Science.gov

Sample records for formation fortescue group

  1. Constraining Rates of Neoarchean Plate Motion through Magnetostratigraphy and Integrated High-Precision Geochronology of the Fortescue Group, Pilbara, Western Australia

    NASA Astrophysics Data System (ADS)

    Kasbohm, J.; Maloof, A. C.; Schoene, B.; Weiss, B. P.

    2015-12-01

    Plate tectonics influences the global climate and carbon cycle. Continental arrangement affects Earth's albedo, and rates of plate motion control heat flux from the interior and rate of volcanic degassing. While rates of Phanerozoic plate movements and magnetic field reversals have been well studied, little is known about these phenomena in Earth's early tectonic history due to a paucity of unaltered Archean rocks retaining primary magnetization. Archean tectonics and an active geodynamo would have played an important role in creating environments suitable for life. A magnetostratigraphic study integrated with high-precision geochronology has the potential to quantify plate velocities and magnetic field reversal rates. The 2.7 Ga Fortescue Group on the Pilbara craton in Western Australia is one of the oldest and best-preserved basalt successions. The Fortescue records two intervals of potentially rapid cratonic motion, but velocity estimates ranging from 4-50 cm/yr suffer from current ages' analytical errors on the order of a few Ma. We measured five stratigraphic sections across these intervals, and collected paleomagnetic and geochronology samples at known stratigraphic heights. With our calculated virtual geomagnetic poles and U-Pb CA-ID-TIMS zircon ages with precision and accuracy of <1 Ma, we can more precisely quantify the velocity of the Pilbara craton as it underwent a ~10,000 km displacement during the eruptive history of the group's lowest stratigraphic unit, the Mount Roe Basalt, and a more modest displacement of ~2000 km during the deposition of the Tumbiana Formation and Maddina Basalt. We also observe and constrain the age of a previously undescribed magnetic field reversal in the Tumbiana Formation, doubling the described magnetic field reversal rate to four reversals over the 60 Ma depositional history of the Fortescue. Our calculated plate velocities will enlighten the debate on the role of tectonics in the cooling of early Earth.

  2. REE chemistry and Sm-Nd systematics of late Archean weathering profiles in the Fortescue Group, Western Australia

    NASA Technical Reports Server (NTRS)

    MacFarlane, A. W.; Danielson, A.; Holland, H. D.; Jacobsen, S. B.

    1994-01-01

    Two weathering profiles, each consisting of an upper, sericite-rich zone and a lower, chlorite-rich zone, are preserved between flows of the Mt. Roe Basalt in the Fortescue Group, Hamersley Basin, Western Australia. REE concentrations in samples from these two profiles, which originally developed ca 2,760 Ma, show large variations depending on stratigraphic position. LREE abundances and (La/Yb)N are greatest at depths of 3-6 m below the paleosurface of the Mt. Roe #1 profile and are somewhat lower in samples above this level. The LREEs reach concentrations 6-9 times greater than in the underlying basalt, and thus appear to have been mobilized downward in the paleosol and concentrated in its middle part. LREE concentrations in the #2 profile show a similar distribution but with a sharp increase in all REE concentrations within 50 cm of the paleosurface. The distinction between the REE profiles in the two paleosols may be related to the difference in the overlying material. The #1 paleosol is overlain by a few meters of sediments and then by basalt, whereas the #2 paleosol is directly overlain by basalt. The LREEs appear to have been mobilized both during chemical weathering of the parental basalt and during later lower-greenschist-facies metamorphism and metasomatism of the paleosols. Remobilization of the REEs during the regional metamorphism of the Fortescue Group is confirmed by a whole-rock Sm-Nd reference isochron of Mt. Roe #1 samples with an age of 2,151 +/- 360 Ma. Variable initial 143Nd/144Nd values of unweathered basalt samples which may represent the paleosol protolith prevents a confident determination of the magnitude of LREE mobility. Both the initial mobilization of the REEs during weathering and the metasomatic remobilization appear to have taken place under redox conditions where Ce was present dominantly as Ce3+, because Ce anomalies are not developed within the sericite zone samples regardless of concentration. Europium anomalies in the

  3. REE chemistry and Sm-Nd systematics of late Archean weathering profiles in the Fortescue Group, Western Australia.

    PubMed

    MacFarlane, A W; Danielson, A; Holland, H D; Jacobsen, S B

    1994-04-01

    Two weathering profiles, each consisting of an upper, sericite-rich zone and a lower, chlorite-rich zone, are preserved between flows of the Mt. Roe Basalt in the Fortescue Group, Hamersley Basin, Western Australia. REE concentrations in samples from these two profiles, which originally developed ca 2,760 Ma, show large variations depending on stratigraphic position. LREE abundances and (La/Yb)N are greatest at depths of 3-6 m below the paleosurface of the Mt. Roe #1 profile and are somewhat lower in samples above this level. The LREEs reach concentrations 6-9 times greater than in the underlying basalt, and thus appear to have been mobilized downward in the paleosol and concentrated in its middle part. LREE concentrations in the #2 profile show a similar distribution but with a sharp increase in all REE concentrations within 50 cm of the paleosurface. The distinction between the REE profiles in the two paleosols may be related to the difference in the overlying material. The #1 paleosol is overlain by a few meters of sediments and then by basalt, whereas the #2 paleosol is directly overlain by basalt. The LREEs appear to have been mobilized both during chemical weathering of the parental basalt and during later lower-greenschist-facies metamorphism and metasomatism of the paleosols. Remobilization of the REEs during the regional metamorphism of the Fortescue Group is confirmed by a whole-rock Sm-Nd reference isochron of Mt. Roe #1 samples with an age of 2,151 +/- 360 Ma. Variable initial 143Nd/144Nd values of unweathered basalt samples which may represent the paleosol protolith prevents a confident determination of the magnitude of LREE mobility. Both the initial mobilization of the REEs during weathering and the metasomatic remobilization appear to have taken place under redox conditions where Ce was present dominantly as Ce3+, because Ce anomalies are not developed within the sericite zone samples regardless of concentration. Europium anomalies in the

  4. REE chemistry and Sm-Nd systematics of late Archean weathering profiles in the Fortescue Group, Western Australia

    NASA Technical Reports Server (NTRS)

    MacFarlane, A. W.; Danielson, A.; Holland, H. D.; Jacobsen, S. B.

    1994-01-01

    Two weathering profiles, each consisting of an upper, sericite-rich zone and a lower, chlorite-rich zone, are preserved between flows of the Mt. Roe Basalt in the Fortescue Group, Hamersley Basin, Western Australia. REE concentrations in samples from these two profiles, which originally developed ca 2,760 Ma, show large variations depending on stratigraphic position. LREE abundances and (La/Yb)N are greatest at depths of 3-6 m below the paleosurface of the Mt. Roe #1 profile and are somewhat lower in samples above this level. The LREEs reach concentrations 6-9 times greater than in the underlying basalt, and thus appear to have been mobilized downward in the paleosol and concentrated in its middle part. LREE concentrations in the #2 profile show a similar distribution but with a sharp increase in all REE concentrations within 50 cm of the paleosurface. The distinction between the REE profiles in the two paleosols may be related to the difference in the overlying material. The #1 paleosol is overlain by a few meters of sediments and then by basalt, whereas the #2 paleosol is directly overlain by basalt. The LREEs appear to have been mobilized both during chemical weathering of the parental basalt and during later lower-greenschist-facies metamorphism and metasomatism of the paleosols. Remobilization of the REEs during the regional metamorphism of the Fortescue Group is confirmed by a whole-rock Sm-Nd reference isochron of Mt. Roe #1 samples with an age of 2,151 +/- 360 Ma. Variable initial 143Nd/144Nd values of unweathered basalt samples which may represent the paleosol protolith prevents a confident determination of the magnitude of LREE mobility. Both the initial mobilization of the REEs during weathering and the metasomatic remobilization appear to have taken place under redox conditions where Ce was present dominantly as Ce3+, because Ce anomalies are not developed within the sericite zone samples regardless of concentration. Europium anomalies in the

  5. Hydrocarbons preserved in a ~2.7 Ga outcrop sample from the Fortescue Group, Pilbara Craton, Western Australia.

    PubMed

    Hoshino, Y; Flannery, D T; Walter, M R; George, S C

    2015-03-01

    The hydrocarbons preserved in an Archean rock were extracted, and their composition and distribution in consecutive slices from the outside to the inside of the rock were examined. The 2.7 Ga rock was collected from the Fortescue Group in the Pilbara region, Western Australia. The bitumen I (solvent-extracted rock) and bitumen II (solvent-extracted hydrochloric acid-treated rock) fractions have different hydrocarbon compositions. Bitumen I contains only trace amounts of aliphatic hydrocarbons and virtually no aromatic hydrocarbons. In contrast, bitumen II contains abundant aliphatic and aromatic hydrocarbons. The difference seems to reflect the weathering history and preservational environment of the investigated rock. Aliphatic hydrocarbons in bitumen I are considered to be mainly from later hydrocarbon inputs, after initial deposition and burial, and are therefore not indigenous. The lack of aromatic hydrocarbons in bitumen I suggests a severe weathering environment since uplift and exposure of the rock at the Earth's surface in the Cenozoic. On the other hand, the high abundance of aromatic hydrocarbons in bitumen II suggests that bitumen II hydrocarbons have been physically isolated from removal by their encapsulation within carbonate minerals. The richness of aromatic hydrocarbons and the relative scarcity of aliphatic hydrocarbons may reflect the original compositions of organic materials biosynthesised in ancient organisms in the Archean era, or the high thermal maturity of the rock. Cyanobacterial biomarkers were observed in the surficial slices of the rock, which may indicate that endolithic cyanobacteria inhabited the surface outcrop. The distribution of aliphatic and aromatic hydrocarbons implies a high thermal maturity, which is consistent with the lack of any specific biomarkers, such as hopanes and steranes, and the prehnite-pumpellyite facies metamorphic grade. © 2014 John Wiley & Sons Ltd.

  6. Modern Subsurface Bacteria in Pristine 2.7 Ga-Old Fossil Stromatolite Drillcore Samples from the Fortescue Group, Western Australia

    PubMed Central

    Gérard, Emmanuelle; Moreira, David; Philippot, Pascal; Van Kranendonk, Martin J.; López-García, Purificación

    2009-01-01

    Background Several abiotic processes leading to the formation of life-like signatures or later contamination with actual biogenic traces can blur the interpretation of the earliest fossil record. In recent years, a large body of evidence showing the occurrence of diverse and active microbial communities in the terrestrial subsurface has accumulated. Considering the time elapsed since Archaean sedimentation, the contribution of subsurface microbial communities postdating the rock formation to the fossil biomarker pool and other biogenic remains in Archaean rocks may be far from negligible. Methodology/Principal Findings In order to evaluate the degree of potential contamination of Archean rocks by modern microorganisms, we looked for the presence of living indigenous bacteria in fresh diamond drillcores through 2,724 Myr-old stromatolites (Tumbiana Formation, Fortescue Group, Western Australia) using molecular methods based on the amplification of small subunit ribosomal RNA genes (SSU rDNAs). We analyzed drillcore samples from 4.3 m and 66.2 m depth, showing signs of meteoritic alteration, and also from deeper “fresh” samples showing no apparent evidence for late stage alteration (68 m, 78.8 m, and 99.3 m). We also analyzed control samples from drilling and sawing fluids and a series of laboratory controls to establish a list of potential contaminants introduced during sample manipulation and PCR experiments. We identified in this way the presence of indigenous bacteria belonging to Firmicutes, Actinobacteria, and Alpha-, Beta-, and Gammaproteobacteria in aseptically-sawed inner parts of drillcores down to at least 78.8 m depth. Conclusions/Significance The presence of modern bacterial communities in subsurface fossil stromatolite layers opens the possibility that a continuous microbial colonization had existed in the past and contributed to the accumulation of biogenic traces over geological timescales. This finding casts shadow on bulk analyses of early life

  7. Group Formation in Economics

    NASA Astrophysics Data System (ADS)

    Demange, Gabrielle; Wooders, Myrna

    2005-01-01

    Broad and diverse ranges of activities are conducted within and by organized groups of individuals, including political, economic and social activities. These activities have recently become a subject of intense interest in economics and game theory. Some of the topics investigated in this collection are models of networks of power and privilege, trade networks, co-authorship networks, buyer-seller networks with differentiated products, and networks of medical innovation and the adaptation of new information. Other topics are social norms on punctuality, clubs and the provision of club goods and public goods, research and development and collusive alliances among corporations, and international alliances and trading agreements. While relatively recent, the literature on game theoretic studies of group formation in economics is already vast. This volume provides an introduction to this important literature on game-theoretic treatments of situations with networks, clubs, and coalitions, including some applications.

  8. A Fossil Group in Formation

    NASA Astrophysics Data System (ADS)

    Miller, Eric D.; Rappaport, Saul A.; McDonald, Michael; Bautz, Mark W.; Grant, Catherine E.; Veilleux, Sylvain

    2016-04-01

    In the current picture of hierarchical structure formation, galaxy groups play a vital role as the seeds from which large assemblies of matter form. Compact groups are also important environments in which to watch the fueling of star formation and AGN activity, as the conditions are ideal for galaxy-galaxy interactions. We have identified a galaxy system that may represent an intermediate or transition stage in group evolution. Shakhbazyan 1 (or SHK 1) is a remarkably compact collection of about ten massive, red-sequence galaxies within a region 100 kpc across. Several of these galaxies show signs of AGN activity, and new, deep optical observations with the Discovery Channel Telescope reveal an extended stellar envelope surrounding the galaxies. This envelope is much more extended than what would be expected from a superposition of normal galaxy envelopes, and it indicates a large amount of intra-group starlight, evidence that the galaxies in SHK 1 are dynamically interacting.We here present new Chandra spectral imaging observations of this unusual system that confirm the presence of an X-ray-emitting diffuse intra-group medium (IGM), with a temperature of 1.5 keV and X-ray luminosity of 1043 erg/s. Assuming hydrostatic equilibrium, the system is about 1/3 as massive as expected from the optical richness. In addition, three of the ten central galaxies exhibit signatures of X-ray AGN. The under-luminous IGM, high density of bright galaxies, and evidence for galaxy-galaxy interaction indicate that this system may be in a transition stage of galaxy merging, similar to that expected in the formation of a fossil group. Alternatively, SHK 1 may consist of multiple poor groups in the final stages of merging along our line of sight. We explore these scenarios and outline paths of future study for this enigmatic system.

  9. Group formation through indirect reciprocity

    NASA Astrophysics Data System (ADS)

    Oishi, Koji; Shimada, Takashi; Ito, Nobuyasu

    2013-03-01

    The emergence of group structure of cooperative relations is studied in an agent-based model. It is proved that specific types of reciprocity norms lead individuals to split into two groups only inside of which they are cooperative. The condition for the evolutionary stability of the norms is also obtained. This result suggests reciprocity norms, which usually promote cooperation, can cause society's separation into multiple groups.

  10. Star Formation in Compact Groups of Galaxies

    NASA Astrophysics Data System (ADS)

    Paramo, Jorge

    We propose to obtain NUV and FUV images of a sample of nearby compact groups and their neighborhoods with the GALEX imaging facility. The main goals for this proposal are: (1) explore whether a relationship between the total star formation rates and the evolutionary state of the group holds, and also to explore the existence of interaction induced nuclear starburst activity in compact group galaxies; (2) study the super star clusters content of the systems in our sample and the relationship to the group properties; (3) search for extended star forming regions in the intragroup medium and (4) perform a morphological multiwavelength study of the sample galaxies in order to quantitatively describe the induced star formation activity with morphological criteria. A sample of field galaxies (already available) will be used to investigate the role of the compact group environment on the UV properties of our sample of compact group galaxies.

  11. Spontaneous Group Formation in the Seceder Model

    NASA Astrophysics Data System (ADS)

    Dittrich, Peter; Liljeros, Fredrik; Soulier, Arne; Banzhaf, Wolfgang

    2000-04-01

    The seceder model shows how the local tendency to be different gives rise to the formation of groups. The model consists of a population of simple entities which reproduce and die. In a single reproduction event three individuals are chosen randomly and the individual which possesses the largest distance to their center is reproduced by creating a mutated offspring. The offspring replaces a randomly chosen individual of the population. The paper demonstrates the complex group formation behavior and its dependency on the population size.

  12. Group formation and ideology. Text and context.

    PubMed

    Hernandez, M

    1988-01-01

    The relationship between the phenomenon of 'mass formation' (Massenbildung) and the production and circulation of ideologies is examined. The explanation of the said relationship must take into account both the social dimension as well as the intrapsychic structure of the ideological. To achieve this a brief review of Freud's ideas on group psychology and of some definitions of ideology, namely those proposed by Ricoeur, Althusser and Habermas is expounded. In the same way as the understanding of the vicissitudes of identification is crucial to gain insight into 'mass formation', the investigation of the processes of idealization is vital to the understanding of the ideological.

  13. Learning Group Formation Based on Learner Profile and Context

    ERIC Educational Resources Information Center

    Muehlenbrock, Martin

    2006-01-01

    An important but often neglected aspect in Computer-Supported Collaborative Learning (CSCL) is the formation of learning groups. Until recently, most support for group formation was based on learner profile information. In addition, the perspective of ubiquitous computing and ambient intelligence allows for a wider perspective on group formation,…

  14. Managed Group Formation: An Approach to Team Formation in Policy Courses.

    ERIC Educational Resources Information Center

    Nelson, Reed E.; And Others

    1994-01-01

    Managed group formation uses student personal value data and sociometric nomination to optimize the influence of work group formation on student learning. Resulting work group formations are used to enhance the effectiveness of traditional course content and to increase students' sensitization to important group process issues in business policy.…

  15. Group-Level Formative Feedback and Metadiscourse

    ERIC Educational Resources Information Center

    Resendes, Monica; Scardamalia, Marlene; Bereiter, Carl; Chen, Bodong; Halewood, Cindy

    2015-01-01

    This research explores the ability of grade 2 students to engage in productive discussion about the state of their knowledge building using group-level feedback tools to support their metadiscourse. Two aspects of knowledge work were common to the comparison and experimental classes: "Knowledge Building talk" (KB talk) involving…

  16. Endogenous Group Formation via Unproductive Costs

    PubMed Central

    Aimone, Jason A.; Iannaccone, Laurence R.; Makowsky, Michael D.; Rubin, Jared

    2013-01-01

    Sacrifice is widely believed to enhance cooperation in churches, communes, gangs, clans, military units, and many other groups. We find that sacrifice can also work in the lab, apart from special ideologies, identities, or interactions. Our subjects play a modified VCM game—one in which they can voluntarily join groups that provide reduced rates of return on private investment. This leads to both endogenous sorting (because free-riders tend to reject the reduced-rate option) and substitution (because reduced private productivity favours increased club involvement). Seemingly unproductive costs thus serve to screen out free-riders, attract conditional cooperators, boost club production, and increase member welfare. The sacrifice mechanism is simple and particularly useful where monitoring difficulties impede punishment, exclusion, fees, and other more standard solutions. PMID:24808623

  17. Individuality and group formation: the role of independence and differentiation.

    PubMed

    Kampmeier, C; Simon, B

    2001-09-01

    This research examined the interplay of group formation and individualization processes with a particular emphasis on minority and majority groups. First, a 2-component theory of individuality that distinguishes between individuality as independence and as differentiation from other people was presented, tested, and cross-validated in 2 questionnaire studies. Next, a pilot experiment provided first support for the working assumption that the salience of the differentiation or independence components of individuality differentially affect minority and majority group formation. Finally, the main experiment demonstrated that these individuality effects on minority and majority group formation are due largely to a differential orientation toward either intergroup or intragroup comparisons. This experiment also uncovered a unique effect of relative in-group size, but this effect was limited to similarity-based group formation.

  18. The Formation of Effective Work Groups within an FE Classroom

    ERIC Educational Resources Information Center

    Russell, Megan

    2010-01-01

    Fascinated by the diversity of composition in effective work groups in Further Education (FE) classrooms, I studied group formation and composition in level 3 Biology classes over an academic year. Using information from the class teacher, observers and students, the importance of effective work groups (defining effectiveness in terms of…

  19. The Formation of Effective Work Groups within an FE Classroom

    ERIC Educational Resources Information Center

    Russell, Megan

    2010-01-01

    Fascinated by the diversity of composition in effective work groups in Further Education (FE) classrooms, I studied group formation and composition in level 3 Biology classes over an academic year. Using information from the class teacher, observers and students, the importance of effective work groups (defining effectiveness in terms of…

  20. Enhancing the impact of groups: an evaluation of two group formats for smokers.

    PubMed

    Hajek, P; Belcher, M; Stapleton, J

    1985-11-01

    The effects of two different group formats constituting part of an otherwise identical smoking cessation programme were evaluated. Each group format was in use for one full calendar year. One hundred and thirty-two smokers were treated in 14 'therapist-oriented' (T-O) groups run in traditional didactic style and 138 in 14 'group-oriented' (G-O) groups, where the primary emphasis was on group resources (group support, group pressure and spontaneous modelling of coping responses). G-O groups were significantly more successful. The two types of groups did not differ in the number of clients who succeeded in stopping smoking just after the first meeting, i.e. before the difference in group formats could have any impact; but in the G-O groups more of those who failed initially persisted in trying and succeeded later in the course. Independently of the format, larger groups were more successful and in addition there was significant variation between single groups regardless of both format and size. Group processes seem to play an important role in smoking cessation and the way in which a group is structured can affect outcome.

  1. Exogenous attention during perceptual group formation and dissolution.

    PubMed

    Gonen, Fahrettin F; Ogmen, Haluk

    2017-02-01

    Under natural viewing conditions, a large amount of information reaches our senses, and the visual system uses attention and perceptual grouping to reduce the complexity of stimuli in order to make real-time perception possible. Prior studies have shown that attention and perceptual grouping operate in synergy; exogenous attention is deployed not only to the cued item, but also to the entire group. Here, we investigated how attention and perceptual grouping operate during the formation and dissolution of groups. Our results showed that reaction times are higher in the presence of perceptual groups than they are for ungrouped stimuli. On the other hand, attentional benefits of perceptual grouping were observed during both the formation and the dissolution of groups. The dynamics were similar during group formation and dissolution, showing a gradual effect that takes approximately half a second to reach its maximum level. In the case of group dissolution, the attentional benefits persisted for about a quarter of a second after dissolution of the group. Taken together, our results reveal the dynamics of how attention and grouping work in synergy during the transient period when groups form or dissolve.

  2. Talking therapy groups on acute psychiatric wards: patients' experience of two structured group formats

    PubMed Central

    Radcliffe, Jonathan; Bird, Laura

    2016-01-01

    Aims and method We report the results of a clinical audit of patients' reactions to two types of talking therapy groups facilitated by assistant psychologists and psychology graduates on three acute wards. Patients' experiences of problem-solving and interpersonal group formats were explored via focus groups and structured interviews with 29 group participants. Results Both group formats generated high satisfaction ratings, with benefits related mostly to generic factors. Clinical implications Adequately trained and supported assistant psychologists and psychology graduates can provide supportive talking groups that patients find helpful. PMID:27512586

  3. Group Additivity Determination for Enthalpies of Formation of Carbenium Ions

    SciTech Connect

    Bjorkman, Kathryn R.; Sung, Chun-Yi; Mondor, Eric; Cheng, Janine C.; Jan, Deng-Yang; Broadbelt, Linda J.

    2014-12-05

    Modeling of acid-catalyzed hydrocarbon conversion processes at the mechanistic level requires rate coefficients for a large number of reactions. The computational demand of finding activation energy barriers for each reaction is substantially reduced by employing structure–reactivity correlations such as the Evans–Polanyi relationship that correlates activation energy with the enthalpy of reaction. However, there are many species for which the enthalpies of formation are unknown. Therefore, group additivity methods to specify enthalpies of formation for each species involved in the reaction network are valuable. Quantum mechanical (QM) calculations and isodesmic reactions were used to calculate enthalpies of formation for a number of acyclic and cyclic carbenium ions, including allylic carbenium ions. These values compare favorably with experimental values, establishing Gaussian-4 as an accurate QM method for these calculations. Using these values, Benson-type group additivity values for enthalpies of formation were then derived through multiple linear regression. Enthalpies of formation values calculated from the group additivity scheme capture experimental and QM enthalpies of formation well and enhance the range of species that can be described by the group additivity approach.

  4. Cyclic diguanylate regulation of Bacillus cereus group biofilm formation.

    PubMed

    Fagerlund, Annette; Smith, Veronika; Røhr, Åsmund K; Lindbäck, Toril; Parmer, Marthe P; Andersson, K Kristoffer; Reubsaet, Leon; Økstad, Ole Andreas

    2016-08-01

    Biofilm formation can be considered a bacterial virulence mechanism. In a range of Gram-negatives, increased levels of the second messenger cyclic diguanylate (c-di-GMP) promotes biofilm formation and reduces motility. Other bacterial processes known to be regulated by c-di-GMP include cell division, differentiation and virulence. Among Gram-positive bacteria, where the function of c-di-GMP signalling is less well characterized, c-di-GMP was reported to regulate swarming motility in Bacillus subtilis while having very limited or no effect on biofilm formation. In contrast, we show that in the Bacillus cereus group c-di-GMP signalling is linked to biofilm formation, and to several other phenotypes important to the lifestyle of these bacteria. The Bacillus thuringiensis 407 genome encodes eleven predicted proteins containing domains (GGDEF/EAL) related to c-di-GMP synthesis or breakdown, ten of which are conserved through the majority of clades of the B. cereus group, including Bacillus anthracis. Several of the genes were shown to affect biofilm formation, motility, enterotoxin synthesis and/or sporulation. Among these, cdgF appeared to encode a master diguanylate cyclase essential for biofilm formation in an oxygenated environment. Only two cdg genes (cdgA, cdgJ) had orthologs in B. subtilis, highlighting differences in c-di-GMP signalling between B. subtilis and B. cereus group bacteria.

  5. Star Formation in Undergraduate ALFALFA Team Galaxy Groups and Clusters

    NASA Astrophysics Data System (ADS)

    Koopmann, Rebecca A.; Durbala, Adriana; Finn, Rose; Haynes, Martha P.; Coble, Kimberly A.; Craig, David W.; Hoffman, G. Lyle; Miller, Brendan P.; Crone-Odekon, Mary; O'Donoghue, Aileen A.; Troischt, Parker; Undergraduate ALFALFA Team; ALFALFA Team

    2017-01-01

    The Undergraduate ALFALFA Team (UAT) Groups project is a coordinated study of gas and star formation properties of galaxies in and around 36 nearby (z<0.03) groups and clusters of varied richness, morphological type mix, and X-ray luminosity. By studying a large range of environments and considering the spatial distributions of star formation, we probe mechanisms of gas depletion and morphological transformation. The project uses ALFALFA HI observations, optical observations, and digital databases like SDSS, and incorporates work undertaken by faculty and students at different institutions within the UAT. Here we present results from our wide area Hα and broadband R imaging project carried out with the WIYN 0.9m+MOSAIC/HDI at KPNO, including an analysis of radial star formation rates and extents of galaxies in the NGC 5846, Abell 779, NRGb331, and HCG 69 groups/clusters. This work has been supported by NSF grant AST-1211005 and AST-1637339.

  6. Star Formation and Environment in Compact Groups of Galaxies

    NASA Astrophysics Data System (ADS)

    Iglesias-Páramo, J.; Vílchez, J. M.

    H &alpha luminosities are presented in order to study the Star Formation Rates (SFRs) of a sample of galaxies in compact groups from Hickson's (1982) catalogue. Although the comparison of the SFRs of the disk galaxies in our sample with those of a sample of field galaxies yielded no difference between the average SFRs for disk galaxies in compact groups and in the field, environmental effects seem to influence the H &alpha luminosities of late and early-type galaxies in compact groups. No relationship was found between the total normalized H &alpha luminosities of the groups and some dynamical parameters, indicating that the dynamical state of the group does not influence the SFR of the group. The lack of dominant interaction induced starbursts in our sample is compatible with a scenario for compact groups of galaxies in which the dark matter of the group is arranged in a common halo, thereby preventing a fast collapse of the galaxies.

  7. A New Group-Formation Method for Student Projects

    ERIC Educational Resources Information Center

    Borges, Jose; Dias, Teresa Galvao; Cunha, Joao Falcao E.

    2009-01-01

    In BSc/MSc engineering programmes at Faculty of Engineering of the University of Porto (FEUP), the need to provide students with teamwork experiences close to a real world environment was identified as an important issue. A new group-formation method that aims to provide an enriching teamwork experience is proposed. Students are asked to answer a…

  8. Exploring Technology Supported Collaborative and Cooperative Group Formation Mechanisms

    ERIC Educational Resources Information Center

    Carapina, Mia; Boticki, Ivica

    2015-01-01

    This paper reflects on the systematic literature review paper (in progress), which analyzes technology enhanced collaborative and cooperative learning in elementary education worldwide from 2004 to 2015, focusing on the exploration of technology mediated group formation. The review paper reports on only a few cases of technology supported methods…

  9. A New Group-Formation Method for Student Projects

    ERIC Educational Resources Information Center

    Borges, Jose; Dias, Teresa Galvao; Cunha, Joao Falcao E.

    2009-01-01

    In BSc/MSc engineering programmes at Faculty of Engineering of the University of Porto (FEUP), the need to provide students with teamwork experiences close to a real world environment was identified as an important issue. A new group-formation method that aims to provide an enriching teamwork experience is proposed. Students are asked to answer a…

  10. Toward Effective Group Formation in Computer-Supported Collaborative Learning

    ERIC Educational Resources Information Center

    Sadeghi, Hamid; Kardan, Ahmad A.

    2016-01-01

    Group formation task as a starting point for computer-supported collaborative learning plays a key role in achieving pedagogical goals. Various approaches have been reported in the literature to address this problem, but none have offered an optimal solution. In this research, an online learning environment was modeled as a weighted undirected…

  11. Exploring Group Formation through Work and Play at Camp.

    ERIC Educational Resources Information Center

    Cain, Jim

    2003-01-01

    While working and playing together at camp, staff often work through most, if not all, of the stages of group formation, commonly referred to as forming, storming, norming, performing, and finally, transforming. Ten adventure-based games and activities are presented to help camp directors train staff and help them progress through these stages.…

  12. Stepfamily Education: Benefits of a Group-Formatted Intervention

    ERIC Educational Resources Information Center

    Skogrand, Linda; Torres, Eliza; Higginbotham, Brian J.

    2010-01-01

    This program evaluation was conducted by interviewing 40 low-income participants in a relationship education (RE) program for stepfamilies to determine specific benefits of a group-formatted intervention. The benefits that were most often identified were learning from others and having personal stepfamily challenges normalized. Participants also…

  13. Toward Effective Group Formation in Computer-Supported Collaborative Learning

    ERIC Educational Resources Information Center

    Sadeghi, Hamid; Kardan, Ahmad A.

    2016-01-01

    Group formation task as a starting point for computer-supported collaborative learning plays a key role in achieving pedagogical goals. Various approaches have been reported in the literature to address this problem, but none have offered an optimal solution. In this research, an online learning environment was modeled as a weighted undirected…

  14. Promoting cooperation by reputation-driven group formation

    NASA Astrophysics Data System (ADS)

    Yang, Han-Xin; Wang, Zhen

    2017-02-01

    In previous studies of the spatial public goods game, each player is able to establish a group. However, in real life, some players cannot successfully organize groups for various reasons. In this paper, we propose a mechanism of reputation-driven group formation, in which groups can only be organized by players whose reputation reaches or exceeds a threshold. We define a player’s reputation as the frequency of cooperation in the last T time steps. We find that the highest cooperation level can be obtained when groups are only established by pure cooperators who always cooperate in the last T time steps. Effects of the memory length T on cooperation are also studied.

  15. Group impressions as dynamic configurations: the tensor product model of group impression formation and change.

    PubMed

    Kashima, Y; Woolcock, J; Kashima, E S

    2000-10-01

    Group impressions are dynamic configurations. The tensor product model (TPM), a connectionist model of memory and learning, is used to describe the process of group impression formation and change, emphasizing the structured and contextualized nature of group impressions and the dynamic evolution of group impressions over time. TPM is first shown to be consistent with algebraic models of social judgment (the weighted averaging model; N. Anderson, 1981) and exemplar-based social category learning (the context model; E. R. Smith & M. A. Zárate, 1992), providing a theoretical reduction of the algebraic models to the present connectionist framework. TPM is then shown to describe a common process that underlies both formation and change of group impressions despite the often-made assumption that they constitute different psychological processes. In particular, various time-dependent properties of both group impression formation (e.g., time variability, response dependency, and order effects in impression judgments) and change (e.g., stereotype change and group accentuation) are explained, demonstrating a hidden unity beneath the diverse array of empirical findings. Implications of the model for conceptualizing stereotype formation and change are discussed.

  16. The star formation histories of Hickson compact group galaxies

    NASA Astrophysics Data System (ADS)

    Plauchu-Frayn, I.; Del Olmo, A.; Coziol, R.; Torres-Papaqui, J. P.

    2012-10-01

    Aims: We study the star formation fistory (SFH) of 210 galaxy members of 55 Hickson compact groups (HCG) and 309 galaxies from the Catalog of Isolated Galaxies (CIG). The SFH traces the variation of star formation over the lifetime of a galaxy, and consequently yields a snapshot picture of its formation. Comparing the SFHs in these extremes in galaxy density allows us to determine the main effects of compact groups (CG) on the formation of galaxies. Methods: We fit our spectra using the spectral synthesis code STARLIGHT and obtained the stellar population contents and mean stellar ages of HCG and CIG galaxies in three different morphological classes: early-type galaxies (EtG), early-type spirals (EtS), and late-type spirals (LtS). Results: We find that EtG and EtS galaxies in HCG show higher contents of old and intermediate stellar populations as well as an important deficit of the young stellar population, which clearly implies an older average stellar age in early galaxies in HCG. For LtS galaxies we find similar mean values for the stellar content and age in the two samples. However, we note that LtS can be split into two subclasses, namely old and young LtS. In HCG we find a higher fraction of young LtS than in the CIG sample, in addition, most of these galaxies belong to groups in which most of the galaxies are also young and actively forming stars. The specific star formation rate (SSFR) of spiral galaxies in the two samples differ. The EtS in HCG show lower SSFR values, while LtS peak at higher values compared with their counterparts in isolation. We also measured the shorter star formation time scale (SFTS) in HCG galaxies, which indicates that they have a shorter star formation activity than CIG galaxies. We take these observations as evidence that galaxies in CG have evolved more rapidly than galaxies in isolation, regardless of their morphology. Our observations are consistent with the hierarchical galaxy formation model, which states that CGs are

  17. Acritarchs of the Ediacaran Frecheirinha Formation, Ubajara Group, Northeastern Brazil.

    PubMed

    Chiglino, Leticia; Gaucher, Claudio; Sial, Alcides N; Ferreira, Valderez P

    2015-01-01

    We report for the first time the occurrence of organic-walled microfossils in Ediacaran limestones and marls of the Frecheirinha Formation, Ubajara Group, and the first Precambrian acritarchs so far reported for northeastern Brazil. The assemblage of the Frecheirinha Formation represents a low-diversity microflora comprising Leiosphaeridia, Lophosphaeridium and subordinated Bavlinella (=Sphaerocongregus). Their thermal alteration index (TAI) between 4+ and 5, suggests metamorphic temperatures exceeding 200-250°C. Higher temperatures are probably related to intruding granitic plutons (Meruoca, Mucambo). Reported δ13C values of carbonates of -3.5 ‰ VPDB (Vienna-Peedee Belemnite) at the base, passing up section into a positive plateau of up to +3.7 ‰, and corresponding 87Sr/86Sr values between 0.7075 and 0.7080 suggest an Ediacaran age. The acritarch assemblage is comparable to the Late Ediacaran Leiosphere Palynoflora (LELP) or Kotlin-Rovno assemblage, in broad agreement with chemostratigraphic data. Macrofossils belonging to the Ediacara fauna were reported from the overlying Jaibaras Group, which would constrain even further the depositional age of the Frecheirinha Formation to within ca. 575-555 Ma. A more comprehensive palynological study of the Frecheirinha Formation is necessary to confirm this age assignment.

  18. Cooperation driven by success-driven group formation

    NASA Astrophysics Data System (ADS)

    Szolnoki, Attila; Chen, Xiaojie

    2016-10-01

    In the traditional setup of the public goods game all players are involved in every available group and the mutual benefit is shared among competing cooperator and defector strategies. However, in real life situations the group formation of players could be more sophisticated because not all players are attractive enough for others to participate in a joint venture. What if only those players who are successful enough to the neighbors can initiate a group formation and establish a game? To elaborate this idea we employ a modified protocol and demonstrate that a carefully chosen threshold to establish a joint venture could efficiently improve the cooperation level even if the synergy factor would suggest a full defector state otherwise. The microscopic mechanism that is responsible for this effect is based on the asymmetric consequences of competing strategies: while the success of a cooperator provides a long-time well-being for the neighborhood, the temporary advantage of defection cannot be maintained if the protocol is based on the success of leaders.

  19. Cooperation driven by success-driven group formation.

    PubMed

    Szolnoki, Attila; Chen, Xiaojie

    2016-10-01

    In the traditional setup of the public goods game all players are involved in every available group and the mutual benefit is shared among competing cooperator and defector strategies. However, in real life situations the group formation of players could be more sophisticated because not all players are attractive enough for others to participate in a joint venture. What if only those players who are successful enough to the neighbors can initiate a group formation and establish a game? To elaborate this idea we employ a modified protocol and demonstrate that a carefully chosen threshold to establish a joint venture could efficiently improve the cooperation level even if the synergy factor would suggest a full defector state otherwise. The microscopic mechanism that is responsible for this effect is based on the asymmetric consequences of competing strategies: while the success of a cooperator provides a long-time well-being for the neighborhood, the temporary advantage of defection cannot be maintained if the protocol is based on the success of leaders.

  20. A model for the formation of the Local Group

    SciTech Connect

    Peebles, P.J.E.; Melott, A.L.; Holmes, M.R.; Jiang, L.R. Kansas Univ., Lawrence )

    1989-10-01

    Observational tests of a model for the formation of the Local Group are presented and analyzed in which the mass concentration grows by gravitational accretion of local-pressure matter onto two seed masses in an otherwise homogeneous initial mass distribution. The evolution of the mass distribution is studied in an analytic approximation and a numerical computation. The initial seed mass and separation are adjusted to produce the observed present separation and relative velocity of the Andromeda Nebula and the Galaxy. If H(0) is adjusted to about 80 km/s/Mpc with density parameter Omega = 1, then the model gives a good fit to the motions of the outer members of the Local Group. The same model gives particle orbits at radius of about 100 kpc that reasonably approximate the observed distribution of redshifts of the Galactic satellites. 47 refs.

  1. A model for the formation of the Local Group

    NASA Technical Reports Server (NTRS)

    Peebles, P. J. E.; Melott, A. L.; Holmes, M. R.; Jiang, L. R.

    1989-01-01

    Observational tests of a model for the formation of the Local Group are presented and analyzed in which the mass concentration grows by gravitational accretion of local-pressure matter onto two seed masses in an otherwise homogeneous initial mass distribution. The evolution of the mass distribution is studied in an analytic approximation and a numerical computation. The initial seed mass and separation are adjusted to produce the observed present separation and relative velocity of the Andromeda Nebula and the Galaxy. If H(0) is adjusted to about 80 km/s/Mpc with density parameter Omega = 1, then the model gives a good fit to the motions of the outer members of the Local Group. The same model gives particle orbits at radius of about 100 kpc that reasonably approximate the observed distribution of redshifts of the Galactic satellites.

  2. Heats of Formation and Bond Energies in Group III Compounds

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Allendorf, Mark D.; Melius, Carl F.; Arnold, James O. (Technical Monitor)

    1999-01-01

    We present heats of formation and bond energies for Group-III compounds obtained from calculations of molecular ground-state I electronic energies. Data for compounds of the form MXn are presented, where M = B, Al, Ga, and In, X = He H, Cl, and CH3, and n = 1-3. Energies for the B, Al, and Ga compounds are obtained from G2 predictions, while those for the In compounds are obtained from CCSD(T)/CBS calculations; these are the most accurate calculations for indium-containing compounds published to date. In most cases, the calculated thermochemistry is in good agreement with published values derived from experiments for those species that have well-established heats of formation. Bond energies obtained from the heats of formation follow the expected trend (Cl much greater than CH3 approx. H). However, the CH3M-(CH3)2 bond energies obtained for trimethylgallium and trimethylindium are considerably stronger (greater than 15 kcal/mol) than currently accepted values.

  3. Reputation drives cooperative behaviour and network formation in human groups.

    PubMed

    Cuesta, Jose A; Gracia-Lázaro, Carlos; Ferrer, Alfredo; Moreno, Yamir; Sánchez, Angel

    2015-01-19

    Cooperativeness is a defining feature of human nature. Theoreticians have suggested several mechanisms to explain this ubiquitous phenomenon, including reciprocity, reputation, and punishment, but the problem is still unsolved. Here we show, through experiments conducted with groups of people playing an iterated Prisoner's Dilemma on a dynamic network, that it is reputation what really fosters cooperation. While this mechanism has already been observed in unstructured populations, we find that it acts equally when interactions are given by a network that players can reconfigure dynamically. Furthermore, our observations reveal that memory also drives the network formation process, and cooperators assort more, with longer link lifetimes, the longer the past actions record. Our analysis demonstrates, for the first time, that reputation can be very well quantified as a weighted mean of the fractions of past cooperative acts and the last action performed. This finding has potential applications in collaborative systems and e-commerce.

  4. Reputation drives cooperative behaviour and network formation in human groups

    PubMed Central

    Cuesta, Jose A.; Gracia-Lázaro, Carlos; Ferrer, Alfredo; Moreno, Yamir; Sánchez, Angel

    2015-01-01

    Cooperativeness is a defining feature of human nature. Theoreticians have suggested several mechanisms to explain this ubiquitous phenomenon, including reciprocity, reputation, and punishment, but the problem is still unsolved. Here we show, through experiments conducted with groups of people playing an iterated Prisoner's Dilemma on a dynamic network, that it is reputation what really fosters cooperation. While this mechanism has already been observed in unstructured populations, we find that it acts equally when interactions are given by a network that players can reconfigure dynamically. Furthermore, our observations reveal that memory also drives the network formation process, and cooperators assort more, with longer link lifetimes, the longer the past actions record. Our analysis demonstrates, for the first time, that reputation can be very well quantified as a weighted mean of the fractions of past cooperative acts and the last action performed. This finding has potential applications in collaborative systems and e-commerce. PMID:25598347

  5. Asteroid mega-impacts and Precambrian banded iron formations: 2.63 Ga and 2.56 Ga impact ejecta/fallout at the base of BIF/argillite units, Hamersley Basin, Pilbara Craton, Western Australia

    NASA Astrophysics Data System (ADS)

    Glikson, Andrew; Vickers, John

    2007-02-01

    The temporal association between late Archaean to earliest Proterozoic asteroid impact ejecta/fallout units and overlying banded iron formations suggests that, in some instances, these impacts were closely followed by significant transformation in the nature of source terrains of the sediments. The Jeerinah Impact Layer (JIL) [B.M. Simonson, D. Davies, S.W. Hassler, Discovery of a layer of probable impact melt spherules in the late Archean Jeerinah Formation, Fortescue Group, Western Australia. Aust. J. Earth Sci. 47 (2000) 315-325; B.M. Simonson, S.W. Hassler, Revised correlations in the early Precambrian Hamersley Basin based on a horizon of resedimented impact spherules. Aust. J. Earth Sci. 44 (1997) 37-48; B.M. Simonson, B.P. Glass, Spherule layers - records of ancient impacts. Ann. Rev. Earth Planet. Sci. 32 (2004) 329-361; A.Y. Glikson, Early Precambrian asteroid impact-triggered tsunami: excavated seabed, debris flows, exotic boulders, and turbulence features associated with 3.47-2.47 Ga-old asteroid impact fallout units, Pilbara Craton, Western Australia. Astrobiology 4 (2001) 19-50; S.W. Hassler, B.M. Simonson, D.Y. Sumner, D. Murphy, Neoarchaean impact spherule layers in the Fortescue and Hamersley Groups, Western Australia: stratigraphic and depositional implications of re-correlation. Aust. J. Earth Sci. 52 (2005) 759-772; B. Rasmussen, C. Koeberl, Iridium anomalies and shocked quartz in a late Archean spherule layer from the Pilbara Craton: new evidence for a major asteroid impact at 2.63 Ga. Geology 32 (2004) 1029-1032; B. Rasmussen, T.S. Blake, I.R. Fletcher, U-Pb zircon age constraints on the Hamersley spherule beds: Evidence for a single 2.63 Ga Jeerinah-Carawine impact ejecta layer. Geology, 33 (2005) 725-728.] overlies an argillite-dominated unit (Jeerinah Formation, 2684 ± 6 Ma [A.F. Trendall, W. Compston, D.R. Nelson, J.R. deLaeter, V.C. Bennett, SHRIMP zircon ages constraining the depositional chronology of the Hamersley Group, Western

  6. Formation of nanostructured Group IIA metal activated sensors: The transformation of Group IIA metal compound sites

    NASA Astrophysics Data System (ADS)

    Tune, Travis C.; Baker, Caitlin; Hardy, Neil; Lin, Arthur; Widing, Timothy J.; Gole, James L.

    2015-05-01

    Trends in the Group IIA metal oxides and hydroxides of magnesium, calcium, and barium are unique in the periodic table. In this study we find that they display novel trends as decorating nanostructures for extrinsic semiconductor interfaces. The Group IIA metal ions are strong Lewis acids. We form these M2+ ions in aqueous solution and bring these solutions in contact with a porous silicon interface to form interfaces for conductometric measurements. Observed responses are consistent with the formation of MgO whereas the heavier elements display behaviors which suggest the effect of their more basic nature. Mg(OH)2, when formed, represents a weak base whereas the heavier metal hydroxides of Ca, Sr, and Ba are strong bases. However, the hydroxides tend to give up hydrogen and act as Brönsted acids. For the latter elements, the reversible interaction response of nanostructures deposited to the porous silicon (PS) interface is modified, as the formation of more basic sites appears to compete with M2+ Lewis acidity and hydroxide Brönsted acidity. Mg2+ forms an interface whose response to the analytes NH3 and NO is consistent with MgO and well explained by the recently developing Inverse Hard/Soft Acid/Base model. The behavior of the Ca2+ and Ba2+ decorated interfaces as they interact with the hard base NH3 follows a reversal of the model, indicating a decrease in acidic character as the observed conductometric response suggests the interaction with hydroxyl groups. A change from oxide-like to hydroxide-like constituents is supported by XPS studies. The changes in conductometric response is easily monitored in contrast to changes associated with the Group IIA oxides and hydroxides observed in XPS, EDAX, IR, and NMR measurements.

  7. Cortical mechanisms for afterimage formation: evidence from interocular grouping

    PubMed Central

    Dong, Bo; Holm, Linus; Bao, Min

    2017-01-01

    Whether the retinal process alone or retinal and cortical processes jointly determine afterimage (AI) formation has long been debated. Based on the retinal rebound responses, recent work proposes that afterimage signals are exclusively generated in the retina, although later modified by cortical mechanisms. We tested this notion with the method of “indirect proof”. Each eye was presented with a 2-by-2 checkerboard of horizontal and vertical grating patches. Each corresponding patch of the two checkerboards was perpendicular to each other, which produces binocular rivalry, and can generate percepts ranging from complete interocular grouping to either monocular pattern. The monocular percepts became more frequent with higher contrast. Due to adaptation, the visual system is less sensitive during the AIs than during the inductions with AI-similar contrast. If the retina is the only origin of AIs, comparable contrast appearance would require stronger retinal signals in the AIs than in the inductions, thus leading to more frequent monocular percepts in the AIs than in the inductions. Surprisingly, subjects saw the fully coherent stripes significantly more often in AIs. Our results thus contradict the retinal generation notion, and suggest that in addition to the retina, cortex is directly involved in the generation of AI signals. PMID:28112230

  8. The formation of Local Group planes of galaxies

    NASA Astrophysics Data System (ADS)

    Shaya, Ed J.; Tully, R. Brent

    2013-12-01

    The confinement of most satellite galaxies in the Local Group to thin planes presents a challenge to the theory of hierarchical galaxy clustering. The Pan-Andromeda Archaeological Survey (PAndAS) collaboration has identified a particularly thin configuration with kinematic coherence among companions of M31 and there have been long-standing claims that the dwarf companions to the Milky Way lie in a plane roughly orthogonal to the disc of our galaxy. This discussion investigates the possible origins of four Local Group planes: the plane similar, but not identical to that identified by the PAndAS collaboration, an adjacent slightly tilted plane and two planes in the vicinity of the Milky Way: one with very nearby galaxies and the other with more distant ones. Plausible orbits are found by using a combination of Numerical Action methods and a backward in time integration procedure. This investigation assumes that the companion galaxies formed at an early time in accordance with the standard cosmological model. For M31, M33, IC10 and Leo I, solutions are found that are consistent with measurements of their proper motions. For galaxies in planes, there must be commonalities in their proper motions, and this constraint greatly limits the number of physically plausible solutions. Key to the formation of the planar structures has been the evacuation of the Local Void and consequent build-up of the Local Sheet, a wall of this void. Most of the M31 companion galaxies were born in early-forming filamentary or sheet-like substrata that chased M31 out of the void. M31 is a moving target because of its attraction towards the Milky Way, and the result has been alignments stretched towards our galaxy. In the case of the configuration around the Milky Way, it appears that our galaxy was in a three-way competition for companions with M31 and Centaurus A. Only those within a modest band fell our way. The Milky Way's attraction towards the Virgo Cluster resulted in alignment along the

  9. Group Supervision in Psychotherapy. Main Findings from a Swedish Research Project on Psychotherapy Supervision in a Group Format

    ERIC Educational Resources Information Center

    Ogren, Marie-Louise; Sundin, Eva C.

    2009-01-01

    Psychotherapy supervision is considered crucial for psychotherapists in training. During the last decades, group supervision has been a frequently used format in many countries. Until recently, very few studies had evaluated the small-group format for training of beginner psychotherapists and psychotherapy supervisors. This article aims to…

  10. Enzymatic Formation of G-Group Aflatoxins and Biosynthetic Relationship between G- and B-Group Aflatoxins

    PubMed Central

    Yabe, Kimiko; Nakamura, Miki; Hamasaki, Takashi

    1999-01-01

    We detected biosynthetic activity for aflatoxins G1 and G2 in cell extracts of Aspergillus parasiticus NIAH-26. We found that in the presence of NADPH, aflatoxins G1 and G2 were produced from O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin, respectively. No G-group aflatoxins were produced from aflatoxin B1, aflatoxin B2, 5-methoxysterigmatocystin, dimethoxysterigmatocystin, or sterigmatin, confirming that B-group aflatoxins are not the precursors of G-group aflatoxins and that G- and B-group aflatoxins are independently produced from the same substrates (O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin). In competition experiments in which the cell-free system was used, formation of aflatoxin G2 from dihydro-O-methylsterigmatocystin was suppressed when O-methylsterigmatocystin was added to the reaction mixture, whereas aflatoxin G1 was newly formed. This result indicates that the same enzymes can catalyze the formation of aflatoxins G1 and G2. Inhibition of G-group aflatoxin formation by methyrapone, SKF-525A, or imidazole indicated that a cytochrome P-450 monooxygenase may be involved in the formation of G-group aflatoxins. Both the microsome fraction and a cytosol protein with a native mass of 220 kDa were necessary for the formation of G-group aflatoxins. Due to instability of the microsome fraction, G-group aflatoxin formation was less stable than B-group aflatoxin formation. The ordA gene product, which may catalyze the formation of B-group aflatoxins, also may be required for G-group aflatoxin biosynthesis. We concluded that at least three reactions, catalyzed by the ordA gene product, an unstable microsome enzyme, and a 220-kDa cytosol protein, are involved in the enzymatic formation of G-group aflatoxins from either O-methylsterigmatocystin or dihydro-O-methylsterigmatocystin. PMID:10473388

  11. Dynamic Group Formation Based on a Natural Phenomenon

    ERIC Educational Resources Information Center

    Zedadra, Amina; Lafifi, Yacine; Zedadra, Ouarda

    2016-01-01

    This paper presents a new approach of learners grouping in collaborative learning systems. This grouping process is based on traces left by learners. The goal is the circular dynamic grouping to achieve collaborative projects. The proposed approach consists of two main algorithms: (1) the circular grouping algorithm and (2) the dynamic grouping…

  12. Dynamic Group Formation Based on a Natural Phenomenon

    ERIC Educational Resources Information Center

    Zedadra, Amina; Lafifi, Yacine; Zedadra, Ouarda

    2016-01-01

    This paper presents a new approach of learners grouping in collaborative learning systems. This grouping process is based on traces left by learners. The goal is the circular dynamic grouping to achieve collaborative projects. The proposed approach consists of two main algorithms: (1) the circular grouping algorithm and (2) the dynamic grouping…

  13. A Framework for Semantic Group Formation in Education

    ERIC Educational Resources Information Center

    Ounnas, Asma; Davis, Hugh C.; Millard, David E.

    2009-01-01

    Collaboration has long been considered an effective approach to learning. However, forming optimal groups can be a time consuming and complex task. Different approaches have been developed to assist teachers allocate students to groups based on a set of constraints. However, existing tools often fail to assign some students to groups creating a…

  14. A Framework for Semantic Group Formation in Education

    ERIC Educational Resources Information Center

    Ounnas, Asma; Davis, Hugh C.; Millard, David E.

    2009-01-01

    Collaboration has long been considered an effective approach to learning. However, forming optimal groups can be a time consuming and complex task. Different approaches have been developed to assist teachers allocate students to groups based on a set of constraints. However, existing tools often fail to assign some students to groups creating a…

  15. Cognitive Behavior Therapy: A Comparison of Group and Individual Formats.

    ERIC Educational Resources Information Center

    Shaffer, Carolyn S.; And Others

    The relative efficacy of both group and individual cognitive behavior therapeutic approaches in treating anxiety and depression are evaluated and then compared to an interpersonal group therapy approach. The two major hypotheses are that group cognitive behavior therapy is at least as effective as individual cognitive behavior therapy, and that…

  16. The formation of compact groups of galaxies. I: Optical properties

    NASA Technical Reports Server (NTRS)

    Diaferio, Antonaldo; Geller, Margaret J.; Ramella, Massimo

    1994-01-01

    The small crossing time of compact groups of galaxies (t(sub cr)H(sub 0) approximately less than 0.02) makes it hard to understand why they are observable at all. Our dissipationless N-body simulations show that within a single rich collapsing group compact groups of galaxies continually form. The mean lifetime of a particular compact configuration if approximately 1 Gyr. On this time scale, members may merge and/or other galaxies in the loose group may join the compact configuration. In other words, compact configurations are continually replaced by new systems. The frequency of this process explains the observability of compact groups. Our model produces compact configurations (compact groups (CG's) with optical properties remarkably similar to Hickson's (1982) compact groups (HCG's): (1) CG's have a frequency distribution of members similar to that of HCG's; (2) CG's are approximately equals 10 times as dense as loose groups; (3) CG's have dynamical properties remarkably similar to those of HCG's; (4) most of the galaxy members of CG's are not merger remnants. The crucial aspect of the model is the relationship between CG's and the surrounding rich loose group. Our model predicts the frequency of occurrence of CG's. A preliminary analysis of 18 rich loose groups is consistent with the model prediction. We suggest further observational tests of the model.

  17. Small Group/Seminar Format for Teaching Behavioral Sciences.

    ERIC Educational Resources Information Center

    Goethe, John W.; Griffin, Phillip T.

    1981-01-01

    The design and implementation of the revised format of the freshman behavioral science course at Tulane University School of Medicine is described. The methods of evaluation utilized and the data from the first class of medical students to participate in the new curriculum are discussed. (Author/MLW)

  18. Reformers or Roadblocks: Educational Interest Groups and State Policy Formation

    ERIC Educational Resources Information Center

    Emerson, Joseph; Lemasters, Linda; Howerton, Everett

    2008-01-01

    Given the overt political nature of this topic, an additional theoretical postulate, the Triadic Theory of Power was also presented as another framework to conceptualize the external and internal forces which shape the formation of contemporary education policy. Predicated upon the scholarship of Nobel laureate James Q. Wilson, Andrew McFarland…

  19. Where Were You Fifth Period? Five Strategies for High School Group Formation in the 1990s.

    ERIC Educational Resources Information Center

    Fast, Jonathan

    1999-01-01

    Presents five strategies to help school social workers form groups during school hours. Advantages and disadvantages of each strategy are discussed, as well as how the formation of the group influences the nature of the group work. (Author/GCP)

  20. [A comparative study of individuals' responses to formative and declining groups].

    PubMed

    Yoshitake, K

    1990-04-01

    Using 40 college students as subjects, this experiment was conducted to investigate differences in the influence exerted by formative groups and declining groups of the same size. No significant differences between formative and declining groups were found at the behavioural level, especially with respect to conformity rates. However, significant differences were found between the two groups at internal levels, especially with respect to the confidence exhibited in subjects' responses and the evaluation of group opinions. In formative groups, the confidence of conformers in the group increased but non-conformers showed no change. In declining groups, the confidence of non-conformers increased but conformers showed no change. Moreover, only the conformers continued to support group opinions after the groups broke down, evaluating the group opinions highly in private. The results suggested in general that individuals are influenced by group changes and that they select their own responses by anticipating changes likely to occur in the group.

  1. An Ontology Engineering Approach to the Realization of Theory-Driven Group Formation

    ERIC Educational Resources Information Center

    Isotani, Seiji; Inaba, Akiko; Ikeda, Mitsuru; Mizoguchi, Riichiro

    2009-01-01

    One of the main difficulties during the design of collaborative learning activities is adequate group formation. In any type of collaboration, group formation plays a critical role in the learners' acceptance of group activities, as well as the success of the collaborative learning process. Nevertheless, to propose both an effective and…

  2. An Ontology Engineering Approach to the Realization of Theory-Driven Group Formation

    ERIC Educational Resources Information Center

    Isotani, Seiji; Inaba, Akiko; Ikeda, Mitsuru; Mizoguchi, Riichiro

    2009-01-01

    One of the main difficulties during the design of collaborative learning activities is adequate group formation. In any type of collaboration, group formation plays a critical role in the learners' acceptance of group activities, as well as the success of the collaborative learning process. Nevertheless, to propose both an effective and…

  3. Influence of Group Formation Choices on Academic Performance

    ERIC Educational Resources Information Center

    Seethamraju, Ravi; Borman, Mark

    2009-01-01

    With its multidisciplinary and applied foci, team-working skills are seen as especially critical in business courses in general and in business information systems courses in particular, and are specifically incorporated into desired graduate attributes by many universities. Past research has focused on the benefits of group working but little…

  4. Dynamic Group Formation as an Approach to Collaborative Learning Support

    ERIC Educational Resources Information Center

    Srba, Ivan; Bielikova, Maria

    2015-01-01

    In the current time of globalization, collaboration among people in virtual environments is becoming an important precondition of success. This trend is reflected also in the educational domain where students collaborate in various short-term groups created repetitively but changing in each round (e.g. in MOOCs). Students in these kind of dynamic…

  5. Cooperation during cultural group formation promotes trust towards members of out-groups

    PubMed Central

    Pan, Xiaofei Sophia; Houser, Daniel

    2013-01-01

    People often cooperate with members of their own group, and discriminate against members of other groups. Previous research establishes that cultural groups can form endogenously, and that these groups demonstrate in-group favouritism. Given the presence of cultural groups, the previous literature argues that cultural evolution selects for groups that exhibit parochial altruism. The source of initial variation in these traits, however, remains uninformed. We show here that a group's economic production environment may substantially influence parochial tendencies, with groups formed around more cooperative production (CP) displaying less parochialism than groups formed around more independent production (IP) processes. Participants randomized into CP and IP production tasks formed cultural groups, and subsequently played hidden-action trust games with in-group and out-group trustees. We found CP to be associated with significantly greater sharing and exchanging behaviours than IP. In trust games, significant parochial altruism (in-group favouritism combined with out-group discrimination) was displayed by members of IP groups. By contrast, members of CP groups did not engage in either in-group favouritism or out-group discrimination. Further, we found the absence of out-group discrimination in CP to persist even following ‘betrayal’. Finally, belief data suggest that members of CP are not more intrinsically generous than IP members, but rather more likely to believe that out-group trustees will positively reciprocate. Our results have important implications for anyone interested in building cooperative teams, and shed new light on connections between culture and cooperation. PMID:23658200

  6. Charged group surface accessibility determines micelleplexes formation and cellular interaction

    NASA Astrophysics Data System (ADS)

    Zhang, Yu; Liu, Yang; Sen, Soumyo; Král, Petr; Gemeinhart, Richard A.

    2015-04-01

    Micelleplexes are a class of nucleic acid carriers that have gained acceptance due to their size, stability, and ability to synergistically carry small molecules. MicroRNAs (miRNAs) are small non-coding RNA gene regulator that is consists of 19-22 nucleotides. Altered expression of miRNAs plays an important role in many human diseases. Using a model 22-nucleotide miRNA sequence, we investigated the interaction between charged groups on the micelle surface and miRNA. The model micelle system was formed from methoxy-poly(ethylene glycol)-b-poly(lactide) (mPEG-PLA) mixed with methoxy-poly(ethylene glycol)-b-poly(lactide)-b-oligoarginine (mPEG-PLA-Rx, x = 8 or 15). Surface properties of the micelles were varied by controlling the oligoarginine block length and conjugation density. Micelles were observed to have a core-shell conformation in the aqueous environment where the PLA block constituted the hydrophobic core, mPEG and oligoarginine formed a hydrophilic corona. Significantly different thermodynamic behaviors were observed during the interaction of single stranded miRNA with micelles of different surface properties, and the resulting micelleplexes mediated substantial cellular association. Depending upon the oligoarginine length and density, micelles exhibited miRNA loading capacity directly related to the presentation of charged groups on the surface. The effect of charged group accessibility of cationic micelle on micelleplex properties provides guidance on future miRNA delivery system design.Micelleplexes are a class of nucleic acid carriers that have gained acceptance due to their size, stability, and ability to synergistically carry small molecules. MicroRNAs (miRNAs) are small non-coding RNA gene regulator that is consists of 19-22 nucleotides. Altered expression of miRNAs plays an important role in many human diseases. Using a model 22-nucleotide miRNA sequence, we investigated the interaction between charged groups on the micelle surface and miRNA. The

  7. Formation of non-magmatic iron-meteorite group IIE

    NASA Astrophysics Data System (ADS)

    Wasson, John T.

