP and Definity® lost more than 80% echogenicity before the onset of stable or inertial cavitation. Once this level of echogenicity loss occurred, both stable and inertial cavitation were detected in the physiologic flow phantom. These results imply that stable and inertial cavitation are necessary in order to trigger complete loss of echogenicity acoustically from UCAs and this finding can be used when planning diagnostic and therapeutic applications.

Smectic phase in suspensions of gapped DNA duplexes

DOE PAGES

Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; ...

2016-11-15

Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, in spite of the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue thatmore » this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. These results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.« less

Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.

PubMed Central

Wilson, J H

1979-01-01

Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028

Characterization of microstructure and texture across dissimilar super duplex/austenitic stainless steel weldment joint by super duplex filler metal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eghlimi, Abbas, E-mail: a.eghlimi@ma.iut.ac.ir; Shamanian, Morteza; Eskandarian, Masoomeh

In the present paper, microstructural changes across an as-welded dissimilar austenitic/duplex stainless steel couple welded by a super duplex stainless steel filler metal using gas tungsten arc welding process is characterized with optical microscopy and electron back-scattered diffraction techniques. Accordingly, variations of microstructure, texture, and grain boundary character distribution of base metals, heat affected zones, and weld metal were investigated. The results showed that the weld metal, which was composed of Widmanstätten austenite side-plates and allotriomorphic grain boundary austenite morphologies, had the weakest texture and was dominated by low angle boundaries. The welding process increased the ferrite content but decreasedmore » the texture intensity at the heat affected zone of the super duplex stainless steel base metal. In addition, through partial ferritization, it changed the morphology of elongated grains of the rolled microstructure to twinned partially transformed austenite plateaus scattered between ferrite textured colonies. However, the texture of the austenitic stainless steel heat affected zone was strengthened via encouraging recrystallization and formation of annealing twins. At both interfaces, an increase in the special character coincident site lattice boundaries of the primary phase as well as a strong texture with <100> orientation, mainly of Goss component, was observed. - Graphical abstract: Display Omitted - Highlights: • Weld metal showed local orientation at microscale but random texture at macroscale. • Intensification of <100> orientated grains was observed adjacent to the fusion lines. • The austenite texture was weaker than that of the ferrite in all duplex regions. • Welding caused twinned partially transformed austenites to form at SDSS HAZ. • At both interfaces, the ratio of special CSL boundaries of the primary phase increased.« less

Interpretation of the Seattle uplift, Washington, as a passive-roof duplex

USGS Publications Warehouse

Brocher, T.M.; Blakely, R.J.; Wells, R.E.

2004-01-01

We interpret seismic lines and a wide variety of other geological and geophysical data to suggest that the Seattle uplift is a passive-roof duplex. A passive-roof duplex is bounded top and bottom by thrust faults with opposite senses of vergence that form a triangle zone at the leading edge of the advancing thrust sheet. In passive-roof duplexes the roof thrust slips only when the floor thrust ruptures. The Seattle fault is a south-dipping reverse fault forming the leading edge of the Seattle uplift, a 40-km-wide fold-and-thrust belt. The recently discovered, north-dipping Tacoma reverse fault is interpreted as a back thrust on the trailing edge of the belt, making the belt doubly vergent. Floor thrusts in the Seattle and Tacoma fault zones, imaged as discontinuous reflections, are interpreted as blind faults that flatten updip into bedding plane thrusts. Shallow monoclines in both the Seattle and Tacoma basins are interpreted to overlie the leading edges of thrust-bounded wedge tips advancing into the basins. Across the Seattle uplift, seismic lines image several shallow, short-wavelength folds exhibiting Quaternary or late Quaternary growth. From reflector truncation, several north-dipping thrust faults (splay thrusts) are inferred to core these shallow folds and to splay upward from a shallow roof thrust. Some of these shallow splay thrusts ruptured to the surface in the late Holocene. Ages from offset soils in trenches across the fault scarps and from abruptly raised shorelines indicate that the splay, roof, and floor thrusts of the Seattle and Tacoma faults ruptured about 1100 years ago.

PNPase autocontrols its expression by degrading a double-stranded structure in the pnp mRNA leader

PubMed Central

Jarrige, Anne-Charlotte; Mathy, Nathalie; Portier, Claude

2001-01-01

Polynucleotide phosphorylase synthesis is autocontrolled at a post-transcriptional level in an RNase III-dependent mechanism. RNase III cleaves a long stem–loop in the pnp leader, which triggers pnp mRNA instability, resulting in a decrease in the synthesis of polynucleotide phosphorylase. The staggered cleavage by RNase III removes the upper part of the stem–loop structure, creating a duplex with a short 3′ extension. Mutations or high temperatures, which destabilize the cleaved stem–loop, decrease expression of pnp, while mutations that stabilize the stem increase expression. We propose that the dangling 3′ end of the duplex created by RNase III constitutes a target for polynucleotide phosphorylase, which binds to and degrades the upstream half of this duplex, hence inducing pnp mRNA instability. Consistent with this interpretation, a pnp mRNA starting at the downstream RNase III processing site exhibits a very low level of expression, regardless of the presence of polynucleotide phosphorylase. Moreover, using an in vitro synthesized pnp leader transcript, it is shown that polynucleotide phosphorylase is able to digest the duplex formed after RNase III cleavage. PMID:11726520

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed Central

Berressem, R; Engels, J W

1995-01-01

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed

Berressem, R; Engels, J W

1995-09-11

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Crystal structure of a poly(rA) staggered zipper at acidic pH: evidence that adenine N1 protonation mediates parallel double helix formation

DOE PAGES

Gleghorn, Michael L.; Zhao, Jianbo; Turner, Douglas H.; ...

2016-06-10

We have solved at 1.07 Å resolution the X-ray crystal structure of a polyriboadenylic acid (poly(rA)) parallel and continuous double helix. Fifty-nine years ago, double helices of poly(rA) were first proposed to form at acidic pH. Here, we show that 7-mer oligo(rA), i.e. rA 7, hybridizes and overlaps in all registers at pH 3.5 to form stacked double helices that span the crystal. Under these conditions, rA 7 forms well-ordered crystals, whereas rA 6 forms fragile crystalline-like structures, and rA 5, rA 8 and rA 11 fail to crystallize. Our findings support studies from ~50 years ago: one showed usingmore » spectroscopic methods that duplex formation at pH 4.5 largely starts with rA 7 and begins to plateau with rA 8; another proposed a so-called ‘staggered zipper’ model in which oligo(rA) strands overlap in multiple registers to extend the helical duplex. While never shown, protonation of adenines at position N1 has been hypothesized to be critical for helix formation. Bond angles in our structure suggest that N1 is protonated on the adenines of every other rAMP–rAMP helix base pair. Lastly, our data offer new insights into poly(rA) duplex formation that may be useful in developing a pH sensor.« less

Crystal structure of a poly(rA) staggered zipper at acidic pH: evidence that adenine N1 protonation mediates parallel double helix formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gleghorn, Michael L.; Zhao, Jianbo; Turner, Douglas H.

We have solved at 1.07 Å resolution the X-ray crystal structure of a polyriboadenylic acid (poly(rA)) parallel and continuous double helix. Fifty-nine years ago, double helices of poly(rA) were first proposed to form at acidic pH. Here, we show that 7-mer oligo(rA), i.e. rA 7, hybridizes and overlaps in all registers at pH 3.5 to form stacked double helices that span the crystal. Under these conditions, rA 7 forms well-ordered crystals, whereas rA 6 forms fragile crystalline-like structures, and rA 5, rA 8 and rA 11 fail to crystallize. Our findings support studies from ~50 years ago: one showed usingmore » spectroscopic methods that duplex formation at pH 4.5 largely starts with rA 7 and begins to plateau with rA 8; another proposed a so-called ‘staggered zipper’ model in which oligo(rA) strands overlap in multiple registers to extend the helical duplex. While never shown, protonation of adenines at position N1 has been hypothesized to be critical for helix formation. Bond angles in our structure suggest that N1 is protonated on the adenines of every other rAMP–rAMP helix base pair. Lastly, our data offer new insights into poly(rA) duplex formation that may be useful in developing a pH sensor.« less

Formation Mechanism of CaS-Bearing Inclusions and the Rolling Deformation in Al-Killed, Low-Alloy Steel with Ca Treatment

NASA Astrophysics Data System (ADS)

Xu, Guang; Jiang, Zhouhua; Li, Yang

2016-08-01

The existing form of CaS inclusion in Ca-treated, Al-killed steel during secondary refining process was investigated with scanning electron microscopy and an energy-dispersive spectrometer (EDS). The results of 12 heats industrial tests showed that CaS has two kinds of precipitation forms. One form takes place by the direct reaction of Ca and S, and the other takes place by the reaction of CaO in calcium aluminates with dissolved Al and S in liquid steel. Thermodynamic research for different precipitation modes of CaS under different temperature was carried out. In particular, CaO-Al2O3-CaS isothermal section diagrams and component activities of calcium aluminates were calculated by the thermodynamic software FactSage. By thermodynamic calculation, a precipitation-area diagram of oxide-sulfide duplex inclusion was established by fixing the sulfur content. The quantity of CaS, which was precipitated in a reaction between [Al], [S] and (CaO), can be calculated and predicted based on the precipitation-area diagram of oxide-sulfide duplex inclusion. Electron probe microanalysis and EDS were used for observing rolling deformation of different types of CaS-bearing inclusions during the rolling process. Low modification of calcium aluminates wrapped by CaS has different degrees of harm to steel in the rolling process. A thick CaS layer can prevent some fragile calcium aluminates from being crushed during the rolling process. Some oxide-sulfide duplex inclusion contains little CaS performed better deformation during the rolling process, but when CaS in oxide-sulfide duplex inclusion becomes more, it will cause the whole inclusion to lose plastic yielding ability. The plastic deformation region of CaS-bearing inclusion in a CaO-Al2O3-CaS isothermal section diagram is confirmed.

DNA oligonucleotide duplexes containing intramolecular platinated cross-links: energetics, hydration, sequence, and ionic effects.

PubMed

Kankia, Besik I; Soto, Ana Maria; Burns, Nicole; Shikiya, Ronald; Tung, Chang-Shung; Marky, Luis A

2002-11-05

The anticancer activity of cisplatin arises from its ability to bind covalently to DNA, forming primarily intrastrand cross-links to adjacent purine residues; the most common adducts involve d(GpG) (65%) and d(ApG) (25%) intrastrand cross-links. The incorporation of these platinum adducts in a B-DNA helix induces local distortions, causing bending and unwinding of the DNA. In this work, we used temperature-dependent UV spectroscopy to investigate the unfolding thermodynamics, and associated ionic effects, of two sets of DNA decamer duplexes containing either cis-[Pt(NH(3))(2)[d(GpG

Structural studies of crystalline forms of triamterene with carboxylic acid, GRAS and API molecules

PubMed Central

Rehman, Abida

2018-01-01

Pharmaceutical salt solvates (dimethyl sulfoxide, DMSO) of the drug triamterene with the coformers acetic, succinic, adipic, pimelic, azelaic and nicotinic acid and ibuprofen are prepared by liquid-assisted grinding and solvent-evaporative crystallization. The modified ΔpK a rule as proposed by Cruz-Cabeza [(2012 ▸). CrystEngComm, 14, 6362–6365] is in close agreement with the results of this study. All adducts were characterized by X-ray diffraction and thermal analytical techniques, including single-crystal X-ray diffraction, powder X-ray diffraction, differential scanning calorimetry and thermal gravimetric analysis. Hydrogen-bonded motifs combined to form a variety of extended tapes and sheets. Analysis of the crystal structures showed that all adducts existed as salt solvates and contained the amino­pyridinium–carboxyl­ate heterodimer, except for the solvate containing triamterene, ibuprofen and DMSO, as a result of the presence of a strong and stable hemitriamterenium duplex. A search of the Cambridge Structural Database (CSD 5.36, Version 1.18) to determine the frequency of occurrence of the putative supramolecular synthons found in this study showed good agreement with previous work. PMID:29755747

Helicases as molecular motors: An insight

NASA Astrophysics Data System (ADS)

Tuteja, Narendra; Tuteja, Renu

2006-12-01

Helicases are one of the smallest motors of biological system, which harness the chemical free energy of ATP hydrolysis to catalyze the opening of energetically stable duplex nucleic acids and thereby are involved in almost all aspect of nucleic acid metabolism including replication, repair, recombination, transcription, translation, and ribosome biogenesis. Basically, they break the hydrogen bonding between the duplex helix and translocate unidirectionally along the bound strand. Mostly all the helicases contain some conserved signature motifs, which act as an engine to power the unwinding. After the discovery of the first prokaryotic DNA helicase from Escherichia coli bacteria in 1976 and the first eukaryotic one from the lily plant in 1978, many more (>100) have been isolated. All the helicases share some common properties, including nucleic acid binding, NTP hydrolysis and unwinding of the duplex. Many helicases have been crystallized and their structures have revealed an underlying common structural fold for their function. The defects in helicases gene have also been reported to be responsible for variety of human genetic disorders, which can lead to cancer, premature aging or mental retardation. Recently, a new role of a helicase in abiotic stress signaling in plant has been discovered. Overall, helicases act as essential molecular tools for cellular machinery and help in maintaining the integrity of genome. Here an overview of helicases has been covered which includes history, biochemical assay, properties, classification, role in human disease and mechanism of unwinding and translocation.

Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

PubMed

Nakano, Shu-ichi; Sugimoto, Naoki

2014-08-05

The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

Membraneless organelles can melt nucleic acid duplexes and act as biomolecular filters

NASA Astrophysics Data System (ADS)

Nott, Timothy J.; Craggs, Timothy D.; Baldwin, Andrew J.

2016-06-01

Membraneless organelles are cellular compartments made from drops of liquid protein inside a cell. These compartments assemble via the phase separation of disordered regions of proteins in response to changes in the cellular environment and the cell cycle. Here we demonstrate that the solvent environment within the interior of these cellular bodies behaves more like an organic solvent than like water. One of the most-stable biological structures known, the DNA double helix, can be melted once inside the liquid droplet, and simultaneously structures formed from regulatory single-stranded nucleic acids are stabilized. Moreover, proteins are shown to have a wide range of absorption or exclusion from these bodies, and can act as importers for otherwise-excluded nucleic acids, which suggests the existence of a protein-mediated trafficking system. A common strategy in organic chemistry is to utilize different solvents to influence the behaviour of molecules and reactions. These results reveal that cells have also evolved this capability by exploiting the interiors of membraneless organelles.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pallan, Pradeep S.; Prakash, Thazha P.; Li, Feng

Crystal structures of A-form and B-form DNA duplexes containing 2'-S-methyl-uridines reveal that the modified residues adopt a RNA-like C3'-endo pucker, illustrating that the replacement of electronegative oxygen at the 2'-carbon of RNA by sulfur does not appear to fundamentally alter the conformational preference of the sugar in the oligonucleotide context and sterics trump stereoelectronics.

Individual Basepair Stability of DNA and RNA Studied by NMR-Detected Solvent Exchange

PubMed Central

Steinert, Hannah S.; Rinnenthal, Jörg; Schwalbe, Harald

2012-01-01

In this study, we have optimized NMR methodology to determine the thermodynamic parameters of basepair opening in DNA and RNA duplexes by characterizing the temperature dependence of imino proton exchange rates of individual basepairs. Contributions of the nuclear Overhauser effect to exchange rates measured with inversion recovery experiments are quantified, and the influence of intrinsic and external catalysis exchange mechanisms on the imino proton exchange rates is analyzed. Basepairs in DNA and RNA have an approximately equal stability, and the enthalpy and entropy values of their basepair dissociation are correlated linearly. Furthermore, the compensation temperature, Tc, which is derived from the slope of the correlation, coincides with the melting temperature, and duplex unfolding occurs at that temperature where all basepairs are equally thermodynamically stable. The impact of protium-deuterium exchange of the imino hydrogen on the free energy of RNA basepair opening is investigated, and it is found that two A·U basepairs show distinct fractionation factors. PMID:22713572

Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

PubMed

Cubero, Elena; Luque, F Javier; Orozco, Modesto

2006-02-01

A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

PubMed Central

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2006-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute

PubMed Central

Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio

2016-01-01

Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson–Crick base-pairing even in the 3′-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5′ base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region. PMID:27325485

Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute.

PubMed

Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio

2016-06-21

Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson-Crick base-pairing even in the 3'-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5' base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region.

The impact of carbon-13 and deuterium on relative quantification of proteins using stable isotope diethyl labeling.

PubMed

Koehler, Christian J; Arntzen, Magnus Ø; Thiede, Bernd

2015-05-15

Stable isotopic labeling techniques are useful for quantitative proteomics. A cost-effective and convenient method for diethylation by reductive amination was established. The impact using either carbon-13 or deuterium on quantification accuracy and precision was investigated using diethylation. We established an effective approach for stable isotope labeling by diethylation of amino groups of peptides. The approach was validated using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) and nanospray liquid chromatography/electrospray ionization (nanoLC/ESI)-ion trap/orbitrap for mass spectrometric analysis as well as MaxQuant for quantitative data analysis. Reaction conditions with low reagent costs, high yields and minor side reactions were established for diethylation. Furthermore, we showed that diethylation can be applied to up to sixplex labeling. For duplex experiments, we compared diethylation in the analysis of the proteome of HeLa cells using acetaldehyde-(13) C(2)/(12) C(2) and acetaldehyde-(2) H(4)/(1) H(4). Equal numbers of proteins could be identified and quantified; however, (13) C(4)/(12) C(4) -diethylation revealed a lower variance of quantitative peptide ratios within proteins resulting in a higher precision of quantified proteins and less falsely regulated proteins. The results were compared with dimethylation showing minor effects because of the lower number of deuteriums. The described approach for diethylation of primary amines is a cost-effective and accurate method for up to sixplex relative quantification of proteomes. (13) C(4)/(12) C(4) -diethylation enables duplex quantification based on chemical labeling without using deuterium which reduces identification of false-negatives and increases the quality of the quantification results. Copyright © 2015 John Wiley & Sons, Ltd.

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

PubMed

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III-aided cycling amplification.

PubMed

Zeng, Yan; Wan, Yi; Zhang, Dun; Qi, Peng

2015-01-01

A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III (Exo-III) aided cycling amplification has been developed. This magneto-DNA duplex probe contains a partly hybrid fluorophore-modified capture probe and a fluorophore-modified signal probe with magnetic microparticle as carrier. In the presence of a perfectly matched target bacterial DNA, blunt 3'-terminus of the capture probe is formed, activating the Exo-III aided cycling amplification. Thus, Exo-III catalyzes the stepwise removal of mononucleotides from this terminus, releasing both fluorophore-modified signal probe, fluorescent dyes of the capture probe and target DNA. The released target DNA then starts a new cycle, while released fluorescent fragments are recovered with magnetic separation for fluorescence signal collection. This system exhibited sensitive detection of bacterial DNA, with a detection limit of 14 pM because of the unique cleavage function of Exo-III, high fluorescence intensity, and separating function of magneto-DNA duplex probes. Besides this sensitivity, this strategy exhibited excellent selectivity with mismatched bacterial DNA targets and other bacterial species targets and good applicability in real seawater samples, hence, this strategy could be potentially used for qualitative and quantitative analysis of bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Quencher-free molecular beacon tethering 7-hydroxycoumarin detects targets through protonation/deprotonation.

PubMed

Kashida, Hiromu; Yamaguchi, Kyohei; Hara, Yuichi; Asanuma, Hiroyuki

2012-07-15

In this study, we synthesized a simple but efficient quencher-free molecular beacon tethering 7-hydroxycoumarin on D-threoninol based on its pK(a) change. The pK(a) of 7-hydroxycoumarin in a single strand was determined as 8.8, whereas that intercalated in the duplex was over 10. This large pK(a) shift (more than 1.2) upon hybridization could be attributed to the anionic and hydrophobic microenvironment inside the DNA duplex. Because 7-hydroxycoumarin quenches its fluorescence upon protonation, the emission intensity of the duplex at pH 8.5 was 1/15 that of the single strand. We applied this quenching mechanism to the preparation of a quencher-free molecular beacon by introducing the dye into the middle of the stem part. In the absence of the target, the stem region formed a duplex and fluorescence was quenched. However, when the target was added, the molecular beacon opened and the dye was deprotonated. As a result, the emission intensity of the molecular beacon with the target was 10 times higher than that without the target. Accordingly, a quencher-free molecular beacon utilizing the pK(a) change was successfully developed. Copyright © 2012 Elsevier Ltd. All rights reserved.

Insights into Watson–Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A

PubMed Central

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.

2017-01-01

Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571

Compact, precision duplex bearing mount for high vibration environments

NASA Technical Reports Server (NTRS)

Bouzakis, George Elias (Inventor); Bowman, James Edward (Inventor); Devine, Edward J. (Inventor); Joffe, Benjamin (Inventor); Segal, Kenneth Neal (Inventor); Webb, Merritt J. (Inventor)

2002-01-01

A duplex bearing mount including at least one duplex bearing having an inner race and an outer race, the inner race disposed within the outer race and being rotatable relative to the outer race about an axis, the inner race having substantially no relative movement relative to the outer race in at least one direction along the axis, the inner and outer races each having first and second axial faces which are respectively located at the same axial end of the duplex bearing. The duplex bearing is radially supported by a housing, and a shaft extends through the inner race, the shaft radially and axially supported by the inner race. A first retainer is connected to the housing and engages the first axial surface of a bearing race, the movement of which race in a first direction along the axis being constrained by the first retainer. A second, resilient retainer is connected to the housing or the shaft and is deflected through engagement with the second axial face of a bearing race, the movement of which race in a second direction along the axis, opposite to the first direction, being constrained by the deflected second retainer. The bearing is preloaded by its being clamped between the first and second retainers, and the second retainer forms at least a portion of a spring having the characteristic of a substantially constant force value correlating to a range of various deflection values, whereby the preload of the bearing is substantially unaffected by variations in the deflection of the second retainer.

Study of Sigma Phase in Duplex SAF 2507

NASA Astrophysics Data System (ADS)

Fellicia, D. M.; Sutarsis; Kurniawan, B. A.; Wulanari, D.; Purniawan, A.; Wibisono, A. T.

2017-05-01

Super duplex stainless steel is one of the stainless steel which has a combination between high strength properties and excellent corrosion resistance. However, the resistance can decrease by precipitation of sigma phase which is formed at high temperature, for example after welding processes. A series of experiments has been performed to study the effect of solution annealing to existence of sigma phase on super duplex SAF 2507. Variations of solution-annealing temperatures were 1000 °C, 1065 °C and 1125 °C with holding time of 15 and 30 minutes for each temperature. Effect of solution annealing process was characterized by using XRD, SEM, and Optical Microscopy. The result showed precipitation of sigma phase completely dissolved at 1065 °C and 1125 °C because it reformed to austenite. After it was heated at 1065 °C, chromium carbide appeared in ferrite site and grain boundary. The amount of chromium carbide increased with the increasing of solution annealing temperature.

The Mentawai forearc sliver off Sumatra: A model for a strike-slip duplex at a regional scale

NASA Astrophysics Data System (ADS)

Berglar, Kai; Gaedicke, Christoph; Ladage, Stefan; Thöle, Hauke

2017-07-01

At the Sumatran oblique convergent margin the Mentawai Fault and Sumatran Fault zones accommodate most of the trench parallel component of strain. These faults bound the Mentawai forearc sliver that extends from the Sunda Strait to the Nicobar Islands. Based on multi-channel reflection seismic data, swath bathymetry and high resolution sub-bottom profiling we identified a set of wrench faults obliquely connecting the two major fault zones. These wrench faults separate at least four horses of a regional strike-slip duplex forming the forearc sliver. Each horse comprises an individual basin of the forearc with differing subsidence and sedimentary history. Duplex formation started in Mid/Late Miocene southwest of the Sunda Strait. Initiation of new horses propagated northwards along the Sumatran margin over 2000 km until Early Pliocene. These results directly link strike-slip tectonics to forearc evolution and may serve as a model for basin evolution in other oblique subduction settings.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

A 30 Mbps in-plane full-duplex light communication using a monolithic GaN photonic circuit

NASA Astrophysics Data System (ADS)

Gao, Xumin; Yuan, Jialei; Yang, Yongchao; Li, Yuanhang; Yuan, Wei; Zhu, Guixia; Zhu, Hongbo; Feng, Meixin; Sun, Qian; Liu, Yuhuai; Wang, Yongjin

2017-07-01

We propose, fabricate and characterize photonic integration of a InGaN/GaN multiple-quantum-well light-emitting diode (MQW-LED), waveguide, ring resonator and InGaN/GaN MQW-photodiode on a single chip, in which the photonic circuit is suspended by the support beams. Both experimental observations and simulation results illustrate the manipulation of in-plane light coupling and propagation by the waveguide and the ring resonator. The monolithic photonic circuit forms an in-plane data communication system using visible light. When the two suspended InGaN/GaN MQW-diodes simultaneously serve as the transmitter and the receiver, an in-plane full-duplex light communication is experimentally demonstrated with a transmission rate of 30 Mbps, and the superimposed signals are extracted using the self-interference cancellation method. The suspended photonic circuit creates new possibilities for exploring the in-plane full-duplex light communication and manufacturing complex GaN-based monolithic photonic integrations.

A 2',2'-disulfide-bridged dinucleotide conformationally locks RNA hairpins.

PubMed

Gauthier, Florian; Beltran, Frédéric; Biscans, Annabelle; Debart, Françoise; Dupouy, Christelle; Vasseur, Jean-Jacques

2018-05-02

The synthesis and the impact of a disulfide bridge between 2'-O-positions of two adjacent nucleotides in an RNA duplex and in the loop of RNA hairpins are reported. The incorporation of this 2',2'-disulfide (S-S) bridge enabled thermal and enzymatic stabilization of the hairpin depending on its position in the loop. The influence of the disulfide bridge on RNA folding was studied at the HIV Dimerization Initiation Site (DIS) as an RNA sequence model. We have shown that this S-S bridge locked the hairpin form, whereas the extended duplex form was generated after the reduction of the disulfide bond in the presence of tris(2-carboxyethyl)phosphine or glutathione. Thus, the S-S bridge can be useful for understanding RNA folding; an RNA molecular beacon locked by an S-S bridge was also investigated as a sensor for the detection of glutathione.

Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

PubMed Central

Phan, Anh Tuân; Mergny, Jean-Louis

2002-01-01

Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

Adeno-associated virus rep protein synthesis during productive infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Redemann, B.E.; Mendelson, E.; Carter, B.J.

1989-02-01

Adeno-associated virus (AAV) Rep proteins mediate viral DNA replication and can regulate expression from AAV genes. The authors studied the kinetics of synthesis of the four Rep proteins, Rep78, Rep68, Rep52, and Rep40, during infection of human 293 or KB cells with AAV and helper adenovirus by in vivo labeling with (/sup 35/S)methionine, immunoprecipitation, and immunoblotting analyses. Rep78 and Rep52 were readily detected concomitantly with detection of viral monomer duplex DNA replicating about 10 to 12 h after infection, and Rep68 and Rep40 were detected 2 h later. Rep78 and Rep52 were more abundant than Rep68 and Rep40 owing tomore » a higher synthesis rate throughout the infectious cycle. In some experiments, very low levels of Rep78 could be detected as early as 4 h after infection. The synthesis rates of Rep proteins were maximal between 14 and 24 h and then decreased later after infection. Isotopic pulse-chase experiments showed that each of the Rep proteins was synthesized independently and was stable for at least 15 h. A slower-migrating, modified form of Rep78 was identified late after infection. AAV capsid protein synthesis was detected at 10 to 12 h after infection and also exhibited synthesis kinetics similar to those of the Rep proteins. AAV DNA replication showed at least two clearly defined stages. Bulk duplex replicating DNA accumulation began around 10 to 12 h and reached a maximum level at about 20 h when Rep and capsid protein synthesis was maximal. Progeny single-stranded DNA accumulation began about 12 to 13 h, but most of this DNA accumulated after 24 h when Rep and capsid protein synthesis had decreased.« less

Renal pelvis urothelial carcinoma of the upper moiety in complete right renal duplex: a case report.

PubMed

Zhang, Yiran; Yu, Quanfeng; Zhang, Zhihong; Liu, Ranlu; Xu, Yong

2015-01-01

Urothelial carcinoma (UC) originated from renal pelvis is the common tumor of the urinary system, however, neoplasia of the renal pelvis in duplex kidneys is extremely rare, especially in the complete renal and ureteral duplex cases. We present the first case of renal pelvis UC of the upper moiety in a complete right renal duplex. This male patient has bilateral complete renal and ureteral duplex. To the best of our knowledge, this is the first reported case of renal pelvis UC in a complete renal duplex system. After this experience we feel that the diagnosis of renal pelvis UC in duplex kidneys is not so easy, and once the diagnosis is determined, the whole renal duplex units and bladder cuff or ectopic orifice should be excised radically.

A process model for the heat-affected zone microstructure evolution in duplex stainless steel weldments: Part I. the model

NASA Astrophysics Data System (ADS)

Hemmer, H.; Grong, Ø.

1999-11-01

The present investigation is concerned with modeling of the microstructure evolution in duplex stainless steels under thermal conditions applicable to welding. The important reactions that have been modeled are the dissolution of austenite during heating, subsequent grain growth in the delta ferrite regime, and finally, the decomposition of the delta ferrite to austenite during cooling. As a starting point, a differential formulation of the underlying diffusion problem is presented, based on the internal-state variable approach. These solutions are later manipulated and expressed in terms of the Scheil integral in the cases where the evolution equation is separable or can be made separable by a simple change of variables. The models have then been applied to describe the heat-affected zone microstructure evolution during both thick-plate and thin-plate welding of three commercial duplex stainless steel grades: 2205, 2304, and 2507. The results may conveniently be presented in the form of novel process diagrams, which display contours of constant delta ferrite grain size along with information about dissolution and reprecipitation of austenite for different combinations of weld input energy and peak temperature. These diagrams are well suited for quantitative readings and illustrate, in a condensed manner, the competition between the different variables that lead to structural changes during welding of duplex stainless steels.

Adenine radicals generated in alternating AT duplexes by direct absorption of low-energy UV radiation.

PubMed

Banyasz, Akos; Ketola, Tiia; Martínez-Fernández, Lara; Improta, Roberto; Markovitsi, Dimitra

2018-04-17

There is increasing evidence that the direct absorption of photons with energies that are lower than the ionization potential of nucleobases may result in oxidative damage to DNA. The present work, which combines nanosecond transient absorption spectroscopy and quantum mechanical calculations, studies this process in alternating adenine-thymine duplexes (AT)n. We show that the one-photon ionization quantum yield of (AT)10 at 266 nm (4.66 eV) is (1.5 ± 0.3) × 10-3. According to our PCM/TD-DFT calculations carried out on model duplexes composed of two base pairs, (AT)1 and (TA)1, simultaneous base pairing and stacking does not induce important changes in the absorption spectra of the adenine radical cation and deprotonated radical. The adenine radicals, thus identified in the time-resolved spectra, disappear with a lifetime of 2.5 ms, giving rise to a reaction product that absorbs at 350 nm. In parallel, the fingerprint of reaction intermediates other than radicals, formed directly from singlet excited states and assigned to AT/TA dimers, is detected at shorter wavelengths. PCM/TD-DFT calculations are carried out to map the pathways leading to such species and to characterize their absorption spectra; we find that, in addition to the path leading to the well-known TA* photoproduct, an AT photo-dimerization path may be operative in duplexes.

Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

PubMed Central

Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

2016-01-01

A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

PubMed Central

Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

2013-01-01

Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

Microstructure, Hardness, and Corrosion Behavior of TiC-Duplex Stainless Steel Composites Fabricated by Spark Plasma Sintering

NASA Astrophysics Data System (ADS)

Han, Ying; Zhang, Wei; Sun, Shicheng; Chen, Hua; Ran, Xu

2017-08-01

Duplex stainless steel composites with various weight fractions of TiC particles are prepared by spark plasma sintering. Ferritic 434L and austenitic 316L stainless steel powders are premixed in a 50:50 weight ratio and added with 3-9 wt.% TiC. The compacts are sintered in the solid state under vacuum conditions at 1223 K for 5 min. The effects of TiC content on the microstructure, hardness, and corrosion resistance of duplex stainless steel composites fabricated by powder metallurgy are evaluated. The results indicate that the TiC particulates as reinforcements can be distributed homogeneously in the steel matrix. Densification of sintered composites decreases with increasing TiC content. M23C6 carbide precipitates along grain boundary, and its neighboring Cr-Mo-depleted region is formed in the sintered microstructure, which can be eliminated subsequently with appropriate heat treatment. With the addition of TiC, the hardness of duplex stainless steel fabricated by powder metallurgy can be markedly enhanced despite increased porosity in the composites. However, TiC particles increase the corrosion rate and degrade the passivation capability, particularly for the composite with TiC content higher than 6 wt.%. Weakened metallurgical bonding in the composite with high TiC content provides the preferred sites for pitting nucleation and/or dissolution.

Superplastic Forming of Duplex Stainless Steel for Aerospace Part

NASA Astrophysics Data System (ADS)

Lee, Ho-Sung; Yoon, Jong-Hoon; Yoo, Joon-Tae; Yi, Young-Moo

2011-08-01

In this study, the high temperature forming behavior of duplex stainless steel has been characterized and the outer shell of a combustion chamber was fabricated with pressure difference of hot gas. It consists of two parts which are the outer skin made of stainless steel to sustain the internal pressure and the inner shell made of copper alloy for regenerative cooling channels. Two outer skins partitioned to half with respect to the symmetric axis was prepared by hot gas forming process with a maximum pressure of 7 MPa following to FEM analysis. For inner layer, copper alloy was machined for cooling channels and then placed in the gas pressure welding fixture. It is shown that the optimum condition of gas pressure welding is 7 MPa at 890 °C, for one hour. EDX analysis and scanning electron microscope micrograph confirm the atomic diffusion process is observed at the interface and copper atoms diffuse into steel, while iron and chrome atoms diffuse into copper. The result shows that the manufacturing method with superplastic forming and gas pressure welding of steel and copper alloy has been successful for near net shape manufacturing of scaled combustion chamber of launch vehicle.

Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

PubMed Central

Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

2018-01-01

Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

Analysis of features of stainless steels in dissimilar welded joints in chloride inducted corrosion

NASA Astrophysics Data System (ADS)

Topolska, S.; Łabanowski, J.

2017-08-01

Stainless steels of femtic-austenitic microstructure that means the duplex Cr-Ni-Mo steels, in comparison with austenitic steel includes less expensive nickel and has much better mechanical properties with good formability and corrosion resistance, even in environments containing chloride ions. Similar share of high chromium ferrite and austenite, which is characterized by high ductility, determines that the duplex steels have good crack resistance at temperatures up to approximately -40°C. The steels containing approximately 22% Cr, 5% Ni, 3% Mo and 0.2% N crystallizes as a solid solution δ, partially transforming from the temperature of about 1200°C to 850°C into the phase α. The stable structure of considered steels, at temperatures above 850°C, is ferrite, and at lower temperatures the mixture of phase γ+α +σ. The two-phase structure α+γ the duplex steel obtains after hyperquenching at the temperature of stability of the mixture of α+γ phases, and the share of the phases depends on the hyper quenching attributes. Hyperquenching in water, with a temperature close to 1200°C, ensures the instance in the microstructure of the steel a large share of ferrite and a small share of the high chromium austenite. This causes the increase of strength properties and reducing the plasticity of the steel and its resistance ability to cracking and corrosion. Slower cooling from the mentioned temperature, for example in the air, enables the partial transformation of the a phase into the γ one (α → γ) and increasing the share of austenite in the steel structure. It leads to improvement of plasticity properties. In the paper are presented the results of investigations of heteronymous welded joints of duplex steel and austenitic one. The results include the relation between the chemical composition of steels and their weldability.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Ab initio study of naphtho-homologated DNA bases.

PubMed

Vazquez-Mayagoita, Alvaro; Huertas, Oscar; Fuentes-Cabrera, Miguel; Sumpter, Bobby G; Orozco, Modesto; Luque, F Javier

2008-02-21

Naphtho-homologated DNA bases have been recently used to build a new type of size-expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naphtho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like forms of naphtho-thymine (yyT) and naphtho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crick pairing. However, the canonical-like species of naphtho-guanine (yyG) and naphtho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphtho-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naphtho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.

Multi-shell model of ion-induced nucleic acid condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois

2016-04-21

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes in- duced by tri-valent cobalt hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. The duplex aggregation free energy is de- composed into attraction and repulsion components represented by simple analytic expressions. The source of the short-range attraction between NA duplexes in the aggregated phase is the in- teraction of CoHex ions in the overlapping regions of the “external” shells with the oppositely chargedmore » duplexes. The attraction depends on CoHex binding affinity to the “external” shell of nearly neutralized duplex and the number of ions in the shell overlapping volume. For a given NA duplex sequence and structure, these parameters are estimated from molecular dynamics simula- tion. The attraction is opposed by the residual repulsion of nearly neutralized duplexes as well as duplex configurational entropy loss upon aggregation. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA conden- sation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. The model also predicts that longer NA fragments will condense easier than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation, lends support to proposed NA condensation picture based on the multivalent “ion binding shells”.« less

Stable isotope labeling-mass spectrometry analysis of methyl- and pyridyloxobutyl-guanine adducts of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone in p53-derived DNA sequences.