    2017-01-01

    Instrumental neutron-activation (INAA) data for metal in 22 nonmagmatic IIE meteorites show narrow ranges in Ir and other refractory siderophiles; the Ir range is a factor of 2.6, a factor of ∼2 smaller than in nonmagmatic IAB-MG, and orders of magnitude smaller than in the large magmatic groups. Siderophile data show no evidence of fractional crystallization. IIE irons can be split into two sets, a larger main-set and a set of 6 Cu- (or FeS) rich irons. Elemental concentrations in metal from veins in H5 chondrite Portales Valley fall within the IIE range with the exceptions of Co (high) and Ga (low). H-group-chondrite and Au-normalized IIE abundances for siderophiles show that IIE irons are ∼30% higher than H in refractory siderophiles Re, Ir and W and are about 30% lower than H chondrites in the volatiles Ga and Sb, inconsistent with proposals that IIE irons formed from H chondrites. The IIE fractionations contrast with those in L chondrites which are about 15% lower than H in the three refractory elements and 40% higher than H in volatiles indicating that IIE irons did not form from H chondrites but from a more reduced and siderophile-rich kind of ordinary chondrite ("HH" chondrites). Most O-isotope data support a close relationship between IIE irons and H or HH chondrites; lower Δ17O in primitive (chondritic) silicates support an HH classification. Literature isotopic data for Ru and Mo also show that IIE metal formed from an ordinary chondrite parent; it appears that the silicates and metal were formed by melting of a single asteroid. There is no evidence for radiogenic (26Al) heating; this, the rapid cooling recorded in the sizes of parental gamma crystal in the metal and the absence of fractional crystallization strongly support the hypothesis that IIE melting was the result of impacts. To summarize, the weight of the evidence favors the conclusion that IIE meteorites were formed by one or more impacts on an HH asteroid. The target probably had a

  8. The Self-Formation of Collaborative Groups in a Problem Based Learning Environment

    ERIC Educational Resources Information Center

    Raiyn, Jamal; Tilchin, Oleg

    2016-01-01

    The aim of this paper is to present "the three steps method" of the self-formation of collaborative groups in a problem-based learning environment. The self-formation of collaborative groups is based on sharing of accountability among students for solving instructional problems. The steps of the method are planning collaborative problem…

  9. Group, One-on-One, or Internet? Preferences for Mindfulness Meditation Delivery Format and their Predictors

    PubMed Central

    Wahbeh, Helané; Svalina, Matthew N.; Oken, Barry S.

    2015-01-01

    Objectives Group mindfulness meditation interventions have improved symptoms in many health conditions. However, many people are unwilling to receive group treatment, so alternative delivery methods such as individual and internet may be a useful option. The study objective was to examine mindfulness meditation intervention delivery format preferences and their relationship to potential predictors. Design An online survey was conducted of adult English speakers. Data was collected on interest and preference for internet, individual, or group formats of a mindfulness meditation intervention. Age, gender, personality, and posttraumatic stress disorder score and status and depression status were also collected. Results and Conclusions 500 eligible participants completed the survey (mean age 39±15; range 18–70; 68% female). Participants were more interested in the Internet (n=356) and individual formats (n=384) than the group format (n=245). Fifty-five participants (11%) said they would refuse a group format. Internet was the first choice format for most participants (Internet 212 (43%), Individual 187 (38%), Group 97 (20%) and group was the last choice for most participants (Internet 140 (29%), Individual 70 (14%), Group 279 (57%)). Age, extraversion and emotional stability were significant in predicting first choice format. These results support the need for more research and implementation of alternative mindfulness meditation intervention delivery formats. Future research will incorporate additional predictors and include a broader range of participants. PMID:27057260

  10. Meteorological Support Interface Control Working Group (MSICWG) Instrumentation, Data Format, and Networks Document

    NASA Technical Reports Server (NTRS)

    Brenton, James; Roberts, Barry C.

    2017-01-01

    The purpose of this document is to provide an overview of instrumentation discussed at the Meteorological Interface Control Working Group (MSICWG), a reference for data formats currently used by members of the group, a summary of proposed formats for future use by the group, an overview of the data networks of the group's members. This document will be updated as new systems are introduced, old systems are retired, and when the MSICWG community necessitates a change to the formats. The MSICWG consists of personnel from the National Aeronautics and Space Administration (NASA) Kennedy Space Center (KSC), NASA Marshall Space Flight Center (MSFC), NASA Johnson Space Center (JSC), National Oceanic and Atmospheric Administration National Weather Service Spaceflight Meteorology Group (SMG), and the United States Air Force (USAF) 45th Space Wing and Weather Squadron. The purpose of the group is to coordinate the distribution of weather related data to support NASA space launch related activities.

  11. Applying Trauma-Focused Cognitive-Behavioral Therapy in Group Format.

    PubMed

    Deblinger, Esther; Pollio, Elisabeth; Dorsey, Shannon

    2016-02-01

    Trauma-focused cognitive-behavioral therapy (TF-CBT), a well-established, evidence-based treatment for children who have experienced trauma, has been increasingly utilized in a group format. Group therapy formats are appealing because they can be highly effective and have the potential to reach larger numbers of clients. Moreover, TF-CBT group delivery may be particularly valuable in reducing the feelings of shame, isolation, and stigma experienced by youth and their caregivers in the aftermath of traumatic experiences. This article reviews the group TF-CBT research, discusses the therapeutic benefits of TF-CBT therapy groups, and provides clinical and logistical guidance for implementing TF-CBT in group format, including a session-by-session protocol. Future directions for research and clinical work in this area are also discussed. © The Author(s) 2015.

  12. Networking the seceder model: Group formation in social and economic systems

    NASA Astrophysics Data System (ADS)

    Grönlund, Andreas; Holme, Petter

    2004-09-01

    The seceder model illustrates how the desire to be different from the average can lead to formation of groups in a population. We turn the original, agent based, seceder model into a model of network evolution. We find that the structural characteristics of our model closely match empirical social networks. Statistics for the dynamics of group formation are also given. Extensions of the model to networks of companies are also discussed.

  13. Networking the seceder model: Group formation in social and economic systems.

    PubMed

    Grönlund, Andreas; Holme, Petter

    2004-09-01

    The seceder model illustrates how the desire to be different from the average can lead to formation of groups in a population. We turn the original, agent based, seceder model into a model of network evolution. We find that the structural characteristics of our model closely match empirical social networks. Statistics for the dynamics of group formation are also given. Extensions of the model to networks of companies are also discussed.

  14. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  15. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  16. Dispersal, group formation and kinship in the black-faced lion tamarin (Leontopithecus caissara).

    PubMed

    Nascimento, Alexandre T A; Nali, Camila; da Fonseca, Gustavo A B

    2014-01-01

    We report on (i) new group formation, (ii) sex differences in dispersal and (iii) dispersal distance over 6 years for 3 social groups of the black-faced lion tamarin (Leontopithecus caissara) in the vicinity of Ariri, São Paulo state, Brazil. The groups were: Bina (monitored for 74 months), BM5 (52 months) and Teca (13 months). Each group was censused once a week and monitored for 3 days each month. Mating opportunities were found to be the incentive for young adult black-faced lion tamarins to either disperse or remain in their kin group. Young adults show delayed dispersal that is related to the cooperative breeding system characteristic of the Callitrichidae and to a low population density which hinders the formation of new breeding pairs. Our findings suggest that in L. caissara (i) both sexes disperse, (ii) successful immigration is related to breeding opportunities in an existing group, (iii) female immigration motivates male emigration and the formation of new groups, and (iv) emigrants tend to form new groups close to their natal groups. These patterns of dispersal and formation of new groups are efficient because the species has been able to avoid loss of genetic diversity despite their small population size. 2014 S. Karger AG, Basel

  17. Micromorphologic evidence for paleosol development in the Endicott group, Siksikpuk formation, Kingak(?) shale, and Ipewik formation, western Brooks range, Alaska

    USGS Publications Warehouse

    Dumoulin, Julie A.; White, Tim

    2005-01-01

    Micromorphologic evidence indicates the presence of paleosols in drill-core samples from four sedimentary units in the Red Dog area, western Brooks Range. Well-developed sepic-plasmic fabrics and siderite spherules occur in claystones of the Upper Devonian through Lower Mississippian(?) Kanayut Conglomerate (Endicott Group), the Pennsylvanian through Permian Siksikpuk Formation (Etivluk Group), the Jurassic through Lower Cretaceous Kingak(?) Shale, and the Lower Cretaceous Ipewik Formation. Although exposure surfaces have been previously recognized in the Endicott Group and Kingak Shale on the basis of outcrop features, our study is the first microscopic analysis of paleosols from these units, and it provides the first evidence of subaerial exposure in the Siksikpuk and Ipewik Formations. Regional stratigraphic relations and geochemical data support our interpretations. Paleosols in the Siksikpuk, Kingak, and Ipewik Formations likely formed in nearshore coastal-plain environments, with pore waters subjected to inundation by the updip migration of slightly brackish ground water, whereas paleosols in the Kanayut Conglomerate probably formed in a more distal setting relative to a marine basin.

  18. Prevalence, Formation, Maintenance, and Evaluation of Interdisciplinary Student Aging Interest Groups

    ERIC Educational Resources Information Center

    Jones, Katherine J.; Vandenberg, Edward V.; Bottsford, Lisa

    2011-01-01

    The authors describe the prevalence, formation, maintenance, and evaluation of student aging interest groups. They conducted a cross-sectional electronic survey of the 46 academic medical centers funded by the Donald W. Reynolds Foundation. To evaluate their group of approximately 50 students, the authors conducted an electronic pretest and…

  19. Exploring Teacher Beliefs and Use of Acceleration, Ability Grouping, and Formative Assessment

    ERIC Educational Resources Information Center

    Missett, Tracy C.; Brunner, Marguerite M.; Callahan, Carolyn M.; Moon, Tonya R.; Azano, Amy Price

    2014-01-01

    Few academic interventions for gifted students have generated more empirical support than acceleration and ability grouping, and formative assessment is advocated as a tool that educators can use to appropriately integrate accelerative practices and ability grouping into the classroom. However, the empirical support for accelerative practices,…

  20. A Genetic Algorithm Approach for Group Formation in Collaborative Learning Considering Multiple Student Characteristics

    ERIC Educational Resources Information Center

    Moreno, Julian; Ovalle, Demetrio A.; Vicari, Rosa M.

    2012-01-01

    Considering that group formation is one of the key processes in collaborative learning, the aim of this paper is to propose a method based on a genetic algorithm approach for achieving inter-homogeneous and intra-heterogeneous groups. The main feature of such a method is that it allows for the consideration of as many student characteristics as…

  1. A Genetic Algorithm Approach for Group Formation in Collaborative Learning Considering Multiple Student Characteristics

    ERIC Educational Resources Information Center

    Moreno, Julian; Ovalle, Demetrio A.; Vicari, Rosa M.

    2012-01-01

    Considering that group formation is one of the key processes in collaborative learning, the aim of this paper is to propose a method based on a genetic algorithm approach for achieving inter-homogeneous and intra-heterogeneous groups. The main feature of such a method is that it allows for the consideration of as many student characteristics as…

  2. Exploring Teacher Beliefs and Use of Acceleration, Ability Grouping, and Formative Assessment

    ERIC Educational Resources Information Center

    Missett, Tracy C.; Brunner, Marguerite M.; Callahan, Carolyn M.; Moon, Tonya R.; Azano, Amy Price

    2014-01-01

    Few academic interventions for gifted students have generated more empirical support than acceleration and ability grouping, and formative assessment is advocated as a tool that educators can use to appropriately integrate accelerative practices and ability grouping into the classroom. However, the empirical support for accelerative practices,…

  3. Prevalence, Formation, Maintenance, and Evaluation of Interdisciplinary Student Aging Interest Groups

    ERIC Educational Resources Information Center

    Jones, Katherine J.; Vandenberg, Edward V.; Bottsford, Lisa

    2011-01-01

    The authors describe the prevalence, formation, maintenance, and evaluation of student aging interest groups. They conducted a cross-sectional electronic survey of the 46 academic medical centers funded by the Donald W. Reynolds Foundation. To evaluate their group of approximately 50 students, the authors conducted an electronic pretest and…

  4. The Role of Star Formation in Radio-Loud Galaxy Groups

    NASA Astrophysics Data System (ADS)

    Herbst, Hanna; Wilcots, E.; Hess, K.

    2010-01-01

    X-ray observations have shown that additional non-gravitational processes are required to explain the heating of the intergalactic medium in galaxy groups. The two most likely processes are galactic outflows from starbursts and feedback from AGN. Here, we look at star formation as a possible additional heating mechanism in X-ray luminous groups such as NGC 741, NGC 1052, NGC 524, and NGC 1587. We report on the results of optical imaging of these groups carried out using the WIYN 3.5m telescope with a specific emphasis on measuring the star formation rates of the resident galaxies in each group and estimating the impact of that star formation on the thermodynamics of the intragroup medium.

  5. Group Enrollment and Open Gym Format Decreases Cardiac Rehabilitation Wait Times.

    PubMed

    Bachmann, Justin M; Klint, Zachary W; Jagoda, Allison M; McNatt, Jeremy K; Abney, Lesa R; Huang, Shi; Liddle, David G; Frontera, Walter R; Freiberg, Matthew S

    2017-09-01

    Wait times for the first cardiac rehabilitation (CR) session are inversely related to CR participation rates. We hypothesized that changing from individually scheduled appointments to a group enrollment and open gym format, in which patients were enrolled during group intake sessions and could arrive for subsequent CR sessions any time during open gym periods, would decrease wait times. A total of 603 patients enrolled in CR at Vanderbilt University Medical Center from July 2012 to December 2014 were included in the study. We evaluated the effect of changing to a group enrollment and open gym format after adjusting for referral diagnosis, insurance status, seasonality, and other factors. We compared outcomes, including exercise capacity and quality of life, between the 2 groups. Patients in the group enrollment and open gym format had significantly lower average wait times than those receiving individual appointments (14.9 vs 19.5 days, P < .001). After multivariable adjustment, the new CR delivery model was associated with a 22% (3.7 days) decrease in average wait times (95% CI, 1.9-5.6, P < .001). Patients completing CR had equally beneficial changes in 6-minute walk distance and Patient Health Questionnaire scores between the 2 groups, although there was no significant difference in participation rates or the number of sessions attended. Implementation of a group enrollment and open gym format was associated with a significant decrease in wait times for first CR sessions. This CR delivery model may be an option for programs seeking to decrease wait times.

  6. Using game format in small group classes for pharmacotherapeutics case studies.

    PubMed

    Patel, Jeegisha

    2008-02-15

    To incorporate games in classroom teaching to encourage student interest and participation in a small group pharmacy therapeutics case studies class. Using a television quiz show and classic board game format, students and the instructor developed games to discuss patient care plans. At the end of the course, a questionnaire was administered to assess students' attitudes and perception of using game format in the class and whether this teaching method was useful in reinforcing therapeutic knowledge. The majority of the students felt that games were beneficial in their learning process. The game format also resulted in higher student participation scores. The game-format approach to learning aroused student interest, enhanced participation, and improved their participation grades. Although the game format of leaning is an effective way of actively engaging students in higher leaning, determining how these games improve test scores will require further assessment.

  7. Do I Know You? How Individual Recognition Affects Group Formation and Structure

    PubMed Central

    2017-01-01

    Groups in nature can be formed by interactions between individuals, or by external pressures like predation. It is reasonable to assume that groups formed by internal and external conditions have different dynamics and structures. We propose a computational model to investigate the effects of individual recognition on the formation and structure of animal groups. Our model is composed of agents that can recognize each other and remember previous interactions, without any external pressures, in order to isolate the effects of individual recognition. We show that individual recognition affects the number and size of groups, and the modularity of the social networks. This model can be used as a null model to investigate the effects of external factors on group formation and persistence. PMID:28125708

  8. Scappoose Formation, Columbia County, Oregon: new evidence of age and relation to Columbia River basalt group

    SciTech Connect

    VanAtta, R.O.; Kelty, K.B.

    1985-05-01

    The Scappoose Formation, considered to be late Oligocene to early Miocene in age, was originally believed to be disconformably separated from both the underlying Pittsburg Bluff Formation and the overlying Yakima subgroup of the Columbia River Basalt Group. Recent mapping and petrography show that it lies disconformably on both the Keasey and Pittsburg Bluff Formations, and interfingers with the Yakima Basalt. The Scappoose is composed of fluvial sandstone, conglomerate, and carbonaceous to coal-bearing mud rock, intertongued with shallow neritic to estuarine siltstone, mud rock, and minor sandstone. Chemistry of basalt clasts from fluvial conglomerates reveals that they are derived from the Yakima subgroup. Basalt conglomerate and palagonitic sediments in the upper part of the formation are intercalated with Grande Ronde basalt (Yakima subgroup) flows at many localities. Flows of Yakima Basalt are also invasive into originally wet, unconsolidated Scappoose sediment. Grande Ronde basalt and the Frenchman Springs Member of the Wanapum basalt overlie conglomerate of the Scappoose. In places, the Scappoose Formation is absent, and Yakima Basalt lies directly on the Pittsburg Bluff and Keasey Formations. The thickness of both the Scappoose Formation and the Columbia River Basalt Group varies widely, indicating that both were deposited over a paleotopography with a relief up to 800 ft (245 m). The definition of the boundaries of the Scappoose Formation should be revised, owing to the disconformable relation of the Scappoose to both the underlying Keasey and Pittsburg Bluff Formations and to the Scappoose's intercalation with the overlying Yakima Basalt. Definition of age must also be revised, inasmuch as sedimentation of the formation was coeval with Columbia River Basalt volcanism.

  9. A FORMATION SCENARIO OF YOUNG STELLAR GROUPS IN THE REGION OF THE SCORPIO CENTAURUS OB ASSOCIATION

    SciTech Connect

    Ortega, V. G.; Jilinski, E.; De la Reza, R.; Bazzanella, B.

    2009-04-15

    The main objective of this work is to investigate the role played by Lower Centaurus Crux (LCC) and Upper Centaurus Lupus (UCL), both subcomponents of the Scorpio Centaurus OB association (Sco-Cen), in the formation of the groups {beta} Pictoris, TW Hydrae, and the {eta} Chamaeleontis cluster. The dynamical evolution of all the stellar groups involved and of the bubbles and shells blown by LCC and UCL are calculated, and followed from the past to the present. This leads to a formation scenario in which (1) the groups {beta} Pictoris, TW Hydrae were formed in the wake of the shells created by LCC and UCL, (2) the young cluster {eta} Chamaeleontis was born as a consequence of the collision of the shells of LCC and UCL, and (3) the formation of Upper Scorpius (US), the other main subcomponent of the Sco-Cen association, may have been started by the same process that created {eta} Chamaeleontis.

  10. Illusory correlation and group impression formation in young and older adults.

    PubMed

    Mutter, S A

    2000-07-01

    This study investigated whether a greater illusory correlation bias is present in older adults' memory and evaluative judgment for majority and minority social groups and, if so, whether this bias might be due to an age-related decline in the ability to engage in on-line processing of group-trait information. Young and older adults read desirable and undesirable trait adjectives about the members of 2 groups under either no-distraction or distraction conditions. Group A had twice as many members as Group B and, for both groups, desirable traits occurred twice as often as undesirable traits. Afterwards, participants completed group-trait memory and evaluative judgment tasks. Greater illusory correlation in memory and evaluative judgment after distraction suggested that diverting resources to competing tasks produced deficits in both memory for specific group-trait information and on-line group impression formation. Older adults' memory for specific group-trait information was disrupted more by distraction than was young adults' memory. However, there were no age differences in evaluative judgment after either distraction condition, suggesting that on-line impression formation activities remain intact in old age. These findings are interpreted within the framework of fuzzy trace theory.

  11. You want to give a good impression? Be honest! Moral traits dominate group impression formation.

    PubMed

    Brambilla, Marco; Sacchi, Simona; Rusconi, Patrice; Cherubini, Paolo; Yzerbyt, Vincent Y

    2012-03-01

    Research has shown that warmth and competence are core dimensions on which perceivers judge others and that warmth has a primary role at various phases of impression formation. Three studies explored whether the two components of warmth (i.e., sociability and morality) have distinct roles in predicting the global impression of social groups. In Study 1 (N= 105) and Study 2 (N= 112), participants read an immigration scenario depicting an unfamiliar social group in terms of high (vs. low) morality, sociability, and competence. In both studies, participants were asked to report their global impression of the group. Results showed that global evaluations were better predicted by morality than by sociability or competence-trait ascriptions. Study 3 (N= 86) further showed that the effect of moral traits on group global evaluations was mediated by the perception of threat. The importance of these findings for the impression-formation process is discussed.

  12. Timing of the Jiufotang Formation (Jehol Group) in Liaoning, northeastern China, and its implications

    NASA Astrophysics Data System (ADS)

    He, H. Y.; Wang, X. L.; Zhou, Z. H.; Wang, F.; Boven, A.; Shi, G. H.; Zhu, R. X.

    2004-06-01

    The timing of the Jiufotang Formation remains speculative despite recent progress in the study of the Jehol Biota. In this paper we contribute to this topic with 40Ar/39Ar dating on K-feldspar (sanidine and orthoclase) from tuffs interbedded within the fossil-bearing shales of the Jiufotang Formation, from the upper part of the Jehol Group in Chaoyang, Liaoning, northeastern China. 40Ar/39Ar step heating analyses of K-feldspar and the SHRIMP U-Pb zircon data indicate that tuffs at the Shangheshou section erupted at 120.3 +/- 0.7 million years ago. This result confirms an Aptian age for the Jiufotang Formation that was mainly based on biostratigraphic evidence. It also places stringent controls on the age of the fossils from the formation, providing a minimum age (120 Ma) for the four-winged dinosaur, Microraptor, and the seed-eating bird, Jeholornis.

  13. Group Formation Based on Learning Styles: Can It Improve Students' Teamwork?

    ERIC Educational Resources Information Center

    Kyprianidou, Maria; Demetriadis, Stavros; Tsiatsos, Thrasyvoulos; Pombortsis, Andreas

    2012-01-01

    This work explores the impact of teacher-led heterogeneous group formation on students' teamwork, based on students' learning styles. Fifty senior university students participated in a project-based course with two key organizational features: first, a web system (PEGASUS) was developed to help students identify their learning styles and…

  14. Group Formation Based on Learning Styles: Can It Improve Students' Teamwork?

    ERIC Educational Resources Information Center

    Kyprianidou, Maria; Demetriadis, Stavros; Tsiatsos, Thrasyvoulos; Pombortsis, Andreas

    2012-01-01

    This work explores the impact of teacher-led heterogeneous group formation on students' teamwork, based on students' learning styles. Fifty senior university students participated in a project-based course with two key organizational features: first, a web system (PEGASUS) was developed to help students identify their learning styles and…

  15. Group Formation for Web-Based Collaborative Learning with Personality Information

    ERIC Educational Resources Information Center

    Hishina, Masateru; Okada, Roberto; Suzuki, Katsuaki

    2005-01-01

    This article addresses the question of how to build human relations in web-based collaborative learning. Although the field of web-based education/training (WBE/T) has grown rapidly in the last few years, there has been little systematic research on the issue of group formation in such environments. It is the difficult to build human relations in…

  16. Effect of Peer Evaluation Format on Student Engagement in a Group Project

    ERIC Educational Resources Information Center

    Tessier, Jack T.

    2012-01-01

    Active participation in classrooms often involves group work. In order to examine the effect of using peer evaluations as part of that experience, this study measured the influence of four formats of peer evaluation on students' perceptions of fairness of the peer evaluation method, its impact on peer engagement, and peer evaluation scores. The…

  17. Comparing Two Cooperative Small Group Formats Used with Physical Therapy and Medical Students

    ERIC Educational Resources Information Center

    D'Eon, Marcel; Proctor, Peggy; Reeder, Bruce

    2007-01-01

    This study compared "Structured Controversy" (a semi-formal debate like small group activity) with a traditional open discussion format for medical and physical therapy students. We found that those students who had participated in Structured Controversy changed their personal opinion on the topic more than those who were in the Open Discussion…

  18. Comparing Two Cooperative Small Group Formats Used with Physical Therapy and Medical Students

    ERIC Educational Resources Information Center

    D'Eon, Marcel; Proctor, Peggy; Reeder, Bruce

    2007-01-01

    This study compared "Structured Controversy" (a semi-formal debate like small group activity) with a traditional open discussion format for medical and physical therapy students. We found that those students who had participated in Structured Controversy changed their personal opinion on the topic more than those who were in the Open Discussion…

  19. Chondrule formation, metamorphism, brecciation, an important new primary chondrule group, and the classification of chondrules

    NASA Technical Reports Server (NTRS)

    Sears, Derek W. G.; Shaoxiong, Huang; Benoit, Paul H.

    1995-01-01

    The recently proposed compositional classification scheme for meteoritic chondrules divides the chondrules into groups depending on the composition of their two major phases, olivine (or pyroxene) and the mesostasis, both of which are genetically important. The scheme is here applied to discussions of three topics: the petrographic classification of Roosevelt County 075 (the least-metamorphosed H chondrite known), brecciation (an extremely important and ubiquitous process probably experienced by greater than 40% of all unequilibrated ordinary chondrites), and the group A5 chondrules in the least metamorphosed ordinary chondrites which have many similarities to chondrules in the highly metamorphosed 'equilibrated' chondrites. Since composition provides insights into both primary formation properties of the chondruies and the effects of metamorphism on the entire assemblage it is possible to determine the petrographic type of RC075 as 3.1 with unique certainty. Similarly, the near scheme can be applied to individual chondrules without knowledge of the petrographic type of the host chondrite, which makes it especially suitable for studying breccias. Finally, the new scheme has revealed the existence of chondrules not identified by previous techniques and which appear to be extremely important. Like group A1 and A2 chondrules (but unlike group B1 chondrules) the primitive group A5 chondruies did not supercool during formation, but unlike group A1 and A2 chondrules (and like group B1 chondrules) they did not suffer volatile loss and reduction during formation. It is concluded that the compositional classification scheme provides important new insights into the formation and history of chondrules and chondrites which would be overlooked by previous schemes.

  20. Mapping the Star Formation History of the Local Group with NHST

    NASA Astrophysics Data System (ADS)

    Brown, T. M.

    2003-05-01

    The color-magnitude diagram (CMD) is the most fundamental tool for studying the star formation history of nearby stellar populations. Strong constraints on the ages of stellar populations come from CMDs reaching the main sequence, and with the Hubble Space Telescope (HST), it is possible to produce such a CMD for stars at any distance within the Local Group. Unfortunately, resolving the main sequence in old populations beyond the satellites of the Milky Way requires an enormous investment of HST time, meaning that only a few pencil beams can be explored within the remaining HST mission. In strong contrast, an 8 meter UV-optical space telescope, diffraction limited at 0.5 microns, could map the star formation history of all galaxies in the Local Group: It would take only one hour to resolve the main sequence in any Local Group galaxy, allowing the exploration of hundreds of sight-lines in a reasonable program.

  1. The Ultraviolet and Infrared Star Formation Rates of Compact Group Galaxies: An Expanded Sample

    NASA Technical Reports Server (NTRS)

    Lenkic, Laura; Tzanavaris, Panayiotis; Gallagher, Sarah C.; Desjardins, Tyler D.; Walker, Lisa May; Johnson, Kelsey E.; Fedotov, Konstantin; Charlton, Jane; Cardiff, Ann H.; Durell, Pat R.

    2016-01-01

    Compact groups of galaxies provide insight into the role of low-mass, dense environments in galaxy evolution because the low velocity dispersions and close proximity of galaxy members result in frequent interactions that take place over extended time-scales. We expand the census of star formation in compact group galaxies by Tzanavaris et al. (2010) and collaborators with Swift UVOT, Spitzer IRAC and MIPS 24 m photometry of a sample of 183 galaxies in 46 compact groups. After correcting luminosities for the contribution from old stellar populations, we estimate the dust-unobscured star formation rate (SFRUV) using the UVOT uvw2 photometry. Similarly, we use the MIPS 24 m photometry to estimate the component of the SFR that is obscured by dust (SFRIR). We find that galaxies which are MIR-active (MIR-red), also have bluer UV colours, higher specific SFRs, and tend to lie in Hi-rich groups, while galaxies that are MIR-inactive (MIR-blue) have redder UV colours, lower specific SFRs, and tend to lie in Hi-poor groups. We find the SFRs to be continuously distributed with a peak at about 1 M yr1, indicating this might be the most common value in compact groups. In contrast, the specific SFR distribution is bimodal, and there is a clear distinction between star-forming and quiescent galaxies. Overall, our results suggest that the specific SFR is the best tracer of gas depletion and galaxy evolution in compact groups.

  2. F-Formation Detection: Individuating Free-Standing Conversational Groups in Images

    PubMed Central

    Setti, Francesco; Russell, Chris; Bassetti, Chiara; Cristani, Marco

    2015-01-01

    Detection of groups of interacting people is a very interesting and useful task in many modern technologies, with application fields spanning from video-surveillance to social robotics. In this paper we first furnish a rigorous definition of group considering the background of the social sciences: this allows us to specify many kinds of group, so far neglected in the Computer Vision literature. On top of this taxonomy we present a detailed state of the art on the group detection algorithms. Then, as a main contribution, we present a brand new method for the automatic detection of groups in still images, which is based on a graph-cuts framework for clustering individuals; in particular, we are able to codify in a computational sense the sociological definition of F-formation, that is very useful to encode a group having only proxemic information: position and orientation of people. We call the proposed method Graph-Cuts for F-formation (GCFF). We show how GCFF definitely outperforms all the state of the art methods in terms of different accuracy measures (some of them are brand new), demonstrating also a strong robustness to noise and versatility in recognizing groups of various cardinality. PMID:25996922

  3. Molecularly oriented surface relief formation in polymethacrylates comprising N-benzylideneaniline derivative side groups

    NASA Astrophysics Data System (ADS)

    Kawatsuki, Nobuhiro; Hosoda, Risa; Kondo, Mizuho; Sasaki, Tomoyuki; Ono, Hiroshi

    2014-12-01

    Molecularly oriented surface relief (SR) formation in polymethacrylates with N-benzylideneaniline (NBA) derivative side groups is investigated by holographic exposure using a 325 nm He-Cd laser. Because the NBA moieties show a photoinduced orientation perpendicular to the polarization of light, polarization holography successfully forms a molecularly oriented SR structure in accordance with the polarization distribution that includes p-polarized components. Although intensity holography induces molecular orientation, it does not generate a satisfactory SR structure. In all the holographic modes, the SR depth depends on the direction of the C=N bonds in the NBA moieties and the photoproducts affect the SR formation ability.

  4. Star formation properties of Hickson Compact Groups based on deep Hα imaging

    NASA Astrophysics Data System (ADS)

    Eigenthaler, Paul; Ploeckinger, Sylvia; Verdugo, Miguel; Ziegler, Bodo

    2015-08-01

    We present deep Hα imaging of seven Hickson Compact Groups (HCGs) using the 4.1-m Southern Astrophysics Research (SOAR) Telescope. The high spatial resolution of the observations allows us to study both the integrated star formation properties of the main galaxies as well as the 2D distribution of star-forming knots in the faint tidal arms that form during interactions between the individual galaxies. We derive star formation rates and stellar masses for group members and discuss their position relative to the main sequence of star-forming galaxies. Despite the existence of tidal features within the galaxy groups, we do not find any indication for enhanced star formation in the selected sample of HCGs. We study azimuthally averaged Hα profiles of the galaxy discs and compare them with the g' and r' surface brightness profiles. We do not find any truncated galaxy discs but reveal that more massive galaxies show a higher light concentration in Hα than less massive ones. We also see that galaxies that show a high light concentration in r', show a systematic higher light concentration in Hα. Tidal dwarf galaxy (TDG) candidates have been previously detected in R-band images for two groups in our sample but we find that most of them are likely background objects as they do not show any emission in Hα. We present a new TDG candidate at the tip of the tidal tail in HCG 91.

  5. Formation of carbonyl groups on cellulose during ozone treatment of pulp: consequences for pulp bleaching.

    PubMed

    Pouyet, Frédéric; Chirat, Christine; Potthast, Antje; Lachenal, Dominique

    2014-08-30

    The formation of carbonyl groups during the ozone treatment (Z) of eucalyptus (Eucalyptus grandis and Eucalyptus urophylla hybrid) kraft pulps and their behaviors during subsequent alkaline stages were investigated by the CCOA method with carbazole-9-carboxylic acid [2-(2-aminooxethoxy)-ethoxy] amide (CCOA) as the carbonyl-selective fluorescence label. Several pulp samples with or without lignin and hexenuronic acids (hexA) were used to elucidate the effects of these components when present in unbleached kraft pulp. Both hexA and lignin increased the formation of carbonyl groups on cellulose and hemicellulose during ozonation. It was concluded that radicals are likely formed when ozone reacts with either lignin or hexA. These carbonyl groups were involved in cellulose depolymerization during subsequent alkaline extraction stages with sodium hydroxide (E) and alkaline hydrogen peroxide (P, in ZEP or ZP). Their numbers decreased after E but increased during P when H2O2 was not stabilized enough. Several ways to minimize the occurrence of carbonyl group formation are suggested. Copyright © 2014. Published by Elsevier Ltd.

  6. Effects of surface functional groups on the formation of nanoparticle-protein corona

    NASA Astrophysics Data System (ADS)

    Podila, R.; Chen, R.; Ke, P. C.; Brown, J. M.; Rao, A. M.

    2012-12-01

    Herein, we examined the dependence of protein adsorption on the nanoparticle surface in the presence of functional groups. Our UV-visible spectrophotometry, transmission electron microscopy, infrared spectroscopy, and dynamic light scattering measurements evidently suggested that the functional groups play an important role in the formation of nanoparticle-protein corona. We found that uncoated and surfactant-free silver nanoparticles derived from a laser ablation process promoted a maximum protein (bovine serum albumin) coating due to increased changes in entropy. On the other hand, bovine serum albumin displayed a relatively lower affinity for electrostatically stabilized nanoparticles due to the constrained entropy changes.

  7. Formation of Pervaporation Membranes from Polyphosphazenes Having Hydrophilic and Hydrophobic Pendant Groups: Synthesis and Characterization

    SciTech Connect

    Stewart, Frederick Forrest; Harrup, Mason Kurt; Luther, Thomas Alan; Orme, Christopher Joseph; Lash, Robert Paul

    2001-02-01

    A series of new polyphosphazene polymers were synthesized using three different pendant groups with the goal of probing structure-function relationships between pendant group substitution and polymer swelling/water flux through thin dense films. Formation of polymers with relative degrees of hydrophilicity was probed by varying the stoichiometry of the pendant groups attached to the phosphazene backbone: p-methoxyphenol, 2-(2-methoxyethoxy)ethanol, and o-allylphenol. The polymers in this study were characterized using NMR, thermal methods, and dilute solution light-scattering techniques. These techniques revealed that the polymers were amorphous high polymers (Mw = 105-107) with varying ratios of pendant groups as determined by integration of the 1H- and 31P-NMR spectra. Thin dense film membranes were solution-cast with azo-bis(cyclohexane)carbonitrile included in the matrix and crosslinked using thermal initiation.

  8. Contribution of methyl group to secondary organic aerosol formation from aromatic hydrocarbon photooxidation

    NASA Astrophysics Data System (ADS)

    Li, Lijie; Qi, Li; Cocker, David R.

    2017-02-01

    The complete atmospheric oxidation pathways leading to secondary organic aerosol remain elusive for aromatic compounds including the role of methyl substitutes on oxidation. This study investigates the contribution of methyl group to Secondary Organic Aerosol (SOA) formation during the photooxidation of aromatic hydrocarbons under low NOx condition by applying methyl carbon labeled aromatic hydrocarbons ((13C2) m-xylene and (13C2) p-xylene). Particle and gas phase oxidation products are analyzed by a series of mass spectrometers (HR-TOF-AMS, PTR-MS and SIFT-MS). The methyl group carbon containing oxidation products partition to the particle-phase at a lower rate than the carbons originating from the aromatic ring as a result of ring opening reactions. Further, the methyl carbon in the original aromatic structure is at least 7 times less likely to be oxidized when forming products that partition to SOA than the aromatic ring carbon. Therefore, oxidation of the methyl group in xylenes exerts little impact on SOA formation in current study. This study provides supporting evidence for a recent finding - a similarity in the SOA formation and composition from aromatic hydrocarbons regardless of the alkyl substitutes.

  9. Upward-migrating methane induced seismic chimney formation in the Nordland Group, Southern Viking Graben

    NASA Astrophysics Data System (ADS)

    Kempka, Thomas; Unger, Victoria; Kühn, Michael

    2016-04-01

    The Nordland Group in the Southern Viking Graben hosts seismic chimneys, represented by anomalies in seismic data and determined by residual methane accumulations. These seismic chimneys are generally interpreted as focused fluid flow structures, and thus pose the risk of potential fluid leakage in geological subsurface utilization. The aim of the present study was to assess two popular scientific hypotheses on seismic chimney formation in the Nordland Group. The first one assumes excess pore pressure to result from buoyancy effects caused by upward-migrating methane and the development of a gas column with a thickness of several hundred meters, whereas the second one considers the load of the Fennoscandian ice sheet to be responsible for occurrence of hydraulic fracturing. In this context, we applied coupled hydromechanical simulations to determine the mechanism inducing the formation of these potential leakage pathways. Our simulation results demonstrate that hydraulic fracturing in the Nordland Group already occurs before the maximum methane column heights develop below. Consequently, the load of the Fennoscandian ice sheet is not initiating seismic chimneys formation.

  10. The ultraviolet and infrared star formation rates of compact group galaxies: an expanded sample

    NASA Astrophysics Data System (ADS)

    Lenkić, Laura; Tzanavaris, Panayiotis; Gallagher, Sarah C.; Desjardins, Tyler D.; Walker, Lisa May; Johnson, Kelsey E.; Fedotov, Konstantin; Charlton, Jane; Hornschemeier, Ann E.; Durrell, Pat R.; Gronwall, Caryl

    2016-07-01

    Compact groups of galaxies provide insight into the role of low-mass, dense environments in galaxy evolution because the low velocity dispersions and close proximity of galaxy members result in frequent interactions that take place over extended time-scales. We expand the census of star formation in compact group galaxies by Tzanavaris et al. (2010) and collaborators with Swift UVOT, Spitzer IRAC and MIPS 24 μm photometry of a sample of 183 galaxies in 46 compact groups. After correcting luminosities for the contribution from old stellar populations, we estimate the dust-unobscured star formation rate (SFRUV) using the UVOT uvw2 photometry. Similarly, we use the MIPS 24 μm photometry to estimate the component of the SFR that is obscured by dust (SFRIR). We find that galaxies which are MIR-active (MIR-`red'), also have bluer UV colours, higher specific SFRs, and tend to lie in H I-rich groups, while galaxies that are MIR-inactive (MIR-`blue') have redder UV colours, lower specific SFRs, and tend to lie in H I-poor groups. We find the SFRs to be continuously distributed with a peak at about 1 M⊙ yr-1, indicating this might be the most common value in compact groups. In contrast, the specific SFR distribution is bimodal, and there is a clear distinction between star-forming and quiescent galaxies. Overall, our results suggest that the specific SFR is the best tracer of gas depletion and galaxy evolution in compact groups.

  11. The anatomy of the NGC5044 group - II. Stellar populations and star formation histories

    NASA Astrophysics Data System (ADS)

    Mendel, J. Trevor; Proctor, Robert N.; Rasmussen, Jesper; Brough, Sarah; Forbes, Duncan A.

    2009-07-01

    The distribution of galaxy properties in groups and clusters holds important information on galaxy evolution and growth of structure in the Universe. While clusters have received appreciable attention in this regard, the role of groups as fundamental to formation of the present-day galaxy population has remained relatively unaddressed. Here, we present stellar ages, metallicities and α-element abundances derived using Lick indices for 67 spectroscopically confirmed members of the NGC5044 galaxy group with the aim of shedding light on galaxy evolution in the context of the group environment. We find that galaxies in the NGC5044 group show evidence for a strong relationship between stellar mass and metallicity, consistent with their counterparts in both higher and lower mass groups and clusters. Galaxies show no clear trend of age or α-element abundance with mass, but these data form a tight sequence when fitted simultaneously in age, metallicity and stellar mass. In the context of the group environment, our data support the tidal disruption of low-mass galaxies at small group-centric radii, as evident from an apparent lack of galaxies below ~109Msolar within ~100kpc of the brightest group galaxy. Using a joint analysis of absorption- and emission-line metallicities, we are able to show that the star-forming galaxy population in the NGC5044 group appears to require gas removal to explain the ~1.5dex offset between absorption- and emission-line metallicities observed in some cases. A comparison with other stellar population properties suggests that this gas removal is dominated by galaxy interactions with the hot intragroup medium.

  12. Spatialy Resolved Star Formation History Movies of 9 Dwarf Irregular Galaxies In The M81 Group.

    NASA Astrophysics Data System (ADS)

    Weisz, Daniel R.; Skillman, E.; Cannon, J.; Dolphin, A.; Kennicutt, R.; Lee, J.; Walter, F.

    2007-12-01

    The role of 'feedback' i.e., supernovae, stellar winds, outflows, in the process of star formation (SF), interstellar medium (ISHM) structure alteration, and galaxy evolution remains an interesting and open question. One way to help define the role of feedback is through observational constraints. Recent HST/ACS observations of 9 dwarf irregular galaxies (dIrrs) in the M81 group will help characterize the spatial and temporal components of feedback in a set of diverse dIrrs, spanning a factor of 6 magnitudes in luminosity, 1000 in current star formation rate, and 0.5 dex in metallicity. Here, I present movies that trace the star formation activity in the recent ( 0.5 Gyrs) history of each M81 dI in our sample. I am able to see how star formation events relate to one another both in time and space. We are able to clearly see the SF duty cycle, periods of activity and quiescence, as well as how events may serve to trigger future events by their spatial and temporal proximity. The M81 dIrr SF movies provide us with unique insight into how stars form and how they impact the evolution of each galaxy. Support for this work is provided by NASA/HST grant GO-10605.01.

  13. Activation of carboxyl group with cyanate: peptide bond formation from dicarboxylic acids.

    PubMed

    Danger, Grégoire; Charlot, Solenne; Boiteau, Laurent; Pascal, Robert

    2012-06-01

    The reaction of cyanate with C-terminal carboxyl groups of peptides in aqueous solution was considered as a potential pathway for the abiotic formation of peptide bonds under the condition of the primitive Earth. The catalytic effect of dicarboxylic acids on cyanate hydrolysis was definitely attributed to intramolecular nucleophilic catalysis by the observation of the 1H-NMR signal of succinic anhydride when reacting succinic acid with KOCN in aqueous solution (pH 2.2-5.5). The formation of amide bonds was noticed when adding amino acids or amino acid derivatives into the solution. The reaction of N-acyl aspartic acid derivatives was observed to proceed similarly and the scope of the cyanate-promoted reaction was analyzed from the standpoint of prebiotic peptide formation. The role of cyanate in activating peptide C-terminus constitutes a proof of principle that intramolecular reactions of adducts of peptides C-terminal carboxyl groups with activating agents represent a pathway for peptide activation in aqueous solution, the relevance of which is discussed in connexion with the issue of the emergence of homochirality.

  14. Effect of estradiol on planktonic growth, coaggregation, and biofilm formation of the Prevotella intermedia group bacteria.

    PubMed

    Fteita, Dareen; Könönen, Eija; Söderling, Eva; Gürsoy, Ulvi Kahraman

    2014-06-01

    Alterations in the quantity and quality of biofilms at gingival margin are considered to play a role in the initiation and development of pregnancy-related gingivitis. Prevotella intermedia sensu lato is able to consume estradiol, the major sex hormone secreted during pregnancy, in the absence of vitamin K. The aim of the study was to examine the effect of estradiol on the planktonic growth, coaggregation, polysaccharide production, and biofilm formation of the P. intermedia group bacteria, namely P. intermedia, Prevotella nigrescens, and Prevotella pallens. In all experiments, the type strain (ATCC) and a clinical strain (AHN) of P. intermedia, P. nigrescens, and P. pallens were incubated with the concentrations of 0, 30, 90, and 120 nmol/L of estradiol. Planktonic growth was assessed by means of the colony forming unit method, while coaggregation and biofilm formation were assessed by spectrophotometric methods. In the determination of protein and polysaccharide levels, the Bradford and phenol-sulfuric acid methods were used, respectively. P. pallens AHN 9283 and P. nigrescens ATCC 33563 increased their numbers at planktonic stage with increasing estradiol concentrations. In 48-h biofilm tests, elevated protein levels were found for both strains of P. intermedia, and the strains P. nigrescens ATCC 33563 and P. pallens AHN 9283 in the presence of estradiol. The P. intermedia strains also increased the levels of polysaccharide formation in the biofilm. Coaggregation of the P. intermedia group organisms with Fusobacterium nucleatum was enhanced only in P. intermedia AHN 8290. In conclusion, our in vitro experiments indicate that estradiol regulates planktonic growth, coaggregation, polysaccharide production, and biofilm formation characteristics of P. intermedia, P. nigrescens, and P. pallens differently. These results may, at least partly, explain the differences seen in their contribution to the pathogenesis of pregnancy-related gingivitis.

  15. Chemoselective methylation of phenolic hydroxyl group prevents quinone methide formation and repolymerization during lignin depolymerization

    DOE PAGES

    Kim, Kwang Ho; Dutta, Tanmoy; Walter, Eric D.; ...

    2017-03-22

    Chemoselective blocking of the phenolic hydroxyl (Ar–OH) group by methylation was found to suppress secondary repolymerization and charring during lignin depolymerization. Methylation of Ar–OH prevents formation of reactive quinone methide intermediates, which are partly responsible for undesirable secondary repolymerization reactions. Instead, this structurally modified lignin produces more relatively low molecular weight products from lignin depolymerization compared to unmodified lignin. This result demonstrates that structural modification of lignin is desirable for production of low molecular weight phenolic products. Finally, this approach could be directed toward alteration of natural lignification processes to produce biomass that is more amenable to chemical depolymerization.

  16. Identification of non-heme diiron proteins that catalyze triple bond and epoxy group formation.

    PubMed

    Lee, M; Lenman, M; Banaś, A; Bafor, M; Singh, S; Schweizer, M; Nilsson, R; Liljenberg, C; Dahlqvist, A; Gummeson, P O; Sjödahl, S; Green, A; Stymne, S

    1998-05-08

    Acetylenic bonds are present in more than 600 naturally occurring compounds. Plant enzymes that catalyze the formation of the Delta12 acetylenic bond in 9-octadecen-12-ynoic acid and the Delta12 epoxy group in 12,13-epoxy-9-octadecenoic acid were characterized, and two genes, similar in sequence, were cloned. When these complementary DNAs were expressed in Arabidopsis thaliana, the content of acetylenic or epoxidated fatty acids in the seeds increased from 0 to 25 or 15 percent, respectively. Both enzymes have characteristics similar to the membrane proteins containing non-heme iron that have histidine-rich motifs.

  17. Side-group size effects on interfaces and glass formation in supported polymer thin films

    NASA Astrophysics Data System (ADS)

    Xia, Wenjie; Song, Jake; Hsu, David D.; Keten, Sinan

    2017-05-01

    Recent studies on glass-forming polymers near interfaces have emphasized the importance of molecular features such as chain stiffness, side-groups, molecular packing, and associated changes in fragility as key factors that govern the magnitude of Tg changes with respect to the bulk in polymer thin films. However, how such molecular features are coupled with substrate and free surface effects on Tg in thin films remains to be fully understood. Here, we employ a chemically specific coarse-grained polymer model for methacrylates to investigate the role of side-group volume on glass formation in bulk polymers and supported thin films. Our results show that bulkier side-groups lead to higher bulk Tg and fragility and are associated with a pronounced free surface effect on overall Tg depression. By probing local Tg within the films, however, we find that the polymers with bulkier side-groups experience a reduced confinement-induced increase in local Tg near a strongly interacting substrate. Further analyses indicate that this is due to the packing frustration of chains near the substrate interface, which lowers the attractive interactions with the substrate and thus lessens the surface-induced reduction in segmental mobility. Our results reveal that the size of the polymer side-group may be a design element that controls the confinement effects induced by the free surface and substrates in supported polymer thin films. Our analyses provide new insights into the factors governing polymer dynamics in bulk and confined environments.

  18. Molecular tectonics: on the formation of 1-D silver coordination networks by thiacalixarenes bearing nitrile groups.

    PubMed

    Kozlova, Marina N; Ferlay, Sylvie; Solovieva, Svetlana E; Antipin, Igor S; Konovalov, Alexander I; Kyritsakas, Nathalie; Hosseini, Mir Wais

    2007-11-28

    Two new p-tert-butylthiacalix[4]arene derivatives 2 and 3 decorated at the lower rim with four nitrile groups have been prepared and structurally characterised in the crystalline phase. The two ligands, differing by the length of the spacer between the calix moiety and the nitrile group, adopt the 1,3-alternate conformation in the solid state. The ligand 3 bearing four (CH(2))(3)CN fragments behaves as a tecton in the presence of silver salts (AgX, X = BF(4), PF(6) or SbF(6)) and leads to the formation of analogous 1-D linear coordination networks. The tecton 3 acts as a bischelate unit and bridges consecutive silver cations adopting a tetrahedral coordination geometry. Anions and solvent molecules occupy the free space between networks and exhibit no specific interactions with the cationic architecture.

  19. Ammonite zonation in condensed zone, middle Ozan formation (Taylor group, upper Cretaceous) in Northeast Texas

    SciTech Connect

    Echols, J.

    1984-04-01

    Recognition of condensed zones is important because they may be marker horizons that are useful in exploration. Such a zone is demonstrated by the occurrence of ammonites belonging to 12 species and 9 genera from the middle Ozan Formation (lower Taylor Marl) in northeast Texas. The 1-foot (0.3-m) thick bed of bioturbated glauconitic biomicrite contains many specimens of disarticulated vertebrates, molluscs, remanie' fossils (blackened phosphatic internal molds), and hiatus concretions. Four of 6 midcontinent ammonite range zones proposed by Cobban and others appear to be represented in the fauna, in ascending order, by Baculites aquilaensis Reeside, Delawarella delawarensis (Morton) (= zones of two unnamed species of Baculites), Baculites obtusus Meek, and Trachyscaphites spiniger porchi Adkins (=zones of Baculites mclearni and B. asperiformis). Young may be correct in assuming that the occurrence of Delawarella delawarensis and Baculites aquilaensis in the Ozan Formation may mean that rocks of the upper Austin Group and parts of the lower Taylor Group are the same age. If correlation with the midcontinent zonation is correct, then the sediments that formed the condensed zone slowly accumulated from 81 to 79 m.y. (mid early Campanian to early late Campanian). Several species of the fauna are preserved as both normal and remanie' fossils, indicating that members of these species lived in the area for an extended period of time, perhaps as a relict fauna. The fauna includes a mixture of cosmopolitan and endemic species (indicating open shelf environment) with several types of heteromorphs (indicating moderate water depths).

  20. New Aspects of the Formation of the β Pictoris Moving Group

    NASA Astrophysics Data System (ADS)

    Ortega, V. G.; de la Reza, R.; Jilinski, E.; Bazzanella, B.

    2004-07-01

    In a previous work, we explored the possibility that the β Pictoris moving group (BPMG), consisting of low-mass post-T Tauri stars, was formed near the Scorpius-Centaurus OB association. The cause of the formation could be a Type II supernova exploding either in Lower Centaurus Crux (LCC) or the Upper Centaurus Lupus (UCL), the two older subgroups of that association. Here we present new results for BPMG. A more detailed analysis of the orbit confinement in this group leads to a star distribution pattern at birth that can be considered as a representation of the density distribution in the natal cloud. We also propose a plausible origin for the supernova that could have triggered the star formation in BPMG by finding the past position of the runaway star HIP 46950. We find that this scenario is capable of explaining the origin of all the members of BPMG proposed by Zuckerman and coworkers and by Song and coworkers, with the exception of HIP 79881, which is probably an old main-sequence interloper.

  1. QUENCHING OF STAR FORMATION IN SLOAN DIGITAL SKY SURVEY GROUPS: CENTRALS, SATELLITES, AND GALACTIC CONFORMITY

    SciTech Connect

    Knobel, Christian; Lilly, Simon J.; Woo, Joanna; Kovač, Katarina

    2015-02-10

    We re-examine the fraction of low-redshift Sloan Digital Sky Survey satellites and centrals in which star formation has been quenched, using the environment quenching efficiency formalism that separates out the dependence of stellar mass. We show that the centrals of the groups containing the satellites are responding to the environment in the same way as their satellites (at least for stellar masses above 10{sup 10.3} M {sub ☉}), and that the well-known differences between satellites and the general set of centrals arise because the latter are overwhelmingly dominated by isolated galaxies. The widespread concept of ''satellite quenching'' as the cause of environmental effects in the galaxy population can therefore be generalized to ''group quenching''. We then explore the dependence of the quenching efficiency of satellites on overdensity, group-centric distance, halo mass, the stellar mass of the satellite, and the stellar mass and specific star formation rate (sSFR) of its central, trying to isolate the effect of these often interdependent variables. We emphasize the importance of the central sSFR in the quenching efficiency of the associated satellites, and develop the meaning of this ''galactic conformity'' effect in a probabilistic description of the quenching of galaxies. We show that conformity is strong, and that it varies strongly across parameter space. Several arguments then suggest that environmental quenching and mass quenching may be different manifestations of the same underlying process. The marked difference in the apparent mass dependencies of environment quenching and mass quenching which produces distinctive signatures in the mass functions of centrals and satellites will arise naturally, since, for satellites at least, the distributions of the environmental variables that we investigate in this work are essentially independent of the stellar mass of the satellite.

  2. Evolution of Compact and Fossil Groups of Galaxies from Semi-analytical Models of Galaxy Formation

    NASA Astrophysics Data System (ADS)

    Farhang, Amin; Khosroshahi, Habib G.; Mamon, Gary A.; Dariush, Ali. A.; Raouf, Mojtaba

    2017-05-01

    We compare the mean mass assembly histories of compact and fossil galaxy groups in the Millennium Dark Matter Simulation and an associated semi-analytic galaxy formation model. Tracing the halo mass of compact groups (CGs) from z = 0 to z = 1 shows that, on average, 55% of the halo mass in CGs is assembled since z˜ 1, compared to 40% of the halo mass in fossil groups (FGs) on the same time interval, indicating that compared to FGs, CGs are relatively younger galaxy systems. At z = 0, for a given halo mass, FGs tend to have a larger concentration than CGs. Investigating the evolution of CG’s parameters reveals that they become more compact with time. CGs at z = 0.5 see their magnitude gaps increase exponentially, but it takes ˜10 Gyr for them to reach a magnitude gap of 2 mag. The slow growth of the magnitude gap leads to only a minority (˜41%) of CGs selected at z = 0.5 turning into a FG by z = 0. Also, while three-quarters of FGs go through a compact phase, most fail to meet the CG isolation criterion, leaving only ˜30% of FGs fully satisfying the CG selection criteria. Therefore, there is no strong link of CGs turning into FGs or FGs originating from CGs. The relation between CGs and FGs is thus more complex, and in most cases, FGs and CGs follow different evolutionary tracks.

  3. The star formation histories of local group dwarf galaxies. II. Searching for signatures of reionization

    SciTech Connect

    Weisz, Daniel R.; Dolphin, Andrew E.; Skillman, Evan D.; Holtzman, Jon; Gilbert, Karoline M.; Dalcanton, Julianne J.; Williams, Benjamin F.

    2014-07-10

    We search for signatures of reionization in the star formation histories (SFHs) of 38 Local Group dwarf galaxies (10{sup 4} < M{sub *} < 10{sup 9} M{sub ☉}). The SFHs are derived from color-magnitude diagrams using archival Hubble Space Telescope/Wide Field Planetary Camera 2 imaging. Only five quenched galaxies (And V, And VI, And XIII, Leo IV, and Hercules) are consistent with forming the bulk of their stars before reionization, when full uncertainties are considered. Observations of 13 of the predicted 'true fossils' identified by Bovill and Ricotti show that only two (Hercules and Leo IV) indicate star formation quenched by reionization. However, both are within the virial radius of the Milky Way and evidence of tidal disturbance complicates this interpretation. We argue that the late-time gas capture scenario posited by Ricotti for the low mass, gas-rich, and star-forming fossil candidate Leo T is observationally indistinguishable from simple gas retention. Given the ambiguity between environmental effects and reionization, the best reionization fossil candidates are quenched low mass field galaxies (e.g., KKR 25).

  4. Possible Microfossils (Warrawoona Group, Towers Formation, Australia, approximately 3.3 - 3.5 Ga)

    NASA Technical Reports Server (NTRS)

    Morris, P. A.; Wentworth, S. J.; Allen, C. C.; McKay, D. S.

    1998-01-01

    Early in the twentieth century there were reports of Archean stromatolite-like structures that were similar to organic rich stromatolites from the base of the Cambrian (600 m.y.). It was not until the latter half of this century that fossilized Archean-age (3.9-2.5 Ga) life forms were found in the Fig Tree Formation of South Africa and the Towers Formation of Australia. Some of the ancient stromatolites contained streaks and clots of kerogen, pyrite grains, remnants of microbial cells, and filaments that represented various stages of preservation, while others appeared to lack fossils. A set of physical criteria was established for evaluating the biogenicity of these Archean discoveries: (1) rocks of unquestionable Archean age; (2) microfossils indigenous to Archean sediments; and (3) microfossils occurring in clasts that are syngenetic with deposition of the sedimentary unit. In the case of bedded cherts, the fossils should predate the cherts; (4) the microfossils are biogenic; and (5) replicate sampling of the fossil-iferous outcrop firmly demonstrates the provenance of these microfossils. Sample 002 from the Precambrian Paleobiology Research Group (PPRG) was examined. This stromatolitic carbonaceous chert contains microbial remains that meet the established criteria [10]. Using a scanning electron microscope (SEM), we have analyzed the morphologies and chemistry of these possible microbial remains.

  5. A novel role for high-mobility group a proteins in cellular senescence and heterochromatin formation.

    PubMed

    Narita, Masashi; Narita, Masako; Krizhanovsky, Valery; Nuñez, Sabrina; Chicas, Agustin; Hearn, Stephen A; Myers, Michael P; Lowe, Scott W

    2006-08-11

    Cellular senescence is a stable state of proliferative arrest that provides a barrier to malignant transformation and contributes to the antitumor activity of certain chemotherapies. Senescent cells can accumulate senescence-associated heterochromatic foci (SAHFs), which may provide a chromatin buffer that prevents activation of proliferation-associated genes by mitogenic transcription factors. Surprisingly, we show that the High-Mobility Group A (HMGA) proteins, which can promote tumorigenesis, accumulate on the chromatin of senescent fibroblasts and are essential structural components of SAHFs. HMGA proteins cooperate with the p16(INK4a) tumor suppressor to promote SAHF formation and proliferative arrest and stabilize senescence by contributing to the repression of proliferation-associated genes. These antiproliferative activities are canceled by coexpression of the HDM2 and CDK4 oncogenes, which are often coamplified with HMGA2 in human cancers. Our results identify a component of the senescence machinery that contributes to heterochromatin formation and imply that HMGA proteins also act in tumor suppressor networks.

  6. Electrostatic-Driven Ridge Formation on Nanoparticles Coated with Charged End-Group Ligands

    SciTech Connect

    Guo, Peijun; Sknepnek, Rastko; Olvera de la Cruz, Monica

    2011-01-01

    Using coarse-grained molecular dynamics simulations, we investigate the surface patterns of charged end-group ligands attached to faceted nanoparticles. A competition between electrostatic repulsion and hydrophobic ligand-ligand attraction leads to the formation of a number of different conformations of the ligand coatings. The most prominent conformation in icosahedral nanoparticles is a ridgelike structure that makes their surfaces highly anisotropic. Meanwhile, bundles seem more prominent than ridges for tetrahedral, cubic, octahedral, and dodecahedral nanoparticles of diameters comparable to the chain length. The applicability of the Debye-Huckel theory to describe the ridges is confirmed by comparing simulations with explicit ion simulations. We argue that a tunable ligand-coating pattern can be used as a simple and robust tool for achieving direction-dependent interactions between nanoparticles and provide control of their assembly into composite materials with a desired symmetry.

  7. Funalichnus bhubani isp. nov. from Bhuban Formation, Surma Group (Lower -Middle Miocene) of Aizawl, Mizoram, India

    PubMed Central

    Tiwari, Raghavendra Prasad; Rajkonwar, Chinmoy; Patel, Satish Jaychandbhai

    2013-01-01

    A new ichnospecies of the ichnogenus Funalichnus Pokorný is described from the Middle Bhuban Unit, Bhuban Formation, Surma Group (Lower - Middle Miocene) of Aizawl, Mizoram, India. Funalichnus bhubani isp. Nov. Is a large burrow displaying cylindrical segments that are oriented nearly perpendicular to the bedding plane. The new ichnospecies can be identified on the basis of general form, size, unlined passive filling and twisted rod-like structure. The association of Funalichnus bhubani isp. Nov. With Arenicolites, Diplocraterion, Ophiomorpha Psilonichnus Skolithos and Thalassinoides points to its bathymetric restriction. The deep extension of the burrow in clastic sediments provides a favourable condition for preservation in the shoreface environment and occurrence in fine- to medium-grained clastic sediments may be a preservational preference. PMID:24204992

  8. MASSIVE STARS IN THE LOCAL GROUP: Implications for Stellar Evolution and Star Formation

    NASA Astrophysics Data System (ADS)

    Massey, Philip

    The galaxies of the Local Group serve as important laboratories for understanding the physics of massive stars. Here I discuss what is involved in identifying various kinds of massive stars in nearby galaxies: the hydrogen-burning O-type stars and their evolved He-burning evolutionary descendants, the luminous blue variables, red supergiants, and Wolf-Rayet stars. Primarily I review what our knowledge of the massive star population in nearby galaxies has taught us about stellar evolution and star formation. I show that the current generation of stellar evolutionary models do well at matching some of the observed features and provide a look at the sort of new observational data that will provide a benchmark against which new models can be evaluated.