PubMed

Rajesh, Mathur; Wang, Gang; Jones, Roger; Tretyakova, Natalia

2005-02-15

The p53 tumor suppressor gene is a primary target in smoking-induced lung cancer. Interestingly, p53 mutations observed in lung tumors of smokers are concentrated at guanine bases within endogenously methylated (Me)CG dinucleotides, e.g., codons 157, 158, 245, 248, and 273 ((Me)C = 5-methylcytosine). One possible mechanism for the increased mutagenesis at these sites involves targeted binding of metabolically activated tobacco carcinogens to (Me)CG sequences. In the present work, a stable isotope labeling HPLC-ESI(+)-MS/MS approach was employed to analyze the formation of guanine lesions induced by the tobacco-specific lung carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) within DNA duplexes representing p53 mutational "hot spots" and surrounding sequences. Synthetic DNA duplexes containing p53 codons 153-159, 243-250, and 269-275 were prepared, where (Me)C was incorporated at all physiologically methylated CG sites. In each duplex, one of the guanine bases was replaced with [1,7,NH(2)-(15)N(3)-2-(13)C]-guanine, which served as an isotope "tag" to enable specific quantification of guanine lesions originating from that position. After incubation with NNK diazohydroxides, HPLC-ESI(+)-MS/MS analysis was used to determine the yields of NNK adducts at the isotopically labeled guanine and at unlabeled guanine bases elsewhere in the sequence. We found that N7-methyl-2'-deoxyguanosine and N7-[4-oxo-4-(3-pyridyl)but-1-yl]guanine lesions were overproduced at the 3'-guanine bases within polypurine runs, while the formation of O(6)-methyl-2'-deoxyguanosine and O(6)-[4-oxo-4-(3-pyridyl)but-1-yl]-2'-deoxyguanosine adducts was specifically preferred at the 3'-guanine base of 5'-GG and 5'-GGG sequences. In contrast, the presence of 5'-neighboring (Me)C inhibited O(6)-guanine adduct formation. These results indicate that the N7- and O(6)-guanine adducts of NNK are not overproduced at the endogenously methylated CG dinucleotides within the p53 tumor suppressor gene, suggesting that factors other than NNK adduct formation are responsible for mutagenesis at these sites.

Duplex Ultrasonography Has Limited Utility in Detection of Postoperative DVT After Primary Total Joint Arthroplasty.

PubMed

Vira, Shaleen; Ramme, Austin J; Alaia, Michael J; Steiger, David; Vigdorchik, Jonathan M; Jaffe, Frederick

2016-07-01

Duplex ultrasound is routinely used to evaluate suspected deep venous thrombosis after total joint arthroplasty. When there is a clinical suspicion for a pulmonary embolism, a chest angiogram (chest CTA) is concomitantly obtained. Two questions were addressed: First, for the population of patients who receive duplex ultrasound after total joint arthroplasty, what is the rate of positive results? Second, for these patients, how many of these also undergo chest CTA for clinical suspicion of pulmonary embolus and how many of these tests are positive? Furthermore, what is the correlation between duplex ultrasound results and chest CTA results? A retrospective chart review was conducted of total joint replacement patients in 2011 at a single institution. Inclusion criteria were adult patients who underwent a postoperative duplex ultrasonography for clinical suspicion of deep venous thrombosis (DVT). Demographic data, result of duplex scan, clinical indications for obtaining the duplex scan, and DVT prophylaxis used were recorded. Additionally, if a chest CTA was obtained for clinical suspicion for pulmonary embolus, results and clinical indication for obtaining the test were recorded. The rate of positive results for duplex ultrasonography and chest CTA was computed and correlated based on clinical indications. Two hundred ninety-five patients underwent duplex ultrasonography of which only 0.7% were positive for a DVT. One hundred three patients underwent a chest CTA for clinical suspicion of a pulmonary embolism (PE) of which 26 revealed a pulmonary embolus, none of which had a positive duplex ultrasound. Postoperative duplex scans have a low rate of positive results. A substantial number of patients with negative duplex results subsequently underwent chest CTA for clinical suspicion for which a pulmonary embolus was found, presumably resulting from a DVT despite negative duplex ultrasound result. A negative duplex ultrasonography should not rule out the presence of a DVT which can embolize to the lungs and thus should not preclude further workup when clinical suspicion exists for a pulmonary embolus.

Genetic Heterogeneity in Streptococcus mutans1

PubMed Central

Coykendall, Alan L.

1971-01-01

The genetic homogeneity among eight cariogenic strains of Streptococcus mutans was assessed by deoxyribonucleic acid (DNA)-DNA reassociation experiments. DNA species were extracted from strains GS5, Ingbritt, 10449, FAl, BHT, E49, SLl, and KlR. Labeled DNA (14C-DNA) was extracted from strains 10449, FAl, and SLl. Denatured 14C-DNA fragments were allowed to reassociate, i.e., form hybrid duplexes, with denatured DNA immobilized on membrane filters incubated in 0.45 m NaCl-0.045 m sodium citrate at 67 or 75 C. At 67 C, 10449 14C-DNA reassociated extensively only with GS5 and Ingbritt DNA. FAl 14C-DNA hybridized extensively only with BHT DNA, and SLl 14C-DNA reassociated with KlR and E49 DNA. DNA which hybridized extensively at 67 C also reassociated to a high degree at 75 C. Thermal elution of 14C-FAl-BHT duplexes showed that the hybrid duplexes were thermostable. The results indicate that S. mutans is a genetically heterogeneous species. The strains studied can be divided into three (possibly four) genetic groups, and these groups closely parallel antigenic groups. PMID:5551636

Effect of Backbone Design on Hybridization Thermodynamics of Oligo-nucleic Acids: A Coarse-Grained Molecular Dynamics Simulation Study

NASA Astrophysics Data System (ADS)

Ghobadi, Ahmadreza F.; Jayaraman, Arthi

DNA hybridization is the basis of various bio-nano technologies, such as DNA origami and assembly of DNA-functionalized nanoparticles. A hybridized double stranded (ds) DNA is formed when complementary nucleobases on hybridizing strands exhibit specific and directional hydrogen bonds through canonical Watson-Crick base-pairing interactions. In recent years, the need for cheaper alternatives and significant synthetic advances have driven design of DNA mimics with new backbone chemistries. However, a fundamental understanding of how these backbone modifications in the oligo-nucleic acids impact the hybridization and melting behavior of the duplex is still lacking. In this talk, we present our recent findings on impact of varying backbone chemistry on hybridization of oligo-nucleic acid duplexes. We use coarse-grained molecular dynamics simulations to isolate the effect of strand flexibility, electrostatic interactions and nucleobase spacing on the melting curves for duplexes with various strand sequences and concentrations. Since conjugation of oligo-nucleic acids with polymers serve as building blocks for thermo-responsive polymer networks and gels, we also present the effect of such conjugation on hybridization thermodynamics and polymer conformation.

Force-Induced Rupture of a DNA Duplex: From Fundamentals to Force Sensors.

PubMed

Mosayebi, Majid; Louis, Ard A; Doye, Jonathan P K; Ouldridge, Thomas E

2015-12-22

The rupture of double-stranded DNA under stress is a key process in biophysics and nanotechnology. In this article, we consider the shear-induced rupture of short DNA duplexes, a system that has been given new importance by recently designed force sensors and nanotechnological devices. We argue that rupture must be understood as an activated process, where the duplex state is metastable and the strands will separate in a finite time that depends on the duplex length and the force applied. Thus, the critical shearing force required to rupture a duplex depends strongly on the time scale of observation. We use simple models of DNA to show that this approach naturally captures the observed dependence of the force required to rupture a duplex within a given time on duplex length. In particular, this critical force is zero for the shortest duplexes, before rising sharply and then plateauing in the long length limit. The prevailing approach, based on identifying when the presence of each additional base pair within the duplex is thermodynamically unfavorable rather than allowing for metastability, does not predict a time-scale-dependent critical force and does not naturally incorporate a critical force of zero for the shortest duplexes. We demonstrate that our findings have important consequences for the behavior of a new force-sensing nanodevice, which operates in a mixed mode that interpolates between shearing and unzipping. At a fixed time scale and duplex length, the critical force exhibits a sigmoidal dependence on the fraction of the duplex that is subject to shearing.

Zoster duplex: a clinical report and etiologic analysis.

PubMed

Zhang, Feng; Zhou, Jin

2015-01-01

Herpes zoster (HZ) duplex is a rare disease presentation. The mechanisms of varicella zoster virus (VZV) reactivation in multiple dermal regions are unknown. To present a HZ duplex case occurring in an immunocompetent woman and to analyze the possible underlying causes of HZ duplex. We present a HZ duplex case in an immunocompetent woman and analyzed the possible contributing factors in 36 HZ duplex cases. Continuously distributed variables were categorized by numbers and percentages. In our study, 24 cases (66.7%) were from Asia, 16 cases (44.4%) were in individuals ≥ 50 years of age, and 17 cases (47.2%) occurred in immunocompromised patients. Of the 36 cases, 23 involved women (63.9%) and 13 involved men. Eighteen patients suffering from HZ duplex, 13 of which were women (72.2%), did not suffer from any chronic systemic disease or have a long history of taking drugs. HZ duplex is a rare event that can occur in both immunocompetent and immunosuppressed individuals. HZ duplex might be associated with the Asia region, advanced age, immunosuppression, and being female.

A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

PubMed

Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

2017-09-20

Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

C-1311 (Symadex), a potential anti-cancer drug, intercalates into DNA between A and G moieties. NMR-derived and MD-refined stereostructure of the d(GAGGCCTC)2:C-1311 complex

NASA Astrophysics Data System (ADS)

Laskowski, Tomasz; Borzyszkowska, Julia; Grynda, Jakub; Mazerski, Jan

2017-08-01

Imidazoacridinone C-1311 (Symadex®) is an antitumor agent which has been recommended for Phase II clinical trials a few years ago. Previously, it was shown experimentally that during the initial stage of its action C-1311 forms stable intercalation complexes with DNA duplexes. Herein, a NMR-derived stereostructure of d(GAGGCCTC)2:C-1311 complex was reported. The ligand was found locating itself between A and G moieties, forming symmetrical DNA:drug 1:2 mol/mol complex. Intercalation site was located upon the DNA-ligand proton/proton dipolar couplings observed in the NOESY spectrum and the performed MD simulations. NMR-derived stereostructure was hence refined by restrained MD using distance restraints obtained from the NOESY data and the result was compared with MD-derived structure of the proposed complex, obtained from the calculations performed with distance restraints applied only for hydrogen bonds in the terminal GC base pairs. The results of both simulations were coherent. Basing on the observed C-1311's intercalation sites and on our previous results concerning the d(CGATCG)2:C-1311 complex, we stated that AG/GA sequences are the preferred binding sites of imidazoacridinone C-1311.

Mimicking an Enzyme-Based Colorimetric Aptasensor for Antibiotic Residue Detection in Milk Combining Magnetic Loop-DNA Probes and CHA-Assisted Target Recycling Amplification.

PubMed

Luan, Qian; Gan, Ning; Cao, Yuting; Li, Tianhua

2017-07-19

A mimicking-enzyme-based colorimetric aptasensor was developed for the detection of kanamycin (KANA) in milk using magnetic loop-DNA-NMOF-Pt (m-L-DNA) probes and catalytic hairpin assembly (CHA)-assisted target recycling for signal amplification. The m-L-DNA probes were constructed via hybridization of hairpin DNA H1 (containing aptamer sequence) immobilized magnetic beads (m-H1) and signal DNA (sDNA, partial hybridization with H1) labeled nano Fe-MIL-88NH 2 -Pt (NMOF-Pt-sDNA). In the presence of KANA and complementary hairpin DNA H2, the m-L-DNA probes decomposed and formed an m-H1/KANA intermediate, which triggered the CHA reaction to form a stable duplex strand (m-H1-H2) while releasing KANA again for recycling. Consequently, numerous NMOF-Pt-sDNA as mimicking enzymes can synergistically catalyze 3,3',5,5'-tetramethylbenzidine (TMB) for color development. The aptasensor exhibited high selectivity and sensitivity for KANA in milk with a detection limit of 0.2 pg mL -1 within 30 min. The assay can be conveniently extended for on-site screening of other antibiotics in foods by simply changing the base sequence of the probes.

T.C.G triplet in an antiparallel purine.purine.pyrimidine DNA triplex. Conformational studies by NMR.

PubMed

Dittrich, K; Gu, J; Tinder, R; Hogan, M; Gao, X

1994-04-12

The antiparallel purine.purine.pyrimidine DNA triplex, RRY6, which contains a T.C.G inverted triplet in the center of the sequence, was examined by proton and phosphorous two-dimensional NMR spectroscopy. The local conformation of the T.C.G triplet (T4.C11.G18) and the effect of this triplet on the global helical structure were analyzed in detail. The formation of the T.C.G triplet is confirmed by a set of cross-strand NOEs, including unusual cross-strand NOEs between the third strand and the pyrimidine strand as opposed to the purine strand of the duplex. NMR data suggest that the T.C.G triplet may be present in an equilibrium between a non-hydrogen-bonded form and a T(O4)-C(NH2) hydrogen-bonded form and that there is a distortion of the in-plane alignment of the three bases. The flanking G.G.C base triplets are well-defined on the 5'-side of T4, but somewhat interrupted on the 3'-side of T4. The effect of the third strand binding on the Watson-Crick duplex was probed by an NMR study of the free duplex RY6. NMR parameters are affected mostly around the T.C.G inversion site. The perturbations extend to at least two adjacent base triplets on either side. The binding of the third purine strand and the accommodation of a central T.C.G inversion in RRY6 does not require a readjustment in sugar pucker, which remains in the range of C2'-endo. 31P resonances of RRY6 distribute over a range of 2.2 ppm. The H-P coupling patterns of the third strand differ from those of the duplex. General spectral patterns defined by the marker protons of the RRY and YRY triplexes are compared.

Structure/cleavage-based insights into helical perturbations at bulge sites within T. thermophilus Argonaute silencing complexes

PubMed Central

Sheng, Gang; Gogakos, Tasos; Wang, Jiuyu; Zhao, Hongtu; Serganov, Artem; Juranek, Stefan

2017-01-01

Abstract We have undertaken a systematic structural study of Thermus thermophilus Argonaute (TtAgo) ternary complexes containing single-base bulges positioned either within the seed segment of the guide or target strands and at the cleavage site. Our studies establish that single-base bulges 7T8, 5A6 and 4A5 on the guide strand are stacked-into the duplex, with conformational changes localized to the bulge site, thereby having minimal impact on the cleavage site. By contrast, single-base bulges 6’U7’ and 6’A7’ on the target strand are looped-out of the duplex, with the resulting conformational transitions shifting the cleavable phosphate by one step. We observe a stable alignment for the looped-out 6’N7’ bulge base, which stacks on the unpaired first base of the guide strand, with the looped-out alignment facilitated by weakened Watson–Crick and reversed non-canonical flanking pairs. These structural studies are complemented by cleavage assays that independently monitor the impact of bulges on TtAgo-mediated cleavage reaction. PMID:28911094

Inhibition of murine DNA methyltransferase Dnmt3a by DNA duplexes containing pyrimidine-2(1H)-one.

PubMed

Cherepanova, N A; Zhuze, A L; Gromova, E S

2010-09-01

Here we studied the inhibition of the catalytic domain of Dnmt3a methyltransferase (Dnmt3a-CD) by DNA duplexes containing the mechanism-based inhibitor pyrimidine-2(1H)-one (P) instead of the target cytosine. It has been shown that conjugates of Dnmt3a-CD with P-DNA (DNA containing pyrimidine-2(1H)-one) are not stable to heating at 65°C in 0.1% SDS. The yield of covalent intermediate increases in the presence of the regulatory factor Dnmt3L. The importance of the DNA minor groove for covalent intermediate formation during the methylation reaction catalyzed by Dnmt3a-CD has been revealed. P-DNA was shown to inhibit Dnmt3a-CD; the IC(50) is 830 nM. The competitive mechanism of inhibition of Dnmt3a-CD by P-DNA has been elucidated. It is suggested that therapeutic effect of zebularine could be achieved by inhibition of not only Dnmt1 but also Dnmt3a.

Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

PubMed Central

Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

2008-01-01

Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

PubMed Central

Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

2000-01-01

Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

Multi-shell model of ion-induced nucleic acid condensation

NASA Astrophysics Data System (ADS)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Baker, Nathan A.; Onufriev, Alexey V.

2016-04-01

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into "external" and "internal" ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the "external" shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the "internal" shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent "ion binding shells."

A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

PubMed

Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

2015-02-17

Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.

2'-Bispyrene-modified 2'-O-methyl RNA probes as useful tools for the detection of RNA: synthesis, fluorescent properties, and duplex stability.

PubMed

Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G

2014-09-05

The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A novel single fluorophore-labeled double-stranded oligonucleotide probe for fluorescence-enhanced nucleic acid detection based on the inherent quenching ability of deoxyguanosine bases and competitive strand-displacement reaction.

PubMed

Zhang, Yingwei; Tian, Jingqi; Li, Hailong; Wang, Lei; Sun, Xuping

2012-01-01

We develop a novel single fluorophore-labeled double-stranded oligonucleotide (OND) probe for rapid, nanostructure-free, fluorescence-enhanced nucleic acid detection for the first time. We further demonstrate such probe is able to well discriminate single-base mutation in nucleic acid. The design takes advantage of an inherent quenching ability of guanine bases. The short strand of the probe is designed with an end-labeled fluorophore that is placed adjacent to two guanines as the quencher located on the long opposite strand, resulting in great quenching of dye fluorescence. In the presence of a target complementary to the long strand of the probe, a competitive strand-displacement reaction occurs and the long strand forms a more stable duplex with the target, resulting in the two strands of the probe being separated from each other. As a consequence of this displacement, the fluorophore and the quencher are no longer in close proximity and dye fluorescence increases, signaling the presence of target.

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Laser heat treatment of welds for various stainless steels

NASA Astrophysics Data System (ADS)

Dontu, O.; Ganatsios, S.; Alexandrescu, N.; Predescu, C.

2008-03-01

The paper presents a study concerning the post - weld heat treatment of a duplex stainless steel. Welded joint samples were surface - treated using the same laser source adopted during welding in order to counterbalance the excess of ferrite formed in the welding process.

A flexible proximity sensor formed by duplex screen/screen-offset printing and its application to non-contact detection of human breathing

NASA Astrophysics Data System (ADS)

Nomura, Ken-Ichi; Kaji, Ryosaku; Iwata, Shiro; Otao, Shinobu; Imawaka, Naoto; Yoshino, Katsumi; Mitsui, Ryosuke; Sato, Junya; Takahashi, Seiya; Nakajima, Shin-Ichiro; Ushijima, Hirobumi

2016-01-01

We describe a flexible capacitance-type sensor that can detect an approaching human without contact, fabricated by developing and applying duplex conductive-ink printing to a film substrate. The results of our calculations show that the difference in size between the top and bottom electrodes of the sensor allows for the spatial extension of the electric field distribution over the electrodes. Hence, such a component functions as a proximity sensor. This thin and light device with a large form factor can be arranged at various places, including curved surfaces and the back of objects such that it is unnoticeable. In our experiment, we attached it to the back of a bed, and found that our device successfully detected the breathing of a subject on the bed without contacting his body. This should contribute to reducing the physical and psychological discomfort among patients during medical checks, or when their condition is being monitored.

How does hydroxyl introduction influence the double helical structure: the stabilization of an altritol nucleic acid:ribonucleic acid duplex

PubMed Central

Ovaere, Margriet; Sponer, Jiri; Sponer, Judit E.; Herdewijn, Piet; Van Meervelt, Luc

2012-01-01

Altritol nucleic acids (ANAs) are a promising new tool in the development of artificial small interfering ribonucleic acids (siRNAs) for therapeutical applications. To mimic the siRNA:messenger RNA (mRNA) interactions, the crystal structure of the ANA:RNA construct a(CCGUAAUGCC-P):r(GGCAUUACGG) was determined to 1.96 Å resolution which revealed the hybrid to form an A-type helix. As this A-form is a major requirement in the RNAi process, this crystal structure confirms the potential of altritol-modified siRNAs. Moreover, in the ANA strands, a new type of intrastrand interactions was found between the O2′ hydroxyl group of one residue and the sugar ring O4′ atom of the next residue. These interactions were further investigated by quantum chemical methods. Besides hydration effects, these intrastrand hydrogen bonds may also contribute to the stability of ANA:RNA duplexes. PMID:22638588

Beamforming Based Full-Duplex for Millimeter-Wave Communication

PubMed Central

Liu, Xiao; Xiao, Zhenyu; Bai, Lin; Choi, Jinho; Xia, Pengfei; Xia, Xiang-Gen

2016-01-01

In this paper, we study beamforming based full-duplex (FD) systems in millimeter-wave (mmWave) communications. A joint transmission and reception (Tx/Rx) beamforming problem is formulated to maximize the achievable rate by mitigating self-interference (SI). Since the optimal solution is difficult to find due to the non-convexity of the objective function, suboptimal schemes are proposed in this paper. A low-complexity algorithm, which iteratively maximizes signal power while suppressing SI, is proposed and its convergence is proven. Moreover, two closed-form solutions, which do not require iterations, are also derived under minimum-mean-square-error (MMSE), zero-forcing (ZF), and maximum-ratio transmission (MRT) criteria. Performance evaluations show that the proposed iterative scheme converges fast (within only two iterations on average) and approaches an upper-bound performance, while the two closed-form solutions also achieve appealing performances, although there are noticeable differences from the upper bound depending on channel conditions. Interestingly, these three schemes show different robustness against the geometry of Tx/Rx antenna arrays and channel estimation errors. PMID:27455256

A flexible proximity sensor formed by duplex screen/screen-offset printing and its application to non-contact detection of human breathing

PubMed Central

Nomura, Ken-ichi; Kaji, Ryosaku; Iwata, Shiro; Otao, Shinobu; Imawaka, Naoto; Yoshino, Katsumi; Mitsui, Ryosuke; Sato, Junya; Takahashi, Seiya; Nakajima, Shin-ichiro; Ushijima, Hirobumi

2016-01-01

We describe a flexible capacitance-type sensor that can detect an approaching human without contact, fabricated by developing and applying duplex conductive-ink printing to a film substrate. The results of our calculations show that the difference in size between the top and bottom electrodes of the sensor allows for the spatial extension of the electric field distribution over the electrodes. Hence, such a component functions as a proximity sensor. This thin and light device with a large form factor can be arranged at various places, including curved surfaces and the back of objects such that it is unnoticeable. In our experiment, we attached it to the back of a bed, and found that our device successfully detected the breathing of a subject on the bed without contacting his body. This should contribute to reducing the physical and psychological discomfort among patients during medical checks, or when their condition is being monitored. PMID:26795237

m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

PubMed Central

Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

2016-01-01

The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

The DNA-recognition mode shared by archaeal feast/famine-regulatory proteins revealed by the DNA-binding specificities of TvFL3, FL10, FL11 and Ss-LrpB

PubMed Central

Yokoyama, Katsushi; Nogami, Hideki; Kabasawa, Mamiko; Ebihara, Sonomi; Shimowasa, Ai; Hashimoto, Keiko; Kawashima, Tsuyoshi; Ishijima, Sanae A.; Suzuki, Masashi

2009-01-01

The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e. paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was studied. Using the method of systematic evolution of ligands by exponential enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11 and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC, CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases complementary to each other. Apparent equilibrium binding constants of the FFRPs and various DNA duplexes were determined, thereby confirming the DNA-binding specificities of the FFRPs. It is likely that these FFRPs recognize DNA in essentially the same way, since their DNA-binding specificities were all explained by the same pattern of relationship between amino-acid positions and base positions to form chemical interactions. As predicted from this relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the b base changed from T to G/A. DNA-binding characteristics of other archaeal FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship. PMID:19468044

A single-stranded DNA binding protein from mouse tumor cells specifically recognizes the C-rich strand of the (AGG:CCT)n repeats that can alter DNA conformation.

PubMed Central

Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R

1992-01-01

A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484

NMR and computational studies of stereoisomeric equine estrogen-derived DNA cytidine adducts in oligonucleotide duplexes: opposite orientations of diastereomeric forms.

PubMed

Zhang, Na; Ding, Shuang; Kolbanovskiy, Alexander; Shastry, Anant; Kuzmin, Vladimir A; Bolton, Judy L; Patel, Dinshaw J; Broyde, Suse; Geacintov, Nicholas E

2009-08-04

The equine estrogens equilin (EQ) and equilenin (EN) are the active components in the widely prescribed hormone replacement therapy formulation Premarin. Metabolic activation of EQ and EN generates the catechol 4-hydroxyequilenin (4-OHEN) that autoxidizes to the reactive o-quinone form in aerated aqueous solutions. The o-quinones react predominantly with C, and to a lesser extent with A and G, to form premutagenic cyclic covalent DNA adducts in vitro and in vivo. To obtain insights into the structural properties of these biologically important DNA lesions, we have synthesized site-specifically modified oligonucleotides containing the stereoisomeric 1'S,2'R,3'R-4-OHEN-C3 and 1'R,2'S,3'S-4-OHEN-C4 adducts derived from the reaction of 4-OHEN with the C in the oligonucleotide 5'-GGTAGCGATGG in aqueous solution. A combined NMR and computational approach was utilized to determine the conformational characteristics of the two major 4-OHEN-C3 and 4-OHEN-C4 stereoisomeric adducts formed in this oligonucleotide hybridized with its complementary strand. In both cases, the modified C adopts an anti glycosidic bond conformation; the equilenin distal ring protrudes into the minor groove while its two proximal hydroxyl groups are exposed on the major groove side of the DNA duplex. The bulky 4-OHEN-C adduct distorts the duplex within the central GC*G portion, but Watson-Crick pairing is maintained adjacent to C* in both stereoisomeric adducts. For the 4-OHEN-C3 adduct, the equilenin rings are oriented toward the 5'-end of the modified strand, while in 4-OHEN-C4 the equilenin is 3'-directed. Correspondingly, the distortions of the double-helical structures are more pronounced on the 5'- or the 3'-side of the lesion, respectively. These differences in stereoisomeric adduct conformations may play a role in the processing of these lesions in cellular environments.

Accelerated corrosion of 2205 duplex stainless steel caused by marine aerobic Pseudomonas aeruginosa biofilm.

PubMed

Xu, Dake; Xia, Jin; Zhou, Enze; Zhang, Dawei; Li, Huabing; Yang, Chunguang; Li, Qi; Lin, Hai; Li, Xiaogang; Yang, Ke

2017-02-01

Microbiologically influenced corrosion (MIC) of 2205 duplex stainless steel (DSS) in the presence of Pseudomonas aeruginosa was investigated through electrochemical and surface analyses. The electrochemical results showed that P. aeruginosa significantly reduced the corrosion resistance of 2205 DSS. Confocal laser scanning microscopy (CLSM) images showed that the depths of the largest pits on 2205 DSS with and without P. aeruginosa were 14.0 and 4.9μm, respectively, indicating that the pitting corrosion was accelerated by P. aeruginosa. X-ray photoelectron spectroscopy (XPS) results revealed that CrO 3 and CrN formed on the 2205 DSS surface in the presence of P. aeruginosa. Copyright © 2016 Elsevier B.V. All rights reserved.

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

PubMed

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

Resolution of carotid stenosis pre-carotid intervention: A case for selective preoperative duplex ultrasound.

PubMed

Ali, Abid; Ashrafi, Mohammed; Zeynali, Iraj

2015-01-01

Spontaneous resolution of carotid stenosis is a phenomenon that has been described in literature in the past. At present it is not routine practise to scan patients prior to carotid endarterectomy surgery within the UK. A 58 year old female presented to hospital with a history of sudden onset headache and left sided weakness. CT head showed findings in keeping with an acute right MCA territory infarct. A duplex ultrasound scan showed echolucent material in the right internal carotid artery forming a greater than 95% stenosis. The scan was unable to visualise the patency of the vessel distally due to the position of the mandible. The patient was provisionally listed for carotid endarterectomy. An MRA was requested prior to surgery to assess the patency of the distal internal carotid artery. The MRA of the carotids showed normal appearance of the common carotid, internal and vertebral arteries with no definite stenosis. A repeat duplex ultrasound confirmed there was no significant stenosis. The finding of complete resolution of stenosis on MRA was an unexpected event. Had the initial duplex imaging allowed visualisation of the distal vessel patency, our patient would have undergone unnecessary carotid surgery with the associated morbidity and mortality. This case report draws attention to the benefits of selective preoperative scanning, in sparing patients from unnecessary surgery as a result of finding occlusion or resolution of a previously diagnosed carotid stenosis. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Hydronephrosis in the Wnt5a-ablated kidney is caused by an abnormal ureter-bladder connection.

PubMed

Yun, Kangsun; Perantoni, Alan O

The Wnt5a null mouse is a complex developmental model which, among its several posterior-localized axis defects, exhibits multiple kidney phenotypes, including duplex kidney and loss of the medullary zone. We previously reported that ablation of Wnt5a in nascent mesoderm causes duplex kidney formation as a result of aberrant development of the nephric duct and abnormal extension of intermediate mesoderm. However, these mice also display a loss of the medullary region late in gestation. We have now genetically isolated duplex kidney formation from the medullary defect by specifically targeting the progenitors for both the ureteric bud and metanephric mesenchyme. The conditional mutants fail to form a normal renal medulla but no longer exhibit duplex kidney formation. Approximately 1/3 of the mutants develop hydronephrosis in the kidneys either uni- or bilaterally when using Dll1Cre. The abnormal kidney phenotype becomes prominent at E16.5, which approximates the time when urine production begins in the mouse embryonic kidney, and is associated with a dramatic increase in apoptosis only in mutant kidneys with hydronephrosis. Methylene blue dye injection and histologic examination reveal that aberrant cell death likely results from urine toxicity due to an abnormal ureter-bladder connection. This study shows that Wnt5a is not required for development of the renal medulla and that loss of the renal medullary region in the Wnt5a-deleted kidney is caused by an abnormal ureter-bladder connection. Published by Elsevier B.V.

Influence of pendant chiral C(γ)-(alkylideneamino/guanidino) cationic side-chains of PNA backbone on hybridization with complementary DNA/RNA and cell permeability.

PubMed

Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N

2014-10-17

Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.

Interactions of Escherichia coli σ70 within the transcription elongation complex

PubMed Central

Daube, Shirley S.; von Hippel, Peter H.

1999-01-01

A functional transcription elongation complex can be formed without passing through a promoter by adding a complementary RNA primer and core Escherichia coli RNA polymerase in trans to an RNA-primed synthetic bubble-duplex DNA framework. This framework consists of a double-stranded DNA sequence with an internal noncomplementary DNA “bubble” containing a hybridized RNA primer. On addition of core polymerase and the requisite NTPs, the RNA primer is extended in a process that manifests most of the properties of in vitro transcription elongation. This synthetic elongation complex can also be assembled by using holo rather than core RNA polymerase, and in this study we examine the interactions and fate of the σ70 specificity subunit of the holopolymerase in the assembly process. We show that the addition of holopolymerase to the bubble-duplex construct triggers the dissociation of the sigma factor from some complexes, whereas in others the RNA oligomer is released into solution instead. These results are consistent with an allosteric competition between σ70 and the nascent RNA strand within the elongation complex and suggest that both cannot be bound to the core polymerase simultaneously. However, the dissociation of σ70 from the complex can also be stimulated by binding of the holopolymerase to the DNA bubble duplex in the absence of a hybridized RNA primer, suggesting that the binding of the core polymerase to the bubble-duplex construct also triggers a conformational change that additionally weakens the sigma–core interaction. PMID:10411885

Mechanism-based inhibition of C5-cytosine DNA methyltransferases by 2-H pyrimidinone.

PubMed

Hurd, P J; Whitmarsh, A J; Baldwin, G S; Kelly, S M; Waltho, J P; Price, N C; Connolly, B A; Hornby, D P

1999-02-19

DNA duplexes in which the target cytosine base is replaced by 2-H pyrimidinone have previously been shown to bind with a significantly greater affinity to C5-cytosine DNA methyltransferases than unmodified DNA. Here, it is shown that 2-H pyrimidinone, when incorporated into DNA duplexes containing the recognition sites for M.HgaI-2 and M.MspI, elicits the formation of inhibitory covalent nucleoprotein complexes. We have found that although covalent complexes are formed between 2-H pyrimidinone-modified DNA and both M.HgaI-2 and M.MspI, the kinetics of complex formation are quite distinct in each case. Moreover, the formation of a covalent complex is still observed between 2-H pyrimidinone DNA and M.MspI in which the active-site cysteine residue is replaced by serine or threonine. Covalent complex formation between M.MspI and 2-H pyrimidinone occurs as a direct result of nucleophilic attack by the residue at the catalytic position, which is enhanced by the absence of the 4-amino function in the base. The substitution of the catalytic cysteine residue by tyrosine or chemical modification of the wild-type enzyme with N-ethylmaleimide, abolishes covalent interaction. Nevertheless the 2-H pyrimidinone-substituted duplex still binds to M.MspI with a greater affinity than a standard cognate duplex, since the 2-H pyrimidinone base is mis-paired with guanine. Copyright 1999 Academic Press.

An H-shaped complete ureteric duplication: embryology or erosion

PubMed Central

Jayasekera, Ashan; Tempest, Heidi; Kumar, Sunil

2011-01-01

The authors report the case of a duplex urinary collecting system that forms a single chamber about 2 cm proximal to the bladder with distal bifurcation and drainage into the bladder via distinct ureteric orifices. This anatomical variant has not been described before. PMID:22691584

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE PAGES

Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

2016-02-04

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paugh, Steven W.; Coss, David R.; Bao, Ju

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

PubMed

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

PubMed Central

Xie, Ping

2015-01-01

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel. PMID:26473825

Multi-shell model of ion-induced nucleic acid condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(III) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derivedmore » from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.”.« less

Multi-shell model of ion-induced nucleic acid condensation

PubMed Central

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Onufriev, Alexey V.

2016-01-01

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.” PMID:27389241

G-Quadruplex Folds of the Human Telomere Sequence Alter the Site Reactivity and Reaction Pathway of Guanine Oxidation Compared to Duplex DNA

PubMed Central

Fleming, Aaron M.; Burrows, Cynthia J.

2013-01-01

Telomere shortening occurs during oxidative and inflammatory stress with guanine (G) as the major site of damage. In this work, a comprehensive profile of the sites of oxidation and structures of products observed from G-quadruplex and duplex structures of the human telomere sequence was studied in the G-quadruplex folds (hybrid (K+), basket (Na+), and propeller (K+ + 50% CH3CN)) resulting from the sequence 5’-(TAGGGT)4T-3’ and in an appropriate duplex containing one telomere repeat. Oxidations with four oxidant systems consisting of riboflavin photosensitization, carbonate radical generation, singlet oxygen, and the copper Fenton-like reaction were analyzed under conditions of low product conversion to determine relative reactivity. The one-electron oxidants damaged the 5’-G in G-quadruplexes leading to spiroiminodihydantoin (Sp) and 2,2,4-triamino-2H-oxazol-5-one (Z) as major products as well as 8-oxo-7,8-dihydroguanine (OG) and 5-guanidinohydantoin (Gh) in low relative yields, while oxidation in the duplex context produced damage at the 5’- and middle-Gs of GGG sequences and resulted in Gh being the major product. Addition of the reductant N-acetylcysteine (NAC) to the reaction did not alter the riboflavin-mediated damage sites, but decreased Z by 2-fold and increased OG by 5-fold, while not altering the hydantoin ratio. However, NAC completely quenched the CO3•− reactions. Singlet oxygen oxidations of the G-quadruplex showed reactivity at all Gs on the exterior faces of G-quartets and furnished the product Sp, while no oxidation was observed in the duplex context under these conditions, and addition of NAC had no effect. Because a long telomere sequence would have higher-order structures of G-quadruplexes, studies were also conducted with 5’-(TAGGGT)8-T-3’, and it provided similar oxidation profiles to the single G-quadruplex. Lastly, CuII/H2O2-mediated oxidations were found to be indiscriminate in the damage patterns, and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) was found to be a major duplex product, while nearly equal yields of 2Ih and Sp were observed in G-quadruplex contexts. These findings indicate that the nature of the secondary structure of folded DNA greatly alters both the reactivity of G toward oxidative stress as well as the product outcome and suggest that recognition of damage in telomeric sequences by repair enzymes may be profoundly different from that of B-form duplex DNA. PMID:23438298

Duplex gall bladder: bystander or culprit.

PubMed

Kumar, Jogender; Yadav, Arushi

2017-08-30

Gall bladder (GB) duplication is a rare anatomical malformation, which can be detected by preoperative imaging study. We present a case of duplex gall bladder in a 14-year-old boy who presented with abdominal pain. On ultrasound, he had right nephrolithiasis and duplex gall bladder. Duplex gall bladder was confirmed on MR cholangiopancreatography. There was a dilemma for surgical management of duplex gall bladder; however, he became asymptomatic after conservative treatment. Prophylactic surgery is not recommended for asymptomatic incidentally detected duplex gall bladder. Radiologists and paediatric surgeons should be sensitised about the exact anatomy of this entity. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Role of the heat capacity change in understanding and modeling melting thermodynamics of complementary duplexes containing standard and nucleobase-modified LNA.

PubMed

Hughesman, Curtis B; Turner, Robin F B; Haynes, Charles A

2011-06-14

Melting thermodynamic data obtained by differential scanning calorimetry (DSC) are reported for 43 duplexed oligonucleotides containing one or more locked nucleic acid (LNA) substitutions. The measured heat capacity change (ΔC(p)) for the helix-to-coil transition is used to compute the changes in enthalpy and entropy for melting of an LNA-bearing duplex at the T(m) of its corresponding isosequential unmodified DNA duplex to allow rigorous thermodynamic analysis of the stability enhancements provided by LNA substitutions. Contrary to previous studies, our analysis shows that the origin of the improved stability is almost exclusively a net reduction (ΔΔS° < 0) in the entropy gain accompanying the helix-to-coil transition, with the magnitude of the reduction dependent on the type of nucleobase and its base pairing properties. This knowledge and our average measured value for ΔC(p) of 42 ± 11 cal mol(-1) K(-1) bp(-1) are then used to derive a new model that accurately predicts melting thermodynamics and the increased melting temperature (ΔT(m)) of heteroduplexes formed between an unmodified DNA strand and a complementary strand containing any number and configuration of standard LNA nucleotides A, T, C, and G. This single-base thermodynamic (SBT) model requires only four entropy-related parameters in addition to ΔC(p). Finally, DSC data for 20 duplexes containing the nucleobase-modified LNAs 2-aminoadenine (D) and 2-thiothymine (H) are reported and used to determine SBT model parameters for D and H. The data and model suggest that along with the greater stability enhancement provided by D and H bases relative to their corresponding A and T analogues, the unique pseudocomplementary properties of D-H base pairs may make their use appealing for in vitro and in vivo applications.

Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

PubMed

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

Relative stabilities of triple helices composed of combinations of DNA, RNA and 2'-O-methyl-RNA backbones: chimeric circular oligonucleotides as probes.

PubMed

Wang, S; Kool, E T

1995-04-11

Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.

Evolution of cooperation under social pressure in multiplex networks

NASA Astrophysics Data System (ADS)

Pereda, María

2016-09-01

In this work, we aim to contribute to the understanding of human prosocial behavior by studying the influence that a particular form of social pressure, "being watched," has on the evolution of cooperative behavior. We study how cooperation emerges in multiplex complex topologies by analyzing a particular bidirectionally coupled dynamics on top of a two-layer multiplex network (duplex). The coupled dynamics appears between the prisoner's dilemma game in a network and a threshold cascade model in the other. The threshold model is intended to abstract the behavior of a network of vigilant nodes that impose the pressure of being observed altering hence the temptation to defect of the dilemma. Cooperation or defection in the game also affects the state of a node of being vigilant. We analyze these processes on different duplex networks structures and assess the influence of the topology, average degree and correlated multiplexity, on the outcome of cooperation. Interestingly, we find that the social pressure of vigilance may impact cooperation positively or negatively, depending on the duplex structure, specifically the degree correlations between layers is determinant. Our results give further quantitative insights in the promotion of cooperation under social pressure.

Structural analysis using thrust-fault hanging-wall sequence diagrams: Ogden duplex, Wasatch Range, Utah

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schirmer, T.W.

1988-05-01

Detailed mapping and cross-section traverses provide the control for structural analysis and geometric modeling of the Ogden duplex, a complex thrust system exposed in the Wasatch Mountains, east of Ogden, Utah. The structures consist of east-dipping folded thrust faults, basement-cored horses, lateral ramps and folds, and tear faults. The sequence of thrusting determined by means of lateral overlap of horses, thrust-splay relationships, and a top-to-bottom piggyback development is Willard thrust, Ogden thrust, Weber thrust, and Taylor thrust. Major decollement zones occur in the Cambrian shales and limestones. The Tintic Quartzite is the marker for determining gross geometries of horses. Thismore » exposed duplex serves as a good model to illustrate the method of constructing a hanging-wall sequence diagram - a series of longitudinal cross sections that move forward in time and space, and show how a thrust system formed as it moved updip over various footwall ramps. A hanging wall sequence diagram also shows the complex lateral variations in a thrust system and helps to locate lateral ramps, lateral folds, tear faults, and other features not shown on dip-oriented cross sections. 8 figures.« less

Cyclophilin 40 facilitates HSP90-mediated RISC assembly in plants.

PubMed

Iki, Taichiro; Yoshikawa, Manabu; Meshi, Tetsuo; Ishikawa, Masayuki

2012-01-18

Posttranscriptional gene silencing is mediated by RNA-induced silencing complexes (RISCs) that contain AGO proteins and single-stranded small RNAs. The assembly of plant AGO1-containing RISCs depends on the molecular chaperone HSP90. Here, we demonstrate that cyclophilin 40 (CYP40), protein phosphatase 5 (PP5), and several other proteins with the tetratricopeptide repeat (TPR) domain associates with AGO1 in an HSP90-dependent manner in extracts of evacuolated tobacco protoplasts (BYL). Intriguingly, CYP40, but not the other TPR proteins, could form a complex with small RNA duplex-bound AGO1. Moreover, CYP40 that was synthesized by in-vitro translation using BYL uniquely facilitated binding of small RNA duplexes to AGO1, and as a result, increased the amount of mature RISCs that could cleave target RNAs. CYP40 was not contained in mature RISCs, indicating that the association is transient. Addition of PP5 or cyclophilin-binding drug cyclosporine A prevented the association of endogenous CYP40 with HSP90-AGO1 complex and inhibited RISC assembly. These results suggest that a complex of AGO1, HSP90, CYP40, and a small RNA duplex is a key intermediate of RISC assembly in plants.

Full-duplex radio-over-fiber system with tunable millimeter-wave signal generation and wavelength reuse for upstream signal.

PubMed

Wang, Yiqun; Pei, Li; Li, Jing; Li, Yueqin

2017-06-10

A full-duplex radio-over-fiber system is proposed, which provides both the generation of a millimeter-wave (mm-wave) signal with tunable frequency multiplication factors (FMFs) and wavelength reuse for uplink data. A dual-driving Mach-Zehnder modulator and a phase modulator are cascaded to form an optical frequency comb. An acousto-optic tunable filter based on a uniform fiber Bragg grating (FBG-AOTF) is employed to select three target optical sidebands. Two symmetrical sidebands are chosen to generate mm waves with tunable FMFs up to 16, which can be adjusted by changing the frequency of the applied acoustic wave. The optical carrier is reused at the base station for uplink connection. FBG-AOTFs driven by two acoustic wave signals are experimentally fabricated and further applied in the proposed scheme. Results of the research indicate that the 2-Gbit/s data can be successfully transmitted over a 25-km single-mode fiber for bidirectional full-duplex channels with power penalty of less than 2.6 dB. The feasibility of the proposed scheme is verified by detailed simulations and partial experiments.

Solution structure and thermodynamics of 2',5' RNA intercalation.

PubMed

Horowitz, Eric D; Lilavivat, Seth; Holladay, Benjamin W; Germann, Markus W; Hud, Nicholas V

2009-04-29

As a means to explore the influence of the nucleic acid backbone on the intercalative binding of ligands to DNA and RNA, we have determined the solution structure of a proflavine-bound 2',5'-linked octamer duplex with the sequence GCCGCGGC. This structure represents the first NMR structure of an intercalated RNA duplex, of either backbone structural isomer. By comparison with X-ray crystal structures, we have identified similarities and differences between intercalated 3',5' and 2',5'-linked RNA duplexes. First, the two forms of RNA have different sugar pucker geometries at the intercalated nucleotide steps, yet have the same interphosphate distances. Second, as in intercalated 3',5' RNA, the phosphate backbone angle zeta at the 2',5' RNA intercalation site prefers to be in the trans conformation, whereas unintercalated 2',5' and 3',5' RNA prefer the -gauche conformation. These observations provide new insights regarding the transitions required for intercalation of a phosphodiester-ribose backbone and suggest a possible contribution of the backbone to the origin of the nearest-neighbor exclusion principle. Thermodynamic studies presented for intercalation of both structural RNA isomers also reveal a surprising sensitivity of intercalator binding enthalpy and entropy to the details of RNA backbone structure.

A superstructure-based electrochemical assay for signal-amplified detection of DNA methyltransferase activity.

PubMed

Zhang, Hui; Yang, Yin; Dong, Huilei; Cai, Chenxin

2016-12-15

DNA methyltransferase (MTase) activity is highly correlated with the occurrence and development of cancer. This work reports a superstructure-based electrochemical assay for signal-amplified detection of DNA MTase activity using M.SssI as an example. First, low-density coverage of DNA duplexes on the surface of the gold electrode was achieved by immobilized mercaptohexanol, followed by immobilization of DNA duplexes. The duplex can be cleaved by BstUI endonuclease in the absence of DNA superstructures. However, the cleavage is blocked after the DNA is methylated by M.SssI. The DNA superstructures are formed with the addition of helper DNA. By using an electroactive complex, RuHex, which can bind to DNA double strands, the activity of M.SssI can be quantitatively detected by differential pulse voltammetry. Due to the high site-specific cleavage by BstUI and signal amplification by the DNA superstructure, the biosensor can achieve ultrasensitive detection of DNA MTase activity down to 0.025U/mL. The method can be used for evaluation and screening of the inhibitors of MTase, and thus has potential in the discovery of methylation-related anticancer drugs. Copyright © 2016 Elsevier B.V. All rights reserved.

Evolution of cooperation under social pressure in multiplex networks.

PubMed

Pereda, María

2016-09-01

In this work, we aim to contribute to the understanding of human prosocial behavior by studying the influence that a particular form of social pressure, "being watched," has on the evolution of cooperative behavior. We study how cooperation emerges in multiplex complex topologies by analyzing a particular bidirectionally coupled dynamics on top of a two-layer multiplex network (duplex). The coupled dynamics appears between the prisoner's dilemma game in a network and a threshold cascade model in the other. The threshold model is intended to abstract the behavior of a network of vigilant nodes that impose the pressure of being observed altering hence the temptation to defect of the dilemma. Cooperation or defection in the game also affects the state of a node of being vigilant. We analyze these processes on different duplex networks structures and assess the influence of the topology, average degree and correlated multiplexity, on the outcome of cooperation. Interestingly, we find that the social pressure of vigilance may impact cooperation positively or negatively, depending on the duplex structure, specifically the degree correlations between layers is determinant. Our results give further quantitative insights in the promotion of cooperation under social pressure.

Ab initio Study of Naptho-Homologated DNA Bases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sumpter, Bobby G; Vazquez-Mayagoitia, Alvaro; Huertas, Oscar

2008-01-01

Naptho-homologated DNA bases have been recently used to build a new type of size expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naptho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like form of naptho-thymine (yyT) and naptho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crickmore » pairing. However, the canonical-like species of naptho-guanine (yyG) and naptho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphto-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naptho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.« less

Assembly and analysis of eukaryotic Argonaute–RNA complexes in microRNA-target recognition

PubMed Central

Gan, Hin Hark; Gunsalus, Kristin C.

2015-01-01

Experimental studies have uncovered a variety of microRNA (miRNA)–target duplex structures that include perfect, imperfect and seedless duplexes. However, non-canonical binding modes from imperfect/seedless duplexes are not well predicted by computational approaches, which rely primarily on sequence and secondary structural features, nor have their tertiary structures been characterized because solved structures to date are limited to near perfect, straight duplexes in Argonautes (Agos). Here, we use structural modeling to examine the role of Ago dynamics in assembling viable eukaryotic miRNA-induced silencing complexes (miRISCs). We show that combinations of low-frequency, global modes of motion of Ago domains are required to accommodate RNA duplexes in model human and C. elegans Ago structures. Models of viable miRISCs imply that Ago adopts variable conformations at distinct target sites that generate distorted, imperfect miRNA-target duplexes. Ago's ability to accommodate a duplex is dependent on the region where structural distortions occur: distortions in solvent-exposed seed and 3′-end regions are less likely to produce steric clashes than those in the central duplex region. Energetic analyses of assembled miRISCs indicate that target recognition is also driven by favorable Ago-duplex interactions. Such structural insights into Ago loading and target recognition mechanisms may provide a more accurate assessment of miRNA function. PMID:26432829

Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

PubMed

Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

2013-07-30

Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

Validation of a novel duplex ultrasound objective structured assessment of technical skills (DUOSATS) for arterial stenosis detection.

PubMed

Jaffer, U; Singh, P; Pandey, V A; Aslam, M; Standfield, N J

2014-01-01

Duplex ultrasound facilitates bedside diagnosis and hence timely patient care. Its uptake has been hampered by training and accreditation issues. We have developed an assessment tool for Duplex arterial stenosis measurement for both simulator and patient based training. A novel assessment tool: duplex ultrasound assessment of technical skills was developed. A modified duplex ultrasound assessment of technical skills was used for simulator training. Novice, intermediate experience and expert users of duplex ultrasound were invited to participate. Participants viewed an instructional video and were allowed ample time to familiarize with the equipment. Participants' attempts were recorded and independently assessed by four experts using the modified duplex ultrasound assessment of technical skills. 'Global' assessment was also done on a four point Likert scale. Content, construct and concurrent validity as well as reliability were evaluated. Content and construct validity as well as reliability were demonstrated. The simulator had good satisfaction rating from participants: median 4; range 3-5. Receiver operator characteristic analysis has established a cut point of 22/ 34 and 25/ 40 were most appropriate for simulator and patient based assessment respectively. We have validated a novel assessment tool for duplex arterial stenosis detection. Further work is underway to establish transference validity of simulator training to improved skill in scanning patients. We have developed and validated duplex ultrasound assessment of technical skills for simulator training.

Fluorous Peptide Nucleic Acids: PNA Analogues with Fluorine in Backbone (γ-CF2-apg-PNA) Enhance Cellular Uptake.

PubMed

Ellipilli, Satheesh; Ganesh, Krishna N

2015-09-18

Fluorous PNA analogues possessing fluorine as inherent part of aminopropylglycine (apg) backbone (γ-CF2-apg PNA) have been synthesized and evaluated for biophysical and cell penetrating properties. These form duplexes of higher thermal stability with cRNA than cDNA, although destabilized compared to duplexes of standard aeg-PNA. Cellular uptake of the fluorinated γ-CF2-apg PNAs in NIH 3T3 and HeLa cells was 2-3-fold higher compared to that of nonfluorinated apg PNA, with NIH 3T3 cells showing better permeability compared to HeLa cells. The backbone fluorinated PNAs, which are first in this class, when combined with other chemical modifications may have potential for future PNA-based antisense agents.

A performance analysis in AF full duplex relay selection network

NASA Astrophysics Data System (ADS)

Ngoc, Long Nguyen; Hong, Nhu Nguyen; Loan, Nguyen Thi Phuong; Kieu, Tam Nguyen; Voznak, Miroslav; Zdralek, Jaroslav

2018-04-01

This paper studies on the relaying selective matter in amplify-and-forward (AF) cooperation communication with full-duplex (FD) activity. Various relay choice models supposing the present of different instant information are investigated. We examine a maximal relaying choice that optimizes the instant FD channel capacity and asks for global channel state information (CSI) as well as partial CSI learning. To make comparison easy, accurate outage probability clauses and asymptote form of these strategies that give a diversity rank are extracted. From that, we can see clearly that the number of relays, noise factor, the transmittance coefficient as well as the information transfer power had impacted on their performance. Besides, the optimal relay selection (ORS) model can promote than that of the partial relay selection (PRS) model.

Evidence of Liquid Crystal-Assisted Abiotic Ligation of Nucleic Acids

NASA Astrophysics Data System (ADS)

Fraccia, Tommaso P.; Zanchetta, Giuliano; Rimoldi, Valeria; Clark, Noel A.; Bellini, Tommaso

2015-06-01

The emergence of early life must have been marked by the appearance in the prebiotic era of complex molecular structures and systems, motivating the investigation of conditions that could not only facilitate appropriate chemical synthesis, but also provide the mechanisms of molecular selection and structural templating necessary to pilot the complexification toward specific molecular patterns. We recently proposed and demonstrated that these functions could be afforded by the spontaneous ordering of ultrashort nucleic acids oligomers into Liquid Crystal (LC) phases. In such supramolecular assemblies, duplex-forming oligomers are held in average end-to-end contact to form chemically discontinuous but physically continuous double helices. Using blunt ended duplexes, we found that LC formation could both provide molecular selection mechanisms and boost inter-oligomer ligation. This paper provides an essential extension to this notion by investigating the catalytic effects of LC ordering in duplexes with mutually interacting overhangs. Specifically, we studied the influence of LC ordering of 5'-hydroxy-3'-phosphate partially self-complementary DNA 14mers with 3'-CG sticky-ends, on the efficiency of non-enzymatic ligation reaction induced by water-soluble carbodiimide EDC as condensing agent. We investigated the ligation products in mixtures of DNA with poly-ethylene glycol (PEG) at three PEG concentrations at which the system phase separates creating DNA-rich droplets that organize into isotropic, nematic LC and columnar LC phases. We observe remarkable LC-enhanced chain lengthening, and we demonstrate that such lengthening effectively promotes and stabilizes LC domains, providing the kernel of a positive feedback cycle by which LC ordering promotes elongation, in turn stabilizing the LC ordering.

Solution structure of a DNA duplex containing a cis-diammineplatinum(II) 1,3-d(GTG) intrastrand cross-link, a major adduct in cells treated with the anticancer drug carboplatin.

PubMed

Teuben, J M; Bauer, C; Wang, A H; Reedijk, J

1999-09-21

The platinum 1,3-d(GXG) intrastrand cross-link is one of the adducts formed in the reaction of the antitumor drug cisplatin with DNA, and in fact the major adduct found in cells treated with the cisplatin analogue carboplatin. To determine the 3D structure of this adduct, the duplex d(CTCTGTGTCTC).d(GAGACACAGAG)], where GTG denotes a platinum 1,3-intrastrand cross-link, was prepared and studied with high-resolution (1)H NMR. The solution structure was determined using the SPEDREF protocol, which includes an iterative NOE-restrained refinement procedure. Calculated and recorded NOE spectra were found to be in good agreement (NMR R factor 22%). The studied duplex is more distorted from B-DNA than previously determined structures of the 1,2-d(GG) intrastrand adducts. The base pairing is lost for the 5'G-C and the central T-A base pair in the GTG lesion, and the central thymine is extruded from the minor groove. To accommodate this lesion, the minor groove is widened, and the 5'-guanine ribose adopts an N-type conformation. The helix is unwound locally and is significantly bent toward the major groove. Significant difference between the structural distortion of the 1, 3-d(GTG) cross-link and other Pt-DNA cross-links sheds new light on the observed differences in protein recognition of these lesions, and thus on the possible differences in mechanisms of action of the various Pt-DNA adducts formed in treatment with platinum anticancer complexes.

Structural energetics of the adenine tract from an intrinsic transcription terminator.

PubMed

Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

2010-04-02

Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

Excited-State Dynamics of a DNA Duplex in a Deep Eutectic Solvent Probed by Femtosecond Time-Resolved IR Spectroscopy.

PubMed

de La Harpe, Kimberly; Kohl, Forrest R; Zhang, Yuyuan; Kohler, Bern

2018-03-08

To better understand how the solvent influences excited-state deactivation in DNA strands, femtosecond time-resolved IR (fs-TRIR) pump-probe measurements were performed on a d(AT) 9 ·d(AT) 9 duplex dissolved in a deep eutectic solvent (DES) made from choline chloride and ethylene glycol in a 1:2 mol ratio. This solvent, known as ethaline, is a member of a class of ionic liquids capable of solubilizing DNA with minimal disruption to its secondary structure. UV melting analysis reveals that the duplex studied here melts at 18 °C in ethaline compared to 50 °C in aqueous solution. Ethaline has an excellent transparency window that facilitates TRIR measurements in the double-bond stretching region. Transient spectra recorded in deuterated ethaline at room temperature indicate that photoinduced intrastrand charge transfer occurs from A to T, yielding the same exciplex state previously detected in aqueous solution. This state decays via charge recombination with a lifetime of 380 ± 10 ps compared to the 300 ± 10 ps lifetime measured earlier in D 2 O solution. The TRIR data strongly suggest that the long-lived exciplex forms exclusively in the solvated duplex, and not in the denatured single strands, which appear to have little, if any, base stacking. The longer lifetime of the exciplex state in the DES compared to aqueous solution is suggested to arise from reduced stabilization of the charge transfer state, resulting in slower charge recombination on account of Marcus inverted behavior.

A Normal-faulting Paleostress in the Vicinity of Up-dip Limit of Seismogenic Zone Detected by Meso-scale Fault Analysis in a Tectonic Mélange

NASA Astrophysics Data System (ADS)

Sato, K.; Ikesawa, E.; Kimura, G.

2003-12-01

The Mugi mélange in the Shimanto Belt, SW Japan, is a mixture of terrigenous and oceanic materials of late Cretaceous to Paleocene. Intermittent bedding planes trend ENE-WSW to E-W (subparallel to the Nankai trough axis) and dip steeply northward. The Mugi mélange consists of several duplex units accompanied by shear zones of basalt layers at their boundaries. Systematic shear fabrics and P-T conditions estimated from analyses of vitrinite reflectance and fluid inclusions indicate that the Mugi mélange had once been subducted to a significant depth (6-7 km below sea floor, which appears to coincide with the up-dip limit of the seismogenic zone), then underplated to the Shimanto accretionary prism, and is now exhumed on ground surface. In this study, for the purpose of determining paleostress fields related to the processes in which subducted materials were deformed, underplated and uplifted to surface, orientations of meso-scale faults and striations were analyzed. Stress inversion techniques including Angelier's Inversion, Multiple Inversion and Ginkgo Method were applied to fault-slip data obtained in each duplex unit of the Mugi mélange, and the results were almost consistent with each other. Most of the resultant σ 1 axes trend N-S horizontally, and are parallel to poles of shale cleavages, which are roughly parallel to bedding planes. Although the cleavages slightly vary their orientations according to later rotation, σ 1 axis changes together with them. This cleavage-controlled paleostress has a low Bishop's stress ratio (i.e. low magnitude of σ 2), therefore is an axial compressional stress normal to cleavages. The restored paleostress was probably exerted just before or at the same time of the formation of duplex structure and the rotation of bedding planes. The meso-scale faults appear to have been formed as normal ones due to overburden. P-T conditions estimated by analysis of fluid inclusions, which occur in the mineral veins sealing measured faults, and cross-cutting relationships between the faults and unit boundary shear zones indicate the simultaneity of these faulting and duplexing. The duplex structure is thought to be formed at the moment of underplating and be caused by stepdown of the décollement. A great variety of drastic changes in properties of material and circumstance such as stress field may occur at the very point of the stepdown, underplating of subducted material, and the up-dip limit of the seismogenic zone.

A Prospective, Randomized Trial of Routine Duplex Ultrasound Surveillance on Arteriovenous Fistula Maturation.

PubMed

Han, Ahram; Min, Seung-Kee; Kim, Mi-Sook; Joo, Kwon Wook; Kim, Jungsun; Ha, Jongwon; Lee, Joongyub; Min, Sang-Il

2016-10-07

Use of arteriovenous fistulas, the most preferred type of access for hemodialysis, is limited by their high maturation failure rate. The aim of this study was to assess whether aggressive surveillance with routine duplex ultrasound and intervention can decrease the maturation failure rate of arteriovenous fistulas. We conducted a single-center, parallel-group, randomized, controlled trial of patients undergoing autogenous arteriovenous fistula. Patients were randomly assigned (1:1) to either the routine duplex or selective duplex group. In the routine duplex group, duplex ultrasound and physical examination were performed 2, 4, and 8 weeks postoperatively. In the selective duplex group, duplex examination was performed only when physical examination detected an abnormality. The primary end point was the maturation failure rate 8 weeks after fistula creation. Maturation failure was defined as the inability to achieve clinical maturation ( i.e. , a successful first use) and failure to achieve sonographic maturation (fistula flow >500 ml/min and diameter >6 mm) within 8 weeks. Between June 14, 2012, and June 25, 2014, 150 patients were enrolled (75 patients in each group), and 118 of those were included in the final analysis. The maturation failure rate was lower in the routine duplex group (8 of 59; 13.6%) than in the selective duplex group (15 of 59; 25.4%), but the difference was not statistically significant (odds ratio, 0.46; 95% confidence interval, 0.18 to 1.19; P =0.10). Factors associated with maturation failure were women (odds ratio, 3.84; 95% confidence interval, 1.05 to 14.06; P =0.04), coronary artery disease (odds ratio, 6.36; 95% confidence interval, 1.62 to 24.95; P <0.01), diabetes (odds ratio, 6.10; 95% confidence interval, 1.76 to 21.19; P <0.01), and the preoperative cephalic vein diameter (odds ratio, 0.30; 95% confidence interval, 0.13 to 0.71; P <0.01). Postoperative routine duplex surveillance failed to prove superiority compared with selective duplex after physical examination for reducing arteriovenous fistula maturation failure. However, the wide 95% confidence interval for the effect of intervention precludes a firm conclusion that routine duplex surveillance was not beneficial. Copyright © 2016 by the American Society of Nephrology.

Benefits of Automatic Duplexing Fact Sheet

EPA Pesticide Factsheets

This resource provides a how-to duplex guide, informs the reader on the benefits and cost savings from automatic duplexing, and several off the shelf print management software options for your facility.

Electron Beam Welding of Duplex Steels with using Heat Treatment

NASA Astrophysics Data System (ADS)

Schwarz, Ladislav; Vrtochová, Tatiana; Ulrich, Koloman

2010-01-01

This contribution presents characteristics, metallurgy and weldability of duplex steels with using concentrated energy source. The first part of the article describes metallurgy of duplex steels and the influence of nitrogen on their solidification. The second part focuses on weldability of duplex steels with using electron beam aimed on acceptable structure and corrosion resistance performed by multiple runs of defocused beam over the penetration weld.

Electrochemical aptamer-based nanosensor fabricated on single Au nanowire electrodes for adenosine triphosphate assay.

PubMed

Wang, Dongmei; Xiao, Xiaoqing; Xu, Shen; Liu, Yong; Li, Yongxin

2018-01-15

In this work, single Au nanowire electrodes (AuNWEs) were fabricated by laser-assisted pulling/hydrofluoric acid (HF) etching process, which then were characterized by transmission electron microscopy (TEM), electrochemical method and finite-element simulation. The as-prepared single AuNWEs were used to construct electrochemical aptamer-based nanosensors (E-AB nanosensors) based on the formation of Au-S bond that duplex DNA tagged with methylene blue (MB) was modified on the surface of electrode. In the presence of adenosine triphosphate (ATP), the MB-labeled aptamer dissociated from the duplex DNA due to the strong specific affinity between aptamer and target, which lead to the reduction of MB electrochemical signals. Moreover, BSA was employed to further passivate electrode surface bonding sites for the stable of the sensor. The as-prepared E-AB nanosensor has been used for ATP assay with excellent sensitivity and selectivity, even in a complex system like cerebrospinal fluid of rat brain. Considering the unique properties of good stability, larger surface area and smaller overall dimensions, this E-AB nanosensor should be an ideal platform for widely sensing applications in living bio-system. Copyright © 2017 Elsevier B.V. All rights reserved.

Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

PubMed

Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

2011-07-01

This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of microstructure and texture across dissimilar super duplex/austenitic stainless steel weldment joint by austenitic filler metal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eghlimi, Abbas, E-mail: a.eghlimi@ma.iut.ac.ir; Shamanian, Morteza; Eskandarian, Masoomeh

The evolution of microstructure and texture across an as-welded dissimilar UNS S32750 super duplex/UNS S30403 austenitic stainless steel joint welded by UNS S30986 (AWS A5.9 ER309LMo) austenitic stainless steel filler metal using gas tungsten arc welding process was evaluated by optical micrography and EBSD techniques. Due to their fabrication through rolling process, both parent metals had texture components resulted from deformation and recrystallization. The weld metal showed the highest amount of residual strain and had large austenite grain colonies of similar orientations with little amounts of skeletal ferrite, both oriented preferentially in the < 001 > direction with cub-on-cube orientationmore » relationship. While the super duplex stainless steel's heat affected zone contained higher ferrite than its parent metal, an excessive grain growth was observed at the austenitic stainless steel's counterpart. At both heat affected zones, austenite underwent some recrystallization and formed twin boundaries which led to an increase in the fraction of high angle boundaries as compared with the respective base metals. These regions showed the least amount of residual strain and highest amount of recrystallized austenite grains. Due to the static recrystallization, the fraction of low degree of fit (Σ) coincident site lattice boundaries, especially Σ3 boundaries, was increased in the austenitic stainless steel heat affected zone, while the formation of subgrains in the ferrite phase increased the content of < 5° low angle boundaries at that of the super duplex stainless steel. - Graphical abstract: Display Omitted - Highlights: • Extensive grain growth in the HAZ of austenitic stainless steel was observed. • Intensification of < 100 > orientated grains was observed adjacent to both fusion lines. • Annealing twins with Σ3 CSL boundaries were formed in the austenite of both HAZ. • Cub-on-cube OR was observed between austenite and ferrite in the weld metal. • Weld metal had the lowest texture intensity and ratio of low angle and CSL boundaries.« less

Geometry and kinematics of the fold-thrust belt and structural evolution of the major Himalayan fault zones in the Darjeeling -- Sikkim Himalaya, India

NASA Astrophysics Data System (ADS)

Bhattacharyya, Kathakali

The Darjeeling-Sikkim Himalaya lies in the eastern part of the Himalayan fold-thrust belt (FTB) in a zone of high arc-perpendicular convergence between the Indian and Eurasian plates. In this region two distinct faults form the Main Central thrust (MCT), the structurally higher MCT1 and the lower MCT2; both these faults have translated the Greater Himalayan hanging wall rocks farther towards the foreland than in the western Himalaya. The width of the sub-MCT Lesser Himalayan rocks progressively decreases from the western Himalaya to this part of the eastern Himalaya, and as a result, the width of the FTB is narrower in this region compared to the western Himalaya. Our structural analysis shows that in the Darjeeling-Sikkim Himalaya the sub-MCT Lesser Himalayan duplex is composed of two duplex systems and has a more complex geometry than in the rest of the Himalayan fold-thrust belt. The structurally higher Dating duplex is a hinterland-dipping duplex; the structurally lower Rangit duplex varies in geometry from a hinterland-dipping duplex in the north to an antiformal stack in the middle and a foreland-dipping duplex in the south. The MCT2 is the roof thrust of the Daling duplex and the Ramgarh thrust is the roof thrust of the Rangit duplex. In this region, the Ramgarh thrust has a complex structural history with continued reactivation during footwall imbrication. The foreland-dipping component of the Rangit duplex, along with the large displacement associated with the reactivation of the Ramgarh thrust accounts for the large translation of the MCT sheets in the Darjeeling-Sikkim Himalaya. The growth of the Lesser Himalayan duplex modified the final geometry of the overlying MCT sheets, resulting in a plunge culmination that manifests itself as a broad N-S trending "anticline" in the Darjeeling-Sikkim Himalaya. This is not a "river anticline" as its trace lies west of the Teesta river. A transport parallel balanced cross section across this region has accommodated a total minimum shortening of ˜502 km (˜82%) south of the South Tibetan Detachment system (STDS). Based on this shortening, the average long-term shortening rate is estimated to be ˜22mm/yr in this region. The available shortening estimates from different parts of the Himalayan arc show significant variations in shortening, but based on the present available data, it is difficult to evaluate the primary cause for this variation. The shortening in the Himalayan fold-thrust belt (FTB) is highest in the middle of the Himalayan arc (western Nepal) and progressively decreases towards the two syntaxes. Although the width of the Lesser Himalayan belt decreases in the eastern Himalaya, the Lesser Himalayan shortening percentage remains approximately similar to that in the Nepal Himalaya. In addition, the shortening accommodated within the Lesser Himalayan duplex progressively increases from the western to the eastern Himalaya where it accommodates nearly half of the total shortening. The regional restorations suggest that the width of the original Lesser Himalayan basin may have played an important role in partitioning the shortening in the Himalayan FTB. In addition, the retrodeformed cross section in the Darjeeling-Sikkim Himalaya provides insights into the palinspastic reconstruction of the Gondwana basin of Peninsular India, suggesting that this basin extended ˜150 km northward of its present northernmost exposure in this region. The balanced cross section suggests that each of the MCT sheets has undergone translation of ≥100km in this region. Although a regional scale flat-on-flat relationship is seen in the MCT sheets, there is a significant variation in overburden from the trailing portion to the leading edge of the MCT due to the geometry of the tapered crystalline orogenic wedge. Microstructural studies from three segments of the MCT2 fault zone suggest that the MCT2 zone has undergone strain softening by different mechanisms along different portions of its transport-parallel length, mainly as a result of changing overburden conditions. This regional strain softening provides a suitable explanation for the large translation of ≥100 km along a relatively thin MCT2 fault zone in the Darjeeling-Sikkim Himalaya.

Promotion of double-duplex invasion of peptide nucleic acids through conjugation with nuclear localization signal peptide.

PubMed

Aiba, Yuichiro; Honda, Yuta; Komiyama, Makoto

2015-03-02

Pseudo-complementary peptide nucleic acid (pcPNA), as one of the most widely used synthetic DNA analogues, invades double-stranded DNA according to Watson-Crick rules to form invasion complexes. This unique mode of DNA recognition induces structural changes at the invasion site and can be used for a range of applications. In this paper, pcPNA is conjugated with a nuclear localization signal (NLS) peptide, and its invading activity is notably promoted both thermodynamically and kinetically. Thus, the double-duplex invasion complex is formed promptly at low pcPNA concentrations under high salt conditions, where the invasion otherwise never occurs. Furthermore, NLS-modified pcPNA is successfully employed for site-selective DNA scission, and the targeted DNA is selectively cleaved under conditions that are not conducive for DNA cutters using unmodified pcPNAs. This strategy of pcPNA modification is expected to be advantageous and promising for a range of in vitro and in vivo applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

In vitro assembly of plant RNA-induced silencing complexes facilitated by molecular chaperone HSP90.

PubMed

Iki, Taichiro; Yoshikawa, Manabu; Nishikiori, Masaki; Jaudal, Mauren C; Matsumoto-Yokoyama, Eiko; Mitsuhara, Ichiro; Meshi, Tetsuo; Ishikawa, Masayuki

2010-07-30

RNA-induced silencing complexes (RISCs) play central roles in posttranscriptional gene silencing. In plants, the mechanism of RISC assembly has remained elusive due to the lack of cell-free systems that recapitulate the process. In this report, we demonstrate that plant AGO1 protein synthesized by in vitro translation using an extract of evacuolated tobacco protoplasts incorporates synthetic small interfering RNA (siRNA) and microRNA (miRNA) duplexes to form RISCs that sequester the single-stranded siRNA guide strand and miRNA strand, respectively. The formed RISCs were able to recognize and cleave the complementary target RNAs. In this system, the siRNA duplex was incorporated into HSP90-bound AGO1, and subsequent removal of the passenger strand was triggered by ATP hydrolysis by HSP90. Removal of the siRNA passenger strand required the ribonuclease activity of AGO1, while that of the miRNA star strand did not. Based on these results, the mechanism of plant RISC formation is discussed. Copyright 2010 Elsevier Inc. All rights reserved.

Drastic stabilization of parallel DNA hybridizations by a polylysine comb-type copolymer with hydrophilic graft chain.

PubMed

Miyoshi, Daisuke; Ueda, Yu-Mi; Shimada, Naohiko; Nakano, Shu-Ichi; Sugimoto, Naoki; Maruyama, Atsushi

2014-09-01

Electrostatic interactions play a major role in protein-DNA interactions. As a model system of a cationic protein, herein we focused on a comb-type copolymer of a polycation backbone and dextran side chains, poly(L-lysine)-graft-dextran (PLL-g-Dex), which has been reported to form soluble interpolyelectrolyte complexes with DNA strands. We investigated the effects of PLL-g-Dex on the conformation and thermodynamics of DNA oligonucleotides forming various secondary structures. Thermodynamic analysis of the DNA structures showed that the parallel conformations involved in both DNA duplexes and triplexes were significantly and specifically stabilized by PLL-g-Dex. On the basis of thermodynamic parameters, it was further possible to design DNA switches that undergo structural transition responding to PLL-g-Dex from an antiparallel duplex to a parallel triplex even with mismatches in the third strand hybridization. These results suggest that polycationic molecules are able to induce structural polymorphism of DNA oligonucleotides, because of the conformation-selective stabilization effects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong Hongping; Zhang Bo; Shi Peiyong

2008-11-10

Genome cyclization is essential for flavivirus replication. We used RNases to probe the structures formed by the 5'-terminal 190 nucleotides and the 3'-terminal 111 nucleotides of the West Nile virus (WNV) genomic RNA. When analyzed individually, the two RNAs adopt stem-loop structures as predicted by the thermodynamic-folding program. However, when mixed together, the two RNAs form a duplex that is mediated through base-pairings of two sets of RNA elements (5'CS/3'CSI and 5'UAR/3'UAR). Formation of the RNA duplex facilitates a conformational change that leaves the 3'-terminal nucleotides of the genome (position - 8 to - 16) to be single-stranded. Viral NS5more » binds specifically to the 5'-terminal stem-loop (SL1) of the genomic RNA. The 5'SL1 RNA structure is essential for WNV replication. The study has provided further evidence to suggest that flavivirus genome cyclization and NS5/5'SL1 RNA interaction facilitate NS5 binding to the 3' end of the genome for the initiation of viral minus-strand RNA synthesis.« less

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

PubMed

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery.

PubMed

Tuteja, Narendra; Tuteja, Renu

2004-05-01

DNA helicases are ubiquitous molecular motor proteins which harness the chemical free energy of ATP hydrolysis to catalyze the unwinding of energetically stable duplex DNA, and thus play important roles in nearly all aspects of nucleic acid metabolism, including replication, repair, recombination, and transcription. They break the hydrogen bonds between the duplex helix and move unidirectionally along the bound strand. All helicases are also translocases and DNA-dependent ATPases. Most contain conserved helicase motifs that act as an engine to power DNA unwinding. All DNA helicases share some common properties, including nucleic acid binding, NTP binding and hydrolysis, and unwinding of duplex DNA in the 3' to 5' or 5' to 3' direction. The minichromosome maintenance (Mcm) protein complex (Mcm4/6/7) provides a DNA-unwinding function at the origin of replication in all eukaryotes and may act as a licensing factor for DNA replication. The RecQ family of helicases is highly conserved from bacteria to humans and is required for the maintenance of genome integrity. They have also been implicated in a variety of human genetic disorders. Since the discovery of the first DNA helicase in Escherichia coli in 1976, and the first eukaryotic one in the lily in 1978, a large number of these enzymes have been isolated from both prokaryotic and eukaryotic systems, and the number is still growing. In this review we cover the historical background of DNA helicases, helicase assays, biochemical properties, prokaryotic and eukaryotic DNA helicases including Mcm proteins and the RecQ family of helicases. The properties of most of the known DNA helicases from prokaryotic and eukaryotic systems, including viruses and bacteriophages, are summarized in tables.