  9. Magnetic hyperfine coupling of a methyl group undergoing internal rotation: a case study of methyl formate.

    PubMed

    Tudorie, M; Coudert, L H; Huet, T R; Jegouso, D; Sedes, G

    2011-02-21

    The hyperfine structure of methyl formate was recorded in the 2-20 GHz range. A molecular beam coupled to a Fourier transform microwave spectrometer having an instrumental resolution of 0.46 kHz and limited by a Doppler width of a few kHz was used. A-type lines were found split by the magnetic hyperfine coupling while no splittings were observed for E-type lines. Symmetry considerations were used to account for the internal rotation of the methyl top and to derive effective hyperfine coupling Hamiltonians. Neglecting the spin-rotation magnetic coupling, the vanishing splittings of the E-type lines could be understood and analyses of the hyperfine patterns of the A-type lines were performed. The results are consistent with a hyperfine structure dominated by the magnetic spin-spin coupling due to the three hydrogen atoms of the methyl group.

  10. Funalichnus bhubani isp. nov. from Bhuban Formation, Surma Group (Lower -Middle Miocene) of Aizawl, Mizoram, India.

    PubMed

    Tiwari, Raghavendra Prasad; Rajkonwar, Chinmoy; Patel, Satish Jaychandbhai

    2013-01-01

    A new ichnospecies of the ichnogenus Funalichnus Pokorný is described from the Middle Bhuban Unit, Bhuban Formation, Surma Group (Lower - Middle Miocene) of Aizawl, Mizoram, India. Funalichnus bhubani isp. Nov. Is a large burrow displaying cylindrical segments that are oriented nearly perpendicular to the bedding plane. The new ichnospecies can be identified on the basis of general form, size, unlined passive filling and twisted rod-like structure. The association of Funalichnus bhubani isp. Nov. With Arenicolites, Diplocraterion, Ophiomorpha Psilonichnus Skolithos and Thalassinoides points to its bathymetric restriction. The deep extension of the burrow in clastic sediments provides a favourable condition for preservation in the shoreface environment and occurrence in fine- to medium-grained clastic sediments may be a preservational preference.

  11. Report of the IAU Commission Working Group on Standardizing Access to Ephemerides and File Format Specification: Update September 2014

    NASA Astrophysics Data System (ADS)

    Hilton, J.; Acton, C.; Arlot, J.-E.; Bell, S.; Capitaine, N.; Fienga, A.; Folkner, W.; Gastineau, M.; Pavlov, D.; Pitjeva, E.; Skripnichenko, V.; Wallace, P.

    2015-08-01

    The IAU Commission 4 Working Group on Standardizing Access to Ephemerides recommends the use of the Spacecraft and Planet Kernel (SPK) file format to provide a uniform format for the position ephemerides of planets and other natural solar system bodies. The Working Group also recommends the use of the binary Planetary Constants Kernel (PCK) format ephemeris file for the orientation of a body. It further recommends supporting data be stored in a text PCK. Since the previous report: - Some minor changes have been made to the formats for the coordinate time ephemeris, data types 20: Chebyshev Polynomials (Velocity Only) and 120: Chebyshev Polynomials (TCB:Velocity Only). - the working group's final report is currently undergoing review by the Navigation and Ancillary Information Facility (NAIF) of NASA's Jet Propulsion Laboratory (JPL) to assure it correctly describes these file formats.

  12. Quantifying Functional Group Interactions that Determine Urea Effects on Nucleic Acid Helix Formation

    PubMed Central

    Guinn, Emily J.; Schwinefus, Jeffrey J.; Cha, Hyo Keun; McDevitt, Joseph L.; Merker, Wolf E.; Ritzer, Ryan; Muth, Gregory W.; Engelsgjerd, Samuel W.; Mangold, Kathryn E.; Thompson, Perry J.; Kerins, Michael J.; Record, Thomas

    2013-01-01

    Urea destabilizes helical and folded conformations of nucleic acids and proteins, as well as protein-nucleic acid complexes. To understand these effects, extend previous characterizations of interactions of urea with protein functional groups, and thereby develop urea as a probe of conformational changes in protein and nucleic acid processes, we obtain chemical potential derivatives (μ23 = dμ2/dm3) quantifying interactions of urea (component 3) with nucleic acid bases, base analogs, nucleosides and nucleotide monophosphates (component 2) using osmometry and hexanol-water distribution assays. Dissection of these μ23 yields interaction potentials quantifying interactions of urea with unit surface areas of nucleic acid functional groups (heterocyclic aromatic ring, ring methyl, carbonyl and phosphate O, amino N, sugar (C,O)); urea interacts favorably with all these groups, relative to interactions with water. Interactions of urea with heterocyclic aromatic rings and attached methyl groups (as on thymine) are particularly favorable, as previously observed for urea-homocyclic aromatic ring interactions. Urea m-values determined for double helix formation by DNA dodecamers near 25°C are in the range 0.72 to 0.85 kcal mol−1 m−1 and exhibit little systematic dependence on nucleobase composition (17–42% GC). Interpretation of these results using the urea interaction potentials indicates that extensive (60–90%) stacking of nucleobases in the separated strands in the transition region is required to explain the m-value. Results for RNA and DNA dodecamers obtained at higher temperatures, and literature data, are consistent with this conclusion. This demonstrates the utility of urea as a quantitative probe of changes in surface area (ΔASA) in nucleic acid processes. PMID:23510511

  13. Cross-dehydrogenative coupling (CDC): exploring C-C bond formations beyond functional group transformations.

    PubMed

    Li, Chao-Jun

    2009-02-17

    Synthetic chemists aspire both to develop novel chemical reactions and to improve reaction conditions to maximize resource efficiency, energy efficiency, product selectivity, operational simplicity, and environmental health and safety. Carbon-carbon bond formation is a central part of many chemical syntheses, and innovations in these types of reactions will profoundly improve overall synthetic efficiency. This Account describes our work over the past several years to form carbon-carbon bonds directly from two different C-H bonds under oxidative conditions, cross-dehydrogenative coupling (CDC). We have focused most of our efforts on carbon-carbon bonds formed via the functionalization of sp(3) C-H bonds with other C-H bonds. In the presence of simple and cheap catalysts such as copper and iron salts and oxidants such as hydrogen peroxide, dioxygen, tert-butylhydroperoxide, and 2,3-dichloro-5,6-dicyanobenzoquinone (DDQ), we can directly functionalize various sp(3) C-H bonds by other C-H bonds without requiring preactivation. We demonstrate (1) reaction of alpha-C-H bonds of nitrogen in amines, (2) reaction of alpha-C-H bonds of oxygen in ethers, (3) reaction of allylic and benzylic C-H bonds, and (4) reaction of alkane C-H bonds. These CDC reactions can tolerate a variety of functional groups, and some can occur under aqueous conditions. Depending on the specific transformation, we propose the in situ generation of different intermediates. These methods provide an alternative to the separate steps of prefunctionalization and defunctionalization that have traditionally been part of synthetic design. As a result, these methods will increase synthetic efficiencies at the most fundamental level. On an intellectual level, the development of C-C bond formations based on the reaction of only C-H bonds (possibly in water) challenges us to rethink some of the most fundamental concepts and theories regarding chemical reactivities. A successful reaction requires the

  14. Randomized controlled trial of a cognitive-behavioral motivational intervention in a group versus individual format for substance use disorders.

    PubMed

    Sobell, Linda Carter; Sobell, Mark B; Agrawal, Sangeeta

    2009-12-01

    Although group therapy is widely used for individuals with substance use disorders (SUDs), randomized clinical trials (RCTs) comparing the same treatment in a group versus individual format are rare. This paper presents the results of a RCT comparing guided self-change (GSC) treatment, a cognitive-behavioral motivational intervention, conducted in a group versus individual format with 212 alcohol abusers and 52 drug abusers who voluntarily sought outpatient treatment. Treatment outcomes demonstrated significant and large reductions in clients' alcohol and drug use during treatment and at the 12-month follow-up, with no significant differences between the group and individual therapy conditions. A therapist time ratio analysis found that it took 41.4% less therapist time to treat clients using the group versus the individual format. Participants' end-of-treatment group cohesion scores characterized the groups as having high engagement, low levels of interpersonal conflict, and low avoidance of group work, all desirable group characteristics. These findings suggest that the GSC treatment model was effectively integrated into a brief group treatment format. Health care cost containment compels further evaluations of the efficacy of group treatments for SUDs. Copyright 2009 APA

  15. Jesse Ewing Canyon Formation, an interpreted alluvial fan deposit in the basal Uinta Mountain Group (Middle Proterozoic), Utah

    SciTech Connect

    Sanderson, I.D.; Wiley, M.T.

    1986-07-01

    The Jesse Ewing Canyon Formation, a member of the Middle Proterozic Uinta Mountain Group, is here proposed as a formal lithostratigraphic unit. It consists of interbedded dark reddish-brown to dark gray conglomerate with predominant white, pale green, gray, or pink metaquartzite clasts, light to dark brown or reddish-brown quartz arenite, and reddish-brown, red, or maroon shale. This represents the first proposal of a formation in the Uinta Mountain Group in the eastern part of the range and follows by only a few years beginning efforts to establish formations in the group in the western part. The Jesse Ewing Canyon Formation locally constitutes the basal member of the Uinta Mountain Group and is here reaffirmed as an alluvial fan deposit, based on a detailed comparison of observed features to those of modern alluvial fans. This interpretation supports the hypothesis that the Uinta Trough is an aulacogen.

  16. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    NASA Astrophysics Data System (ADS)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  17. Chemical Evolution and Star Formation History of the Disks of Spirals in Local Group

    NASA Astrophysics Data System (ADS)

    Yin, J.

    2011-05-01

    Milky Way (MW), M31 and M33 are the only three spiral galaxies in our Local group. MW and M31 have similar mass, luminosity and morphology, while M33 is only about one tenth of MW in terms of its baryonic mass. Detailed theoretical researches on these three spirals will help us to understand the formation and evolution history of both spiral galaxies and Local group. Referring to the phenomenological chemical evolution model adopted in MW disk, a similar model is established to investigate the star formation and chemical enrichment history of these three local spirals. Firstly, the properties of M31 disk are studied by building a similar chemical evolution model which is able to successfully describe the MW disk. It is expected that a simple unified phenomenological chemical evolution model could successfully describe the radial and global properties of both disks. Comparing with the former work, we adopt an extensive data set as model constraints, including the star formation profile of M31 disk derived from the recent UV data of GALEX. The comparison among the observed properties of these two disks displays very interesting similarities in their radial profiles when the distance from the galactic center is expressed in terms of the corresponding scale length. This implies some common processes in their formation and evolution history. Based on the observed data of the gas mass surface density and SFR surface density, the SFR radial profile of MW can be well described by Kennicutt-Schmidt star formation law (K-S law) or modified K-S law (SFR is inversely proportional to the distance from the galactic center), but this is not applicable to the M31 disk. Detailed calculations show that our unified model describes fairly well all the main properties of the MW disk and most properties of M31 disk, provided that the star formation efficiency of M31 disk is adjusted to be twice as large as that of MW disk (as anticipated from the lower gas fraction of M31). However, the

  18. The dependence of galaxy group star formation rates and metallicities on large-scale environment

    NASA Astrophysics Data System (ADS)

    Scudder, Jillian M.; Ellison, Sara L.; Mendel, J. Trevor

    2012-07-01

    We construct a sample of 75 863 star-forming galaxies with robust metallicity and star formation rate (SFR) measurements from the Sloan Digital Sky Survey Data Release 7, from which we select a clean sample of compact group (CG) galaxies. The CGs are defined to be close configurations of at least four galaxies that are otherwise apparently isolated. Our selection results in a sample of 112 spectroscopically identified CG galaxies, which can be further divided into groups that are either embedded within a larger structure, such as a cluster or large group, or truly isolated systems. The CGs then serve as a probe into the influence of large-scale environment on a galaxy's evolution, while keeping the local density fixed at high values. We find that the SFRs of star-forming galaxies in CGs are significantly different between isolated and embedded systems. Galaxies in isolated systems show significantly enhanced SFR, relative to a control sample matched in mass and redshift, a trend not seen in the embedded systems. Galaxies in isolated systems exhibit a median SFR enhancement at a fixed stellar mass of +0.07 ± 0.03 dex. These dependences on large-scale environment are small in magnitude relative to the apparent influence of local-scale effects found in previous studies, but the significance of the difference in SFRs between our two samples constrains the effect of large-scale environment to be non-zero. We find no significant change in the gas-phase interstellar metallicity for either the isolated or embedded CG sample relative to their controls. However, simulated samples that include artificial offsets indicate that we are only sensitive to metallicity changes of log O/H> 0.13 dex (at 99 per cent confidence), which is considerably larger than the typical metallicity differences seen in previous environmental studies.

  19. The Formation of the Local Group and the High Velocity Clouds

    NASA Astrophysics Data System (ADS)

    Spergel, D. N.; Blitz, L.; Teuben, P. J.; Hartmann, D.; Burton, B.

    1996-12-01

    We simulate the formation and evolution of the Local Group. The dynamics of the Local Group is governed primarily by the its two largest members, Andromeda (M31) and the Galaxy (M0) and secondarily by the tidal effects of neighboring galaxies. In the simulation, a long filament forms which contains M31 and M0. While the gas near M31 and M0 is likely shock heated, we expect that much of the gas in the filament is cold. The kinematics of this gas in the simulation is remarkably similar to the kinematics of the High Velocity Clouds (HVCs). This similarity suggests reinterpreting the HVCs as primarily extragalactic. In this model, the HVCs are similar to the Lyman alpha clouds. Recent work (Hernquist et al. 996) suggests that the Lyman alpha clouds are primarily condensations in the filaments between galaxies. We suggest a similar picture for most of the HVCs: they are gravitationally confined, rather than pressure confined, clouds infalling into the Local Group and are likely associated with a substantial amount of dark matter. In this picture, the two phase structure seen in some of the HVCs (Wakker & Schwarz 1991) would be due to self shielding that arises in gas clouds ionized by external UV (Murakami & Ikeuchi 1990). This model suggests that there is a substantial amount of gas in the HVCs: ~ 1 x 10(10) M_sun. This gas is and was a reservoir of relatively unprocessed gas for both M31 and our Galaxy and likely plays an important role in the evolution of both galaxies. Hernquist, L, Katz, N., Weinberg, D. & Miralda-Escude, J. 1996, ApJ L 457, 51 Murakami, I. & Ikeuchi, S. 1990 PASJ, 41 , L11. Wakker, B.P. & Schwarz, U.J. 1991 A & A, 250, 48.

  20. Correlations and Areal Distribution of the Table Mountain Formation, Stanislaus Group; Central Sierra Nevada, California

    NASA Astrophysics Data System (ADS)

    Torrez, G.; Carlson, C. W.; Putirka, K. D.; Pluhar, C. J.; Sharma, R. K.

    2011-12-01

    Late Cenozoic evolution of the western Cordillera is a matter of ongoing debate in geologic studies. Volcanic deposits within, and adjacent to the Sierra Nevada have played a significant role in many of these debates. With local faulting coincident with eruption of members of the Stanislaus Group at ca. 38°N, the composition and correlation of these volcanics can greatly aid our understanding of Sierra Nevada tectonics. At the crest of the central Sierra Nevada, 23 trachyandesite lava flows of the Table Mountain Formation, dated at ~10 Ma, cap Sonora Peak. These 23 flows compose the thickest and most complete known stratigraphic section of the Table Mountain Formation in the region. Located ~12 km east of Sonora Peak are 16 flows of trachyandesite at Grouse Meadow. We have collected a detailed set of geochemical and paleomagnetic data for flows of these two sections at Sonora Peak and Grouse Meadows in an attempt to correlate volcanic, paleomagnetic and structural events related to uplift and extension in the Sierra Nevada and the Walker Lane. Correlation of individual flows is possible based on: stratigraphic order, temporal gaps in deposition as determined by paleomagnetic remanence direction and nonconformities, and flow geochemistry. These correlations allow us to infer source localities, flow directions, and temporal changes in flow routes. The large number of flows present at Grouse Meadow provides an additional data set from which to correlate various localities in the region to those units not represented at Sonora Peak. Several flows which occur in the upper portions of the Sonora Peak and Grouse Meadow stratigraphic sections do not correlate between these localities. The causes of stratigraphic discontinuity potentially represent: tectonic isolation across the Sierran Crest, topographic isolation by the emplacement of younger flows, or the combination of the two. Additional to the correlation of individual flows at these localities, this study shows a

  1. Crystallographic evidence of sulfate evaporites in the Kromberg Formation, Onverwacht Group, South Africa

    SciTech Connect

    Fisher, G.L.; Lowe, D.R.

    1985-01-01

    The 3.5 Ga Kromberg Formation of the Onverwacht Group, Barberton Greenstone Belt, South Africa, includes a basal silicified shallow-water evaporite sequence deposited in a series of small fault-bounded basins. Other early Archean replaced and recrystallized evaporites have been interpreted to have included both primary gypsum and aragonite based on general crystal morphology and the overall similarity of these units to Phanerozoic evaporites. Crystal interfacial angle measurements, however, have not been widely reported to support interpretations of primary mineralogy. Although the primary evaporite minerals in the Kromberg Formation have been replaced by chert and druzy megaquartz, interfacial angles of silicified pseudohexagonal, prismatic to bladed crystals can be measured with a contact goniometer. Measurement of angles between the six prism faces display a biomodal distribution about 55/sup 0/ and 69/sup 0/. Within individual crystals, these angles show a general arrangement of two at 69/sup 0/ separated by sets of two angles at 55/sup 0/. These relationships closely resemble those of gypsum which has four angles of (010) (120)=55.75/sup 0/ and two of (120) (120)-68.50/sup 0/. No evidence has been found for the existence of aragonite which has six angles of (110) (110)=60/sup 0/. Textural and geometric crystal comparisons of these silicified crystals with Messinian algal-related selenite and modern gypsum support the proposal of a gypsum precursor. The common presence of gypsum in this and other greenstone belts suggests that the early Archean ocean may have been at or near saturation with respect to sulfate.

  2. Stages of rootless cone formation observed within the Raudhólar cone group, Iceland

    NASA Astrophysics Data System (ADS)

    Fitch, E. P.; Hamilton, C.; Fagents, S. A.; Thordarson, T.

    2013-12-01

    Secondary (rootless) cones form when lava interacts explosively with water contained in the substrate, and represent a largely degassed, end-member system that can elucidate mechanisms of magma-water interactions in the absence of primary degassing-induced fragmentation. Rootless cones are well documented in Iceland. The Raudhólar rootless cone group, located within the ~5200-year-old Ellidaá lava flow on the south-eastern outskirts of Reykjavík, was extensively quarried during the Second World War and now provides excellent cross-sections through the tephra sequences. Taking advantage of this exposure, we performed detailed stratigraphic, grain-size, and componentry analyses, which suggest that the energetics of rootless explosions vary substantially during cone formation. The lower unit contains the most substrate sediment and is characterized by dilute pyroclastic density current deposits. The middle unit is dominated by a succession of bed-pairs, each containing a finer-grained lower layer and coarser-grained upper layer. In the upper unit, the succession grades into a welded section that caps the cone. The abundance of substrate sediment generally decreases upwards within the cone, which suggests that the efficiency of lava-substrate mixing decreased with time. In addition, clast size generally increases upwards within the cone, implying that the fragmentation energy also decreased as the rootless eruption progressed. Both lines of evidence suggest that the explosions decreased in intensity with time, likely due to the depletion of available groundwater. However, alternating fine- and coarse-grained beds imply cycles of increased and decreased fragmentation efficiency, which we attribute to groundwater recharge and depletion during the event. Therefore, this study presents a detailed look at rootless cone formation and provides the foundation for future work on this important, yet understudied, system.

  3. Ultraviolet+Infrared Star Formation Rates: Hickson Compact Groups with Swift and Spitzer

    NASA Astrophysics Data System (ADS)

    Tzanavaris, P.; Hornschemeier, A. E.; Gallagher, S. C.; Johnson, K. E.; Gronwall, C.; Immler, S.; Reines, A. E.; Hoversten, E.; Charlton, J. C.

    2010-06-01

    We present Swift UVOT ultraviolet (UV; 1600-3000 Å) data with complete three-band UV photometry for a sample of 41 galaxies in 11 nearby (<4500 km s-1) Hickson Compact Groups (HCGs) of galaxies. We use UVOT uvw2-band (2000 Å) photometry to estimate the dust-unobscured component, SFRUV, of the total star formation rate, SFRTOTAL. We use Spitzer MIPS 24 μm photometry to estimate SFRIR, the component of SFRTOTAL that suffers dust extinction in the UV and is re-emitted in the IR. By combining the two components, we obtain SFRTOTAL estimates for all HCG galaxies. We obtain total stellar mass, M *, estimates by means of Two Micron All Sky Survey Ks -band luminosities, and use them to calculate specific star formation rates, SSFR ≡ SFRTOTAL/M *. SSFR values show a clear and significant bimodality, with a gap between low (lsim3.2 × 10-11 yr-1) and high-SSFR (gsim1.2 × 10-10 yr-1) systems. We compare this bimodality to the previously discovered bimodality in αIRAC, the MIR activity index from a power-law fit to the Spitzer IRAC 4.5-8 μm data for these galaxies. We find that all galaxies with αIRAC <= 0 ( >0) are in the high- (low-) SSFR locus, as expected if high levels of star-forming activity power MIR emission from polycyclic aromatic hydrocarbon molecules and a hot dust continuum. Consistent with this finding, all elliptical/S0 galaxies are in the low-SSFR locus, while 22 out of 24 spirals/irregulars are in the high-SSFR locus, with two borderline cases. We further divide our sample into three subsamples (I, II, and III) according to decreasing H I richness of the parent galaxy group to which a galaxy belongs. Consistent with the SSFR and αIRAC bimodality, 12 out of 15 type I (11 out of 12 type III) galaxies are in the high- (low-) SSFR locus, while type II galaxies span almost the full range of SSFR values. We use the Spitzer Infrared Nearby Galaxy Survey (SINGS) to construct a comparison subsample of galaxies that (1) match HCG galaxies in J-band total

  4. ULTRAVIOLET+INFRARED STAR FORMATION RATES: HICKSON COMPACT GROUPS WITH SWIFT AND SPITZER

    SciTech Connect

    Tzanavaris, P.; Hornschemeier, A. E.; Immler, S.; Johnson, K. E.; Reines, A. E.; Gronwall, C.; Hoversten, E.; Charlton, J. C.

    2010-06-10

    We present Swift UVOT ultraviolet (UV; 1600-3000 A) data with complete three-band UV photometry for a sample of 41 galaxies in 11 nearby (<4500 km s{sup -1}) Hickson Compact Groups (HCGs) of galaxies. We use UVOT uvw2-band (2000 A) photometry to estimate the dust-unobscured component, SFR{sub UV}, of the total star formation rate, SFR{sub TOTAL}. We use Spitzer MIPS 24 {mu}m photometry to estimate SFR{sub IR}, the component of SFR{sub TOTAL} that suffers dust extinction in the UV and is re-emitted in the IR. By combining the two components, we obtain SFR{sub TOTAL} estimates for all HCG galaxies. We obtain total stellar mass, M {sub *}, estimates by means of Two Micron All Sky Survey K{sub s} -band luminosities, and use them to calculate specific star formation rates, SSFR {identical_to} SFR{sub TOTAL}/M {sub *}. SSFR values show a clear and significant bimodality, with a gap between low ({approx}<3.2 x 10{sup -11} yr{sup -1}) and high-SSFR ({approx_gt}1.2 x 10{sup -10} yr{sup -1}) systems. We compare this bimodality to the previously discovered bimodality in {alpha}{sub IRAC}, the MIR activity index from a power-law fit to the Spitzer IRAC 4.5-8 {mu}m data for these galaxies. We find that all galaxies with {alpha}{sub IRAC} {<=} 0 ( >0) are in the high- (low-) SSFR locus, as expected if high levels of star-forming activity power MIR emission from polycyclic aromatic hydrocarbon molecules and a hot dust continuum. Consistent with this finding, all elliptical/S0 galaxies are in the low-SSFR locus, while 22 out of 24 spirals/irregulars are in the high-SSFR locus, with two borderline cases. We further divide our sample into three subsamples (I, II, and III) according to decreasing H I richness of the parent galaxy group to which a galaxy belongs. Consistent with the SSFR and {alpha}{sub IRAC} bimodality, 12 out of 15 type I (11 out of 12 type III) galaxies are in the high- (low-) SSFR locus, while type II galaxies span almost the full range of SSFR values. We use the

  5. Ultraviolet+Infrared Star Formation Rates: Hickson Compact Groups with Swift and SPitzer

    NASA Technical Reports Server (NTRS)

    Tzanavaris, P.; Hornschemeier, A. E.; Gallagher, S. C.; Johnson, K. E.; Gronwall, C.; Immler, S.; Reines, A. E.; Hoversten, E.; Charlton, J. C.

    2010-01-01

    We present Swift UVOT ultraviolet (UV; 1600-3000 A) data with complete three-band UV photometry for a sample of 41 galaxies in 11 nearby (<4500 km/s) Hickson Compact Groups (HCGs) of galaxies. We use UVOT uvw2-band (2000A) photometry to estimate the dust-unobscured component, SFR(sub uv), of the total star formation rate, SFR(sub TOTAL). We use Spitzer MIPS 24 micron photometry to estimate SFR(sub IR), the component of SFR(sub TOTAL) that suffers dust extinction in the UV and is re-emitted in the IR. By combining the two components, we obtain SFR(sub TOTAL) estimates for all HCG galaxies. We obtain total stellar mass, M(sub *) estimates by means of Two Micron All Sky Survey K(sub s)-band luminosities, and use them to calculate specific star formation rates, SSFR is identical with SFR(sub TOTAL)/ M (sub *). SSFR values show a clear and significant bimodality, with a gap between low (approximately <3.2 x 10(exp -11) / yr) and high-SSFR (approximately > 1.2 x lO)exp -10)/yr) systems. We compare this bimodality to the previously discovered bimodality in alpha-IRAC, the MIR activity index from a power-law fit to the Spitzer IRAC 4.5-8 micron data for these galaxies. We find that all galaxies with alpha-IRAC <= 0 (> 0) are in the high- (low-) SSFR locus, as expected if high levels of star-forming activity power MIR emission from polycyclic aromatic hydrocarbon molecules and a hot dust continuum. Consistent with this finding, all elliptical/SO galaxies are in the low-SSFR locus, while 22 out of 24 spirals / irregulars are in the high-SSFR locus, with two borderline cases. We further divide our sample into three subsamples (I, II, and III) according to decreasing H I richness of the parent galaxy group to which a galaxy belongs. Consistent with the SSFR and alpha-IRAC bimodality, 12 out of 15 type I (11 out of 12 type III) galaxies are in the high- (low-) SSFR locus, while type II galaxies span almost the full range of SSFR values. We use the Spitzer Infrared Nearby Galaxy

  6. Ultraviolet+Infrared Star Formation Rates: Hickson Compact Groups with Swift and SPitzer

    NASA Technical Reports Server (NTRS)

    Tzanavaris, P.; Hornschemeier, A. E.; Gallagher, S. C.; Johnson, K. E.; Gronwall, C.; Immler, S.; Reines, A. E.; Hoversten, E.; Charlton, J. C.

    2010-01-01

    We present Swift UVOT ultraviolet (UV; 1600-3000 A) data with complete three-band UV photometry for a sample of 41 galaxies in 11 nearby (<4500 km/s) Hickson Compact Groups (HCGs) of galaxies. We use UVOT uvw2-band (2000A) photometry to estimate the dust-unobscured component, SFR(sub uv), of the total star formation rate, SFR(sub TOTAL). We use Spitzer MIPS 24 micron photometry to estimate SFR(sub IR), the component of SFR(sub TOTAL) that suffers dust extinction in the UV and is re-emitted in the IR. By combining the two components, we obtain SFR(sub TOTAL) estimates for all HCG galaxies. We obtain total stellar mass, M(sub *) estimates by means of Two Micron All Sky Survey K(sub s)-band luminosities, and use them to calculate specific star formation rates, SSFR is identical with SFR(sub TOTAL)/ M (sub *). SSFR values show a clear and significant bimodality, with a gap between low (approximately <3.2 x 10(exp -11) / yr) and high-SSFR (approximately > 1.2 x lO)exp -10)/yr) systems. We compare this bimodality to the previously discovered bimodality in alpha-IRAC, the MIR activity index from a power-law fit to the Spitzer IRAC 4.5-8 micron data for these galaxies. We find that all galaxies with alpha-IRAC <= 0 (> 0) are in the high- (low-) SSFR locus, as expected if high levels of star-forming activity power MIR emission from polycyclic aromatic hydrocarbon molecules and a hot dust continuum. Consistent with this finding, all elliptical/SO galaxies are in the low-SSFR locus, while 22 out of 24 spirals / irregulars are in the high-SSFR locus, with two borderline cases. We further divide our sample into three subsamples (I, II, and III) according to decreasing H I richness of the parent galaxy group to which a galaxy belongs. Consistent with the SSFR and alpha-IRAC bimodality, 12 out of 15 type I (11 out of 12 type III) galaxies are in the high- (low-) SSFR locus, while type II galaxies span almost the full range of SSFR values. We use the Spitzer Infrared Nearby Galaxy

  7. Examining the Center: Positions, Dominance, and Star Formation Rates of Most Massive Group Galaxies at Intermediate Redshift

    NASA Astrophysics Data System (ADS)

    Connelly, Jennifer L.; Parker, Laura C.; McGee, Sean; Mulchaey, John S.; Finoguenov, Alexis; Balogh, Michael; Wilman, David; Group Environment Evolution Collaboration

    2015-01-01

    The group environment is believed to be the stage for many galaxy transformations, helping evolve blue star-forming galaxies to red passive ones. In local studies of galaxy clusters, the central member is usually a single dominant giant galaxy at the center of the potential with little star formation thought to be the result of galaxy mergers. In nearby groups, a range of morphologies and star formation rates are observed and the formation history is less clear. Further, the position and dominance of the central galaxy cannot be assumed in groups, which are less massive and evolved than clusters. To understand the connections between global group properties and properties of the central group galaxy at intermediate redshift, we examine galaxy groups from the Group Environment and Evolution Collaboration (GEEC) catalog, including both optically- and X-ray-selected groups at redshift z~0.4. The sample is diverse, containing a range in overall mass and evolutionary state. The number of groups is significant, membership is notably complete, and measurements span the IR to the UV allowing the properties of the members to be connected to those of the host groups. Having investigated trends in the global group properties previously, including mass and velocity substructure, we turn our attention now to the galaxy populations, focusing on the central regions of these systems. The most massive and second most massive group galaxies are identified by their stellar mass. The positions of the most massive galaxies (MMGs) are determined with respect to both the luminosity-weighted and X-ray center. Star formation rates are used to explore the fraction of passive/quiescent versus star-forming MMGs and the dominance of the MMGs in our group sample is also tested. Determinations of these characteristics and trends constitute the important first steps toward a detailed understanding of the relationships between the properties of host groups and their most massive galaxies and the

  8. Brightest group galaxies: stellar mass and star formation rate (paper I)

    NASA Astrophysics Data System (ADS)

    Gozaliasl, Ghassem; Finoguenov, Alexis; Khosroshahi, Habib G.; Mirkazemi, Mohammad; Erfanianfar, Ghazaleh; Tanaka, Masayuki

    2016-05-01

    We study the distribution and evolution of the stellar mass and the star formation rate (SFR) of the brightest group galaxies (BGGs) over 0.04 < z < 1.3 using a large sample of 407 X-ray galaxy groups selected from the COSMOS, AEGIS, and XMM-LSS fields. We compare our results with predictions from the semi-analytic models based on the Millennium simulation. In contrast to model predictions, we find that, as the Universe evolves, the stellar mass distribution evolves towards a normal distribution. This distribution tends to skew to low-mass BGGs at all redshifts implying the presence of a star-forming population of the BGGs with MS ˜ 1010.5 M⊙ which results in the shape of the stellar mass distribution deviating from a normal distribution. In agreement with the models and previous studies, we find that the mean stellar mass of BGGs grows with time by a factor of ˜2 between z = 1.3 and z = 0.1, however, the significant growth occurs above z = 0.4. The BGGs are not entirely a dormant population of galaxies, as low-mass BGGs in low-mass haloes are more active in forming stars than the BGGs in more massive haloes, over the same redshift range. We find that the average SFR of the BGGs evolves steeply with redshift and fraction of the passive BGGs increases as a function of increasing stellar mass and halo mass. Finally, we show that the specific SFR of the BGGs within haloes with M200 ≤ 1013.4 M⊙ decreases with increasing halo mass at z < 0.4.

  9. Biofilm Formation by Group A Streptococci: Is There a Relationship with Treatment Failure?

    PubMed Central

    Conley, Joslyn; Olson, Merle E.; Cook, Linda S.; Ceri, Howard; Phan, Van; Dele Davies, H.

    2003-01-01

    Group A streptococcus (GAS) is the primary cause of bacterial pharyngitis in children and adults. Up to one-third of patients treated for GAS pharyngitis fail to respond to antibiotic therapy. The objective of this cohort study was to evaluate GAS biofilm formation as a mechanism for antibiotic treatment failure using previously collected GAS isolates and penicillin treatment outcome data. The minimum biofilm eradication concentration (MBEC) assay device was used to determine the biofilm-forming capabilities, efficiencies, and antibiotic susceptibilities of GAS isolates. The MBECs and MICs of several antibiotics for GAS were determined. All 99 GAS isolates available for this study formed biofilms, with various efficiencies. Antibiotic MBECs were consistently higher than MICs for all of the GAS isolates. MBECs indicated penicillin insensitivity in 60% of GAS isolates, producing the first report of in vitro GAS insensitivity to penicillin. Using MBECs to predict penicillin treatment failure had better sensitivity (56%) but lower specificity (36%) than the sensitivity (0%) and specificity (100%) when MICs were used. However, the positive predictive value of the MBEC was superior to that of the MIC (56 versus 0%), while the negative predictive values (42 and 47%) were similar. More studies are needed to understand the roles of biofilms and the MBEC assay in predicting GAS treatment failure. In addition, further investigations are necessary to determine if non-biofilm-forming strains of GAS exist and the roles of in vivo monospecies and multispecies biofilms in streptococcal pharyngitis treatment failure. PMID:12958223

  10. The Magellanic Satellites Survey: Searching for Hierarchical Structure Formation within the Local Group

    NASA Astrophysics Data System (ADS)

    Bechtol, Keith; Magellanic Satellites Survey (MagLiteS)

    2017-01-01

    A generic prediction of galaxy formation in the standard cosmological model with cold dark matter is the hierarchical assembly of structure on mass scales ranging from ultra-faint galaxies to galaxy clusters. In the Local Group, dozens of galaxies have been found orbiting the Milky Way and Andromeda. The question of whether the largest Milky Way satellites, the Large and Small Magellanic Clouds, brought in their own entourage of satellites has been a long standing puzzle, and has garnered renewed interest following the recent discovery of more than a dozen ultra-faint galaxy candidates in the southern hemisphere. The on-going Magellanic Satellites Survey (MagLiteS) aims to complete an annulus of contiguous deep optical imaging with Blanco/DECam around the periphery of the Magellanic Clouds, enabling a systematic search for ultra-faint galaxies and other low-surface-brightness stellar substructures associated with the Magellanic system. I will report on the progress of MagLiteS and discuss science highlights from the first observing season, including a new ultra-faint galaxy candidate located ~11 kpc from the Large Magellanic Cloud.

  11. Sequential palynostratigraphy of the Queen City and Weches formations (Middle Eocene Claiborne Group), southeast central Texas

    SciTech Connect

    Elsik, W.C. )

    1993-02-01

    Palynomorph sequences of several orders of magnitude were found in the Queen City and Weches formations respectively at Six Mile and Burleson bluffs on the Brazos River, Milam and Burleson counties, Texas. The long term development of the subtropical to tropical Claibornian palynoflora included Engelhardtia spp., Friedrichipollis claibornensis, Nudopollis terminalis, Pollenites laesius and Symplocoipollenites spp. Shorter term fluctuations in sea level were reflected by common herbaceous pollen in the Queen City, and common mangrove pollen in the Weches. Paleoenvironments were marginally to fully marine; dinocysts occurred throughout. The Wetzeliella group of dinocysts were present only in the Queen City at Six Mile Bluff. Late Paleocene to Early Eocene pollen, and Early Middle Eocene pollen with last effective occurrences near the Queen City and Weches boundary included Aesculiidites circumstriatus, Annona foveoreticulata and a new species of Platycarya. Five short term warmer-cooler couplet events were represented by successive abundance peaks of Juglandaceae followed by Ulmus; Alnus supports the three upper Ulmus peaks. One deep water event was recorded by an abundance of fresh water Pediastrum at the Queen City and Weches boundary. That boundary event was bracketed by two of the Alnus and Ulmus peaks.

  12. Selected Data for Wells and Test Holes Used in Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation in the Black Hills Area, South Dakota

    DTIC Science & Technology

    1999-01-01

    Selected Data for Wells and Test Holes Used in Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison...Test Holes Used in Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation...Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation in the Black Hills Area

  13. Final Update of the IAU Commission 4 Working Group on Standardizing Access to Ephemerides and File Format Specification

    NASA Astrophysics Data System (ADS)

    Hilton, James L.

    2015-08-01

    The IAU Commission 4 Working Group on Standardizing Access to Ephemerides recommends the use of the Spacecraft and Planet Kernel (SPK) format to provide a uniform format for the position ephemerides of planets and other natural solar system bodies, and the use of the Planetary Constants Kernel (PCK) for the orientation of these bodies. These formats are used by the SPICE system, developed by the Navigation and Ancillary Information Facility of NASA’s Jet Propulsion Laboratory. The working group's final report is currently undergoing final preparations for publication. A long version of this report will be available at the IAU Commission 4 - Ephemerides (or its successor) web site. This long version will contain a full description of that portion of the SPK and PCK formats required to duplicate these file types for this application.

  14. Stratigraphy and characteristic mollusks of the Pamunkey Group (lower Tertiary) and the Old Church Formation of the Chesapeake Group; Virginia Coastal Plain

    USGS Publications Warehouse

    Ward, Lauck W.

    1985-01-01

    Along the Pamunkey River and its tributaries can be found a very complete, well-preserved, Tertiary stratigraphic record that reflects the sea-level changes as well as the local tectonic history of the central Virginia Coastal Plain. Using this record, I have described the lower Tertiary units and proposed a sequential model for their occurrence. Sediments examined in this study range in age from early Paleocene to latest Oligocene or earliest Miocene. Upper Tertiary units are described where they occur in the same sections with the lower Tertiary beds. The Brightseat Formation (lower Paleocene), Aquia Formation (upper Paleocene), Marlboro Clay (upper Paleocene), Nanjemoy Formation (lower Eocene), Piney Point Formation (middle Eocene) and Old Church Formation (new unit, upper Oligocene and lower Miocene) were studied. The definitions of the Piscataway and Paspotansa Members of the Aquia are amended, and a lectostratotype (principal reference section) is designated for those units as well as the Aquia on the Potomac River just below the mouth of Aquia Creek. A lectostratotype section is also designated for the Nanjemoy and its two members, the Potapaco and the Woodstock. That section is on the Potomac above Popes Creek. Beds assigned to the Piney Point and Old Church Formations, previously known only in the subsurface, crop out extensively on the Pamunkey River. A hypostratotype (reference section) is selected for the Piney Point Formation on the Pamunkey River at Horseshoe. The Old Church Formation (named herein) is included in the Chesapeake Group. Areal extent of the stratigraphic units was determined by correlation of outcropping beds on the Pamunkey, Patuxent, Potomac, Rappahannock, Mattaponi, Chickahominy, and James Rivers supplemented by well data. Comparisons of the onlap histories of the Salisbury, Albemarle, and Charleston Embayments indicate a number of simultaneous transgressive events implying global sea-level rises. More restricted transgressions

  15. Report of the IAU Commission 4 Working Group on Standardizing Access to Ephemerides and File Format Specification

    DTIC Science & Technology

    2014-12-01

    Standardizing Access To Ephemerides And File Format Specification 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...TO EPHEMERIDES AND FILE FORMAT SPECIFICATION J. L. HILTON1, C. ACTON2, J.-E. ARLOT2, S.A. BELL2, N. CAPITAINE2, A. FIENGA2, W.M. FOLKNER2, M...4 Working Group on Standardizing Access to Ephemerides rec- ommends the use of the Spacecraft and Planet Kernel (SPK) file format to provide a uniform

  16. [Study on virulence factors associated with biofilm formation and phylogenetic groupings in Escherichia coli strains isolated from patients with cystitis].

    PubMed

    Tiba, Monique Ribeiro; Nogueira, Gustavo Prado; Leite, Domingos da Silva

    2009-01-01

    Escherichia coli samples isolated from female patients with cystitis were characterized with regard to the presence of virulence factors associated with biofilm formation and phylogenetic groupings. Polymerase chain reaction results demonstrated that all the samples were positive for the gene fimH (type 1 fimbriae), 91 for fliC (flagellins), 50 for papC (P fimbriae), 44 for kpsMTII (capsules) and 36 for flu (antigen 43). The results from assays to quantify the biofilm formation demonstrated that 44 samples produced biofilm on polystyrene microplates and 56 samples produced weak or no biofilm. We also confirmed that Escherichia coli samples were present in phylogenetic groups B2 and D.

  17. Molecular Structures, Acid-Base Properties, and Formation of Group 6 Transition Metal Hydroxides

    SciTech Connect

    Li, Shenggang; Guenther, Courtney L.; Kelley, Matthew S.; Dixon, David A.

    2011-04-28

    Density functional theory (DFT) and coupled cluster theory (CCSD(T)) were used to study the group 6 metal (M = Cr, Mo, W) hydroxides: MO3-m(OH)2m (m = 1-3), M2O6-m(OH)2m (m = 1-5), M3O9-m(OH)2m (m = 1, 2), and M4O11(OH)2. The calculations were done up to the complete basis set (CBS) limit for the CCSD(T) method. Molecular structures of many low-energy conformers/isomers were located. Brønsted acidities in the gas phase and pKa values in aqueous solution were predicted for MO3-m(OH)2m (m = 1-3) and MnO3n-1(OH)2 (n = 2-4). In addition, Brønsted basicities and Lewis acidities (fluoride affinities) were predicted for MO3-m(OH)2m (m = 1-3) as well as the metal oxide clusters MnO3n (n = 1-3). The metal hydroxides were predicted to be strong Brønsted acids and weak to modest Brønsted bases and Lewis acids. The pKa values can have values as negative as -31. Potential energy surfaces for the hydrolysis of the MnO3n (n = 1-4) clusters were calculated. Heats of formation of the metal hydroxides were predicted from the calculated reaction energies, and the agreement with the limited available experimental data is good. The first hydrolysis step leading to the formation of MnO3n-1(OH)2 was predicted to be exothermic, with the exothermicity becoming less negative as n increases and essentially converged at n = 3. Reaction rate constants for the hydrogen transfer steps were calculated using transition state theory and RRKM theory. Further hydrolysis of MnO3n-1(OH)2 tends to be endothermic especially for M = Cr. Fifty-five DFT exchange-correlation functionals were benchmarked for the calculations of the reaction energies, complexation energies, and reaction barriers by comparing to our CCSD(T) results. Overall, the DFT results for the potential energy surfaces are semiquantitatively correct, but no single functional works for all processes and all three metals. Among the functionals benchmarked, the wB97, wB97X, B1B95, B97-1, mPW1LYP, and X3LYP functionals have the best

  18. Image encryption schemes for joint photographic experts group and graphics interchange format formats based on three-dimensional baker with compound chaotic sequence generator

    NASA Astrophysics Data System (ADS)

    Ji, Shiyu; Tong, Xiaojun; Zhang, Miao

    2013-01-01

    We propose several methods to transplant the compound chaotic image encryption scheme with permutation based on three-dimensional (3-D) baker onto image formats such as the joint photographic experts group (JPEG) and graphics interchange format (GIF). The new methods avert the discrete cosine transform and quantization, which result in floating point precision loss, and succeed to encrypt and decrypt JPEG images lossless. The ciphered JPEG images generated by our solution own much better randomness than most other existing schemes. Our proposed method for GIF keeps the property of animation successfully. The security test results indicate the proposed methods have high security, and the speed of our algorithm is faster than classical solutions. Since JPEG and GIF image formats are popular contemporarily, we show that the prospect of chaotic image encryption is promising.

  19. Star Formation Suppression in Compact Group Galaxies: A New Path to Quenching?

    NASA Astrophysics Data System (ADS)

    Alatalo, K.; Appleton, P. N.; Lisenfeld, U.; Bitsakis, T.; Lanz, L.; Lacy, M.; Charmandaris, V.; Cluver, M.; Dopita, M. A.; Guillard, P.; Jarrett, T.; Kewley, L. J.; Nyland, K.; Ogle, P. M.; Rasmussen, J.; Rich, J. A.; Verdes-Montenegro, L.; Xu, C. K.; Yun, M.

    2015-10-01

    We present CO(1-0) maps of 12 warm H2-selected Hickson Compact Groups (HCGs), covering 14 individually imaged warm H2 bright galaxies, with the Combined Array for Research in Millimeter Astronomy. We found a variety of molecular gas distributions within the HCGs, including regularly rotating disks, bars, rings, tidal tails, and possibly nuclear outflows, though the molecular gas morphologies are more consistent with spirals and early-type galaxies than mergers and interacting systems. Our CO-imaged HCG galaxies, when plotted on the Kennicutt-Schmidt relation, shows star formation (SF) suppression of < {S} > =10+/- 5, distributed bimodally, with five objects exhibiting suppressions of {S} ≳ 10 and depletion timescales ≳10 Gyr. This SF inefficiency is also seen in the efficiency per freefall time of Krumholz et al. We investigate the gas-to-dust ratios of these galaxies to determine if an incorrect LCO-M(H2) conversion caused the apparent suppression and find that HCGs have normal gas-to-dust ratios. It is likely that the cause of the apparent suppression in these objects is associated with shocks injecting turbulence into the molecular gas, supported by the fact that the required turbulent injection luminosity is consistent with the bright H2 luminosity reported by Cluver et al. Galaxies with high SF suppression ({S} ≳ 10) also appear to be those in the most advanced stages of transition across both optical and infrared color space. This supports the idea that at least some galaxies in HCGs are transitioning objects, where a disruption of the existing molecular gas in the system suppresses SF by inhibiting the molecular gas from collapsing and forming stars efficiently. These observations, combined with recent work on poststarburst galaxies with molecular reservoirs, indicates that galaxies do not need to expel their molecular reservoirs prior to quenching SF and transitioning from blue spirals to red early-type galaxies. This may imply that SF quenching can

  20. Fractured-aquifer hydrogeology from geophysical logs: Brunswick group and Lockatong Formation, Pennsylvania

    USGS Publications Warehouse

    Morin, Roger H.; Senior, Lisa A.; Decker, Edward R.

    2000-01-01

    The Brunswick Group and the underlying Lockatong Formation are composed of lithified Mesozoic sediments that constitute part of the Newark Basin in southeastern Pennsylvania. These fractured rocks form an important regional aquifer that consists of gradational sequences of shale, siltstone, and sandstone, with fluid transport occurring primarily in fractures. An extensive suite of geophysical logs was obtained in seven wells located at the borough of Lansdale, Pennsylvania, in order to better characterize the areal hydrogeologic system and provide guidelines for the refinement of numerical ground water models. Six of the seven wells are approximately 120 m deep and the seventh extends to a depth of 335 m. Temperature, fluid conductivity, and flowmeter logs are used to locate zones of fluid exchange and to quantify transmissivities. Electrical resistivity and natural gamma logs together yield detailed stratigraphic information, and digital acoustic televiewer data provide magnetically oriented images of the borehole wall from which almost 900 fractures are identified.Analyses of the geophysical data indicate that the aquifer penetrated by the deep well can be separated into two distinct structural domains, which may, in turn, reflect different mechanical responses to basin extension by different sedimentary units:1. In the shallow zone (above 125 m), the dominant fracture population consists of gently dipping bedding plane partings that strike N46°E and dip to the northwest at about 11 degrees. Fluid flow is concentrated in the upper 80 m along these subhorizontal fractures, with transmissivities rapidly diminishing in magnitude with depth.2. The zone below 125 m marks the appearance of numerous high-angle fractures that are orthogonal to the bedding planes, striking parallel but dipping steeply southeast at 77 degrees.This secondary set of fractures is associated with a fairly thick (approximately 60 m) high-resistivity, low-transmissivity sandstone unit that is

  1. The role of diagnosticity in stereotype formation: perceiving group means and variances.

    PubMed

    Ford, T E; Stangor, C

    1992-09-01

    Three experiments tested the hypotheses that while forming stereotypes of social groups, people abstract the central tendency and variability of different attribute dimensions to determine which ones best differentiate the groups and that more differentiating dimensions are more likely to become stereotypical in the sense of becoming strongly associated with the groups in memory. Supporting these hypotheses. Experiment 1 found that, after viewing behaviors performed by members of 2 groups, Ss characterized the groups more in terms of attribute dimensions indicating larger differences between the central tendencies of the groups, and Experiment 2 showed that this effect did not occur when Ss formed impressions of only 1 group. Experiment 3 found that Ss also characterized groups more in terms of attribute dimensions indicating lower within-group variability.

  2. Dispersal and group formation dynamics in a rare and endangered temperate forest bat (Nyctalus lasiopterus, Chiroptera: Vespertilionidae).

    PubMed

    Santos, João D; Meyer, Christoph F J; Ibáñez, Carlos; Popa-Lisseanu, Ana G; Juste, Javier

    2016-11-01

    For elusive mammals like bats, colonization of new areas and colony formation are poorly understood, as is their relationship with the genetic structure of populations. Understanding dispersal and group formation behaviors is critical not only for a better comprehension of mammalian social dynamics, but also for guiding conservation efforts of rare and endangered species. Using nuclear and mitochondrial markers, we studied patterns of genetic diversity and differentiation among and within breeding colonies of giant noctule bats (Nyctalus lasiopterus), their relation to a new colony still in formation, and the impact of this ongoing process on the regionwide genetic makeup. Nuclear differentiation among colonies was relatively low and mostly nonsignificant. Mitochondrial variation followed this pattern, contrasting with findings for other temperate bat species. Our results suggest that this may indicate a recent population expansion. On average, female giant noctules were not more closely related to other colony members than to foreign individuals. This was also true for members of the newly forming colony and those of another, older group sampled shortly after its formation, suggesting that contrary to findings for other temperate bats, giant noctule colonies are not founded by relatives. However, mother-daughter pairs were found in the same populations more often than expected under random dispersal. Given this indication of philopatry, the lack of mitochondrial differentiation among most colonies in the region is probably due to the combination of a recent population expansion and group formation events.

  3. The Formation of Group Ethos Among Student Teachers for Inner City

    ERIC Educational Resources Information Center

    Ross, Colvin; Swick, Kevin

    1971-01-01

    The study attempted to verify a group ethos among student teachers. When the teachers involved sensed a groupness, a family ethos, they become a special core of teachers, and they performed accordingly. (Author)

  4. Report of the IAU Commission 4 Working Group on standardizing access to ephemerides and File format specification

    NASA Astrophysics Data System (ADS)

    Hilton, J.; Acton, A.; Arlot, J.-E.; Bell, , S. A.; Capitaine, N.; Fienga, A.; Folkner, W. M.; Gastineau, M.; Pavlov, D.; Pitjeva, E. V.; Skripnichenko, V. I.; Wallace, P. T.

    2014-12-01

    The IAU Commission 4 Working Group on Standardizing Access to Ephemerides recommends the use of the Spacecraft and Planet Kernel (SPK) file format to provide a uniform format for the position ephemerides of planets and other natural solar system bodies, and the use of the binary Planetary Constants Kernel (PCK) format for the orientation of a body. It further recommends supporting data be stored in a text PCK. These formats are used by the SPICE system developed by the Jet Propulsion Laboratory. A new data type, Type 20: Chebyshev (Velocity Only) has been added. Other changes to the specification are new object identification numbers for coordinate time ephemerides, and a set of three new data types that uses the TCB rather than the TDB timescale.

  5. Natural compounds containing a catechol group enhance the formation of Nε-(carboxymethyl)lysine of the Maillard reaction.

    PubMed

    Fujiwara, Yukio; Kiyota, Naoko; Tsurushima, Keiichiro; Yoshitomi, Makiko; Mera, Katsumi; Sakashita, Naomi; Takeya, Motohiro; Ikeda, Tsuyoshi; Araki, Tomohiro; Nohara, Toshihiro; Nagai, Ryoji

    2011-04-01

    Inhibition of advanced glycation end-product (AGE) formation is a potential strategy for the prevention of clinical diabetes complications. Screening for new AGE inhibitors revealed several natural compounds that inhibited the formation of N(ε)-(carboxymethyl)lysine (CML), a major antigenic AGE structure, whereas natural compounds containing a catechol group, such as gallic acid and epicatechin, significantly enhanced CML formation. A similar enhancing effect was also observed by culturing THP-1 macrophages in the presence of catechol compounds. Although 4-methylcatechol significantly enhanced CML formation from glycated HSA (gHSA), a model for Amadori proteins, analogues of catechol such as 5-methylresorcinol and methylhydroquinone showed no enhancing effect. Even though 1mM 4-methylcatechol, epicatechin, and gallic acid significantly enhanced CML formation from gHSA, it was significantly inhibited by decreasing their concentration. The enhancing effect of 1mM catechol compounds was inhibited in the presence of the glutathione peroxidase system, thus demonstrating that hydrogen peroxide generated from catechol compounds plays an important role in the enhancement of CML formation. Furthermore, administration of 500mg/kg/day epicatechin to STZ-induced diabetic mice for 45days enhanced CML accumulation at the surface area of gastric epithelial cells in the stomach. This study provides the first evidence that high amounts of catechol-containing structures enhance oxidative stress, thus leading to enhanced CML formation, and this phenomenon may explain the paradoxical effect that some flavonoids have on redox status.

  6. Pedogenesis and paleoclimatic implications of the Chamberlain Pass Formation, basal White River Group, Badlands of South Dakota

    SciTech Connect

    Terry, D.O. Jr. . Dept. of Geology); Evans, J.E. . Dept. of Geology)

    1992-01-01

    The Chamberlain Pass Formation is a new lithostratigraphic unit representing the first phase of deposition of the Paleogene White River Group in western South Dakota. The Chamberlain Pass Formation is entirely nonmarine, and has been subjected to intensive pedogenic modification. Pedogenic features within the distal overbank deposits of the Chamberlain Pass Formation have long been recognized, and classified as the Interior Paleosol Series. This study focuses on pedogenic features preserved within the channel sandstone and proximal overbank deposits of the Chamberlain Pass Formation, and proposes a new pedostratigraphic unit called the Weta Paleosol Series, to describe these features. The Interior and Weta Paleosol Series have a catenary soil relationship, based on differences in parent material and soil moisture conditions. A major difference between the two is the presence of pedorelicts within the Weta Paleosol Series, demonstrating sequential modification of soils as moisture conditions changed from wet to dry. The types of pedogenic features present within the Weta Paleosol Series, which include silcretes, calcretes, and zeolite mineralization with particular soil horizons, suggests that while previous interpretations of paleoclimates were essentially correct, paleosols of the Chamberlain Pass Formation were also subjected to periods of dryness. Counting of superimposed paleosols suggests a minimum of 60ky for deposition and pedogenic modification of the Chamberlain Pass Formation prior to a major period of incision and deposition of the overlying Chadron Formation.

  7. Social factors shaping the formation of a multi-stakeholder trails network group for the Monongahela National Forest, West Virginia

    Treesearch

    Karen Robinson; Steven Selin; Chad Pierskalla

    2009-01-01

    This paper reports the results and management implications of a longitudinal research study examining the social factors affecting the formation of a trails network advisory group for the Monongahela National Forest (MNF) in West Virginia. A collaborative process of creating an MNF trails network with input from local users and stakeholders has been largely...

  8. Treatment Effectiveness of Anxiety Management Training in Small and Large Group Formats.

    ERIC Educational Resources Information Center

    Daley, Paul C.; And Others

    1983-01-01

    Compared relative efficiency of anxiety management training (AMT) in large group to AMT in small groups and to a wait-list control. Immediately after treatment, small group AMT participants reported significantly less general anxiety than controls. Seven-week follow-up revealed maintenance of this reduction of general anxiety.

  9. The Cheshire Cat Gravitational Lens: The Formation of a Massive Fossil Group

    NASA Astrophysics Data System (ADS)

    Irwin, Jimmy A.; Dupke, Renato; Carrasco, Eleazar R.; Maksym, W. Peter; Johnson, Lucas; White, Raymond E., III

    2015-06-01

    The Cheshire Cat is a relatively poor group of galaxies dominated by two luminous elliptical galaxies surrounded by at least four arcs from gravitationally lensed background galaxies that give the system a humorous appearance. Our combined optical/X-ray study of this system reveals that it is experiencing a line of sight merger between two groups with a roughly equal mass ratio with a relative velocity of ˜1350 km s-1. One group was most likely a low-mass fossil group, while the other group would have almost fit the classical definition of a fossil group. The collision manifests itself in a bimodal galaxy velocity distribution, an elevated central X-ray temperature and luminosity indicative of a shock, and gravitational arc centers that do not coincide with either large elliptical galaxy. One of the luminous elliptical galaxies has a double nucleus embedded off-center in the stellar halo. The luminous ellipticals should merge in less than a Gyr, after which observers will see a massive 1.2-1.5 × 1014 {M}⊙ fossil group with an {M}r=-24.0 brightest group galaxy at its center. Thus, the Cheshire Cat offers us the first opportunity to study a fossil group progenitor. We discuss the limitations of the classical definition of a fossil group in terms of magnitude gaps between the member galaxies. We also suggest that if the merging of fossil (or near-fossil) groups is a common avenue for creating present-day fossil groups, the time lag between the final galactic merging of the system and the onset of cooling in the shock-heated core could account for the observed lack of well-developed cool cores in some fossil groups.

  10. Observations from practice: support group membership as a process of social capital formation among female survivors of domestic violence.

    PubMed

    Larance, Lisa Young; Porter, Maryann Lane

    2004-06-01

    This article explores the authors' practice observations of female domestic violence survivors' journey from first agency contact to active participation in a support group process. The authors have witnessed female victims of domestic violence challenging the social isolation imposed by their dominant partners as they search for meaning in their lives. As practitioners, they have observed women building trustful relationships and establishing supportive networks during the group process. In this article, the authors suggest that the support group process facilitates trust and network formation indicative of social capital.

  11. An Agent-Based Simulation for Investigating the Impact of Stereotypes on Task-Oriented Group Formation

    NASA Astrophysics Data System (ADS)

    Maghami, Mahsa; Sukthankar, Gita

    In this paper, we introduce an agent-based simulation for investigating the impact of social factors on the formation and evolution of task-oriented groups. Task-oriented groups are created explicitly to perform a task, and all members derive benefits from task completion. However, even in cases when all group members act in a way that is locally optimal for task completion, social forces that have mild effects on choice of associates can have a measurable impact on task completion performance. In this paper, we show how our simulation can be used to model the impact of stereotypes on group formation. In our simulation, stereotypes are based on observable features, learned from prior experience, and only affect an agent's link formation preferences. Even without assuming stereotypes affect the agents' willingness or ability to complete tasks, the long-term modifications that stereotypes have on the agents' social network impair the agents' ability to form groups with sufficient diversity of skills, as compared to agents who form links randomly. An interesting finding is that this effect holds even in cases where stereotype preference and skill existence are completely uncorrelated.

  12. Formation and Uses of Lay Advisory Groups for the Humanities. Project Report No. 14.

    ERIC Educational Resources Information Center

    Beckwith, Miriam M.

    Based on the experiences of several community colleges, this report examines successful and unsuccessful strategies utilized in the formation of lay advisory committees for the humanities. The report first presents brief descriptions of successful committee organization efforts at five institutions: Clark College (Vancouver, WA), Brevard Community…

  13. Formation and Uses of Lay Advisory Groups for the Humanities. Project Report No. 14.

    ERIC Educational Resources Information Center

    Beckwith, Miriam M.

    Based on the experiences of several community colleges, this report examines successful and unsuccessful strategies utilized in the formation of lay advisory committees for the humanities. The report first presents brief descriptions of successful committee organization efforts at five institutions: Clark College (Vancouver, WA), Brevard Community…

  14. Lower miocene larger foraminifera and petroleum potential of the Tai Formation, Mergui Group, Andaman Sea

    NASA Astrophysics Data System (ADS)

    Polachan, Songpope; Racey, Andrew

    Tertiary larger foraminifera are recorded for the first time from Thailand. The fauna studied is restricted mainly to the reefal carbonate of the Tai Formation, which rests unconformably on the pre-Late Eocene quartz-chlorite schist basement in the Central High region of the Mergui Basin. The formation is broadly correlatable with the Peutu Formation of the North Sumatra Basin. The Tai Formation can be divided into three units at the type locality; a basal unit of interbedded anhydrite, dolomite, shale and sandstone; a middle unit of coral/algal reefal limestones, and an upper unit of calcarenites interbedded with silty shales and sandstones. The middle and upper units have yielded a fauna comprising; Lepidocyclina (Nephrolepidina) japonica, Spiroclypeus yabeii, Cycloclypeus eidae, Cycloclypeus sp. A, Heterostegina sp. A, Lepidocyclina (N) sp. A, Miogypsina sp. A, and Miogypsinoides sp. L. (N) japonica and Miogypsinoides sp. can range up into the Middle Miocene (Lower Tf) whilst C. eidae can range down into the Upper Oligocene (Lower Te). The fauna is typical of the Indo-West Pacific Miocene faunal province of Adams (1970) and shows closer affinities to the faunas of Indonesia than those of India-Pakistan.

  15. Bark beetle conditions in western forests and formation of the Western Bark Beetle Research Group

    Treesearch

    Robert J. Cain; Jane L. Hayes

    2009-01-01

    The recent dramatic impacts of bark beetle outbreaks across conifer forests of the West have been mapped and reported by entomology and pathology professionals with Forest Health Protection (FHP), a component of USDA Forest Service's State and Private Forestry, and their state counterparts. These forest conditions set the stage for the formation of the Western...

  16. Unconformities in the mid-Late Proterozoic Pahrump Group: Stratigraphic evidence from the upper member Crystal Spring Formation

    SciTech Connect

    Mbuyi, K.; Prave, A.R. . Dept. of Earth and Atmospheric Sciences)

    1993-04-01

    Deposition of the Pahrump Group rocks (Crystal Spring-Beck Spring-Kingston Peak Formations) in the Death Valley region of California post-dates 1.7 to 1.4 Ga gneissic basement rocks (Wright et al., 1976) and mostly predates the inferred 0.75 Ga glacial deposits of the Kingston Peak Formation. The 1.08 Ga age of the diabase sills in the middle Crystal Spring Formation provides an additional time constraint. Event though this time span is excessive when compared to better dated Phanerozoic successions, the Pahrump Group, nonetheless, has been assumed to be internally conformable. Results from the authors recent work invalidates that assumption. They have carefully measured 15 sections of upper member Crystal Spring Formation rocks and have mapped in detail the belt of exposures in the Saratoga, Saddle Peak, and Ibex Hills, and northern Kingston Range. Their data indicates that an unconformity of significant but unknown duration occurs within the upper member. Evidence for this unconformity includes: (1) local angular discordance of up to 20[degree]; (2) presence of an erosive-based breccia unit (0.10--30 m thick) that consists mostly of hornfelsic clasts derived from immediately subjacent rocks; and (3) erosional beveling and truncation of underlying rocks. In addition, the upward transition to Beck Spring deposition is marked by a disconformity (sequence boundary) that cuts down across and erosionally truncates strata of the upper member Crystal Spring Formation.

  17. Educational Outcomes of Small-Group Discussion Versus Traditional Lecture Format in Dental Students' Learning and Skills Acquisition.

    PubMed

    Arias, Ana; Scott, Raymond; Peters, Ove A; McClain, Elizabeth; Gluskin, Alan H

    2016-04-01

    The aim of this prospective quantitative study was to compare the effect of different instructional formats on dental students' skills and knowledge acquisition for access cavity preparation. All first-year dental students were invited to participate in this study conducted during the four consecutive two-week endodontic rotation courses at the University of the Pacific Arthur A. Dugoni School of Dentistry in spring semester 2015. Four alphabetically distributed intact groups of students were randomly allocated to two groups (n=70 each) that participated in either small-group discussion or a traditional lecture on access preparation. The first outcome measure was skill acquisition, measured by the quality of access cavities prepared in extracted teeth at the conclusion of the session. Two blinded raters scored direct observations on a continuous scale. Knowledge, the second outcome measure, was scored with a multiple-choice and open-ended question test at the end of each two-week session. Data were obtained for 134 of the 140 students, for a 96% response rate. The results showed that students in the small-group discussion groups scored significantly higher than those in the lecture groups when skill performance was tested (p=8.9 × 10(-7)). However, no significant differences were found in the acquisition of knowledge between the two groups on the written test. Active student participation was significantly related to improved manual skill acquisition, but the format of the session does not seem to have had a direct influence on acquired knowledge.

  18. The effect of natural organic matter polarity and molecular weight on NDMA formation from two antibiotics containing dimethylamine functional groups.

    PubMed

    Leavey-Roback, Shannon L; Krasner, Stuart W; Suffet, Irwin H Mel

    2016-12-01

    N-nitrosodimethylamine (NDMA) is a disinfection byproduct preferentially formed in chloraminated water. NDMA may be formed from certain chemicals containing dimethylamine (DMA) functional groups. This reaction may be slowed by the presence of natural organic matter (NOM). In this study, NOM fractionated by size or polarity was tested for its ability to slow or impede the formation of NDMA from two DMA-containing precursors, the antibiotics tetracycline and spiramycin. The high molecular weight NOM fractions (>10KDa) were shown to be the most effective in reducing the amount of NDMA formed from the precursor chemicals. The filtrate of a C-18 non-polar cartridge was also effective at reducing NDMA formation from tetracycline (spyramycin not tested). Therefore, polar and charged NOM components may be responsible for the reduction in NDMA formation. A possible mechanism for the reduction of NDMA formation from tetracycline is complexation due to the hydrogen bonding of the DMA functional group on tetracycline to polar phenolic functional groups in the NOM. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Presence of the dinosaur Scelidosaurus indicates Jurassic age for the Kayenta Formation (Glen Canyon Group, northern Arizona)

    NASA Astrophysics Data System (ADS)

    Padian, Kevin

    1989-05-01

    The Glen Canyon Group (Moenave, Wingate, Kayenta and Navajo Formations) of northern Arizona represents an extensive outcrop of early Mesozoic age terrestrial sediments. The age of these formations has long been disputed because independent stratigraphic data from marine tie-ins, paleobotanical and palynological evidence, and radiometric calibrations have been scanty or absent. The fauna of the Kayenta Formation in particular has been problematic because it has appeared to contain both typical Late Triassic and Early Jurassic taxa Here I report that the principal evidence for Late Triassic taxa, dermal scutes previously assigned to an aetosaur, in fact belongs to the thyreophoran ornithischian dinosaur Scelidosaurus, previously known only as a washed-in form found in marine sediments in the Early Jurassic of England. The presence of this dinosaur represents the first vertebrate biostratigraphic tie-in of the Glen Canyon Group horizons with reliably dated marine deposits in Europe. Together with revised systematic assessments of other vertebrates and independent evidence from fossil pollen, it supports an Early Jurassic age for the Kayenta Formation and most or all of the Glen Canyon Group.

  20. Cubic Siloxanes with Both Si-H and Si-OtBu Groups for Site-Selective Siloxane Bond Formation.

    PubMed

    Saito, Shohei; Yamasue, Nao; Wada, Hiroaki; Shimojima, Atsushi; Kuroda, Kazuyuki

    2016-09-19

    Cage-type siloxanes have attracted increasing attention as building blocks for silica-based nanomaterials as their corners can be modified with various functional groups. Cubic octasiloxanes incorporating both Si-H and Si-OtBu groups [(tBuO)n H8-n Si8 O12 ; n=1, 2 or 7] have been synthesized by the reaction of octa(hydridosilsesquioxane) (H8 Si8 O12 ) and tert-butyl alcohol in the presence of a Et2 NOH catalyst. The Si-H and Si-OtBu groups are useful for site-selective formation of Si-O-Si linkages without cage structure deterioration. The Si-H group can be selectively hydrolyzed to form a Si-OH group in the presence of Et2 NOH, enabling the formation of the monosilanol compound (tBuO)7 (HO)Si8 O12 . The Si-OH group can be used for either intermolecular condensation to form a dimeric cage compound or silylation to introduce new reaction sites. Additionally, the alkoxy groups of (tBuO)7 HSi8 O12 can be treated with organochlorosilanes in the presence of a BiCl3 catalyst to form Si-O-Si linkages, while the Si-H group remains intact. These results indicate that such bifunctional cage siloxanes allow for stepwise Si-O-Si bond formation to design new siloxane-based nanomaterials. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Lithostratigraphy of the Calico Hills Formation and Prow Pass Tuff (Crater Flat Group) at Yucca Mountain, Nevada

    SciTech Connect

    Moyer, T.C.; Geslin, J.K.

    1995-07-01

    Lithostratigraphic relations within the Calico Hills Formation and Prow Pass Tuff (Crater Flat Group) were reconstructed from analysis of core samples and observation of outcrop exposures. The Calico Hills Formation is composed of five nonwelded pyroclastic units (each formed of one or more pyroclastic-flow deposits) that overlie an interval of bedded tuff and a basal volcaniclastic sandstone unit. The Prow Pass Tuff is divided into four pyroclastic units and an underlying interval of bedded tuff. The pyroclastic units of the Prow Pass Tuff are distinguished by the sizes and amounts of their pumice and lithic clasts and their degree of welding. Pyroclastic units of the Prow Pass Tuff are distinguished from those of the Calico Hills Formation by their phenocryst assemblage, chemical composition, and ubiquitous siltstone lithic clasts. Downhole resistivity tends to mirror the content of authigenic minerals, primarily zeolites, in both for-mations and may be useful for recognizing the vitric-zeolite boundary in the study area. Maps of zeolite distribution illustrate that the bedded tuff and basal sandstone units of the Calico Hills Formation are altered over a wider area than the pyroclastic units of both the Calico Hills Formation and the upper Prow Pass Tuff.

  2. Functional-Group-Tolerant, Silver-Catalyzed N-N Bond Formation by Nitrene Transfer to Amines.

    PubMed

    Maestre, Lourdes; Dorel, Ruth; Pablo, Óscar; Escofet, Imma; Sameera, W M C; Álvarez, Eleuterio; Maseras, Feliu; Díaz-Requejo, M Mar; Echavarren, Antonio M; Pérez, Pedro J

    2017-02-15

    Silver(I) promotes the highly chemoselective N-amidation of tertiary amines under catalytic conditions to form aminimides by nitrene transfer from PhI═NTs. Remarkably, this transformation proceeds in a selective manner in the presence of olefins and other functional groups without formation of the commonly observed aziridines or C-H insertion products. The methodology can be applied not only to rather simple tertiary amines but also to complex natural molecules such as brucine or quinine, where the products derived from N-N bond formation were exclusively formed. Theoretical mechanistic studies have shown that this selective N-amidation reaction proceeds through triplet silver nitrenes.

  3. The Town Hall Focus Group: A New Format for Qualitative Research Methods

    ERIC Educational Resources Information Center

    Zuckerman-Parker, Michelle; Shank, Gary

    2008-01-01

    The town hall focus group method is described in this paper. We start by outlining the circumstances that brought about this unusual research strategy. Then, we describe the tactical decisions we made that allowed this particular effort to be a success. We conclude with a series of concrete suggestions for conducting focus groups with large groups…

  4. Item Construction Using Reflective, Formative, or Rasch Measurement Models: Implications for Group Work

    ERIC Educational Resources Information Center

    Peterson, Christina Hamme; Gischlar, Karen L.; Peterson, N. Andrew

    2017-01-01

    Measures that accurately capture the phenomenon are critical to research and practice in group work. The vast majority of group-related measures were developed using the reflective measurement model rooted in classical test theory (CTT). Depending on the construct definition and the measure's purpose, the reflective model may not always be the…

  5. Item Construction Using Reflective, Formative, or Rasch Measurement Models: Implications for Group Work

    ERIC Educational Resources Information Center

    Peterson, Christina Hamme; Gischlar, Karen L.; Peterson, N. Andrew

    2017-01-01

    Measures that accurately capture the phenomenon are critical to research and practice in group work. The vast majority of group-related measures were developed using the reflective measurement model rooted in classical test theory (CTT). Depending on the construct definition and the measure's purpose, the reflective model may not always be the…

  6. Depositional History and Sequence Stratigraphy of the Middle Ordovician Yeongheung Formation (Yeongweol Group), Taebaeksan Basin, mid-east Korea

    NASA Astrophysics Data System (ADS)

    Kwon, Yoo Jin; Kwon, Yi Kyun

    2017-04-01

    The Middle Ordovician Yeongheung Formation consists of numerous meter-scale, shallowing-upward cycles which were deposited on a shallow-marine carbonate platform. Many diagnostic sedimentary textures and structures such as supratidal laminite, tepee structure, and solution-collapsed breccia are observed, which enable to infer the dry climate and high salinity conditions during deposition of the formation. In order to understand its depositional history, this study focuses on vertical and spatial stacking patterns of the second- to third-order sequences through the detailed outcrop description and geologic mapping. A total 19 lithofacies have been recognized, which can be grouped into 5 facies associations (FAs): FA1 (Supratidal flat), FA2 (Supratidal or dolomitization of peritidal facies), FA3 (Intertidal flat), FA4 (Shallow subtidal to peritidal platform), FA5 (Shallow subtidal shoal). Global mega-sequence boundary (Sauk-Tippecanoe) occurs in solution-collapsed breccia zone in the lower part of the formation. Correlation of the shallowing-upward cycle stacking pattern across the study area defines 6 transgressive-regressive depositional sequences. Each depositional sequences comprises a package of vertical and spatial staking of shallow subtidal cycles in the lower part and peritidal cycles in the upper part of the formation. According to sequence stratigraphic interpretation, the reconstructed relative sea-level curve of the Yeongweol platform is very similar to that of the Taebaek platform. Based on the absence of siliciclastic sequence such as the Jigunsan Formation and the lithologic & stratigraphic differences, however, the Yeongweol and Taebaek groups might not belong to a single depositional system within the North China platform. The Yeongweol Group can be divided by the four subunits into their unique lithologic successions and geographic distributions. The Eastern subunit of the Yeongweol Group is composed dominantly of carbonate rocks with a high

  7. Toxic tau oligomer formation blocked by capping of cysteine residues with 1,2-dihydroxybenzene groups.

    PubMed

    Soeda, Yoshiyuki; Yoshikawa, Misato; Almeida, Osborne F X; Sumioka, Akio; Maeda, Sumihiro; Osada, Hiroyuki; Kondoh, Yasumitsu; Saito, Akiko; Miyasaka, Tomohiro; Kimura, Tetsuya; Suzuki, Masaaki; Koyama, Hiroko; Yoshiike, Yuji; Sugimoto, Hachiro; Ihara, Yasuo; Takashima, Akihiko

    2015-12-16

    Neurofibrillary tangles, composed of hyperphosphorylated tau fibrils, are a pathological hallmark of Alzheimer's disease; the neurofibrillary tangle load correlates strongly with clinical progression of the disease. A growing body of evidence indicates that tau oligomer formation precedes the appearance of neurofibrillary tangles and contributes to neuronal loss. Here we show that tau oligomer formation can be inhibited by compounds whose chemical backbone includes 1,2-dihydroxybenzene. Specifically, we demonstrate that 1,2-dihydroxybenzene-containing compounds bind to and cap cysteine residues of tau and prevent its aggregation by hindering interactions between tau molecules. Further, we show that orally administered DL-isoproterenol, an adrenergic receptor agonist whose skeleton includes 1,2-dihydroxybenzene and which penetrates the brain, reduces the levels of detergent-insoluble tau, neuronal loss and reverses neurofibrillary tangle-associated brain dysfunction. Thus, compounds that target the cysteine residues of tau may prove useful in halting the progression of Alzheimer's disease and other tauopathies.

  8. Divergent Mechanistic Routes for the Formation of gem-Dimethyl Groups in the Biosynthesis of Complex Polyketides

    SciTech Connect

    Poust, S; Phelan, RM; Deng, K; Katz, L; Petzold, CJ; Keasling, JD

    2015-01-07

    The gem-dimethyl groups in polyketide-derived natural products add steric bulk and, accordingly, lend increased stability to medicinal compounds, however, our ability to rationally incorporate this functional group in modified natural products is limited. In order to characterize the mechanism of gem-dimethyl group formation, with a goal toward engineering of novel compounds containing this moiety, the gem-dimethyl group producing polyketide synthase (PKS) modules of yersiniabactin and epothilone were characterized using mass spectrometry. The work demonstrated, contrary to the canonical understanding of reaction order in PKSs, that methylation can precede condensation in gem-dimethyl group producing PKS modules. Experiments showed that both PKSs are able to use dimethylmalonyl acyl carrier protein (ACP) as an extender unit. Interestingly, for epothilone module8, use of dimethylmalonyl-ACP appeared to be the sole route to form a gem-dimethylated product, while the yersiniabactin PKS could methylate before or after ketosynthase condensation.

  9. Undergraduate ALFALFA Team: Analysis of Spatially-Resolved Star-Formation in Nearby Galaxy Groups and Clusters

    NASA Astrophysics Data System (ADS)

    Finn, Rose; Collova, Natasha; Spicer, Sandy; Whalen, Kelly; Koopmann, Rebecca A.; Durbala, Adriana; Haynes, Martha P.; Undergraduate ALFALFA Team

    2017-01-01

    As part of the Undergraduate ALFALFA Team, we are conducting a survey of the gas and star-formation properties of galaxies in 36 groups and clusters in the local universe. The galaxies in our sample span a large range of galactic environments, from the centers of galaxy groups and clusters to the surrounding infall regions. One goal of the project is to map the spatial distribution of star-formation; the relative extent of the star-forming and stellar disks provides important information about the internal and external processes that deplete gas and thus drive galaxy evolution. We obtained wide-field H-alpha observations with the WIYN 0.9m telescope at Kitt Peak National Observatory for galaxies in the vicinity of the MKW11 and NRGb004 galaxy groups and the Abell 1367 cluster. We present a preliminary analysis of the relative size of the star-forming and stellar disks as a function of galaxy morphology and local galaxy density, and we calculate gas depletion times using star-formation rates and HI gas mass. We will combine these results with those from other UAT members to determine if and how environmentally-driven gas depletion varies with the mass and X-ray properties of the host group or cluster. This work has supported by NSF grants AST-0847430, AST-1211005 and AST-1637339.

  10. Local wave grouping in a parameter-gradient system and its formation mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Huimin; Wu, Yangle; Yu, Jianglei; Ouyang, Qi

    2008-01-01

    In a ferroin-catalyzed Belousov-Zhabotinsky (BZ) reaction-diffusion system with reagent concentration gradients, we observed in the experiment a type of spirals with local waves forming groups. Here, we propose an interpretation of the wave grouping phenomenon. The wave grouping mechanism can be well explained in terms of the cooperation of the excitability gradient and the Doppler effect induced by spiral tip’s meandering. In the simulation based on three-dimensional reaction-diffusion system using Oregonator model, spiral patterns analogous to the experiment observation are well reproduced when the parameter gradient in the z direction is introduced.

  11. Local wave grouping in a parameter-gradient system and its formation mechanism.

    PubMed

    Liao, Huimin; Wu, Yangle; Yu, Jianglei; Ouyang, Qi

    2008-01-01

    In a ferroin-catalyzed Belousov-Zhabotinsky (BZ) reaction-diffusion system with reagent concentration gradients, we observed in the experiment a type of spirals with local waves forming groups. Here, we propose an interpretation of the wave grouping phenomenon. The wave grouping mechanism can be well explained in terms of the cooperation of the excitability gradient and the Doppler effect induced by spiral tip's meandering. In the simulation based on three-dimensional reaction-diffusion system using Oregonator model, spiral patterns analogous to the experiment observation are well reproduced when the parameter gradient in the z direction is introduced.

  12. Alcohol and group formation: a multimodal investigation of the effects of alcohol on emotion and social bonding.

    PubMed

    Sayette, Michael A; Creswell, Kasey G; Dimoff, John D; Fairbairn, Catharine E; Cohn, Jeffrey F; Heckman, Bryan W; Kirchner, Thomas R; Levine, John M; Moreland, Richard L

    2012-08-01

    We integrated research on emotion and on small groups to address a fundamental and enduring question facing alcohol researchers: What are the specific mechanisms that underlie the reinforcing effects of drinking? In one of the largest alcohol-administration studies yet conducted, we employed a novel group-formation paradigm to evaluate the socioemotional effects of alcohol. Seven hundred twenty social drinkers (360 male, 360 female) were assembled into groups of 3 unacquainted persons each and given a moderate dose of an alcoholic, placebo, or control beverage, which they consumed over 36 min. These groups' social interactions were video recorded, and the duration and sequence of interaction partners' facial and speech behaviors were systematically coded (e.g., using the facial action coding system). Alcohol consumption enhanced individual- and group-level behaviors associated with positive affect, reduced individual-level behaviors associated with negative affect, and elevated self-reported bonding. Our results indicate that alcohol facilitates bonding during group formation. Assessing nonverbal responses in social contexts offers new directions for evaluating the effects of alcohol.

  13. Formation of the lamellar structure in Group IA and IIID iron meteorites

    NASA Technical Reports Server (NTRS)

    Kowalik, J. A.; Williams, D. B.; Goldstein, J. I.

    1988-01-01

    Analytical EM, light microscopy, and electron microprobe analysis are used to study the lamellar plessite structure of Group IA and IIID iron meteorites. The alpha lamellae in IIID structures contained a compositional gradient from 6.1 + or - 0.7 wt pct Ni at the center of the alpha lamellae to 3.6 + or - 0.5 wt pct at the alpha/gamma interface. For the Group IA irons, compositions of 4 wt pct Ni in alpha and about 48 wt pct Ni in gamma are found. Convergent beam electron diffraction was used to characterize the orientation relations at the alpha/gamma interface in the lamellar regions of both Group IA and IIID. The phase transformations responsible for the observed lamellar structure in the IA and IIID chemical groups were also investigated.

  14. The activation energy values estimated by the Arrhenius equation as a controlling factor of platinum-group mineral formation

    NASA Astrophysics Data System (ADS)

    Petrou, Athinoula L.; Economou-Eliopoulos, Maria

    2009-03-01

    In ophiolite complexes and Ural/Alaskan-type intrusions the platinum-group element minerals (PGM) occur as laurite (RuS 2), erlichmanite (OsS 2), irarsite (IrAsS) and alloys (Os-Ir-Ru and Pt-Fe). They are commonly found as small inclusions (normally less than 10 μm, occasionally up to 100 μm) in chromite. The origin of coarse-grained PGM, in the form of 0.5-10 mm nuggets, in placer deposits related with mafic/ultramafic complexes remains still unclear. Literature data on grain size ( r) of platinum-group minerals (PGM) and their formation temperature (range of temperatures between 700 and 1100 °C), revealed an Arrhenius temperature dependence. Correlation of the rate of crystal formation that depends on temperature (T) with the size ( r) of the grain results in a linear relationship between ln( r) and 1/T. From the slope of the line n × ln( r) = -const. + Eact/ RT the activation energy for the formation of IPGM (Ir-platinum-group minerals) was estimated, for the first time in the present study, to be approximately 450 ± 45 kJ mol -1. Applying the Arrhenius equation, the corresponding formation temperature for extremely large IPGM grains (up to 1.3 mm) in chromite ores related to ophiolites was found to be approximately 740 °C. It seems to be consistent with a lower formation temperature than with the typical formation temperature of small PGM grains associated with ophiolitic chromitites. This suggests that coarse-grained PGM in mafic/ultramafic complexes, along the permeable shear zones, may have been re-crystallized during plastic deformation at relatively lower temperatures (700-800 °C), under appropriate pressure, temperature, redox conditions and an increased H 2O content. Thus, applying the plot of ln( r) versus 1/T on large Os-Ir-Ru-minerals (sulfides or alloys), characterized by an r value falling into the linear part of the graph and having evidence supporting their formation at relatively high temperatures, then the corresponding formation

  15. End Group Effects on the Hydrogel Formation of PEO-PPO-PEO Triblock Copolymers

    NASA Astrophysics Data System (ADS)

    Cohen, Aaron; Ryu, Chang Y.; Jung, Gyoo Y.; Hwang, Hee Sung

    2012-02-01

    Pluronic F108, a triblock copolymer consisting of outer polyethylene oxide (PEO) chains and an inner polypropylene oxide (PPO) chains, has been shown to be an effective hydrogel matrix for DNA separation by capillary electrophoresis using single-stranded conformation polymorphism. This presentation will discuss a new pathway to potentially enhance the separation abilities of F108 by altering the chain end groups of the block copolymers. F108 is believed to form a micelle in aqueous solutions with the hydrophobic group in the interior, thus we expect considerable interaction between the DNA sample and the end groups found at the hydrophilic brush layers of the micelle. The rheological properties of end group derivatives of F108, in combination of small angle x-ray scattering, can reveal structural differences in the micelles. In particular, gelation temperature of the end group derivatives can be linked to differences in the micelle structure. Dynamic light scattering can also be used to determine the effects of chain end groups on the hydrodynamic size of the block copolymer micelles in dilute solution.

  16. INTERGALACTIC GAS IN GROUPS OF GALAXIES: IMPLICATIONS FOR DWARF SPHEROIDAL FORMATION AND THE MISSING BARYONS PROBLEM

    SciTech Connect

    Freeland, E.; Wilcots, E. E-mail: ewilcots@astro.wisc.edu

    2011-09-10

    Radio galaxies with bent jets are predominantly located in groups and clusters of galaxies. We use bent-double radio sources, under the assumption that their jets are bent by ram pressure, to probe intragroup medium (IGM) gas densities in galaxy groups. This method provides a direct measurement of the intergalactic gas density and allows us to probe intergalactic gas at large radii and in systems whose IGM is too cool to be detected by the current generation of X-ray telescopes. We find gas with densities of 10{sup -3} to 10{sup -4} cm{sup -3} at group radii from 15 to 700 kpc. A rough estimate of the total baryonic mass in intergalactic gas is consistent with the missing baryons being located in the IGM of galaxy groups. The neutral gas will be easily stripped from dwarf galaxies with total masses of 10{sup 6}-10{sup 7} M{sub sun} in the groups studied here. Indications are that intragroup gas densities in less-massive systems like the Local Group should be high enough to strip gas from dwarfs like Leo T and, in combination with tides, produce dwarf spheroidals.

  17. Stratigraphic reconnaissance of the Middle Jurassic Red Glacier Formation, Tuxedni Group, at Red Glacier, Cook Inlet, Alaska

    USGS Publications Warehouse

    LePain, David L.; Stanley, Richard G.

    2015-01-01

    The Alaska Division of Geological & Geophysical Surveys (DGGS) and U.S. Geological Survey (USGS) are implementing ongoing programs to characterize the petroleum potential of Cook Inlet basin. Since 2009 this program has included work on the Mesozoic stratigraphy of lower Cook Inlet, including the Middle Jurassic Tuxedni Group between Tuxedni and Iniskin bays (LePain and others, 2013; Stanley and others, 2013; fig. 5-1). The basal unit in the group, the Red Glacier Formation (fig. 5-2), is thought to be the principal source rock for oil produced in upper Cook Inlet, and available geochemical data support this contention (Magoon and Anders, 1992; Magoon, 1994). Despite its economic significance very little has been published on the formation since Detterman and Hartsock’s (1966) seminal contribution on the geology of the Iniskin–Tuxedni area nearly 50 years ago. Consequently its stratigraphy, contact relations with bounding formations, and source rock characteristics are poorly known. During the 2014 field season, a nearly continuous stratigraphic section through the Red Glacier Formation in its type area at Red Glacier was located and measured to characterize sedimentary facies and to collect a suite of samples for analyses of biostratigraphy, Rock-Eval pyrolysis, vitrinite reflectance, and sandstone composition (fig. 5-3).The poorly known nature of the Red Glacier Formation is likely due to its remote location, steep terrain, and the fact that the type section is split into two segments that are more than 3 km apart. The lower 375 m segment of the formation is on the ridge between Red Glacier and Lateral Glacier and the upper 1,009 m segment is on the ridge between Red Glacier and Boulder Creek (fig. 5-3). Structural complications in the area add to the difficulty in understanding how these two segments fit together.

  18. Surface relief grating formation in luminescent dye doped photochromic polymer containing azobenzene side groups

    NASA Astrophysics Data System (ADS)

    Sznitko, Lech; Karpinski, Pawel; Bartkiewicz, Stanislaw; Miniewicz, Andrzej; Mysliwiec, Jaroslaw

    2013-08-01

    We study the formation of a surface relief grating and photoluminescence in a thin layers of a photochromic polymer doped with the luminescent dyes 3-(1,1-dicyanoethenyl)-1-phenyl-4,5-dihydro-1H-pyrazole and Rhodamine 6G. Surface topography measurements via Atomic Force Microscopy confirmed the existence of a surface relief grating with amplitudes as high as 650 nm both for doped and undoped photochromic polymers. Spectroscopic measurements carried out for polymers containing luminescent dyes have shown efficient photoluminescence and amplified spontaneous emission which is characteristic for gain media.

  19. An ectoprotein kinase of group C streptococci binds hyaluronan and regulates capsule formation.

    PubMed

    Nickel, V; Prehm, S; Lansing, M; Mausolf, A; Podbielski, A; Deutscher, J; Prehm, P

    1998-09-11

    A 56-kDa protein had been isolated and cloned from protoplast membranes of group C streptococci that had erroneously been identified as hyaluronan synthase. The function of this protein was reexamined. When streptococcal membranes were separated on an SDS-polyacrylamide gel and renatured, a 56-kDa protein was detected that had kinase activity for a casein substrate. When this recombinant protein was expressed in Escherichia coli and incubated in the presence of [32P]ATP, it was responsible for phosphorylation of two proteins with 30 and 56 kDa that were not present in the control lysate. The 56-kDa protein was specifically phosphorylated in an immunoprecipitate of a detergent extract of the recombinant E. coli lysate with antibodies against the 56-kDa protein, indicating that it was autophosphorylated. The E. coli lysate containing the recombinant protein could bind hyaluronan, and hyaluronan binding was abolished by the addition of ATP. Kinetic analysis of hyaluronan synthesis and release from isolated protoplast membranes indicated that phosphorylation by ATP stimulated hyaluronan release and synthesis. Incubation of membranes with antibodies to the 56-kDa protein increased hyaluronan release. The addition of [32P]ATP to intact streptococci led to rapid phosphorylation of two proteins, 56 and 75 kDa each at threonine residues. This phosphorylation was neither observed with [32P]phosphate nor in the presence of trypsin, indicating that the kinase was localized extracellularly. The addition of ATP to growing group C streptococci led to increased hyaluronan synthesis and release. However marked differences were found between group A and group C streptococci. Antibodies against the 56-kDa protein from group C streptococci did not recognize proteins from group A strains, and a homologous DNA sequence could not be detected by polymerase chain reaction or Southern blotting. In addition, Group A streptococci did not retain a large hyaluronan capsule like group C strains

  20. Environmental interactions in Space Exploration: Announcement of the formation of an Environmental Interactions Working Group

    NASA Technical Reports Server (NTRS)

    Kolecki, Joseph C.; Hillard, G. Barry

    1991-01-01

    With the advent of the Space Exploration Initiative, the possibility of designing and using systems on scales not heretofore attempted presents exciting new challenges in systems design and space science. The environments addressed by the Space Exploration Initiative include the surfaces of the Moon and Mars, as well as the varied plasma and field environments which will be encountered by humans and cargo enroute to these destinations. Systems designers will need to understand environmental interactions and be able to model these mechanisms from the earliest conceptual design stages through design completion. To the end of understanding environmental interactions and establishing robotic precursor mission requirements, an Environmental Interactions Working Group has been established as part of the Robotic Missions Working Group. The current paper describes the working group and gives an update of its current activities. Working group charter and operation are reviewed, background information on the environmental interactions and their characteristics is offered, and the current status of the group's activities is presented along with anticipations for the future.

  1. Petrography, diagenesis and geotechnical properties of the El-Rufuf Formation (Thebes Group), El-Kharga Oasis, Egypt

    NASA Astrophysics Data System (ADS)

    Bashed, M. A.; Sediek, K. N.

    1997-10-01

    The El-Rufuf Formation (Thebes Group) outcrops widely in Egypt. It is quarried as an ornamental building stone and used as slabs in walls and floors. It is also important in foundation construction. The geotechnical behaviour of these rocks is commonly related to stratigraphical position, controlled by their petrography and textural and diagenetic features. The El-Rufuf Formation of Naqb Assiut, El-Kharga Oasis, consists of 63 m of micritic and neomorphosed limestones which are marly at the base. Microfacies analysis of these limestones indicates an inner to middle shelf open marine environment. The most common diagenetic features are neomorphism, silicification, dissolution and stylolites. There are clear relationships between the measured compressive strength of rocks and the facies and diagenetic features. Neomorphic sparry limestone has the lowest compressive strength, while cherty biomicritic limestone shows the highest values. Micritic and biomicritic limestones show intermediate values. Some anisotropism of compressive strength values is recorded in the stylolitic limestones and in the foliated marly part of the formation. The present study reveals that the El-Rufuf limestones, according to Deere's (1968) classification, are low to medium strength rocks with low modulus ratios (DL-CL), while the marly parts of the formation are low strength rocks with low modulus ratios (EL). The rocks of the marly part of the El-Rufuf Formation are unstable with regard to water and therefore have a zero softness coefficient.

  2. Isolation, phylogenetic group, drug resistance, biofilm formation, and adherence genes of Escherichia coli from poultry in central China.

    PubMed

    Wang, Yang; Yi, Li; Wang, Yuxin; Wang, Yuanguo; Cai, Ying; Zhao, Wenpeng; Ding, Chan

    2016-12-01

    The isolation and identification, genetic typing, antibiotic sensitivity, and biofilm formation of avian Escherichia coli in central China was studied. A total of 256 isolates of E. coli were obtained, and classified into groups: A (50.78%, 130/256), B1 (11.72%, 30/256), B2 (17.58%, 45/256), and D (19.92%, 51/256). Drug susceptibility testing revealed that the strains showed a high drug resistance rate against penicillin, aztreonam, rifampicin, kanamycin, clindamycin, and gentamicin, with 92.19% of strains exhibiting multi-drug resistance. A biofilm assay revealed that 81.64% of isolates could form biofilms. Of the total isolates, 25.39% of isolates showed strong biofilm-formation ability, 31.25% showed moderate biofilm-formation ability, 28.90% showed weak biofilm-formation ability, and 18.36% were unable to form biofilms. Most adhesion-associated genes were distributed among 5 or 8 genes in strong biofilm-forming ability isolates. However, adhesion-associated genes distributed among 1 or 4 genes were found in weak biofilm-forming ability isolates and non-ability isolates. The results showed a high drug resistance rate and biofilm formation ability in E.coli strains isolated from poultry. The isolates which have strong biofilm-forming ability were mostly belong to pathogenic E. coli (B2, D). Furthermore, it was the first report to demonstrate a positive correlation between adhesion-encoding genes and biofilms phenotype.

  3. The Trier Social Stress Test for Groups (TSST-G): A new research tool for controlled simultaneous social stress exposure in a group format.

    PubMed

    von Dawans, Bernadette; Kirschbaum, Clemens; Heinrichs, Markus

    2011-05-01

    Psychological stress is an ubiquitous challenge across human cultures affecting mental and physical health. Recent evidence indicates that performance tasks combining elements of socio-evaluative threat and uncontrollability elicit reliable stress responses. The Trier Social Stress Test (TSST) is the most frequently used psychological protocol in stress research; however, to date it has only been available in a single-subject version. In particular, there is an increasing need in several emerging research fields such as stress research or social neurosciences for a standardized research tool to expose relatively large groups of subjects to controlled simultaneous stress. In search of a laboratory stressor that allows simultaneous stress exposure in a group format, we exposed a total of 25 healthy male participants to the Trier Social Stress Test for Groups (TSST-G; public speaking and mental arithmetic tasks in front of a panel of two evaluators in groups of six participants) and a specific control condition. Results showed that the TSST-G induced significant increases in cortisol, heart rate, and psychological stress responses. The TSST-G provides a novel, effective, and economical protocol for experimental paradigms requiring simultaneous stress induction in multiple participants. Copyright © 2010 Elsevier Ltd. All rights reserved.

  4. Modeling the formation process of grouping stimuli sets through cortical columns and microcircuits to feature neurons.

    PubMed

    Klefenz, Frank; Williamson, Adam

    2013-01-01

    A computational model of a self-structuring neuronal net is presented in which repetitively applied pattern sets induce the formation of cortical columns and microcircuits which decode distinct patterns after a learning phase. In a case study, it is demonstrated how specific neurons in a feature classifier layer become orientation selective if they receive bar patterns of different slopes from an input layer. The input layer is mapped and intertwined by self-evolving neuronal microcircuits to the feature classifier layer. In this topical overview, several models are discussed which indicate that the net formation converges in its functionality to a mathematical transform which maps the input pattern space to a feature representing output space. The self-learning of the mathematical transform is discussed and its implications are interpreted. Model assumptions are deduced which serve as a guide to apply model derived repetitive stimuli pattern sets to in vitro cultures of neuron ensembles to condition them to learn and execute a mathematical transform.

  5. Petrology and geochemistry of REE-rich Mafé banded iron formations (Bafia group, Cameroon)

    NASA Astrophysics Data System (ADS)

    Nkoumbou, Charles; Gentry, Fuh Calistus; Tchakounte Numbem, Jacqueline; Belle Ekwe Lobé, Yolande Vanessa; Nwagoum Keyamfé, Christin Steve

    2017-07-01

    Archaean-Paleoproterozoic foliated amphibole-gneisses and migmatites interstratified with amphibolites, pyroxeno-amphibolites and REE-rich banded-iron formations outcrop at Mafé, Ndikinimeki area. The foliation is nearly vertical due to tight folds. Flat-lying quartz-rich mica schists and quartzites, likely of Pan-African age, partly cover the formations. Among the Mafé BIFs, the oxide BIF facies shows white layers of quartz and black layers of magnetite and accessory hematite, whereas the silicate BIF facies is made up of thin discontinuous quartz layers alternating with larger garnet (almandine-spessartine) + chamosite + ilmenite ± Fe-talc layers. REE-rich oxide BIFs compositions are close to the East Pacific Rise (EPR) hydrothermal deposit; silicate BIFs plot midway between EPR and the associated amphibolite, accounting for a contamination by volcanic materials, in addition to the hydrothermal influence during their oceanic deposition. The association of an oceanic setting with alkaline and tholeiitic magmatism is typical of the Algoma-type BIF deposit. The REE-rich BIFs indices recorded at Mafé are interpreted as resulting from an Archaean-Paleoproterozoic mineralization.

  6. Modeling the Formation Process of Grouping Stimuli Sets through Cortical Columns and Microcircuits to Feature Neurons

    PubMed Central

    Williamson, Adam

    2013-01-01

    A computational model of a self-structuring neuronal net is presented in which repetitively applied pattern sets induce the formation of cortical columns and microcircuits which decode distinct patterns after a learning phase. In a case study, it is demonstrated how specific neurons in a feature classifier layer become orientation selective if they receive bar patterns of different slopes from an input layer. The input layer is mapped and intertwined by self-evolving neuronal microcircuits to the feature classifier layer. In this topical overview, several models are discussed which indicate that the net formation converges in its functionality to a mathematical transform which maps the input pattern space to a feature representing output space. The self-learning of the mathematical transform is discussed and its implications are interpreted. Model assumptions are deduced which serve as a guide to apply model derived repetitive stimuli pattern sets to in vitro cultures of neuron ensembles to condition them to learn and execute a mathematical transform. PMID:24369455

  7. Insights into the formation of inorganic heterocycles via cyclocondensation of primary amines with group 15 and 16 halides.

    PubMed

    Chivers, Tristram; Laitinen, Risto S

    2017-01-31

    Cyclocondensation is a major preparative route for the generation of inorganic heterocycles especially in the case of ring systems involving a Group 15 or 16 element linked to nitrogen. This Perspective will consider recent experimental and computational studies involving the reactions of primary amines (or their synthetic equivalents) with pnictogen and chalcogen halides. The major focus will be a discussion of the identity and role of acyclic intermediates in the reaction pathways to ring formation, as well as the nature of the heterocycles so formed. The similarities and differences between the chemistry of group 15 and 16 systems are emphasised with a view to providing signposts for further investigations.

  8. Human group formation in online guilds and offline gangs driven by a common team dynamic

    NASA Astrophysics Data System (ADS)

    Johnson, Neil F.; Xu, Chen; Zhao, Zhenyuan; Ducheneaut, Nicolas; Yee, Nicholas; Tita, George; Hui, Pak Ming

    2009-06-01

    Quantifying human group dynamics represents a unique challenge. Unlike animals and other biological systems, humans form groups in both real (offline) and virtual (online) spaces—from potentially dangerous street gangs populated mostly by disaffected male youths to the massive global guilds in online role-playing games for which membership currently exceeds tens of millions of people from all possible backgrounds, age groups, and genders. We have compiled and analyzed data for these two seemingly unrelated offline and online human activities and have uncovered an unexpected quantitative link between them. Although their overall dynamics differ visibly, we find that a common team-based model can accurately reproduce the quantitative features of each simply by adjusting the average tolerance level and attribute range for each population. By contrast, we find no evidence to support a version of the model based on like-seeking-like (i.e., kinship or “homophily”).

  9. Human group formation in online guilds and offline gangs driven by a common team dynamic.

    PubMed

    Johnson, Neil F; Xu, Chen; Zhao, Zhenyuan; Ducheneaut, Nicolas; Yee, Nicholas; Tita, George; Hui, Pak Ming

    2009-06-01

    Quantifying human group dynamics represents a unique challenge. Unlike animals and other biological systems, humans form groups in both real (offline) and virtual (online) spaces-from potentially dangerous street gangs populated mostly by disaffected male youths to the massive global guilds in online role-playing games for which membership currently exceeds tens of millions of people from all possible backgrounds, age groups, and genders. We have compiled and analyzed data for these two seemingly unrelated offline and online human activities and have uncovered an unexpected quantitative link between them. Although their overall dynamics differ visibly, we find that a common team-based model can accurately reproduce the quantitative features of each simply by adjusting the average tolerance level and attribute range for each population. By contrast, we find no evidence to support a version of the model based on like-seeking-like (i.e., kinship or "homophily").

  10. Doing Violence, Making Race: Southern Lynching and White Racial Group Formation.

    PubMed

    Smångs, Mattias

    2016-03-01

    This article presents a theoretical framework of how intergroup violence may figure into the activation and maintenance of group categories, boundaries, and identities, as well as the mediating role played by organizations in such processes. The framework's analytical advantages are demonstrated in an application to southern lynchings. Findings from event- and community-level analyses suggest that "public" lynchings, carried out by larger mobs with ceremonial violence, but not "private" ones, perpetrated by smaller bands without public or ceremonial violence, fed off and into the racial group boundaries, categories, and identities promoted by the southern Democratic Party at the turn of the 20th century and on which the emerging Jim Crow system rested. Highlighting that racialized inequalities cannot be properly understood apart from collective processes of racial group boundary and identity making, the article offers clues to the mechanisms by which past racial domination influences contemporary race relations.

  11. ON THE FORMATION OF AMIDE POLYMERS VIA CARBONYL–AMINO GROUP LINKAGES IN ENERGETICALLY PROCESSED ICES OF ASTROPHYSICAL RELEVANCE

    SciTech Connect

    Förstel, Marko; Maksyutenko, Pavlo; Jones, Brant M.; Kaiser, Ralf I.; Sun, Bing J.; Lee, Huan C.; Chang, Agnes H. H. E-mail: hhchang@mail.ndhu.edu.tw

    2016-04-01

    We report on the formation of organic amide polymers via carbonyl–amino group linkages in carbon monoxide and ammonia bearing energetically processed ices of astrophysical relevance. The first group comprises molecules with one carboxyl group and an increasing number of amine moieties starting with formamide (45 u), urea (60 u), and hydrazine carboxamide (75 u). The second group consists of species with two carboxyl (58 u) and up to three amine groups (73 u, 88 u, and 103 u). The formation and polymerization of these linkages from simple inorganic molecules via formamide und urea toward amide polymers is discussed in an astrophysical and astrobiological context. Our results show that long chain molecules, which are closely related to polypeptides, easily form by energetically processing simple, inorganic ices at very low temperatures and can be released into the gas phase by sublimation of the ices in star-forming regions. Our experimental results were obtained by employing reflectron time-of-flight mass spectroscopy, coupled with soft, single photon vacuum ultraviolet photoionization; they are complemented by theoretical calculations.

  12. On the Formation of Amide Polymers via Carbonyl-Amino Group Linkages in Energetically Processed Ices of Astrophysical Relevance

    NASA Astrophysics Data System (ADS)

    Förstel, Marko; Maksyutenko, Pavlo; Jones, Brant M.; Sun, Bing J.; Lee, Huan C.; Chang, Agnes H. H.; Kaiser, Ralf I.

    2016-04-01

    We report on the formation of organic amide polymers via carbonyl-amino group linkages in carbon monoxide and ammonia bearing energetically processed ices of astrophysical relevance. The first group comprises molecules with one carboxyl group and an increasing number of amine moieties starting with formamide (45 u), urea (60 u), and hydrazine carboxamide (75 u). The second group consists of species with two carboxyl (58 u) and up to three amine groups (73 u, 88 u, and 103 u). The formation and polymerization of these linkages from simple inorganic molecules via formamide und urea toward amide polymers is discussed in an astrophysical and astrobiological context. Our results show that long chain molecules, which are closely related to polypeptides, easily form by energetically processing simple, inorganic ices at very low temperatures and can be released into the gas phase by sublimation of the ices in star-forming regions. Our experimental results were obtained by employing reflectron time-of-flight mass spectroscopy, coupled with soft, single photon vacuum ultraviolet photoionization; they are complemented by theoretical calculations.

  13. The International Dermatology Outcome Measures Group: formation of patient-centered outcome measures in dermatology.

    PubMed

    Gottlieb, Alice B; Levin, Adriane A; Armstrong, April W; Abernethy, April; Duffin, Kristina Callis; Bhushan, Reva; Garg, Amit; Merola, Joseph F; Maccarone, Mara; Christensen, Robin

    2015-02-01

    As quality standards are increasingly in demand throughout medicine, dermatology needs to establish outcome measures to quantify the effectiveness of treatments and providers. The International Dermatology Outcome Measures Group was established to address this need. Beginning with psoriasis, the group aims to create a tool considerate of patients and providers using the input of all relevant stakeholders in assessment of disease severity and response to treatment. Herein, we delineate the procedures through which consensus is being reached and the future directions of the project.

  14. Use of formative research and social network theory to develop a group walking intervention: Sumter County on the Move!

    PubMed

    Forthofer, Melinda; Burroughs-Girardi, Ericka; Stoisor-Olsson, Liliana; Wilcox, Sara; Sharpe, Patricia A; Pekuri, Linda M

    2016-10-01

    Although social support is a frequently cited enabler of physical activity, few studies have examined how to harness social support in interventions. This paper describes community-based formative research to design a walking program for mobilizing naturally occurring social networks to support increases in walking behavior. Focus group methods were used to engage community members in discussions about desired walking program features. The research was conducted with underserved communities in Sumter County, South Carolina. The majority of focus group participants were women (76%) and African American (92%). Several important themes emerged from the focus group results regarding attitudes toward walking, facilitators of and barriers to walking, ideal walking program characteristics, and strategies for encouraging community members to walk. Most noteably, the role of existing social networks as a supportive influence on physical activity was a recurring theme in our formative research and a gap in the existing evidence base. The resulting walking program focused on strategies for mobilizing, supporting and reinforcing existing social networks as mechanisms for increasing walking. Our approach to linking theory, empirical evidence and community-based formative research for the development of a walking intervention offers an example for practitioners developing intervention strategies for a wide range of behaviors.

  15. THE SUPPRESSION OF STAR FORMATION AND THE EFFECT OF THE GALAXY ENVIRONMENT IN LOW-REDSHIFT GALAXY GROUPS

    SciTech Connect

    Rasmussen, Jesper; Mulchaey, John S.; Bai, Lei; Ponman, Trevor J.; Raychaudhury, Somak; Dariush, Ali

    2012-10-01

    Understanding the interaction between galaxies and their surroundings is central to building a coherent picture of galaxy evolution. Here we use Galaxy Evolution Explorer imaging of a statistically representative sample of 23 galaxy groups at z Almost-Equal-To 0.06 to explore how local and global group environments affect the UV properties and dust-corrected star formation rates (SFRs) of their member galaxies. The data provide SFRs out to beyond 2R{sub 200} in all groups, down to a completeness limit and limiting galaxy stellar mass of 0.06 M{sub Sun} yr{sup -1} and 1 Multiplication-Sign 10{sup 8} M{sub Sun }, respectively. At fixed galaxy stellar mass, we find that the fraction of star-forming group members is suppressed relative to the field out to an average radius of R Almost-Equal-To 1.5 Mpc Almost-Equal-To 2R{sub 200}, mirroring results for massive clusters. For the first time, we also report a similar suppression of the specific SFR within such galaxies, on average by 40% relative to the field, thus directly revealing the impact of the group environment in quenching star formation within infalling galaxies. At fixed galaxy density and stellar mass, this suppression is stronger in more massive groups, implying that both local and global group environments play a role in quenching. The results favor an average quenching timescale of {approx}> 2 Gyr and strongly suggest that a combination of tidal interactions and starvation is responsible. Despite their past and ongoing quenching, galaxy groups with more than four members still account for at least {approx}25% of the total UV output in the nearby universe.

  16. Thermochemistry of organic, elementorganic and inorganic species. Part XX. Enthalpies of formation for free radicals of main group elements’ halogenides

    NASA Astrophysics Data System (ADS)

    Ponomarev, Dmitry; Takhistov, Viatcheslav; Slayden, Suzanne; Liebman, Joel

    2008-03-01

    General trends in thermochemistry for free radicals as the fragments of halogenated molecules of main group elements were found for the first time applying the series of isodesmic (working) reactions following the Benson's comparison of relative stabilities of free radicals in equations R+RH→ RH+R+Q, where Q is stabilization (destabilization) energy. The enthalpies of formation for parent molecules of main group elements' halogenides necessary for application of this and similar equations were presented earlier [A.V. Golovin, V.V. Takhistov, J. Mol. Struct., 784 (2006) 47.]. For fluorinated free radicals rad EF (E = Be-Ra), rad EF 2 ( rad EHF) (E = B-Tl, N-Bi) and rad EF 3 ( rad EH 2F, rad EHF 2) (E = C-Pb) the gradual decrease in stabilization by fluorine atoms was found when coming down the periodic table. This turned to destabilization for Tl, Sb, and Bi, and IVth group of elements (excluding carbon) with increasing destabilization in the row Si < Ge < Sn < Pb. The destabilization of free radicals by other halogens for IVth group of elements decreased in the row F > Cl > Br > I which was interpreted by involvement of polarizability (PAZ) effect of halogens increasing in this direction. For finding the enthalpies of formation for silicon and germanium-centered free radicals the data on ν ≡ E-H frequencies in IR-spectra were applied. Quite definite tendencies in structure/enthalpy of formation interrelationship were found for chlorinated, brominated and iodinated free radicals of IInd and IIIrd group of elements. In the VIth group the situation with F → Cl → Br → I replacement in stabilization of free radical center appeared completely different compared with II-IV groups. Owing to the high electronegativity of HO-group and low thermodynamic stability of HO rad radical all halogens highly stabilize rad OX radical and perform it in the row F < Cl-Br < I which is explained by increase of PAZ effect in this direction. All halogens are suggested to

  17. Personalized Education; Solving a Group Formation and Scheduling Problem for Educational Content

    ERIC Educational Resources Information Center

    Bahargam, Sanaz; Erdos, Dóra; Bestavros, Azer; Terzi, Evimaria

    2015-01-01

    Whether teaching in a classroom or a Massive Online Open Course it is crucial to present the material in a way that benefits the audience as a whole. We identify two important tasks to solve towards this objective; (1) group students so that they can maximally benefit from peer interaction and (2) find an optimal schedule of the educational…

  18. Group Formation in Mobile Computer Supported Collaborative Learning Contexts: A Systematic Literature Review

    ERIC Educational Resources Information Center

    Amara, Sofiane; Macedo, Joaquim; Bendella, Fatima; Santos, Alexandre

    2016-01-01

    Learners are becoming increasingly divers. They may have much personal, social, cultural, psychological, and cognitive diversity. Forming suitable learning groups represents, therefore, a hard and time-consuming task. In Mobile Computer Supported Collaborative Learning (MCSCL) environments, this task is more difficult. Instructors need to consider…

  19. Does Like Seek Like?: The Formation of Working Groups in a Programming Project

    ERIC Educational Resources Information Center

    Sanou Gozalo, Eduard; Hernández-Fernández, Antoni; Arias, Marta; Ferrer-i-Cancho, Ramon

    2017-01-01

    In a course of the degree of computer science, the programming project has changed from individual to teamed work, tentatively in couples (pair programming). Students have full freedom to team up with minimum intervention from teachers. The analysis of the working groups made indicates that students do not tend to associate with students with a…

  20. Designing Project-Based Courses with a Focus on Group Formation and Assessment

    ERIC Educational Resources Information Center

    Richards, Debbie

    2009-01-01

    The value and the pitfalls of project and group work are well recognized. The principles and elements which apply to projects in general, apply to project-based courses. Thoughtful and detailed planning, understanding of the stakeholders and their needs, a good design, appropriate testing, monitoring and quality control and continual management…

  1. Facilitated Networking and Group Formation in an Online Community of Practice

    ERIC Educational Resources Information Center

    Fasso, Wendy

    2010-01-01

    In 2008 and 2009, a series of online professional development communities for groups of teacher-leaders in digital pedagogy was run. In each of the first two iterations, there was an early dropout of individuals who felt they "did not belong". Contributing to this sense of isolation was the immediate emergence of online networks in the…

  2. Designing Project-Based Courses with a Focus on Group Formation and Assessment

    ERIC Educational Resources Information Center

    Richards, Debbie

    2009-01-01

    The value and the pitfalls of project and group work are well recognized. The principles and elements which apply to projects in general, apply to project-based courses. Thoughtful and detailed planning, understanding of the stakeholders and their needs, a good design, appropriate testing, monitoring and quality control and continual management…

  3. Integration of Structured Expressive Activities within a Humanistic Group Play Therapy Format for Preadolescents

    ERIC Educational Resources Information Center

    Bratton, Sue C.; Ceballos, Peggy L.; Ferebee, Kelly Webb

    2009-01-01

    The integration of expressive activities in play groups with preadolescents encourages them to reach more deeply into their own resources, enabling them to handle future challenges more effectively. Developmental and therapeutic rationale, along with research support, is given for the integration of creative activities into a humanistic play group…

  4. Geological Features of Iron Formations and Associate Rock in Bulunkuole Group, West Kunlun, Xinjiang, China

    NASA Astrophysics Data System (ADS)

    Huang, Chaoyang; Wang, He; Ren, Guangli; Wu, Wenying

    2017-05-01

    West Kunlun is located at northwest part of the Tibetan plateau, and it’s divided into North Kunlun terrane, South Kunlun terrane and Tianshuihai terrane. Bulunkuole Group is located in Tianshuihai terrane, and Taaxi, Yelike, Laobing, Zankan, Mokaer and Jiertiekegou iron deposit was found in this terrane. Those iron deposits are set to the important iron ore mineralization belt of Xinjiang and even China. By investigation the geological features, ore distributions, and mineralization characters; and analyze the electron microprobe of magnetite and pyrite, stable isotope of pyrite, magnetite and anhydrite to discussion the tectonic setting and its genesis analysis iron ore deposit in Blunkuole Group, and establish the metallogenic model in this area. By contrastive analyzing of Taaxi, Yelike Zankan-Mokar iron ore deposits in Bulunkuole Group, it was found that all the iron ore deposit share the similar sedimentary environment. Those deposits have 3 ∼ 4 ore bodies, each get a meter to dozens of meters in width, extend to thousands of meters. The wall rocks are biotite quartz schist and plagioclase amphibole schist, and the two rocks interbed usually. It should be distinguish in the stratigraphic correlation of Bulunkuole Group for the influenced by the magma intrusion, such as granite and felsite porphyry.

  5. Delaware Mountain Group (DMG) hydrology-salt removal potential. [Castile formation

    SciTech Connect

    Wood, B.J.; Snow, R.E.; Cosler, D.J.; Haji-Djafari, S.

    1982-12-01

    This study has been performed to assess potential salt dissolution from the evaporite sequences by the underlying aquifer and to evaluate the impact of this process on the WIPP facility integrity. The hydrogeologic and geochemical characteristics of the DMG have been reviewed and the various salt dissolution hypotheses and mechanimsms have been examined. Based on analytical and numerical evaluations, the following conclusions have been reached: The potential dissolution mechanisms include diffusion and convection from halite layers to the Bell Canyon and Captain Reef aquifers. Computation of the present dissolution rate based on observed chloride concentration levels in the Bell Canyon aquifer indicates that diffusion and possibly very weak convection result in removal of halite from the Castile overlying the DMG. Evaluation of the DMG hydrogeologic conditions and review of the range of values for the hydrogeologic and geochemical parameters which influence salt removal indicate that general salt removal by the diffusion process would produce an advancement of the dissolution front of only 0.3 cm in 10,000 yr. Based on an analysis of potential changes in the hydrologic characteristics of the Bell Canyon aquifer, an increase in flow rate of even one order of magnitude would not increase the salt removal from the Castile Formation by more than 17% cm. analysis of implausible worst-case dissolution rates associated with both diffusive and convective dissolution at the Bell Canyon aquifer-Castile Formation interface suggests that the structural integrity of the WIPP facility located more than 400 m above would not be affected. In this analysis, it was determined that the theoretical maximum cavity radius would be seven meters over a fracture and one meter above a circular porous zone in a period of 10,000 yrs.

  6. Revision of the Western Australian pebble-mimic dragon species-group (Tympanocryptis cephalus: Reptilia: Agamidae).

    PubMed

    Doughty, Paul; Kealley, Luke; Shoo, Luke P; Melville, Jane

    2015-11-03

    Recent work on species complexes of the pebble-mimic dragons of the Australian genus Tympanocryptis has greatly clarified evolutionary relationships among taxa and also indicated that species diversity has been severely underestimated. Here we provide a morphological and molecular appraisal of variation in the T. cephalus species-group and find evidence for recognizing five species-level lineages from Western Australia. Four species-level lineages are strongly supported with a combined mitochondrial and nuclear DNA Bayesian analysis (a fifth population from the Gascoyne region lacked tissue samples). Morphologically, we found subtle, yet consistent, differences among the populations in scalation, color and pattern. True T. cephalus Günther is restricted to the coastal Pilbara region and characterized by five dark blotches on the dorsum, keeled ventrals, and other characters. Two other lineages within the Pilbara, from the Hamersley range and Fortescue/northern Pilbara region, differed from T. cephalus senso stricto by possessing a more elongate body and a plain dorsum. Furthermore, the Hamersley lineage differed from the Fortescue lineage by possessing slightly more reddish coloration and feeble keeling on the snout. Although there are few specimens and no tissue samples available for the Gascoyne population, these individuals are larger, have rugose scales on the snout, and possess scattered enlarged tubercles with three large blotches on the dorsum. The name T. cephalus gigas Mitchell is available for this population. The most widespread lineage, and the one best represented in collections and in field guides, occurs throughout central Western Australia. These Goldfield populations are characterized by a protruding snout, narrow rostral, and uniform reddish-brown coloration, often with a dark wash. Based on the genetic and morphological differences, we redescribe T. cephalus, resurrect and elevate T. gigas to a full species and designate a neotype for this taxon

  7. Dietary treatment of urinary risk factors for renal stone formation. A review of CLU Working Group.

    PubMed

    Prezioso, Domenico; Strazzullo, Pasquale; Lotti, Tullio; Bianchi, Giampaolo; Borghi, Loris; Caione, Paolo; Carini, Marco; Caudarella, Renata; Ferraro, Manuel; Gambaro, Giovanni; Gelosa, Marco; Guttilla, Andrea; Illiano, Ester; Martino, Marangella; Meschi, Tiziana; Messa, Piergiorgio; Miano, Roberto; Napodano, Giorgio; Nouvenne, Antonio; Rendina, Domenico; Rocco, Francesco; Rosa, Marco; Sanseverino, Roberto; Salerno, Annamaria; Spatafora, Sebastiano; Tasca, Andrea; Ticinesi, Andrea; Travaglini, Fabrizio; Trinchieri, Alberto; Vespasiani, Giuseppe; Zattoni, Filiberto

    2015-07-07

    Diet interventions may reduce the risk of urinary stone formation and its recurrence, but there is no conclusive consensus in the literature regarding the effectiveness of dietary interventions and recommendations about specific diets for patients with urinary calculi. The aim of this study was to review the studies reporting the effects of different dietary interventions for the modification of urinary risk factors in patients with urinary stone disease. A systematic search of the Pubmed database literature up to July 1, 2014 for studies on dietary treatment of urinary risk factors for urinary stone formation was conducted according to a methodology developed a priori. Studies were screened by titles and abstracts for eligibility. Data were extracted using a standardized form and the quality of evidence was assessed. Evidence from the selected studies were used to form evidence-based guideline statements. In the absence of sufficient evidence, additional statements were developed as expert opinions. General measures: Each patient with nephrolithiasis should undertake appropriate evaluation according to the knowledge of the calculus composition. Regardless of the underlying cause of the stone disease, a mainstay of conservative management is the forced increase in fluid intake to achieve a daily urine output of 2 liters. HYPERCALCIURIA: Dietary calcium restriction is not recommended for stone formers with nephrolithiasis. Diets with a calcium content ≥ 1 g/day (and low protein-low sodium) could be protective against the risk of stone formation in hypercalciuric stone forming adults. Moderate dietary salt restriction is useful in limiting urinary calcium excretion and thus may be helpful for primary and secondary prevention of nephrolithiasis. A low-normal protein intake decrease calciuria and could be useful in stone prevention and preservation of bone mass. Omega-3 fatty acids and bran of different origin decreases calciuria, but their impact on the urinary

  8. The geological significance of the boundary between the Fort Sill and Signal Mountain Formations in the lower Arbuckle Group (Cambrian)

    SciTech Connect

    Hosey, R.; Donovan, R.N. . Geology Dept.)

    1993-02-01

    During the upper Cambrian, a transgression inundated the Southern Oklahoma aulacogen enveloping a landscape that consisted of hills of Cambrian-aged rhyolite up to 350 m in height. Initial deposits on this topography--the Reagan Formation--consist of siliciclastics that were deposited as alluvium and succeeding tidally-influenced marine sandstones and shales. The siliciclastics grains are made up of local rhyolite, quartz and authigenic glauconite. The overlying Honeycreek Formation is defined by the addition of carbonated detritus in the form of tidally-influenced pelmatozoan grainstones. The passage from the Honeycreek to the overlying Fort Sill Formation of the Arbuckle Group is marked by the incoming of beds of lime mudstone and the gradual disappearance of grainstones and siliciclastics. The contact between the Fort Sill and the overlying thinly-bedded dark grey bioclastic limestones of the Signal Mountain Formation is one of the most distinctive horizons in the Arbuckle Group. The contact evidently marks a substantial change in depositional environment. In detail the contact is sharp and shows evidence of minor erosion, although no karsting has been detected. The authors suggest that the contact surface records a regression, perhaps associated with dolomitization and followed by some erosion. A regression is also indicated by the local occurrence of a laminated tidal flat unit with traces of evaporites that outcrops in the far west of the Slick Hills immediately below the formation contact. They suggest that the Signal Mountains as a transgressive unit, incorporating siliciclastics transported into the area during the regression. It has been suggested that the unconformity reflects localized tectonism associated with the evolution of the Southern Oklahoma aulacogen. On the other hand the surface may correlate with a craton--wide Sauxian' hiatus.