The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

PubMed

Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

2017-04-01

Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

Mg(II) and Ni(II) induce aggregation of poly(rA)poly(rU) to either tetra-aggregate or triplex depending on the metal ion concentration.

PubMed

Biver, Tarita; Busto, Natalia; García, Begoña; Leal, José M; Menichetti, Luisa; Secco, Fernando; Venturini, Marcella

2015-10-01

The ability of magnesium(II) and nickel(II) to induce dramatic conformational changes in the synthetic RNA poly(rA)poly(rU) has been investigated. Kinetic experiments, spectrofluorometric titrations, melting experiments and DSC measurements contribute in shedding light on a complex behaviour where the action of metal ions (Na(+), Mg(2+), Ni(2+)), in synergism with other operators as the intercalating dye coralyne and temperature, all concur in stabilising a peculiar RNA form. Mg(2+) and Ni(2+) (M) bind rapidly and almost quantitatively to the duplex (AU) to give a RNA/metal ion complex (AUM). Then, by the union of two AUM units, an unstable tetra-aggregate (UAUA(M2)*) is formed which, in the presence of a relatively modest excess of metal, evolves to the UAUM triplex by releasing a single AM strand. On the other hand, under conditions of high metal content, the UAUA(M2)* intermediate rearranges to give a more stable tetra-aggregate (UAUA(M2)). As concerns the role of coralyne (D), it is found that D strongly interacts with UAUA(M2). Also, in the presence of coralyne, the ability of divalent ions to promote the transition of AUD into UAUD is enhanced, according to the efficiency sequence [Ni(2+)]≫[Mg(2+)]≫[Na(+)]. Copyright © 2015 Elsevier Inc. All rights reserved.

Chemical synthesis of oligodeoxyribonucleotides containing the Dewar valence isomer of the (6–4) photoproduct and their use in (6–4) photolyase studies

PubMed Central

Yamamoto, Junpei; Hitomi, Kenichi; Todo, Takeshi; Iwai, Shigenori

2006-01-01

The pyrimidine(6–4)pyrimidone photoproduct, a major UV lesion formed between adjacent pyrimidine bases, is transformed to its Dewar valence isomer upon exposure to UVA/UVB light. We have synthesized a phosphoramidite building block of the Dewar photoproduct formed at the thymidylyl(3′–5′)thymidine site and incorporated it into oligodeoxyribonucleotides. The diastereoisomers of the partially protected dinucleoside monophosphate bearing the (6–4) photoproduct, which were caused by the chirality of the phosphorus atom, were separated by reversed-phase chromatography, and the (6–4) photoproduct was converted to the Dewar photoproduct by irradiation of each isomer with Pyrex-filtered light from a high-pressure mercury lamp. The Dewar photoproduct was stable under both acidic and alkaline conditions at room temperature. After characterization of the isomerized base moiety by NMR spectroscopy, a phosphoramidite building block was synthesized in three steps. Although the ordinary method could be used for the oligonucleotide synthesis, benzimidazolium triflate as an alternative activator yielded better results. The oligonucleotides were used for the analysis of the reaction and the binding of Xenopus (6–4) photolyase. Although the affinity of this enzyme for the Dewar photoproduct-containing duplex was reportedly similar to that for the (6–4) photoproduct-containing substrate, the results suggested a difference in the binding mode. PMID:16936311

Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.

PubMed

Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J

2018-04-06

In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.

Reducing the background fluorescence in mice receiving fluorophore/inhibitor DNA duplexes.

PubMed

Liang, Minmin; Liu, Xinrong; Liu, Guozheng; Dou, Shuping; Cheng, Dengfeng; Liu, Yuxia; Rusckowski, Mary; Hnatowich, Donald J

2011-02-07

In principle, a DNA duplex consisting of an antisense fluorophore-conjugated major strand hybridized to a shorter complementary inhibitor-conjugated minor strand should provide fluorescence only in the tumor after intravenous administration if designed to remain intact except in the presence in tumor of its mRNA target. While we have obtained impressive tumor images in mice using this approach, there remains some background fluorescence. In this study, tissue homogenates of selected mouse organs were incubated with a test duplex and the kinetics of duplex dissociation in normal tissues were measured. In this manner we were able to identify the liver as the likely major source responsible for the duplex dissociation providing this fluorescence background. Thereafter liver homogenates were used to screen a series of duplex candidates with variable-length minor strands, and dissociation was measured by gel electrophoresis. The selected fluorophore/inhibitor duplex with improved stability displayed an insignificant (P > 0.05) background fluorescence after administration to SKH-1 normal mice and apparently without affecting target mRNA binding in vitro in cell culture or in vivo in tumor bearing mice.

Synthesis of 5-(1,2,3-triazol-4-yl)-2'-deoxyuridines by a click chemistry approach: stacking of triazoles in the major groove gives increased nucleic acid duplex stability.

PubMed

Kocalka, Petr; Andersen, Nicolai K; Jensen, Frank; Nielsen, Poul

2007-11-23

A general protocol for converting alkyl and aryl halides into azides and for converting these in situ into 1,4-disubstituted triazoles was applied with 5-ethynyl-2'-deoxyuridine. This afforded three modified 2'-deoxyuridine analogues with either unsubstituted or 1-phenyl-/1-benzyl-substituted triazoles in their 5-positions. Modelling demonstrates coplanarity of the two heteroaromatic rings, and UV spectroscopy showed the uracil pK(a) values to be almost unchanged. The three nucleosides were introduced into nonamer oligonucleotides by phosphoramidite chemistry. The heteroaromatic triazoles became positioned in the major grooves of the short dsDNA and DNA-RNA duplexes. While single modifications led to decreased duplex stability, the stacking of four consecutive modifications led to enhanced duplex stability, especially for DNA-RNA duplexes. The duplex structures were studied by CD spectroscopy and molecular dynamics simulations, which supported the conjecture that the duplex stabilizing effect is due to efficient stacking of the heteroaromatic triazoles.

MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

PubMed Central

Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

2016-01-01

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

'Passive-roof' duplex geometry in the frontal structures of the Kirthar and Sulaiman mountain belts, Pakistan

NASA Astrophysics Data System (ADS)

Banks, C. J.; Warburton, J.

Exploration for hydrocarbons over the past few years has greatly improved our understanding of the geometry of frontal mountain belt structures. In this study we introduce and discuss the concept of the 'Passive-roof duplex', using as the main example the Kirthar and Sulaiman Ranges in the Baluchistan Province of Pakistan. Structures similar to those described here have been recognized previously in other mountain belts, and they appear to exist as a common feature in many more frontal regions of mountain belts. Our example of a Passive-roof duplex which we describe from Pakistan is compared briefly with similar structures reported by others. The Passive-roof duplex is here defined as a duplex whose roof thrust has backthrust sense ( Passive-roof thrust) and whose roof sequence (those rocks lying above the roof thrust) remains relatively 'stationary' during foreland directed piggy-back style propagation of horses within the duplex.

Variable exhumation rates and variable displacement rates: Documenting recent slowing of Himalayan shortening in western Bhutan

USGS Publications Warehouse

McQuarrie, Nadine; Tobgay, Tobgay; Long, Sean P.; Reiners, Peter W.; Cosca, Michael A.

2014-01-01

We link exhumational variability in space and time to the evolving geometry of the Himalayan fold–thrust belt in western Bhutan. By combining new and published geochronologic and thermochronologic data we document the burial age, peak temperatures and complete cooling history from 20 Ma to the present over an across-strike distance of ∼125 km. These integrated cooling curves highlight windows of fast exhumation that vary spatially and temporally. We propose that pulses of fast exhumation are a result of structures that facilitate the vertical motion of material, illustrated in sequentially-restored cross sections. Due to a range of permissible geometries at depth, we explore and evaluate the impact of geometry on kinematics and rates of deformation. The linked cooling history and cross sections provide estimates of both magnitude and timing of thrust sheet displacement and highlight temporal variability in potential shortening rates. Structural and chronologic data illustrate a general north to south progression of Himalayan deformation, with emplacement of the Main Central thrust (MCT), Paro thrust and Shumar thrust by 12 to no later than 9 Ma. Two different geometries and kinematic scenarios for the Lesser Himalayan duplex are proposed. A north to south propagating duplex system requires that the southern portion of that system, south of the MCT, deformed and cooled by 9 Ma, leaving only the southernmost thrust sheets, including the Main Boundary and Main Frontal thrusts, to deform between 9 and 0 Ma. This limited post 9 Ma shortening would necessitate a marked slowdown in convergence accommodated on the Main Himalayan thrust. A two-tiered duplex system, which allows for the Paro window duplex and the southern Baxa duplex to form simultaneously, permits duplex formation and accompanying exhumation until 6 Ma. Limited cooling from ∼200 °C to the surface post 6 Ma suggests either a decrease in shortening rates from 6 to 0 Ma or that duplex formation and exhumation are temporally decoupled. Our combined cooling curves highlight that the youngest cooling ages may not mark the fastest thrusting rates or the window of fastest exhumation. Instead, temporal variations in exhumation are best viewed through identifying transients in exhumation rate. We suggest that the strongest control on exhumation magnitude and variability is fold–thrust belt geometry, particularly the locations and magnitudes of footwall ramps, which can change over 10ʼs of km distance. Balanced cross sections predict the location and magnitude of these ramps and how they vary in space and time, providing an untapped potential for testing permissible cross-section geometries and kinematics against measured cooling histories.

Impact of Duplex arterial mapping on decision making in non-acute ischemic limb patients.

PubMed

Elbadawy, A; Aly, H; Ibrahim, M; Bakr, H

2015-12-01

The aim of this study was to demonstrate the impact of Duplex arterial mapping on decision making in non-acute ischemic limb patient group reporting pain onset between 15 days and 3 months. We prospectively evaluated patients presented with critical limb ischemia who reported pain onset of duration between 15 days and 3 months in one-year period. Our series included thirty cases (mean age=61.3 years old), as Duplex arterial mapping was the sole preoperative imaging tool performed in all of them. All patients, in whom duplex indicated thrombosis in long occluded segments, were candidates for fluoroscopically guided thrombectomy. When Duplex defined chronic arterial occlusions, patients underwent endovascular or bypass revascularisation procedures. Impact of Duplex wall interrogation on decision-making between the two groups (subacute and chronic) was measured. Duplex arterial mapping categorized correctly all 30 patients into either subacute ischemia with removable clot (N.=14) or chronic ischemia (N.=16). Fluoroscopic guided thrombectomy was performed in 14 cases when Duplex advised long occluded arterial segments as indicted by intact intima with echogenic thrombus inside. Bypass surgery was performed in 8 patients. Percutaneous transluminal angioplasty (PTA) was done in 7 cases and thrombendartrectomy of common femoral artery in a single case. One-year patency rate in our series was 86.6%. It was 71.4% in thrombosis group. Limb salvage rate was 93.3%. Duplex arterial mapping could be used to differentiate the subacute ischemia with removable thrombus and chronic arterial occlusions guiding for the best revascularization procedure accordingly.

Development and properties of duplex MgF2/PCL coatings on biodegradable magnesium alloy for biomedical applications.

PubMed

Makkar, Preeti; Kang, Hoe Jin; Padalhin, Andrew R; Park, Ihho; Moon, Byoung-Gi; Lee, Byong Taek

2018-01-01

The present work addresses the performance of polycaprolactone (PCL) coating on fluoride treated (MgF2) biodegradable ZK60 magnesium alloy (Mg) for biomedical application. MgF2 conversion layer was first produced by immersing Mg alloy substrate in hydrofluoric acid solution. The outer PCL coating was then prepared using dip coating technique. Morphology, elements profile, phase structure, roughness, mechanical properties, invitro corrosion, and biocompatibility of duplex MgF2/PCL coating were then characterized and compared to those of fluoride coated and uncoated Mg samples. The invivo degradation behavior and biocompatibility of duplex MgF2/PCL coating with respect to ZK60 Mg alloy were also studied using rabbit model for 2 weeks. SEM and TEM analysis showed that the duplex coating was uniform and comprised of porous PCL film (~3.3 μm) as upper layer with compact MgF2 (~2.2 μm) as inner layer. No significant change in microhardness was found on duplex coating compared with uncoated ZK60 Mg alloy. The duplex coating showed improved invitro corrosion resistance than single layered MgF2 or uncoated alloy samples. The duplex coating also resulted in better cell viability, cell adhesion, and cell proliferation compared to fluoride coated or uncoated alloy. Preliminary invivo studies indicated that duplex MgF2/PCL coating reduced the degradation rate of ZK60 Mg alloy and exhibited good biocompatibility. These results suggested that duplex MgF2/PCL coating on magnesium alloy might have great potential for orthopedic applications.

Development and properties of duplex MgF2/PCL coatings on biodegradable magnesium alloy for biomedical applications

PubMed Central

Makkar, Preeti; Kang, Hoe Jin; Padalhin, Andrew R.; Park, Ihho; Moon, Byoung-Gi

2018-01-01

The present work addresses the performance of polycaprolactone (PCL) coating on fluoride treated (MgF2) biodegradable ZK60 magnesium alloy (Mg) for biomedical application. MgF2 conversion layer was first produced by immersing Mg alloy substrate in hydrofluoric acid solution. The outer PCL coating was then prepared using dip coating technique. Morphology, elements profile, phase structure, roughness, mechanical properties, invitro corrosion, and biocompatibility of duplex MgF2/PCL coating were then characterized and compared to those of fluoride coated and uncoated Mg samples. The invivo degradation behavior and biocompatibility of duplex MgF2/PCL coating with respect to ZK60 Mg alloy were also studied using rabbit model for 2 weeks. SEM and TEM analysis showed that the duplex coating was uniform and comprised of porous PCL film (~3.3 μm) as upper layer with compact MgF2 (~2.2 μm) as inner layer. No significant change in microhardness was found on duplex coating compared with uncoated ZK60 Mg alloy. The duplex coating showed improved invitro corrosion resistance than single layered MgF2 or uncoated alloy samples. The duplex coating also resulted in better cell viability, cell adhesion, and cell proliferation compared to fluoride coated or uncoated alloy. Preliminary invivo studies indicated that duplex MgF2/PCL coating reduced the degradation rate of ZK60 Mg alloy and exhibited good biocompatibility. These results suggested that duplex MgF2/PCL coating on magnesium alloy might have great potential for orthopedic applications. PMID:29608572

C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.

PubMed

Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E

2015-07-20

Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of Weld Metal Microstructures in Pulsed Laser Welding of Duplex Stainless Steel

NASA Astrophysics Data System (ADS)

Mirakhorli, F.; Malek Ghaini, F.; Torkamany, M. J.

2012-10-01

The microstructure of the weld metal of a duplex stainless steel made with Nd:YAG pulsed laser is investigated at different travel speeds and pulse frequencies. In terms of the solidification pattern, the weld microstructure is shown to be composed of two distinct zones. The presence of two competing heat transfer channels to the relatively cooler base metal and the relatively hotter previous weld spot is proposed to develop two zones. At high overlapping factors, an array of continuous axial grains at the weld centerline is formed. At low overlapping factors, in the zone of higher cooling rate, a higher percentage of ferrite is transformed to austenite. This is shown to be because with extreme cooling rates involved in pulsed laser welding with low overlapping, the ferrite-to-austenite transformation can be limited only to the grain boundaries.

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

PubMed

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Musical duplex perception: perception of figurally good chords with subliminal distinguishing tones.

PubMed

Hall, M D; Pastore, R E

1992-08-01

In a variant of duplex perception with speech, phoneme perception is maintained when distinguishing components are presented below intensities required for separate detection, forming the basis for the claim that a phonetic module takes precedence over nonspeech processing. This finding is replicated with music chords (C major and minor) created by mixing a piano fifth with a sinusoidal distinguishing tone (E or E flat). Individual threshold intensities for detecting E or E flat in the context of the fixed piano tones are established. Chord discrimination thresholds defined by distinguishing tone intensity were determined. Experiment 2 verified masked detection thresholds and subliminal chord identification for experienced musicians. Accurate chord perception was maintained at distinguishing tone intensities nearly 20 dB below the threshold for separate detection. Speech and music findings are argued to demonstrate general perceptual principles.

Prolonged CT urography in duplex kidney.

PubMed

Gong, Honghan; Gao, Lei; Dai, Xi-Jian; Zhou, Fuqing; Zhang, Ning; Zeng, Xianjun; Jiang, Jian; He, Laichang

2016-05-13

Duplex kidney is a common anomaly that is frequently associated with multiple complications. Typical computed tomography urography (CTU) includes four phases (unenhanced, arterial, parenchymal and excretory) and has been suggested to considerably aid in the duplex kidney diagnosi. Unfortunately, regarding duplex kidney with prolonged dilatation, the affected parenchyma and tortuous ureters demonstrate a lack of or delayed excretory opacification. We used prolonged-delay CTU, which consists of another prolonged-delay phase (1- to 72-h delay; mean delay: 24 h) to opacify the duplicated ureters and affected parenchyma. Seventeen patients (9 males and 8 females; age range: 2.5-56 y; mean age: 40.4 y) with duplex kidney were included in this study. Unenhanced scans did not find typical characteristics of duplex kidney, except for irregular perirenal morphology. Duplex kidney could not be confirmed on typical four-phase CTU, whereas it could be easily diagnosed in axial and CT-3D reconstruction using prolonged CTU (prolonged-delay phase). Between January 2005 and October 2010, in this review board-approved study (with waived informed consent), 17 patients (9 males and 8 females; age range: 2.5 ~ 56 y; mean age: 40.4 y) with suspicious duplex kidney underwent prolonged CTU to opacify the duplicated ureters and confirm the diagnosis. Our results suggest the validity of prolonged CTU to aid in the evaluation of the function of the affected parenchyma and in the demonstration of urinary tract malformations.

[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

PubMed

Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

2015-04-01

To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

l-Proline and RNA Duplex m-Value Temperature Dependence.

PubMed

Schwinefus, Jeffrey J; Baka, Nadia L; Modi, Kalpit; Billmeyer, Kaylyn N; Lu, Shutian; Haase, Lucas R; Menssen, Ryan J

2017-08-03

The temperature dependence of l-proline interactions with the RNA dodecamer duplex surface exposed after unfolding was quantified using thermal and isothermal titration denaturation monitored by uv-absorbance. The m-value quantifying proline interactions with the RNA duplex surface area exposed after unfolding was measured using RNA duplexes with GC content ranging between 17 and 83%. The m-values from thermal denaturation decreased with increasing GC content signifying increasingly favorable proline interactions with the exposed RNA surface area. However, m-values from isothermal titration denaturation at 25.0 °C were independent of GC content and less negative than those from thermal denaturation. The m-value from isothermal titration denaturation for a 50% GC RNA duplex decreased (became more negative) as the temperature increased and was in nearly exact agreement with the m-value from thermal denaturation. Since RNA duplex transition temperatures increased with GC content, the more favorable proline interactions with the high GC content duplex surface area observed from thermal denaturation resulted from the temperature dependence of proline interactions rather than the RNA surface chemical composition. The enthalpy contribution to the m-value was positive and small (indicating a slight increase in duplex unfolding enthalpy with proline) while the entropic contribution to the m-value was positive and increased with temperature. Our results will facilitate proline's use as a probe of solvent accessible surface area changes during biochemical reactions at different reaction temperatures.

Translational Entropy and DNA Duplex Stability.

PubMed

Privalov, Peter L; Crane-Robinson, Colyn

2018-01-09

Investigation of folding/unfolding DNA duplexes of various size and composition by superprecise calorimetry has revised several long-held beliefs concerning the forces responsible for the formation of the double helix. It was established that: 1) the enthalpy and the entropy of duplex unfolding are temperature dependent, increasing with temperature rise and having the same heat capacity increment for CG and AT pairs; 2) the enthalpy of AT melting is greater than that of the CG pair, so the stabilizing effect of the CG pair in comparison with AT results not from its larger enthalpic contribution (as expected from its extra hydrogen bond), but from the larger entropic contribution of the AT pair that results from its ability to fix ordered water in the minor groove and release it upon duplex unfolding; 3) the translation entropy, resulting from the appearance of a new kinetic unit on duplex dissociation, determines the dependence of duplex stability on its length and its concentration (it is an order-of-magnitude smaller than predicted from the statistical mechanics of gases and is fully expressed by the stoichiometric correction term); 4) changes in duplex stability on reshuffling the sequence (the "nearest-neighbor effect") result from the immobilized water molecules fixed by AT pairs in the minor groove; and 5) the evaluated thermodynamic components permit a quantitative expression of DNA duplex stability. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Solution structure and stability of the DNA undecamer duplexes containing oxanine mismatch

PubMed Central

Pack, Seung Pil; Morimoto, Hirohisa; Makino, Keisuke; Tajima, Kunihiko; Kanaori, Kenji

2012-01-01

Solution structures of DNA duplexes containing oxanine (Oxa, O) opposite a cytosine (O:C duplex) and opposite a thymine (O:T duplex) have been solved by the combined use of 1H NMR and restrained molecular dynamics calculation. One mismatch pair was introduced into the center of the 11-mer duplex of [d(GTGACO6CACTG)/d(CAGTGX17GTCAC), X = C or T]. 1H NMR chemical shifts and nuclear Overhauser enhancement (NOE) intensities indicate that both the duplexes adopt an overall right-handed B-type conformation. Exchangeable resonances of C17 4-amino proton of the O:C duplex and of T17 imino proton of O:T duplex showed unusual chemical shifts, and disappeared with temperature increasing up to 30°C, although the melting temperatures were >50°C. The O:C mismatch takes a wobble geometry with positive shear parameter where the Oxa ring shifted toward the major groove and the paired C17 toward the minor groove, while, in the O:T mismatch pair with the negative shear, the Oxa ring slightly shifted toward the minor groove and the paired T17 toward the major groove. The Oxa mismatch pairs can be wobbled largely because of no hydrogen bond to the O1 position of the Oxa base, and may occupy positions in the strands that optimize the stacking with adjacent bases. PMID:22039100

Development of nano-structured duplex and ferritic stainless steels by pulverisette planetary milling followed by pressureless sintering

DOE Office of Scientific and Technical Information (OSTI.GOV)

R, Shashanka, E-mail: shashankaic@gmail.com; Chaira, D., E-mail: chaira.debasis@gmail.com

Nano-structured duplex and ferritic stainless steel powders are prepared by planetary milling of elemental Fe, Cr and Ni powder for 40 h and then consolidated by conventional pressureless sintering. The progress of milling and the continuous refinement of stainless steel powders have been confirmed by means of X-ray diffraction and scanning electron microscopy. Activation energy for the formation of duplex and ferritic stainless steels is calculated by Kissinger method using differential scanning calorimetry and is found to be 159.24 and 90.17 KJ/mol respectively. Both duplex and ferritic stainless steel powders are consolidated at 1000, 1200 and 1400 °C in argonmore » atmosphere to study microstructure, density and hardness. Maximum sintered density of 90% and Vickers microhardness of 550 HV are achieved for duplex stainless steel sintered at 1400 °C for 1 h. Similarly, 92% sintered density and 263 HV microhardness are achieved for ferritic stainless steel sintered at 1400 °C. - Highlights: • Synthesized duplex and ferritic stainless steels by pulverisette planetary milling • Calculated activation energy for the formation of duplex and ferritic stainless steels • Studied the effect of sintering temperature on density, hardness and microstructure • Duplex stainless steel exhibits 90% sintered density and microhardness of 550 HV. • Ferritic stainless steel shows 92% sintered density and 263 HV microhardness.« less

Novel DNA lesions generated by the interaction between therapeutic thiopurines and UVA light.

PubMed

Zhang, Xiaohong; Jeffs, Graham; Ren, Xiaolin; O'Donovan, Peter; Montaner, Beatriz; Perrett, Conal M; Karran, Peter; Xu, Yao-Zhong

2007-03-01

The therapeutic effect of the thiopurines, 6-thioguanine (6-TG), 6-mercaptopurine, and its prodrug azathioprine, depends on the incorporation of 6-TG into cellular DNA. Unlike normal DNA bases, 6-TG absorbs UVA radiation, and UVA-mediated photochemical damage of DNA 6-TG has potentially harmful side effects. When free 6-TG is UVA irradiated in solution in the presence of molecular oxygen, reactive oxygen species are generated and 6-TG is oxidized to guanine-6-sulfonate (G(SO3)) and guanine-6-thioguanine in reactions involving singlet oxygen. This conversion is prevented by antioxidants, including the dietary vitamin ascorbate. DNA G(SO3) is also the major photoproduct of 6-TG in DNA and it can be selectively introduced into DNA or oligonucleotides in vitro by mild chemical oxidation. Thermal stability measurements indicate that G(SO3) does not form stable base pairs with any of the normal DNA bases in duplex oligonucleotides and is a powerful block for elongation by Klenow DNA polymerase in primer extension experiments. In cultured human cells, DNA damage produced by 6-TG and UVA treatment is associated with replication inhibition and provokes a p53-dependent DNA damage response.

Furan Decorated Nucleoside Analogues as Fluorescent Probes: synthesis, photophysical evaluation and site-specific incorporation

PubMed Central

Greco, Nicholas J.; Tor, Yitzhak

2007-01-01

The synthesis and photophysical evaluation of modified nucleoside analogues in which a five-membered heterocycle (furan, thiophene, oxazole and thiazole) is attached to the 5 position of 2′-deoxyuridine are reported. The furan containing derivative is identified as the most promising responsive nucleoside of this family due to its emission quantum efficiency and degree of sensitivity to its microenvironment. The furan moiety was then attached to the 5 position of 2′-deoxycytidine as well as the 8 position of adenosine and guanosine. Photophysical evaluation of these four furan containing nucleoside analogues reveal distinct differences in the absorption, emission and quantum efficiency depending upon the class of nucleoside (pyrimidine or purine). Comparing the photophysical properties of all furan containing nucleosides, identifies the furan thymidine analogue, 5-(fur-2-yl)-2′-deoxyuridine, as the best candidate for use as a responsive fluorescent probe in nucleic acids. 5-(fur-2-yl)-2′-deoxyuridine was then converted to the corresponding phosphoramidite and site specifically incorporated into DNA oligonucleotides with greater than 88% coupling efficiency. Such furan-modified oligonucleotides form stable duplexes upon hybridization to their complementary DNA strands and display favorable fluorescent features. PMID:18431439

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

PubMed

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Slicing-independent RISC activation requires the argonaute PAZ domain.

PubMed

Gu, Shuo; Jin, Lan; Huang, Yong; Zhang, Feijie; Kay, Mark A

2012-08-21

Small RNAs regulate genetic networks through a ribonucleoprotein complex called the RNA-induced silencing complex (RISC), which, in mammals, contains at its center one of four Argonaute proteins (Ago1-Ago4). A key regulatory event in the RNA interference (RNAi) and microRNA (miRNA) pathways is Ago loading, wherein double-stranded small-RNA duplexes are incorporated into RISC (pre-RISC) and then become single-stranded (mature RISC), a process that is not well understood. The Agos contain an evolutionarily conserved PAZ (Piwi/Argonaute/Zwille) domain whose primary function is to bind the 3' end of small RNAs. We created multiple PAZ-domain-disrupted mutant Ago proteins and studied their biochemical properties and biological functionality in cells. We found that the PAZ domain is dispensable for Ago loading of slicing-competent RISC. In contrast, in the absence of slicer activity or slicer-substrate duplex RNAs, PAZ-disrupted Agos bound duplex small interfering RNAs, but were unable to unwind or eject the passenger strand and form functional RISC complexes. We have discovered that the highly conserved PAZ domain plays an important role in RISC activation, providing new mechanistic insights into how miRNAs regulate genes, as well as new insights for future design of miRNA- and RNAi-based therapeutics. Copyright © 2012 Elsevier Ltd. All rights reserved.

Effect of heat input on dissimilar welds of ultra high strength steel and duplex stainless steel: Microstructural and compositional analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tasalloti, H., E-mail: hamed.tasalloti.kashani@stu

The effect of heat input on the microstructure and compositional heterogeneity of welds of direct-quenched ultra high strength steel (Optim 960 QC) and duplex stainless steel (UNS S32205) was studied. The dissimilar welds were made using GMAW with a fully austenitic filler wire. In addition to grain coarsening in the heat affected zone (HAZ) of the ferritic side, it was found that an increase in heat input correlatively increased the proportional volume of bainitic to martensitic phases. Coarse ferritic grains were observed in the duplex HAZ. Higher heat input, however, had a beneficial effect on the nucleation of austenite inmore » the HAZ. Heat input had a regulatory effect on grain growth within the austenitic weld and more favorable equiaxed austenite was obtained with higher heat input. On the ferritic side of the welds, macrosegregation in the form of a martensitic intermediate zone was observed for all the cooling rates studied. However, on the duplex side, macrosegregation in the fusion boundary was only noticed with higher cooling rates. Microstructural observations and compositional analysis suggest that higher heat input could be beneficial for the structural integrity of the weld despite higher heat input increasing the extent of adverse coarse grains in the HAZ, especially on the ferritic side. - Highlights: •The effect of heat input on dissimilar welds of UHSS and DSS was studied. •Transmutation of the microstructure was discussed in detail. •The influence of heat input on compositional heterogeneity of welds was described. •Higher heat input enhanced bainitic transformation on the ferritic side. •Macrosegregation was affected by the amount of heat input on the DSS side.« less

Determining the folding and unfolding rate constants of nucleic acids by biosensor. Application to telomere G-quadruplex.

PubMed

Zhao, Yong; Kan, Zhong-yuan; Zeng, Zhi-xiong; Hao, Yu-hua; Chen, Hua; Tan, Zheng

2004-10-20

Nucleic acid molecules may fold into secondary structures, and the formation of such structures is involved in many biological processes and technical applications. The folding and unfolding rate constants define the kinetics of conformation interconversion and the stability of these structures and is important in realizing their functions. We developed a method to determine these kinetic parameters using an optical biosensor based on surface plasmon resonance. The folding and unfolding of a nucleic acid is coupled with a hybridization reaction by immobilization of the target nucleic acid on a sensor chip surface and injection of a complementary probe nucleic acid over the sensor chip surface. By monitoring the time course of duplex formation, both the folding and unfolding rate constants for the target nucleic acid and the association and dissociation rate constants for the target-probe duplex can all be derived from the same measurement. We applied this method to determine the folding and unfolding rate constants of the G-quadruplex of human telomere sequence (TTAGGG)(4) and its association and dissociation rate constants with the complementary strand (CCCTAA)(4). The results show that both the folding and unfolding occur on the time scale of minutes at physiological concentration of K(+). We speculate that this property might be important for telomere elongation. A complete set of the kinetic parameters for both of the structures allows us to study the competition between the formation of the quadruplex and the duplex. Calculations indicate that the formation of both the quadruplex and the duplex is strand concentration-dependent, and the quadruplex can be efficiently formed at low strand concentration. This property may provide the basis for the formation of the quadruplex in vivo in the presence of a complementary strand.

A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins.

PubMed

Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa

2016-03-21

Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

PubMed

Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

2014-01-18

Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.

Tertiary uplift of the Mt. Doonerak antiform, central Brooks Range, Alaska: Apatite fission track evidence from the Trans-Alaska Crustal Transect

USGS Publications Warehouse

O'Sullivan, P. B.; Moore, Thomas E.; Murphy, J.M.; Oldow, J.S.; Ave Lallemant, H.G.

1998-01-01

The Mt. Doonerak antiform is a northeast-trending, doubly plunging antiform located along the axial part of the central Brooks Range. This antiform is a crustal-scale duplex estimated to have a vertical displacement of ~15 km. The antiform folds the Amawk thrust, which separates relatively less displaced lower plate rocks in a window in the core of the antiform from allochthonous upper plate rocks of the Endicott Mountains allochthon. Because regional geological relations indicate that displacement on the Amawk thrust occurred between early Neocomian and early Albian time, uplift of the antiform is post-early Neocomian in age.Zircon fission-track data from the Mt. Doonerak antiform suggest -8-12 km of vertical denudation has occurred within the antiform region since -70-65 Ma. whereas apatite fission-track data indicate the antiform has experienced a minimum of -46 km of denudation since late Oligocene time. Following rapid denudation at -24 + 3 Ma, the rocks have experienced continued denudation to present surface conditions at a slower rate.We conclude from the relative relations and timing that the Mt. Doonerak duplex was constructed in part during the late Oligocene by reactivation of an older duplex formed during the latest Cretaceous to Paleocene. Deformation and uplift of Oligocene age for the axial part of the Brooks Range orogen is anomalously young, but it is the same age as the youngest episode of north-vergent contractional uplift in the northeastern Brooks Range. Because the Mt. Doonerak antiform displays structural characteristics similar to those of antiforms in the northeastern Brooks Range and because both regions experienced simultaneous rapid denudation, we suggest that the Mt. Doonerak antiform formed in response to an episode of contractional deformation that affected both areas in the late Oligocene.

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

PubMed

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

Photophysical Characterization of Enhanced 6-Methylisoxanthopterin Fluorescence in Duplex DNA.

PubMed

Moreno, Andrew; Knee, J L; Mukerji, Ishita

2016-12-08

The structure and dynamic motions of bases in DNA duplexes and other constructs are important for understanding mechanisms of selectivity and recognition of DNA-binding proteins. The fluorescent guanine analogue, 6-methylisoxanthopterin 6-MI, is well suited to this purpose as it exhibits an unexpected 3- to 4-fold increase in relative quantum yield upon duplex formation when incorporated into the following sequences: ATFAA, AAFTA, or ATFTA (where F represents 6-MI). To better understand some of the factors leading to the 6-MI fluorescence increase upon duplex formation, we characterized the effect of local sequence and structural perturbations on 6-MI photophysics through temperature melts, quantum yield measurements, fluorescence quenching assays, and fluorescence lifetime measurements. By examining 21 sequences we have determined that the duplex-enhanced fluorescence (DEF) depends on the composition of bases adjacent to 6-MI and the presence of adenines at locations n ± 2 from the probe. Investigation of duplex stability and local solvent accessibility measurements support a model in which the DEF arises from a constrained geometry of 6-MI in the duplex, which remains H-bonded to cytosine, stacked with adjacent bases and inaccessible to quenchers. Perturbation of DNA structure through the introduction of an unpaired base 3' to 6-MI or a mismatched basepair increases 6-MI dynamic motion leading to fluorescence quenching and a reduction in quantum yield. Molecular dynamics simulations suggest the enhanced fluorescence results from a greater degree of twist at the X-F step relative to the quenched duplexes examined. These results point to a model where adenine residues located at n ± 2 from 6-MI induce a structural geometry with greater twist in the duplex that hinders local motion reducing dynamic quenching and producing an increase in 6-MI fluorescence.

Duplex-assisted carotid artery stenting without administration of contrast medium for patients with chronic kidney disease or allergic reaction.

PubMed

Mizowaki, Takashi; Fujita, Atsushi; Imahori, Taichiro; Uyama, Atsushi; Inoue, Satoshi; Kohta, Masaaki; Hamaguchi, Hirotoshi; Sasayama, Takashi; Hosoda, Kohkichi; Kohmura, Eiji

2016-07-01

We aimed to investigate the safety and feasibility of duplex-assisted carotid artery stenting (CAS) without administration of contrast medium for the prevention of adverse reactions. Fifteen patients (9 % of all CASs) with severe carotid stenosis (≥70 %) associated with chronic kidney disease (CKD) (stage ≥3) or allergy to contrast medium underwent duplex-assisted CAS without administration of contrast medium over 4 years. The procedural success rate and perioperative complication rates were compared between the duplex-assisted CAS (n = 15) and conventional CAS (n = 153) groups. The technical success rate was 100 % in both groups. Combined stroke or death rates during the post-procedural period did not differ significantly between the duplex-assisted CAS group (0/15, 0 %) and conventional CAS group (4/153, 2.6 %). None of the 14 patients with CKD in the duplex-assisted CAS group experienced further deterioration of renal function. The mean surface radiation dose of participants in the duplex-assisted CAS group (n = 13, 312 ± 131 mGy) was significantly lower than that of the conventional CAS group (n = 31, 1036 ± 571 mGy) (p < 0.001). The mean duration of CAS procedure was not significantly different between the duplex-assisted CAS group (156 ± 39.7 min) and the conventional CAS group (156 ± 37.4 min). Duplex-assisted CAS without administration of contrast medium could be an alternative option in selected patients deemed to be at high risk for renal failure from nephrotoxic contrast medium or who have an allergy to contrast medium.

Transcranial Duplex Sonography Predicts Outcome following an Intracerebral Hemorrhage.