  9. Comparing Web, Group and Telehealth Formats of a Military Parenting Program

    DTIC Science & Technology

    2015-06-01

    agewirtz@umn.edu 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER Regents of the...assessments at 6, 12- and 24 months. We hypothesize that NGR families in both the ADAPT group-based condition and the ADAPT individualized web-facilitated... condition will show greater pre-post improvements in observed parenting, and parent, child, and couple functioning relative to the self-directed online

  10. Early amygdala or hippocampus damage influences adolescent female social behavior during group formation.

    PubMed

    Moadab, Gilda; Bliss-Moreau, Eliza; Bauman, Melissa D; Amaral, David G

    2017-02-01

    This study continues a longitudinal analysis of rhesus macaque social behavior following bilateral neonatal ibotenic acid lesions of the amygdala or hippocampus, or sham operations. The social behavior of female subjects was evaluated at a critical developmental time point-the transition to adulthood. At approximately 4 years of age, female subjects were housed in small groups with other female subjects and reproductively viable adult males. As compared with neurologically intact control animals and animals with early amygdala damage, animals with early hippocampal damage were more social with their female peers. In contrast, as compared with control animals, animals with early amygdala damage spent less time with the males, engaged less frequently in behaviors typical of reproductive consortships, had higher frequencies of self-directed stereotypies, and became pregnant later. Males also generated fewer communicative signals toward animals with early amygdala damage than to control animals and animals with early hippocampus damage. Rates of sexual behavior were generally low for all animals, and there were no lesion-based differences in their frequencies. Discriminant function analyses demonstrated that patterns of affiliative social behaviors differed across the 3 experimental groups, both in terms of the social behaviors directed to the males, and the social behaviors generated by the males toward the females. In 4 of the 5 social groups, amygdala-lesioned animals were lowest ranked, potentially contributing to reduced sociability interactions with males. Other potential mechanisms and the experiments needed to elucidate them are discussed. (PsycINFO Database Record

  11. Synthesis and revision of the lithostratigraphic groups and formations in the Upper Permian?–Lower Jurassic Newark Supergroup of eastern North America

    USGS Publications Warehouse

    Weems, Robert E.; Tanner, Lawrence H.; Lucas, Spencer G.

    2016-01-01

    The Upper Permian? - Lower Jurassic Newark Supergroup of eastern North America has a strikingly uniform succession of lithologic units. This uniformity is seen regardless of whether these units are characterized on the basis of their lithostratigraphy, allostratigraphy, biostratigraphy, or chemostratigraphy. After deposition, these units were broken up tectonically and attacked erosionally; parts of them survive today only within localized, down-faulted areas. Many lines of evidence compellingly demonstrate that most or all of these remnant units once were physically continuous between remaining outcrops. It is needlessly confusing to give every remnant of each unit a different name in each area where it persists simply because it is now physically isolated by erosion from other portions of the same unit. Instead, these units should be defined within a regional lithostratigraphic framework that emphasizes their common origins and original stratigraphic continuity. To this end, the formation-level stratigraphy of the Newark Supergroup is reduced from 58 locally applied and locally defined formations to a succession of only 16 uniformly defined and regionally recognizable formations. In all cases the oldest name validly applied to each formation is given priority over more recently erected synonymous names, which are either abandoned or, in a few cases, changed in rank to a member of one of the formations recognized here. The Newark Supergroup is here organized into four regionally recognizable groups, each subdivided into regionally recognizable formations. In ascending order, the Upper Permian?-Middle Triassic Acadia Group (new name) includes the Honeycomb Point Formation, Chedabucto Formation, Economy Formation, and Evangeline Formation. This group is preserved only in the Canadian Fundy and Chedabucto basins. The Upper Triassic (Carnian-Norian) Chatham Group includes the Doswell Formation, Stockton Formation, Lockatong Formation, and Passaic Formation. The Upper

  12. Properties of galaxy groups in the Sloan Digital Sky Survey - II. Active galactic nucleus feedback and star formation truncation

    NASA Astrophysics Data System (ADS)

    Weinmann, Simone M.; van den Bosch, Frank C.; Yang, Xiaohu; Mo, H. J.; Croton, Darren J.; Moore, Ben

    2006-11-01

    Successfully reproducing the galaxy luminosity function (LF) and the bimodality in the galaxy distribution requires a mechanism that can truncate star formation in massive haloes. Current models of galaxy formation consider two such truncation mechanisms: strangulation, which acts on satellite galaxies, and active galactic nucleus (AGN) feedback, which predominantly affects central galaxies. The efficiencies of these processes set the blue fraction of galaxies, fblue(L, M), as a function of galaxy luminosity, L, and halo mass, M. In this paper, we use a galaxy group catalogue extracted from the Sloan Digital Sky Survey (SDSS) to determine fblue(L, M). To demonstrate the potential power of these data as a benchmark for galaxy formation models, we compare the results to the semi-analytical model for galaxy formation of Croton et al. Although this model accurately fits the global statistics of the galaxy population, as well as the shape of the conditional LF, there are significant discrepancies when the blue fraction of galaxies as a function of mass and luminosity is compared between the observations and the model. In particular, the model predicts (i) too many faint satellites in massive haloes, (ii) a blue fraction of satellites that is much too low, and (iii) a blue fraction of centrals that is too high and with an inverted luminosity dependence. In the same order, we argue that these discrepancies owe to (i) the neglect of tidal stripping in the semi-analytical model, (ii) the oversimplified treatment of strangulation, and (iii) improper modelling of dust extinction and/or AGN feedback. The data presented here will prove useful to test and calibrate future models of galaxy formation and, in particular, to discriminate between various models for AGN feedback and other star formation truncation mechanisms.

  13. Gap formation and phase transition of the anisotropic Kondo necklace model: Density matrix renormalization group analysis

    NASA Astrophysics Data System (ADS)

    Mendoza-Arenas, J. J.; Franco, R.; Silva-Valencia, J.

    2010-01-01

    We analyze the one-dimensional Kondo necklace model, at zero temperature, with an anisotropy parameter η in the interaction of the conduction chain, by means of the density matrix renormalization group. We calculate the energy gap and estimate the quantum critical points that separate a Kondo singlet state from an antiferromagnetic state, assuming a Kosterlitz-Thouless tendency. We also observe the correlation functions and the structure factors that support our critical points. The resulting phase diagram is presented and compared to that reported previously using Lanczos calculations. It is shown that the quantum critical points vary very slowly with η , but when η approaches zero, they drop abruptly.

  14. Life Before the Fall: Star Formation of Galaxies in Groups Prior to Cluster Assembly at z~0.37

    NASA Astrophysics Data System (ADS)

    Tran, Kim-Vy; Gonzalez, Anthony; Moustakas, John; Zaritsky, Dennis

    2005-06-01

    We propose to obtain a deep MIPS 24 micron map (18'x18') of a protocluster made of 4 distinct galaxy groups that are gravitationally bound to each other at z=0.37. The galaxy groups already have a total combined mass comparable to the Coma cluster, but they have at least 4 times as many emission line galaxies as Coma. The SG1120 complex thus provides an unprecedented opportunity for determining when and how star formation is quenched (or briefly enhanced) in the galaxies that will evolve into cluster members. MIPS is ideal for measuring the emission due to warm dust at mid-IR wavelengths. This sensitive tracer of integrated star formation enables us to identify weakly star-forming members (~1 solar mass/year) to very dusty, strongly star-forming ones, e.g. ultra-luminous infrared galaxies (ULIRGs) and the possible progenitors of post-starburst (E+A) members. Combining mid-IR with the deep, wide-field X-ray/optical/near-IR imaging and spectroscopy we already have in hand, we will trace how star formation varies as a function of environment and how quickly cluster galaxies build up their stellar masses.

  15. Fish in a ring: spatio-temporal pattern formation in one-dimensional animal groups

    PubMed Central

    Abaid, Nicole; Porfiri, Maurizio

    2010-01-01

    In this work, we study the collective behaviour of fish shoals in annular domains. Shoal mates are modelled as self-propelled particles moving on a discrete lattice. Collective decision-making is determined by information exchange among neighbours. Neighbourhoods are specified using the perceptual limit and numerosity of fish. Fish self-propulsion and obedience to group decisions are described through random variables. Spatio-temporal schooling patterns are measured using coarse observables adapted from the literature on coupled oscillator networks and features of the time-varying network describing the fish-to-fish information exchange. Experiments on zebrafish schooling in an annular tank are used to validate the model. Effects of group size and obedience parameter on coarse observables and network features are explored to understand the implications of perceptual numerosity and spatial density on fish schooling. The proposed model is also compared with a more traditional metric model, in which the numerosity constraint is released and fish interactions depend only on physical configurations. Comparison shows that the topological regime on which the proposed model is constructed allows for interpreting characteristic behaviours observed in the experimental study that are not captured by the metric model. PMID:20413559

  16. Chemically mediated group formation in soil-dwelling larvae and pupae of the beetle Trypoxylus dichotomus

    NASA Astrophysics Data System (ADS)

    Kojima, Wataru; Ishikawa, Yukio; Takanashi, Takuma

    2014-09-01

    Many insects form groups through interactions among individuals, and these are often mediated by chemical, acoustic, or visual cues and signals. In spite of the diversity of soil-dwelling insects, their aggregation behaviour has not been examined as extensively as that of aboveground species. We investigated the aggregation mechanisms of larvae of the Japanese rhinoceros beetle Trypoxylus dichotomus, which live in groups in humus soil. In two-choice laboratory tests, 2nd- and 3rd-instar larvae gathered at conspecific larvae irrespective of the kinship. The ablation of maxillae, which bear chemosensilla, abolished aggregation behaviour. Intact larvae also exhibited aggregation behaviour towards a larval homogenate. These results suggest that larval aggregation is mediated by chemical cues. We also demonstrated that the mature larvae of T. dichotomus built their pupal cells close to a mesh bag containing a conspecific pupal cell, which indicated that larvae utilize chemical cues emanating from these cells to select the pupation site. Thus, the larvae of T. dichotomus may use chemical cues from the conspecifics in two different contexts, i.e. larval aggregation and pupation site selection. Using conspecific cues, larvae may be able to choose suitable locations for foraging or building pupal cells. The results of the present study highlight the importance of chemical information in belowground ecology.

  17. Chemically mediated group formation in soil-dwelling larvae and pupae of the beetle Trypoxylus dichotomus.

    PubMed

    Kojima, Wataru; Ishikawa, Yukio; Takanashi, Takuma

    2014-09-01

    Many insects form groups through interactions among individuals, and these are often mediated by chemical, acoustic, or visual cues and signals. In spite of the diversity of soil-dwelling insects, their aggregation behaviour has not been examined as extensively as that of aboveground species. We investigated the aggregation mechanisms of larvae of the Japanese rhinoceros beetle Trypoxylus dichotomus, which live in groups in humus soil. In two-choice laboratory tests, 2nd- and 3rd-instar larvae gathered at conspecific larvae irrespective of the kinship. The ablation of maxillae, which bear chemosensilla, abolished aggregation behaviour. Intact larvae also exhibited aggregation behaviour towards a larval homogenate. These results suggest that larval aggregation is mediated by chemical cues. We also demonstrated that the mature larvae of T. dichotomus built their pupal cells close to a mesh bag containing a conspecific pupal cell, which indicated that larvae utilize chemical cues emanating from these cells to select the pupation site. Thus, the larvae of T. dichotomus may use chemical cues from the conspecifics in two different contexts, i.e. larval aggregation and pupation site selection. Using conspecific cues, larvae may be able to choose suitable locations for foraging or building pupal cells. The results of the present study highlight the importance of chemical information in belowground ecology.

  18. Hierarchical Formation in Action: Characterizing Accelerated Galaxy Evolution in Compact Groups Using Whole-sky WISE Data

    NASA Astrophysics Data System (ADS)

    Zucker, Catherine; Walker, Lisa May; Johnson, Kelsey; Gallagher, Sarah; Alatalo, Katherine; Tzanavaris, Panayiotis

    2016-04-01

    Compact groups provide an environment to study the growth of galaxies amid multiple prolonged interactions. With their dense galaxy concentrations and relatively low velocity dispersions, compact groups mimic the conditions of hierarchical galaxy assembly. Compact group galaxies are known to show a bimodality in Spitzer IRAC infrared color space: galaxies are preferentially either quiescent with low specific star formation rates (SSFRs) or prolifically forming stars—galaxies with moderate levels of specific star formation are rare. Previous Spitzer IRAC studies identifying this “canyon” have been limited by small number statistics. We utilize whole-sky Wide-field Infrared Survey Explorer (WISE) data to study 163 compact groups, thereby tripling our previous sample and including more galaxies with intermediate mid-IR colors indicative of moderate SSFRs. We define a distinct WISE mid-IR color space ≤ft({log}≤ft[\\tfrac{{f}12}{{f}4.6}\\right]\\right) versus ≤ft({log}≤ft[\\tfrac{{f}22}{{f}3.4}\\right]\\right) that we use to identify canyon galaxies from the larger sample. We confirm that compact group galaxies show a bimodal distribution in the mid-infrared and identify 37 canyon galaxies with reliable photometry and intermediate mid-IR colors. Morphologically, we find that the canyon harbors a large population of both Sa-Sbc and E/S0 type galaxies, and that they fall on the optical red sequence rather than the green valley. Finally, we provide a catalog of WISE photometry for 567 of 652 galaxies selected from the sample of 163 compact groups.

  19. On the Formation of Elliptical Galaxies via Mergers in Galaxy Groups

    NASA Astrophysics Data System (ADS)

    Taranu, Dan; Dubinski, John; Yee, Howard K. C.

    2015-08-01

    Giant elliptical galaxies have long been thought to form through gas-rich "major" mergers of two roughly equal-mass spiral galaxies. However, ellipticals are often found at the centers of groups and are likely to have undergone several significant mergers since z=2. We test the hypothesis that ellipticals form through multiple, mainly minor and dry mergers in groups, using hundreds of N-body simulations of mergers in groups of three to twenty-five spirals (Taranu et al. 2013).Realistic mock observations of the central merger remnants show that they have similar surface brightness profiles to local ellipticals. The size-luminosity and velocity dispersion-luminosity relations have modest (~0.1 dex) scatter, with similar slopes; however, most remnants are too large and have too low dispersions for their luminosities. Some remnants show substantial (v/σ > 0.1) rotational support, but most are slow rotators with v/σ << 0.5.Ellipticals also follow a tight "fundamental plane" scaling relation between size R, mean surface brightness μ and velocity dispersion σ: R ∝ σ^a μ^b. This relation has small (<0.06 dex) scatter and significantly different coefficients from the expected scaling (a "tilt"). The remnants lie on a similar fundamental plane, with even smaller scatter (0.02 dex) and a tilt in the correct sense - albeit weaker than observed. This tilt is caused by variable dark matter fractions within the effective radius, such that massive merger remnants have larger central dark matter fractions than their lower-mass counterparts (Taranu et al. 2015).These results suggest that massive ellipticals can originate from multiple, mainly minor and dry mergers of spirals at z<2, producing tight scaling relations in the process. However, significant gas dissipation and/or more compact progenitor spirals may be needed to produce lower-mass, rapidly-rotating ellipticals. I will also show preliminary results from simulations with more realistic progenitor galaxies (including

  20. Phase behavior of semifluorinated catanionic mixtures: head group dependence and spontaneous formation of vesicles.

    PubMed

    Blanco, Elena; Olsson, Ulf; Ruso, Juan M; Schulz, Pablo C; Prieto, Gerardo; Sarmiento, Félix

    2009-03-15

    Hexadecyltrimethylammonium bromide (C(16)TAB)-sodium perfluorooctanoate (C(8)FONa) and hexadecylpyridynium bromide (C(16)PyB)-C(8)FONa catanionic semifluorinated mixtures have been studied by conductivity, dynamic light scattering (DLS), cryo-transmission electron microscopy (cryo-TEM) and polarizing microscopy. The regular solution theory, applicable for a limited fluorinated molar ratio, does not predict long-range electrostatic interactions. The results are consistent with the fact that in the hydrogenated-rich region the interaction is attractive in both catanionic mixtures. The systems containing pyridinium headgroups were of the stronger interaction. A transition from micelles was found in both mixtures as a function of fluorinated molar ratio. Special attention was devoted to the effect of the head group in the system properties. The information related with the mean vesicle radius measured by DLS was compared with the vesicle size distribution as well as the elastic properties of the bilayer measured with cryo-TEM.

  1. Lagoonal deposits in the Upper Cretaceous Rock Springs Formation (Mesaverde Group), southwest Wyoming

    USGS Publications Warehouse

    Kirschbaum, M.A.

    1989-01-01

    Most paleogeographic reconstructions of the Rock Springs Formation show shorelines having lobate to arcuate deltas. These shorelines are oriented NE-SW, with the sea to the southeast. Brackish-water bodies are usually shown in interdistributary areas or associated with abandoned delta lobes, and are open to the sea. In this study, a sedimentary sequence 30-50 m thick is interpreted as interdeltaic deposits. Brackish-water deposits within the sequence are interpreted as interdeltaic lagoons rather than interdistributary bays. Three facies associations (units) are recognized in nine measured sections of the study interval. Unit A consists of interbedded sandstone, mudrock and coal which occur in both fining- and coarsening-upward sequences less than 10 m thick. Fining-upward sequences decrease in thickness and frequency upwards in unit A and are interpreted as distributary channels. Coarsening-upward sequences associated with the channels are interpreted as crevasse splays that filled lakes or interdistributary bays. In the upper part of the unit where only minor channels are present, the coarsening-upward sequences are interpreted as bay deltas. Unit B consists of fossiliferous silty shale and bioturbated sandy siltstone. A low-diversity fauna of bivalves, gastropods, ostracods and foraminifers indicates that brackish-water conditions existed. Unit B intertongues with unit A to the northwest and with unit C to the southeast, and is interpreted as lagoonal deposits. Unit C consists of crossbedded and burrowed sandstone in beds 0.5-9 m thick. Sandstones are laterally continuous in the southeast but become tabular bodies enclosed within unit B to the northwest. Laterally continuous sandstones are interpreted as shoreface deposits on the basis of multidirectional crossbeds, marine trace fossils and continuity. Tabular sandstones are interpreted as flood-tidal deltas on the basis of NW-oriented crossbeds, pinchouts to the northwest and enclosure within unit B. Scoured

  2. Intermolecular charge flux as the origin of infrared intensity enhancement upon halogen-bond formation of the peptide group

    NASA Astrophysics Data System (ADS)

    Torii, Hajime

    2010-07-01

    The changes in the vibrational properties of the peptide group upon formation of O⋯X and N⋯X halogen bonds are studied theoretically. Calculations are carried out for complexes of N-methylacetamide (NMA), a well known model molecule of the peptide group, with halogen-containing molecules. For comparison, calculations are also carried out for some NMA-water hydrogen-bonding complexes. It is shown that the infrared (IR) intensity of the amide I mode of the peptide group is enhanced significantly (up to about 520 km mol-1 or 2.6 times) upon CO⋯X halogen-bond formation, in spite of rather modest magnitudes of the intermolecular electric field and of the changes in the CO bond length and in the amide I vibrational frequency as compared with the cases of the CO⋯H(D) hydrogen bonding. From the analysis of the changes in the dipole derivative and in the electronic structure, it is shown that this IR intensity enhancement arises from the intermolecular charge flux. For the N⋯X halogen bonding complexes, some characteristic changes in the vibrational properties are seen, among which the IR intensity enhancement of the ND out-of-plane wagging mode is most notable. The reason why such large IR intensity enhancements are seen for these particular vibrational modes is examined.

  3. Intermolecular charge flux as the origin of infrared intensity enhancement upon halogen-bond formation of the peptide group.

    PubMed

    Torii, Hajime

    2010-07-21

    The changes in the vibrational properties of the peptide group upon formation of O...X and N...X halogen bonds are studied theoretically. Calculations are carried out for complexes of N-methylacetamide (NMA), a well known model molecule of the peptide group, with halogen-containing molecules. For comparison, calculations are also carried out for some NMA-water hydrogen-bonding complexes. It is shown that the infrared (IR) intensity of the amide I mode of the peptide group is enhanced significantly (up to about 520 km mol(-1) or 2.6 times) upon C=O...X halogen-bond formation, in spite of rather modest magnitudes of the intermolecular electric field and of the changes in the C=O bond length and in the amide I vibrational frequency as compared with the cases of the C=O...H(D) hydrogen bonding. From the analysis of the changes in the dipole derivative and in the electronic structure, it is shown that this IR intensity enhancement arises from the intermolecular charge flux. For the N...X halogen bonding complexes, some characteristic changes in the vibrational properties are seen, among which the IR intensity enhancement of the ND out-of-plane wagging mode is most notable. The reason why such large IR intensity enhancements are seen for these particular vibrational modes is examined.

  4. Sedimentological cross section of Cambro-Ordovician carbonate shelf (Knox group, Conassauga Formation) in central Alabama: facies, diagenesis, potential reservoirs

    SciTech Connect

    Sternbach, L.R.

    1984-04-01

    Cambro-Ordovician thrust-imbricated carbonates in central Alabama are the focus of renewed exploration interest. Samples from east-west-trending core holes within the surface-most thrust plates reconstruct the carbonate shelf and shelf-edge facies before deformation. The Upper Cambrian shelf margin now is in the subsurface of Talledega County; coeval dolostones in the western part of the state represent the former shelf interior. Rock analogs to former environments include the following. (1) Barrier shoals (Conasauga Formation) - dark colored, partially dolomitized ooid and skeletal grainstones. (2) Submerged back-barrier and offshelf dolomitized sediments (lower Knox Group) - western belt: finely crystalline algal thrombolites, fenestral dolopelmicrites, rippled beds; eastern belt: finely laminated dolostones, slope-derived pebbles and graded beds. (3) Tidal flats (upper Knox Group) - light-colored, crystalline dolostones, dolomitized pellet grainstones, algal laminites, pseudomorphs after sulfates and early diagenetic chertification. (4) Former emergent shelf -(Knox unconformity)-pelmicrite, skeletal wackestones, erosional chert pebble conglomerate. Multiple possibilities for hydrocarbon reservoirs appear throughout the sequence. Vuggy and intercrystalline dolostone porosity is primarily in the lower Knox formations. Primary interparticle pores are retained in lower Knox algal buildups. Breccia porosity occurs in the strata below the Knox unconformity through solution of the underlying Knox Group. Fractures in the subsurface are believed to enhance permeability in all porosity types.

  5. Sedimentological cross section of Cambro-Ordovician carbonate shelf (Knox group, Conasauga Formation) in central Alabama: facies, diagenesis, potential reservoirs

    SciTech Connect

    Sternbach, L.R.

    1984-04-01

    Cambro-Ordovician thrust-imbricated carbonates in central Alabama are the focus of renewed exploration interest. Samples from east-west-trending core holes within the surface-most thrust plates reconstruct the carbonate shelf and shelf-edge facies before deformation. The Upper Cambrian shelf margin now is in the subsurface of Talledega County; coeval dolostones in the western part of the state represent the former shelf interior. Rock analogs to former environments include the following. (1) Barrier shoals (Conasauga Formation) - dark colored, partially dolomitized ooid and skeletal grainstones. (2) Submerged back-barrier and offshelf dolomitized sediments (lower Knox Group) - western belt: finely crystalline algal thrombolites, fenestral dolopelmicrites, rippled beds; eastern belt: finely laminated dolostones, slope-derived pebbles and graded beds. (3) Tidal flats (upper Knox Group) - light-colored, crystalline dolostones, dolomitized pellet grainstones, algal laminites, pseudomorphs after sulfates and early diagenetic chertification. (4) Former emergent shelf -(Knox unconformity)-pelmicrite, skeletal wackestones, erosional chert pebble conglomerate. Multiple possibilities for hydrocarbon reservoirs appear throughout the sequence. Vuggy and intercrystalline dolostone porosity is primarily in the lower Knox formations. Primary interparticle pores are retained in lower Knox algal buildups. Breccia porosity occurs in the strata below the Knox unconformity through solution of the underlying Knox Group. Fractures in the subsurface are believed to enhance permeability in all porosity types.

  6. Group additive values for the gas-phase standard enthalpy of formation, entropy and heat capacity of oxygenates.

    PubMed

    Paraskevas, Paschalis D; Sabbe, Maarten K; Reyniers, Marie-Françoise; Papayannakos, Nikos; Marin, Guy B

    2013-11-25

    A complete and consistent set of 60 Benson group additive values (GAVs) for oxygenate molecules and 97 GAVs for oxygenate radicals is provided, which allow to describe their standard enthalpies of formation, entropies and heat capacities. Approximately half of the GAVs for oxygenate molecules and the majority of the GAVs for oxygenate radicals have not been reported before. The values are derived from an extensive and accurate database of thermochemical data obtained by ab initio calculations at the CBS-QB3 level of theory for 202 molecules and 248 radicals. These compounds include saturated and unsaturated, α- and β-branched, mono- and bifunctional oxygenates. Internal rotations were accounted for by using one-dimensional hindered rotor corrections. The accuracy of the database was further improved by adding bond additive corrections to the CBS-QB3 standard enthalpies of formation. Furthermore, 14 corrections for non-nearest-neighbor interactions (NNI) were introduced for molecules and 12 for radicals. The validity of the constructed group additive model was established by comparing the predicted values with both ab initio calculated values and experimental data for oxygenates and oxygenate radicals. The group additive method predicts standard enthalpies of formation, entropies, and heat capacities with chemical accuracy, respectively, within 4 kJ mol(-1) and 4 J mol(-1) K(-1) for both ab initio calculated and experimental values. As an alternative, the hydrogen bond increment (HBI) method developed by Lay et al. (T. H. Lay, J. W. Bozzelli, A. M. Dean, E. R. Ritter, J. Phys. Chem.- 1995, 99, 14514) was used to introduce 77 new HBI structures and to calculate their thermodynamic parameters (Δ(f)H°, S°, C(p)°). The GAVs reported in this work can be reliably used for the prediction of thermochemical data for large oxygenate compounds, combining rapid prediction with wide-ranging application.

  7. Effectiveness of Making Alcoholics Anonymous Easier: a group format 12-step facilitation approach.

    PubMed

    Kaskutas, Lee Ann; Subbaraman, Meenakshi S; Witbrodt, Jane; Zemore, Sarah E

    2009-10-01

    Most treatment programs recommend clients attend 12-step groups, but many drop out posttreatment. The effectiveness of Making Alcoholics Anonymous [AA] Easier (MAAEZ ), a manual-guided intervention designed to help clients connect with individuals encountered in AA, was tested using an "OFF/ON" design (n = 508). MAAEZ effectiveness was determined by comparing abstinence rates of participants recruited during ON and OFF conditions and by studying the effect of the number of MAAEZ sessions attended. At 12 months, more clients in the ON condition (vs. OFF) reported past 30-day abstinence from alcohol (p = .012), drugs (p = .009), and both alcohol and drugs (p = .045). In multivariate analyses, ON condition participants had significantly increased odds of abstinence from alcohol (odds ratio [OR] = 1.85) and from drugs (OR = 2.21); abstinence odds also increased significantly for each additional MAAEZ session received. MAAEZ appeared especially effective for those with more prior AA exposure, severe psychiatric problems, and atheists/agnostics. MAAEZ represents an evidence-based intervention that is easily implemented in existing treatment programs.

  8. ABO (histo) blood group phenotype development and human reproduction as they relate to ancestral IgM formation: A hypothesis.

    PubMed

    Arend, Peter

    2016-01-01

    The formation of a histo (blood) group) ABO phenotype and the exclusion of an autoreactive IgM or isoagglutinin activity arise apparently in identical glycosylation of complementary domains on cell surfaces and plasma proteins. The fundamental O-glycan emptiness of the circulating IgM, which during the neonatal amino acid sequencing of the variable regions is exerting germline-specific O-GalNAc glycan-reactive serine/threonine residues that in the plasma of the adult human blood group O individuals apparently remain associated with the open glycosidic sites on the ABOH convertible red cell surface, must raise suggestions on a transient expression of developmental glycans, which have been "lost" over the course of maturation. In fact, while the mammalian non-somatic, embryogenic stem cell (ESC)- germ cell (GC) transformation is characterized by a transient and genetically as-yet-undefined trans-species-functional O-GalNAc glycan expression, in the C57BL/10 mouse such expression was potentially identified in growth-dependent, blood group A-like GalNAc glycan-bearing, ovarian glycolipids complementary with the syngeneic anti-A reactive IgM, which does not appear in early ovariectomized animals. This non-somatically encoded, polyreactive, ancestral IgM molecule has not undergone clonal selection and does primarily not differentiate between self and non-self and might, due to amino acid hydroxyl groups, highly suggest substrate competition with subsequent O-glycosylations in ongoing ESC-GC transformations and affecting GC maturation. However, the membrane-bound somatic N/O-glycotransferases, which initiate, after formation of the zygote, the complex construction of the human ABO phenotypes in the trans cisternae of the Golgi apparatus, are associated and/or completed with soluble enzyme versions exerting identical specificities in plasma and likely competing vice versa by glycosylation of neonatal IgM amino acids, where they suggest to accomplish the clearance of anti

  9. The Pan-STARRS1 Medium-deep Survey: Star Formation Quenching in Group and Cluster Environments

    NASA Astrophysics Data System (ADS)

    Jian, Hung-Yu; Lin, Lihwai; Lin, Kai-Yang; Foucaud, Sebastien; Chen, Chin-Wei; Chiueh, Tzihong; Bower, R. G.; Cole, Shaun; Chen, Wen-Ping; Burgett, W. S.; Draper, P. W.; Flewelling, H.; Huber, M. E.; Kaiser, N.; Kudritzki, R.-P.; Magnier, E. A.; Metcalfe, N.; Wainscoat, R. J.; Waters, C.

    2017-08-01

    We make use of a catalog of 1600 Pan-STARRS1 groups produced by the probability friends-of-friends algorithm to explore how the galaxy properties, i.e., the specific star formation rate (SSFR) and quiescent fraction, depend on stellar mass and group-centric radius. The work is the extension of Lin et al. In this work, powered by a stacking technique plus a background subtraction for contamination removal, a finer correction and more precise results are obtained than in our previous work. We find that while the quiescent fraction increases with decreasing group-centric radius, the median SSFRs of star-forming galaxies in groups at fixed stellar mass drop slightly from the field toward the group center. This suggests that the main quenching process in groups is likely a fast mechanism. On the other hand, a reduction in SSFRs by ˜0.2 dex is seen inside clusters as opposed to the field galaxies. If the reduction is attributed to the slow quenching effect, the slow quenching process acts dominantly in clusters. In addition, we also examine the density-color relation, where the density is defined by using a sixth-nearest-neighbor approach. Comparing the quiescent fractions contributed from the density and radial effect, we find that the density effect dominates the massive group or cluster galaxies, and the radial effect becomes more effective in less massive galaxies. The results support mergers and/or starvation as the main quenching mechanisms in the group environment, while harassment and/or starvation dominate in clusters.

  10. Archean Age Fossils from Northwestern Australia (Approximately 3.3 to 3.5 GA, Warrawoona Group, Towers Formation)

    NASA Technical Reports Server (NTRS)

    Smith, Penny A. Morris

    1999-01-01

    Archean aged rocks from the Pilbara Block area of western Australia (Warrawoona Group, Towers Formation, -3.3-3.5 Ga) contain microfossils that are composed of various sizes of spheres and filaments. The first descriptions of these microfossils were published in the late 1970's (Dunlop, 1978; Dunlop, et. al., 1978). The authenticity of the microfossils is well established. The small size of the microfossils prevents isotope dating, at least with the present technology. Microbiologists, however, have established guidelines to determine the authenticity of the Archean aged organic remains (Schopf, Walter, 1992).

  11. A novel low-molecular-mass gelator with a redox active ferrocenyl group: tuning gel formation by oxidation.

    PubMed

    Liu, Jing; Yan, Junlin; Yuan, Xuanwei; Liu, Kaiqiang; Peng, Junxia; Fang, Yu

    2008-02-15

    A novel low-molecular-mass gelator containing a redox-active ferrocenyl group, cholesteryl glycinate ferrocenoylamide (CGF), was intentionally designed and prepared. It was demonstrated that the gelator gels 13 out of the 45 solvents tested. Scanning electron microscopy (SEM) measurements revealed that the gelator self-assembled into different supramolecular network structures in different gels. Chemical oxidation of the ferrocenyl residue resulted in phase transition of the gel from gel state to solution state. FTIR and (1)H NMR spectroscopy studies revealed that hydrogen bonding between the gelator molecules in the gel was one of the main driving forces for the formation of the gels.

  12. [Prognostic assessment for formation of a group of cardiovascular high risk among personnel participating in atomic submarines utilization].

    PubMed

    Sosiukin, A E; Vasiliuk, V B; Ivanchenko, A V; Saenko, S A; Semenchuk, O A; Dokhov, M A; Verveda, A B

    2014-01-01

    Ultrasound scanning of main vessels (common carotid, internal carotid, common and superficial femoral, posterior tibial arteries) in staffers of shipyard "Nerpa"--branch of JSC "Shipbuilding center Zvezdochka" (Snezhnogorsk city Murmansk region)--engaged into atomic submarines utilization. Findings are atherosclerotic changes in common carotid and common femoral arteries--increased thickness of intima-media complex over the reference values or atherosclerotic plaque formation. The changes were maximal in a group of males aged over 50 with length of service over 25 years. Discriminant analysis helped to suggest a mathematic model to forecast cardiovascular diseases in personnel of "Nerpa" shipyard.

  13. Archean Age Fossils from Northwestern Australia (Approximately 3.3 to 3.5 GA, Warrawoona Group, Towers Formation)

    NASA Technical Reports Server (NTRS)

    Smith, Penny A. Morris

    1999-01-01

    Archean aged rocks from the Pilbara Block area of western Australia (Warrawoona Group, Towers Formation, -3.3-3.5 Ga) contain microfossils that are composed of various sizes of spheres and filaments. The first descriptions of these microfossils were published in the late 1970's (Dunlop, 1978; Dunlop, et. al., 1978). The authenticity of the microfossils is well established. The small size of the microfossils prevents isotope dating, at least with the present technology. Microbiologists, however, have established guidelines to determine the authenticity of the Archean aged organic remains (Schopf, Walter, 1992).

  14. Detrital zircon provenance link of the Chinle Formation and the Auld Lang Syne Group in Nevada

    SciTech Connect

    Gehrels, G.E.; Dickinson, W.R. . Dept of Geosciences); Riggs, N. . Dept of Geology)

    1993-04-01

    Previous workers have interpreted the Upper Triassic Auld Lang Syne Group of northwest Nevada as (a) part of a suspect terrane displaced with respect to the craton, or (b) the deltaic terminus of the Chinle depositional system of the Colorado Plateau. U-Pb ages for detrital zircons (air-abraded and analyzed as individual crystals), from sandstones in basal Chinle Fm near Currie and the Osobb Fm (basal Auld Lang Syne Gp) in Dixie Valley, set constraints on the provenance of the two units as follows: (a) Chinle grains (n = 40): 225--235 (n = 2), 505--525 (n = 19), 1,410--1,440 (n = 9), 1,700--1,740 (n = 4); (b) Osobb grains (n = 40): [approximately]235 (n = 1), [approximately]265 (n = 1), 355--415 (n = 3), 510--530 (n = 5), 1,010--1,080 (n = 11), [approximately]1,160 (n = 1), 1,430--1,450 (n = 7), 1,705--1,730 (n = 3). Proterozoic grains were likely shed from basement rocks in the SW US, whereas Triassic grains in both samples and Silurian-Devonian and Permian grains in the Osobb sample may have come from arc terranes to the south (Chinle) or west (Osobb). The Chinle sand is quartzose with only rare chert-quartzite grains, whereas the Osobb sand is subarkosic with chert-argillite and feldspar grains that presumably reflect the admixture of Grenville-age detritus (1,010--1,160 Ma) of uncertain provenance. The most likely source for Cambrian grains (505--530 Ma) is the rift-related igneous province stretching from southern Colorado to SW Oklahoma (Wichita Mtns). Regardless of origin, the unexpected occurrence of Cambrian grains in both Nevada samples supports the suggestion of Lupe and Silberling (1985) that the Auld Lang Syne Gp was deposited as a linked facies equivalent of the Chinle Fm.

  15. Effectiveness of cognitive remediation and emotion skills training (CREST) for anorexia nervosa in group format: a naturalistic pilot study.

    PubMed

    Tchanturia, Kate; Doris, Eli; Fleming, Caroline

    2014-05-01

    This study aims to evaluate a novel and brief skills-based therapy for inpatients with anorexia nervosa, which addressed 'cold' and 'hot' cognitions in group format. Adult inpatients with anorexia nervosa participated in the cognitive remediation and emotion skills training groups. Participants who attended all group sessions completed patient satisfaction and self-report questionnaires. Analysis of the data showed that social anhedonia (measured by the Revised Social Anhedonia Scale) decreased significantly between pre- and post-interventions, with small effect size (d=0.39). Motivation (perceived 'importance to change' and 'ability to change') was found to have increased with small effect sizes (d=0.23 and d=0.16), but these changes did not reach statistical significance. The cognitive remediation and emotion skills training group had positive feedback from both the patients and therapists delivering this structured intervention. Improved strategies are needed both in supporting inpatients to tolerate the group therapy setting and in helping them to develop the skills necessary for participation. Further larger-scale research in this area is needed to consolidate these findings. Copyright © 2014 John Wiley & Sons, Ltd and Eating Disorders Association.

  16. Divergent mechanistic routes for the formation of gem-dimethyl groups in the biosynthesis of complex polyketides.

    PubMed

    Poust, Sean; Phelan, Ryan M; Deng, Kai; Katz, Leonard; Petzold, Christopher J; Keasling, Jay D

    2015-02-16

    The gem-dimethyl groups in polyketide-derived natural products add steric bulk and, accordingly, lend increased stability to medicinal compounds, however, our ability to rationally incorporate this functional group in modified natural products is limited. In order to characterize the mechanism of gem-dimethyl group formation, with a goal toward engineering of novel compounds containing this moiety, the gem-dimethyl group producing polyketide synthase (PKS) modules of yersiniabactin and epothilone were characterized using mass spectrometry. The work demonstrated, contrary to the canonical understanding of reaction order in PKSs, that methylation can precede condensation in gem-dimethyl group producing PKS modules. Experiments showed that both PKSs are able to use dimethylmalonyl acyl carrier protein (ACP) as an extender unit. Interestingly, for epothilone module 8, use of dimethylmalonyl-ACP appeared to be the sole route to form a gem-dimethylated product, while the yersiniabactin PKS could methylate before or after ketosynthase condensation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. The first Pan-Podocnemididae turtle egg from the Presidente Prudente Formation (Late Cretaceous, Bauru Group), Brazil.

    PubMed

    Marsola, Júlio C De A; Grellet-Tinner, Gerald; Montefeltro, Felipe C; Langer, Max C

    2014-10-08

    Pan-Podocnemididae turtles are ubiquitous in Late Cretaceous rocks of the Bauru Group in southeastern Brazil. This group of side-necked turtles is particularly abundant in a turtle-bearing site of the Presidente Prudente Formation known as Tartaruguito. Here, we describe the first turtle egg (LPRP-USP 0052) from the Tartaruguito site. LPRP-USP 0052 is nearly complete but misses a pole and measures 5,1 and 2,9-2,2 centimeters due to its flattened minor axis. The egg morphology and microstructure were analyzed by observations performed with CT, Optic Microscopy, Scanning Electronic Microscopy and Wave Dispersion Energy analyses. The eggshell ranges from 145 to160 micrometers thick. Considering the matching morphology of the new specimen and its provenance from the stratigraphic horizon that yielded only the podocnemidids Bauruemys and Roxochelys, it is most likely that LPRP-USP 0052 was produced by a podocnemidid turtle. 

  18. Thermochemistry of organic, heteroorganic and inorganic species. XV. The enthalpies of formation for halogenides of main group elements

    NASA Astrophysics Data System (ADS)

    Takhistov, V. V.; Golovin, A. V.

    2006-02-01

    Systematization of known experimental and theoretical data on the enthalpies of formation for halogenides of main group elements has been performed. Applying the enthalpic shift procedure, the definite trends in the enthalpy of formation/structure interrelationships have been found and these are interpreted as interplay of polarizability and electronegativity effects. These formulated trends permit to find out many unknown values and to suggest reasonable ones in case of known but conflicting cases for full halogenides and especially for hydrogenated halogenides. The data on about 150 unknown species are presented. It was shown that all full elements's halogenides are thermodynamically stable in relation to their decomposition on fragments while among 322 hydrides and H-comprising halogenides only 24 appeared to be thermodynamically unstable relative to their fragmentation to lower valency products. However, nearly all the latter might be stable kinetically. The effect of σ-conjugation (anomeric effect) in stabilization of halogenides of IV and V-group of elements is called in question.

  19. The star formation histories of local group dwarf galaxies. I. Hubble space telescope/wide field planetary camera 2 observations

    SciTech Connect

    Weisz, Daniel R.; Dolphin, Andrew E.; Skillman, Evan D.; Holtzman, Jon; Gilbert, Karoline M.; Dalcanton, Julianne J.; Williams, Benjamin F.

    2014-07-10

    We present uniformly measured star formation histories (SFHs) of 40 Local Group (LG) dwarf galaxies based on color-magnitude diagram (CMD) analysis from archival Hubble Space Telescope imaging. We demonstrate that accurate SFHs can be recovered from CMDs that do not reach the oldest main sequence turn-off (MSTO), but emphasize that the oldest MSTO is critical for precisely constraining the earliest epochs of star formation. We find that: (1) the average lifetime SFHs of dwarf spheroidals (dSphs) can be approximated by an exponentially declining SFH with τ ∼ 5 Gyr; (2) lower luminosity dSphs are less likely to have extended SFHs than more luminous dSphs; (3) the average SFHs of dwarf irregulars (dIrrs), transition dwarfs, and dwarf ellipticals can be approximated by the combination of an exponentially declining SFH (τ ∼ 3-4 Gyr) for lookback ages >10-12 Gyr ago and a constant SFH thereafter; (4) the observed fraction of stellar mass formed prior to z = 2 ranges considerably (80% for galaxies with M < 10{sup 5} M{sub ☉} to 30% for galaxies with M > 10{sup 7} M{sub ☉}) and is largely explained by environment; (5) the distinction between 'ultra-faint' and 'classical' dSphs is arbitrary; (6) LG dIrrs formed a significantly higher fraction of stellar mass prior to z = 2 than the Sloan Digital Sky Survey galaxies from Leitner and the SFHs from the abundance matching models of Behroozi et al. This may indicate higher than expected star formation efficiencies at early times in low mass galaxies. Finally, we provide all the SFHs in tabulated electronic format for use by the community.

  20. Siderophile element systematics of IAB complex iron meteorites: New insights into the formation of an enigmatic group

    NASA Astrophysics Data System (ADS)

    Worsham, Emily A.; Bermingham, Katherine R.; Walker, Richard J.

    2016-09-01

    Siderophile trace element abundances and the 187Re-187Os isotopic systematics of the metal phases of 58 IAB complex iron meteorites were determined in order to investigate formation processes and how meteorites within chemical subgroups may be related. Close adherence of 187Re-187Os isotopic data of most IAB iron meteorites to a primordial isochron indicates that the siderophile elements of most members of the complex remained closed to elemental disturbance soon after formation. Minor, presumably late-stage open-system behavior, however, is observed in some members of the sLM, sLH, sHL, and sHH subgroups. The new siderophile element abundance data are consistent with the findings of prior studies suggesting that the IAB subgroups cannot be related to one another by any known crystallization process. Equilibrium crystallization, coupled with crystal segregation, solid-liquid mixing, and subsequent fractional crystallization can account for the siderophile element variations among meteorites within the IAB main group (MG). The data for the sLM subgroup are consistent with equilibrium crystallization, combined with crystal segregation and mixing. By contrast, the limited fractionation of siderophile elements within the sLL subgroup is consistent with metal extraction from a chondritic source with little subsequent processing. The limited data for the other subgroups were insufficient to draw robust conclusions about crystallization processes involved in their formation. Collectively, multiple formational processes are represented in the IAB complex, and modeling results suggest that fractional crystallization within the MG may have been a more significant process than has been previously recognized.

  1. Geologic and hydrogeologic characteristics of the Ogallala Formation and White River Group, Belvoir Ranch near Cheyenne, Laramie County, Wyoming

    USGS Publications Warehouse

    Bartos, Timothy T.; Diehl, Sharon F.; Hallberg, Laura L.; Webster, Daniel M.

    2014-01-01

    The geologic and hydrogeologic characteristics of Tertiary lithostratigraphic units (Ogallala Formation and White River Group) that typically compose or underlie the High Plains aquifer system in southeastern Wyoming were described physically and chemically, and evaluated at a location on the Belvoir Ranch in Laramie County, Wyoming. On the basis of this characterization and evaluation, three Tertiary lithostratigraphic units were identified using physical and chemical characteristics determined during this study and previous studies, and these three units were determined to be correlative with three identified hydrogeologic units composing the groundwater system at the study site—a high-yielding aquifer composed of the entire saturated thickness of the heterogeneous and coarse-grained fluvial sediments assigned to the Ogallala Formation (Ogallala aquifer); an underlying confining unit composed primarily of very fine-grained volcaniclastic sediments and mudrocks assigned to the Brule Formation of the White River Group and some additional underlying sediments that belong to either the Brule or Chadron Formation, or both (Brule confining unit); and an underlying low-yielding aquifer composed primarily of poorly sorted fluvial sediments assigned to the Chadron Formation of the White River Group (Chadron aquifer). Despite widely varying sediment heterogeneity and consolidation, some limited hydraulic connection throughout the full vertical extent of the Ogallala aquifer was indicated but not conclusively proven by interpretation of similar chemical and isotopic characteristics, modern apparent groundwater ages, and similar hydraulic-head responses measured continuously in two Ogallala aquifer monitoring wells installed for this study at two different widely separated (83 feet) depth intervals. Additional work beyond the scope of this study, such as aquifer tests, would be required to conclusively determine hydraulic connection within the Ogallala aquifer. Groundwater

  2. Personality, Parasites, Political Attitudes, and Cooperation: A Model of How Infection Prevalence Influences Openness and Social Group Formation.

    PubMed

    Brown, Gordon D A; Fincher, Corey L; Walasek, Lukasz

    2016-01-01

    What is the origin of individual differences in ideology and personality? According to the parasite stress hypothesis, the structure of a society and the values of individuals within it are both influenced by the prevalence of infectious disease within the society's geographical region. High levels of infection threat are associated with more ethnocentric and collectivist social structures and greater adherence to social norms, as well as with socially conservative political ideology and less open but more conscientious personalities. Here we use an agent-based model to explore a specific opportunities-parasites trade-off (OPTO) hypothesis, according to which utility-maximizing agents place themselves at an optimal point on a trade-off between (a) the gains that may be achieved through accessing the resources of geographically or socially distant out-group members through openness to out-group interaction, and (b) the losses arising due to consequently increased risks of exotic infection to which immunity has not been developed. We examine the evolution of cooperation and the formation of social groups within social networks, and we show that the groups that spontaneously form exhibit greater local rather than global cooperative networks when levels of infection are high. It is suggested that the OPTO model offers a first step toward understanding the specific mechanisms through which environmental conditions may influence cognition, ideology, personality, and social organization.

  3. How did formative research inform the development of a women’s group intervention in rural Nepal?

    PubMed Central

    Morrison, J; Osrin, D; Shrestha, B; Tumbahangphe, KM; Tamang, S; Shrestha, D; Thapa, S; Mesko, N; Manandhar, DS; Costello, A

    2012-01-01

    Inability to reduce neonatal and maternal mortality in poor countries is sometimes blamed on a lack of contextual knowledge about care practices and care-seeking behavior. There is a lack of knowledge about how to translate formative research into effective interventions to improve maternal and newborn health. We describe the findings of formative research and how they were used to inform the development of such an intervention in rural Nepal. Formative research was carried out in four parts. Part 1 involved familiarization with the study area and literature review, and parts 2, 3 and 4 involved community mapping, audit of health services, and qualitative and quantitative studies of perinatal care behaviors. Participatory approaches have been successful at reducing neonatal mortality and may be suitable in our context. Community mapping and profiling helped to describe the community context, and we found that community-based organizations often sought to involve the Female Community Health Volunteer in community mobilization. She was not routinely conducting monthly meetings and found them difficult to sustain without support and supervision. In health facilities, most primary care staff were in post, but doctors and staff nurses were absent from referral centers. Mortality estimates reflected under-reporting of deaths and hygiene and infection control strategies had low coverage. The majority of women give birth at home with their mother-in-law, friends and neighbors. Care during perinatal illness was usually sought from traditional healers. Cultural issues of shyness, fear and normalcy restricted women’s behavior during pregnancy, birth and the postpartum period, and decisions about her health were usually made after communications with the family and community. The formative research indicated the type of intervention that could be successful. It should be community-based and should not be exclusively for pregnant women. It should address negotiations within

  4. A strategy to advance the evidence base in palliative medicine: formation of a palliative care research cooperative group.

    PubMed

    Abernethy, Amy P; Aziz, Noreen M; Basch, Ethan; Bull, Janet; Cleeland, Charles S; Currow, David C; Fairclough, Diane; Hanson, Laura; Hauser, Joshua; Ko, Danielle; Lloyd, Linda; Morrison, R Sean; Otis-Green, Shirley; Pantilat, Steve; Portenoy, Russell K; Ritchie, Christine; Rocker, Graeme; Wheeler, Jane L; Zafar, S Yousuf; Kutner, Jean S

    2010-12-01

    Palliative medicine has made rapid progress in establishing its scientific and clinical legitimacy, yet the evidence base to support clinical practice remains deficient in both the quantity and quality of published studies. Historically, the conduct of research in palliative care populations has been impeded by multiple barriers including health care system fragmentation, small number and size of potential sites for recruitment, vulnerability of the population, perceptions of inappropriateness, ethical concerns, and gate-keeping. A group of experienced investigators with backgrounds in palliative care research convened to consider developing a research cooperative group as a mechanism for generating high-quality evidence on prioritized, clinically relevant topics in palliative care. The resulting Palliative Care Research Cooperative (PCRC) agreed on a set of core principles: active, interdisciplinary membership; commitment to shared research purposes; heterogeneity of participating sites; development of research capacity in participating sites; standardization of methodologies, such as consenting and data collection/management; agile response to research requests from government, industry, and investigators; focus on translation; education and training of future palliative care researchers; actionable results that can inform clinical practice and policy. Consensus was achieved on a first collaborative study, a randomized clinical trial of statin discontinuation versus continuation in patients with a prognosis of less than 6 months who are taking statins for primary or secondary prevention. This article describes the formation of the PCRC, highlighting processes and decisions taken to optimize the cooperative group's success.

  5. Evidence for successful implementation of exposure and response prevention in a naturalistic group format for pediatric OCD.

    PubMed

    Olino, Thomas M; Gillo, Susan; Rowe, David; Palermo, Sean; Nuhfer, Elizabeth C; Birmaher, Boris; Gilbert, Andrew R

    2011-04-01

    Although exposure and response prevention (ERP) is an effective treatment for youth with obsessive-compulsive disorder (OCD), the majority of studies, randomized clinical trials of individual therapy, find variability in treatment response. We evaluated the potential role of individual differences in OCD presentation, comorbid disorders, age, and gender on treatment effects. Moreover, we examined these potential effects in a group format in a naturalistic, clinic-based sample of patients. Pediatric patients with a DSM-IV diagnosis of OCD (n=41) were treated with ERP in an intensive outpatient community-based program. OCD, mood, and anxiety symptom severity was measured at baseline, during treatment, and at discharge. Trajectories and predictors of treatment outcome were measured using linear growth models. We found that group-based ERP was effective in reducing pediatric OCD symptom severity in a naturalistic treatment setting irrespective of age or gender. Furthermore, ERP was found to be effective at reducing depressive symptoms but not other anxiety symptoms. We also found inter-individual variability in the discharge levels of contamination, symmetry, and intrusive sexual thoughts and in the rate of severity reduction of intrusive sexual thoughts. Group-based ERP is an effective treatment for children and adolescents with OCD. Several factors, including symptom dimensions and comorbid psychopathology, are associated with treatment response and outcome in this pediatric population. © 2011 Wiley-Liss, Inc.

  6. A Strategy To Advance the Evidence Base in Palliative Medicine: Formation of a Palliative Care Research Cooperative Group

    PubMed Central

    Aziz, Noreen M.; Basch, Ethan; Bull, Janet; Cleeland, Charles S.; Currow, David C.; Fairclough, Diane; Hanson, Laura; Hauser, Joshua; Ko, Danielle; Lloyd, Linda; Morrison, R. Sean; Otis-Green, Shirley; Pantilat, Steve; Portenoy, Russell K.; Ritchie, Christine; Rocker, Graeme; Wheeler, Jane L.; Zafar, S. Yousuf; Kutner, Jean S.

    2010-01-01

    Abstract Background Palliative medicine has made rapid progress in establishing its scientific and clinical legitimacy, yet the evidence base to support clinical practice remains deficient in both the quantity and quality of published studies. Historically, the conduct of research in palliative care populations has been impeded by multiple barriers including health care system fragmentation, small number and size of potential sites for recruitment, vulnerability of the population, perceptions of inappropriateness, ethical concerns, and gate-keeping. Methods A group of experienced investigators with backgrounds in palliative care research convened to consider developing a research cooperative group as a mechanism for generating high-quality evidence on prioritized, clinically relevant topics in palliative care. Results : The resulting Palliative Care Research Cooperative (PCRC) agreed on a set of core principles: active, interdisciplinary membership; commitment to shared research purposes; heterogeneity of participating sites; development of research capacity in participating sites; standardization of methodologies, such as consenting and data collection/management; agile response to research requests from government, industry, and investigators; focus on translation; education and training of future palliative care researchers; actionable results that can inform clinical practice and policy. Consensus was achieved on a first collaborative study, a randomized clinical trial of statin discontinuation versus continuation in patients with a prognosis of less than 6 months who are taking statins for primary or secondary prevention. This article describes the formation of the PCRC, highlighting processes and decisions taken to optimize the cooperative group's success. PMID:21105763

  7. EVIDENCE FOR SUCCESSFUL IMPLEMENTATION OF EXPOSURE AND RESPONSE PREVENTION IN A NATURALISTIC GROUP FORMAT FOR PEDIATRIC OCD

    PubMed Central

    Olino, Thomas M.; Gillo, Susan; Rowe, David; Palermo, Sean; Nuhfer, Elizabeth C.; Birmaher, Boris; Gilbert, Andrew R.

    2011-01-01

    Background Although exposure and response prevention (ERP) is an effective treatment for youth with obsessive–compulsive disorder (OCD), the majority of studies, randomized clinical trials of individual therapy, find variability in treatment response. We evaluated the potential role of individual differences in OCD presentation, comorbid disorders, age, and gender on treatment effects. Moreover, we examined these potential effects in a group format in a naturalistic, clinic-based sample of patients. Methods Pediatric patients with a DSM-IV diagnosis of OCD (n = 41) were treated with ERP in an intensive outpatient community-based program. OCD, mood, and anxiety symptom severity was measured at baseline, during treatment, and at discharge. Trajectories and predictors of treatment outcome were measured using linear growth models. Results We found that group-based ERP was effective in reducing pediatric OCD symptom severity in a naturalistic treatment setting irrespective of age or gender. Furthermore, ERP was found to be effective at reducing depressive symptoms but not other anxiety symptoms. We also found inter-individual variability in the discharge levels of contamination, symmetry, and intrusive sexual thoughts and in the rate of severity reduction of intrusive sexual thoughts. Conclusion Group-based ERP is an effective treatment for children and adolescents with OCD. Several factors, including symptom dimensions and comorbid psychopathology, are associated with treatment response and outcome in this pediatric population. PMID:21456041

  8. Delivering a very brief psychoeducational program to cancer patients and family members in a large group format.

    PubMed

    Cunningham, A J; Edmonds, C V; Williams, D

    1999-01-01

    It is well established that brief psychoeducational programs for cancer patients will significantly improve mean quality of life. As this kind of adjunctive treatment becomes integrated into general cancer management, it will be necessary to devise cost-effective and efficacious programs that can be offered to relatively large numbers of patients. We have developed a very brief 4-session program that provides this service to 40-80 patients and family members per month (and seems capable of serving much larger numbers, depending on the capacity of the facility in which they assemble). Patients meet in a hospital auditorium for a large group, lecture-style program that offers training in basic coping skills: stress management, relaxation training, thought monitoring and changing, mental imagery and goal setting. Over the first year we have treated 363 patients and 150 family members. Improvements were assessed by changes in the POMS-Short Form, and both patients and family members were found to improve significantly over the course of the program. While this is not a randomized comparison, it suggests that the benefits gained from a large group in a classroom are not substantially less than the improvements that have been documented in the usual small group format, where more interactive discussions are possible.

  9. A new squamate lizard from the Upper Cretaceous Adamantina Formation (Bauru Group), São Paulo State, Brazil.

    PubMed

    Nava, William R; Martinelli, Agustín G

    2011-03-01

    The record of non-mosasaur squamates (Reptilia, Squamata) is sparse in the Cretaceus fossil record of Brazil and include six putative reports, three from the Aptian-Albian of the Araripe Basin (Tijubina pontei Bonfim-Júnior and Marques, Olindalacerta brasiliensis Evans and Yabumoto, and a lizard indet.) and three from the Upper Cretaceous of the Bauru Group (Pristiguana brasiliensis Estes and Price, Anilioidae gen. et sp. indet., and Squamata gen. et sp. indet.). In this contribution, a new genus and species of lizard, Brasiliguana prudentis gen. et sp. nov., is described based on an isolated left maxilla with teeth. The material was discovered in an outcrop of the Upper Cretaceous Adamantina Formation (Bauru Group) located in the proximity of Presidente Prudente Municipality, São Paulo State, Brazil. The new taxon is considered a basal non-Priscagamidae+Acrodonta iguanian based on the presence of a weakly inclined anterior margin of the maxillary nasal process and maxillary tooth shape and tooth implantation similar to that of iguanians rather than of other lizard groups (e.g. teiids). This finding significantly increases the squamate lizard diversity of South America, which is still poorly understood and sparsely represented in the fossil record.

  10. Origin of iron oxide spherules in the banded iron formation of the Bababudan Group, Dharwar Craton, Southern India

    NASA Astrophysics Data System (ADS)

    Orberger, Beate; Wagner, Christiane; Wirth, Richard; Quirico, Eric; Gallien, Jean Paul; Derré, Colette; Montagnac, Gilles; Noret, Aurélie; Jayananda, Mudlappa; Massault, Marc; Rouchon, Virgile

    2012-06-01

    The banded iron formation of the Bababudan Group (Western Dharwar Craton, India) is composed of millimetric to centimetric alternating quartz and grey to red Fe-oxide bands. Major phases are quartz and martite (hematized magnetite) with minor Fe-sulfides and Ca-Mg-Fe-carbonates. Micrometric Fe-oxide spherules fill cavities in discontinuous micrometric layers of Fe-oxides that occur in the massive quartz layers and at the interface of massive Fe-oxide and quartz layers. The spherules are composed of micrometric radial plates of hematite intergrown with nanometric magnetite. These spherules contain carbonaceous matter (CM) with nanometric Fe-particles and have low N contents (˜900 ppm; CM1). The spherule formation is attributed to a low temperature hydrothermal process (150-200 °C) at around 2.52 Ga, possibly favored by the presence of CM. These hydrothermal fluids dissolved diagenetic interstitial sulfides or carbonates creating cavities which, provided space for the spherule precipitation. Carbonaceous matter of semi-anthracite maturity is encapsulated in quartz grains adjacent to the Fe-oxide spherules (CM2) and it is thus concluded that CM1 and CM2 are most likely contemporaneous and of the same origin, either incorporated at the time of BIF formation or during the hydrothermal event at 2.52 Ga from the underlying phyllitised black shales. Carbonaceous matter (CM3) was also found around the Fe-oxide spherules and the martite grains. CM3 has much higher N contents (>5000 ppm), is of a lower maturity than CM1 and CM2, and is related to weathering, which is also indicated by the presence of goethite and kaolinite. The δ13C of all CMs varies from -19.4 to -24.7‰, similar to values measured in the underlying phyllitised black shales and likely reflect denitrifying microbial activity.

  11. Effect of functional end groups of silane self assembled monolayer surfaces on apatite formation, fibronectin adsorption and osteoblast cell function

    PubMed Central

    Toworfe, G.K.; Bhattacharyya, S.; Composto, R.J.; Adams, C.S.; Shapiro, I.M.; Ducheyne, P.

    2008-01-01

    Bioactive glass (BG) can directly bond to living bone without fibrous tissue encapsulation. Key mechanistic steps of BG’s activity are attributed to calcium phosphate formation, surface hydroxylation and fibronectin (FN) adsorption. In the present study, self-assembled monolayers (SAMs) of alkanesilanes with different surface chemistry (OH, NH2, and COOH) were used as a model system to mimic BG’s surface activity. Calcium phosphate (Ca-P) was formed on SAMs by immersion in a solution which simulates the electrolyte content of physiological fluids. FN adsorption kinetics and monolayer coverage was determined on SAMs with or without Ca-P coating. The surface roughness was also examined on these substrates before and after FN adsorption. The effects of FN-adsorbed, Ca-P coated SAMs on the function of MC3T3-E1 were evaluated by cell growth, expression of alkaline phosphatase activity, and actin cytoskeleton formation. We demonstrate that, although the FN monolayer coverage and the rms roughness are similar on −OH and −COOH terminated SAMs with or without Ca-P coating, higher levels of ALP activity, more actin cytoskeleton formation and more cell growth are obtained on −OH and −COOH terminated SAMs with Ca-P coating. In addition, although the FN monolayer coverage is higher on Ca-P coated −NH2 terminated SAMs and SiOx surfaces, higher levels of ALP activity and more cell growth are obtained on Ca-P coated −OH and −COOH terminated SAMs. Thus with same Ca-P coatings, different surface functional groups have different effects on the function of osteoblastic cells. These findings represent new insights into the mechanism of bioactivity of BG and, thereby, may lead to designing superior constructs for bone grafting. PMID:19012271

  12. Group IVA phospholipase A2-associated production of MMP-9 in macrophages and formation of atherosclerotic lesions.

    PubMed

    Ii, Hiromi; Hontani, Naoya; Toshida, Issei; Oka, Mayuko; Sato, Takashi; Akiba, Satoshi

    2008-03-01

    Matrix metalloproteinase-9 (MMP-9) is involved in atherogenesis, and the production of MMP-9 in macrophages is considered to be mediated by the arachidonic acid cascade. The present study examined the possible involvement of group IVA phospholipase A2 (IVA-PLA2), a key enzyme in the arachidonic acid cascade, in the production of MMP-9 induced by oxidized low-density lipoprotein (oxLDL) in macrophages and high-fat diet-induced formation of atherosclerotic lesions using IVA-PLA2-deficient mice (C57BL/6 background). In wild-type mouse peritoneal macrophages, oxLDL induced an increase in MMP-9 in the culture medium. The oxLDL-promoted production of MMP-9 was markedly reduced in IVA-PLA2-deficient macrophages compared to wild-type macrophages. Feeding of wild-type mice with a high-fat diet caused the formation of early atherosclerotic lesions in the aortic root with increases in MMP-9 and macrophages in the lesions and with higher serum levels of total cholesterol. Such lesions were apparently less severe in IVA-PLA2-deficient mice fed a high-fat diet, despite higher total cholesterol levels. Under the conditions, a high-fat diet reduced the serum levels of high-density lipoprotein-cholesterol (HDL-C) in wild-type mice. However, IVA-PLA2-deficient mice fed a high-fat diet were protected against the decrease in HDL-C levels. The present results suggest that IVA-PLA2 is involved in the oxLDL-induced production of MMP-9 in macrophages and the high-fat diet-induced formation of early atherosclerotic lesions. The protection against the lesions in IVA-PLA2-deficient mice may be ascribable, in part, to the impaired production of MMP-9 and/or the maintained levels of HDL-C.

  13. Constraining the Nature of Dark Matter with the Star-formation History of the Faintest Local Group Dwarf Galaxy Satellites

    NASA Astrophysics Data System (ADS)

    Chau, Alice; Mayer, Lucio; Governato, Fabio

    2017-08-01

    Λ warm dark matter (ΛWDM), realized by collisionless particles of 1-3 keV, has been proposed as an alternative scenario to Λ-Cold-Dark Matter (ΛCDM) for the dwarf galaxy scale discrepancies. We present an approach to test the viability of such WDM models using star-formation histories (SFHs) of the dwarf spheroidal galaxies (dSphs) in the Local Group. We compare their high-time-resolution SFHs with the collapse redshift of their dark halos in CDM and WDM. Collapse redshift is inferred after determining the subhalo infall mass. This is based on the dwarf current mass inferred from stellar kinematics, combined with cosmological simulation results on subhalo evolution. WDM subhalos close to the filtering mass scale, forming significantly later than CDM, are the most difficult to reconcile with early truncation of star formation (z ≥ 3). The ultra-faint dwarfs (UFDs) provide the most stringent constraints. Using six UFDs and eight classical dSphs, we show that a 1 keV particle is strongly disfavored, consistently with other reported methods. Excluding other models is only hinted for a few UFDs. Other UFDs for which the lack of robust constraints on halo mass prevents us from carrying out our analysis rigorously, show a very early onset of star formation that will strengthen the constraints delivered by our method in the future. We discuss the various caveats, notably the low number of dwarfs with accurately determined SFHs and the uncertainties when determining the subhalo infall mass, most notably the baryonic physics. Our preliminary analysis may serve as a pathfinder for future investigations that will combine accurate SFHs for local dwarfs with direct analysis of WDM simulations with baryons.

  14. Low Temperature Magnetic Properties of the Late Archean Boolgeeda Iron Formation (Hamersley Group, Western Australia): Environmental Implications

    NASA Astrophysics Data System (ADS)

    Carlut, Julie; Isambert, Aude; Bouquerel, Hélène; Pecoits, Ernesto; Philippot, Pascal; Vennin, Emmanuelle; Ader, Magali; Thomazo, Christophe; Buoncristiani, Jean-François; Baton, Franck; Muller, Elodie; Deldicque, Damien

    2015-05-01

    The origin of the iron oxides in Archean and Paleoproterozoic Banded Iron Formations is still a debated question. We report low and high temperature magnetic properties, susceptibility and saturation magnetization results joined with scanning microscope observations within a 35 meters section of the Late Archean Boolgeeda Iron Formation of the Hamersley Group, Western Australia. With the exception of two volcanoclastic intervals characterized by low susceptibility and magnetization, nearly pure magnetite is identified as the main magnetic carrier in all iron-rich layers including hematite-rich jasper beds. Two populations of magnetically distinct magnetites are reported from a 2 meter-thick interval within the section. Each population shows a specific Verwey transition temperature: one around 120-124 K and the other in the range of 105-110 K. This temperature difference is interpreted to reflect two distinct stoichiometry and likely two episodes of crystallization. The 120-124K transition is attributed to nearly pure stoichiometric magnetite, SEM and microprobe observations suggest that the lower temperature transition is related to chemically impure silician magnetite. Microbial-induced partial substitution of iron by silicon is suggested here. This is supported by an increase in Total Organic Carbon (TOC) in the same interval.

  15. The effect of response scale, administration mode, and format on responses to the CAHPS Clinician and Group survey.

    PubMed

    Drake, Keith M; Hargraves, J Lee; Lloyd, Stephanie; Gallagher, Patricia M; Cleary, Paul D

    2014-08-01

    To examine how different response scales, methods of survey administration, and survey format affect responses to the CAHPS (Consumer Assessment of Healthcare Providers and Systems) Clinician and Group (CG-CAHPS) survey. A total of 6,500 patients from a university health center were randomly assigned to receive the following: standard 12-page mail surveys using 4-category or 6-category response scales (on CG-CAHPS composite items), telephone surveys using 4-category or 6-category response scales, or four-page mail surveys. A total of 3,538 patients completed surveys. Composite score means and provider-level reliabilities did not differ between respondents receiving 4-category or 6-category response scale surveys or between 12-page and four-page mail surveys. Telephone respondents gave more positive responses than mail respondents. We recommend using 4-category response scales and the four-page mail CG-CAHPS survey. © Health Research and Educational Trust.

  16. The Effect of Response Scale, Administration Mode, and Format on Responses to the CAHPS Clinician and Group Survey

    PubMed Central

    Drake, Keith M; Hargraves, J Lee; Lloyd, Stephanie; Gallagher, Patricia M; Cleary, Paul D

    2014-01-01

    Objective To examine how different response scales, methods of survey administration, and survey format affect responses to the CAHPS (Consumer Assessment of Healthcare Providers and Systems) Clinician and Group (CG-CAHPS) survey. Study Design A total of 6,500 patients from a university health center were randomly assigned to receive the following: standard 12-page mail surveys using 4-category or 6-category response scales (on CG-CAHPS composite items), telephone surveys using 4-category or 6-category response scales, or four-page mail surveys. Principal Findings A total of 3,538 patients completed surveys. Composite score means and provider-level reliabilities did not differ between respondents receiving 4-category or 6-category response scale surveys or between 12-page and four-page mail surveys. Telephone respondents gave more positive responses than mail respondents. Conclusions We recommend using 4-category response scales and the four-page mail CG-CAHPS survey. PMID:24471975

  17. Characteristics of Escherichia coli causing persistence or relapse of urinary tract infections: phylogenetic groups, virulence factors and biofilm formation.

    PubMed

    Ejrnæs, Karen; Stegger, Marc; Reisner, Andreas; Ferry, Sven; Monsen, Tor; Holm, Stig E; Lundgren, Bettina; Frimodt-Møller, Niels

    2011-01-01

    Recurrent urinary tract infections (RUTIs) pose a major problem but little is known about characteristics of Escherichia coli associated with RUTI. This study includes E. coli from 155 women with community-acquired lower urinary tract infections (UTIs) randomized to one of three dosing regiments of pivmecillinam and aimed to identify associations between the presence of 29 virulence factor genes (VFGs), phylogenetic groups and biofilm formation and the course of infection during follow-up visits at 8-10 and 35-49 days post-inclusion, respectively. E. coli causing persistence or relapse were more often of phylogenetic group B2 and had a significantly higher aggregate VFG score than E. coli that were not detectable at follow-up. Specifically, these E. coli causing persistence or relapse were characterized by a higher prevalence of hemolysis and 12 VFGs (sfa/focDE, papAH, agn43, chuA, fyuA, iroN, kpsM II, kpsM II K2, cnf1, hlyD, malX and usp). KpsM II K2 and agn43a(CFT073) were independently associated with persistence or relapse. No specific combination of presence/absence of VFGs could serve as a marker to predict RUTI. Stratifying for VFGs, seven days of pivmecillinam treatment reduced the prevalence of persistence or relapse of UTI compared with three days. In vitro biofilm formation was not higher among E. coli causing persistence or relapse. The presence of agn43a(CFT073) or agn43b(CFT073) was associated with biofilm forming capacity. In conclusion, our results show potential targets for prevention and treatment of persistence/relapse of UTI and potential markers for selecting treatment lengths and warrant studies of these and new VFGs.

  18. Selected data for wells and test holes used in structure-contour maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation in the Black Hills area, South Dakota

    USGS Publications Warehouse

    Carter, J.M.

    1999-01-01

    This report presents selected data on wells and test holes that were used in the construction of structure-contour maps of selected formations that contain major aquifers in the Black Hills area of western South Dakota. Altitudes of the top of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation are presented for the wells and test holes presented in this report.

  19. Social conflict and the formation of emergent groups in a technological disaster: The Exxon Valdez oil spill and the response of residents in the area of Homer, Alaska

    SciTech Connect

    Button, G.V.

    1993-01-01

    To date there has been a paucity of research on the formation of emergent groups in the wake of technological disasters. A majority of researchers have contended that whereas natural disasters engender social cohesion and stimulate the formation of emergent groups, technological disasters have the tendency to constrain such formation because of the social conflict which follows in the wake of a technological disaster. This thesis challenges that assumption and examines both the nature of the social conflict and the formation of emergent groups that occurred in the aftermath of this country's largest environmental disaster: the Exxon Valdez oil spill. An anthropological perspective is employed. The investigator examines the formation of such groups in the area of Homer, Alaska. The differential response to the disaster and the ensuing social conflict is examined by a combination of participant-observation methods, formal and informal, in-depth interviews, and archival records. This investigation reveals that although there was considerable social conflict, there was also sufficient social cohesion to promote the formation of emergent group responses to the oil spill and the cleanup that followed. Moreover, it finds that the resultant conflict and the formation of such groups was attributable in part to a widely reported sense of a loss of control' and considerable uncertainty about many of the facts' surrounding the spill. This included uncertainty about who was ultimately in control of the cleanup and which clean-up technologies and remediation efforts were most urgent and useful. This thesis concludes that, contrary to the expectations of most social scientists, emergent groups can form in the wake of a technological disaster. Moreover, given the sense of urgency and the common perception of disaster victims that authorities are both unable and unwilling to respond to disasters, the formation of such groups is inevitable.

  20. Strong Far-infrared Cooling Lines, Peculiar CO Kinematics, and Possible Star-formation Suppression in Hickson Compact Group 57

    NASA Astrophysics Data System (ADS)

    Alatalo, K.; Appleton, P. N.; Lisenfeld, U.; Bitsakis, T.; Guillard, P.; Charmandaris, V.; Cluver, M.; Dopita, M. A.; Freeland, E.; Jarrett, T.; Kewley, L. J.; Ogle, P. M.; Rasmussen, J.; Rich, J. A.; Verdes-Montenegro, L.; Xu, C. K.; Yun, M.

    2014-11-01

    We present [C II] and [O I] observations from Herschel and CO(1-0) maps from the Combined Array for Research in Millimeter Astronomy (CARMA) of the Hickson compact group HCG 57, focusing on the galaxies HCG 57a and HCG 57d. HCG 57a has been previously shown to contain enhanced quantities of warm molecular hydrogen consistent with shock or turbulent heating. Our observations show that HCG 57d has strong [C II] emission compared to L FIR and weak CO(1-0), while in HCG 57a, both the [C II] and CO(1-0) are strong. HCG 57a lies at the upper end of the normal distribution of the [C II]/CO and [C II]/FIR ratios, and its far-infrared (FIR) cooling supports a low-density, warm, diffuse gas that falls close to the boundary of acceptable models of a photon-dominated region. However, the power radiated in the [C II] and warm H2 emissions have similar magnitudes, as seen in other shock-dominated systems and predicted by recent models. We suggest that shock heating of the [C II] is a viable alternative to photoelectric heating in violently disturbed, diffuse gas. The existence of shocks is also consistent with the peculiar CO kinematics in the galaxy, indicating that highly noncircular motions are present. These kinematically disturbed CO regions also show evidence of suppressed star formation, falling a factor of 10-30 below normal galaxies on the Kennicutt-Schmidt relation. We suggest that the peculiar properties of both galaxies are consistent with a highly dissipative, off-center collisional encounter between HCG 57d and 57a, creating ring-like morphologies in both systems. Highly dissipative gas-on-gas collisions may be more common in dense groups because of the likelihood of repeated multiple encounters. The possibility of shock-induced star-formation suppression may explain why a subset of these HCG galaxies has been found previously to fall in the mid-infrared green valley.

  1. Strong far-infrared cooling lines, peculiar CO kinematics, and possible star-formation suppression in Hickson compact group 57

    SciTech Connect

    Alatalo, K.; Appleton, P. N.; Ogle, P. M.; Rich, J. A.; Xu, C. K.; Lisenfeld, U.; Bitsakis, T.; Guillard, P.; Charmandaris, V.; Cluver, M.; Jarrett, T.; Dopita, M. A.; Kewley, L. J.; Freeland, E.; Rasmussen, J.; Verdes-Montenegro, L.

    2014-11-10

    We present [C II] and [O I] observations from Herschel and CO(1-0) maps from the Combined Array for Research in Millimeter Astronomy (CARMA) of the Hickson compact group HCG 57, focusing on the galaxies HCG 57a and HCG 57d. HCG 57a has been previously shown to contain enhanced quantities of warm molecular hydrogen consistent with shock or turbulent heating. Our observations show that HCG 57d has strong [C II] emission compared to L {sub FIR} and weak CO(1-0), while in HCG 57a, both the [C II] and CO(1-0) are strong. HCG 57a lies at the upper end of the normal distribution of the [C II]/CO and [C II]/FIR ratios, and its far-infrared (FIR) cooling supports a low-density, warm, diffuse gas that falls close to the boundary of acceptable models of a photon-dominated region. However, the power radiated in the [C II] and warm H{sub 2} emissions have similar magnitudes, as seen in other shock-dominated systems and predicted by recent models. We suggest that shock heating of the [C II] is a viable alternative to photoelectric heating in violently disturbed, diffuse gas. The existence of shocks is also consistent with the peculiar CO kinematics in the galaxy, indicating that highly noncircular motions are present. These kinematically disturbed CO regions also show evidence of suppressed star formation, falling a factor of 10-30 below normal galaxies on the Kennicutt-Schmidt relation. We suggest that the peculiar properties of both galaxies are consistent with a highly dissipative, off-center collisional encounter between HCG 57d and 57a, creating ring-like morphologies in both systems. Highly dissipative gas-on-gas collisions may be more common in dense groups because of the likelihood of repeated multiple encounters. The possibility of shock-induced star-formation suppression may explain why a subset of these HCG galaxies has been found previously to fall in the mid-infrared green valley.

  2. Involvement of the nadA gene in formation of G-group aflatoxins in Aspergillus parasiticus.

    PubMed

    Cai, Jingjing; Zeng, Hongmei; Shima, Yoko; Hatabayashi, Hidemi; Nakagawa, Hiroyuki; Ito, Yasuhiro; Adachi, Yoshikazu; Nakajima, Hiromitsu; Yabe, Kimiko

    2008-07-01

    The nadA gene is present at the end of the aflatoxin gene cluster in the genome of Aspergillus parasiticus as well as in Aspergillus flavus. RT-PCR analyses showed that the nadA gene was expressed in an aflatoxin-inducible YES medium, but not in an aflatoxin-non-inducible YEP medium. The nadA gene was not expressed in the aflR gene-deletion mutant, irrespective of the culture medium used. To clarify the nadA gene's function, we disrupted the gene in aflatoxigenic A. parasiticus. The four nadA-deletion mutants that were isolated commonly accumulated a novel yellow-fluorescent pigment (named NADA) in mycelia as well as in culture medium. When the mutants and the wild-type strain were cultured for 3 days in YES medium, the mutants each produced about 50% of the amounts of G-group aflatoxins that the wild-type strain produced. In contrast, the amounts of B-group aflatoxins did not significantly differ between the mutants and the wild-type strain. The NADA pigment was so unstable that it could non-enzymatically change to aflatoxin G(1) (AFG(1)). LC-MS measurement showed that the molecular mass of NADA was 360, which is 32 higher than that of AFG(1). We previously reported that at least one cytosol enzyme, together with two other microsome enzymes, is necessary for the formation of AFG(1) from O-methylsterigmatocystin (OMST) in the cell-free system of A. parasiticus. The present study confirmed that the cytosol fraction of the wild-type A.parasiticus strain significantly enhanced the AFG(1) formation from OMST, whereas the cytosol fraction of the nadA-deletion mutant did not show the same activity. Furthermore, the cytosol fraction of the wild-type strain showed the enzyme activity catalyzing the reaction from NADA to AFG(1), which required NADPH or NADH, indicating that NADA is a precursor of AFG(1); in contrast, the cytosol fraction of the nadA-deletion mutant did not show the same enzyme activity. These results demonstrated that the NadA protein is the cytosol enzyme

  3. Outcome differences between individual and group formats when identical and nonidentical treatments, patients, and doses are compared: A 25-year meta-analytic perspective.

    PubMed

    Burlingame, Gary M; Seebeck, Jyssica D; Janis, Rebecca A; Whitcomb, Kaitlyn E; Barkowski, Sarah; Rosendahl, Jenny; Strauss, Bernhard

    2016-12-01

    There are mixed findings regarding the differential efficacy of the group and individual format. One explanation of these mixed findings is that nearly all-recent meta-analyses use between-study effect sizes to test format equivalence introducing uncontrolled differences in patients, treatments, and outcome measures. Only 3 meta-analyses were located from the past 20 years that directly tested format differences in the same study using within-study effect sizes; mixed findings were reported with a primary limitation being the small number of studies. However, we located 67 studies that compared both formats in the same study. Format equivalence (g = -0.01) with low effect size heterogeneity (variability) was found in 46 studies that compared identical treatments, patients, and doses on primary outcome measures. Format equivalence (g = -0.06) with moderate effect size heterogeneity was found for 21 studies that compared nonidentical treatments; however, allegiance to a specific format moderated differences in effect sizes. There were no differences between formats for rates of treatment acceptance, dropout, remission, and improvement. Additionally, there were no differences in outcome between formats by patient diagnosis; however, differences in pre-to-post improvement were explained by diagnosis with depression, anxiety, and substance disorder posting the highest outcomes and medical and childhood disorders the lowest. Findings are discussed with reference to the practical challenges of implementing groups in clinical practice from an agency, clinician, and reimbursement perspective. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  4. Heat evolution of micelle formation, dependence of enthalpy, and heat capacity on the surfactant chain length and head group.

    PubMed

    Opatowski, Ella; Kozlov, Michael M; Pinchuk, Ilya; Lichtenberg, Dov

    2002-02-15

    Micelle formation by many surfactants is endothermic at low temperatures but exothermic at high temperatures. In this respect, dissociation of micelles (demicellization) is similar to dissolving hydrocarbons in water. However, a remarkable difference between the two processes is that dissolving hydrocarbons is isocaloric at about 25 degrees C, almost independently of the hydrocarbon chain length, whereas the temperature (T*) at which demicellization of different surfactants is athermal varies over a relatively large range. We have investigated the temperature dependence of the heat of demicellization of three alkylglucosides with hydrocarbon chains of 7, 8, and 9 carbon atoms. At about 25 degrees C, the heat of demicellization of the three studied alkylglucosides varied within a relatively small range (DeltaH=-7.8+/-0.4 kJ/mol). The temperature dependence of DeltaH(demic) indicates that within the studied temperature range the heat capacity of demicellization (DeltaC(P,demic)) is about constant. The value of DeltaC(P,demic) exhibited an apparently linear dependence on the surfactant's chain length (DeltaC(P,demic)/n(CH(2))=47+/-7 kJ/mol K). Our interpretation of these results is that (i) the transfer of the head groups from micelles to water is exothermic and (ii) the temperature dependence of the heat associated with water-hydrocarbon interactions is only slightly affected by the head group. This implies that the deviation of the value of T* from 25 degrees C results from the contribution of the polar head to the overall heat of demicellization. Calorimetric studies of other series of amphiphiles will have to be conducted to test whether the latter conclusion is general.

  5. Toxin Profile, Biofilm Formation, and Molecular Characterization of Emetic Toxin-Producing Bacillus cereus Group Isolates from Human Stools.

    PubMed

    Oh, Su Kyung; Chang, Hyun-Joo; Choi, Sung-Wook; Ok, Gyeongsik; Lee, Nari

    2015-11-01

    Emetic toxin-producing Bacillus cereus group species are an important problem, because the staple food for Korean is grains such as rice. In this study, we determined the prevalence (24 of 129 isolates) of emetic B. cereus in 36,745 stool samples from sporadic food-poisoning cases in Korea between 2007 and 2008. The toxin gene profile, toxin production, and biofilm-forming ability of the emetic B. cereus isolates were investigated. Repetitive element sequence polymorphism polymerase chain reaction fingerprints (rep-PCR) were also used to assess the intraspecific biodiversity of these isolates. Emetic B. cereus was present in 0.07% of the sporadic food-poisoning cases. The 24 emetic isolates identified all carried the nheABC and entFM genes and produced NHE enterotoxin. However, they did not have hemolysin BL toxin or related genes. A relationship between biofilm formation and toxin production was not observed in this study. The rep-PCR fingerprints of the B. cereus isolates were not influenced by the presence of toxin genes, or biofilm-forming ability. The rep-PCR assay discriminated emetic B. cereus isolates from nonemetic isolates, even if this assay did not perfectly discriminate these isolates. Further study on emetic isolates possessing a high degree of diversity may be necessary to evaluate the performance of the subtyping assay to discriminate emetic and nonemetic B. cereus isolates and could provide a more accurate indication of the risk from B. cereus strains.

  6. An improved lossless group compression algorithm for seismic data in SEG-Y and MiniSEED file formats

    NASA Astrophysics Data System (ADS)

    Li, Huailiang; Tuo, Xianguo; Shen, Tong; Henderson, Mark Julian; Courtois, Jérémie; Yan, Minhao

    2017-03-01

    An improved lossless group compression algorithm is proposed for decreasing the size of SEG-Y files to relieve the enormous burden associated with the transmission and storage of large amounts of seismic exploration data. Because each data point is represented by 4 bytes in SEG-Y files, the file is broken down into 4 subgroups, and the Gini coefficient is employed to analyze the distribution of the overall data and each of the 4 data subgroups within the range [0,255]. The results show that each subgroup comprises characteristic frequency distributions suited to distinct compression algorithms. Therefore, the data of each subgroup was compressed using its best suited algorithm. After comparing the compression ratios obtained for each data subgroup using different algorithms, the Lempel-Ziv-Markov chain algorithm (LZMA) was selected for the compression of the first two subgroups and the Deflate algorithm for the latter two subgroups. The compression ratios and decompression times obtained with the improved algorithm were compared with those obtained with commonly employed compression algorithms for SEG-Y files with different sizes. The experimental results show that the improved algorithm provides a compression ratio of 75-80%, which is more effective than compression algorithms presently applied to SEG-Y files. In addition, the proposed algorithm is applied to the miniSEED format used in natural earthquake monitoring, and the results compared with those obtained using the Steim2 compression algorithm, the results again show that the proposed algorithm provides better data compression.

  7. Real-space renormalization group flow in quantum impurity systems: Local moment formation and the Kondo screening cloud

    NASA Astrophysics Data System (ADS)

    Mitchell, Andrew K.; Becker, Michael; Bulla, Ralf

    2011-09-01

    The existence of a length scale ξK˜1/TK (with TK the Kondo temperature) has long been predicted in quantum impurity systems. At low temperatures T≪TK, the standard interpretation is that a spin-(1)/(2) impurity is screened by a surrounding “Kondo cloud” of spatial extent ξK. We argue that renormalization group (RG) flow between any two fixed points (FPs) results in a characteristic length scale, observed in real space as a crossover between physical behavior typical of each FP. In the simplest example of the Anderson impurity model, three FPs arise, and we show that “free orbital,” “local moment,” and “strong coupling” regions of space can be identified at zero temperature. These regions are separated by two crossover length scales ξLM and ξK, with the latter diverging as the Kondo effect is destroyed on increasing temperature through TK. One implication is that moment formation occurs inside the “Kondo cloud”, while the screening process itself occurs on flowing to the strong coupling FP at distances ˜ξK. Generic aspects of the real-space physics are exemplified by the two-channel Kondo model, where ξK now separates local moment and overscreening clouds.

  8. Translating group programmes into online formats: establishing the acceptability of a parents' sex and relationships communication serious game.

    PubMed

    Bayley, Julie E; Brown, Katherine E

    2015-12-09

    to feedback text volume. A manualised group programme can be viably converted into a serious game format which is both cognitively and emotionally acceptable. The intervention may be more effectively targeted at parents with younger children, and further game developments must particularly address information dosing. Establishing the viability of digitally converting a group programme is a significant step forward for implementation focused research.

  9. Explosive Lava-Water Interactions in Elysium Planitia, Mars: Constraints on the Formation of the Tartarus Colles Cone Groups

    NASA Astrophysics Data System (ADS)

    Hamilton, C. W.; Fagents, S. A.; Wilson, L.

    2009-12-01

    Volcanic rootless cones (VRCs) are typically generated by explosive molten fuel-coolant interactions (MFCIs) involving lava and groundwater. VRCs are significant in planetary environments because they imply the presence of active lava flows and an underlying volatile phase (e.g., groundwater or ice) at the time of cone formation. Rootless MFCIs require volatilization of groundwater before the core lava temperature descends below its solidus. Therefore, integrated geological mapping of VRC groups, age-dating of their host lava flow surfaces, and thermodynamic modeling of lava-permafrost interactions can provide constraints on where and when near-surface ground ice has been present in volcanic regions. This information is valuable for developing models of global climate change on Mars and for determining the relationships between climate and planetary volatile accretion, outgassing history, distribution of water and evolution of the hydrological cycle, abundance and stability of liquid water, surface weathering environments, and the development of environments that could support life. Photogeological mapping reveals that the Tartarus Colles Region, located in eastern Elysium Planitia (25-27°N, 170-171°E), Mars, includes >167 VRC groups ranging in area from <1 to 1258 km2 with a total area of 2014 km2. Crater size-frequency relationships suggest that the Tartarus Colles lava flow formed ~75-250 Ma ago. Within the Tartarus Colles Region, VRCs preferentially form where lava is >30 m thick. Based on the results of our thermodynamic modeling, we infer that VRCs did not form where the lava was <30 m thick because the upper 16-21 m of the substrate was partially desiccated. The common occurrence of VRCs in association with 30-60 m thick lava suggests that at the time of the cone-forming eruptions there was an ice table at <37 m depth. We therefore conclude that during the Late to Middle Amazonian a global cryosphere was present at mid-latitudes at a depth <37 m, but that

  10. Appendix: Final Update of the IAU Division A Commission 4 Working Group on Standardizing Access to Ephemerides and File Format Specification

    NASA Astrophysics Data System (ADS)

    Hilton, James L.; Acton, Charles; Arlot, Jean-Eudes; Bell, Steven A.; Capitaine, Nicole; Fienga, Agnès; Folkner, William M.; Gastineau, Mickaël; Pavlov, Dmitry; Pitjeva, Elena V.; Skripnichenko, Vladimir I.; Wallace, Patrick

    2016-04-01

    The IAU Commission 4 Working Group on Standardizing Access to Ephemerides recommends the use of the Spacecraft and Planet Kernel (SPK) format to provide a uniform format for the position ephemerides of planets and other natural solar system bodies, and the use of the Planetary Constants Kernel (PCK) for the orientation of these bodies. These formats are used by the SPICE system, developed by the Navigation and Ancillary Information Facility of NASA's Jet Propulsion Laboratory. The working group's final report is currently undergoing final preparations for publication. A long version of this report will be available at the IAU Commission 4: Ephemerides (or its successor) web site. This long version will contain a full description of that portion of the SPK and PCK formats required to duplicate these file types for this application.

  11. Barriers to Medication Decision Making in Women with Lupus Nephritis: A Formative Study using Nominal Group Technique.

    PubMed

    Singh, Jasvinder A; Qu, Haiyan; Yazdany, Jinoos; Chatham, Winn; Dall'era, Maria; Shewchuk, Richard M

    2015-09-01

    To assess the perspectives of women with lupus nephritis on barriers to medication decision making. We used the nominal group technique (NGT), a structured process to elicit ideas from participants, for a formative assessment. Eight NGT meetings were conducted in English and moderated by an expert NGT researcher at 2 medical centers. Participants responded to the question: "What sorts of things make it hard for people to decide to take the medicines that doctors prescribe for treating their lupus kidney disease?" Patients nominated, discussed, and prioritized barriers to decisional processes involving medications for treating lupus nephritis. Fifty-one women with lupus nephritis with a mean age of 40.6 ± 13.3 years and disease duration of 11.8 ± 8.3 years participated in 8 NGT meetings: 26 African Americans (4 panels), 13 Hispanics (2 panels), and 12 whites (2 panels). Of the participants, 36.5% had obtained at least a college degree and 55.8% needed some help in reading health materials. Of the 248 responses generated (range 19-37 responses/panel), 100 responses (40%) were perceived by patients as having relatively greater importance than other barriers in their own decision-making processes. The most salient perceived barriers, as indicated by percent-weighted votes assigned, were known/anticipated side effects (15.6%), medication expense/ability to afford medications (8.2%), and the fear that the medication could cause other diseases (7.8%). Women with lupus nephritis identified specific barriers to decisions related to medications. Information relevant to known/anticipated medication side effects and medication cost will form the basis of a patient guide for women with systemic lupus erythematosus, currently under development.

  12. Doubts about the crucial role of the rising-tube mechanism in the formation of sunspot groups

    NASA Astrophysics Data System (ADS)

    Getling, A. V.; Ishikawa, R.; Buchnev, A. A.

    2015-02-01

    Some preliminary processing results are presented for a dataset obtained with the Solar Optical Telescope on the Hinode satellite. The idea of the project is to record, nearly simultaneously, the full velocity and magnetic-field vectors in growing active regions and sunspot groups at a photospheric level. Our ultimate aim is to elaborate observational criteria to distinguish between the manifestations of two mechanisms of sunspot-group formation - the rising of an Ω -shaped flux tube of a strong magnetic field and the in situ amplification and structuring of magnetic field by convection (the convective mechanism is briefly described). Observations of a young bipolar subregion developing within AR 11313 were carried out on 9-10 October 2011. During each 2-h observational session, 5576-Å filtergrams and Dopplergrams were obtained at a time cadence of 2 min, and one or two 32-min-long spectropolarimetric fast-mode scans were done. Based on the series of filtergrams, the trajectories of corks are computed, using a technique similar to but more reliable than local correlation tracking (LCT), and compared with the magnetic maps. At this stage of the investigation, only the vertical magnetic field and the horizontal flows are used for a qualitative analysis. According to our preliminary findings, the velocity pattern in the growing active region has nothing to do with a spreading flow on the scale of the entire bipolar region, which could be expected if a tube of strong magnetic field emerged. No violent spreading flows on the scale of the entire growing magnetic region can be identified. Instead, normal mesogranular and supergranular flows are preserved. Signs of small-scale structuring of the magnetic field can be detected in the area where new spots develop, and signs of the presence of separatrices between the magnetic polarities can be found, such that the surface flows converge to but not diverge from these separatrix curves. The observed scenario of evolution

  13. In vitro effect of antibiotics on biofilm formation by Bacteroides fragilis group strains isolated from intestinal microbiota of dogs and their antimicrobial susceptibility.

    PubMed

    Silva, Janice Oliveira; Martins Reis, Ana Catarina; Quesada-Gómez, Carlos; Pinheiro, Adriana Queiroz; Freire, Rosemary Souza; Oriá, Reinaldo Barreto; de Carvalho, Cibele Barreto Mano

    2014-08-01

    The Bacteroides fragilis group strains colonize the intestinal tract of dogs as commensal bacteria. Nevertheless, they can be opportunistic pathogens responsible for significant morbidity and mortality rates in dogs, like in oral infections, abscesses and wound infections. The purpose of this study was to evaluate antimicrobial susceptibility in B. fragilis strains isolated from dogs intestinal microbiota and to evaluate the effect of subinhibitory concentrations of some antimicrobials on biofilm formation. A total of 30 B. fragilis group strains were tested for susceptibility to ten antimicrobial agents by broth microdilution method. Thirteen B. fragilis strains were tested for biofilm formation and the biofilm producer strains were chosen to evaluate the effect of subinhibitory concentrations of six antimicrobials on biofilm formation. The isolates were susceptible to amoxicillin-clavulanic acid, metronidazole, imipenem and chloramphenicol. Tetracycline and clindamycin were active against 50% and 33% of the strains, respectively. When biofilm-forming strains were grown in the presence of sub-MICs of imipenem and metronidazole, the inhibition of biofilm formation was observed. In contrast, enrofloxacin at ½ MIC caused a significant increase in biofilm formation in two of four strains examined. In conclusion, the B. fragilis group strains isolated were susceptible to most of the antimicrobials tested and the sub-MIC concentrations of imipenem, metronidazole and clindamycin were able to inhibit the biofilm formation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Few-cycle laser-pulse collapse in Kerr media: The role of group-velocity dispersion and X -wave formation

    NASA Astrophysics Data System (ADS)

    Faccio, Daniele; Clerici, Matteo; Averchi, Alessandro; Lotti, Antonio; Jedrkiewicz, Ottavia; Dubietis, Audrius; Tamosauskas, Gintaras; Couairon, Arnaud; Bragheri, Francesca; Papazoglou, Dimitris; Tzortzakis, Stelios; di Trapani, Paolo

    2008-09-01

    We study ultrashort laser-pulse propagation and filamentation dynamics in dispersive Kerr media. We identify the regime for which the filamentation threshold (Pth) is considerably higher than the critical power (Pcr) for monochromatic beam collapse in pure Kerr media. In particular, we compare the threshold for the formation of filaments with that for the formation of X -waves. At powers Pcrgroup-velocity dispersion, and no filaments or X -waves are formed. At P⩾Pth , we observe X -wave formation and a weak filamentation regime. At P≫Pth , we observe both X -waves and fully formed filaments.

  15. Correlation, sedimentology, structural setting, chemical composition, and provenance of selected formations in Mesoproterozoic Lemhi Group, central Idaho

    USGS Publications Warehouse

    Tysdal, Russell G.; Lindsey, David A.; Taggart, Joseph E.

    2003-01-01

    A unit of the Mesoproterozoic Apple Creek Formation of the Lemhi Range previously was correlated with part of the lower subunit of the Mesoproterozoic Yellowjacket Formation in the Salmon River Mountains. Strata currently assigned to the middle subunit of the Yellowjacket Formation lie conformably above the Apple Creek unit in the Salmon River Mountains, and are here renamed the banded siltite unit and reassigned to the Apple Creek Formation. Almost all of the banded siltite unit is preserved within the Salmon River Mountains, where it grades upward into clastic rocks that currently are assigned to the upper subunit of the Yellowjacket Formation and that here are reassigned to the Gunsight Formation. The banded siltite unit of the Apple Creek Formation is composed of a turbidite sequence, as recognized by previous workers. Uppermost strata of the unit were reworked by currents, possibly storm generated, and adjusted to a high water content by developing abundant soft-sediment deformation features. Basal strata of the overlying Gunsight Formation in the Salmon River Mountains display abundant hummocky crossbeds, storm-generated features deposited below fair-weather wave base, that are conformable above the storm-reworked deposits. The hummocky crossbedded strata grade upward into marine shoreface strata deposited above fair-weather wave base, which in turn are succeeded by fluvial strata. Hummocky and shoreface strata are absent from the Gunsight Formation in the Lemhi Range. The major thickness of the Gunsight Formation in both the Salmon River Mountains and the Lemhi Range is composed of fluvial rocks, transitional in the upper part into marine rocks of the Swauger Formation. The fluvial strata are mainly characterized by stacked sheets of metasandstone and coarse siltite; they are interpreted as deposits of braided rivers. The Poison Creek thrust fault of the Lemhi Range extends northwestward through the study area in the east-central part of the Salmon River

  16. The Carrancas Formation, Bambuí Group: A record of pre-Marinoan sedimentation on the southern São Francisco craton, Brazil

    NASA Astrophysics Data System (ADS)

    Uhlein, Gabriel J.; Uhlein, Alexandre; Halverson, Galen P.; Stevenson, Ross; Caxito, Fabrício A.; Cox, Grant M.; Carvalho, Jorge F. M. G.

    2016-11-01

    The Carrancas Formation outcrops in east-central Brazil on the southern margin of the São Francisco craton where it comprises the base of the late Neoproterozoic Bambuí Group. It is overlain by the basal Ediacaran cap carbonate Sete Lagoas Formation and was for a long time considered to be glacially influenced and correlative with the glaciogenic Jequitaí Formation. New stratigraphic, isotopic and geochronologic data imply that the Carrancas Formation was instead formed by the shedding of debris from basement highs uplifted during an episode of minor continental rifting. Reddish dolostones in the upper Carrancas Formation have δ13C values ranging from +7.1 to +9.6‰, which is a unique C isotopic composition for the lowermost Bambuí Group but similar to values found in the Tijucuçu sequence, a pre-glacial unit in the Araçuaí fold belt on the eastern margin of the São Francisco craton. The stratigraphic position below basal Ediacaran cap carbonates and the highly positive δ13C values together indicate a Cryogenian interglacial age for the Carrancas Formation, with the high δ13C values representing the so-called Keele peak, which precedes the pre-Marinoan Trezona negative δ13C excursion in other well characterized Cryogenian sequences. Hence, The Carrancas Formation pre-dates de Marinoan Jequitaí Formation and represents an interval of Cryogenian stratigraphy not previously known to occur on the southern margin of São Francicso craton. Documentation of Cryogenian interglacial strata on the São Francisco craton reinforces recent revisions to the age of Bambuí Group strata and has implications for the development of the Bambuí basin.

  17. A Search for Triggered Star Formation in the Compact Group of Galaxies NGC 5851, NGC 5852 and CGCG 077-007

    NASA Astrophysics Data System (ADS)

    Olsen, Charlotte Alexandra; Basu-Zych, Antara; Hornschemeier, Ann E.; NASA / GSFC X-ray Galaxies Group

    2017-01-01

    Galaxy interactions provide ideal conditions for triggering star formation, and impact galaxy evolution and the structure of the universe. The aim of this research is to study the key factors during galaxy interactions that influence star formation events by studying close pairs of galaxies to find the relationship between interaction properties (e.g. relative velocities and distances, mass ratios, orientation, and merger stage) and star formation rate (SFR). We present our analysis on one compact group of star-forming galaxies CGCG 077-007, NGC 5851, and their quiescent companion NGC 5852. Within this group we investigate the conditions where galaxy interactions cause higher SFR or supermassive black hole accretion (i.e. AGN activity), which might rather quench SFR. Areas of increased star formation are classified by the identification of the most UV bright regions within the galaxies. We find these areas by taking the Swift UVOT W2 filter and subtracting from it the Sloan Digital Sky Survey (SDSS) z-band image in order to remove the underlying stellar population. The regions identified by this process allow us to conduct a multi-wavelength study of stellar populations within this compact group. We use Spectral Energy Distribution models to fit ultraviolet to mid-infrared photometry from Swift UVOT, SDSS, 2MASS and WISE and measure global star formation histories for the galaxies and for the identified star forming regions within the galaxies. In the future we will include analysis of Swift XRT data to place constraints on AGN activity, and relate to the star formation history. This group serves as a pilot study and we will apply these methods to a sample of 30 galaxy groups and close pairs in order to investigate the relationship between galaxy interactions, SFR, and AGN activity and gain deeper insight into how mergers drive galaxy evolution.

  18. The Star Formation Histories of Local Group Dwarf Galaxies. III. Characterizing Quenching in Low-mass Galaxies

    NASA Astrophysics Data System (ADS)

    Weisz, Daniel R.; Dolphin, Andrew E.; Skillman, Evan D.; Holtzman, Jon; Gilbert, Karoline M.; Dalcanton, Julianne J.; Williams, Benjamin F.

    2015-05-01

    We explore the quenching of low-mass galaxies (104 ≲ {{M}\\star } ≲ 108 {{M}⊙ }) as a function of lookback time using the star formation histories (SFHs) of 38 Local Group dwarf galaxies. The SFHs were derived by analyzing color-magnitude diagrams of resolved stellar populations in archival Hubble Space Telescope/Wide Field Planetary Camera 2 imaging. We find: (1) lower-mass galaxies quench earlier than higher-mass galaxies; (2) inside of Rvirial there is no correlation between a satellite’s current proximity to a massive host and its quenching epoch; and (3) there are hints of systematic differences in the quenching times of M31 and Milky Way (MW) satellites, although the sample size and uncertainties in the SFHs of M31 dwarfs prohibit definitive conclusions. Combined with results from the literature, we qualitatively consider the redshift evolution (z = 0-1) of the quenched galaxy fraction over ˜7 dex in stellar mass (104 ≲ {{M}\\star } ≲ 1011.5 {{M}⊙ }). The quenched fraction of all galaxies generally increases toward the present, with both the lowest and highest-mass systems exhibiting the largest quenched fractions at all redshifts. In contrast, galaxies between {{M}\\star } ˜ 108-1010 {{M}⊙ } have the lowest quenched fractions. We suggest that such intermediate-mass galaxies are the least efficient at quenching. Finally, we compare our quenching times with predictions for infall times for low-mass galaxies associated with the MW. We find that some of the lowest-mass satellites (e.g., CVn II, Leo IV) may have been quenched before infall, while higher-mass satellites (e.g., Leo I, Fornax) typically quench ˜1-4 Gyr after infall. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained from the Data Archive at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA constract NAS 5-26555.

  19. Formation of Monolayers by the Coadsorption of Thiols on Gold: Variation in the Length of the Head Group, Tail Group, and Solvent

    DTIC Science & Technology

    1989-05-01

    oleophobic monolayer) and the other by a polar or polarizable group (yielding a hydrophilic or oleophilic monolayer). In these systems the contact...particular mechanism, and we prefer not to speculate further. Experimental Section Materials . Ethanol (U.S. Industrials Co.) was deoxygenated with nitrogen...8217 solution reacts violently with most organic materials and must be handled with extreme care. Adsorption solutions containing two thiols were prepared in

  20. [Mechanisms in group formation and cohesion in Tupaia glis Diard, 1820. Results of long-term studies of a family group].

    PubMed

    Richarz, K

    1979-10-01

    In long-term studies of a family group, all the partner-orientated interactions are quantitatively registered and analysed in connection with the usuage of space by the animals. From this, the connections between the interactions and respectively status forms of the group members are recognizable. During the growing-up period of the juveniles in the group, beginning with the first leaving of the nest box at the age of about 33 days, three phases can be differentiated. A phase of "integration" of about 5 to 8 days, in which the behavior patterns between adults and juveniles are polarized on licking mouth with the adults and scent marking the juveniles, is obviously the presupposition for including the rising generation in the relational system (including the space system) of the adults. This phase is followed by a "neutral phase", lasting about 30 days, during which the juveniles stand in connection with the adults by means of a space bonding, in which relatively few interactions occur. Through the joint use of parental resting places and through the resting in close spatial neighbourhood, a true retention of experience for the juveniles must be thought of. At the age of about 60 days an 'ambivalent phase" begins, in which the contacts between parents and the offspring increases again, with an alteration and a superposition of sexual and agonistic interactions. Besides, the sex-specific differences become recognizable: the male interacts with his daughters increasingly sexually, with the sons he is more and more aggressive; the relations of the mother with the female offspring are ambivalent, during which she shows male behaviour patterns and with her sons the female scarcely has contact. Lying in bodily contact has, beyond the importance for a pair bonding, significance for a group bonding. Licking the mouth as an element of the care system (infantile behavior) can be used as an appeasement gesture. The age of 90--100 days, in which the parents frequently have

  1. THE NATURE OF STAR FORMATION AT 24 {mu}m IN THE GROUP ENVIRONMENT AT 0.3 {approx}< z {approx}< 0.55

    SciTech Connect

    Tyler, K. D.; Rieke, G. H.; Shi, Y.; Wilman, D. J.; Pierini, D.; McGee, S. L.; Bower, R. G.; Bai, L.; Mulchaey, J. S.; Parker, L. C.

    2011-09-01

    Galaxy star formation rates (SFRs) are sensitive to the local environment; for example, the high-density regions at the cores of dense clusters are known to suppress star formation. It has been suggested that galaxy transformation occurs largely in groups, which are the intermediate step in density between field and cluster environments. In this paper, we use deep MIPS 24 {mu}m observations of intermediate-redshift (0.3 {approx}< z {approx}< 0.55) group and field galaxies from the Group Environment and Evolution Collaboration (GEEC) subset of the Second Canadian Network for Observational Cosmology (CNOC2) survey to probe the moderate-density environment of groups, wherein the majority of galaxies are found. The completeness limit of our study is log (L{sub TIR}(L{sub sun})) {approx}> 10.5, corresponding to SFR {approx}>2.7 M{sub sun} yr{sup -1}. We find that the group and field galaxies have different distributions of morphologies and mass. However, individual group galaxies have star-forming properties comparable to those of field galaxies of similar mass and morphology; that is, the group environment does not appear to modify the properties of these galaxies directly. There is a relatively large number of massive early-type group spirals, along with E/S0 galaxies, that are forming stars above our detection limit. These galaxies account for the nearly comparable level of star-forming activity in groups as compared with the field, despite the differences in mass and morphology distributions between the two environments. The distribution of specific SFRs (SFR/M{sub *}) is shifted to lower values in the groups, reflecting the fact that groups contain a higher proportion of massive and less active galaxies. Considering the distributions of morphology, mass, and SFR, the group members appear to lie between field and cluster galaxies in overall properties.

  2. Data Collection Design for Equivalent Groups Equating: Using a Matrix Stratification Framework for Mixed-Format Assessment

    ERIC Educational Resources Information Center

    Mbella, Kinge Keka

    2012-01-01

    Mixed-format assessments are increasingly being used in large scale standardized assessments to measure a continuum of skills ranging from basic recall to higher order thinking skills. These assessments are usually comprised of a combination of (a) multiple-choice items which can be efficiently scored, have stable psychometric properties, and…

  3. Formative Assessment: Using Concept Cartoon, Pupils' Drawings, and Group Discussions to Tackle Children's Ideas about Biological Inheritance

    ERIC Educational Resources Information Center

    Chin, Christine; Teou, Lay-Yen

    2010-01-01

    This study was carried out in the context of formative assessment where assessment and learning were integrated to enhance both teaching and learning. The purpose of the study was to: (a) identify pupils' ideas about biological inheritance through the use of a concept cartoon, pupils' drawings and talk, and (b) devise scaffolding structures that…

  4. Formative Assessment: Using Concept Cartoon, Pupils' Drawings, and Group Discussions to Tackle Children's Ideas about Biological Inheritance

    ERIC Educational Resources Information Center

    Chin, Christine; Teou, Lay-Yen

    2010-01-01

    This study was carried out in the context of formative assessment where assessment and learning were integrated to enhance both teaching and learning. The purpose of the study was to: (a) identify pupils' ideas about biological inheritance through the use of a concept cartoon, pupils' drawings and talk, and (b) devise scaffolding structures that…

  5. Evidence for inter- and intraspecies biofilm formation variability among a small group of coagulase-negative staphylococci.

    PubMed

    Oliveira, Fernando; Lima, Cláudia Afonso; Brás, Susana; França, Ângela; Cerca, Nuno

    2015-10-01

    Coagulase-negative staphylococci (CoNS) are common bacterial colonizers of the human skin. They are often involved in nosocomial infections due to biofilm formation in indwelling medical devices. While biofilm formation has been extensively studied in Staphylococcus epidermidis, little is known regarding other CoNS species. Here, biofilms from six different CoNS species were characterized in terms of biofilm composition and architecture. Interestingly, the ability to form a thick biofilm was not associated with any particular species, and high variability on biofilm accumulation was found within the same species. Cell viability assays also revealed different proportions of live and dead cells within biofilms formed by different species, although this parameter was particularly similar at the intraspecies level. On the other hand, biofilm disruption assays demonstrated important inter- and intraspecies differences regarding extracellular matrix composition. Lastly, confocal laser scanning microscopy experiments confirmed this variability, highlighting important differences and common features of CoNS biofilms. We hypothesized that the biofilm formation heterogeneity observed was rather associated with biofilm matrix composition than with cells themselves. Additionally, our results indicate that polysaccharides, DNA and proteins are fundamental pieces in the process of CoNS biofilm formation.

  6. Identity Formation in Early and Middle Adolescents from Various Ethnic Groups: From Three Dimensions to Five Statuses

    ERIC Educational Resources Information Center

    Crocetti, Elisabetta; Rubini, Monica; Luyckx, Koen; Meeus, Wim

    2008-01-01

    We used three identity processes (i.e., commitment, in-depth exploration, and reconsideration of commitment) from a recently developed model of identity formation to derive empirically identity statuses in a sample of 1952 early and middle adolescents. By means of cluster analysis, we identified five statuses: achievement, foreclosure, moratorium,…

  7. Data Collection Design for Equivalent Groups Equating: Using a Matrix Stratification Framework for Mixed-Format Assessment

    ERIC Educational Resources Information Center

    Mbella, Kinge Keka

    2012-01-01

    Mixed-format assessments are increasingly being used in large scale standardized assessments to measure a continuum of skills ranging from basic recall to higher order thinking skills. These assessments are usually comprised of a combination of (a) multiple-choice items which can be efficiently scored, have stable psychometric properties, and…

  8. Knowing what to think by knowing who you are: self-categorization and the nature of norm formation, conformity and group polarization.

    PubMed

    Abrams, D; Wetherell, M; Cochrane, S; Hogg, M A; Turner, J C

    1990-06-01

    We contrast two theoretical approaches to social influence, one stressing interpersonal dependence, conceptualized as normative and informational influence (Deutsch & Gerard, 1955), and the other stressing group membership, conceptualized as self-categorization and referent informational influence (Turner, Hogg, Oakes, Reicher & Wetherell, 1987). We argue that both social comparisons to reduce uncertainty and the existence of normative pressure to comply depend on perceiving the source of influence as belonging to one's own category. This study tested these two approaches using three influence paradigms. First we demonstrate that, in Sherif's (1936) autokinetic effect paradigm, the impact of confederates on the formation of a norm decreases as their membership of a different category is made more salient to subjects. Second, in the Asch (1956) conformity paradigm, surveillance effectively exerts normative pressure if done by an in-group but not by an out-group. In-group influence decreases and out-group influence increases when subjects respond privately. Self-report data indicate that in-group confederates create more subjective uncertainty than out-group confederates and public responding seems to increase cohesiveness with in-group - but decrease it with out-group - sources of influence. In our third experiment we use the group polarization paradigm (e.g. Burnstein & Vinokur, 1973) to demonstrate that, when categorical differences between two subgroups within a discussion group are made salient, convergence of opinion between the subgroups is inhibited. Taken together the experiments show that self-categorization can be a crucial determining factor in social influence.

  9. Dynamics of the accumulation process of the Earth group of planets: Formation of the reverse rotation of Venus

    NASA Technical Reports Server (NTRS)

    Koslov, N. N.; Eneyev, T. M.

    1979-01-01

    A numerical simulation of the process of formation of the terrestrial planets is carried within the framework of a new theory for the accumulation of planetary and satellite systems. The numerical simulation permitted determining the parameters of the protoplanetary disk from which Mercury, Venus and the Earth were formed as result of the evolution. The acquisition of a slow retrograde rotation for Venus was discovered during the course of the investigation, whereas Mercury and the Earth acquired direct rotation about their axes. Deviations of the semimajor axes of these three planets as well as the masses of the Earth and Venus from the true values are small as a rule (l 10%). It is shown that during the accumulation of the terrestrial planets, there existed a profound relationship between the process of formation of the orbits and masses of the planet and the process of formation of their rotation about their axes. Estimates are presented for the radii of the initial effective bodies and the time of evolution for the terrestrial accumulation zone.

  10. Submillimeter continuum emission from galaxies - Star formation and the interstellar medium in the local group dwarf IC 10

    SciTech Connect

    Thronson, H.A. Jr.; Hunter, D.A.; Casey, S.; Harper, D.A. Lowell Observatory, Flagstaff, AZ Yerkes Observatory, Williams Bay, WI )

    1990-05-01

    Far-infrared (95 and 160 micron) maps and visual broad-band and line images of the nearby, luminous irregular galaxy IC 10 are discussed. Observations of the dust emission make it possible to constrain the total mass of gas and the rate of star formation derived for the galaxy. The total star-formation rate is estimated to be about 0.15 solar mass/yr, and the e-folding time for exhaustion of the interstellar gas due to the star formation is only a few billion years. To determine the source of the cool dust in emission at approximately 100-250 microns from many galaxies, 60, 100, and 160 micron photometry, obtained previously, is compared; and CO, H I, and dust emission is correlated. Based on the correlation between the various cool components of the interstellar medium, it is concluded that the likely location of the dust that dominates the emission at about 160, and possibly 100, microns is within both the diffuse atomic gas and in surface layers of molecular clouds. 57 refs.

  11. Petrologic and isotopic data from the Cretaceous (Campanian) Blackhawk Formation and Star Point Sandstone (Mesaverde Group), Wasatch Plateau, Utah

    USGS Publications Warehouse

    Fishman, Neil S.; Turner, Christine E.; Peterson, Fred

    2013-01-01

    The presence of discrete minerals associated with coal—whether (1) detrital or authigenic constituents of the coals or in thin mudstone or siltstone units interbedded with coals, or (2) authigenic phases that formed along cleats—might influence its utilization as an energy resource. The build-up of sintered ash deposits on the surfaces of heat exchangers in coal-fired power plants, due to the alteration of minerals during combustion of the coal, can seriously affect the functioning of the boiler and enhance corrosion of combustion equipment. In particular, the presence of sodium in coals has been considered a key factor in the fouling of boilers; however, other elements (such as calcium or magnesium) and the amount of discrete minerals burned with coal can also play a significant role in the inefficiency of and damage to boilers. Previous studies of the quality of coals in the Cretaceous (Campanian) Blackhawk Formation of the Wasatch Plateau, Utah, revealed that the sodium content of the coals varied across the region. To better understand the origin and distribution of sodium in these coals, petrologic studies were undertaken within a sedimentological framework to evaluate the timing and geochemical constraints on the emplacement of sodium-bearing minerals, particularly analcime, which previously had been identified in coals in the Blackhawk Formation. Further, the study was broadened to include not just coals in the Blackhawk Formation from various localities across the Wasatch Plateau, but also sandstones interbedded with the coals as well as sandstones in the underlying Star Point Sandstone. The alteration history of the sandstones in both formations was considered a key component of this study because it records the nature and timing of fluids passing through them and the associated precipitation of sodium-bearing minerals; thus, the alteration history could place constraints on the distribution and timing of sodium mineralization in the interbedded or

  12. Formation of Pickering emulsions stabilized via interaction between nanoparticles dispersed in aqueous phase and polymer end groups dissolved in oil phase.

    PubMed

    Okada, Masahiro; Maeda, Hayata; Fujii, Syuji; Nakamura, Yoshinobu; Furuzono, Tsutomu

    2012-06-26

    The influence of end groups of a polymer dissolved in an oil phase on the formation of a Pickering-type hydroxyapatite (HAp) nanoparticle-stabilized emulsion and on the morphology of HAp nanoparticle-coated microspheres prepared by evaporating solvent from the emulsion was investigated. Polystyrene (PS) molecules with varying end groups and molecular weights were used as model polymers. Although HAp nanoparticles alone could not function as a particulate emulsifier for stabilizing dichloromethane (oil) droplets, oil droplets could be stabilized with the aid of carboxyl end groups of the polymers dissolved in the oil phase. Lower-molecular-weight PS molecules containing carboxyl end groups formed small droplets and deflated microspheres, due to the higher concentration of carboxyl groups on the droplet/microsphere surface and hence stronger adsorption of the nanoparticles at the water/oil interface. In addition, Pickering-type suspension polymerization of styrene droplets stabilized by PS molecules containing carboxyl end groups successfully led to the formation of spherical HAp-coated microspheres.

  13. The group A3 chondrules of Krymka: Further evidence for major evaporative loss during the formation of chondrules

    NASA Technical Reports Server (NTRS)

    Huang, S.; Benoit, P. H.; Sears, D. W. G.

    1993-01-01

    Like Semarkona (type 3.0), Krymka (type 3.1) contains two distinct types of chondrule (namely groups A and B) which differ in their bulk compositions, phase compositions, and CL properties. The group A chondrules in both meteorites show evidence for major loss of material by evaporation(i.e. elemental abundance patterns, size, redox state, olivine-pyroxene abundances). Group A and B chondrules probably formed from common or very similar precursors by the same processes acting with different intensities, group A suffering greater mass-loss by evaporation and reduction of FeO and SiO2. While Krymka chondrules share many primary mineralogical and compositional properties with Semarkona chondrules, the minimal metamorphism it has suffered has also had a significant effect on its chondrules.

  14. A randomized trial of individual versus group-format exercise and self-management in individuals with Parkinson's disease and comorbid depression.

    PubMed

    Sajatovic, Martha; Ridgel, Angela L; Walter, Ellen M; Tatsuoka, Curtis M; Colón-Zimmermann, Kari; Ramsey, Riane K; Welter, Elisabeth; Gunzler, Steven A; Whitney, Christina M; Walter, Benjamin L

    2017-01-01

    Depression is common in people with Parkinson's disease (PD), and exercise is known to improve depression and PD. However, lack of motivation and low self-efficacy can make exercise difficult for people with PD and comorbid depression (PD-Dep). A combined group exercise and chronic disease self-management (CDSM) program may improve the likeli-hood that individuals will engage in exercise and will show a reduction in depression symptoms. The purpose of this study was to compare changes in depression in PD-Dep between individual versus group exercise plus CDSM and to examine participant adherence and perception of the interventions. Participants (N=30) were randomized to either Enhanced EXerCisE thErapy for PD (EXCEED; group CDSM and exercise) or self-guided CDSM plus exercise. Outcomes were change in depression assessed with the Montgomery-Asberg Depression Rating Scale (MADRS), cognition, apathy, anxiety, sleep, quality of life, motor function, self-efficacy, and patient satisfaction. Both groups showed significant improvement in MADRS (P<0.001) with no significant group difference. Individuals in EXCEED group enjoyed the group dynamics but noted difficulty with the fixed-time sessions. Both group CDSM plus exercise and self-guided CDSM plus exercise can improve depression in PD-Dep. These findings suggest that development of a remotely delivered group-based CDSM format plus manualized exercise program could be useful for this population.

  15. Professional identity formation in the transition from medical school to working life: a qualitative study of group-coaching courses for junior doctors.

    PubMed

    de Lasson, Lydia; Just, Eva; Stegeager, Nikolaj; Malling, Bente

    2016-06-24

    The transition from student to medical doctor is challenging and stressful to many junior doctors. To practice with confidence and professionalism the junior doctors have to develop a strong professional identity. Various suggestions on how to facilitate formation of professional identity have been offered including the possible positive effect of group-coaching courses. The purpose of this study was to explore how group-coaching might facilitate professional identity formation among junior doctors in the transition period. Group-coaching courses comprising three whole-day sessions and five 2 h sessions during a period of 4 months were offered to junior doctors in the first years after graduation. The purpose was to support the participants' professional development, ability to relate to patients, relatives and staff and career development. The coaches in this study had a background as health professionals combined with coaching educations. Data was obtained through observations, open-ended questionnaires and interviews. A generic thematic analysis was applied. Forty-five doctors participated in six coaching groups. The three main themes emerging in the sessions were: Adoption to medical culture, career planning, and work/life-balance. The junior doctors found the coaching intervention highly useful in order to cope with these challenges. Furthermore, the group was a forum where the junior doctors could share thoughts and feelings with colleagues without being afraid that this would endanger their professional career. Many found new ways to respond to everyday challenges mainly through a new awareness of patterns of thinking and feeling. The participants found that the group-coaching course supported their professional identity formation (thinking, feeling and acting as a doctor), adoption to medical culture, career planning and managing a healthy work/life-balance. Further studies in different contexts are recommended as well as studies using other methods to

  16. Diverse microbially induced sedimentary structures from 1 Ga lakes of the Diabaig Formation, Torridon Group, northwest Scotland

    NASA Astrophysics Data System (ADS)

    Callow, Richard H. T.; Battison, Leila; Brasier, Martin D.