PubMed

Camps-Renom, P; Méndez, J; Granell, E; Casoni, F; Prats-Sánchez, L; Martínez-Domeño, A; Guisado-Alonso, D; Martí-Fàbregas, J; Delgado-Mederos, R

2017-08-01

Several radiologic features such as hematoma volume are related to poor outcome following an intracerebral hemorrhage and can be measured with transcranial duplex sonography. We sought to determine the prognostic value of transcranial duplex sonography in patients with intracerebral hemorrhage. We conducted a prospective study of patients diagnosed with spontaneous intracerebral hemorrhage. Transcranial duplex sonography examinations were performed within 2 hours of baseline CT, and we recorded the following variables: hematoma volume, midline shift, third ventricle and lateral ventricle diameters, and the pulsatility index in both MCAs. We correlated these data with the CT scans and assessed the prognostic value of the transcranial duplex sonography measurements. We assessed early neurologic deterioration during hospitalization and mortality at 1-month follow-up. We included 35 patients with a mean age of 72.2 ± 12.8 years. Median baseline hematoma volume was 9.85 mL (interquartile range, 2.74-68.29 mL). We found good agreement and excellent correlation between transcranial duplex sonography and CT when measuring hematoma volume ( r = 0.791; P < .001) and midline shift ( r = 0.827; P < .001). The logistic regression analysis with transcranial duplex sonography measurements showed that hematoma volume was an independent predictor of early neurologic deterioration (OR, 1.078; 95% CI, 1.023-1.135) and mortality (OR, 1.089; 95% CI, 1.020-1.160). A second regression analysis with CT variables also demonstrated that hematoma volume was associated with early neurologic deterioration and mortality. When we compared the rating operation curves of both models, their predictive power was similar. Transcranial duplex sonography showed an excellent correlation with CT in assessing hematoma volume and midline shift in patients with intracerebral hemorrhage. Hematoma volume measured with transcranial duplex sonography was an independent predictor of poor outcome. © 2017 by American Journal of Neuroradiology.

Effect of ultrafine grain on tensile behaviour and corrosion resistance of the duplex stainless steel.

PubMed

Jinlong, Lv; Tongxiang, Liang; Chen, Wang; Limin, Dong

2016-05-01

The ultrafine grained 2205 duplex stainless steel was obtained by cold rolling and annealing. The tensile properties were investigated at room temperature. Comparing with coarse grained stainless steel, ultrafine grained sample showed higher strength and plasticity. In addition, grain size changed deformation orientation. The strain induced α'-martensite was observed in coarse grained 2205 duplex stainless steel with large strain. However, the grain refinement inhibited the transformation of α'-martensite;nevertheless, more deformation twins improved the strength and plasticity of ultrafine grained 2205 duplex stainless steel. In addition, the grain refinement improved corrosion resistance of the 2205 duplex stainless steel in sodium chloride solution. Copyright © 2016 Elsevier B.V. All rights reserved.

Duplex Healing of Selectively Thiolated Guanosine Mismatches through a Cd2+ Chemical Stimulus.

PubMed

Lunn, Samantha M L; Hribesh, Samira; Whitfield, Colette J; Hall, Michael J; Houlton, Andrew; Bronowska, Agnieszka K; Tuite, Eimer M; Pike, Andrew R

2018-03-25

The on-column selective conversion of guanosine to thioguanosine (tG) yields modified oligomers that exhibit destabilisation over the fully complementary duplex. Restoration to a stabilised duplex is induced through thio-directed Cd 2+ coordination; a route for healing DNA damage. Short oligomers are G-specifically thiolated through a modified on-column protocol without the need for costly thioguanosine phosphoramidites. Addition of Cd 2+ ions to a duplex containing a highly disrupted tG central mismatch sequence, 3'-A 6 tG 4 T 6 -5', suggests a (tG) 8 Cd 2 central coordination regime, resulting in increased base stacking and duplex stability. Equilibrium molecular dynamic calculations support the hypothesis of metal-induced healing of the thiolated duplex. The 2 nm displacement of the central tG mismatched region is dramatically reduced after the addition of a chemical stimuli, Cd 2+ ions, returning to a minimized fluctuational state comparable to the unmodified fully complementary oligomer. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of Microstructure and Mechanical Properties in Dissimilar Austenitic/Super Duplex Stainless Steel Joint

NASA Astrophysics Data System (ADS)

Rahmani, Mehdi; Eghlimi, Abbas; Shamanian, Morteza

2014-10-01

To study the effect of chemical composition on microstructural features and mechanical properties of dissimilar joints between super duplex and austenitic stainless steels, welding was attempted by gas tungsten arc welding process with a super duplex (ER2594) and an austenitic (ER309LMo) stainless steel filler metal. While the austenitic weld metal had vermicular delta ferrite within austenitic matrix, super duplex stainless steel was mainly comprised of allotriomorphic grain boundary and Widmanstätten side plate austenite morphologies in the ferrite matrix. Also the heat-affected zone of austenitic base metal comprised of large austenite grains with little amounts of ferrite, whereas a coarse-grained ferritic region was observed in the heat-affected zone of super duplex base metal. Although both welded joints showed acceptable mechanical properties, the hardness and impact strength of the weld metal produced using super duplex filler metal were found to be better than that obtained by austenitic filler metal.

Effect of Cavity Size of Mesoporous Silica on Short DNA Duplex Stability.

PubMed

Masuda, Tsubasa; Shibuya, Yuuta; Arai, Shota; Kobayashi, Sayaka; Suzuki, Sotaro; Kijima, Jun; Itoh, Tetsuji; Sato, Yusuke; Nishizawa, Seiichi; Yamaguchi, Akira

2018-05-15

We studied the stabilities of short (4- and 3-bp) DNA duplexes within silica mesopores modified with a positively charged trimethyl aminopropyl (TMAP) monolayer (BJH pore diameter 1.6-7.4 nm). The DNA fragments with fluorescent dye were introduced into the pores, and their fluorescence resonance energy transfer (FRET) response was measured to estimate the structuring energies of the short DNA duplexes under cryogenic conditions (temperature 233-323 K). The results confirmed the enthalpic stability gain of the duplex within size-matched pores (1.6 and 2.3 nm). The hybridization equilibrium constants found for the size-matched pores were 2 orders of magnitude larger than those for large pores (≥3.5 nm), and this size-matching effect for the enhanced duplex stability was explained by a tight electrostatic interaction between the duplex and the surface TMAP groups. These results indicate the requirement of the precise regulation of mesopore size to ensure the stabilization of hydrogen-bonded supramolecular assemblies.

Assessing the effect of different operation techniques on postoperative duplex ultrasound quality after carotid endarterectomy.

PubMed

Grambow, E; Heller, T; Wieneke, P; Weiß, C; Klar, E; Weinrich, M

2018-01-01

Duplex ultrasound is the first choice in diagnostics and surveillance of stenoses of the internal carotid arteries before and even after surgery. Therefore, the quality of duplex ultrasound is crucial to investigate these vascular pathologies. Aim of this study was the evaluation whether different surgical techniques affect the postoperative quality of duplex ultrasound. In a time period from January to May 2015 duplex ultrasound of the cervical vessels was performed in 75 patients after unilateral endarterectomy of the internal carotid artery at our department between 2006 and 2012. Thereby, the non-operated contralateral side served as a control. Study groups were defined by the surgical techniques of eversion- or thrombendarterectomy with patch plasty using different patch materials and/or a haemostatic sealant. Duplex ultrasound analysis included acoustic impedance, extinction of ultrasound, thickness of skin and individual anatomic aspects of the patients. Carotid endarterectomy itself reduced intravascular grey levels, skin thickness and increased extinction of duplex ultrasound when compared to the non-operated side of the neck. In contrast, neither the kind of chosen operative technique nor the use of different patch materials or the application of a haemostatic sealant showed an effect in this regards. Whereas carotid endarterectomy per se worsens the quality of postoperative duplex ultrasound, the different analysed surgical techniques as well as used patches and the application of a haemostatic sealant can be assumed to be equal regarding the quality of postoperative ultrasound.

The effect of S-substitution at the O6-guanine site on the structure and dynamics of a DNA oligomer containing a G:T mismatch

PubMed Central

2017-01-01

The effect of S-substitution on the O6 guanine site of a 13-mer DNA duplex containing a G:T mismatch is studied using molecular dynamics. The structure, dynamic evolution and hydration of the S-substituted duplex are compared with those of a normal duplex, a duplex with S-substitution on guanine, but no mismatch and a duplex with just a G:T mismatch. The S-substituted mismatch leads to cell death rather than repair. One suggestion is that the G:T mismatch recognition protein recognises the S-substituted mismatch (GS:T) as G:T. This leads to a cycle of futile repair ending in DNA breakage and cell death. We find that some structural features of the helix are similar for the duplex with the G:T mismatch and that with the S-substituted mismatch, but differ from the normal duplex, notably the helical twist. These differences arise from the change in the hydrogen-bonding pattern of the base pair. However a marked feature of the S-substituted G:T mismatch duplex is a very large opening. This showed considerable variability. It is suggested that this enlarged opening would lend support to an alternative model of cell death in which the mismatch protein attaches to thioguanine and activates downstream damage-response pathways. Attack on the sulphur by reactive oxygen species, also leading to cell death, would also be aided by the large, variable opening. PMID:28910418

Evidence of a sewer vapor transport pathway at the USEPA ...

EPA Pesticide Factsheets

The role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into the duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. These test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope. Highlights • The sewer line is an important pathway for VOC transport at the USEPA duplex. • The importance of this pathway was not identified during prior study of the duplex. • Sewer lines should be routinely evaluated

Structures of exocyclic R,R- and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine adducts induced by 1,2,3,4-diepoxybutane.

PubMed

Kowal, Ewa A; Seneviratne, Uthpala; Wickramaratne, Susith; Doherty, Kathleen E; Cao, Xiangkun; Tretyakova, Natalia; Stone, Michael P

2014-05-19

1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N(6) position of adenine in DNA. Two enantiomers of bis-N(6)-dA adducts of DEB have been identified: R,R-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (R,R-DHB-dA), and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (S,S-DHB-dA) [ Seneviratne , U. , Antsypovich , S. , Dorr , D. Q. , Dissanayake , T. , Kotapati , S. , and Tretyakova , N. ( 2010 ) Chem. Res. Toxicol. 23 , 1556 -1567 ]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5'-d(C(1)G(2)G(3)A(4)C(5)X(6)A(7)G(8)A(9)A(10)G(11))-3':5'-d(C(12)T(13)T(14)C(15)T(16)T(17)G(18)T(19)C(20)C(21)G(22))-3' duplex [X(6) = R,R-DHB-dA (R(6)) or S,S-DHB-dA (S(6))]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N(6) bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N(6) bond, allows the complementary thymine, T(17), to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T(17) N3H imino proton. The loss of the second Watson-Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as compared to the corresponding unmodified duplex. The reduced base stacking at the adduct sites may also contribute to the thermal instability.

Structures of Exocyclic R,R- and S,S-N6,N6-(2,3-Dihydroxybutan-1,4-diyl)-2′-Deoxyadenosine Adducts Induced by 1,2,3,4-Diepoxybutane

PubMed Central

2015-01-01

1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N6 position of adenine in DNA. Two enantiomers of bis-N6-dA adducts of DEB have been identified: R,R-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (R,R-DHB-dA), and S,S-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (S,S-DHB-dA) [SeneviratneU., AntsypovichS., DorrD. Q., DissanayakeT., KotapatiS., and TretyakovaN. (2010) Chem. Res. Toxicol.23, 1556−156720873715]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5′-d(C1G2G3A4C5X6A7G8A9A10G11)-3′:5′-d(C12T13T14C15T16T17G18T19C20C21G22)-3′ duplex [X6 = R,R-DHB-dA (R6) or S,S-DHB-dA (S6)]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N6 bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N6 bond, allows the complementary thymine, T17, to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T17 N3H imino proton. The loss of the second Watson–Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as compared to the corresponding unmodified duplex. The reduced base stacking at the adduct sites may also contribute to the thermal instability. PMID:24741991

Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

PubMed

Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

2016-01-01

We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex

PubMed Central

Ueda, Yu-mi; Zouzumi, Yu-ki; Maruyama, Atsushi; Nakano, Shu-ichi; Sugimoto, Naoki; Miyoshi, Daisuke

2016-01-01

Abstract We systematically investigated effects of molecular crowding with trimethylamine N-oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences. PMID:27933115

Tribocorrosion Failure Mechanism of TiN/SiOx Duplex Coating Deposited on AISI304 Stainless Steel.

PubMed

Chen, Qiang; Xie, Zhiwen; Chen, Tian; Gong, Feng

2016-11-26

TiN/SiO x duplex coatings were synthesized on AISI304 stainless steel by plasma immersion ion implantation and deposition (PIIID) followed by radio frequency magnetron sputtering (RFMS). The microstructure and tribocorrosion failure behaviors of the duplex coatings were investigated by X-ray diffraction, X-ray photoelectron spectroscopy, scanning electron microscopy, atomic force microscopy, reciprocating-sliding tribometer, and electrochemical tests. The as-deposited duplex coating had a two-layered columnar growth structure consisting of face-centered cubic TiN and amorphous SiO x . Sliding tests showed that the TiN interlayer had good adhesion with the substrate, but the SiO x layer suffered from severe delamination failure. Friction force induced a number of micro-cracks in the coating, which provided channels for the diffusion of NaCl solution. The tribocorrosion test showed that the duplex coating exhibited a lower wear-performance in NaCl solution than in ambient atmosphere. Multi-scale chloride ion corrosion occurred simultaneously and substantially degraded the bonding strength of the columnar crystals or neighboring layers. Force-corrosion synergy damage eventually led to multi-degradation failure of the duplex coating. The presented results provide a comprehensive understanding of the tribocorrosion failure mechanism in coatings with duplex architecture.

Tertiary structure-based analysis of microRNA–target interactions

PubMed Central

Gan, Hin Hark; Gunsalus, Kristin C.

2013-01-01

Current computational analysis of microRNA interactions is based largely on primary and secondary structure analysis. Computationally efficient tertiary structure-based methods are needed to enable more realistic modeling of the molecular interactions underlying miRNA-mediated translational repression. We incorporate algorithms for predicting duplex RNA structures, ionic strength effects, duplex entropy and free energy, and docking of duplex–Argonaute protein complexes into a pipeline to model and predict miRNA–target duplex binding energies. To ensure modeling accuracy and computational efficiency, we use an all-atom description of RNA and a continuum description of ionic interactions using the Poisson–Boltzmann equation. Our method predicts the conformations of two constructs of Caenorhabditis elegans let-7 miRNA–target duplexes to an accuracy of ∼3.8 Å root mean square distance of their NMR structures. We also show that the computed duplex formation enthalpies, entropies, and free energies for eight miRNA–target duplexes agree with titration calorimetry data. Analysis of duplex–Argonaute docking shows that structural distortions arising from single-base-pair mismatches in the seed region influence the activity of the complex by destabilizing both duplex hybridization and its association with Argonaute. Collectively, these results demonstrate that tertiary structure-based modeling of miRNA interactions can reveal structural mechanisms not accessible with current secondary structure-based methods. PMID:23417009

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex.

PubMed

McHugh, Thomas; Beckley, Lila; Sullivan, Terry; Lutes, Chris; Truesdale, Robert; Uppencamp, Rob; Cosky, Brian; Zimmerman, John; Schumacher, Brian

2017-11-15

The role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into the duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. These test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope. Copyright © 2017 Elsevier B.V. All rights reserved.

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex

DOE PAGES

McHugh, Thomas; Beckley, Lila; Sullivan, Terry; ...

2017-04-26

We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less

Synergistic effects between analogs of DNA and RNA improve the potency of siRNA-mediated gene silencing

PubMed Central

Deleavey, Glen F.; Watts, Jonathan K.; Alain, Tommy; Robert, Francis; Kalota, Anna; Aishwarya, Veenu; Pelletier, Jerry; Gewirtz, Alan M.; Sonenberg, Nahum; Damha, Masad J.

2010-01-01

We report that combining a DNA analog (2′F-ANA) with rigid RNA analogs [2′F-RNA and/or locked nucleic acid (LNA)] in siRNA duplexes can produce gene silencing agents with enhanced potency. The favored conformations of these two analogs are different, and combining them in a 1–1 pattern led to reduced affinity, whereas alternating short continuous regions of individual modifications increased affinity relative to an RNA:RNA duplex. Thus, the binding affinity at key regions of the siRNA duplex could be tuned by changing the pattern of incorporation of DNA-like and RNA-like nucleotides. These heavily or fully modified duplexes are active against a range of mRNA targets. Effective patterns of modification were chosen based on screens using two sequences targeting firefly luciferase. We then applied the most effective duplex designs to the knockdown of the eIF4E binding proteins 4E-BP1 and 4E-BP2. We identified modified duplexes with potency comparable to native siRNA. Modified duplexes showed dramatically enhanced stability to serum nucleases, and were characterized by circular dichroism and thermal denaturation studies. Chemical modification significantly reduced the immunostimulatory properties of these siRNAs in human peripheral blood mononuclear cells. PMID:20413581

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex

DOE Office of Scientific and Technical Information (OSTI.GOV)

McHugh, Thomas; Beckley, Lila; Sullivan, Terry

We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less

Venous filling time using air-plethysmography correlates highly with great saphenous vein reflux time using duplex.

PubMed

Lattimer, C R; Azzam, M; Kalodiki, E; Geroulakos, G

2014-03-01

Venous filling time (VFT90) is the time taken to reach 90% of the venous volume in the calf. It is recorded by air-plethysmography (APG(®)) and is assumed to measure global venous reflux duration. However, this has never been confirmed by duplex. The aim of the study was to compare VFT on APG to venous reflux time/duration (RT) measured simultaneously with duplex on the same patients. Twenty-six consecutive patients, M:F = 16:10, age (25-78), C1 = 1, C2 = 4, C3 = 8, C4a = 6, C4b = 4, C5 = 2, C6 = 1, underwent simultaneous APG with duplex. The venous filling index (VFI, mL/second), VFT90 (seconds), great saphenous vein (GSV) RT on duplex, averaged thigh GSV diameter and thigh length (length) between the APG sensor air-cuff and duplex transducer were recorded. The VFT100 was calculated by VFT90/0.9. The additional time taken to fill the thigh was achieved using the VFI, length and deep vein diameter (d), to determine the corrected reflux duration: CRD = VFT100 + (length × πd(2)/4 (1/VFI)). Twenty-five patients are presented. One patient with very mild reflux (VFT90 = 55.9 seconds) had an indeterminate endpoint on duplex and was excluded. The median (range) VFI and GSV diameter was 4.9(1.3-15.5) mL/second and 7(4-17) mm, respectively. The VFT90 and VFT100 both correlated with RT on duplex (Spearman, P < 0.0005) at: r = 0.933, r(2) linear = 0.72 and r = 0.933, r(2) linear = 0.68, respectively. The median (interquartile range) filling time with VFT90 was less than the duplex RT at 24 (16.9) versus 28 (20) seconds respectively, P < 0.0005 (Wilcoxon). The median percentage underestimation improved from 24% to 16% and then 4% using the VFT90, VFT100 and CRD, respectively. This is the first study to compare APG parameters with duplex by performing simultaneous measurements. There was an excellent correlation between the VFT90 versus duplex RT, thereby comparing reverse flow in a single superficial vein against the legs overall venous haemodynamic status. These tests can both be used in the quantification of reflux.

Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.

PubMed

Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P

2014-07-05

The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the WSSV and the PstDV1 in whiteleg shrimp. The use of the TaqMan Universal Master Mix and the relative threshold method of data analysis in our duplex qPCR method provided optimal levels of sensitivity and specificity.

Venous Ulcers

PubMed Central

Caprini, J.A.; Partsch, H.; Simman, R.

2013-01-01

Venous leg ulcers are the most frequent form of wounds seen in patients. This article presents an overview on some practical aspects concerning diagnosis, differential diagnosis and treatment. Duplex ultrasound investigations are essential to ascertain the diagnosis of the underlying venous pathology and to treat venous refluxes. Differential diagnosis includes mainly other vascular lesions (arterial, microcirculatory causes), hematologic and metabolic diseases, trauma, infection, malignancies. Patients with superficial venous incompetence may benefit from endovenous or surgical reflux abolition diagnosed by Duplex ultrasound. The most important basic component of the management is compression therapy, for which we prefer materials with low elasticity applied with high initial pressure (short-stretch bandages and Velcro-strap devices). Local treatment should be simple, absorbing and not sticky dressings keeping adequate moisture balance after debridement of necrotic tissue and biofilms are preferred. After the ulcer is healed compression therapy should be continued in order to prevent recurrence. PMID:26236636

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

PubMed Central

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

1999-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

1999-06-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

Chip-to-Chip Half Duplex Spiking Data Communication over Power Supply Rails

NASA Astrophysics Data System (ADS)

Hashida, Takushi; Nagata, Makoto

Chip-to-chip serial data communication is superposed on power supply over common Vdd/Vss connections through chip, package, and board traces. A power line transceiver demonstrates half duplex spiking communication at more than 100Mbps. A pair of transceivers consumes 1.35mA from 3.3V, at 130Mbps. On-chip power line LC low pass filter attenuates pseudo-differential communication spikes by 30dB, purifying power supply current for internal circuits. Bi-directional spiking communication was successfully examined in a 90-nm CMOS prototype setup of on-chip waveform capturing. A micro controller forwards clock pulses to and receives data streams from a comparator based waveform capturer formed on a different chip, through a single pair of power and ground traces. The bit error rate is small enough not to degrade waveform acquisition capability, maintaining the spurious free dynamic range of higher than 50dB.

Effect of heat treatment on corrosion behavior of duplex stainless steel in orthodontic applications

NASA Astrophysics Data System (ADS)

Sabea Hammood, Ali; Faraj Noor, Ahmed; Talib Alkhafagy, Mohammed

2017-12-01

Heat treatment is necessary for duplex stainless steel (DSS) to remove or dissolve intermetallic phases, to remove segregation and to relieve any residual thermal stress in DSS, which may be formed during production processes. In the present study, the corrosion resistance of a DSS in artificial saliva was studied by potentiodynamic measurements. The microstructure was investigated by scanning electron microscopy (SEM),x-ray diffraction (XRD) and Vickers hardness (HV). The properties were tested in as-received and in thermally treated conditions (800-900 °C, 2-8 min). The research aims to evaluate the capability of DSS for orthodontic applications, in order to substitute the austenitic grades. The results indicate that the corrosion resistance is mainly affected by the ferrite/austenite ratio. The best result was obtained with a treatment at 900 °C for 2 min.

Abiotic ligation of DNA oligomers templated by their liquid crystal ordering

NASA Astrophysics Data System (ADS)

Fraccia, Tommaso P.; Smith, Gregory P.; Zanchetta, Giuliano; Paraboschi, Elvezia; Yi, Yougwooo; Walba, David M.; Dieci, Giorgio; Clark, Noel A.; Bellini, Tommaso

2015-03-01

It has been observed that concentrated solutions of short DNA oligomers develop liquid crystal ordering as the result of a hierarchically structured supramolecular self-assembly. In mixtures of oligomers with various degree of complementarity, liquid crystal microdomains are formed via the selective aggregation of those oligomers that have a sufficient degree of duplexing and propensity for physical polymerization. Here we show that such domains act as fluid and permeable microreactors in which the order-stabilized molecular contacts between duplex terminals serve as physical templates for their chemical ligation. In the presence of abiotic condensing agents, liquid crystal ordering markedly enhances ligation efficacy, thereby enhancing its own phase stability. The coupling between order-templated ligation and selectivity provided by supramolecular ordering enables an autocatalytic cycle favouring the growth of DNA chains, up to biologically relevant lengths, from few-base long oligomers. This finding suggests a novel scenario for the abiotic origin of nucleic acids.

Efficacy of duplex ultrasound surveillance after infrainguinal vein bypass may be enhanced by identification of characteristics predictive of graft stenosis development.

PubMed

Tinder, Chelsey N; Chavanpun, Joe P; Bandyk, Dennis F; Armstrong, Paul A; Back, Martin R; Johnson, Brad L; Shames, Murray L

2008-09-01

Controversy regarding the efficacy of duplex ultrasound surveillance after infrainguinal vein bypass led to an analysis of patient and bypass graft characteristics predictive for development of graft stenosis and a decision of secondary intervention. Retrospective analysis of a contemporary, consecutive series of 353 clinically successful infrainguinal vein bypasses performed in 329 patients for critical (n = 284; 80%) or noncritical (n = 69; 20%) limb ischemia enrolled in a surveillance program to identify and repair duplex-detected graft stenosis. Variables correlated with graft stenosis and bypass repair included: procedure indication, conduit type (saphenous vs nonsaphenous vein; reversed vs nonreversed orientation), prior bypass graft failure, postoperative ankle-brachial index (ABI) < 0.85, and interpretation of the first duplex surveillance study as "normal" or "abnormal" based on peak systolic velocity (PSV) and velocity ratio (Vr) criteria. Overall, 126 (36%) of the 353 infrainguinal bypasses had 174 secondary interventions (endovascular, 100; surgery, 74) based on duplex surveillance; resulting in 3-year Kaplan-Meier primary (46%), assisted-primary (80%), and secondary (81%) patency rates. Characteristics predictive of duplex-detected stenosis leading to intervention (PSV: 443 +/- 94 cm/s; Vr: 8.6 +/- 9) were: "abnormal" initial duplex testing indicating moderate (PSV: 180-300 cm/s, Vr: 2-3.5) stenosis (P < .0001), non-single segment saphenous vein conduit (P < .01), warfarin drug therapy (P < .01), and redo bypass grafting (P < .001). Procedure indication, postoperative ABI level, statin drug therapy, and vein conduit orientation were not predictive of graft revision. The natural history of 141 (40%) bypasses with an abnormal first duplex scan differed from "normal" grafts by more frequent (51% vs 24%, P < .001) and earlier (7 months vs 11 months) graft revision for severe stenosis and a lower 3-year assisted primary patency (68% vs 87%; P < .001). In 52 (15%) limbs, the bypass graft failed and 20 (6%) limbs required amputation. The efficacy of duplex surveillance after infrainguinal vein bypass may be enhanced by modifying testing protocols, eg, rigorous surveillance for "higher risk" bypasses, based on the initial duplex scan results and other characteristics (warfarin therapy, non- single segment saphenous vein conduit, redo bypass) predictive for stenosis development.

Disruption of Short-Term Memory by Changing and Deviant Sounds: Support for a Duplex-Mechanism Account of Auditory Distraction

ERIC Educational Resources Information Center

Hughes, Robert W.; Vachon, Francois; Jones, Dylan M.

2007-01-01

The disruption of short-term memory by to-be-ignored auditory sequences (the changing-state effect) has often been characterized as attentional capture by deviant events (deviation effect). However, the present study demonstrates that changing-state and deviation effects are functionally distinct forms of auditory distraction: The disruption of…

Tertiary thrust systems and fluid flow beneath the Beaufort coastal plain (1002 area), Arctic National Wildlife Refuge, Alaska, U.S.A.

USGS Publications Warehouse

Potter, Christopher J.; Grow, John A.; Perry, William J.; Moore, Thomas E.; O'Sullivan, Paul B.; Phillips, Jeffrey D.; Saltus, Richard W.

2004-01-01

In the eastern part of the 1002 area, a northward-younging pattern of thin-skinned deformation is apparent. Converging patterns of Paleocene reflectors on the north flank of the Sabbath syncline indicate that the Aichilik high and the Sabbath syncline formed as a passive-roof duplex and piggyback basin, respectively, just behind the Paleocene deformation front. During the Eocene and possibly the Oligocene, thin-skinned thrusting advanced northward over the present location of the Niguanak high. A passive-roof duplex occupied the frontal part of this system. The Kingak and Hue shales exposed above the Niguanak high were transported into their present structural position during the Eocene to Oligocene motion on the long thrust ramps above the present south flank of the Niguanak high. Broad, basement-cored subsurface domes (Niguanak high and Aurora dome) formed near the deformation front in the Oligocene, deforming the overlying thin-skinned structures and feeding a new increment of displacement into thin-skinned structures directly to the north. Deformation continued through the Miocene above a detachment in the basement. Offshore seismicity and Holocene shortening documented by previous workers may indicate that contractional deformation continues to the present day.

DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

PubMed

Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

2013-10-01

Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

Histone H3 phosphorylation near the nucleosome dyad alters chromatin structure

PubMed Central

North, Justin A.; Šimon, Marek; Ferdinand, Michelle B.; Shoffner, Matthew A.; Picking, Jonathan W.; Howard, Cecil J.; Mooney, Alex M.; van Noort, John; Poirier, Michael G.; Ottesen, Jennifer J.

2014-01-01

Nucleosomes contain ∼146 bp of DNA wrapped around a histone protein octamer that controls DNA accessibility to transcription and repair complexes. Posttranslational modification (PTM) of histone proteins regulates nucleosome function. To date, only modest changes in nucleosome structure have been directly attributed to histone PTMs. Histone residue H3(T118) is located near the nucleosome dyad and can be phosphorylated. This PTM destabilizes nucleosomes and is implicated in the regulation of transcription and repair. Here, we report gel electrophoretic mobility, sucrose gradient sedimentation, thermal disassembly, micrococcal nuclease digestion and atomic force microscopy measurements of two DNA–histone complexes that are structurally distinct from nucleosomes. We find that H3(T118ph) facilitates the formation of a nucleosome duplex with two DNA molecules wrapped around two histone octamers, and an altosome complex that contains one DNA molecule wrapped around two histone octamers. The nucleosome duplex complex forms within short ∼150 bp DNA molecules, whereas altosomes require at least ∼250 bp of DNA and form repeatedly along 3000 bp DNA molecules. These results are the first report of a histone PTM significantly altering the nucleosome structure. PMID:24561803

Why double-stranded RNA resists condensation

PubMed Central

Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.

2014-01-01

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663

Duplex kidney: not just a drooping lily.

PubMed

Doery, Ashlea J; Ang, Eileen; Ditchfield, Michael R

2015-04-01

Duplex kidneys are common, mostly asymptomatic and of no clinical significance. However, they can be associated with significant pathology, often with long-term morbidity. There is minimal literature on the review of the duplex kidney, its associated anomalies and complications. The purpose of this paper is to review our experience of imaging the spectrum of abnormalities associated with duplex kidneys in the paediatric population and correlate this with contemporary literature. A retrospective review of the radiology database in a tertiary paediatric centre was performed. A word search of the Radiology Information System for 'duplex' of patients under the age of 16 was undertaken and limited to studies performed between 2006 and 2013. Two hundred seventy-four patients were identified (age range 0-16, median 3 years, gender 59.9% female) who had 836 studies: ultrasound 598/836 (71.6%), nuclear medicine 180/836 (21.5%), micturating cystourethrogram 52/836 (6.2%), MRI 5/836 (<1%) and CT scan 1/836 (<1%). Patients were categorised as duplex and no complication (151/274 = 55.1%), upper moiety obstruction, lower moiety reflux/scarring, multicystic dysplastic kidney, abnormal ureteric insertion and other pathology. Duplex kidneys are common and often not clinically significant. However, this study demonstrates almost 50% of paediatric patients investigated for duplex kidneys had complications requiring treatment. The most common complications were upper moiety obstruction associated with a ureterocele and lower moiety vesicoureteric reflux. Ultrasound was the most common modality for early detection of these complications. © 2015 The Royal Australian and New Zealand College of Radiologists.

The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

2016-07-01

Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

Tectonic controls of transient landscapes in the Bhutan Himalaya

NASA Astrophysics Data System (ADS)

Adams, B. A.; Whipple, K. X.; Hodges, K. V.; Van Soest, M. C.; Heimsath, A. M.

2013-12-01

Previous research has identified many landscapes within the Himalaya that are not easily explained by classical critical taper models of orogenic wedges. One of the most striking examples is the sharp physiographic transition between the more subdued landforms of the Lower Himalayan ranges and the Higher Himalayan ranges to the north in Nepal. This transition has been attributed to several potential causes: changes in the rheology of rocks at depth, a ramp in the basal detachment of the orogenic wedge, a blind duplex, or a north-dipping, surface-breaking thrust fault. A similar, but more subdued transition marks the northern margin of perched, low-relief landscape patches found at ca. 3000 m in Bhutan. These low-relief surfaces, characterized by bogs and thick saprolites at the surface, overlie piggyback basins within the evolving orogenic wedge, filled with hundreds of meters of colluvial and alluvial deposits. The southern boundaries of the low-relief surfaces are less regular than the physiographic transition at their northern boundaries. The surfaces occur at similar elevations but are not continuous geographically, having been dissected by a series of river systems draining southward from the crest of the range. Pronounced knickpoints have formed at the southern margins of the low-relief surfaces. Our work suggests that there is a young (Pliocene-Pleistocene) fault system coincident with the physiographic transition in Bhutan. This high-angle, north-dipping structure, the Lhuentse fault, has minor normal-sense offset and could not have been responsible for differential uplift of the rugged terrain (in the hanging wall) relative to the low-relief landscape (in the footwall). The Lhuentse fault is coincident with the back limb of a previously inferred blind duplex at depth, and thus may be associated with active deformation on a rotated horse within the duplex. This duplex may also be responsible for the creation of the low-relief landscapes to the south of the Lhuentse fault due to upstream tilting in the back limb of the antiformal rock uplift pattern. Erosion patterns modeled on the basis of newly acquired 40Ar/39Ar and (U-Th)/He thermochronometric data as well as basin-average erosion rates from detrital cosmogenic nuclide concentrations are consistent with this hypothesis. We used a landscape evolution model (CHILD) to track landscape response to an imposed antiformal rock uplift gradient produced by an active duplex at depth. Rotation associated with the back limb of such a duplex causes aggradation, surface uplift, and headward migration of knickpoints. The wedge of sediment deposited during fluvial aggradation migrates northward beyond the back limb where uplift lessens. At this position in the landscape, a subdued physiographic transition develops in the model, similar to the one observed in Bhutan. Our modeling suggests that the presence and juxtaposition of low-relief landscapes and a physiographic transition, and our observed distribution of erosion rates can be explained by a single, simple mechanism related to the growth of a blind duplex.

52. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

52. Photocopy of copy of original Officers' Duplex Quarters drawing by Copeland, 7 April 1932 (Original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Heating - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

53. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

53. Photocopy of copy of original Officers' Duplex Quarters drawing by A.G.D., 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Electrical - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

51. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

51. Photocopy of copy of original Officers' Duplex Quarters drawing by B.S. Elliott, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Plumbing - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Criteria for the Segmentation of Vowels on Duplex Oscillograms.

ERIC Educational Resources Information Center

Naeser, Margaret A.

This paper develops criteria for the segmentation of vowels on duplex oscillograms. Previous vowel duration studies have primarily used sound spectrograms. The use of duplex oscillograms, rather than sound spectrograms, permits faster production (real time) at less expense (adding machine paper may be used). The speech signal can be more spread…

Sequence distribution of acetaldehyde-derived N2-ethyl-dG adducts along duplex DNA.

PubMed

Matter, Brock; Guza, Rebecca; Zhao, Jianwei; Li, Zhong-ze; Jones, Roger; Tretyakova, Natalia

2007-10-01

Acetaldehyde (AA) is the major metabolite of ethanol and may be responsible for an increased gastrointestinal cancer risk associated with alcohol beverage consumption. Furthermore, AA is one of the most abundant carcinogens in tobacco smoke and induces tumors of the respiratory tract in laboratory animals. AA binding to DNA induces Schiff base adducts at the exocyclic amino group of dG, N2-ethylidene-dG, which are reversible on the nucleoside level but can be stabilized by reduction to N2-ethyl-dG. Mutagenesis studies in the HPRT reporter gene and in the p53 tumor suppressor gene have revealed the ability of AA to induce G-->A transitions and A-->T transversions, as well as frameshift and splice mutations. AA-induced point mutations are most prominent at 5'-AGG-3' trinucleotides, possibly a result of sequence specific adduct formation, mispairing, and/or repair. However, DNA sequence preferences for the formation of acetaldehyde adducts have not been previously examined. In the present work, we employed a stable isotope labeling-HPLC-ESI+-MS/MS approach developed in our laboratory to analyze the distribution of acetaldehyde-derived N2-ethyl-dG adducts along double-stranded oligodeoxynucleotides representing two prominent lung cancer mutational "hotspots" and their surrounding DNA sequences. 1,7,NH 2-(15)N-2-(13)C-dG was placed at defined positions within DNA duplexes derived from the K-ras protooncogene and the p53 tumor suppressor gene, followed by AA treatment and NaBH 3CN reduction to convert N2-ethylidene-dG to N2-ethyl-dG. Capillary HPLC-ESI+-MS/MS was used to quantify N2-ethyl-dG adducts originating from the isotopically labeled and unlabeled guanine nucleobases and to map adduct formation along DNA duplexes. We found that the formation of N2-ethyl-dG adducts was only weakly affected by the local sequence context and was slightly increased in the presence of 5-methylcytosine within CG dinucleotides. These results are in contrast with sequence-selective formation of other tobacco carcinogen-DNA adducts along K-ras- and p53-derived duplexes and the preferential modification of endogenously methylated CG dinucleotides by benzo[a]pyrene diol epoxide and acrolein.

Duplex ultrasound surveillance after carotid artery endarterectomy.

PubMed

Al Shakarchi, Julien; Lowry, Danielle; Nath, Jay; Khawaja, Aurangzaib Z; Inston, Nicholas; Tiwari, Alok

2016-06-01

After carotid endarterectomy (CEA), patients have been regularly followed up by duplex ultrasound imaging. However, the evidence for long-term follow-up is not clear, especially if the results from an early duplex scan are normal. This study assessed and systematically reviewed the evidence base for long-term surveillance after CEA and a normal early scan. Electronic databases were searched for studies assessing duplex surveillance after CEA in accordance with Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. The primary outcome for this study was the incidence of restenosis after a normal early scan. The secondary outcome was the number of reinterventions after a normal early scan. The review included seven studies that reported 2317 procedures. Of those patients with a normal early scan, 2.8% (95% confidence interval, 0.7%-6%) developed a restenosis, and 0.4% (95% confidence interval, 0%-0.9%) underwent a reintervention for their restenosis during the follow-up period. This review confirms that routine postoperative duplex ultrasound surveillance after CEA is not necessary if the early duplex scan is normal. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Duplex evaluation following femoropopliteal angioplasty and stenting: criteria and utility of surveillance.