    2011-08-01

    The siliciclastic lacustrine rocks of the ~ 1000 Ma Diabaig Formation, northwest Scotland, contain a remarkable diversity of macroscopic structures on bedding planes that can be compared with various kinds of microbially induced sedimentary structures (MISS). Field sedimentological investigations, combined with laboratory analysis of bedding planes and petrographic study of thin sections have allowed us to characterise a range of depositional environments and document the spectrum of biological structures. MISS are reported from frequently subaerial environments, through commonly submerged facies, and down to permanently sub-wavebase settings. Palaeoenvironmental conditions (water depth, exposure, hydrodynamic energy) control the distribution of MISS within these facies. This demonstrates that mat-forming microbial communities were arguably well adapted to low light levels or periodic exposure. Some MISS from the Diabaig Formation are typical of Precambrian microbial mats, including reticulate fabrics and 'old elephant skin' textures. In addition to these, a number of new and unusual fabrics of putative microbial origin are described, including linear arrays of ridges and grooves (cf. 'Arumberia') and discoidal structures that are comparable with younger Ediacaran fossils such as Beltanelliformis. These observations indicate that benthic microbial ecosystems were thriving in freshwater lake systems ~ 1000 Ma, and indicate how microbially induced sedimentary structures may be applied as facies indicators for Proterozoic lacustrine environments. The discovery of structures closely resembling Ediacaran fossils (cf. Beltanelliformis) also serves to highlight the difficulty of interpreting simple discoidal bedding plane structures as metazoan fossils.

  17. Controlling the Formation of Ionic-Liquid-based Aqueous Biphasic Systems by Changing the Hydrogen-Bonding Ability of Polyethylene Glycol End Groups.

    PubMed

    Pereira, Jorge F B; Kurnia, Kiki A; Freire, Mara G; Coutinho, João A P; Rogers, Robin D

    2015-07-20

    The formation of aqueous biphasic systems (ABS) when mixing aqueous solutions of polyethylene glycol (PEG) and an ionic liquid (IL) can be controlled by modifying the hydrogen-bond-donating/-accepting ability of the polymer end groups. It is shown that the miscibility/immiscibility in these systems stems from both the solvation of the ether groups in the oxygen chain and the ability of the PEG terminal groups to preferably hydrogen bond with water or the anion of the salt. The removal of even one hydrogen bond in PEG can noticeably affect the phase behavior, especially in the region of the phase diagram in which all the ethylene oxide (EO) units of the polymeric chain are completely solvated. In this region, removing or weakening the hydrogen-bond-donating ability of PEG results in greater immiscibility, and thus, in a higher ability to form ABS, as a result of the much weaker interactions between the IL anion and the PEG end groups.

  18. A discussion group program enhances the conceptual reasoning skills of students enrolled in a large lecture-format introductory biology course.

    PubMed

    Peteroy-Kelly, Marcy A

    2007-01-01

    It has been well-established that discussion groups enhance student learning in large lecture courses. The goal of this study was to determine the impact of a discussion group program on the development of conceptual reasoning skills of students enrolled in a large lecture-format introductory biology course. In the discussion group, students worked on problems based on topics discussed in lecture. The program was evaluated using three assessment tools. First, student responses to pre- and posttests were analyzed. The test question asked the students to demonstrate the relationships between 10 different but related terms. Use of a concept map to link the terms indicated an advanced level of conceptual reasoning skills. There was a 13.8% increase in the use of concept maps from pre- to posttest. Second, the students took a Likert-type survey to determine the perceived impact of the program on their conceptual reasoning skills. Many of the students felt that the program helped them understand and use the main course concepts to logically solve problems. Finally, average exam grades increased as the semester progressed. The average final grade in the course was 75%. Students enrolled in the course the previous year (where the lecture component of the course did not assess or reflect student learning in the discussion group) had an average final grade of 69%. The results of this study demonstrate that the discussion group program improves the conceptual reasoning skills of students enrolled in a large lecture-format introductory biology course.

  19. Do not aim too high nor too low: Moderate expectation-based group formation promotes public cooperation on networks

    NASA Astrophysics Data System (ADS)

    Wang, Xiaofeng; Wu, Te; Wang, Long

    2014-09-01

    We propose a public goods game model wherein individuals can adaptively adjust their social ties. Individuals have expectation towards the groups they are involved in. They drop out of these groups which do not satisfy their expectation and explore some new ones in the evolutionary process. The time scale ratio of natural selection to interaction determines how fast interaction happens relatively to selection. The results show that cooperation is greatly enhanced when interaction happens quickly. Furthermore, we find that there exists an optimal interval of intermediate expectation level most favoring cooperation. Robustness of the results has been checked by means of an extended model, where individuals' expectation is subject to evolution as well.

  20. Observations From Practice: Support Group Membership as a Process of Social Capital Formation Among Female Survivors of Domestic Violence

    ERIC Educational Resources Information Center

    Larance, Lisa Young; Porter, Maryann Lane

    2004-01-01

    This article explores the authors' practice observations of female domestic violence survivors' journey from first agency contact to active participation in a support group process. The authors have witnessed female victims of domestic violence challenging the social isolation imposed by their dominant partners as they search for meaning in their…

  1. The elusive concept of 'internal objects' (1934-1943). Its role in the formation of the Klein Group.

    PubMed

    Hinshelwood, R D

    1997-10-01

    The author traces a debate about the concept of 'internal objects' that took place between 1937 and 1943 at a time when a group of British analysts was forming around Melanie Klein. The debate is set within a complex of personal, group and organisational dynamics, which the paper makes a start on unravelling. The history of the British Psycho-Analytical Society at this time exemplifies Bion's notion of group schism. The events in the Society's history demonstrate defensive aspects of the interaction between the opposed groups, which support members against various anxieties. These include the stress of the work of analysis, but also in this instance the particular anxieties deriving from the collapse of psychoanalysis in Europe, the state of war of the country as a whole, and the death of Freud shortly after he came to London. This psychoanalytic anxiety/defence model clarifies some aspects of the debate about internal objects, and demonstrates the way in which these various anxieties and defences become organised around a scientific debate in a scientific society.

  2. Identifying priorities to improve maternal and child nutrition among the Khmu ethnic group, Laos: a formative study.

    PubMed

    de Sa, Joia; Bouttasing, Namthipkesone; Sampson, Louise; Perks, Carol; Osrin, David; Prost, Audrey

    2013-10-01

    Chronic malnutrition in children remains highly prevalent in Laos, particularly among ethnic minority groups. There is limited knowledge of specific nutrition practices among these groups. We explored nutritional status, cultural beliefs and practices of Laos' Khmu ethnic group to inform interventions for undernutrition as part of a Primary Health Care (PHC) project. Mixed methods were used. For background, we disaggregated anthropometric and behavioural indicators from Laos' Multiple Indicator Cluster Survey. We then conducted eight focus group discussions and 33 semi-structured interviews with Khmu villagers and health care workers, exploring beliefs and practices related to nutrition. The setting was two rural districts in Luang Prabang province, in one of which the PHC project had been established for 3 years. There was a higher prevalence of stunting in the Khmu than in other groups. Disaggregation showed nutrition behaviours were associated with ethnicity, including exclusive breastfeeding. Villagers described strong adherence to post-partum food restrictions for women, while little change was described in intake during pregnancy. Most children were breastfed, although early introduction of pre-lacteal foods was noted in the non-PHC district. There was widespread variation in introduction and diversity of complementary foods. Guidance came predominantly from the community, with some input from health care workers. Interventions to address undernutrition in Khmu communities should deliver clear, consistent messages on optimum nutrition behaviours. Emphasis should be placed on dietary diversity for pregnant and post-partum mothers, encouraging exclusive breastfeeding and timely, appropriate complementary feeding. The impact of wider governmental policies on food security needs to be further assessed.

  3. Identifying priorities to improve maternal and child nutrition among the Khmu ethnic group, Laos: a formative study

    PubMed Central

    de Sa, Joia; Bouttasing, Namthipkesone; Sampson, Louise; Perks, Carol; Osrin, David; Prost, Audrey

    2013-01-01

    Chronic malnutrition in children remains highly prevalent in Laos, particularly among ethnic minority groups. There is limited knowledge of specific nutrition practices among these groups. We explored nutritional status, cultural beliefs and practices of Laos' Khmu ethnic group to inform interventions for undernutrition as part of a Primary Health Care (PHC) project. Mixed methods were used. For background, we disaggregated anthropometric and behavioural indicators from Laos' Multiple Indicator Cluster Survey. We then conducted eight focus group discussions and 33 semi-structured interviews with Khmu villagers and health care workers, exploring beliefs and practices related to nutrition. The setting was two rural districts in Luang Prabang province, in one of which the PHC project had been established for 3 years. There was a higher prevalence of stunting in the Khmu than in other groups. Disaggregation showed nutrition behaviours were associated with ethnicity, including exclusive breastfeeding. Villagers described strong adherence to post-partum food restrictions for women, while little change was described in intake during pregnancy. Most children were breastfed, although early introduction of pre-lacteal foods was noted in the non-PHC district. There was widespread variation in introduction and diversity of complementary foods. Guidance came predominantly from the community, with some input from health care workers. Interventions to address undernutrition in Khmu communities should deliver clear, consistent messages on optimum nutrition behaviours. Emphasis should be placed on dietary diversity for pregnant and post-partum mothers, encouraging exclusive breastfeeding and timely, appropriate complementary feeding. The impact of wider governmental policies on food security needs to be further assessed. PMID:22515273

  4. Compounds of tin(IV) - catalysts of amide formation. Effect of temperature and nature of leaving group

    SciTech Connect

    Oleinik, N.M.; Garkusha-Bozhko, I.P.; Usanova, I.V.

    1988-09-20

    The effect of substitution of the ester oxygen atom by sulfur in p-nitrophenyl acetate on its aminolysis rate with benzylamine in beneze at 25/degree/C in the presence of dibutyltin dibenzoate as catalyst was studied. Such substitution leads to a decrease in the catalytic activity by approximately a half, and this is explained by the smaller capacity of the sulfur atom for the formation of hydrogen bonds. The effect of temperature on the rate of the reaction of N-benzyl-oxycarbonylglycine p-nitrophenyl ester with glycine tert-butyl ester in benzene in the presence of dibutyltin dibenzoate was also investigated in the range of 10-50/degree/C. The Arrhenius equation is not fulfilled in this case. The obtained facts demonstrate the multistage character of the catalytic reaction and do not contradict the authors previously proposed bifunctional mechanism of catalysis by tin(IV) compounds.

  5. Some Like it Hot: Linking Diffuse X-Ray Luminosity, Baryonic Mass, and Star Formation Rate in Compact Groups of Galaxies

    NASA Technical Reports Server (NTRS)

    Desjardins, Tyler D.; Gallagher, Sarah C.; Hornschemeier, Ann E.; Mulchaey, John S.; Walker, Lisa May; Brandt, Willian N.; Charlton, Jane C.; Johnson, Kelsey E.; Tzanavaris, Panayiotis

    2014-01-01

    We present an analysis of the diffuse X-ray emission in 19 compact groups (CGs) of galaxies observed with Chandra. The hottest, most X-ray luminous CGs agree well with the galaxy cluster X-ray scaling relations in L(x-T) and (L(x-sigma), even in CGs where the hot gas is associated with only the brightest galaxy. Using Spitzer photometry, we compute stellar masses and classify Hickson CGs 19, 22, 40, and 42, and RSCGs 32, 44, and 86 as fossil groups using a new definition for fossil systems that includes a broader range of masses. We find that CGs with total stellar and Hi masses are great than or equal to 10(sup (11.3) solar mass are often X-ray luminous, while lower-mass CGs only sometimes exhibit faint, localized X-ray emission. Additionally, we compare the diffuse X-ray luminosity against both the total UV and 24 micron star formation rates of each CG and optical colors of the most massive galaxy in each of the CGs. The most X-ray luminous CGs have the lowest star formation rates, likely because there is no cold gas available for star formation, either because the majority of the baryons in these CGs are in stars or the X-ray halo, or due togas stripping from the galaxies in CGs with hot halos. Finally, the optical colors that trace recent star formation histories of the most massive group galaxies do not correlate with the X-ray luminosities of the CGs, indicating that perhaps the current state of the X-ray halos is independent of the recent history of stellar mass assembly in the most massive galaxies.

  6. Some like it hot: Linking diffuse X-ray luminosity, baryonic mass, and star formation rate in compact groups of galaxies

    SciTech Connect

    Desjardins, Tyler D.; Gallagher, Sarah C.; Hornschemeier, Ann E.; Tzanavaris, Panayiotis; Walker, Lisa May; Johnson, Kelsey E.; Brandt, William N.; Charlton, Jane C.

    2014-08-01

    We present an analysis of the diffuse X-ray emission in 19 compact groups (CGs) of galaxies observed with Chandra. The hottest, most X-ray luminous CGs agree well with the galaxy cluster X-ray scaling relations in L{sub X} -T and L{sub X} -σ, even in CGs where the hot gas is associated with only the brightest galaxy. Using Spitzer photometry, we compute stellar masses and classify Hickson CGs 19, 22, 40, and 42, and RSCGs 32, 44, and 86 as fossil groups using a new definition for fossil systems that includes a broader range of masses. We find that CGs with total stellar and H I masses ≳ 10{sup 11.3} M{sub ☉} are often X-ray luminous, while lower-mass CGs only sometimes exhibit faint, localized X-ray emission. Additionally, we compare the diffuse X-ray luminosity against both the total UV and 24 μm star formation rates of each CG and optical colors of the most massive galaxy in each of the CGs. The most X-ray luminous CGs have the lowest star formation rates, likely because there is no cold gas available for star formation, either because the majority of the baryons in these CGs are in stars or the X-ray halo, or due to gas stripping from the galaxies in CGs with hot halos. Finally, the optical colors that trace recent star formation histories of the most massive group galaxies do not correlate with the X-ray luminosities of the CGs, indicating that perhaps the current state of the X-ray halos is independent of the recent history of stellar mass assembly in the most massive galaxies.

  7. Child and Family-Focused Cognitive-Behavioral Therapy for Pediatric Bipolar Disorder: Pilot Study of Group Treatment Format

    PubMed Central

    West, Amy E.; Jacobs, Rachel H.; Westerholm, Robert; Lee, Adabel; Carbray, Julie; Heidenreich, Jodi; Pavuluri, Mani N.

    2009-01-01

    Introduction: This study is a preliminary report of a group adaptation of child- and family-focused cognitive behavior therapy (CFF-CBT) for pediatric bipolar disorder (PBD). Methods: CFF-CBT group treatment was provided to twenty six families who had children with a diagnosis of PBD ranging between six- and twelve-years-old. Results: Results indicated that CFF-CBT was feasible and acceptable to families. CFF-CBT resulted in significant improvement in manic, but not depressive, symptoms and in children’s psychosocial functioning post-treatment. In addition, although not statistically significant, parents reported an increased ability to cope with their child’s illness. Results of this study suggest that group psychosocial treatment provided alongside pharmacotherapy may help attain remission of symptoms, as well as increase overall psychosocial coping and well-being in both children and parents. Conclusion: Future work must include a more rigorous test of CFF-CBT in a randomized controlled trial. PMID:19718425

  8. Views of parents, teachers and children on health promotion in kindergarten--first results from formative focus groups and observations.

    PubMed

    Sansolios, Sanne; Mikkelsen, Bent Egberg

    2011-10-01

    The aim of the study was to capture the views of children, parents and teachers on the topic of physical activity in kindergarten through observation and focus group interviews. The study was conducted in the kindergartens from the sampling group in the Danish part of PERISCOPE. 1(st) methodology: Children interviewed inside by the researcher on preferable movements and settings and then observed outside during their playtime. 2(nd) methodology: Children asked to draw themselves playing their most preferred physical activity. Parents and kindergarten teachers interviewed in two different groups, using an identical guide. Children are skilled in taking advantage of the space and facilities available for physical activity; girls need more support than boys to initiate physical activity; children are happy with the facilities and the toys available in the kindergarten. Teachers feel an increasing pressure to take more responsibility and initiatives for the children's health habits. Parents state that if more physical activity is initiated in the kindergarten, it could make children request domestic activity. Physical activity and movement concept are too abstract for children of this age to talk about: they quickly lose their focus and concentration. The new methodology of videotaping gives the researcher the chance to interpret facial expressions to capture movement, talk and actions, and to make a distinction among children, as they tend to interrupt each other. However, this method contains a weakness, if used alone, by the fact that the shooting is only a reflection of what the video camera has recorded.

  9. A brief lithostratigraphic review of the Abrahamskraal and Koonap formations of the Beaufort Group, South Africa: Towards a basin-wide stratigraphic scheme for the Middle Permian Karoo

    NASA Astrophysics Data System (ADS)

    Day, Michael Oliver; Rubidge, Bruce Sidney

    2014-12-01

    The basal strata of the Beaufort Group of the South African Karoo Basin, comprising the western Abrahamskraal and eastern Koonap formations, contain the most time extensive record of Middle Permian fossil tetrapods and hold the key to understanding Middle Permian biodiversity change in the continental realm. To determine faunal stratigraphic ranges a reliable lithostratigraphic framework for Middle Permian Beaufort deposits is essential. Until now this has proved difficult to achieve, largely due to the homogeneity of the fluvial succession coupled with structural complexity as a result of Cape Fold Belt orogenesis. Accordingly, the Abrahamskraal Formation has been only locally subdivided on the basis of sandstone packages but regional stratigraphic subdivision has not yet achieved satisfactorily. Collation of stratigraphic sections from around the Karoo Basin for this study demonstrates the presence of four sandstone packages are present within the Abrahamskraal Formation in the south-western corner of the basin. These sandstone packages are given member status, based upon the nomenclature of Le Roux (1985) with the addition of the newly recognised Grootfontein Member. The Combrinkskraal and Grootfontein Members occur in the lower half of the Abrahamskraal Formation and are laterally persistent along the southern margin of the basin. The Koornplaats Member is more restricted to the south west corner of the basin, where it quite thick, suggesting the narrowing of the highly channelized area. The overlying Moordenaars Member, more extensive towards the north than underlying packages, indicates subsequent northwesterly expansion of the locus of active channelization with time. Although thin sandstone packages in the more easterly positioned and stratigraphically equivalent Koonap Formation, this does not facilitate lithostratigraphic subdivision of this part of the stratigraphic succession and may indicate a different form of fluvial architecture. Our study provides

  10. A re-evaluation of the stratigraphy and sedimentology of the Day Point Formation (Chazy Group): A new look at old reefs

    SciTech Connect

    Falkenberg, J.; Mehrtens, C.J. . Dept. of Geology)

    1993-03-01

    The Day Point Formation (Chazy Group, Middle Ordovician) outcrops in the Champlain Valley of New York and Vermont. The stratigraphy of the Day Point Formation is complex, containing lithologic sequences that are unique at different localities around the Champlain Valley. The formation exhibits complex lateral interfingering of seven lithofacies: (1) Highly bioturbated sandstone with symmetrical and bifurcating ripples. (2) Bioturbated, brachiopod rich, wackestone facies. (3) Planar cross-bedded, interlayered sand and sandy packstone. (4) Interlayered sand and shale grading into sand and limestone layers. (5) Grainstone which, at some localities, contains mound-shaped bryozoan reefs, at other localities thin non-reefal sheet-like layers are present. The grainstone also has planar laminated and cross stratified beds. (6) Fine-grained, calcareous sandstone with planar and herringbone cross bedding, which in places contains small bryozoan reefs and thin sheet-reefs. (7) Planar cross bedded packstone containing bryozoan reefs and thin sheet-like non-reefal layers. The thin reefal layers are found where the mound-shaped reefs are absent. The sand units are found only in the lower portion of the Day Point Formation. The bryozoan reefs and non-reefal layers are associated with the sand beds in the lower portion of the Day Point Formation, and either live within the sand or on top of it. The bryozoans that form the non-reefal layers, found in the limestones, are contained within thin layers of sand. In contrast, no sand is found in the upper section of the Day Point Formation, yet the bryozoan reefs flourish.

  11. Existence of two groups of Staphylococcus aureus strains isolated from bovine mastitis based on biofilm formation, intracellular survival, capsular profile and agr-typing.

    PubMed

    Bardiau, Marjorie; Caplin, Jonathan; Detilleux, Johann; Graber, Hans; Moroni, Paolo; Taminiau, Bernard; Mainil, Jacques G

    2016-03-15

    Staphylococcus (S.) aureus is recognised worldwide as an important pathogen causing contagious acute and chronic bovine mastitis. Chronic mastitis account for a significant part of all bovine cases and represent an important economic problem for dairy producers. Several properties (biofilm formation, intracellular survival, capsular expression and group agr) are thought to be associated with this chronic status. In a previous study, we found the existence of two groups of strains based on the association of these features. The aim of the present work was to confirm on a large international and non-related collection of strains the existence of these clusters and to associate them with case history records. In addition, the genomes of eight strains were sequenced to study the genomic differences between strains of each cluster. The results confirmed the existence of both groups based on capsular typing, intracellular survival and agr-typing: strains cap8-positive, belonging to agr group II, showing a low invasion rate and strains cap5-positive, belonging to agr group I, showing a high invasion rate. None of the two clusters were associated with the chronic status of the cow. When comparing the genomes of strains belonging to both clusters, the genes specific to the group "cap5-agrI" would suggest that these strains are better adapted to live in hostile environment. The existence of these two groups is highly important as they may represent two clusters that are adapted differently to the host and/or the surrounding environment.

  12. Paleomagnetism of the Late Triassic Petrified Forest Formation, Chinle Group, western United States: Further evidence of “large” rotation of the Colorado Plateau

    NASA Astrophysics Data System (ADS)

    Steiner, Maureen B.; Lucas, Spencer G.

    2000-11-01

    Paleomagnetic poles and magnetostratigraphy were obtained from the late Carnian and early Norian Petrified Forest Formation. The remanent magnetization characteristics of this variegated claystones formation are correlated closely with stratal color; red strata display univectorial magnetizations directed to the origin of orthogonal axes plots between 300° and 630°C, whereas progressively greater overlap in magnetization component stabilities is exhibited by purple, blue, and green strata. Rock-magnetic, petrographic, and microprobe investigations indicate that detrital titanohematite is the carrier of much of the characteristic magnetization, with a smaller contribution from magnetite in green and portions of the red strata. Eight magnetic polarity intervals were observed in three quarters of the formation (155 m) good correlation is observed with the coeval portion of the Newark Supergroup. Paleopoles from the late Carnian Blue Mesa and the early Norian Painted Desert Members of the Petrified Forest Formation are identical and agree well with other Chinle Group paleopoles from the Colorado Plateau; the tight cluster formed by all poles indicates that little or no apparent polar wander (APW) with respect to North America occurred during the Late Triassic (late Carnian through Rhaetian time). In addition, Chinle Group paleopoles derived from strata located on the North American (NA) craton also are tightly grouped and indicative of a paucity of significant APW through the Late Triassic. With that same observation from the coeval Newark Supergroup, three independent Late Triassic data sets from different tectonic settings in NA indicate minimal or no APW during more than 20 m.y. The combination of the vertebrate fauna and magnetostratigraphy within the Chinle Group provides a high degree of age control, allowing comparisons among coeval Colorado Plateau (CP) and NA craton paleopoles at about a 250-500 kyr level. CP Chinle Group paleopoles are displaced 9±3

  13. Population genomic analysis of strain variation in Leptospirillum group II bacteria involved in acid mine drainage formation.

    PubMed

    Simmons, Sheri L; Dibartolo, Genevieve; Denef, Vincent J; Goltsman, Daniela S Aliaga; Thelen, Michael P; Banfield, Jillian F

    2008-07-22

    Deeply sampled community genomic (metagenomic) datasets enable comprehensive analysis of heterogeneity in natural microbial populations. In this study, we used sequence data obtained from the dominant member of a low-diversity natural chemoautotrophic microbial community to determine how coexisting closely related individuals differ from each other in terms of gene sequence and gene content, and to uncover evidence of evolutionary processes that occur over short timescales. DNA sequence obtained from an acid mine drainage biofilm was reconstructed, taking into account the effects of strain variation, to generate a nearly complete genome tiling path for a Leptospirillum group II species closely related to L. ferriphilum (sampling depth approximately 20x). The population is dominated by one sequence type, yet we detected evidence for relatively abundant variants (>99.5% sequence identity to the dominant type) at multiple loci, and a few rare variants. Blocks of other Leptospirillum group II types ( approximately 94% sequence identity) have recombined into one or more variants. Variant blocks of both types are more numerous near the origin of replication. Heterogeneity in genetic potential within the population arises from localized variation in gene content, typically focused in integrated plasmid/phage-like regions. Some laterally transferred gene blocks encode physiologically important genes, including quorum-sensing genes of the LuxIR system. Overall, results suggest inter- and intrapopulation genetic exchange involving distinct parental genome types and implicate gain and loss of phage and plasmid genes in recent evolution of this Leptospirillum group II population. Population genetic analyses of single nucleotide polymorphisms indicate variation between closely related strains is not maintained by positive selection, suggesting that these regions do not represent adaptive differences between strains. Thus, the most likely explanation for the observed patterns of

  14. An active site rearrangement within the Tetrahymena group I ribozyme releases nonproductive interactions and allows formation of catalytic interactions.

    PubMed

    Sengupta, Raghuvir N; Van Schie, Sabine N S; Giambaşu, George; Dai, Qing; Yesselman, Joseph D; York, Darrin; Piccirilli, Joseph A; Herschlag, Daniel

    2016-01-01

    Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such "off-pathway" species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2'- and 3'-deoxy (-H) and -amino (-NH(2)) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3'-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2'-OH making no interaction. Upon S binding, a rearrangement occurs that allows both -OH groups to contact a different active site metal ion, termed M(C), to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. © 2015 Sengupta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. An active site rearrangement within the Tetrahymena group I ribozyme releases nonproductive interactions and allows formation of catalytic interactions

    PubMed Central

    Sengupta, Raghuvir N.; Van Schie, Sabine N.S.; Giambaşu, George; Dai, Qing; Yesselman, Joseph D.; York, Darrin; Piccirilli, Joseph A.; Herschlag, Daniel

    2016-01-01

    Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such “off-pathway” species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2′- and 3′-deoxy (–H) and −amino (–NH2) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3′-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2′-OH making no interaction. Upon S binding, a rearrangement occurs that allows both –OH groups to contact a different active site metal ion, termed MC, to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. PMID:26567314

  16. THE EFFECT OF ENVIRONMENT ON THE FORMATION OF H{alpha} FILAMENTS AND COOL CORES IN GALAXY GROUPS AND CLUSTERS

    SciTech Connect

    McDonald, Michael; Veilleux, Sylvain; Mushotzky, Richard E-mail: veilleux@astro.umd.edu

    2011-04-10

    We present the results of a combined X-ray and H{alpha} study of 10 galaxy groups and 17 galaxy clusters using the Chandra X-ray Observatory and the Maryland Magellan Tunable Filter. We find no difference in the morphology or detection frequency of H{alpha} filaments in groups versus clusters over the mass range 10{sup 13} < M{sub 500} < 10{sup 15} M{sub sun}. The detection frequency of H{alpha} emission is shown to be only weakly dependent on the total mass of the system at the 52% confidence level. In contrast, we find that the presence of H{alpha} filaments is strongly correlated with both the global (89% confidence level) and core (84%) intracluster medium (ICM) entropy, as well as the X-ray cooling rate (72%). The H{alpha} filaments are therefore an excellent proxy for the cooling ICM. The H{alpha} filaments are more strongly correlated with the cooling properties of the ICM than with the radio properties of the brightest cluster galaxy; this further supports the scenario where these filaments are directly associated with a thermally unstable, rapidly cooling ICM, rather than radio bubbles. The ICM cooling efficiency, defined as the X-ray cooling rate per unit gas mass, is shown to correlate with the total system mass, indicating that groups are more efficient at cooling than clusters. This result implies that, in systems with cool cores, active galactic nucleus feedback scales with the total mass of the system, in agreement with earlier suggestions.

  17. [Search for destruction factors of bacterial biofilms: comparison of phage properties in a group of Pseudomonas putida bacteriophages and specificity of their halo-formation products].

    PubMed

    Shaburova, O V; Krylov, S V; Veĭko, V P; Pleteneva, E A; Burkal'tseva, M V; Miroshnokov, K A; Kornelissen, A; Lavogne, R; Sykilinda, N N; Kadykov, V A; Mesianzhinov, V V; Volckaert, G; Krylov, V N

    2009-02-01

    Comparison of Pseudomonas putida group of phages attributed to five species (af, phi15, phi27, phi2F, and pf16) with their common property of halo-formation (formation of lightening zones) around phage plaques was conducted. The halo around phage plaques appears as a result of reduction or disappearance of bacterial polysaccharide capsules. The concentration of viable bacteria remains unchanged within the halo. A comparison of specificities of halo-formation products from various phages was conducted by a simple method. These products were shown to be highly specific and inactive on other species of pseudomonads. Phage-resistant P. putida mutants scored with respect to various phages, which lost phage adsorption ability, were tolerant to the effect of halo-formation products in most cases. Apparently, the capsular polysaccharides, which serve as a substrate for depolymerases and are the primary phage receptors, may be often lost. Results of partial sequencing of the af phage genome revealed an open reading frame that encodes the enzyme transglycosylase similar rather to transglycosylases of oligotrophic bacteria belonging to different species than to lysozymes of other phages. Possibly, it is a polyfunctional enzyme combining functions of lysozyme and an enzyme that executes the penetration of phage particle across extracellular slime and capsule.

  18. Burial history of Lockport formation (Middle Silurian), New York, in light of studies of Ellenburger group (Lower Ordovician), west Texas-southeastern New Mexico

    SciTech Connect

    Lee, Y.I.; Ergin, M.; Friedman, G.M.

    1986-05-01

    For studies of burial depth of the Lockport Formation (Middle Silurian) of the Appalachian basin, the authors used as a control data from petrographic, stable isotope, and two-phase fluid-inclusion analyses of carbonate rocks cored from 5000 to 23,000 ft (1.5 to 7 km) burial depth of the Ellenburger Group, west Texas and southeastern New Mexico. The coarse to very coarse crystalline nature of the host-rock dolomite, the vug-filling and fracture-filling saddle dolomite containing relatively light oxygen isotope compositions ranging from -6 to -12 per thousand (PDB), and the high mean homogenization temperatures for saddle dolomite formation from 100/sup 0/ to 260/sup 0/C, all suggest diagenetic changes occurred under deep burial conditions. Using Ellenburger carbonates as a control for burial depth diagenesis studies of saddle dolomite of the surface-exposed Lockport Formation, New York, other literature, and the regional conodont color alteration index (CAI) of 2-3, a former burial depth for the Lockport Formation strata of up to 5 km is indicated, much greater than the present estimation of less than 2 km of paleogeographic reconstruction. This depth was confirmed by delta/sup 18/O values ranging from -9 to -11 per thousand, and two-phase fluid-inclusion homogenization temperatures ranging from 110/sup 0/ to 200/sup 0/C with an average of 150/sup 0/C.

  19. Addition of surfactants in ozonated water cleaning for the suppression of functional group formation and particle adhesion on the SiO2 surface

    NASA Astrophysics Data System (ADS)

    Yang, Jahyun; Im, Kyungtaek; Lim, Sangwoo

    2011-04-01

    Various kinds of surfactants were added to a cleaning solution and deionized (DI) water, and their effect on the suppression of organic function group formation and particle adhesion to a SiO2 surface was analyzed using multi-internal reflection Fourier transform infrared spectroscopy. The results implied that attached organic functional groups are affected by the chemical structure of a surfactant in DI water. Furthermore, the addition of anionic glycolic acid ethoxylate 4-tert-butylphenyl ether (GAE4E) is the most effective in terms of preventing organic group attachment and particle adhesion to the SiO2 surface, whether it was added to the cleaning solution or post-cleaning rinse water, with or without polystyrene latex particles. Moreover, it was possible to completely prevent particle adhesion to the SiO2 surface with the proper addition of GAE4E in DIO3 solution.

  20. Diagrammatic restored section of the Inyan Kara group, Morrison formation, and Unkpapa sandstone of the western side of the Black Hills, Wyoming and South Dakota

    USGS Publications Warehouse

    Mapel, W.J.; Gott, G.B.

    1959-01-01

    The Inyan Kara group of Early Creaceous age and the underlying Morrison formation and Unkapa sandstone of Late Jurassic age comprise about 300 to 850 feet of gently dipping predominantly nonmarine rocks that crop out along the flanks of the Black Hills in northeastern Wyoming and western South Dakota. Terailed mapping and stratigraphic studies of these rocks were made from 1952 to 1957 by the U.S. Geological Survey on behalf of the Division of Raw Materials of the U.S. Atomic Energy Commission. One of the results of the studies is a correlation of formational and informational units along the western side of the Black Hills for a distance of about 140 miles. The generalized section above, which has a greatly exaggerated vertical scale, shoes the main lithologic units that have been traced and correlated, and  the stratigraphic position of uranium deposits in various parts of the Black Hills in relation to these units. Geologists who have this sheet and the areas for which each is responsible are shown on the accompanying map. The brief text below summarizes some of the broad stratigraphic relations within the Inyan Kara group and underlying formations.

  1. The crucial role of higher order multiplicity in wide binary formation: a case study using the β-Pictoris moving group

    NASA Astrophysics Data System (ADS)

    Elliott, P.; Bayo, A.

    2016-07-01

    The `in situ' formation of very wide binaries is hard to explain as their physical separations are beyond the typical size of a collapsing cloud core (≈5000-10 000 au). Here we investigate the formation process of such systems. We compute population statistics such as the multiplicity fraction, companion-star fraction and physical separation distribution of companions in the β-Pictoris moving group. We compare previous multiplicity studies in younger and older regions and show that the dynamic evolution of a young population with a high degree of primordial multiplicity can lead to a processed separation distribution, similar to the field population. The evolution of outer components is attributed to the dynamical unfolding of higher order (triple) systems; a natural consequence of which is the formation of wide binaries. We find a strong preference for wide systems to contain three or more components (>1000 au: 11/14, 10 000 au: 6 / 7). We argue that the majority of wide binaries identified in young moving groups are primordial. Under the assumption that stellar populations, within our galaxy, have statistically similar primordial multiplicity, we can infer that the paucity of wide binaries in the field is the result of dynamical evolution.

  2. Hydrophilic group formation and cell culturing on polystyrene Petri-dish modified by ion-assisted reaction

    NASA Astrophysics Data System (ADS)

    Kim, Ki-Hwan; Cho, Jun-Sik; Choi, Doo-Jin; Koh, Seok-Keun

    2001-04-01

    Polystyrene (PS) Petri-dishes were modified by an ion-assisted reaction (IAR) to improve wettability and to supply a suitable surface for cell culturing. Low energy Ar + ions with 1000 eV were irradiated on the surface of PS in oxygen gas environment. Water contact angles of PS were not reduced much by ion irradiation without oxygen gas and had a value of 40°. In the case of ion irradiation with flowing oxygen gas, however, the water contact angles were dropped significantly from 73° to 19°. X-ray photoelectron spectroscopy analysis showed that the hydrophilic groups were formed on the surface of PS by a chemical reaction between unstable chains induced by ion irradiation and the oxygen gas. Newly formed hydrophilic groups were identified as -(C-O)-, -(CO)- and -(CO)-O- bonds. The influence of the surface modification on growth of the rat pheochromocytoma (PC12) cells was investigated. The IAR-treated PS surfaces showed enhanced attachment and growth in PC12 cell culture test.

  3. The influence of functional groups of self-assembled monolayers on fibrous capsule formation and cell recruitment.

    PubMed

    Barbosa, Judite N; Madureira, Pedro; Barbosa, Mário A; Aguas, Artur P

    2006-03-15

    The contribution of the surface chemistry of an implant to the thickness of the fibrous capsule formed after implantation was herein investigated. For that, self-assembled monolayers (SAMs) of alkanethiols on gold with different terminal functional groups (COOH, OH, and CH(3)) were used. These surfaces were implanted in subcutaneous air pouches of BALB/c mice and the ensuing fibrous capsules were evaluated and compared with the initial inflammatory response caused by the implant. The thickness of the fibrous capsules that are under organization around the implant was measured 1 week after implantation by histology. Inflammatory exudates were collected from the air pouches 24 h after the implantation of SAMs and were analyzed by flow cytometry. A significant increase in the thickness of fibrous capsules was seen around implanted CH(3)-terminated SAMs, and also in gold surfaces, in comparison with the air pouch wall of sham-operated mice and of COOH- and OH-covered SAMs. The CH(3)-coated implants also recruited higher numbers of inflammatory cells; this enhancement involved a significant number of Mac-1(+) cells. Our data indicate that implant surfaces coated with CH(3) induce thick fibrous capsules and this may be the result of the stronger inflammatory effect of CH(3) in comparison with COOH or OH chemical groups.

  4. Contrasting Sr isotope ratios in plagioclase from different formations of the mid-Miocene Columbia River Basalt Group

    NASA Astrophysics Data System (ADS)

    Starkel, W. A.; Wolff, J.; Eckberg, A.; Ramos, F.

    2008-12-01

    Many early Columbia River Basalt flows of the Steens and Imnaha Formations are characterized by abundant, texturally complex, coarse plagioclase phenocrysts. In Imnaha lavas, the feldspars typically have more radiogenic 87Sr/86Sr than whole rock and matrix, and may exhibit complex isotopic zoning that is not correlated with An content. Imnaha plagioclase grains are interpreted as variably-contaminated crystals produced when high-crystallinity mid-crustal basaltic intrusions exchanged interstitial melt with adjacent partly-melted crustal rock; this isotopically variable debris was then remobilized by subsequent intrusion of mantle-derived basalt and brought to the surface as an isotopically heterogeneous mixture. In contrast, plagioclase grains in the texturally very similar Steens lavas are isotopically near-homogeneous and 87Sr/86Sr is not significantly displaced from that of the bulk rock. This is consistent with magma- crust interaction at low degrees of crustal melting during the early stages of the Columbia River flood basalt episode, where Steens and Imnaha lavas were erupted from distinct magma systems hosted by different types of crust that exerted different degrees of isotopic leverage on the mantle-derived magmas [1]. Thermal input to the Steens system declined at the same time as the Imnaha magmatic flux increased to ultimately produce the huge outpouring of Grande Ronde lavas, which are mixtures of mantle- and crust-derived liquids, the latter produced during high degrees of crustal melting during the time of peak magmatic flux. [1] Wolff et al. (2008) Nature Geoscience 1, 177-180.

  5. Stable isotopic compositions of early calcite cements in the Middle Devonian Coralville Formation (Cedar Valley Group), eastern Iowa

    SciTech Connect

    Ludvigson, G.A.; Gonzalez, L.S.; Witzke, B.J. . Dept. of Geology Iowa DNR-Geological Survey Bureau, Iowa City, IA ); Plocher, O.W. )

    1993-03-01

    The Middle-Upper Devonian Cedar Valley Gp in Iowa is subdivided into four formations each representing a broad transgressive-regressive (T-R) cycle of deposition. Cycles consist of basal open marine facies that shallow upward into capping peritidal facies. Results from ongoing diagenetic studies of the Coralville Fm (late Givetian), the second T-R cycle of the Cedar Valley Gp, have focused attention on the origins of early cements. Early calcite cements in the Coralville Fm of Johnson County, Iowa, include blocky equant spars filling fenestral voids in birdseye limestones of the Iowa City Mbr and isopachous bladed spars that occur throughout the Coralville. Bladed spars fill stromatactis and microkarstic voids in the Iowa City Mbr, and sheltered voids in underlying open-marine skeletal packstones of the Cou Falls Mbr (lower Coralville cycle). The bladed spars include nonluminescent inclusion-free domains that contain up to 4,000 ppm Mg, and luminescent inclusion-rich domains that contain less than 2,000 ppm Mg. Birdseye spars have a constructive oscillatory luminescent-nonluminescent zonation controlled by Mn contents and contain less than 1,000 ppm Mg. Nonluminescent domains in bladed spars have the heaviest oxygen isotopic compositions of all components in the Coralville, similar to the isotopically heaviest nonluminescent brachiopods but have [delta][sup 13]C values ranging from [minus]3 to [minus]5 [per thousand]. They are interpreted to have precipitated from marine fluids saturated by CO[sub 2] produced from bacterial oxidation of organic matter. Altered luminescent domains in the bladed spars have the same [delta][sup 13]C compositions, but have widely varying [delta][sup 18]O compositions, ranging to [minus]9 [per thousand].

  6. Unique temperature dependence in the adduct formation between FMN and cysteine S-H group in the LOV2 domain of Adiantum phytochrome3

    NASA Astrophysics Data System (ADS)

    Nozaki, Dai; Iwata, Tatsuya; Tokutomi, Satoru; Kandori, Hideki

    2005-07-01

    In a plant blue-light receptor phototropin, the primary reaction is an adduct formation between the flavin chromophore and a cysteine S-H group. In the case of a LOV2 domain of Adiantum phytochrome3 (phy3-LOV2), we found that Arrhenius plots of the efficiency of the adduct formation provide two kinks at about 190 and 270 K, and a negative activation energy was obtained between the temperatures. They are close to the transition temperatures of protein structural changes observed by the low-temperature difference FTIR spectroscopy. We concluded that the observed temperature dependence of the reaction efficiency in a restricted protein environment originates from protein fluctuation that mainly reflects secondary structure.

  7. Cyclopropane-ring formation in the acyl groups of chlorosome glycolipids is crucial for acid resistance of green bacterial antenna systems.

    PubMed

    Mizoguchi, Tadashi; Tsukatani, Yusuke; Harada, Jiro; Takasaki, Shin; Yoshitomi, Taichi; Tamiaki, Hitoshi

    2013-07-01

    Green photosynthetic bacteria have unique light-harvesting antenna systems called chlorosomes. Chlorobaculum tepidum, a model organism of the bacteria, biosynthesized monogalactosyl- and rhamnosylgalactosyldiacylglycerides possessing a methylene-bridged palmitoleyl group characterized by a cis-substituted cyclopropane ring as the dominant glycolipids of its chlorosome surface. The formation of the cyclopropane ring was chemically inhibited by supplementation of sinefungin, an analog of S-adenosyl-L-methionine, into the bacterial cultivation. The presence of the cyclopropane ring reinforced acid resistance of the light-harvesting chlorosomes and suppressed acidic demetalation (pheophytinization) of bacteriochlorophyll-c pigments constructing the core part of chlorosomes. The ring-formation would represent direct and post-synthetic modifications of chlorosome membrane properties and was tolerant of acidic environments.

  8. Usefulness of postoperative hip irradiation in the prevention of heterotopic bone formation in a high risk group of patients

    SciTech Connect

    MacLennan, I.; Keys, H.M.; Evarts, C.M.; Rubin, P.

    1984-01-01

    Heterotopic ossification is a complication of total hip arthroplasty in 14 to 30% of patients. Significant functional impairment will occur in up to 28% of patients with ectopic bone. The high risk group includes those with preexisting heterotopic bone in either hip, those suffering from hypertrophic osteoarthritis or ankylosing spondylitis and patients who have had multiple procedures on the hip. Fifty-eight patients (67 hips) were irradiated after surgical removal of ectopic bone (53 hips) or received radiation prophylaxis of heterotopic ossification (14 hips). Ninety-five percent of patients had either no bone visible or insignificant amounts of ectopic bone visible on postoperative hip X-rays. Only 5% of patients showed significant persistence of ectopic bone. Postoperative hip function was dramatically improved compared to preoperative function in all patients treated. The importance of early commencement of irradiation is emphasized.

  9. The epitaxial role of silica groups in promoting the formation of silica/carbonate biomorphs: A first hypothesis

    NASA Astrophysics Data System (ADS)

    Bittarello, Erica; Roberto Massaro, Francesco; Aquilano, Dino

    2010-01-01

    This paper deals with the influence of silicate species on the morphogenesis of BaCO 3 (witherite), one of the main component of "silica/carbonate biomorphs". The size of barium carbonate crystals decreases progressively and significantly with the increasing amount of Na-metasilicate (Na-MTS) in the crystallization environment. When the Na-MTS amount in the aqueous mother solution is less than 500 ppm, single well-shaped micrometric BaCO 3 crystals are obtained. Higher Na-MTS concentrations (4000-5000 ppm) produce polycrystalline structures built by pseudo-hexagonal nano-rods. X-ray powder diffraction (XRPD) diagrams show the decrease of crystal size with Na-MTS concentration and point out as well that silicate groups can be slightly absorbed into the barium carbonate lattice. The last part of the paper is devoted to the first finding, in laboratory, of aragonite polycrystalline structures belonging to the family of "silica/carbonate biomorphs".

  10. [The difficult concept of "internal objects" (1934-1943). Its significance for the formation of the Klein group].

    PubMed

    Hinshelwood, R D

    1996-06-01

    Although the concept of "inner objects" developed by Melanie Klein is hardly a major object of discussion today, it caused a furore in the ranks of the British Psychoanalytical Society in the thirties and forties. Notably the analysts from Vienna were unable to agree to the existence of inner objects engendered via processes of internalisation. The author traces the course of these discussions of a clinical problem and the confusion they caused, placing them at the same time in a specific historical context. He sees the controversy as the expression of conflicts and fears unsettling the British Psychoanalytical Society during that period, caused on the one hand by the necessary integration of the exiled Freud family and on the other by tensions within its own ranks leading ultimately to a division of the Society and the constitution of the Klein Group.

  11. Studying with the cloud: the use of online Web-based resources to augment a traditional study group format.

    PubMed

    Chan, Teresa; Sennik, Serena; Zaki, Amna; Trotter, Brendon

    2015-03-01

    Cloud-based applications such as Google Docs, Skype, Dropbox, and SugarSync are revolutionizing the way that we interact with the world. Members of the millennial generation (those born after 1980) are now becoming senior residents and junior attending physicians. We describe a novel technique combining Internet- and cloud-based methods to digitally augment the classic study group used by final-year residents studying for the Royal College of Physicians and Surgeons of Canada examination. This material was developed by residents and improved over the course of 18 months. This is an innovation report about a process for enhanced communication and collaboration as there has been little research to date regarding the augmentation of learner-driven initiatives with virtual resources.

  12. Millimeter-scale variations of stable isotope abundances in carbonates from banded iron-formations in the Hamersley Group of Western Australia

    NASA Technical Reports Server (NTRS)

    Baur, M. E.; Hayes, J. M.; Studley, S. A.; Walter, M. R.

    1985-01-01

    Several diamond drill cores from formations within the Hamersley Group of Western Australia have been studied for evidence of short-range variations in the isotopic compositions of the carbonates. For a set of 32 adjacent microbands analyzed in a specimen from the Marra Mamba Iron Formation, carbon isotope compositions of individual microbands ranged from -2.8 to -19.8 per mil compared to PDB and oxygen isotope compositions ranged from 10.2 to 20.8 per mil compared to SMOW. A pattern of alternating abundances was present, with the average isotopic contrasts between adjacent microbands being 3.0 per mil for carbon and 3.1 per mil for oxygen. Similar results were obtained for a suite of 34 microbands (in four groups) from the Bruno's Band unit of the Mount Sylvia Formation. Difficulties were experienced in preparing samples of single microbands from the Dales Gorge Member of the Brockman Iron Formation, but overall isotopic compositions were in good agreement with values reported by previous authors. Chemical analyses showed that isotopically light carbon and oxygen were correlated with increased concentrations of iron. The preservation of these millimeter-scale variations in isotopic abundances is interpreted as inconsistent with a metamorphic origin for the isotopically light carbon in the BIF carbonates. A biological origin is favored for the correlated variations in 13C and Fe, and it is suggested that the 13C-depleted carbonates may derive either from fermentative metabolism or from anaerobic respiration. A model is presented in which these processes occur near the sediment-water interface and are coupled with an initial oxidative precipitation of the iron.

  13. Millimeter-scale variations of stable isotope abundances in carbonates from banded iron-formations in the Hamersley Group of Western Australia.

    PubMed

    Baur, M E; Hayes, J M; Studley, S A; Walter, M R

    1985-01-01

    Several diamond drill cores from formations within the Hamersley Group of Western Australia have been studied for evidence of short-range variations in the isotopic compositions of the carbonates. For a set of 32 adjacent microbands analyzed in a specimen from the Marra Mamba Iron Formation, carbon isotope compositions of individual microbands ranged from -2.8 to -19.8 per mil compared to PDB and oxygen isotope compositions ranged from 10.2 to 20.8 per mil compared to SMOW. A pattern of alternating abundances was present, with the average isotopic contrasts between adjacent microbands being 3.0 per mil for carbon and 3.1 per mil for oxygen. Similar results were obtained for a suite of 34 microbands (in four groups) from the Bruno's Band unit of the Mount Sylvia Formation. Difficulties were experienced in preparing samples of single microbands from the Dales Gorge Member of the Brockman Iron Formation, but overall isotopic compositions were in good agreement with values reported by previous authors. Chemical analyses showed that isotopically light carbon and oxygen were correlated with increased concentrations of iron. The preservation of these millimeter-scale variations in isotopic abundances is interpreted as inconsistent with a metamorphic origin for the isotopically light carbon in the BIF carbonates. A biological origin is favored for the correlated variations in 13C and Fe, and it is suggested that the 13C-depleted carbonates may derive either from fermentative metabolism or from anaerobic respiration. A model is presented in which these processes occur near the sediment-water interface and are coupled with an initial oxidative precipitation of the iron.

  14. The Italian MSUS Study Group recommendations for the format and content of the report and documentation in musculoskeletal ultrasonography in rheumatology.

    PubMed

    Iagnocco, Annamaria; Porta, Francesco; Cuomo, Giovanna; Delle Sedie, Andrea; Filippucci, Emilio; Grassi, Walter; Sakellariou, Garifallia; Epis, Oscar; Adinolfi, Antonella; Ceccarelli, Fulvia; De Lucia, Orazio; Di Geso, Luca; Di Sabatino, Valentina; Gabba, Alessandra; Gattamelata, Angelica; Gutierrez, Marwin; Massaro, Laura; Massarotti, Marco; Perricone, Carlo; Picerno, Valentina; Ravagnani, Viviana; Riente, Lucrezia; Scioscia, Crescenzio; Naredo, Esperanza; Filippou, Georgios

    2014-02-01

    The objective of this study was to draw up a set of recommendations for the format and content of the musculoskeletal ultrasonography (MSUS) report in rheumatology. A panel of rheumatologists, members of the MSUS Study Group of the Italian Society of Rheumatology, met in order to identify the main discrepancies in the MSUS report. A set of 15 recommendations was then defined, aimed at resolving the main discrepancies. They consisted of information about the motivations for the MSUS examination, the equipment, the US modalities and scanning technique, a list of the examined structures and findings, the scoring/grading systems, the number of images and main findings to include and conclusions. Subsequently a Delphi-based procedure was started in order to obtain agreement on a core set of recommendations. Consensus for each recommendation was considered achieved when the percentage of agreement was >75%. Three complete rounds were performed. The response rate was 85.2% for the first round, 78.3% for the second and 88.9% for the third. Finally, consensus was obtained for 14 of 15 statements. These 14 statements represent the recommendations of the group for the format and content of the report and documentation in MSUS in rheumatology. To the best of our knowledge, our group has produced the first recommendations for the format and content of the report and documentation in MSUS in rheumatology. The report is an integral part of the MSUS examination and its use in a homogeneous form can help in the correct interpretation of the findings.

  15. Horseradish peroxidase-catalyzed formation of hydrogels from chitosan and poly(vinyl alcohol) derivatives both possessing phenolic hydroxyl groups.

    PubMed

    Sakai, Shinji; Khanmohammadi, Mehdi; Khoshfetrat, Ali Baradar; Taya, Masahito

    2014-10-13

    Horseradish peroxidase-catalyzed cross-linking was applied to prepare hydrogels from aqueous solutions containing chitosan and poly(vinyl alcohol) derivatives both possessing phenolic hydroxyl groups (denoted as Ph-chitosan and Ph-PVA, respectively). Comparing the hydrogels prepared from the solution of 1.0% (w/v) Ph-chitosan and 3.0% (w/v) Ph-PVA and that of 3.0% (w/v) Ph-chitosan and 1.0% (w/v) Ph-PVA, the gelation time of the former hydrogel was 47 s, while was 10s longer than that of the latter one. The breaking point for the former hydrogel under stretching (114% strain) was approximately twice larger than that for the latter one. The swelling ratio of the former hydrogel in saline was about half of the latter one. Fibroblastic cells did not adhere on the former hydrogel but adhered and spread on the latter one. The growth of Escherichia coli cells was fully suppressed on the latter hydrogel during 48 h cultivation.

  16. Comparative palynology of clastics and lignites from the Manning Formation, Jackson Group, Upper Eocene, Grimes County, TX

    SciTech Connect

    Gennett, J.A.

    1996-09-01

    The 3500 lignite seam at the Gibbons Creek Mine in Grimes County, TX was sampled for pollen and spores at 10 cm intervals. The majority of samples are dominated (to 60%) by Momipites from the Juglandaceae (walnut family), as is typical of Jackson Group sediments. Other palynomorph taxa vary systematically, with a peak of pollen of the freshwater tree Nyssa (blackgum) and associated Rboipites angustus (to 17%) occurring at the base. Higher in the seam, increase (to 55%) of Cupuliferoipollenites (a chestnut-like grain) and Cyrillaceae-pollenites? ventosus (to 7%) percentages may indicate a higher salinity environment. A Chrysophyllum (satin leaf) peak (to 25%) near the top of the seam suggests relatively shallow fresh-water conditions. Core samples from an interval above the lignites represent a transgressive-regressive cycle in inner shelf clastics. These samples were taken at 40 cm or greater intervals and reveal the regional pollen flora. Although minor changes occur, palynomorph spectra are for the most part homogenous. The dominant grain is again Momipites coryloides, but in general percentages are lower (to 35%). Cupuliferoipollenites (to 17%), Chrysophyllum (to 5%), and Rhoipites angustus (to 3%) are not less important, but do not peak as they do in the lignite spectra. Palm leaf megafossils; in one sample suggest a clastic wetland; in this sample palm pollen (mostly Arecipites, representing the modern saw palmetto) reaches 73%. Another sample contains high (26%) percentages of the fern spore Lygodiumsporites adriennis. High percentages of these two taxa do not occur in the lignite samples.

  17. Formation of selfbound states in a one-dimensional nuclear model—a renormalization group based density functional study

    NASA Astrophysics Data System (ADS)

    Kemler, Sandra; Pospiech, Martin; Braun, Jens

    2017-01-01

    In nuclear physics, density functional theory (DFT) provides the basis for state-of-the art studies of ground-state properties of heavy nuclei. However, the direct relation of the density functional underlying these calculations and the microscopic nuclear forces is not yet fully understood. We present a combination of DFT and renormalization group (RG) techniques which allows to study selfbound many-body systems from microscopic interactions. We discuss its application with the aid of systems of identical fermions interacting via a long-range attractive and short-range repulsive two-body force in one dimension. We compute ground-state energies, intrinsic densities, and density correlation functions of these systems and compare our results to those obtained from other methods. In particular, we show how energies of excited states as well as the absolute square of the ground-state wave function can be extracted from the correlation functions within our approach. The relation between many-body perturbation theory and our DFT-RG approach is discussed and illustrated with the aid of the calculation of the second-order energy correction for a system of N identical fermions interacting via a general two-body interaction. Moreover, we discuss the control of spuriously emerging fermion self-interactions in DFT studies within our framework. In general, our approach may help to guide the development of energy functionals for future quantitative DFT studies of heavy nuclei from microscopic interactions.

  18. Ab initio study of hydrogen-bond formation between aliphatic and phenolic hydroxy groups and selected amino acid side chains.

    PubMed

    Nagy, Peter I; Erhardt, Paul W

    2008-05-08

    Hydrogen bonding was studied in 24 pairs of isopropyl alcohol and phenol as one partner, and water and amino-acid mimics (methanol, acetamide, neutral and protonated imidazole, protonated methylalamine, methyl-guanidium cation, and acetate anion) as the other partner. MP2/6-31+G* and MP2/aug-cc-pvtz calculations were conducted in the gas phase and in a model continuum dielectric environment with dielectric constant of 15.0. Structures were optimized in the gas phase with both basis sets, and zero-point energies were calculated at the MP2/6-31+G* level. At the MP2/aug-cc-pvtz level, the BSSE values from the Boys-Bernardi counterpoise calculations amount to 10-20 and 5-10% of the uncorrected binding energies of the neutral and ionic complexes, respectively. The geometry distortion energy upon hydrogen-bond formation is up to 2 kcal/mol, with the exception of the most strongly bound complexes. The BSSE-corrected MP2/aug-cc-pvtz binding energy of -27.56 kcal/mol for the gas-phase acetate...phenol system has been classified as a short and strong hydrogen bond (SSHB). The CH3NH3+...isopropyl alcohol complex with binding energy of -22.54 kcal/mol approaches this classification. The complete basis set limit (CBS) for the binding energy was calculated for twelve and six complexes on the basis of standard and counterpoise-corrected geometry optimizations, respectively. The X...Y distances of the X-H...Y bridges differ by up to 0.03 A as calculated by the two methods, whereas the corresponding CBS energy values differ by up to 0.03 kcal/mol. Uncorrected MP2/aug-cc-pvtz hydrogen-bonding energies are more negative by up to 0.35 kcal/mol than the MP2/CBS values, and overestimate the CCSD(T)/CBS binding energies generally by up to 5% for the eight studied complexes in the gas phase. The uncorrected MP2/aug-cc-pvtz binding energies decreased (in absolute value) by 11-18 kcal/mol for the ionic species and by up to 5 kcal/mol for the neutral complexes when the electrostatic effect

  19. Resolving the Galaxies within a Giant Lyα Nebula: Witnessing the Formation of a Galaxy Group?

    NASA Astrophysics Data System (ADS)

    Prescott, Moire K. M.; Dey, Arjun; Brodwin, Mark; Chaffee, Frederic H.; Desai, Vandana; Eisenhardt, Peter; Le Floc'h, Emeric; Jannuzi, Buell T.; Kashikawa, Nobunari; Matsuda, Yuichi; Soifer, B. T.

    2012-06-01

    Detailed analysis of the substructure of Lyα nebulae can put important constraints on the physical mechanisms at work and the properties of galaxies forming within them. Using high-resolution Hubble Space Telescope (HST) imaging of a Lyα nebula at z ≈ 2.656, we have taken a census of the compact galaxies in the vicinity, used optical/near-infrared colors to select system members, and put constraints on the morphology of the spatially extended emission. The system is characterized by (1) a population of compact, low-luminosity (~0.1 L*) sources—17 primarily young, small (Re ≈ 1-2 kpc), disky galaxies including an obscured active galactic nucleus—that are all substantially offset (gsim20 kpc) from the line-emitting nebula; (2) the lack of a central galaxy at or near the peak of the Lyα emission; and (3) several nearly coincident, spatially extended emission components—Lyα, He II, and UV continuum—that are extremely smooth. These morphological findings are difficult to reconcile with theoretical models that invoke outflows, cold flows, or resonant scattering, suggesting that while all of these physical phenomena may be occurring, they are not sufficient to explain the powering and large extent of Lyα nebulae. In addition, although the compact galaxies within the system are irrelevant as power sources, the region is significantly overdense relative to the field galaxy population (by at least a factor of four). These observations provide the first estimate of the luminosity function of galaxies within an individual Lyα nebula system and suggest that large Lyα nebulae may be the seeds of galaxy groups or low-mass clusters.

  20. Formation of the Treysa quintet and the main-group pallasites by impact-generated processes in the IIIAB asteroid

    NASA Astrophysics Data System (ADS)

    Wasson, John T.

    2016-04-01

    Treysa and Delegate have compositions closely similar to those of IIIAB irons but plot above the IIIAB field on Ir-Au diagrams; for this reason they are designated anomalous members of IIIAB. All refractory siderophiles share this anomaly. Wasson () interpreted the large spread on IIIAB Ir-Au diagrams to result from melt-trapping and generated solid and liquid fractional crystallization tracks; almost all IIIAB irons fall between the tracks. In contrast, Treysa, Delegate, and three other irons (the Treysa quintet) plot beyond the liquid track. Ideal fractional crystallization cannot account for compositions that plot outside the region between the tracks. Possible explanations for the anomalous compositions of the Treysa quintet are that (1) these meteorites did not form in the IIIAB magma or (2) they formed by the mixing of early crystallized solids with a late liquid. The weight of the evidence including cosmic-ray ages favor the second explanation. Although this explanation can account for positions plotting above the liquid track, it requires special circumstances. The infalling blocks must be assimilated and the resulting melt must crystallize quickly into pockets small enough (<1 m) to allow igneous gradients to be leveled by subsequent diffusion. The Treysa quintet shares the region beyond the liquid track with most main-group pallasites (PMG), which may have also originated in the IIIAB body. It appears that Treysa, its relatives, and the PMG were formed in one or more impact events that mixed olivine and solid metal formed near the core-mantle boundary with nearby magma. It is then necessary to cool the melt rapidly; the best way to achieve rapid cooling is by heat exchange with cooler solids. That the Treysa quintet and the PMG can be explained by the same processes operating on late IIIAB magma supports the conclusion that PMG formed on the IIIAB parent asteroid.

  1. RESOLVING THE GALAXIES WITHIN A GIANT Ly{alpha} NEBULA: WITNESSING THE FORMATION OF A GALAXY GROUP?

    SciTech Connect

    Prescott, Moire K. M.; Dey, Arjun; Jannuzi, Buell T.; Brodwin, Mark; Chaffee, Frederic H.; Desai, Vandana; Soifer, B. T.; Eisenhardt, Peter; Le Floc'h, Emeric; Matsuda, Yuichi

    2012-06-20

    Detailed analysis of the substructure of Ly{alpha} nebulae can put important constraints on the physical mechanisms at work and the properties of galaxies forming within them. Using high-resolution Hubble Space Telescope (HST) imaging of a Ly{alpha} nebula at z Almost-Equal-To 2.656, we have taken a census of the compact galaxies in the vicinity, used optical/near-infrared colors to select system members, and put constraints on the morphology of the spatially extended emission. The system is characterized by (1) a population of compact, low-luminosity ({approx}0.1 L*) sources-17 primarily young, small (R{sub e} Almost-Equal-To 1-2 kpc), disky galaxies including an obscured active galactic nucleus-that are all substantially offset ({approx}>20 kpc) from the line-emitting nebula; (2) the lack of a central galaxy at or near the peak of the Ly{alpha} emission; and (3) several nearly coincident, spatially extended emission components-Ly{alpha}, He II, and UV continuum-that are extremely smooth. These morphological findings are difficult to reconcile with theoretical models that invoke outflows, cold flows, or resonant scattering, suggesting that while all of these physical phenomena may be occurring, they are not sufficient to explain the powering and large extent of Ly{alpha} nebulae. In addition, although the compact galaxies within the system are irrelevant as power sources, the region is significantly overdense relative to the field galaxy population (by at least a factor of four). These observations provide the first estimate of the luminosity function of galaxies within an individual Ly{alpha} nebula system and suggest that large Ly{alpha} nebulae may be the seeds of galaxy groups or low-mass clusters.