PubMed

Baril, Donald T; Marone, Luke K

2012-07-01

Surveillance following lower extremity bypass, carotid endarterectomy, and endovascular aortic aneurysm repair has become the standard of care at most institutions. Conversely, surveillance following lower extremity endovascular interventions is performed somewhat sporadically in part because the duplex criteria for recurrent stenoses have been ill defined. It appears that duplex surveillance after peripheral endovascular interventions, as with conventional bypass, is beneficial in identifying recurrent lesions which may preclude failure and occlusion. In-stent stenosis following superficial femoral artery angioplasty and stenting can be predicted by both peak systolic velocity and velocity ratio data as measured by duplex ultrasound. Duplex criteria have been defined to determine both ≥50% in-stent stenosis and ≥80% in-stent stenosis. Although not yet well studied, it appears that applying these criteria during routine surveillance may assist in preventing failure of endovascular interventions.

Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

DOEpatents

Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

2001-01-01

Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

Geometry of an outcrop-scale duplex in Devonian flysch, Maine

USGS Publications Warehouse

Bradley, D.C.; Bradley, L.M.

1994-01-01

We describe an outcrop-scale duplex consisting of 211 exposed repetitions of a single bed. The duplex marks an early Acadian (Middle Devonian) oblique thrust zone in the Lower Devonian flysch of northern Maine. Detailed mapping at a scale of 1:8 has enabled us to measure accurately parameters such as horse length and thickness, ramp angles and displacements; we compare these and derivative values with those of published descriptions of duplexes, and with theoretical models. Shortening estimates based on line balancing are consistently smaller than two methods of area balancing, suggesting that layer-parallel shortening preceded thrusting. ?? 1994.

Capturing a DNA duplex under near-physiological conditions

NASA Astrophysics Data System (ADS)

Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.

2010-10-01

We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.

Duplex-guided percutaneous transluminal angioplasty in iliac arterial occlusive disease.

PubMed

Krasznai, A G; Sigterman, T A; Welten, R J; Heijboer, R; Sikkink, C J J M; van de Akker, L H J M; Bouwman, L H

2013-11-01

Chronic renal insufficiency (CRI) is a growing global problem. PTA can be performed without nephrotoxic contrast, utilizing Doppler-ultrasound (Duplex) guidance. Duplex-guided infra-inguinal interventions and access-related interventions have been reported. Duplex-guided iliac interventions have not been performed to any extent because of the anatomic location. In our study we evaluated the safety and efficacy of Duplex-guided percutaneous transluminal angioplasty (DuPTA) in iliac arteries. From June 2012 until February 2013, 31 patients (35 iliac lesions), underwent DuPTA. Indications ranged from Rutherford 3 to 5. Preoperative evaluation included Ankle Brachial Index (ABI), Duplex and MRA. Procedural success was defined as crossing the lesion with a guidewire and dilating or stenting the lesion. Clinical success was defined as 50% reduction in peak systolic velocity (PSV) or clinical improvement. PSV was evaluated after PTA, then at 2 weeks. Clinical results were assessed 2 weeks after the procedure. Procedural success was achieved in 94% of patients (33/35), all of whom also had clinical success. Post-procedural PSV reduction showed an average improvement of 63% (431 cm/s to 153 cm/s). Mean preoperative ABI was 0.72 and improved to 0.88 postoperatively. PTA using Duplex-guidance in significant iliac stenosis is a safe method with major advantages in patients at high risk for developing contrast-induced nephropathy. Copyright © 2013 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

Duplex recombinase polymerase amplification assays incorporating competitive internal controls for bacterial meningitis detection.

PubMed

Higgins, Owen; Clancy, Eoin; Forrest, Matthew S; Piepenburg, Olaf; Cormican, Martin; Boo, Teck Wee; O'Sullivan, Nicola; McGuinness, Claire; Cafferty, Deirdre; Cunney, Robert; Smith, Terry J

2018-04-01

Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.

Label-free liquid crystal biosensor based on specific oligonucleotide probes for heavy metal ions.

PubMed

Yang, Shengyuan; Wu, Chao; Tan, Hui; Wu, Yan; Liao, Shuzhen; Wu, Zhaoyang; Shen, Guoli; Yu, Ruqin

2013-01-02

In this study, to enhance the capability of metal ions disturbing the orientation of liquid crystals (LCs), we designed a new label-free LC biosensor for the highly selective and sensitive detection of heavy metal ions. This strategy makes use of the target-induced DNA conformational change to enhance the disruption of target molecules for the orientation of LC leading to an amplified optical signal. The Hg(2+) ion, which possesses a unique property to bind specifically to two DNA thymine (T) bases, is used as a model heavy metal ion. In the presence of Hg(2+), the specific oligonucleotide probes form a conformational reorganization of the oligonucleotide probes from hairpin structure to duplex-like complexes. The duplex-like complexes are then bound on the triethoxysilylbutyraldehyde/N,N-dimethyl-N-octadecyl (3-aminopropyl) trimethoxysilyl chloride (TEA/DMOAP)-coated substrate modified with capture probes, which can greatly distort the orientational profile of LC, making the optical image of LC cell birefringent as a result. The optical signal of LC sensor has a visible change at the Hg(2+) concentration of low to 0.1 nM, showing good detection sensitivity. The cost-effective LC sensing method can translate the concentration signal of heavy metal ions in solution into the presence of DNA duplexes and is expected to be a sensitive detection platform for heavy metal ions and other small molecule monitors.

Recognition of DNA bulges by dinuclear iron(II) metallosupramolecular helicates.

PubMed

Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor

2014-02-01

Bulged DNA structures are of general biological significance because of their important roles in a number of biochemical processes. Compounds capable of targeting bulged DNA sequences can be used as probes for studying their role in nucleic acid function, or could even have significant therapeutic potential. The interaction of [Fe(2)L(3)](4+) metallosupramolecular helicates (L = C(25)H(20)N(4)) with DNA duplexes containing bulges has been studied by measurement of the DNA melting temperature and gel electrophoresis. This study was aimed at exploring binding affinities of the helicates for DNA bulges of various sizes and nucleotide sequences. The studies reported herein reveal that both enantiomers of [Fe(2)L(3)](4+) bind to DNA bulges containing at least two unpaired nucleotides. In addition, these helicates show considerably enhanced affinity for duplexes containing unpaired pyrimidines in the bulge and/or pyrimidines flanking the bulge on both sides. We suggest that the bulge creates the structural motif, such as the triangular prismatic pocket formed by the unpaired bulge bases, to accommodate the [Fe(2)L(3)](4+) helicate molecule, and is probably responsible for the affinity for duplexes with a varying number of bulge bases. Our results reveal that DNA bulges represent another example of unusual DNA structures recognized by dinuclear iron(II) ([Fe(2)L(3)](4+)) supramolecular helicates. © 2013 FEBS.

Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses

USDA-ARS?s Scientific Manuscript database

Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...

Multi-carrier mobile TDMA system with active array antenna

NASA Technical Reports Server (NTRS)

Suzuki, Ryutaro; Matsumoto, Yasushi; Hamamoto, Naokazu

1990-01-01

A multi-carrier time division multiple access (TDMA) is proposed for the future mobile satellite communications systems that include a multi-satellite system. This TDMA system employs the active array antenna in which the digital beam forming technique is adopted to control the antenna beam direction. The antenna beam forming is carried out at the base band frequency by using the digital signal processing technique. The time division duplex technique is applied for the TDM/TDMA burst format, in order not to overlap transmit and receive timing.

Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B

PubMed Central

Özeş, Ali R.; Feoktistova, Kateryna; Avanzino, Brian C.; Fraser, Christopher S.

2011-01-01

Eukaryotic initiation factor 4A (eIF4A) is a DEAD-box helicase that stimulates translation initiation by unwinding mRNA secondary structure. The accessory proteins, eIF4G, eIF4B, and eIF4H enhance the duplex unwinding activity of eIF4A, but the extent to which they modulate eIF4A activity is poorly understood. Here, we use real time fluorescence assays to determine the kinetic parameters of duplex unwinding and ATP hydrolysis by these initiation factors. To ensure efficient duplex unwinding, eIF4B and eIF4G cooperatively activate the duplex unwinding activity of eIF4A. Our data reveal that eIF4H is much less efficient at stimulating eIF4A unwinding activity than eIF4B, implying that eIF4H is not able to completely substitute for eIF4B in duplex unwinding. By monitoring unwinding and ATPase assays using identical conditions, we demonstrate that eIF4B couples the ATP hydrolysis cycle of eIF4A with strand separation, thereby minimizing non-productive unwinding events. Using duplex substrates with altered GC contents, but with similar predicted thermal stabilities, we further show that the rate of formation of productive unwinding complexes is strongly influenced by the local stability per base pair in addition to the stability of the entire duplex. This finding explains how a change in the GC content of a hairpin while maintaining overall predicted thermal stability is able to influence translation initiation. PMID:21840318

Genotyping by alkaline dehybridization using graphically encoded particles.

PubMed

Zhang, Huaibin; DeConinck, Adam J; Slimmer, Scott C; Doyle, Patrick S; Lewis, Jennifer A; Nuzzo, Ralph G

2011-03-01

This work describes a nonenzymatic, isothermal genotyping method based on the kinetic differences exhibited in the dehybridization of perfectly matched (PM) and single-base mismatched (MM) DNA duplexes in an alkaline solution. Multifunctional encoded hydrogel particles incorporating allele-specific oligonucleotide (ASO) probes in two distinct regions were fabricated by using microfluidic-based stop-flow lithography. Each particle contained two distinct ASO probe sequences differing at a single base position, and thus each particle was capable of simultaneously probing two distinct target alleles. Fluorescently labeled target alleles were annealed to both probe regions of a particle, and the rate of duplex dehybridization was monitored by using fluorescence microscopy. Duplex dehybridization was achieved through an alkaline stimulus using either a pH step function or a temporal pH gradient. When a single target probe sequence was used, the rate of mismatch duplex dehybridization could be discriminated from the rate of perfect match duplex dehybridization. In a more demanding application in which two distinct probe sequences were used, we found that the rate profiles provided a means to discriminate probe dehybridizations from both of the two mismatched duplexes as well as to distinguish at high certainty the dehybridization of the two perfectly matched duplexes. These results demonstrate an ability of alkaline dehybridization to correctly discriminate the rank hierarchy of thermodynamic stability among four sets of perfect match and single-base mismatch duplexes. We further demonstrate that these rate profiles are strongly temperature dependent and illustrate how the sensitivity can be compensated beneficially by the use of an actuating gradient pH field. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum fiber

PubMed Central

Chen, Shi; Liu, Jun; Zhao, Yifan; Zhu, Long; Wang, Andong; Li, Shuhui; Du, Jing; Du, Cheng; Mo, Qi; Wang, Jian

2016-01-01

We present a full-duplex bidirectional data transmission link using twisted lights multiplexing over 1.1-km orbital angular momentum (OAM) fiber. OAM+1 and OAM−1 modes carrying 20-Gbit/s quadrature phase-shift keying (QPSK) signals are employed in the downlink and uplink transmission experiments. The observed mode crosstalks are less than −15.2 dB, and the full-duplex crosstalks are less than −12.7 dB. The measured full-duplex optical signal-to-noise ratio (OSNR) penalties at a bit-error rate (BER) of 2 × 10−3 are ~2.4 dB in the downlink transmission and ~2.3 dB in the uplink transmission. The obtained results show favorable full-duplex twisted lights multiplexing data transmission performance in a km-scale OAM fiber link. PMID:27901082

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

PubMed

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cognitive Control of Auditory Distraction: Impact of Task Difficulty, Foreknowledge, and Working Memory Capacity Supports Duplex-Mechanism Account

ERIC Educational Resources Information Center

Hughes, Robert W.; Hurlstone, Mark J.; Marsh, John E.; Vachon, Francois; Jones, Dylan M.

2013-01-01

The influence of top-down cognitive control on 2 putatively distinct forms of distraction was investigated. Attentional capture by a task-irrelevant auditory deviation (e.g., a female-spoken token following a sequence of male-spoken tokens)--as indexed by its disruption of a visually presented recall task--was abolished when focal-task engagement…

Numerical modeling of fold-and-thrust belts: Applications to Kuqa foreland fold belt, China

NASA Astrophysics Data System (ADS)

Yin, H.; Morgan, J. K.; Zhang, J.; Wang, Z.

2009-12-01

We constructed discrete element models to simulate the evolution of fold-and-thrust belts. The impact of rock competence and decollement strength on the geometric pattern and deformation mechanics of fold-and-thrust belts has been investigated. The models reproduced some characteristic features of fold-and-thrust belts, such as faulted detachment folds, pop-ups, far-traveled thrust sheets, passive-roof duplexes, and back thrusts. In general, deformation propagates farther above a weak decollement than above a strong decollement. Our model results confirm that fold-and-thrust belts with strong frictional decollements develop relatively steep and narrow wedges formed by closely spaced imbricate thrust slices, whereas fold belts with weak decollements form wide low-taper wedges composed of faulted detachment folds, pop-ups, and back thrusts. Far-traveled thrust sheets and passive-roof duplexes are observed in the model with a strong lower decollement and a weak upper detachment. Model results also indicate that the thickness of the weak layer is critical. If it is thick enough, it acts as a ductile layer that is able to flow under differential stress, which helps to partition deformation above and below it. The discrete element modeling results were used to interpret the evolution of Kuqa Cenozoic fold-and-thrust belt along northern Tarim basin, China. Seismic and well data show that the widely distributed Paleogene rock salt has a significant impact on the deformation in this area. Structures beneath salt are closely spaced imbricate thrust and passive-roof duplex systems. Deformation above salt propagates much farther than below the salt. Faults above salt are relatively wide spaced. A huge controversy over the Kuqa fold-and-thrust belt is whether it is thin-skinned or thick-skinned. With the insights from DEM results, we suggest that Kuqa structures are mostly thin-skinned with Paleogene salt as decollement, except for the rear part near the backstop, where the faults below the salt are thick-skinned and involve the Paleozoic basement. We think that most basement-involved sub-salt faults, if not all, formed later than the above salt-detached thin-skinned structures.

47 CFR 80.374 - Provisions for frequencies in the 4000-4063 and the 8100-8195 kHz bands shared with the fixed...

Code of Federal Regulations, 2010 CFR

2010-10-01

... ship-to-shore duplex operations with coast stations assigned the frequencies described in § 80.371(b... shore-to-ship simplex operations; or (iv) Duplex operations with coast stations assigned in the band... coast stations for: (i) Supplementary ship-to-shore duplex operations with coast stations assigned the...

A Commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century"

ERIC Educational Resources Information Center

Brandt, Steffen

2010-01-01

This article presents the author's commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century," in which Isaac I. Bejar and E. Aurora Graf propose the application of a test design--the duplex design (which was proposed in 1988 by Bock and Mislevy) for application in current accountability assessments.…

50. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

50. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University. Detail of front entrance and of gable dormer - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

48. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

48. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Attic and roof, basement, first floor, and second floor plans - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

49. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

49. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Front, rear, and side elevations, and cross-section - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

An Arabidopsis ATP-dependent, DEAD-box RNA helicase loses activity upon iosAsp formation but is restored by Protein Isoaspartyl Methltransferase

USDA-ARS?s Scientific Manuscript database

Arabidopsis thaliana PLANT RNA HELICASE75 (AtPRH75) demonstrated an ATP-dependent, RNA duplex unwinding capacity and an ATP-independent, RNA duplex reforming ability. It is known to accumulate isoAsp, but the consequences of isoAsp formation in AtPRH75 are unknown. Duplex unwinding was abolished by ...

The effects of laser welding parameters on the microstructure of ferritic and duplex stainless steels welds

NASA Astrophysics Data System (ADS)

Pekkarinen, J.; Kujanpää, V.

This study is focused to determine empirically, which microstructural changes occur in ferritic and duplex stainless steels when heat input is controlled by welding parameters. Test welds were done autogenously bead-on-plate without shielding gas using 5 kW fiber laser. For comparison, some gas tungsten arc welds were made. Used test material were 1.4016 (AISI 430) and 1.4003 (low-carbon ferritic) type steels in ferritic steels group and 1.4162 (low-alloyed duplex, LDX2101) and 1.4462 (AISI 2205) type steels in duplex steels group. Microstructural changes in welds were identified and examined using optical metallographic methods.

Concurrent infections of pseudorabies virus and porcine bocavirus in China detected by duplex nanoPCR.

PubMed

Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin

2015-07-01

Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

A sensitive duplex nanoparticle-assisted PCR assay for identifying porcine epidemic diarrhea virus and porcine transmissible gastroenteritis virus from clinical specimens.

PubMed

Zhu, Yu; Liang, Lin; Luo, Yakun; Wang, Guihua; Wang, Chunren; Cui, Yudong; Ai, Xia; Cui, Shangjin

2017-02-01

In this study, a novel duplex nanoparticle-assisted polymerase chain reaction (nanoPCR) assay was developed to detect porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). Two pairs of primers were designed based on the conserved region within the N gene of PEDV and TGEV. In a screening of 114 clinical samples from four provinces in China for PEDV and TGEV, 48.2 and 3.5 % of the samples, respectively, tested positive. Under optimized conditions, the duplex nanoPCR assay had a detection limit of 7.6 × 10 1 and 8.5 × 10 1 copies μL -1 for PEDV and TGEV, respectively. The sensitivity of the duplex nanoPCR assay was ten times higher than that of a conventional PCR assay. Moreover, no fragments were amplified when the duplex nanoPCR assay was used to test samples containing other porcine viruses. Our results indicate that the duplex nanoPCR assay described here is useful for the rapid detection of PEDV and TGEV and can be applied in clinical diagnosis.

Effects of chitosan inhibitor on the electrochemical corrosion behavior of 2205 duplex stainless steel

NASA Astrophysics Data System (ADS)

Yang, Se-fei; Wen, Ying; Yi, Pan; Xiao, Kui; Dong, Chao-fang

2017-11-01

The effects of chitosan inhibitor on the corrosion behavior of 2205 duplex stainless steel were studied by electrochemical measurements, immersion tests, and stereology microscopy. The influences of immersion time, temperature, and chitosan concentration on the corrosion inhibition performance of chitosan were investigated. The optimum parameters of water-soluble chitosan on the corrosion inhibition performance of 2205 duplex stainless steel were also determined. The water-soluble chitosan showed excellent corrosion inhibition performance on the 2205 duplex stainless steel. Polarization curves demonstrated that chitosan acted as a mixed-type inhibitor. When the stainless steel specimen was immersed in the 0.2 g/L chitosan solution for 4 h, a dense and uniform adsorption film covered the sample surface and the inhibition efficiency (IE) reached its maximum value. Moreover, temperature was found to strongly influence the corrosion inhibition of chitosan; the inhibition efficiency gradually decreased with increasing temperature. The 2205 duplex stainless steel specimen immersed in 0.4 g/L water-soluble chitosan at 30°C displayed the best corrosion inhibition among the investigated specimens. Moreover, chitosan decreased the corrosion rate of the 2205 duplex stainless steel in an FeCl3 solution.

Quality assurance of lower limb venous duplex scans performed by vascular surgeons.

PubMed

Kordowicz, A; Ferguson, G; Salaman, R; Onwudike, M

2015-02-01

Duplex scanning is the gold standard for investigating venous reflux; increasingly surgeons perform these scans themselves. There has been no data published analysing the accuracy of Duplex scans performed by vascular surgeons. We aimed to evaluate an objective method of comparing the results of lower limb Duplex scans performed by one consultant vascular surgeon with those performed by a vascular technologist. We assessed 100 legs with symptomatic varicose veins. Each patient underwent two lower limb venous Duplex scans; one performed by a consultant vascular surgeon and one by a vascular technologist. Scan results were randomised and sent to two consultant vascular surgeons blinded to the identity and experience of the sonographer. They were asked to recommend treatment. A k score was calculated in each case to assess the level of agreement between the scans performed by the consultant and the technologist. Eighty-one patients were studied (53 females). The kappa score for assessor 1 was 0.60 (95%CI:0.44-0.75) and for assessor 2 was 0.62 (95%CI:0.48-0.75). k scores >0.60 represent a substantial strength of agreement. Duplex scans performed by this surgeon were comparable to those performed by a vascular technologist. It is possible to quality-assure duplex performed by vascular surgeons without directly observing the scanning process or reviewing digitally recorded images. We propose standardisation of training, assessment and quality assurance for vascular surgeons wishing to perform ultrasound scans.

The value and economic analysis of routine postoperative carotid duplex ultrasound surveillance after carotid endarterectomy.

PubMed

AbuRahma, Ali F; Srivastava, Mohit; AbuRahma, Zachary; Jackson, Will; Mousa, Albeir; Stone, Patrick A; Dean, L Scott; Green, Jason

2015-08-01

Several studies have reported on the role of postoperative duplex ultrasound surveillance after carotid endarterectomy (CEA) with varying results. Most of these studies had a small sample size or did not analyze cost-effectiveness. We analyzed 489 of 501 CEA patients with patch closure. All patients had immediate postoperative duplex ultrasound examination and were routinely followed up both clinically and with duplex ultrasound at regular intervals of 1 month, 6 months, 12 months, and every 12 months thereafter. A Kaplan-Meier analysis was used to estimate the rate of ≥50% and ≥80% post-CEA restenosis over time and the time frame of progression from normal to ≥50% or ≥80% restenosis. The cost of post-CEA duplex surveillance was also estimated. Overall, 489 patients with a mean age of 68.5 years were analyzed. Ten of these had residual postoperative ≥50% stenosis, and 37 did not undergo a second duplex ultrasound examination and therefore were not included in the final analysis. The mean follow-up was 20.4 months (range, 1-63 months), with a mean number of duplex ultrasound examinations of 3.6 (range, 1-7). Eleven of 397 patients (2.8%) with a normal finding on immediate postoperative duplex ultrasound vs 4 of 45 (8.9%) with mild stenosis on immediate postoperative duplex ultrasound progressed to ≥50% restenosis (P = .055). Overall, 15 patients (3.1%) had ≥50% restenosis, 9 with 50% to <80% and 4 with 80% to 99% (2 of these had carotid artery stenting reintervention), and 2 had late carotid occlusion. All of these were asymptomatic, except for one who had a transient ischemic attack. The mean time to ≥50% to <80% restenosis was 14.7 months vs 19.8 months for ≥80% restenosis after the CEA. Freedom from restenosis rates were 98%, 96%, 94%, 94%, and 94% for ≥50% restenosis and 99%, 98%, 97%, 97%, and 97% for ≥80% restenosis at 1 year, 2 years, 3 years, 4 years, and 5 years, respectively. Freedom from myocardial infarction, stroke, and deaths was not significantly different between patients with and without restenosis (100%, 93%, 83%, and 83% vs 94%, 91%, 86%, and 79% at 1 year, 2 years, 3 years, and 4 years, respectively; P = .951). The estimated charge of this surveillance was 3.6 × 489 (number of CEAs) × $800 (charge for carotid duplex ultrasound), which equals $1,408,320, to detect only four patients with ≥80% to 99% restenosis who may have been potential candidates for reintervention. This study shows that the value of routine postoperative duplex ultrasound surveillance after CEA with patch closure may be limited, particularly if the finding on immediate postoperative duplex ultrasound is normal or shows minimal disease. Copyright © 2015 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Comparison of monoplex and duplex RT-PCR assays for the detection of measles virus.

PubMed

Binkhamis, Khalifa; Gillis, Hayley; Lafreniere, Joseph Daniel; Hiebert, Joanne; Mendoza, Lillian; Pettipas, Janice; Severini, Alberto; Hatchette, Todd F; LeBlanc, Jason J

2017-01-01

Rapid and accurate detection of measles virus is important for case diagnosis and public health management. This study compared the performance of two monoplex RT-PCR reactions targeting the H and N genes to a duplex RT-PCR targeting both genes simultaneously. The duplex simplified processing without compromising assay performance characteristic. Copyright © 2016 Elsevier B.V. All rights reserved.

Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

PubMed

Patel, D J; Canuel, L L

1977-07-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

PubMed Central

Patel, Dinshaw J.; Canuel, Lita L.

1977-01-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

Cloned plasmid DNA fragments as calibrators for controlling GMOs: different real-time duplex quantitative PCR methods.

PubMed

Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc

2004-03-01

Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.

Fork rotation and DNA precatenation are restricted during DNA replication to prevent chromosomal instability.

PubMed

Schalbetter, Stephanie A; Mansoubi, Sahar; Chambers, Anna L; Downs, Jessica A; Baxter, Jonathan

2015-08-18

Faithful genome duplication and inheritance require the complete resolution of all intertwines within the parental DNA duplex. This is achieved by topoisomerase action ahead of the replication fork or by fork rotation and subsequent resolution of the DNA precatenation formed. Although fork rotation predominates at replication termination, in vitro studies have suggested that it also occurs frequently during elongation. However, the factors that influence fork rotation and how rotation and precatenation may influence other replication-associated processes are unknown. Here we analyze the causes and consequences of fork rotation in budding yeast. We find that fork rotation and precatenation preferentially occur in contexts that inhibit topoisomerase action ahead of the fork, including stable protein-DNA fragile sites and termination. However, generally, fork rotation and precatenation are actively inhibited by Timeless/Tof1 and Tipin/Csm3. In the absence of Tof1/Timeless, excessive fork rotation and precatenation cause extensive DNA damage following DNA replication. With Tof1, damage related to precatenation is focused on the fragile protein-DNA sites where fork rotation is induced. We conclude that although fork rotation and precatenation facilitate unwinding in hard-to-replicate contexts, they intrinsically disrupt normal chromosome duplication and are therefore restricted by Timeless/Tipin.

Refinement of Generalized Born Implicit Solvation Parameters for Nucleic Acids and their Complexes with Proteins

PubMed Central

Nguyen, Hai; Pérez, Alberto; Bermeo, Sherry; Simmerling, Carlos

2016-01-01

The Generalized Born (GB) implicit solvent model has undergone significant improvements in accuracy for modeling of proteins and small molecules. However, GB still remains a less widely explored option for nucleic acid simulations, in part because fast GB models are often unable to maintain stable nucleic acid structures, or they introduce structural bias in proteins, leading to difficulty in application of GB models in simulations of protein-nucleic acid complexes. Recently, GB-neck2 was developed to improve the behavior of protein simulations. In an effort to create a more accurate model for nucleic acids, a similar procedure to the development of GB-neck2 is described here for nucleic acids. The resulting parameter set significantly reduces absolute and relative energy error relative to Poisson Boltzmann for both nucleic acids and nucleic acid-protein complexes, when compared to its predecessor GB-neck model. This improvement in solvation energy calculation translates to increased structural stability for simulations of DNA and RNA duplexes, quadruplexes, and protein-nucleic acid complexes. The GB-neck2 model also enables successful folding of small DNA and RNA hairpins to near native structures as determined from comparison with experiment. The functional form and all required parameters are provided here and also implemented in the AMBER software. PMID:26574454

Duplex ultrasound

MedlinePlus

Vascular ultrasound; Peripheral vascular ultrasound ... A duplex ultrasound combines: Traditional ultrasound: This uses sound waves that bounce off blood vessels to create pictures. Doppler ultrasound: This ...

Influence of drug binding on DNA hydration: acoustic and densimetric characterizations of netropsin binding to the poly(dAdT).poly(dAdT) and poly(dA).poly(dT) duplexes and the poly(dT).poly(dA).poly(dT) triplex at 25 degrees C.

PubMed

Chalikian, T V; Plum, G E; Sarvazyan, A P; Breslauer, K J

1994-07-26

We use high-precision acoustic and densimetric techniques to determine, at 25 degrees C, the changes in volume, delta V, and adiabatic compressibility, delta Ks, that accompany the binding of netropsin to the poly(dAdT).poly(dAdT) and poly(dA).poly(dT) duplexes, as well as to the poly(dT).poly(dA).poly(dT) triplex. We find that netropsin binding to the heteropolymeric poly(dAdT).poly(dAdT) duplex is accompanied by negative changes in volume, delta V, and small positive changes in compressibility, delta Ks. By contrast, netropsin binding to the homopolymeric poly(dA).poly(dT) duplex is accompanied by large positive changes in both volume, delta V, and compressibility, delta Ks. Furthermore, netropsin binding to the poly(dT).poly(dA).poly(dT) triplex causes changes in both volume and compressibility that are nearly twice as large as those observed when netropsin binds to the poly(dA).poly(dT) duplex. We interpret these macroscopic data in terms of binding-induced microscopic changes in the hydration of the DNA structures and the drug. Specifically, we find that netropsin binding induces the release of approximately 22 waters from the hydration shell of the poly(dAdT).poly(dAdT) heteropolymeric duplex, approximately 40 waters from the hydration shell of the poly(dA).poly(dT) homopolymeric duplex, and about 53 waters from the hydration shell of the poly(dA).poly(dT), induces the release of 18 more water molecules than netropsin binding to the heteropolymeric duplex, poly(dAdT).poly(dAdT). On the basis of apparent molar volume, phi V, and apparent molar adiabatic compressibility, phi Ks, values for the initial drug-free and final drug-bound states of the two all-AT duplexes, we propose that the larger dehydration of the poly(dA).poly(dT) duplex reflects, in part, the formation of a less hydrated poly(dA).poly(dT)-netropsin complex compared with the corresponding poly(dAdT).poly(dAdT)-netropsin complex. In conjunction with our previously published entropy data [Marky, L. A., & Breslauer, K. J. (1987) Proc. Natl. Acad. Sci. U.S.A. 84, 4359-4363], we calculate that each water of hydration released to the bulk solvent by ligand binding contributes 1.6 cal K-1 mol-1 to the entropy of binding. This value corresponds to the average difference between the partial molar entropy of water in the bulk state and water in the hydration shells of the two all-AT duplexes. When netropsin binds to the poly(dT).poly(dA).poly(dT) triplex, the changes in both volume and compressibility suggest that the binding event induces more dehydration of the triplex than of the duplex state. Specifically, we calculate that netropsin binding to the poly(dT).poly(dA).poly(dT) triplex causes the release of 13 more waters than netropsin binding to the poly(dA).poly(dT) duplex.(ABSTRACT TRUNCATED AT 400 WORDS)

Preoperative Duplex Scanning is a Helpful Diagnostic Tool in Neurogenic Thoracic Outlet Syndrome.

PubMed

Orlando, Megan S; Likes, Kendall C; Mirza, Serene; Cao, Yue; Cohen, Anne; Lum, Ying Wei; Freischlag, Julie A

2016-01-01

To evaluate the diagnostic role of venous and arterial duplex scanning in neurogenic thoracic outlet syndrome (NTOS). Retrospective review of patients who underwent duplex ultrasonography prior to first rib resection and scalenectomy (FRRS) for NTOS from 2005 to 2013. Abnormal scans included ipsilateral compression (IC) with abduction of the symptomatic extremity (>50% change in subclavian vessel flow), contralateral (asymptomatic side) compression (CC) or bilateral compression (BC). A total of 143 patients (76% female, average age 34, range 13-59) underwent bilateral preoperative duplex scanning. Ipsilateral compression was seen in 44 (31%), CC in 12 (8%), and BC in 14 (10%). Seventy-three (51%) patients demonstrated no compression. Patients with IC more often experienced intraoperative pneumothoraces (49% vs. 25%, P < .05) and had positive Adson tests (86% vs. 61%, P < .02). Compression of the subclavian vein or artery on duplex ultrasonography can assist in NTOS diagnosis. Ipsilateral compression on abduction often correlates with Adson testing. © The Author(s) 2016.

A most spectrum-efficient duplexing system: CDD

NASA Astrophysics Data System (ADS)

Lee, William C. Y.

2001-10-01

The game to play in wireless communications when it comes to increasing spectrum efficiency is to eliminate interference. Currently, all cellular systems use FDD (Frequency Division Duplexing) in an attempt to eliminate the interference from the adjacent cells. Through the use of many technologies only one type of interference remains and that is the adjacent base-tohome mobile interference. TDD (Time Division Duplexing) has not been used for mobile cellular systems, not only because of the adjacent base-to-home mobile interference, but also because of the additional adjacent base-to-home base interference, and adjacent mobile-to-home mobile interference. Therefore, TDD can only be used for small, confined area systems. CDD (Code Division Duplexing) can eliminate all three kinds of interference; the adjacent base-to-home mobile, the adjacent baseto-home base, and the adjacent mobile- to- home in cellular systems. Eliminating each of these interferences makes CDD the most spectrum efficient duplexing system. This talk will elaborate on a set of smart codes, which will make an efficient CDD system a reality.

The energetic basis of the DNA double helix: a combined microcalorimetric approach

PubMed Central

Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.

2015-01-01

Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541

Molecular detection of infectious bronchitis and Newcastle disease viruses in broiler chickens with respiratory signs using Duplex RT-PCR.

PubMed

Saba Shirvan, Aylar; Mardani, Karim

2014-01-01

Infectious bronchitis (IB) and Newcastle disease (ND) are highly contagious and the most economically important diseases of the poultry affecting respiratory tract and causing economic losses in poultry industry throughout the world. In the present study, the simultaneous detection and differentiation of causative agents of these diseases were investigated using duplex-RT-PCR. RNA was extracted from vaccinal and reference strains of infectious bronchitis virus (IBV) and Newcastle disease virus (NDV) and then cDNA was synthesized. Using two universal primer sets for detection of IBV and NDV, the duplex-RT-PCR was developed. In order to assess the efficiency of the developed duplex RT-PCR, a number of 12 broiler farms with the symptoms of respiratory tract infection was sampled (trachea, lung and kidney were sampled from affected birds suspicious for IBV and NDV infections). After RNA extraction from tissues and cDNA synthesis, the presence of IBV and NDV genome were investigated using duplex-PCR. The results showed that three of twelve examined broiler farms were positive for IBV and two farms were positive for NDV and IBV. The results revealed that the duplex-RT-PCR is a quick and sensitive procedure for simultaneously detecting IBV and NDV in birds with respiratory infections.

A novel duplex real time quantitative reverse transcription polymerase chain reaction for rubella virus with armored RNA as a noncompetitive internal positive control.

PubMed

Zhao, Lihong; Li, Ruiying; Liu, Aihua; Zhao, Shuping

2015-07-01

The objective of this study was to build and apply a duplex real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) for rubella virus. Firstly, a 60-bp-long armored RV RNA was constructed in the laboratory. Secondly, a duplex real time RT-PCR assay was established. Thirdly, the 60-bp-long armored RV RNA was used as an internal positive control (IPC) for the duplex real time RT-PCR. And finally the duplex real time RT-PCR assay was applied to detect RV RNA in clinical specimens. The in-house assay has a high amplification efficiency (0.99), a high analytical sensitivity (200 copies/mL), and a good reproducibility. The diagnostic specificity and sensitivity of the in-house assay were both 100%, due to the monitoring of the armored RV RNA IPC. Therefore, the in-house duplex real time quantitative RT-PCR assay is a specific, sensitive, reproducible and accurate assay for quantitation of RV RNA in clinical specimens. And noncompetitive armored RV RNA IPC can monitor RT-PCR inhibition and prevent false-negative and inaccurate results in the real time detection system. Copyright © 2015 Elsevier B.V. All rights reserved.

Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

PubMed Central

O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

2006-01-01

Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

PubMed Central

Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

2014-01-01

Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

Development of TRIP-Aided Lean Duplex Stainless Steel by Twin-Roll Strip Casting and Its Deformation Mechanism

NASA Astrophysics Data System (ADS)

Zhao, Yan; Zhang, Weina; Liu, Xin; Liu, Zhenyu; Wang, Guodong

2016-12-01

In the present work, twin-roll strip casting was carried out to fabricate thin strip of a Mn-N alloyed lean duplex stainless steel with the composition of Fe-19Cr-6Mn-0.4N, in which internal pore defects had been effectively avoided as compared to conventional cast ingots. The solidification structure observed by optical microscope indicated that fine Widmannstatten structure and coarse-equiaxed crystals had been formed in the surface and center, respectively, with no columnar crystal structures through the surface to center of the cast strip. By applying hot rolling and cold rolling, thin sheets with the thickness of 0.5 mm were fabricated from the cast strips, and no edge cracks were formed during the rolling processes. With an annealing treatment at 1323 K (1050 °C) for 5 minutes after cold rolling, the volume fractions of ferrite and austenite were measured to be approximately equal, and the distribution of alloying elements in the strip was further homogenized. The cold-rolled and annealed sheet exhibited an excellent combination of strength and ductility, with the ultimate tensile strength and elongation having been measured to be 1000 MPa and 65 pct, respectively. The microstructural evolution during deformation was investigated by XRD, EBSD, and TEM, indicating that ferrite and austenite had different deformation mechanisms. The deformation of ferrite phase was dominated by dislocation slipping, and the deformation of austenite phase was mainly controlled by martensitic transformation in the sequence of γ→ ɛ-martensite→ α'-martensite, leading to the improvement of strength and plasticity by the so-called transformation-induced plasticity (TRIP) effect. By contrast, lean duplex stainless steels of Fe-21Cr-6Mn-0.5N and Fe-23Cr-7Mn-0.6N fabricated by twin-roll strip casting did not show TRIP effects and exhibited lower strength and elongation as compared to Fe-19Cr-6Mn-0.4N.

Oxidation characteristics of porous-nickel prepared by powder metallurgy and cast-nickel at 1273 K in air for total oxidation time of 100 h.

PubMed

Mohamed, Lamiaa Z; Ghanem, Wafaa A; El Kady, Omayma A; Lotfy, Mohamed M; Ahmed, Hafiz A; Elrefaie, Fawzi A

2017-11-01

The oxidation behavior of two types of inhomogeneous nickel was investigated in air at 1273 K for a total oxidation time of 100 h. The two types were porous sintered-nickel and microstructurally inhomogeneous cast-nickel. The porous-nickel samples were fabricated by compacting Ni powder followed by sintering in vacuum at 1473 K for 2 h. The oxidation kinetics of the samples was determined gravimetrically. The topography and the cross-section microstructure of each oxidized sample were observed using optical and scanning electron microscopy. X-ray diffractometry and X-ray energy dispersive analysis were used to determine the nature of the formed oxide phases. The kinetic results revealed that the porous-nickel samples had higher trend for irreproducibility. The average oxidation rate for porous- and cast-nickel samples was initially rapid, and then decreased gradually to become linear. Linear rate constants were 5.5 × 10 -8  g/cm 2  s and 3.4 × 10 -8  g/cm 2  s for the porous- and cast-nickel samples, respectively. Initially a single-porous non-adherent NiO layer was noticed on the porous- and cast-nickel samples. After a longer time of oxidation, a non-adherent duplex NiO scale was formed. The two layers of the duplex scales were different in color. NiO particles were observed in most of the pores of the porous-nickel samples. Finally, the linear oxidation kinetics and the formation of porous non-adherent duplex oxide scales on the inhomogeneous nickel substrates demonstrated that the addition of new layers of NiO occurred at the scale/metal interface due to the thermodynamically possible reaction between Ni and the molecular oxygen migrating inwardly.

The tectono-thermal evolution of the Waterbury dome, western Connecticut, based on U-Pb and 40Ar/39Ar ages

USGS Publications Warehouse

Dietsch, Craig; Kunk, Michael J.; Aleinikoff, John; Sutter, John F.

2010-01-01

Level 3 nappes were emplaced over the Waterbury dome along an Acadian décollement synchronous with the formation of a D3 thrust duplex in the dome. The décollement truncates the Ky + Kfs-in (migmatite) isograd in the dome core and a St-in isograd in level 3 nappes, indicating that peak metamorphic conditions in the dome core and nappe cover rocks formed in different places at different times. Metamorphic overgrowths on zircon from the felsic orthogneiss in the Waterbury dome have an age of 387 ± 5 Ma. Rocks of all levels and the décollement are folded by D4 folds that have a strongly developed, regional crenulation cleavage and D5 folds. The Waterbury dome was formed by thrust duplexing followed by fold interference during the Acadian orogeny. The 40Ar/39Ar ages of amphibole, muscovite, biotite, and K-feldspar from above and below the décollement are ca. 378 Ma, 355 Ma, 360 Ma (above) and 340 (below), and 288 Ma, respectively. Any kilometer-scale vertical movements between dome and nappe rocks were over by ca. 378 Ma. Core and cover rocks of the Waterbury dome record synchronous, post-Acadian cooling.

Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

PubMed

Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

2017-12-14

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

A target-triggered strand displacement reaction cycle: the design and application in adenosine triphosphate sensing.

PubMed

Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu

2014-02-01

A strand displacement reaction (SDR) system that runs solely on oligonucleotides has been developed for the amplification detection of adenosine triphosphate (ATP). It involves a target-induced SDR and an entropy-driven catalytic cycle of two SDRs with five oligonucleotides, denoted as substrate, fuel, catalyst, C-1, and C-2. Catalyst, released from the ATP aptamer-catalyst duplex by ATP molecule, catalyzes the SDRs to finally form the substrate-fuel duplex. All of the intermediates in the catalytic SDR processes have been identified by polyacrylamide gel electrophoresis (PAGE) analysis. The introduction of ATP into the SDR system will induce the ATP aptamer to form G-quadruplex conformation so as to release catalyst and trigger the SDR cycle. When the substrate and C-2 oligonucleotides were labeled with a carboxyfluorescein (FAM) fluorophore and a 4-([4-(dimethylamino)phenyl]azo)benzoic acid (DABCYL) quencher, this SDR catalytic system exhibited a "turn-on" response for ATP. The condition for detecting ATP, such as Mg²⁺ concentration, has been optimized to afford a detection limit of 20 nM. This work provides an enzyme-free biosensing strategy and has potential application in aptamer-based biosensing. Copyright © 2013 Elsevier Inc. All rights reserved.

Investigation of Hot Deformation Behavior of Duplex Stainless Steel Grade 2507

NASA Astrophysics Data System (ADS)

Kingklang, Saranya; Uthaisangsuk, Vitoon

2017-01-01

Recently, duplex stainless steels (DSSs) are being increasingly employed in chemical, petro-chemical, nuclear, and energy industries due to the excellent combination of high strength and corrosion resistance. Better understanding of deformation behavior and microstructure evolution of the material under hot working process is significant for achieving desired mechanical properties. In this work, plastic flow curves and microstructure development of the DSS grade 2507 were investigated. Cylindrical specimens were subjected to hot compression tests for different elevated temperatures and strain rates by a deformation dilatometer. It was found that stress-strain responses of the examined steel strongly depended on the forming rate and temperature. The flow stresses increased with higher strain rates and lower temperatures. Subsequently, predictions of the obtained stress-strain curves were done according to the Zener-Hollomon equation. Determination of material parameters for the constitutive model was presented. It was shown that the calculated flow curves agreed well with the experimental results. Additionally, metallographic examinations of hot compressed samples were performed by optical microscope using color tint etching. Area based phase fractions of the existing phases were determined for each forming condition. Hardness of the specimens was measured and discussed with the resulted microstructures. The proposed flow stress model can be used to design and optimize manufacturing process at elevated temperatures for the DSS.

Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

PubMed

Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

2016-10-01

Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation <3.1%. 439 clinical samples were evaluated by both duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples，95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

PubMed

Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

2013-07-01

Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

PubMed

Ye, Y W; Ling, N; Han, Y J; Wu, Q P

2014-11-01

Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Comparison of duplex ultrasound with digital subtraction angiography in the assessment of infra-inguinal autologous vein bypass grafts.

PubMed

Griffin, Nick M R; Wright, Isabel A; Buckenham, Tim M

2006-11-01

Postoperative surveillance of infra-inguinal vein grafts has arisen because of the high incidence of vein graft stenoses, which frequently progress to vein graft occlusion. The use of duplex ultrasound as the primary imaging method for graft surveillance is well established. This study aims to compare the accuracy of duplex ultrasound with the reference standard of digital subtraction angiography in the assessment of infra-inguinal vein grafts. Sixty patients underwent routine postoperative duplex ultrasound as part of the local graft surveillance programme. Angiography was subsequently carried out on 18 grafts. Each lower limb arterial tree was divided into three segments (native arteries proximal to the graft, the graft itself and native arteries distal to the graft) resulting in a total of 42 comparisons. Degree of diameter stenosis on ultrasound was compared with angiography findings to determine concordance. Agreement was also expressed as a kappa value. Overall accuracy of duplex ultrasound was 88% (37/42). A kappa value of 0.80 indicates good agreement. In three of the five discordant cases, ultrasound correctly identified a stenosis, but overestimated the degree of stenosis compared with angiography. In each of the remaining two discordant cases, ultrasound identified a focal stenosis that was not apparent on angiography. In both cases, the area of duplex described abnormality responded to balloon angioplasty. Duplex ultrasound as part of the local vein graft surveillance programme is a reliable and accurate method in the detection of failing grafts and in some instances may be more sensitive.

Boride Formation Induced by pcBN Tool Wear in Friction-Stir-Welded Stainless Steels

NASA Astrophysics Data System (ADS)

Park, Seung Hwan C.; Sato, Yutaka S.; Kokawa, Hiroyuki; Okamoto, Kazutaka; Hirano, Satoshi; Inagaki, Masahisa

2009-03-01

The wear of polycrystalline cubic boron nitride (pcBN) tool and its effect on second phase formation were investigated in stainless steel friction-stir (FS) welds. The nitrogen content and the flow stress were analyzed in these welds to examine pcBN tool wear. The nitrogen content in stir zone (SZ) was found to be higher in the austenitic stainless steel FS welds than in the ferritic and duplex stainless steel welds. The flow stress of austenitic stainless steels was almost 1.5 times larger than that of ferritic and duplex stainless steels. These results suggest that the higher flow stress causes the severe tool wear in austenitic stainless steels, which results in greater nitrogen pickup in austenitic stainless steel FS welds. From the microstructural observation, a possibility was suggested that Cr-rich borides with a crystallographic structure of Cr2B and Cr5B3 formed through the reaction between the increased boron and nitrogen and the matrix during FS welding (FSW).

Corrosion studies using potentiodynamic and EIS electrochemical techniques of welded lean duplex stainless steel UNS S82441

NASA Astrophysics Data System (ADS)

Brytan, Z.; Niagaj, J.; Reiman, Ł.

2016-12-01

The corrosion characterisation of lean duplex stainless steel (1.4662) UNS S82441 welded joints using the potentiodynamic test and electrochemical impedance spectroscopy in 1 M NaCl solution are discussed. The influence of autogenous TIG welding parameters (amount of heat input and composition of shielding gases like Ar and Ar-N2 and an Ar-He mixture), as well as A-TIG welding was studied. The influence of welding parameters on phase balance, microstructural changes and the protective properties of passive oxide films formed at the open circuit potential or during the anodic polarisation were studied. From the results of the potentiodynamic test and electrochemical impedance spectroscopy of TIG and A-TiG, welded joints show a lower corrosion resistance compared to non-welded parent metal, but introducing heat input properly during welding and applying shielding gases rich in nitrogen or helium can increase austenitic phase content, which is beneficial for corrosion resistance, and improves surface oxide layer resistance in 1 M NaCl solution.

Influence of Temperature and Chloride Concentration on Passivation Mechanism and Corrosion of a DSS2209 Welded Joint

NASA Astrophysics Data System (ADS)

Hachemi, Hania; Azzaz, Mohamed; Djeghlal, Mohamed Elamine

2016-10-01

The passivity behavior of a 2209 duplex stainless steel welded joint was investigated using potentiodynamic polarization, Mott-Schottky analysis and EIS measurements. In order to evaluate the contribution of temperature, chloride concentration and microstructure, a sequence of polarization tests were carried out in aerated NaCl solutions selected according to robust design of a three level-three factors Taguchi L9 orthogonal array. Analysis of signal-to-noise ratio and ANOVA were achieved on all measured data, and the contribution of every control factor was estimated. The results showed that the corrosion resistance of 2209 duplex stainless steel welded joint is related to the evolution of the passive film formed on the surface. It was found that the passive film on the welded zone possessed n- and p-type semiconductor characteristics. With the increase of solution temperature and chlorides concentration, the corrosion resistance of the passive film is more affected in the weldment than in the base metal.

Characterization of a cold-rolled 2101 lean duplex stainless steel.

PubMed

Bassani, Paola; Breda, Marco; Brunelli, Katya; Mészáros, Istvan; Passaretti, Francesca; Zanellato, Michela; Calliari, Irene

2013-08-01

Duplex stainless steels (DSS) may be defined as a category of steels with a two-phase ferritic-austenitic microstructure, which combines good mechanical and corrosion properties. However, these steels can undergo significant microstructural modification as a consequence of either thermo-mechanical treatments (ferrite decomposition, which causes σ- and χ-phase formation and nitride precipitation) or plastic deformation at room temperature [austenite transformation into strain-induced martensite (SIM)]. These secondary phases noticeably affect the properties of DSS, and therefore are of huge industrial interest. In the present work, SIM formation was investigated in a 2101 lean DSS. The material was subjected to cold rolling at various degrees of deformation (from 10 to 80% thickness reduction) and the microstructure developed after plastic deformation was investigated by electron backscattered diffraction, X-ray diffraction measurements, and hardness and magnetic tests. It was observed that SIM formed as a consequence of deformations higher than ~20% and residual austenite was still observed at 80% of thickness reduction. Furthermore, a direct relationship was found between microstructure and magnetic properties.

M23C6 carbides and Cr2N nitrides in aged duplex stainless steel: A SEM, TEM and FIB tomography investigation.

PubMed

Maetz, J-Y; Douillard, T; Cazottes, S; Verdu, C; Kléber, X

2016-05-01

The precipitation evolution during ageing of a 2101 lean duplex stainless steel was investigated, revealing that the precipitate type and morphology depends on the nature of the grain boundary. Triangular M23C6 carbides precipitate only at γ/δ interfaces and rod-like Cr2N nitrides precipitate at both γ/δ and δ/δ interfaces. After 15min of ageing, the M23C6 size no longer evolves, whereas that of the Cr2N continues to evolve. For Cr2N, the morphology is maintained at γ/δ interfaces, whereas percolation occurs to form a continuous layer at δ/δ interfaces. By combining 2D and 3D characterisation at the nanoscale using transmission electron microscopy (TEM) and focused ion beam (FIB) tomography, a complete description of the precipitation evolution was obtained, including the composition, crystallographic structure, orientation relationship with the matrix phases, location, morphology, size and volume fraction. Copyright © 2016 Elsevier Ltd. All rights reserved.

Crystal structure of a transcribing RNA Polymerase II complex reveals a complete transcription bubble

PubMed Central

Barnes, Christopher O.; Calero, Monica; Malik, Indranil; Graham, Brian W.; Spahr, Henrik; Lin, Guowu; Cohen, Aina; Brown, Ian S.; Zhang, Qiangmin; Pullara, Filippo; Trakselis, Michael A.; Kaplan, Craig D.; Calero, Guillermo

2015-01-01

Summary Notwithstanding numerous published structures of RNA Polymerase II (Pol II), structural details of Pol II engaging a complete nucleic acid scaffold have been lacking. Here, we report the structures of TFIIF stabilized transcribing Pol II complexes, revealing the upstream duplex and full transcription bubble. The upstream duplex lies over a wedge-shaped loop from Rpb2 that engages its minor groove, providing part of the structural framework for DNA tracking during elongation. At the upstream transcription bubble fork, rudder and fork loop-1 residues spatially coordinate strand annealing and the nascent RNA transcript. At the downstream fork, a network of Pol II interactions with the non-template strand forms a rigid domain with the Trigger Loop (TL), allowing visualization of its open state. Overall, our observations suggest that “open/closed” conformational transitions of the TL may be linked to interactions with the non-template strand, possibly in a synchronized ratcheting manner conducive to polymerase translocation. PMID:26186291

The morphology and treatment of coexisting ureteropelvic junction obstruction in lower moiety of duplex kidney.

PubMed

Liu, Wei; Zhang, Liujuan; Ma, Rui; Wu, Rongde

2016-10-01

Duplex kidney is a common congenital anomaly of the urinary tract, while ureteropelvic junction obstruction (UPJO) in lower unit of duplex kidney is rare. Surgical treatment can be challenging in such cases. The aim was to report our experience in managements of UPJO in lower moiety of duplex kidney. Among the pediatric patients with duplex system from 2007 to 2013, 7 children were diagnosed with UPJO in lower moiety. Their medical records were retrospectively analyzed, mainly focused on anatomic aspects and operation details. The lower pole UPJO associated with incomplete duplex systems were identified in 6 patients on the left side and 1 on the right side. Median patient age at surgery was 11 months (range 6-84 months). Prenatal hydronephrosis was detected in 4 patients, and 3 had intermittent abdominal pain. Hydronephrosis, thin parenchyma and presence of UPJO in lower moiety could be shown on computed tomography urogram (CTU). The ureters were fused in a "Y" shape without any dilation. Based on the length between UPJO to the confluence in retrograde ureteropyelography, patients were classified into group 1 (5 cases,≤3 cm) and group 2 (2 cases, >3 cm). In group 1, surgical procedure involved end-to-side pyeloureterostomy of the lower pelvis to the ureteral confluence in 4 cases and laparoscopic pyeloureterostomy in one case. The two patients in group 2 underwent laparoscopic pyeloplasty of lower moiety. In all of these patients hydronephrosis gradually improved and no complications were detected during follow-up. UPJO in a duplex kidney requires careful evaluation and treatment should be individualized. Ureteropyeloanastomosis is a feasible treatment for duplex kidneys associated to a functioning lower moiety with UPJO. With the technical improvements in laparoscopic pyeloplasty, this procedure can be performed using laparoscopy. Copyright © 2016 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

PubMed

Pang, Jie; Zhang, Ziping; Jin, Haizhu

2016-03-15

Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of one novel multiple-target plasmid for duplex quantitative PCR analysis of roundup ready soybean.

PubMed

Zhang, Haibo; Yang, Litao; Guo, Jinchao; Li, Xiang; Jiang, Lingxi; Zhang, Dabing

2008-07-23

To enforce the labeling regulations of genetically modified organisms (GMOs), the application of reference molecules as calibrators is becoming essential for practical quantification of GMOs. However, the reported reference molecules with tandem marker multiple targets have been proved not suitable for duplex PCR analysis. In this study, we developed one unique plasmid molecule based on one pMD-18T vector with three exogenous target DNA fragments of Roundup Ready soybean GTS 40-3-2 (RRS), that is, CaMV35S, NOS, and RRS event fragments, plus one fragment of soybean endogenous Lectin gene. This Lectin gene fragment was separated from the three exogenous target DNA fragments of RRS by inserting one 2.6 kb DNA fragment with no relatedness to RRS detection targets in this resultant plasmid. Then, we proved that this design allows the quantification of RRS using the three duplex real-time PCR assays targeting CaMV35S, NOS, and RRS events employing this reference molecule as the calibrator. In these duplex PCR assays, the limits of detection (LOD) and quantification (LOQ) were 10 and 50 copies, respectively. For the quantitative analysis of practical RRS samples, the results of accuracy and precision were similar to those of simplex PCR assays, for instance, the quantitative results were at the 1% level, the mean bias of the simplex and duplex PCR were 4.0% and 4.6%, respectively, and the statistic analysis ( t-test) showed that the quantitative data from duplex and simplex PCR had no significant discrepancy for each soybean sample. Obviously, duplex PCR analysis has the advantages of saving the costs of PCR reaction and reducing the experimental errors in simplex PCR testing. The strategy reported in the present study will be helpful for the development of new reference molecules suitable for duplex PCR quantitative assays of GMOs.

Effects of Polymer Conjugation on Hybridization Thermodynamics of Oligonucleic Acids.

PubMed

Ghobadi, Ahmadreza F; Jayaraman, Arthi

2016-09-15

In this work, we perform coarse-grained (CG) and atomistic simulations to study the effects of polymer conjugation on hybridization/melting thermodynamics of oligonucleic acids (ONAs). We present coarse-grained Langevin molecular dynamics simulations (CG-NVT) to assess the effects of the polymer flexibility, length, and architecture on hybridization/melting of ONAs with different ONA duplex sequences, backbone chemistry, and duplex concentration. In these CG-NVT simulations, we use our recently developed CG model of ONAs in implicit solvent, and treat the conjugated polymer as a CG chain with purely repulsive Weeks-Chandler-Andersen interactions with all other species in the system. We find that 8-100-mer linear polymer conjugation destabilizes 8-mer ONA duplexes with weaker Watson-Crick hydrogen bonding (WC H-bonding) interactions at low duplex concentrations, while the same polymer conjugation has an insignificant impact on 8-mer ONA duplexes with stronger WC H-bonding. To ensure the configurational space is sampled properly in the CG-NVT simulations, we also perform CG well-tempered metadynamics simulations (CG-NVT-MetaD) and analyze the free energy landscape of ONA hybridization for a select few systems. We demonstrate that CG-NVT-MetaD simulation results are consistent with the CG-NVT simulations for the studied systems. To examine the limitations of coarse-graining in capturing ONA-polymer interactions, we perform atomistic parallel tempering metadynamics simulations at well-tempered ensemble (AA-MetaD) for a 4-mer DNA in explicit water with and without conjugation to 8-mer poly(ethylene glycol) (PEG). AA-MetaD simulations also show that, for a short DNA duplex at T = 300 K, a condition where the DNA duplex is unstable, conjugation with PEG further destabilizes DNA duplex. We conclude with a comparison of results from these three different types of simulations and discuss their limitations and strengths.

Enhancing the cellular uptake of siRNA duplexes following noncovalent packaging with protein transduction domain peptides.

PubMed

Meade, Bryan R; Dowdy, Steven F

2008-03-01

The major limitation in utilizing information rich macromolecules for basic science and therapeutic applications is the inability of these large molecules to readily diffuse across the cellular membrane. While this restriction represents an efficient defense system against cellular penetration of unwanted foreign molecules and thus a crucial component of cell survival, overcoming this cellular characteristic for the intracellular delivery of macromolecules has been the focus of a large number of research groups worldwide. Recently, with the discovery of RNA interference, many of these groups have redirected their attention and have applied previously characterized cell delivery methodologies to synthetic short interfering RNA duplexes (siRNA). Protein transduction domain and cell penetrating peptides have been shown to enhance the delivery of multiple types of macromolecular cargo including peptides, proteins and antisense oligonucleotides and are now being utilized to enhance the cellular uptake of siRNA molecules. The dense cationic charge of these peptides that is critical for interaction with cell membrane components prior to internalization has also been shown to readily package siRNA molecules into stable nanoparticles that are capable of traversing the cell membrane. This review discusses the recent advances in noncovalent packaging of siRNA molecules with cationic peptides and the potential for the resulting complexes to successfully induce RNA interference within both in vitro and in vivo settings.

Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

PubMed

Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

2015-02-15

In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

The DEAD-box helicase eIF4A: paradigm or the odd one out?

PubMed

Andreou, Alexandra Z; Klostermeier, Dagmar

2013-01-01

DEAD-box helicases catalyze the ATP-dependent unwinding of RNA duplexes. They share a helicase core formed by two RecA-like domains that carries a set of conserved motifs contributing to ATP binding and hydrolysis, RNA binding and duplex unwinding. The translation initiation factor eIF4A is the founding member of the DEAD-box protein family, and one of the few examples of DEAD-box proteins that consist of a helicase core only. It is an RNA-stimulated ATPase and a non-processive helicase that unwinds short RNA duplexes. In the catalytic cycle, a series of conformational changes couples the nucleotide cycle to RNA unwinding. eIF4A has been considered a paradigm for DEAD-box proteins, and studies of its function have revealed the governing principles underlying the DEAD-box helicase mechanism. However, as an isolated helicase core, eIF4A is rather the exception, not the rule. Most helicase modules in other DEAD-box proteins are modified, some by insertions into the RecA-like domains, and the majority by N- and C-terminal appendages. While the basic catalytic function resides within the helicase core, its modulation by insertions, additional domains or a network of interaction partners generates the diversity of DEAD-box protein functions in the cell. This review summarizes the current knowledge on eIF4A and its regulation, and discusses to what extent eIF4A serves as a model DEAD-box protein.

Slicer function of Drosophila Argonautes and its involvement in RISC formation

PubMed Central

Miyoshi, Keita; Tsukumo, Hiroko; Nagami, Tomoko; Siomi, Haruhiko; Siomi, Mikiko C.

2005-01-01

Argonaute proteins play important yet distinct roles in RNA silencing. Human Argonaute2 (hAgo2) was shown to be responsible for target RNA cleavage (“Slicer”) activity in RNA interference (RNAi), whereas other Argonaute subfamily members do not exhibit the Slicer activity in humans. In Drosophila, AGO2 was shown to possess the Slicer activity. Here we show that AGO1, another member of the Drosophila Argonaute subfamily, immunopurified from Schneider2 (S2) cells associates with microRNA (miRNA) and cleaves target RNA completely complementary to the miRNA. Slicer activity is reconstituted with recombinant full-length AGO1. Thus, in Drosophila, unlike in humans, both AGO1 and AGO2 have Slicer functions. Further, reconstitution of Slicer activity with recombinant PIWI domains of AGO1 and AGO2 demonstrates that other regions in the Argonautes are not strictly necessary for small interfering RNA (siRNA)-binding and cleavage activities. It has been shown that in circumstances with AGO2-lacking, the siRNA duplex is not unwound and consequently an RNA-induced silencing complex (RISC) is not formed. We show that upon addition of an siRNA duplex in S2 lysate, the passenger strand is cleaved in an AGO2-dependent manner, and nuclease-resistant modification of the passenger strand impairs RISC formation. These findings give rise to a new model in which AGO2 is directly involved in RISC formation as “Slicer” of the passenger strand of the siRNA duplex. PMID:16287716

Acid-induced exchange of the imino proton in G.C pairs.

PubMed Central

Nonin, S; Leroy, J L; Gueron, M

1996-01-01

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

Acid-induced exchange of the imino proton in G.C pairs.

PubMed

Nonin, S; Leroy, J L; Gueron, M

1996-02-15

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

Corrosion behavior of 2205 duplex stainless steel.

PubMed

Platt, J A; Guzman, A; Zuccari, A; Thornburg, D W; Rhodes, B F; Oshida, Y; Moore, B K

1997-07-01

The corrosion of 2205 duplex stainless steel was compared with that of AISI type 316L stainless steel. The 2205 stainless steel is a potential orthodontic bracket material with low nickel content (4 to 6 wt%), whereas the 316L stainless steel (nickel content: 10 to 14 wt%) is a currently used bracket material. Both stainless steels were subjected to electrochemical and immersion (crevice) corrosion tests in 37 degrees C, 0.9 wt% sodium chloride solution. Electrochemical testing indicates that 2205 has a longer passivation range than 316L. The corrosion rate of 2205 was 0.416 MPY (milli-inch per year), whereas 316L exhibited 0.647 MPY. When 2205 was coupled to 316L with equal surface area ratio, the corrosion rate of 2205 reduced to 0.260 MPY, indicating that 316L stainless steel behaved like a sacrificial anode. When 316L is coupled with NiTi, TMA, or stainless steel arch wire and was subjected to the immersion corrosion test, it was found that 316L suffered from crevice corrosion. On the other hand, 2205 stainless steel did not show any localized crevice corrosion, although the surface of 2205 was covered with corrosion products, formed when coupled to NiTi and stainless steel wires. This study indicates that considering corrosion resistance, 2205 duplex stainless steel is an improved alternative to 316L for orthodontic bracket fabrication when used in conjunction with titanium, its alloys, or stainless steel arch wires.

The Origins of Microtexture in Duplex Ti Alloys (Preprint)

DTIC Science & Technology

2008-06-01

To) June 2008 Journal Article Preprint 4 . TITLE AND SUBTITLE THE ORIGINS OF MICROTEXTURE IN DUPLEX Ti ALLOYS (PREPRINT) 5a. CONTRACT NUMBER In...house 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 62102F 6 . AUTHOR(S) M.G. Glavic (UES, Inc.) B.B. Bartha (United Technologies Corporation...applicable to duplex alpha/beta titanium microstructures. The crystallographic coherency of the primary and secondary alpha phase with the prior beta

Approximation methods for the stability analysis of complete synchronization on duplex networks

NASA Astrophysics Data System (ADS)

Han, Wenchen; Yang, Junzhong

2018-01-01

Recently, the synchronization on multi-layer networks has drawn a lot of attention. In this work, we study the stability of the complete synchronization on duplex networks. We investigate effects of coupling function on the complete synchronization on duplex networks. We propose two approximation methods to deal with the stability of the complete synchronization on duplex networks. In the first method, we introduce a modified master stability function and, in the second method, we only take into consideration the contributions of a few most unstable transverse modes to the stability of the complete synchronization. We find that both methods work well for predicting the stability of the complete synchronization for small networks. For large networks, the second method still works pretty well.

Features of residual stresses in duplex stainless steel butt welds

NASA Astrophysics Data System (ADS)

Um, Tae-Hwan; Lee, Chin-Hyung; Chang, Kyong-Ho; Nguyen Van Do, Vuong

2018-04-01

Duplex stainless steel finds increasing use as an alternative to austenitic stainless steel, particularly where chloride or sulphide stress corrosion cracking is of primary concern, due to the excellent combination of strength and corrosion resistance. During welding, duplex stainless steel does not create the same magnitude or distribution of weld-induced residual stresses as those in welded austenitic stainless steel due to the different physical and mechanical properties between them. In this work, an experimental study on the residual stresses in butt-welded duplex stainless steel is performed utilizing the layering technique to investigate the characteristics of residual stresses in the weldment. Three-dimensional thermos-mechanical-metallurgical finite element analysis is also performed to confirm the residual stress measurements.

Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

NASA Astrophysics Data System (ADS)

Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

2017-02-01

The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber, to reanneal the reshuffled library. In the binding chamber (the cooled chamber) specific retaining structures are integrated. These hold back beads functionalized with the target protein, while the chamber is continuously flushed with library molecules. Afterwards the whole system can be flushed with buffer to wash out unspecific bound molecules. Finally the protein-loaded beads with attached molecules can be eluted for further investigation.

Clinical utility of carotid duplex ultrasound prior to cardiac surgery.

PubMed

Lin, Judith C; Kabbani, Loay S; Peterson, Edward L; Masabni, Khalil; Morgan, Jeffrey A; Brooks, Sara; Wertella, Kathleen P; Paone, Gaetano

2016-03-01

Clinical utility and cost-effectiveness of carotid duplex examination prior to cardiac surgery have been questioned by the multidisciplinary committee creating the 2012 Appropriate Use Criteria for Peripheral Vascular Laboratory Testing. We report the clinical outcomes and postoperative neurologic symptoms in patients who underwent carotid duplex ultrasound prior to open heart surgery at a tertiary institution. Using the combined databases from our clinical vascular laboratory and the Society of Thoracic Surgery, a retrospective analysis of all patients who underwent carotid duplex ultrasound within 13 months prior to open heart surgery from March 2005 to March 2013 was performed. The outcomes between those who underwent carotid duplex scanning (group A) and those who did not (group B) were compared. Among 3233 patients in the cohort who underwent cardiac surgery, 515 (15.9%) patients underwent a carotid duplex ultrasound preoperatively, and 2718 patients did not (84.1%). Among the patients who underwent carotid screening vs no screening, there was no statistically significant difference in the risk factors of cerebrovascular disease (10.9% vs 12.7%; P = .26), prior stroke (8.2% vs 7.2%; P = .41), and prior transient ischemic attack (2.9% vs 3.3%; P = .24). For those undergoing isolated coronary artery bypass grafting (CABG), 306 (17.8%) of 1723 patients underwent preoperative carotid duplex ultrasound. Among patients who had carotid screening prior to CABG, the incidence of carotid disease was low: 249 (81.4%) had minimal or mild stenosis (<50%); 25 (8.2%) had unilateral moderate stenosis (50%-69%); 10 (3.3%) had bilateral moderate stenosis; 9 (2.9%) had unilateral severe stenosis (70%-99%); 5 (1.6%) had contralateral moderate stenosis; 2 (0.7%) had bilateral severe stenosis; 4 (1.3%) had unilateral occluded with contralateral less than 50% stenosis, 1 (0.3%) had unilateral occluded with contralateral (70%-99%) stenosis; and 1 had bilateral occluded carotid arteries. Primary outcomes of patients who underwent isolated CABG showed no difference in the perioperative mortality (2.9% vs 4.3%; P = .27) and stroke (2.9% vs 2.6%; P = .70) between patients undergoing preoperative duplex scanning and those who did not. Primary outcomes of patients who underwent open heart surgery also showed no difference in the perioperative mortality (5.1% vs 6.9%; P = .14) and stroke (2.6% vs 2.4%; P = .85) between patients undergoing preoperative duplex scanning and those who did not. Operative intervention of severe carotid stenosis prior to isolated CABG occurred in 2 of the 17 patients (11.8%) identified who underwent carotid endarterectomy with CABG. In this study, the correlation between preoperative duplex-documented high-grade carotid stenosis and postoperative stroke was low. Prudent use of preoperative carotid duplex ultrasound should be based on the presence of cerebrovascular symptoms and the type of open heart surgery. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Reducing duplex examinations in patients with iatrogenic pseudoaneurysms.

PubMed

Stone, Patrick A; Aburahma, Ali F; Flaherty, Sarah K

2006-06-01

Ultrasound-guided thrombin injection has become the initial treatment of choice for femoral access-related pseudoaneurysms. Patients typically undergo serial duplex examinations to assess for spontaneous resolution of small iatrogenic pseudoaneurysms (IPSAs) (<2.5 cm), or may require repeated diagnostic, therapeutic, and follow-up studies for larger IPSAs (>2.5 cm). We evaluated the impact of a revised treatment algorithm that includes primary treatment of both small (<2.5 cm) and larger pseudoaneurysms (>2.5 cm), rather than observation of smaller ones, and attempts to establish a single duplex examination via a point-of-care treatment strategy. We reviewed 105 consecutive patients treated with ultrasound-guided thrombin injection from July 2001 through September 2004. Patient, IPSAs, characteristics, and treatment methods were examined. The number of duplex examinations per patient was evaluated over the treatment interval. Also, published cost data were used to compare primary treatment of small ISPAs vs observation with serial duplex examinations. Successful thrombosis occurred in 103 (98.1%) of 105 treated pseudoaneurysms. No minor or major complications occurred after thrombin injection in either small or large ISPAs, and both failures requiring operation were in the large aneurysm group. The recurrence rate for the series was 1.9% (2/105), and both recurrences were successfully treated with an additional thrombin injection. A single injection was successful in treating 43 (97.7%) of 44 small (<2.5 cm) IPSAs, and one required a second injection. Patients had an average of 3.3 duplex examinations in our first year of treatment experience, which declined to 1.5 by our third year with the institution of a point-of-care service model for all pseudoaneurysms. Based on this decreased use of duplex examination and an average treatment cohort of 35 IPSA patients per year our institution, we determined this results in a reduction of 35 hours of laboratory time and nearly 70 ultrasounds per year. Similarly for small pseudoaneurysms, a point-of-service primary treatment program rather than observation results in an estimated cost savings of $12,000, based on treating 15 small IPSAs per year. Ultrasound-guided thrombin injection is safe and effective for the treatment of nearly all iatrogenic pseudoaneurysms. We recommend primary treatment of small pseudoaneurysms by ultrasound-guided thrombin injection rather than observation with serial duplex scans. A point-of-care treatment algorithm can result in cost savings by reducing the number of necessary duplex examinations.

Bilateral Non-arteritic Anterior Ischaemic Optic Neuropathy as the Presentation of Systemic Amyloidosis.

PubMed

Kanaan, M Z; Lorenzi, A R; Thampy, N; Pandit, R; Dayan, Margaret

2017-12-01

A 75-year-old hypertensive female with stable idiopathic intermediate uveitis presented with bilateral sequential optic neuropathy with optic disc swelling. The optic neuropathy in the first affected eye (right) was thought to be due to non-arteritic anterior ischaemic optic neuropathy (NAION). Asymptomatic left optic disc swelling was found at routine review 2 months later, and a diagnosis of giant cell arteritis (GCA) was sought. Temporal artery duplex ultrasound showed the "halo sign," but a subsequent temporal artery biopsy showed light-chain (AL) amyloidosis with no signs of giant cell arteritis. In this case, bilateral sequential ischaemic optic neuropathy mimicking non-arteritic anterior ischaemic optic neuropathy was the presenting sign of systemic amyloidosis involving the temporal arteries.

Insights to primitive replication derived from structures of small oligonucleotides

NASA Technical Reports Server (NTRS)

Smith, G. K.; Fox, G. E.

1995-01-01

Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

Plastomes of the green algae Hydrodictyon reticulatum and Pediastrum duplex (Sphaeropleales, Chlorophyceae).

PubMed

McManus, Hilary A; Sanchez, Daniel J; Karol, Kenneth G

2017-01-01

Comparative studies of chloroplast genomes (plastomes) across the Chlorophyceae are revealing dynamic patterns of size variation, gene content, and genome rearrangements. Phylogenomic analyses are improving resolution of relationships, and uncovering novel lineages as new plastomes continue to be characterized. To gain further insight into the evolution of the chlorophyte plastome and increase the number of representative plastomes for the Sphaeropleales, this study presents two fully sequenced plastomes from the green algal family Hydrodictyaceae (Sphaeropleales, Chlorophyceae), one from Hydrodictyon reticulatum and the other from Pediastrum duplex . Genomic DNA from Hydrodictyon reticulatum and Pediastrum duplex was subjected to Illumina paired-end sequencing and the complete plastomes were assembled for each. Plastome size and gene content were characterized and compared with other plastomes from the Sphaeropleales. Homology searches using BLASTX were used to characterize introns and open reading frames (orfs) ≥ 300 bp. A phylogenetic analysis of gene order across the Sphaeropleales was performed. The plastome of Hydrodictyon reticulatum is 225,641 bp and Pediastrum duplex is 232,554 bp. The plastome structure and gene order of H. reticulatum and P. duplex are more similar to each other than to other members of the Sphaeropleales. Numerous unique open reading frames are found in both plastomes and the plastome of P. duplex contains putative viral protein genes, not found in other Sphaeropleales plastomes. Gene order analyses support the monophyly of the Hydrodictyaceae and their sister relationship to the Neochloridaceae. The complete plastomes of Hydrodictyon reticulatum and Pediastrum duplex , representing the largest of the Sphaeropleales sequenced thus far, once again highlight the variability in size, architecture, gene order and content across the Chlorophyceae. Novel intron insertion sites and unique orfs indicate recent, independent invasions into each plastome, a hypothesis testable with an expanded plastome investigation within the Hydrodictyaceae.

Recent Developments in Assessing Microstructure-Sensitive Early Stage Fatigue of Polycrystals (Postprint)

DTIC Science & Technology

2014-04-01

can strongly affect formation of fatigue cracks. El Bartali et al. [7] quantified plastic strain at the grain scale in a duplex stainless steel and mea... Fatigue Fract Eng Mater Struct 2013. [7] El Bartali A, Aubin V, Degallaix S. Fatigue damage analysis in a duplex stainless steel by digital image...S. Surface observation and measurement techniques to study the fatigue damage micromechanisms in a duplex stainless steel . Int J Fatigue 2009;31:2049

Surgical retroperitoneoscopic and transperitoneoscopic access in varicocelectomy: duplex scan results in pediatric population.

PubMed

Mancini, Stefano; Bulotta, Anna Lavinia; Molinaro, Francesco; Ferrara, Francesco; Tommasino, Giulio; Messina, Mario

2014-12-01

This is a retrospective study to compare duplex scan results of laparoscopic Palomo's technique through retroperitoneal and transperitoneal approach for varicocelectomy in children. We statistically analyzed recurrence, testicular volume growth and complications. Surgical intervention was performed utilizing transperitoneoscopic (group A) or retroperitoneoscopic access (group B). Duplex scan control was performed after 12 months (T1), after 2 years (T2) and the last one at 18 years old in most patients. Statistical analysis was performed using the t-test for parametric data. Differences in proportions were evaluated using χ2 or Fisher's exact test. We treated 120 children (age range 10-17 years) who presented an asymptomatic IV grade of reflux, Coolsaet 1, associated with a left testicular hypotrophy in 36.6% of the cases (44 patients). No post-operative complications were verified. Duplex scan exam showed an increase of left testicular growth in both groups, with complete hypotrophy disappear in patients in both groups after 24 months. Hydrocele, diagnosed clinically and confirmed with duplex scan, was the most frequent post-operative complication (22/120 cases; 18.3%). This study showed the importance of duplex scan at all steps of this vascular pathology in children, and that there is no significantly difference in results between the two surgical techniques except for hydrocele in transperitoneoscopic access. Copyright © 2014 Journal of Pediatric Urology Company. Published by Elsevier Ltd. All rights reserved.

Comparison of the severity of lower extremity arterial disease in smokers and patients with diabetes using a novel duplex Doppler scoring system.

PubMed

Hiremath, Rudresh; Gowda, Goutham; Ibrahim, Jebin; Reddy, Harish T; Chodiboina, Haritha; Shah, Rushit

2017-07-01

The aim of this study was to validate the diagnostic feasibility of a novel scoring system of peripheral arterial disease (PAD) in smokers and patients with diabetes depending on duplex Doppler sonographic features. Patients presenting with the symptomatology of PAD were divided into three groups: diabetes only, smoking only, and smokers with diabetes. The patients were clinically examined, a clinical severity score was obtained, and the subjects were categorized into the three extrapolated categories of mild, moderate, and severe. All 106 subjects also underwent a thorough duplex Doppler examination, and various aspects of PAD were assessed and tabulated. These components were used to create a novel duplex Doppler scoring system. Depending on the scores obtained, each individual was categorized as having mild, moderate, or severe illness. The Cohen kappa value was used to assess interobserver agreement between the two scoring systems. Interobserver agreement between the traditional Rutherford clinical scoring system and the newly invented duplex Doppler scoring system showed a kappa value of 0.83, indicating significant agreement between the two scoring systems (P<0.001). Duplex Doppler imaging is an effective screening investigation for lower extremity arterial disease, as it not only helps in its diagnosis, but also in the staging and grading of the disease, providing information that can be utilized for future management and treatment planning.

Validation of a novel venous duplex ultrasound objective structured assessment of technical skills for the assessment of venous reflux.

PubMed

Jaffer, Usman; Normahani, Pasha; Lackenby, Kimberly; Aslam, Mohammed; Standfield, Nigel J

2015-01-01

Duplex ultrasound measurement of reflux time is central to the diagnosis of venous incompetence. We have developed an assessment tool for Duplex measurement of venous reflux for both simulator and patient-based training. A novel assessment tool, Venous Duplex Ultrasound Assessment of Technical Skills (V-DUOSATS), was developed. A modified DUOSATS was used for simulator training. Participants of varying skill level were invited to viewed an instructional video and were allowed ample time to familiarize with the Duplex equipment. Attempts made by the participants were recorded and independently assessed by 3 expert assessors and 5 novice assessors using the modified V-DUOSATS. "Global" assessment was also done by expert assessors on a 4-point Likert scale. Content, construct, and concurrent validities as well as reliability were evaluated. Content and construct validity as well as reliability were demonstrated. Receiver operator characteristic analysis-established cut points of 19/22 and 21/30 were most appropriate for simulator and patient-based assessment, respectively. We have validated a novel assessment tool for Duplex venous reflux measurement. Further work is required to establish transference validity of simulator training to improve skill in scanning patients. We have developed and validated V-DUOSATS for simulator training. Copyright © 2015 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Transvaginal duplex ultrasonography appears to be the gold standard investigation for the haemodynamic evaluation of pelvic venous reflux in the ovarian and internal iliac veins in women.

PubMed

Whiteley, M S; Dos Santos, S J; Harrison, C C; Holdstock, J M; Lopez, A J

2015-12-01

To assess the suitability of transvaginal duplex ultrasonography to identify pathological reflux in the ovarian and internal iliac veins in women. A retrospective study of patients treated in 2011 and 2012 was performed in a specialised vein clinic. Diagnostic transvaginal duplex ultrasonography in women presenting with symptoms or signs of pelvic vein reflux were compared with the outcomes of treatment from pelvic vein embolisation. A repeat transvaginal duplex ultrasonography was performed 6 weeks later by a blinded observer and any residual reflux was identified. Results from 100 sequential patients were analysed. Mean age 44.2 years (32-69) with mode average parity of 3 (0-5 deliveries). Pre-treatment, 289/400 veins were refluxing (ovarian - 29 right, 81 left; internal iliac - 93 right, 86 left). Coil embolisation was successful in 86/100 patients and failed partially in 14/100 - 5 due to failure to cannulate the target vein. One false-positive diagnosis was made. Currently there is no accepted gold standard for pelvic vein incompetence. Comparing transvaginal duplex ultrasonography with the outcome from selectively treating the veins identified as having pathological reflux with coil embolisation, there were no false-negative diagnoses and only one false-positive. This study suggests that transvaginal duplex ultrasonography could be the gold standard in assessing pelvic vein reflux. © The Author(s) 2014.

[Can TOF MRA replace duplex and Doppler sonography in preoperative assessment of the carotid arteries? A prospective comparison and review of the literature].

PubMed

Krappel, F A; Bauer, E; Harland, U

2002-01-01

To examine the quality and usefulness of time-of-flight MR-angiography and duplex-doppler sonography, respectively, in assessment of the extracranial arteries before cervical spine operations. Patients scheduled for operations of the cervical spine had an MRI plus TOF as well as a duplex and Doppler scan. At the time of the examination the radiologist and the neurologist in charge were blinded for the study. Endpoints were not only the accuracy of the procedures but more so which method improved the preoperative process most. Twenty patients were examined so far. Only in one case did the result differ when a complete occlusion diagnosed sonographically was judged as a severe stenosis on MRA. One patient did not tolerate the MRA for the extra 5 minutes necessary, therefore a contrast-enhanced MRA was performed. MRA eased the preoperative process as imaging of the pathology and the carotids were realised in one step. The costs were slightly higher for MRA than for duplex-doppler sonography. TOF-MRA can replace the duplex-doppler examination in the preoperative assessment of the carotids and has the potential to streamline the preoperative time schedule. Similar to duplex and doppler, in order to be accurate enough the method requires a high degree of expertise from the radiologist.

Microstructure and Antiwear Property of Laser Cladding Ni-Co Duplex Coating on Copper.

PubMed

Wang, Yiyong; Liang, Zhipeng; Zhang, Junwei; Ning, Zhe; Jin, Hui

2016-07-28

Ni-Co duplex coatings were cladded onto Cu to improve the antiwear properties of Cu products. Prior to laser cladding, n-Al₂O₃/Ni layers were introduced as interlayers between laser cladding coatings and Cu substrates to improve the laser absorptivity of these substrates and ensure defect-free laser cladding coatings. The structure and morphology of the coatings were characterized by scanning electron microscopy and optical microscopy, and the phases of the coatings were analyzed by X-ray diffraction. Their hardness was measured using a microhardness tester. Experimental results showed that defect-free composite coatings were obtained and that the coatings were metallurgically bonded to the substrates. The surface of the Ni-Co duplex coatings comprised a Co-based solid solution, Cr₇C₃, (Fe,Ni) 23 C₆, and other strengthening phases. The microhardness and wear resistance of the duplex coatings were significantly improved compared with the Cu substrates. The average microhardness of the cladded coatings was 845.6 HV, which was approximately 8.2 times greater than that of the Cu substrates (102.6 HV). The volume loss of the Cu substrates was approximately 7.5 times greater than that of the Ni-Co duplex coatings after 60 min of sliding wear testing. The high hardness of and lack of defects in the Ni-Co duplex coatings reduced the plastic deformation and adhesive wear of the Cu substrates, resulting in improved wear properties.

Step-by-step mechanism of DNA damage recognition by human 8-oxoguanine DNA glycosylase.

PubMed

Kuznetsova, Alexandra A; Kuznetsov, Nikita A; Ishchenko, Alexander A; Saparbaev, Murat K; Fedorova, Olga S

2014-01-01

Extensive structural studies of human DNA glycosylase hOGG1 have revealed essential conformational changes of the enzyme. However, at present there is little information about the time scale of the rearrangements of the protein structure as well as the dynamic behavior of individual amino acids. Using pre-steady-state kinetic analysis with Trp and 2-aminopurine fluorescence detection the conformational dynamics of hOGG1 wild-type (WT) and mutants Y203W, Y203A, H270W, F45W, F319W and K249Q as well as DNA-substrates was examined. The roles of catalytically important amino acids F45, Y203, K249, H270, and F319 in the hOGG1 enzymatic pathway and their involvement in the step-by-step mechanism of oxidative DNA lesion recognition and catalysis were elucidated. The results show that Tyr-203 participates in the initial steps of the lesion site recognition. The interaction of the His-270 residue with the oxoG base plays a key role in the insertion of the damaged base into the active site. Lys-249 participates not only in the catalytic stages but also in the processes of local duplex distortion and flipping out of the oxoG residue. Non-damaged DNA does not form a stable complex with hOGG1, although a complex with a flipped out guanine base can be formed transiently. The kinetic data obtained in this study significantly improves our understanding of the molecular mechanism of lesion recognition by hOGG1. © 2013.

Quantitative Proteomics Reveals Dynamic Interactions of the Minichromosome Maintenance Complex (MCM) in the Cellular Response to Etoposide Induced DNA Damage.

PubMed

Drissi, Romain; Dubois, Marie-Line; Douziech, Mélanie; Boisvert, François-Michel

2015-07-01

The minichromosome maintenance complex (MCM) proteins are required for processive DNA replication and are a target of S-phase checkpoints. The eukaryotic MCM complex consists of six proteins (MCM2-7) that form a heterohexameric ring with DNA helicase activity, which is loaded on chromatin to form the pre-replication complex. Upon entry in S phase, the helicase is activated and opens the DNA duplex to recruit DNA polymerases at the replication fork. The MCM complex thus plays a crucial role during DNA replication, but recent work suggests that MCM proteins could also be involved in DNA repair. Here, we employed a combination of stable isotope labeling with amino acids in cell culture (SILAC)-based quantitative proteomics with immunoprecipitation of green fluorescent protein-tagged fusion proteins to identify proteins interacting with the MCM complex, and quantify changes in interactions in response to DNA damage. Interestingly, the MCM complex showed very dynamic changes in interaction with proteins such as Importin7, the histone chaperone ASF1, and the Chromodomain helicase DNA binding protein 3 (CHD3) following DNA damage. These changes in interactions were accompanied by an increase in phosphorylation and ubiquitination on specific sites on the MCM proteins and an increase in the co-localization of the MCM complex with γ-H2AX, confirming the recruitment of these proteins to sites of DNA damage. In summary, our data indicate that the MCM proteins is involved in chromatin remodeling in response to DNA damage. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Development and validation of a duplex real-time PCR assay for the simultaneous detection of three mustard species (Sinapis alba, Brassica nigra and Brassica juncea) in food.

PubMed

Palle-Reisch, Monika; Cichna-Markl, Margit; Hochegger, Rupert

2014-06-15

The paper presents a duplex real-time PCR assay for the simultaneous detection of three potentially allergenic mustard species commonly used in food: white mustard (Sinapis alba), black mustard (Brassica nigra) and brown mustard (Brassica juncea). White mustard is detected in the "green" and black/brown mustard in the "yellow" channel. The duplex real-time PCR assay does not show cross-reactivity with other Brassicaceae species including broccoli, cauliflower, radish and rapeseed. Low cross-reactivities (difference in the Ct value ⩾ 11.91 compared with the positive control) were obtained with cumin, fenugreek, ginger, rye and turmeric. When applying 500 ng DNA per PCR tube, the duplex real-time PCR assay allowed the detection of white, black and brown mustard in brewed model sausages down to a concentration of 5mg/kg in 10 out of 10 replicates. The duplex real-time PCR assay was applied to verify correct labelling of commercial foodstuffs. Copyright © 2013 Elsevier Ltd. All rights reserved.

Duplex investigations in children: Are clinical signs in children with venous disorders relevant?

PubMed

Birgitte Maessen-Visch, M; Smeets, L; van Vleuten, C

2015-12-01

Ultra sound colored duplex sonography is the preferred method in diagnosing chronic venous disease. Data in children on incidence, indications, and results are lacking. From the total of 9180 duplex investigations performed in our hospital from 2009 to 2012, data on indication and results of the investigation as well as patient characteristics were evaluated retrospectively for the proportion of pediatric patients. Duplex investigations were performed 49 times in 38 children (6-18 years), with an average of 1.3 times (1-6 times) per child. Forty percent showed abnormalities: 17 times deep venous thrombosis was suspected; deep venous thrombosis was objectified in 18%. In the 21 investigations performed for varicosis-related complaints, varicose veins or venous malformations were objectified in 57%. Edema was never a symptom of chronic venous disease. Duplex investigation is not often performed in children. In children with established deep venous thrombosis, a family history with deep venous thrombosis is common. In general, edema was not seen in children with varicose veins and, therefore, does not seem a reliable clinical sign at young age. © The Author(s) 2014.

Development of internally controlled duplex real-time NASBA diagnostics assays for the detection of microorganisms associated with bacterial meningitis.

PubMed

Clancy, Eoin; Coughlan, Helena; Higgins, Owen; Boo, Teck Wee; Cormican, Martin; Barrett, Louise; Smith, Terry J; Reddington, Kate; Barry, Thomas

2016-08-01

Three duplex molecular beacon based real-time Nucleic Acid Sequence Based Amplification (NASBA) assays have been designed and experimentally validated targeting RNA transcripts for the detection and identification of Haemophilus influenzae, Neisseria meningitidis and Streptococcus pneumoniae respectively. Each real-time NASBA diagnostics assay includes an endogenous non-competitive Internal Amplification Control (IAC) to amplify the splice variant 1 mRNA of the Homo sapiens TBP gene from human total RNA. All three duplex real-time NASBA diagnostics assays were determined to be 100% specific for the target species tested for. Also the Limits of Detection (LODs) for the H. influenzae, N. meningitidis and S. pneumoniae duplex real-time NASBA assays were 55.36, 0.99, and 57.24 Cell Equivalents (CE) respectively. These robust duplex real-time NASBA diagnostics assays have the potential to be used in a clinical setting for the rapid (<60min) specific detection and identification of the most prominent microorganisms associated with bacterial meningitis in humans. Copyright © 2016 Elsevier B.V. All rights reserved.

Duplex System with Ectopic Ureter Opens into the Posterior Urethra: Case Report.

PubMed

Milicevic, Snjezana; Bijelic, Radojka; Krivokuca, Vladimir; Jakovljevic, Branislava

2018-04-01

Duplicated ureter or Duplex Collecting System is a congenital condition in which the ureteric bud, the embryological origin of the ureter, arises twice, resulting in two ureters draining a single kidney. This congenital anomaly is rare, and even rarer when the duplex system with ectopic ureter is present. This type of congenital anomaly is even more rarely diagnosed and surgically treated in adulthood. This case report presents a case of a 32-year-old male, who had a duplex collecting system with two ureters on the left side. Ectopic ureter, draining the upper pole of the left kidney, opened into the posterior urethra. In our patient, taking into account the clinical perspective, the renal tissue damaging of the upper pole which was not functional, partial nephrectomy and ureterectomy was successfully performed.

Direct Determination of the Equilibrium Unbinding Potential Profile for a Short DNA Duplex from Force Spectroscopy Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noy, A

2004-05-04

Modern force microscopy techniques allow researchers to use mechanical forces to probe interactions between biomolecules. However, such measurements often happen in non-equilibrium regime, which precludes straightforward extraction of the equilibrium energy information. Here we use the work averaging method based on Jarzynski equality to reconstruct the equilibrium interaction potential from the unbinding of a complementary 14-mer DNA duplex from the results of non-equilibrium single-molecule measurements. The reconstructed potential reproduces most of the features of the DNA stretching transition, previously observed only in equilibrium stretching of long DNA sequences. We also compare the reconstructed potential with the thermodynamic parameters of DNAmore » duplex unbinding and show that the reconstruction accurately predicts duplex melting enthalpy.« less

2'-modified nucleosides for site-specific labeling of oligonucleotides

NASA Technical Reports Server (NTRS)

Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

2002-01-01

We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

Distributed Topology Organization and Transmission Scheduling in Wireless Ad Hoc Networks

DTIC Science & Technology

2004-01-01

slot consists of two mini -slots that support that support full-duplex transfer–one for master-to-slave transmission and the other from slave-to-master...protocol storage requirement would only be 208 bits in this case. 111 Communication requirements Each half-duplex mini -slot can be used by either a data or...either a data or control packet, eq. (4.2) sets the minimum half-duplex mini -slot size in the system or equivalently, the maximum system period

A Synchronous Digital Duplexing Technique for OFDMA-Based Indoor Communications

NASA Astrophysics Data System (ADS)

Park, Chang-Hwan; Ko, Yo-Han; Kim, Yeong-Jun; Park, Kyung-Won; Jeon, Won-Gi; Paik, Jong-Ho; Lee, Seok-Pil; Cho, Yong-Soo

In this paper, we propose a new digital duplexing scheme, called synchronous digital duplexing (SDD), which can increase data efficiency and flexibility of resource by transmitting uplink signal and downlink signal simultaneously in wireless communication. In order to transmit uplink and downlink signals simultaneously, the proposed SDD obtains mutual information among subscriber stations (SSs) with a mutual ranging symbol. This information is used for selection of transmission time, decision on cyclic suffix (CS) insertion, determination of CS length, and re-establishment of FFT starting point.

Measuring secondary phases in duplex stainless steels

NASA Astrophysics Data System (ADS)

Calliari, I.; Brunelli, K.; Dabalà, M.; Ramous, E.

2009-01-01

The use of duplex stainless steels is limited by their susceptibility to the formation of dangerous intermetallic phases resulting in detrimental effects on impact toughness and corrosion resistance. This precipitation and the quantitative determinations of the phases have received considerable attention and different precipitation sequences (σ phase, χ phase, and carbides) have been suggested. This study investigates the phase transformation during continuous cooling and isothermal treatments in commercial duplex stainless steel grades and the effects on alloy properties, and compares the most common techniques of analysis.

A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

PubMed

Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

2011-06-15

A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

5'-(E)-Vinylphosphonate: A Stable Phosphate Mimic Can Improve the RNAi Activity of siRNA-GalNAc Conjugates.

PubMed

Parmar, Rubina; Willoughby, Jennifer L S; Liu, Jingxuan; Foster, Donald J; Brigham, Benjamin; Theile, Christopher S; Charisse, Klaus; Akinc, Akin; Guidry, Erin; Pei, Yi; Strapps, Walter; Cancilla, Mark; Stanton, Matthew G; Rajeev, Kallanthottathil G; Sepp-Lorenzino, Laura; Manoharan, Muthiah; Meyers, Rachel; Maier, Martin A; Jadhav, Vasant

2016-06-02

Small interfering RNA (siRNA)-mediated silencing requires siRNA loading into the RNA-induced silencing complex (RISC). Presence of 5'-phosphate (5'-P) is reported to be critical for efficient RISC loading of the antisense strand (AS) by anchoring it to the mid-domain of the Argonaute2 (Ago2) protein. Phosphorylation of exogenous duplex siRNAs is thought to be accomplished by cytosolic Clp1 kinase. However, although extensive chemical modifications are essential for siRNA-GalNAc conjugate activity, they can significantly impair Clp1 kinase activity. Here, we further elucidated the effect of 5'-P on the activity of siRNA-GalNAc conjugates. Our results demonstrate that a subset of sequences benefit from the presence of exogenous 5'-P. For those that do, incorporation of 5'-(E)-vinylphosphonate (5'-VP), a metabolically stable phosphate mimic, results in up to 20-fold improved in vitro potency and up to a threefold benefit in in vivo activity by promoting Ago2 loading and enhancing metabolic stability. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

77 FR 53212 - Federal Property Suitable as Facilities To Assist the Homeless

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-31

... Buildings Duplex Cabins Yosemite CA 95389 Landholding Agency: Interior Property Number: 61201230009 Status... details 33 Buildings Duplex Cabins Yosemite CA 95389 Landholding Agency: Interior Property Number...

There is no benefit to universal carotid artery duplex screening before a major cardiac surgical procedure.

PubMed

Adams, Brian C; Clark, Ross M; Paap, Christina; Goff, James M

2014-01-01

Perioperative stroke is a devastating complication after cardiac surgery. In an attempt to minimize this complication, many cardiac surgeons routinely preoperatively order carotid artery duplex scans to assess for significant carotid stenosis. We hypothesize that the routine screening of preoperative cardiac surgery patients with carotid artery duplex scans detects few patients who would benefit from carotid intervention or that a significant carotid stenosis reliably predicts stroke risk after cardiac surgery. A retrospective review identified 1,499 patients who underwent cardiac surgical procedures between July 1999 and September 2010. Data collected included patient demographics, comorbidities, history of previous stroke, preoperative carotid artery duplex scan results, location of postoperative stroke, and details of carotid endarterectomy (CEA) procedures before, in conjunction with, or after cardiac surgery. Statistical methods included univariate analysis and Fisher's exact test. Twenty-six perioperative strokes were identified (1.7%). In the 21 postoperative stroke patients for whom there is complete carotid artery duplex scan data, 3 patients had a hemodynamically significant lesion (>70%) and 1 patient underwent unilateral carotid CEA for bilateral disease. Postoperative strokes occurred in the anterior cerebral circulation (69.2%), posterior cerebral circulation (15.4%), or both (15.4%). Patient comorbidities, preoperative carotid artery duplex scan screening velocities, or types of cardiac surgical procedure were not predictive for stroke. Thirteen patients (0.86%) underwent CEA before, in conjunction with, or after cardiac surgery. Two of these patients had symptomatic disease, 1 of whom underwent CEA before and the other after his cardiac surgery. Of the 11 asymptomatic patients, 2 underwent CEA before, 3 concurrently, and 6 after cardiac surgery. Left main disease (≥50% stenosis), previous stroke, and peripheral vascular disease were found to be statistically significant predictors of carotid revascularization. A cost analysis of universal screening resulted in an estimated net cost of $378,918 during the study period. The majority of postoperative strokes after cardiac surgery are not related to extracranial carotid artery disease and they are not predicted by preoperative carotid artery duplex scan screening. Consequently, universal carotid artery duplex scan screening cannot be recommended and a selective approach should be adopted. Published by Elsevier Inc.

Formation of an active thrust triangle zone associated with structural inversion in a subduction setting, eastern New Zealand

NASA Astrophysics Data System (ADS)

Barnes, Philip M.; Nicol, Andrew

2004-02-01

We analyze a thrust triangle zone, which underlies the continental shelf of Hawke Bay, eastern New Zealand, within the Hikurangi subduction margin. This triangle zone differs from many other examples in that it is active, 90 km from the leading edge of the overriding plate, and formed due to polyphase deformation involving opposed dipping thrust duplex and backthrust, with the later structure forming in response to inversion of an extensional graben. The component structures of the zone mainly developed sequentially rather than synchronously. High-quality marine seismic reflection lines, tied to well and seabed samples, reveal the three-dimensional structure of the zone, together with its 25 Myr evolution and late Quaternary activity. The triangle zone occurs in the lateral overlap between a stack of NW dipping blind thrusts, and a principal backthrust, the Kidnappers fault. The NW dipping thrusts initiated in the early-middle Miocene during the early stages of subduction, with subsequent thrust duplex formation producing major uplift and erosion in the late Miocene-early Pliocene. The active backthrust formed during the late Miocene to early Pliocene as a thin-skinned listric extensional fault confined to the cover sequence. Structural inversion of the extensional fault commenced in the early-middle Pliocene, produced the backthrust and marks the formation of the thrust triangle zone. The thrust duplex and backthrust accrued strain following inversion; however, the later structure accommodated most of the surface deformation in the Quaternary. Section balancing of the triangle zone together with a detailed analysis of reverse displacements along the backthrust reveal spatial and temporal variations of strain accumulation on the two principal components of the zone. Although the formation of the triangle zone is strongly influenced by regional tectonics of the subduction system, these variations may also, in part, reflect local fault interaction. For example, high Quaternary displacement rates on the backthrust accounts for ˜70% of the displacement loss that occurs on the southern segments of the overlapping, Lachlan fault. Understanding the tectonic evolution of such complex, polyphase thrust triangle zones requires the preservation of growth strata that record sequential deformation history. In the absence of such data, synchroneity of opposed dipping thrusts in triangle zones cannot be assumed.

Low cost high temperature, duplex coating for superalloys

NASA Technical Reports Server (NTRS)

Young, S. G.; Deadmore, D. L.

1981-01-01

Duplex silicon-slurry/aluminide coating substantially improves high temperature resistance to oxidation and corrosion of nickel base alloys. Coating used in critical sections of power systems like turbojet engines extends their operating capabilities.

Development of a One-Step Duplex RT-PCR Method for the Simultaneous Detection of VP3/VP1 and VP1/P2B Regions of the Hepatitis A Virus.

PubMed

Kim, Mi-Ju; Lee, Shin-Young; Kim, Hyun-Joong; Lee, Jeong Su; Joo, In Sun; Kwak, Hyo Sun; Kim, Hae-Yeong

2016-08-28

The simultaneous detection and accurate identification of hepatitis A virus (HAV) is critical in food safety and epidemiological studies to prevent the spread of HAV outbreaks. Towards this goal, a one-step duplex reverse-transcription (RT)-PCR method was developed targeting the VP1/P2B and VP3/VP1 regions of the HAV genome for the qualitative detection of HAV. An HAV RT-qPCR standard curve was produced for the quantification of HAV RNA. The detection limit of the duplex RT-PCR method was 2.8 × 10(1) copies of HAV. The PCR products enabled HAV genotyping analysis through DNA sequencing, which can be applied for epidemiological investigations. The ability of this duplex RT-PCR method to detect HAV was evaluated with HAV-spiked samples of fresh lettuce, frozen strawberries, and oysters. The limit of detection of the one-step duplex RT-PCR for each food model was 9.4 × 10(2) copies/20 g fresh lettuce, 9.7 × 10(3) copies/20 g frozen strawberries, and 4.1 × 10(3) copies/1.5 g oysters. Use of a one-step duplex RT-PCR method has advantages such as shorter time, decreased cost, and decreased labor owing to the single amplification reaction instead of four amplifications necessary for nested RT-PCR.

Microstructure and Antiwear Property of Laser Cladding Ni–Co Duplex Coating on Copper

PubMed Central

Wang, Yiyong; Liang, Zhipeng; Zhang, Junwei; Ning, Zhe; Jin, Hui

2016-01-01

Ni–Co duplex coatings were cladded onto Cu to improve the antiwear properties of Cu products. Prior to laser cladding, n-Al2O3/Ni layers were introduced as interlayers between laser cladding coatings and Cu substrates to improve the laser absorptivity of these substrates and ensure defect-free laser cladding coatings. The structure and morphology of the coatings were characterized by scanning electron microscopy and optical microscopy, and the phases of the coatings were analyzed by X-ray diffraction. Their hardness was measured using a microhardness tester. Experimental results showed that defect-free composite coatings were obtained and that the coatings were metallurgically bonded to the substrates. The surface of the Ni–Co duplex coatings comprised a Co-based solid solution, Cr7C3, (Fe,Ni)23C6, and other strengthening phases. The microhardness and wear resistance of the duplex coatings were significantly improved compared with the Cu substrates. The average microhardness of the cladded coatings was 845.6 HV, which was approximately 8.2 times greater than that of the Cu substrates (102.6 HV). The volume loss of the Cu substrates was approximately 7.5 times greater than that of the Ni–Co duplex coatings after 60 min of sliding wear testing. The high hardness of and lack of defects in the Ni–Co duplex coatings reduced the plastic deformation and adhesive wear of the Cu substrates, resulting in improved wear properties. PMID:28773755

Gadolinium-enhanced versus time-of-flight magnetic resonance angiography: what is the benefit of contrast enhancement in evaluating carotid stenosis?

PubMed

Muhs, Bart E; Gagne, Paul; Wagener, Jael; Baker, Jessica; Ortega, Marta Ramirez; Adelman, Mark A; Cayne, Neal S; Rockman, Caron B; Maldonado, Thomas

2005-11-01

Accurate patient selection based on preoperative imaging is imperative to good risk reduction in patients undergoing carotid endarterectomy (CEA). The goal of this study was to assess the accuracy of gadolinium-enhanced magnetic resonance angiography (GE MRA) versus time-of-flight (TOF) MRA in the work-up of patients undergoing CEA. Patients undergoing CEA between 1999 and 2001 were identified from a prospectively maintained institutional database. GE or TOF MRA was obtained on extracranial carotid arteries (n = 319) in patients undergoing CEA. Stenosis on MRA images was graded as moderate (n = 76) or severe (n = 243) by an attending radiologist who was blind to duplex results. Duplex imaging was performed in an Intersocietal Commission for the Accreditation of Vascular Labs (ICAVL) accredited lab, and stenosis was stratified as moderate (50-79%, n = 76) or high (80-99%, n = 243) grade using University of Washington criteria. For each patient, the degree of stenosis as determined by MRA (GE versus TOF) was compared to percent stenosis on duplex. For moderate-grade lesions, GE MRA concurred with duplex in 11.1% (4/36), underestimated in 2.8% (1/36), and overestimated in 86.1% (31/36) of carotid arteries imaged. TOF MRA concurred with duplex in 35% (14/40), underestimated in 0% (0/40), and overestimated in 65% (26/40) of carotid arteries. High-grade lesions demonstrated improved concordance between MRA and duplex. For these lesions, GE MRA concurred with duplex in 95.6% (130/136) of carotid arteries imaged, never overestimated stenosis (0/136), and underestimated in 4.4% (6/136). TOF MRA concurred with duplex 96.3% (103/107), overestimated stenosis as an occlusion in 0.9% (1/107), and underestimated in 2.8% (3/107). In addition to neck visualization, the GE technique allowed simultaneous aortic arch imaging. This was accomplished in 79.1% (136/172) of all GE MRAs. Simultaneous aortic arch imaging was not technically feasible with TOF MRA. For moderate-grade lesions, both MR techniques are inaccurate predictors of degree of carotid stenosis and result in a significant overestimation of stenosis. Each technique demonstrates improved concordance with duplex ultrasound in the setting of severe carotid artery stenoses. The ability of GE MRA to simultaneously image the aortic arch and the neck may allow for detection of occult tandem lesions and other anatomic variations, which may be particularly important in preoperative planning for carotid artery stenting.

Silver nanoparticles-enhanced time-resolved fluorescence sensor for VEGF(165) based on Mn-doped ZnS quantum dots.

PubMed

Zhu, Dong; Li, Wei; Wen, Hong-Mei; Yu, Sheng; Miao, Zhao-Yi; Kang, An; Zhang, Aihua

2015-12-15

A silver nanoparticles (AgNPs)-enhanced time-resolved fluorescence (TR-FL) sensor based on long-lived fluorescent Mn-doped ZnS quantum dots (QDs) is developed for the sensitive detection of vascular endothelial growth factor-165 (VEGF165), a predominant cancer biomarker in cancer angiogenesis. The aptamers bond with the Mn-doped ZnS QDs and the BHQ-2 quencher-labelling strands hybridized in duplex are coupled with streptavidin (SA)-functionalized AgNPs to form the AgNPs-enhanced TR-FL sensor, showing lower fluorescence intensity in the duplex state due to the fluorescence resonance energy transfer (FRET) between the Mn-doped ZnS QDs and quenchers. Upon the addition of VEGF165, the BHQ-2 quencher-labelling strands of the duplex are displaced, leading to the disruption of the FRET. As a result, the fluorescence of the Mn-doped QDs within the proximity of the AgNPs is recovered. The FL signal can be measured free of the interference of short-lived background by setting appropriate delay time and gate time, which offers a signal with high signal-to-noise ratio in photoluminescent biodetection. Compared with the bare TR-FL sensor, the AgNPs-based TR-FL sensor showed a huge improvement in fluorescence based on metal-enhanced fluorescence (MEF) effect, and the sensitivity increased 11-fold with the detection limit of 0.08 nM. In addition, the sensor provided a wide range of linear detection from 0.1 nM to 16 nM. Copyright © 2015 Elsevier B.V. All rights reserved.

Right-handed double-helix ultrashort DNA yields chiral nematic phases with both right- and left-handed director twist

PubMed Central

Zanchetta, Giuliano; Giavazzi, Fabio; Nakata, Michi; Buscaglia, Marco; Cerbino, Roberto; Clark, Noel A.; Bellini, Tommaso

2010-01-01

Concentrated solutions of duplex-forming DNA oligomers organize into various mesophases among which is the nematic (N∗), which exhibits a macroscopic chiral helical precession of molecular orientation because of the chirality of the DNA molecule. Using a quantitative analysis of the transmission spectra in polarized optical microscopy, we have determined the handedness and pitch of this chiral nematic helix for a large number of sequences ranging from 8 to 20 bases. The B-DNA molecule exhibits a right-handed molecular double-helix structure that, for long molecules, always yields N∗ phases with left-handed pitch in the μm range. We report here that ultrashort oligomeric duplexes show an extremely diverse behavior, with both left- and right-handed N∗ helices and pitches ranging from macroscopic down to 0.3 μm. The behavior depends on the length and the sequence of the oligomers, and on the nature of the end-to-end interactions between helices. In particular, the N∗ handedness strongly correlates with the oligomer length and concentration. Right-handed phases are found only for oligomers shorter than 14 base pairs, and for the sequences having the transition to the N∗ phase at concentration larger than 620 mg/mL. Our findings indicate that in short DNA, the intermolecular double-helical interactions switch the preferred liquid crystal handedness when the columns of stacked duplexes are forced at high concentrations to separations comparable to the DNA double-helix pitch, a regime still to be theoretically described. PMID:20876125

Structure of L-A Virus: A Specialized Compartment for the Transcription and Replication of Double-stranded RNA

PubMed Central

Castón, José R.; Trus, Benes L.; Booy, Frank P.; Wickner, Reed B.; Wall, Joseph S.; Steven, Alasdair C.

1997-01-01

The genomes of double-stranded (ds)RNA viruses are never exposed to the cytoplasm but are confined to and replicated from a specialized protein-bound compartment—the viral capsid. We have used cryoelectron microscopy and three-dimensional image reconstruction to study this compartment in the case of L-A, a yeast virus whose capsid consists of 60 asymmetric dimers of Gag protein (76 kD). At 16-Å resolution, we distinguish multiple domains in the elongated Gag subunits, whose nonequivalent packing is reflected in subtly different morphologies of the two protomers. Small holes, 10–15 Å across, perforate the capsid wall, which functions as a molecular sieve, allowing the exit of transcripts and the influx of metabolites, while retaining dsRNA and excluding degradative enzymes. Scanning transmission electron microscope measurements of mass-per-unit length suggest that L-A RNA is an A-form duplex, and that RNA filaments emanating from disrupted virions often consist of two or more closely associated duplexes. Nuclease protection experiments confirm that the genome is entirely sequestered inside full capsids, but it is packed relatively loosely; in L-A, the center-to-center spacing between duplexes is 40–45 Å, compared with 25–30 Å in other double-stranded viruses. The looser packing of L-A RNA allows for maneuverability in the crowded capsid interior, in which the genome (in both replication and transcription) must be translocated sequentially past the polymerase immobilized on the inner capsid wall. PMID:9281577

Formation of Nitrogen Bubbles During Solidification of Duplex Stainless Steels

NASA Astrophysics Data System (ADS)

Dai, Kaiju; Wang, Bo; Xue, Fei; Liu, Shanshan; Huang, Junkai; Zhang, Jieyu

2018-04-01

The nucleation and growth of nitrogen bubbles for duplex stainless steels are of great significance for the formation mechanism of bubbles during solidification. In the current study, numerical method and theoretical analysis of formula derivation were used to study the formation of nitrogen bubbles during solidification. The critical sizes of the bubble for homogeneous nucleation and heterogeneous nucleation at the solid-liquid interface during solidification were derived theoretically by the classical nucleation theory. The results show that the calculated values for the solubility of nitrogen in duplex stainless steel are in good agreement with the experimental values which are quoted by references: for example, when the temperature T = 1823 K and the nitrogen partial pressure P_{{N2 }} = 40P^{Θ} , the calculated value (0.8042 wt pct) for the solubility of Fe-12Cr alloy nitrogen in molten steel is close to the experimental value (0.780 wt pct). Moreover, the critical radii for homogeneous nucleation and heterogeneous nucleation are identical during solidification. On the one hand, with the increasing temperature or the melt depth, the critical nucleation radius of bubbles at the solid-liquid interface increases, but the bubble growth rate decreases. On the other hand, with the decreasing initial content of nitrogen or the cooling rate, the critical nucleation radius of bubbles at the solid-liquid interface increases, but the bubble growth rate decreases. Furthermore, when the melt depth is greater than the critical depth, which is determined by the technological conditions, the change in the Gibbs free energy for the nucleation is not conducive enough to form new bubbles.