  2. First-principles electronic structure and formation energies of group V and VII impurities in the α-Fe{sub 2}O{sub 3} alloys

    SciTech Connect

    Xia, Congxin; Jia, Yu; Zhang, Qiming

    2014-09-21

    Based on density functional theory, the electronic structures, formation energy, and transition level of the selected group V and VII impurities in α-Fe{sub 2}O{sub 3} are investigated by means of first-principles methods. Numerical results show that the group V and VII atoms-doped α-Fe{sub 2}O{sub 3} can be energetically favorable under the Fe-rich condition. Group V atom substituting O atom can induce the acceptor impurity level, while the deep donor impurity states are formed inside the band gap when group VII atom substitute O atom in the α-Fe{sub 2}O{sub 3}. Moreover, our results show that halogen atom F substituting O atom should be very easy in the α-Fe{sub 2}O{sub 3}. In addition, our results also show that for both group V and VII atom-doped α-Fe{sub 2}O{sub 3}, the upper sides of valence band are modified obviously, while the conduction band edge does not change.

  3. Fission track ages of detrital zircons from sandstones of the Umpqua Group and Tyee Formation, Oregon coast range

    SciTech Connect

    Vance, J.A. . Dept. of Geological Sciences); Brandon, M.T. . Dept. of Geology and Geophysics)

    1993-04-01

    Detrital zircons from Paleogene sandstones of the Umpqua Group (UG) and the Tyee Fm (TF) yield contrasting FT age patterns which distinguish these two units and cast new light on their regional extent, correlation and provenance. In the Roseburg (Rg) area of the southern Oregon Coast Range, where most widely exposed, the UG consists of continental and marine clastic beds which overlie submarine lavas of the Coast Range Basalt. K-Ar And Ar-Ar dating of the basement basalts shows a younging trend from about 62 Ma at Rg at the south to 56 Ma at Siletz River and 53 Ma at Tillamook to the north. Detrital zircons from the Rg area are characterized by old FT ages. Of 192 grains dated, 90% are older than 90 Ma; the median age is 129 Ma. A diorite cobble from an UG conglomerate gave a zircon FT age of 105 Ma. These ages point to a source in the Jurassic plutons in the Klamath Mountains nearby to the south. The authors have determined FT cooling ages of 110 and 120 Ma for zircons from the Mt. Ashland and Grants Pass plutons. Continental and shallow marine clastic strata of the TF overly the UG beds west of Rg. The UG is not widely exposed north of Rg where it thins and pinches out above the Coast Range Basalt and is overlain by a northern turbidite facies of the TF. Three TF sandstones from the latitude of Rg and three others from west and south of Corvallis yielded distinctive and identical zircon FT age patterns characterized by young ages. Of 335 zircons dated, 80% are younger than 90 Ma; the median age is 61 Ma. This maximum age is very close to that of the overlying Tillamook and Fisher Fms. The flood of detrital zircons with young FT ages in the TF marks the abrupt change from a nearby Klamath source for the UG beds to a distant, easterly TF source in a recently uplifted plutonic-metamorphic terrane.

  4. Group additivity values for estimating the enthalpy of formation of organic compounds: an update and reappraisal. 2. C, H, N, O, S, and halogens.

    PubMed

    Holmes, John L; Aubry, Christiane

    2012-07-05

    This study extends a previous publication on group additivity values (GAVs) for the elements C, H, and O, to include the elements nitrogen, sulfur, and the halogens. The present state and utility of the Benson additivity schemes for estimating the enthalpy of formation (Δ(f)H(0)) of organic compounds are again described, extending them to include more elements. Old and new GAVs for a wide variety of compounds are provided and are revised where necessary. When new terms are proposed, or old ones are significantly altered, the rationale for so doing is presented. GAV derived ring strain values for benzene and pyridine indicate that the aromatic stabilization of each is essentially the same. As before, the thermochemical consequences of replacing one functional group by another are also shown, thus permitting quick shortcuts to the estimation of new Δ(f)H(0) values.

  5. [The role of the students' research groups in the formation of the system of values as a personality trait of the future doctor].

    PubMed

    Svistushkin, V M; Morozova, S V; Savvateeva, D M

    2017-01-01

    This publication was designed to report the experience gained by the Department of Ear, Throat and Nose Diseases at I.M. Sechenov First Moscow State Medical University in the matters concerning the education of the students involved in the activities of research groups. The main causes for which the senior students should be attracted to doing research work in the framework of the university-based scientific societies are considered. Special emphasis is laid on the role of the students' research groups in the formation of the system of values as a personality trait of the future doctor. The experience gained during the recent years with the organization of inter-institutional students' competitions (otorhinolaryngological olympiads) is discussed.

  6. Reactivity of the nitro-group of a π-conjugated polymer upon the interface formation with chromium: a photoelectron spectroscopy investigation

    NASA Astrophysics Data System (ADS)

    Iucci, G.; Polzonetti, G.; Altamura, P.; Paolucci, G.; Goldoni, A.; D'Amato, R.; Russo, M. V.

    1999-12-01

    X-ray photoelectron spectroscopy was used in order to investigate the interface formation between chromium and thin films of a newly synthesised π-conjugated polymer P(PA- pNO 2PA); the investigated material is a block copolymer consisting of phenylacetylene (PA) and para-nitro phenylacetylene ( pNO 2PA) units {[-(CHC-R) n-(CHC-R') m-] N; RC 6H 5, R'C 6H 4NO 2}. Chromium was evaporated stepwise in situ onto the polymer surface and the XPS spectra of the substrate polymer and of the metal overlayer were studied as a function of increasing chromium thickness. In the early stages of the interface formation, chromium was found to interact mainly with the nitrogen atoms of the -NO 2 groups, that are reduced to nitride-like species; the N-O bond is broken, as evidenced by the modifications occurring in the N1s and O1s spectra. The changes in the C1s spectra upon increasing metal deposition suggest the formation of a chromium-arene π-complex at low chromium coverage and of carbide-like species at higher chromium thickness.

  7. Reversible blocking of amino groups of octreotide for the inhibition of formation of acylated peptide impurities in poly(lactide-co-glycolide) delivery systems.

    PubMed

    Ahn, Jae Hwa; Park, Eun Ji; Lee, Hye Suk; Lee, Kang Choon; Na, Dong Hee

    2011-12-01

    The purpose of this study was to develop a novel method to inhibit the formation of acylated peptide impurities in poly(D,L-lactide-co-glycolide) (PLGA) formulations by reversely blocking the amino groups of octreotide with maleic anhydride (MA). Two mono-MA conjugates with different modification sites (N terminus and Lys residue) and di-MA conjugate of octreotide were prepared and isolated by reversed-phase high-performance liquid chromatography (RP-HPLC). The polymer interaction of peptides and the formation of acylated peptides were monitored by RP-HPLC. The stability of MA-octreotide conjugates in PLGA films was studied in 0.1 M phosphate buffer (pH 7.4) at 37°C. The conjugation of MA to octreotide substantially inhibited the interaction of peptide with PLGA polymer and the subsequent formation of acylated peptide impurities. The MA-octreotides were successfully converted to intact octreotide as pH drops by PLGA hydrolysis. In PLGA films, MA-octreotide also showed complete inhibition of peptide acylation. In conclusion, MA conjugation provides a viable approach for stabilizing peptides in PLGA delivery systems.

  8. Subsurface study of Lower Ordovician Prairie du Chien group and underlying Cambrian formations and their relation to pre-Glenwood unconformity in southern peninsula of Michigan

    SciTech Connect

    Wheeler, C.T. Jr.

    1987-09-01

    Prior to discovery of commercial gas in Lower Ordovician Prairie du Chien sandstones at Falmouth field, Missaukee County, in April 1981, only 119 wells had reached underlying Cambrian rocks in Michigan's Southern Peninsula. The resulting deep basin drilling activity to January 1, 1987, has resulted in 17 Prairie du Chien gas discoveries in the north-central part of the Michigan basin and an additional 46 Cambrian penetrations. This study also utilized 235 Prairie du Chien partial penetrations. It is now possible to correlate with relative certainty the standard Cambrian formations of the subsurface of southern Michigan to wells within and on the other margins of the basin. These, in ascending order, are Mount Simon, Eau Claire, Dresbach, Franconia, and Trempealeau. Because of the previous lack of control, these units were commonly misidentified in northern wells in previous studies. The present study largely corroborates previous recent work. Four ascending formations of the Prairie du Chien Group were also correlated throughout the basin: Umlor, Foster, Bruggers, and Goodwell (newly proposed). Two type wells demonstrate the character of the Goodwell Formation. The Bruggers Sandstones has been further divided into four informal zones, based on extending correlations of thin, silty dolomite marker beds on gamma-ray logs from the Goodwell and Woodville fields area, Newaygo County. Gas is produced from these Brugger zones. Twelve detailed stratigraphic cross sections (using 183 wells) and a pre-Glenwood paleogeologic map demonstrate marked basin-wide pre-Middle Ordovician erosional truncation.

  9. Formation of truncated peptide by-products via sequence-specific formyl group transfer from Trp(For) residues to Nα in the course of Boc-SPPS.

    PubMed

    Azev, Viatcheslav N; Mustaeva, Leila G; Gorbunova, Elena Yu; Molchanov, Maksim V; Rodionov, Igor L

    2013-10-01

    (N(In))-Formyl protective group of tryptophan has been introduced as a base/nucleophile-labile protective group. It has long been known that a free Nα-amino group of the peptide can serve as a nucleophile: an irreversible formyl N(In)  → NH(2) transfer is consistently observed when deformylation is performed last on an otherwise deprotected peptide that possesses free Nα-amino group. Obviously, this particular side reaction should be expected any time free amino group is exposed to Trp(For), but, at the best of our knowledge, has never been reported in the course of Boc-SPPS. In the present communication, we describe a set of appropriately designed model experiments that permitted to detect the title side reaction both in solution and in solid-phase reactions. We observed intermolecular formyl group transfer with a model compound, Trp(For)-NH(2). Importantly, we also observed this migration on solid support with the rate roughly estimated to be up to 1% of residues per minute. We also observed that the formyl-group transfer reaction occurred in a sequence-dependent manner and was suppressed to a non-detectable level using 'in situ neutralization' technique. Because this side reaction is sequence dependent, there might be situations when the rate of the formation of Nα -formyl termination by-products is significant. In other cases, the Nα -For truncated by-products would not contaminate the final peptide significantly but still could be a source of microheterogeneity. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.

  10. Density functional study of hydrogen bond formation between methanol and organic molecules containing Cl, F, NH2, OH, and COOH functional groups.

    PubMed

    Kolev, Stefan K; St Petkov, Petko; Rangelov, Miroslav A; Vayssilov, Georgi N

    2011-12-08

    Various hydrogen-bonded complexes of methanol with different proton accepting and proton donating molecules containing Cl, F, NH(2), OH, OR, and COOH functional groups have been modeled using DFT with hybrid B3LYP and M05-2X functionals. The latter functional was found to provide more accurate estimates of the structural and thermodynamic parameters of the complexes of halides, amines, and alcohols. The characteristics of these complexes are influenced not only by the principle hydrogen bond of the methanol OH with the proton acceptor heteroatom, but also by additional hydrogen bonds of a C-H moiety with methanol oxygen as a proton acceptor. The contribution of the former hydrogen bond in the total binding enthalpy increases in the order chlorides < fluorides < alcohols < amines, while the contribution of the second type of hydrogen bond increases in the reverse order. A general correlation was found between the binding enthalpy of the complex and the electrostatic potential at the hydrogen center participating in the formation of the hydrogen bond. The calculated binding enthalpies of different complexes were used to clarify which functional groups can potentially form a hydrogen bond to the 2'-OH hydroxyl group in ribose, which is strong enough to block it from participation in the intramolecular catalytic activation of the peptide bond synthesis. Such blocking could result in inhibition of the protein biosynthesis in the living cell if the corresponding group is delivered as a part of a drug molecule in the vicinity of the active site in the ribosome. According to our results, such activity can be accomplished by secondary or tertiary amines, alkoxy groups, deprotonated carboxyl groups, and aliphatic fluorides, but not by the other modeled functional groups.

  11. Hydroxy-group effect on the regioselectivity in a photochemical oxetane formation reaction (the Paternò-Büchi Reaction) of geraniol derivatives.

    PubMed

    Hisamoto, Ken; Hiraga, Yoshikazu; Abe, Manabu

    2011-09-01

    The Paternò-Büchi (PB) reaction of geraniol derivatives 1, which contain allylic alcohol functionality and unfunctionalized double bonds, with benzophenone was investigated to see the effect of the hydroxyl group on the regioselectivity of the oxetane formation, i.e., 2/3. At low concentration of geraniol (1a), oxetanes 2a and 3a were formed in a ratio of 2a/3a = ca. 50/50. The oxetane 2a is derived from the PB reaction at the allylic alcohol moiety, whereas the PB reaction at the unfunctionalized double bond produces the oxetane 3a. The PB reaction of the hydroxy-protected methyl ether 1b and acetate 1c gave selectively oxetanes 3b,c derived from the reaction at the more nucleophilic double bond, 2/3∼ 15/85. The hydroxyl-group effect was found to be small, but apparently increased the formation of 2a in the PB reaction with geraniol (1a).

  12. Unique Footprint in the scl1.3 Locus Affects Adhesion and Biofilm Formation of the Invasive M3-Type Group A Streptococcus

    PubMed Central

    Bachert, Beth A.; Choi, Soo J.; LaSala, Paul R.; Harper, Tiffany I.; McNitt, Dudley H.; Boehm, Dylan T.; Caswell, Clayton C.; Ciborowski, Pawel; Keene, Douglas R.; Flores, Anthony R.; Musser, James M.; Squeglia, Flavia; Marasco, Daniela; Berisio, Rita; Lukomski, Slawomir

    2016-01-01

    The streptococcal collagen-like proteins 1 and 2 (Scl1 and Scl2) are major surface adhesins that are ubiquitous among group A Streptococcus (GAS). Invasive M3-type strains, however, have evolved two unique conserved features in the scl1 locus: (i) an IS1548 element insertion in the scl1 promoter region and (ii) a nonsense mutation within the scl1 coding sequence. The scl1 transcript is drastically reduced in M3-type GAS, contrasting with a high transcription level of scl1 allele in invasive M1-type GAS. This leads to a lack of Scl1 expression in M3 strains. In contrast, while scl2 transcription and Scl2 production are elevated in M3 strains, M1 GAS lack Scl2 surface expression. M3-type strains were shown to have reduced biofilm formation on inanimate surfaces coated with cellular fibronectin and laminin, and in human skin equivalents. Repair of the nonsense mutation and restoration of Scl1 expression on M3-GAS cells, restores biofilm formation on cellular fibronectin and laminin coatings. Inactivation of scl1 in biofilm-capable M28 and M41 strains results in larger skin lesions in a mouse model, indicating that lack of Scl1 adhesin promotes bacterial spread over localized infection. These studies suggest the uniquely evolved scl1 locus in the M3-type strains, which prevents surface expression of the major Scl1 adhesin, contributed to the emergence of the invasive M3-type strains. Furthermore these studies provide insight into the molecular mechanisms mediating colonization, biofilm formation, and pathogenesis of group A streptococci. PMID:27630827

  13. A new turtle from the Upper Cretaceous Bauru Group of Brazil, updated phylogeny and implications for age of the Santo Anastácio Formation

    NASA Astrophysics Data System (ADS)

    Menegazzo, Mirian Costa; Bertini, Reinaldo José; Manzini, Flávio Fernando

    2015-03-01

    A new Podocnemidinura specimen from the Upper Cretaceous Bauru Group (Paraná Basin) of southeastern Brazil was described. The Bauru Group provided an important portrait of the Brazilian Mesozoic terrestrial biota, which boasts a vertebrate fauna formed from fishes, frogs, lacertilians, crocodyliforms, dinosaurs and mammals; records of palynomorphs; and invertebrate fauna consisted of gastropods, bivalves, ostracods and conchostracans. Nevertheless, the age of these continental deposits is not precisely estimated, which prevents global correlations, and its fauna is argued to be endemic. The new specimen described is the first turtle from the Santo Anastácio Formation, and its morphological comparison with other South American forms provided a significant advancement in the understanding of the age of this unit (Late Cretaceous). This study permitted a revision of the turtle taxa of the Bauru Group. As a result, some taxa were considered synonym, including the new Santo Anastácio form. The specimen is still unnamed due to the absence of skull characters that preclude its accurate positioning within the Bauru Group skull-based taxa. In addition, the phylogenetic affinities of this taxon were analyzed into Podocnemidinura clade.

  14. Thermochemistry of organic, elementorganic and inorganic species. Part XXI: Enthalpies of formation for bi- and triradicals of main group elements’ halogenides

    NASA Astrophysics Data System (ADS)

    Ponomarev, Dmitry; Takhistov, Viatcheslav; Slayden, Suzanne; Liebman, Joel

    2008-03-01

    General trends in thermochemistry of bi- and triradicals as the fragments of halogenated molecules of main group elements :EX (:EHX; :EX 2) and triradicals ·:EX, respectively, where X-halogens F-I were found for the first time. The enthalpy of formation for methylene CH 2 was drastically changed in present work with adopted values 79 ( 3B 1) and 88 ( 1A 1) compared with currently used values ˜93 and ˜102 kcal mol -1, respectively. This happened mainly because of the drastic change in the enthalpy of formation for ketene CH 2dbnd C dbnd O molecule from currently used value -11.4 to -24 kcal mol -1 [A.V. Golovin, D.A. Ponomarev, V.V. Takhistov, This Journal 524 (2000) 259] which was the source of experimental determination of ΔHf0 :CH 2. Other experimental data are provided for support of the lower values of the ΔHf0 for :CH 2. It was established that halogens F-I stabilize all biradicals :EX (E = B-Tl, N-Bi) and :EHX (:EX 2) (E = C-Pb) compared with the free radicals of these elements. This was interpreted by essentially smaller thermodynamic stability of bi- compared with mono (free)radicals the former extracting larger stabilization at H → X replacement from the same halogen compared with more stable free radicals. The expected increase in stabilization of biradicals is observed when coming down the periodic table while due to lower stability of biradicals all halogens reveal similar (contrary to free radicals) stabilization effects. Finding unknown values and correcting some literature data on the enthalpies of formation for mono-, bi- and triradicals we could estimate their thermodynamic stabilities. It was established that only about 40 molecules, radicals and biradicals from more than 800 hydrides and halogenides possess higherΔHf0 values compared with their fragments with elements in lower valent states with H 2 (rarely HX) as a partner. This might be treated only in the sense that the parent species are less stable than the system [fragment + H 2 (or

  15. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing ); Chingnien Chen )

    1991-10-15

    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  16. Conversion of membrane lipid acyl groups to triacylglycerol and formation of lipid bodies upon nitrogen starvation in biofuel green algae Chlorella UTEX29.

    PubMed

    Goncalves, Elton C; Johnson, Jodie V; Rathinasabapathi, Bala

    2013-11-01

    Algal lipids are ideal biofuel sources. Our objective was to determine the contributors to triacylglycerol (TAG) accumulation and lipid body formation in Chlorella UTEX29 under nitrogen (N) deprivation. A fivefold increase in intracellular lipids following N starvation for 24 h confirmed the oleaginous characteristics of UTEX29. Ultrastructural studies revealed increased number of lipid bodies and decreased starch granules in N-starved cells compared to N-replete cells. Lipid bodies were observed as early as 3 h after N removal and plastids collapsed after 48 h of stress. Moreover, the identification of intracellular pyrenoids and differences in the expected nutritional requirements for Chlorella protothecoides (as UTEX29 is currently classified) led us to conduct a phylogenetic study using 18S and actin cDNA sequences. This indicated UTEX29 to be more phylogenetically related to Chlorella vulgaris. To investigate the fate of different lipids after N starvation, radiolabeling using ¹⁴C-acetate was used. A significant decrease in ¹⁴C-galactolipids and phospholipids matched the increase in ¹⁴C-TAG starting at 3 h of N starvation, consistent with acyl groups from structural lipids as sources for TAG under N starvation. These results have important implications for the identification of key steps controlling oil accumulation in N-starved biofuel algae and demonstrate membrane recycling during lipid body formation.

  17. An unusual Middle Permian flora from the Blaine Formation (Pease River Group: Leonardian-Guadalupian Series) of King County, West Texas

    USGS Publications Warehouse

    DiMichele, W.A.; Hook, R.W.; Nelson, W.J.; Chaney, D.S.

    2004-01-01

    A new Middle Permian plant assemblage from South Ash Pasture in King County, Texas, may be the youngest and is certainly the most unusual flora known from the Permian of either West Texas or adjoining north-central Texas. Found serendipitously in the evaporite-rich upper Blaine Formation (Pease River Group, Guadalupian Series), the flora is of very low diversity despite intensive collecting efforts, and the affinities of nearly all taxa are enigmatic. The most common elements are parallel-veined leaves that resemble cordaites but that could be isolated pinnules of a pinnate leaf. Gigantopterid foliage is present but not assignable to any known taxon. A single foliar conifer specimen is too incomplete for assignment. Numerous reproductive organs, however, and an abundance of axes may represent conifers. Conchostracans, palaeoniscoid fish scales, and small heteropolar coprolites also occur in the deposit, which originated as a small, claystone-dominated channel fill in a coastal plain setting.

  18. Evidence for the formation of adducts and S-(carboxymethyl)cysteine on reaction of alpha-dicarbonyl compounds with thiol groups on amino acids, peptides, and proteins.

    PubMed

    Zeng, Jingmin; Davies, Michael J

    2005-08-01

    Nonenzymatic covalent adduction of glucose, or aldehydes derived from glucose or oxidation reactions, to proteins (glycation) has been proposed as a key factor in the vascular complications of diabetes. In conditions of chronic glucose elevation, alpha-dicarbonyl compounds, including glyoxal and methylglyoxal, are also present at elevated levels. These carbonyls react rapidly with nucleophilic groups on Lys and Arg side chains and the N-terminal amino group, to give poorly defined products, often called advanced glycation endproducts. These are present at elevated levels in tissue samples from people with diabetes and have been linked with disease development. As the thiol group of Cys is a powerful nucleophile, we hypothesized that adduction should occur rapidly and efficiently at Cys residues. It is shown here that Cys residues react with dicarbonyl compounds to give thiol-aldehyde adducts, which have been detected by electrospray ionization mass spectrometry. This process is accompanied by loss of the thiol group and formation of stable products. In the case of glyoxal, these reactions give S-(carboxymethyl)cysteine. The percentage conversion of thiol lost to product is substrate-dependent and < or = 32%. S-(Carboxymethyl)cysteine has been quantified by HPLC on thiol-containing, protected amino acids, peptides, and proteins, after exposure to glyoxal. The yield of this product has been shown to increase in a time- and dose-dependent manner with higher glyoxal concentrations and to also be formed on extended incubation of serum albumin with glucose. This novel, stable, advanced glycation endproduct is a potential marker of glycation.

  19. Galaxy And Mass Assembly (GAMA): Gas Fueling of Spiral Galaxies in the Local Universe. I. The Effect of the Group Environment on Star Formation in Spiral Galaxies

    NASA Astrophysics Data System (ADS)

    Grootes, M. W.; Tuffs, R. J.; Popescu, C. C.; Norberg, P.; Robotham, A. S. G.; Liske, J.; Andrae, E.; Baldry, I. K.; Gunawardhana, M.; Kelvin, L. S.; Madore, B. F.; Seibert, M.; Taylor, E. N.; Alpaslan, M.; Brown, M. J. I.; Cluver, M. E.; Driver, S. P.; Bland-Hawthorn, J.; Holwerda, B. W.; Hopkins, A. M.; Lopez-Sanchez, A. R.; Loveday, J.; Rushton, M.

    2017-03-01

    We quantify the effect of the galaxy group environment (for group masses of 1012.5–1014.0 M ⊙) on the current star formation rate (SFR) of a pure, morphologically selected sample of disk-dominated (i.e., late-type spiral) galaxies with redshift ≤0.13. The sample embraces a full representation of quiescent and star-forming disks with stellar mass M * ≥ 109.5 M ⊙. We focus on the effects on SFR of interactions between grouped galaxies and the putative intrahalo medium (IHM) of their host group dark matter halos, isolating these effects from those induced through galaxy–galaxy interactions, and utilizing a radiation transfer analysis to remove the inclination dependence of derived SFRs. The dependence of SFR on M * is controlled for by measuring offsets Δlog(ψ *) of grouped galaxies about a single power-law relation in specific SFR, {\\psi }* \\propto {M}* -0.45+/- 0.01, exhibited by non-grouped “field” galaxies in the sample. While a small minority of the group satellites are strongly quenched, the group centrals and a large majority of satellites exhibit levels of ψ * statistically indistinguishable from their field counterparts, for all M *, albeit with a higher scatter of 0.44 dex about the field reference relation (versus 0.27 dex for the field). Modeling the distributions in Δlog(ψ *), we find that (i) after infall into groups, disk-dominated galaxies continue to be characterized by a similar rapid cycling of gas into and out of their interstellar medium shown prior to infall, with inflows and outflows of ∼1.5–5 x SFR and ∼1–4 x SFR, respectively; and (ii) the independence of the continuity of these gas flow cycles on M * appears inconsistent with the required fueling being sourced from gas in the circumgalactic medium on scales of ∼100 kpc. Instead, our data favor ongoing fueling of satellites from the IHM of the host group halo on ∼Mpc scales, i.e., from gas not initially associated with the galaxies upon infall. Consequently

  20. Mechanistic Insights of Ethanol Steam Reforming over Ni–CeO x (111): The Importance of Hydroxyl Groups for Suppressing Coke Formation

    DOE PAGES

    Liu, Zongyuan; Duchoň, Tomáš; Wang, Huanru; ...

    2015-07-30

    We have studied the reaction of ethanol and water over Ni–CeO2-x(111) model surfaces to elucidate the mechanistic steps associated with the ethanol steam reforming (ESR) reaction. Our results provide insights about the importance of hydroxyl groups to the ESR reaction over Ni-based catalysts. Systematically, we have investigated the reaction of ethanol on Ni–CeO2-x(111) at varying Ce³⁺ concentrations (CeO1.8–2.0) with absence/presence of water using a combination of soft X-ray photoelectron spectroscopy (sXPS) and temperature-programmed desorption (TPD). Consistent with previous reports, upon annealing, metallic Ni formed on reduced ceria while NiO was the main component on fully oxidized ceria. Ni⁰ is themore » active phase leading to both the C–C and C–H cleavage of ethanol but is also responsible for carbon accumulation or coking. We have identified a Ni₃C phase that formed prior to the formation of coke. At temperatures above 600K, the lattice oxygen from ceria and the hydroxyl groups from water interact cooperatively in the removal of coke, likely through a strong metal–support interaction between nickel and ceria that facilitates oxygen transfer.« less

  1. Formation of lysosulfatide, 3',6'-anhydropsychosine, ceramide, and sphingosine by saponification of cerebroside sulfate. Effect of the sulfate group on the hydrolysis.

    PubMed

    Nonaka, G; Kishimoto, Y; Seyama, Y; Yamakawa, T

    1979-02-01

    Saponification of cerebroside sulfate (sulfatide) by refluxing with 1 N KOH in 90% n-butanol for 1 h yielded ceramide, sphingosine, lysosulfatide (psychosine-3'-sulfate ester) and a hitherto unknown compound. The latter compound was identified as 3,6-anhydrogalactosyl sphingosine (3',6'-anhydropsychosine) from its mass spectrum. The structure of lysosulfatide was confirmed by reacylating it to sulfatide by condensing it with lignoceroyl chloride. The resulting sulfatide, which was chromatographically identical to control sulfatides, was not oxidized by periodate. The sulfatide was also permethylated and methanolyzed. The sugar moiety obtained was identified as methyl 2,4,6-tri-O-methylgalactoside by gas-liquid chromatography and thin-layer chromatography. The presence of the sulfate group in lysosulfatide was further confirmed by IR spectroscopy and the presence of radioactivity when it was prepared from [35S]sulfatide. The effect of the sulfate group on cleavage of the galactoside linkage and on the formation of the 3,6-anhydro derivative is discussed.

  2. Mechanistic Insights of Ethanol Steam Reforming over Ni–CeO x (111): The Importance of Hydroxyl Groups for Suppressing Coke Formation

    SciTech Connect

    Liu, Zongyuan; Duchoň, Tomáš; Wang, Huanru; Peterson, Erik W.; Zhou, Yinghui; Luo, Si; Zhou, Jing; Matolín, Vladimir; Stacchiola, Dario J.; Rodriguez, José A.; Senanayake, Sanjaya D.

    2015-07-30

    We have studied the reaction of ethanol and water over Ni–CeO2-x(111) model surfaces to elucidate the mechanistic steps associated with the ethanol steam reforming (ESR) reaction. Our results provide insights about the importance of hydroxyl groups to the ESR reaction over Ni-based catalysts. Systematically, we have investigated the reaction of ethanol on Ni–CeO2-x(111) at varying Ce³⁺ concentrations (CeO1.8–2.0) with absence/presence of water using a combination of soft X-ray photoelectron spectroscopy (sXPS) and temperature-programmed desorption (TPD). Consistent with previous reports, upon annealing, metallic Ni formed on reduced ceria while NiO was the main component on fully oxidized ceria. Ni⁰ is the active phase leading to both the C–C and C–H cleavage of ethanol but is also responsible for carbon accumulation or coking. We have identified a Ni₃C phase that formed prior to the formation of coke. At temperatures above 600K, the lattice oxygen from ceria and the hydroxyl groups from water interact cooperatively in the removal of coke, likely through a strong metal–support interaction between nickel and ceria that facilitates oxygen transfer.

  3. Facilitating identity formation, group membership, and learning in science classrooms: What can be learned from out-of-field teaching in an urban school?

    NASA Astrophysics Data System (ADS)

    Olitsky, Stacy

    2007-03-01

    This paper explores both the obstacles and the possibilities for students developing identities associated with science by engaging in solidarity-building classroom interactions. Data come from ethnographic research conducted in a diverse eighth-grade urban magnet school classroom in which the teacher taught out of field for part of the year. Contrary to expectations, more students participated and reported enjoying science when the teacher was out of field. Analysis of classroom interactions indicated that while in field, the teacher primarily engaged in front stage performances that hid her struggles with the material and accentuated students' views of science as an elite status group. The types of solidarity that developed among students often did not involve science language and sometimes involved students rejecting peers' claims to membership. However, when out of field, the teacher allowed students into her backstage, where her struggles and learning processes were more explicit. These practices lessened the social distance between teacher and students, and reduced the risks of using science language, thereby encouraging solidarity and group membership. This study provides insights into some of the ways that teachers, particularly those in urban settings characterized by diversity, might be more successful at facilitating identity formation and learning in science.

  4. Prediction of Enthalpy of Formation in the Solid State (at 298.15 K) using Second-Order Group Contributions. Part 1. Carbon-Hydrogen and Carbon-Hydrogen-Oxygen Compounds

    NASA Astrophysics Data System (ADS)

    Salmon, Anna; Dalmazzone, Didier

    2006-09-01

    A predictive method, based on Benson's group additivity technique, is developed for calculating the enthalpy of formation in the solid phase, at 298.15K, of carbon-hydrogen compounds and carbon-hydrogen-oxygen compounds. A complete database compiles 398 experimental enthalpies of formation. The whole group contribution values, ring strain corrections, and nonnearest neighbor interactions evaluated are listed. Finally a comparison with Cohen's method indicates that this new estimation method leads to higher precision and reliability.

  5. Stepwise sequential analysis of stable multiradicals formation in polyphenolic myricetin active OH groups throughout the antioxidant process to scavenge free radicals

    NASA Astrophysics Data System (ADS)

    Barzegar, Abolfazl; Rezaei-Sadabady, Rogaie

    2017-10-01

    Five galvinoxyl radicals (Grad) reduction by one polyphenolic myricetin (Myc, 3,3‧,4‧,5,5‧,7-Hexahydroxyflavone) molecule-using EPR method-demonstrated that each Myc should donate at least five H atoms resulted in multiradicals Myc5rad (5 Grad + 1Myc → 5 GH + 1 Myc5rad). The process that five H atoms donation occurs from different OH sites of Myc lead to appearing of five unpaired valence electrons of Myc5rad via two possible different mechanisms. First; concerted five H atoms donation from five different OH groups that directly results in Myc5rad radicals (Myc → Myc5rad). Second; the step-wise radical formation in five different OH groups of Myc (Myc → Mycrad → Myc2rad → Myc3rad → Myc4rad → Myc5rad). Computational DFT method was used to analyze all the six different OH groups of Myc which involved in free radical reactions for the purposes of clarification the stable multiradicals Myc5rad formation mechanism. The fast semi-empirical combined quantum method, AM1/DFT, as well as full DFT geometry optimization approaches of B3LYP functional DFT/DFT with different basis sets of 6-31G (d), 6-311 + G (d,p) and 6-311 + G (2d,2p) confirmed the stepwise H atom abstraction trend on the main three hydroxyl sites as 4‧-Orad → 4‧-Orad3-Orad → 4‧-Orad3-Orad-7Orad both in the gas and water phase. Spin delocalization over the entire Myc, adding the co-planarity, contributed to the stabilization of respective radical species. The excellent stability of Myc radicals should give an effective chain-breaking antioxidant activity for Myc in biological environment which is expected to have far fewer side effects. These findings may be useful to elucidate the radical scavenging mechanism of other flavonoids regarding to design novel antioxidants.

  6. Influence of surface oxygenated groups on the formation of active Cu species and the catalytic activity of Cu/AC catalyst for the synthesis of dimethyl carbonate

    NASA Astrophysics Data System (ADS)

    Zhang, Guoqiang; Li, Zhong; Zheng, Huayan; Hao, Zhiqiang; Wang, Xia; Wang, Jiajun

    2016-12-01

    Activated carbon (AC) supported Cu catalysts are employed to study the influence of surface oxygenated groups on the formation of active Cu species and the catalytic activity of Cu/AC catalyst for oxidative carbonylation of methanol to dimethyl carbonate (DMC). The AC supports are thermal treated under different temperatures in order to adjust the levels of surface oxygenated groups. The AC supports are characterized by BET, TPD-MS and XRD, and the Cu/AC catalysts are characterized by BET, XRD, TEM, XPS, AAS, CH3OH-TPD and N2O chemisorption. The results show that as the treatment temperature is below 800 °C, the BET surface area of the corresponding AC supports are nearly unchanged and close to that of the original AC (1529.6 m2/g). But as the thermal treatment temperature is elevated from 1000 to 1600 °C, the BET surface area of AC supports gradually decreases from 1407.6 to 972.2 m2/g. After loading of Cu, the BET surface area of copper catalysts is in the range of 834.4 to 1545.3 m2/g, which is slightly less than that of the respective supports. When AC is thermal treated at 400 and 600 °C, the unstable carboxylic acid and anhydrides groups are selectively removed, which has weakened the mobility and agglomeration of Cu species during the calcination process, and thus improve the Cu species dispersion over AC support. But as the treatment temperature is elevated from 600 °C to 1200 °C, the Cu species dispersion begins to decline suggesting further removal of stable surface oxygenated groups is unfavorable for Cu species dispersion. Moreover, higher thermal treatment temperature (above 1200 °C) promotes the graphitization degree of AC and leds to the decrease of Cu loading on AC support. Meanwhile, the removal of surface oxygenated groups by thermal treatment is conducive to the formation of more π-sites, and thus promote the reduction of Cu2+ to Cu+ and Cu0 as active centers. The specific surface area of (Cu+ + Cu0) is improved by thermal treatment of AC

  7. Production history matching to determine reservoir properties of important coal groups in the Upper Pottsville formation, Brookwood and Oak Grove fields, Black Warrior Basin, Alabama

    PubMed Central

    Karacan, C. Özgen

    2015-01-01

    The Black Warrior Basin of Alabama is one of the most important coal mining and coalbed methane production areas in the United States. Methane control efforts through degasification that started almost 25 years ago for the sole purpose of ensuring mining safety resulted in more than 5000 coalbed methane wells distributed within various fields throughout the basin. The wells are completed mostly in the Pratt, Mary Lee, and Black Creek coal groups of the Upper Pottsville formation and present a unique opportunity to understand methane reservoir properties of these coals and to improve their degasification performances. The Brookwood and Oak Grove fields in the Black Warrior Basin are probably two of the most important fields in the basin due to current longwall coal mining activities. In this work, methane and water productions of 92 vertical wellbores drilled, some completed 20 years ago, over a current large coal mine district located in these two fields, were analyzed by history matching techniques. The boreholes were completed at the Mary Lee coal group, or at combinations of the Pratt, Mary Lee, and Black Creek groups. History matching models were prepared and performed according to properties of each coal group. Decline curve analyses showed that effective exponential decline rates of the wells were between 2% and 25% per year. Results of production history matching showed, although they varied by coal group, that pressure decreased as much as 80% to nearly 25 psi in some areas and resulted in corresponding decreases in methane content. Water saturation in coals decreased from 100% to between 20 and 80%, improving gas relative permeabilities to as much as 0.8. As a result of primary depletion, permeability of coal seams increased between 10 and 40% compared to their original permeability, which varied between 1 and 10 md depending on depth and coal seam. These results not only can be used for diagnostic and interpretation purposes, but can be used as parameter

  8. Development of a Web-Based Intervention for Addressing Distress in Caregivers of Patients Receiving Stem Cell Transplants: Formative Evaluation With Qualitative Interviews and Focus Groups

    PubMed Central

    Joshi, Tanisha; Simoneau, Teresa; Kilbourn, Kristin; Carr, Alaina; Kutner, Jean; Laudenslager, Mark L

    2017-01-01

    Background Caregivers of cancer patients experience significant burden and distress including depression and anxiety. We previously demonstrated the efficacy of an eight session, in-person, one-on-one stress management intervention to reduce distress in caregivers of patients receiving allogeneic hematopoietic stem cell transplants (allo-HSCT). Objective The objective of this study was to adapt and enhance the in-person caregiver stress management intervention to a mobilized website (eg, tablet, smartphone, or computer-based) for self-delivery in order to enhance dissemination to caregiver populations most in need. Methods We used an established approach for development of a mhealth intervention, completing the first two research and evaluation steps: Step One: Formative Research (eg, expert and stakeholder review from patients, caregivers, and palliative care experts) and Step Two: Pretesting (eg, Focus Groups and Individual Interviews with caregivers of patients with autologous HSCT (auto-HSCT). Step one included feedback elicited for a mock-up version of Pep-Pal session one from caregiver, patients and clinician stakeholders from a multidisciplinary palliative care team (N=9 caregivers and patient stakeholders and N=20 palliative care experts). Step two included two focus groups (N=6 caregivers) and individual interviews (N=9 caregivers) regarding Pep-Pal’s look and feel, content, acceptability, and potential usability/feasibility. Focus groups and individual interviews were audio-recorded. In addition, individual interviews were transcribed, and applied thematic analysis was conducted in order to gain an in-depth understanding to inform the development and refinement of the mobilized caregiver stress management intervention, Pep-Pal (PsychoEducation and skills for Patient caregivers). Results Overall, results were favorable. Pep-Pal was deemed acceptable for caregivers of patients receiving an auto-HSCT. The refined Pep-Pal program consisted of 9 sessions

  9. Explosive lava-water interactions in Elysium Planitia, Mars: Geologic and thermodynamic constraints on the formation of the Tartarus Colles cone groups

    NASA Astrophysics Data System (ADS)

    Hamilton, Christopher W.; Fagents, Sarah A.; Wilson, Lionel

    2010-09-01

    Volcanic rootless constructs (VRCs) are the products of explosive lava-water interactions. VRCs are significant because they imply the presence of active lava and an underlying aqueous phase (e.g., groundwater or ice) at the time of their formation. Combined mapping of VRC locations, age-dating of their host lava surfaces, and thermodynamic modeling of lava-substrate interactions can therefore constrain where and when water has been present in volcanic regions. This information is valuable for identifying fossil hydrothermal systems and determining relationships between climate, near-surface water abundance, and the potential development of habitable niches on Mars. We examined the western Tartarus Colles region (25-27°N, 170-171°E) in northeastern Elysium Planitia, Mars, and identified 167 VRC groups with a total area of ˜2000 km2. These VRCs preferentially occur where lava is ˜60 m thick. Crater size-frequency relationships suggest the VRCs formed during the late to middle Amazonian. Modeling results suggest that at the time of VRC formation, near-surface substrate was partially desiccated, but that the depth to the midlatitude ice table was $\\lesssim$42 m. This ground ice stability zone is consistent with climate models that predict intermediate obliquity (˜35°) between 75 and 250 Ma, with obliquity excursions descending to ˜25-32°. For lava thicknesses ranging from 30 to 60 m and ground ice fractions ranging from 0.1 to 0.3, an ice volume of ˜4-23 km3 could have been melted and/or vaporized by the time the lava solidified, and the associated hydrothermal systems could have retained temperatures >273 K for up to ˜1300 years.

  10. Stratigraphic correlation of the Awahab and Tafelberg Formations, Etendeka Group, Namibia, and location of an eruptive site for flood basalt volcanism

    NASA Astrophysics Data System (ADS)

    Marsh, J. S.; Milner, S. C.

    2007-08-01

    Detailed field and geochemical investigations in the vicinity of the type section of the Tafelberg Formation of the early Cretaceous Etendeka Group, NW Namibia, have revealed the existence of a large eruptive vent in the lower part of the regional volcanic sequence produced by Strombolian and Vulcanian eruptions. The vent is filled with the thick, differentiated, ponded Kudu-Run olivine-rich basaltic flow, which has a distinctive low Zr/Y geochemical signature as well as a Tafelberg-type tabular basalt and the Nil Desperandum latite. Field evidence indicates that the Kudu-Run basalt and the latite were erupted from fissures located within the vent. Associated with the vent is an extensive pyroclastic apron extending from the vent edge and which is interbedded with the regional stratigraphy. Blocks of Precambrain basement lithologies occur within this deposit and indicate that the vent was excavated to a depth of at least 350 m below the palaeosurface at that time. The original Tafelberg Formation type section described by Erlank et al. [Erlank, A.J., Marsh, J.S., Duncan, A.R., Miller, R.McG., Hawkesworth, C.H., Betton, P.J., Rex, D.C. 1984. Geochemistry and petrogenesis of the Etendeka volcanic rocks from SWA/Namibia, 195-247. In: Erlank, A.J. (Ed.), Petrogenesis of Volcanic Rocks of the Karoo province. Special Publication of the Geological Society of South Africa, vol. 13, 395 p.] the Tafelberg Gully section, crosses from the lower part of the regional sequence into the intra-vent sequence and returns to the regional sequence higher up. In doing so it includes some of the localized intra-vent flows and excludes a number of flows which are part of the regional sequence in its lower part, thus rendering it inappropriate as a type section. A revised type section for the Tafelberg Formation is described by combining the upper part of the Tafelberg Gully section with a new section of 14 flows at the base of the regional sequence in the Tafelberg North (TBN) section

  11. Mixed-Format Test Score Equating: Effect of Item-Type Multidimensionality, Length and Composition of Common-Item Set, and Group Ability Difference

    ERIC Educational Resources Information Center

    Wang, Wei

    2013-01-01

    Mixed-format tests containing both multiple-choice (MC) items and constructed-response (CR) items are now widely used in many testing programs. Mixed-format tests often are considered to be superior to tests containing only MC items although the use of multiple item formats leads to measurement challenges in the context of equating conducted under…

  12. Mixed-Format Test Score Equating: Effect of Item-Type Multidimensionality, Length and Composition of Common-Item Set, and Group Ability Difference

    ERIC Educational Resources Information Center

    Wang, Wei

    2013-01-01

    Mixed-format tests containing both multiple-choice (MC) items and constructed-response (CR) items are now widely used in many testing programs. Mixed-format tests often are considered to be superior to tests containing only MC items although the use of multiple item formats leads to measurement challenges in the context of equating conducted under…

  13. Formative Work to Develop a Tailored HIV Testing Smartphone App for Diverse, At-Risk, HIV-Negative Men Who Have Sex With Men: A Focus Group Study

    PubMed Central

    Torres, Maria Beatriz; Joe, Jennifer; Danh, Thu; Gass, Bobbi; Horvath, Keith J

    2016-01-01

    Background Although gay, bisexual, and other men who have sex with men (MSM) are disproportionately affected by human immunodeficiency virus (HIV) infection, few test for HIV at regular intervals. Smartphone apps may be an ideal tool to increase regular testing among MSM. However, the success of apps to encourage regular testing among MSM will depend on how frequently the apps are downloaded, whether they continue to be used over months or years, and the degree to which such apps are tailored to the needs of this population. Objective The primary objectives of this study were to answer the following questions. (1) What features and functions of smartphone apps do MSM believe are associated with downloading apps to their mobile phones? (2) What features and functions of smartphone apps are most likely to influence MSM’s sustained use of apps over time? (3) What features and functions do MSM prefer in an HIV testing smartphone app? Methods We conducted focus groups (n=7, with a total of 34 participants) with a racially and ethnically diverse group of sexually active HIV-negative MSM (mean age 32 years; 11/34 men, 33%, tested for HIV ≥10 months ago) in the United States in Miami, Florida and Minneapolis, Minnesota. Focus groups were digitally recorded, transcribed verbatim, and deidentified for analysis. We used a constant comparison method (ie, grounded theory coding) to examine and reexamine the themes that emerged from the focus groups. Results Men reported cost, security, and efficiency as their primary reasons influencing whether they download an app. Usefulness and perceived necessity, as well as peer and posted reviews, affected whether they downloaded and used the app over time. Factors that influenced whether they keep and continue to use an app over time included reliability, ease of use, and frequency of updates. Poor performance and functionality and lack of use were the primary reasons why men would delete an app from their phone. Participants also

  14. Formative Work to Develop a Tailored HIV Testing Smartphone App for Diverse, At-Risk, HIV-Negative Men Who Have Sex With Men: A Focus Group Study.

    PubMed

    Mitchell, Jason W; Torres, Maria Beatriz; Joe, Jennifer; Danh, Thu; Gass, Bobbi; Horvath, Keith J

    2016-11-16

    Although gay, bisexual, and other men who have sex with men (MSM) are disproportionately affected by human immunodeficiency virus (HIV) infection, few test for HIV at regular intervals. Smartphone apps may be an ideal tool to increase regular testing among MSM. However, the success of apps to encourage regular testing among MSM will depend on how frequently the apps are downloaded, whether they continue to be used over months or years, and the degree to which such apps are tailored to the needs of this population. The primary objectives of this study were to answer the following questions. (1) What features and functions of smartphone apps do MSM believe are associated with downloading apps to their mobile phones? (2) What features and functions of smartphone apps are most likely to influence MSM's sustained use of apps over time? (3) What features and functions do MSM prefer in an HIV testing smartphone app? We conducted focus groups (n=7, with a total of 34 participants) with a racially and ethnically diverse group of sexually active HIV-negative MSM (mean age 32 years; 11/34 men, 33%, tested for HIV ≥10 months ago) in the United States in Miami, Florida and Minneapolis, Minnesota. Focus groups were digitally recorded, transcribed verbatim, and deidentified for analysis. We used a constant comparison method (ie, grounded theory coding) to examine and reexamine the themes that emerged from the focus groups. Men reported cost, security, and efficiency as their primary reasons influencing whether they download an app. Usefulness and perceived necessity, as well as peer and posted reviews, affected whether they downloaded and used the app over time. Factors that influenced whether they keep and continue to use an app over time included reliability, ease of use, and frequency of updates. Poor performance and functionality and lack of use were the primary reasons why men would delete an app from their phone. Participants also shared their preferences for an app to

  15. Grouped exposed metal heaters

    DOEpatents

    Vinegar, Harold J [Bellaire, TX; Coit, William George [Bellaire, TX; Griffin, Peter Terry [Brixham, GB; Hamilton, Paul Taylor [Houston, TX; Hsu, Chia-Fu [Granada Hills, CA; Mason, Stanley Leroy [Allen, TX; Samuel, Allan James [Kular Lumpar, ML; Watkins, Ronnie Wade [Cypress, TX

    2012-07-31

    A system for treating a hydrocarbon containing formation is described. The system includes two or more groups of elongated heaters. The group includes two or more heaters placed in two or more openings in the formation. The heaters in the group are electrically coupled below the surface of the formation. The openings include at least partially uncased wellbores in a hydrocarbon layer of the formation. The groups are electrically configured such that current flow through the formation between at least two groups is inhibited. The heaters are configured to provide heat to the formation.

  16. Grouped exposed metal heaters

    DOEpatents

    Vinegar, Harold J.; Coit, William George; Griffin, Peter Terry; Hamilton, Paul Taylor; Hsu, Chia-Fu; Mason, Stanley Leroy; Samuel, Allan James; Watkins, Ronnie Wade

    2010-11-09

    A system for treating a hydrocarbon containing formation is described. The system includes two or more groups of elongated heaters. The group includes two or more heaters placed in two or more openings in the formation. The heaters in the group are electrically coupled below the surface of the formation. The openings include at least partially uncased wellbores in a hydrocarbon layer of the formation. The groups are electrically configured such that current flow through the formation between at least two groups is inhibited. The heaters are configured to provide heat to the formation.

  17. Studies in Neotropical paleobotany. XI. Late Tertiaryvegetation and environments of southeastern Guatemala: palynofloras fromthe Mio-Pliocene Padre Miguel Group and the Pliocene HerreriaFormation.

    PubMed

    Graham, A

    1998-10-01

    Plant microfossils are reported from the late Tertiary Padre MiguelGroup and the Pliocene Herrería Formation of southeasternGuatemala. The most abundant palynomorphs are cf. Acrostichum(maximum 45%), Cyperaceae (29%), cf. Antrophyum(27%), monolete fern spores (16%), and Pinus(11%). Pollen grains of Picea, Juglans,Quercus, and Ulmus, primarily from the Padre Miguelflora, reveal the presence of a northern cool-temperate element. Theyounger Herrería flora is more lowland and warm temperate. Inthe absence of evidence for substantially higher elevations, thedifferences between the Neogene and modern vegetation are attributedmostly to climate. MAT (mean annual temperature) is estimated2°-3°C cooler than at present for the Padre Miguel flora,and ∼3.5°C warmer for the Herrería flora. There islittle evidence for arid vegetation, and the tropical rain forest wasabsent or poorly represented. These data are consistent with those ofother fossil floras in the region and with trends suggested by isotopicpaleotemperature analysis and global sea-level changes. The Guatemalaassemblages further provide evidence that the current version of thetropical rain forest is recent in origin and has undergone considerablechange in its range and composition throughout the lateCenozoic.

  18. Chavicol formation in sweet basil (Ocimum basilicum): cleavage of an esterified C9 hydroxyl group with NAD(P)H-dependent reduction.

    PubMed

    Vassão, Daniel G; Gang, David R; Koeduka, Takao; Jackson, Brenda; Pichersky, Eran; Davin, Laurence B; Lewis, Norman G

    2006-07-21

    Propenyl- and allyl-phenols, such as methylchavicol, p-anol and eugenol, have gained importance as flavoring agents and also as putative precursors in the biosynthesis of 9,9'-deoxygenated lignans, many of which have potential medicinal applications. In spite of several decades of investigation, however, the complete biosynthetic pathway to a propenyl/allylphenol had not yet been reported. We have subjected a Thai basil variety accumulating relatively large amounts of the simplest volatile allylphenol, methylchavicol, to in vivo administration of radiolabeled precursors and assays of protein preparations in vitro. Through these experiments, the biosynthesis of chavicol was shown to occur via the phenylpropanoid pathway to p-coumaryl alcohol. Various possibilities leading to deoxygenation of the latter were examined, including reduction of the side-chain double bond to form p-dihydrocoumaryl alcohol, followed by dehydration to afford chavicol, as well as formation of p-methoxycinnamyl alcohol, with further side-chain modification to afford methylchavicol. A third possibility studied was activation of the side-chain alcohol of p-coumaryl alcohol, e.g.via esterification, to form a more facile leaving group via reductive elimination. The latter was shown to be the case using p-coumaryl esters as potential substrates for a NAD(P)H-dependent reductase to afford chavicol, which is then O-methylated to afford methylchavicol.

  19. Paleomagnetic and magnetostratigraphic investigations of the whitehorse group/quartermaster (Dewey Lake) formation (upper permian-lowermost triassic) in the Palo Duro basin, northwest Texas, USA

    NASA Astrophysics Data System (ADS)

    Collins, Dylan R.

    In northwest Texas, upper Permian to lowermost Triassic hematite-cemented detrital sedimentary rocks, which include a small number of regionally extensive ash beds, were deposited during the time interval of the greatest mass extinction event sequences in Earth history. The magnetic polarity stratigraphy, as well as key rock magnetic properties, of the upper Whitehorse Group (WH) and Quartermaster formations (QM) at selected sections in the Palo Duro Basin, have been determined using thermal, and chemical demagnetization approaches and anisotropy of magnetic susceptibility, acquisition of isothermal remanent magnetization (IRM) and backfield demagnetization, and thermal demagnetization of three component IRM methods. Demagnetization results show that the WH/QM contains a primary/near-primary characteristic remanent magnetization at each level sampled and thus the magnetic polarity stratigraphy for each section can be compared with existing polarity time scales across the Permian-Triassic boundary. Estimated site mean directions yield a paleomagnetic pole for the latest Permian for North America of 57.8°N, 130.6°E from 38 sampled sites.

  20. Preliminary paleomagnetic results from the Triassic Prida Formation (Lower Star Peak Group), west-central Nevada, and implications for latitudinal displacement

    SciTech Connect

    Geissman, J.Wm. ); Gillett, S.L. ); Oldow, J.S. )

    1990-05-01

    Paleomagnetic data were obtained from two oppositely dipping carbonate sections of the Triassic Prida Formation, lower Star Peak Group, in the Humboldt Range of west-central Nevada. Progressive demagnetization of the rocks indicated that the remanent magnetization consists of three or fewer vector components. A characteristic component, with the highest unblocking temperatures, was most effectively isolated by low temperature (200-300C) thermal followed by progressive alternating field demagnetization. The sections yield in situ mean directions that differ significantly, but that have similar inclinations (Star Canyon: D=311, I=+34, {alpha}95=5, k=22, N=38 samples; Fossil Hill: D=281, I=+33, {alpha}95=2{degree}, k=2814, N=3 section means, 154 samples). The directions diverge upon simple structural correction, from which the authors infer that at least one and probably both of the sections were remagnetized, probably in latest Middle to Late Jurassic time. These data cannot be used to indicate significant southward translation of Golconda allochthon rocks, as inferred from magnetizations in underlying volcanic rocks. The translation interpretation may require revision if magnetizations in the volcanic rocks are also secondary.

  1. Stacked base-pair structures of adenine nucleosides stabilized by the formation of hydrogen-bonding network involving the two sugar groups

    NASA Astrophysics Data System (ADS)

    Asami, Hiroya; Yagi, Kiyoshi; Ohba, Masashi; Urashima, Shu-hei; Saigusa, Hiroyuki

    2013-06-01

    We have employed a laser desorption technique combined with supersonic-jet cooling for producing base pairs of adenine nucleosides, adenosine (Ado) and N6,N6-dimethyladenosine (DMAdo) under low-temperature conditions. The resulting base pairs are then ionized through resonant two-photon ionization (R2PI) and analyzed by time-of-flight mass spectrometry. It is found that dimers of these adenine nucleosides are stable, especially in the case of DMAdo, with respect to those of the corresponding bases, i.e., adenine and N6,N6-dimethyladenine. Structural analysis of the DMAdo dimer is performed based on the IR-UV double resonance measurements and theoretical calculations. The result demonstrates that the dimer possesses a stacked structure being stabilized by the formation of hydrogen-bonding network involving the two sugar groups. The occurrence of the frequency shift and broadening is explained satisfactorily based on the anharmonic coupling of the OH stretching modes with specific bending modes and low-frequency modes of base and sugar moieties.

  2. Coal geology of the Paleocene-Eocene Calvert Bluff Formation (Wilcox Group) and the Eocene Manning Formation (Jackson Group) in east-central Texas; field trip guidebook for the Society for Organic Petrology, Twelfth Annual Meeting, The Woodlands, Texas, August 30, 1995

    USGS Publications Warehouse

    Warwick, Peter D.; Crowley, Sharon S.

    1995-01-01

    The Jackson and Wilcox Groups of eastern Texas (fig. 1) are the major lignite producing intervals in the Gulf Region. Within these groups, the major lignite-producing formations are the Paleocene-Eocene Calvert Bluff Formation (Wilcox) and the Eocene Manning Formation (Jackson). According to the Keystone Coal Industry Manual (Maclean Hunter Publishing Company, 1994), the Gulf Coast basin produces about 57 million short tons of lignite annually. The state of Texas ranks number 6 in coal production in the United States. Most of the lignite is used for electric power generation in mine-mouth power plant facilities. In recent years, particular interest has been given to lignite quality and the distribution and concentration of about a dozen trace elements that have been identified as potential hazardous air pollutants (HAPs) by the 1990 Clean Air Act Amendments. As pointed out by Oman and Finkelman (1994), Gulf Coast lignite deposits have elevated concentrations of many of the HAPs elements (Be, Cd, Co, Cr, Hg, Mn, Se, U) on a as-received gm/mmBtu basis when compared to other United States coal deposits used for fuel in thermo-electric power plants. Although regulations have not yet been established for acceptable emissions of the HAPs elements during coal burning, considerable research effort has been given to the characterization of these elements in coal feed stocks. The general purpose of the present field trip and of the accompanying collection of papers is to investigate how various aspects of east Texas lignite geology might collectively influence the quality of the lignite fuel. We hope that this collection of papers will help future researchers understand the complex, multifaceted interrelations of coal geology, petrology, palynology and coal quality, and that this introduction to the geology of the lignite deposits of east Texas might serve as a stimulus for new ideas to be applied to other coal basins in the U.S. and abroad.

  3. Iron speciation analysis of 3.2 Ga old DXCL-DP drillcore BIFs and shales of the Dixon Island Formation, Cleaverville Group, Western Australia

    NASA Astrophysics Data System (ADS)

    Fujita, S.; Yamaguchi, K. E.; Yamaguchi, A.; Kiyokawa, S.; Ito, T.; Ikehara, M.

    2016-12-01

    In order to examine redox state of the ocean well before the inferred rise of atmospheric oxygen at around 2.4 Ga ago (a.k.a. GOE; e.g., Holland, 1994), we conducted geochemical studies of the 3.2 Ga old drillcore black shale and banded iron formation (BIF). The samples (CL3 core) that belong to the Cleaverville Group, were recovered in 2011 in the northwestern part of Pilbara district, Western Australia. The samples are free from effects of modern-weathering (containing layer-parallel and disseminated pyrite). We measured abundance of major elements by XRF and different Fe-bearing species (FeHCl, Fecarb, Feox, and Femag) of the 23 samples (17 BIF samples and 6 black shales). Furthermore, we extracted pyrite from 6 black shales by Cr reduction method (Canfield et al. 1986; Kobayashi, 2013) and estimated redox condition based on the DOP (degree of pyritization) values. Black shales in the lower part of the core have Al2O3 content (13.04-18.39 wt.%) that decreased toward upper part of the core where BIF dominates. The black shales have higher FeHR/FeTratios (highly-reactive Fe toward pyrite formation to total Fe). The DOP values of the black shales suggest that their sedimentary environment was anoxic. We then estimated, using mass balance calculation with PAAS (post-Archean Australian Average Shale), the origin of Fe in the samples. We found that Fe in the black shales in the lower part of the core was continental, whereas Fe in the BIF samples in the upper part of the core was mostly hydrothermal. We suggest that the samples used in this study represent environmental transitions from continent-dominated to submarine hydrothermal-dominated, Such environmental transition could be represented by modern Red Sea, where initiation of rifting created sedimentary basin where input of continental materials dominated, input from hydrothermal activity gradually increased, and BIF-like Fe-rich material accumulated. To test the above hypothesis, we will provide trace element

  4. Multiple embryos in the Lepidocyclina pustulosa group as possible indicators of palaeoenvironmental conditions: The case of the Late Eocene Toluviejo Formation (Sinú Domain, Caribbean, Colombia

    NASA Astrophysics Data System (ADS)

    Baumgartner-Mora, Claudia; Baumgartner, Peter O.; Rincón Martínez, Daniel; Salazar Ortiz, Edward A.

    2016-04-01

    The Middle-Late Eocene Toluviejo Formation of the Sinú-San Jacinto folded belt (Caribbean, Colombia) contains 15-75 m thick, grey, massive limestone sequences that are interbedded with terrigenous nearshore to offshore mudstones to quartzose sandstones and conglomerates. The formation accumulated in a transitional continent-ocean setting, probably on oceanic crust. We studied over 80 polished thin sections under light microscopy and cathodoluminescence (CL) to analyse carbonate microfacies and Larger Benthic Foraminifera (LBF). The overall facies distribution is 3-fold: (1) Facies close to the shoreline are dominated by low diversity operculinid assemblages, rich in detrital elements. (2) Shallow offshore facies are characterized by round lepidocyclinids, associated with, and often encrusted by, corallinacean algae, Sporolithon and structureless microbial crusts. The matrix is rich in carbonate/detrital mud and sand-sized detritals. (3) Distal offshore facies on structural highs show abundance of flat, current-sorted lepidoclinids without a noticeable detrital component. Facies 1 and 2 are clearly under the influence of suspension- and dissolved-nutrient input, probably carried offshore by freshwater lids of river plumes. Facies (2) contains abundant specimens of the Lepidocyclina pustulosa group of which the macrospheric forms show complicated embryonic apparatuses, which suppose double or multiple embryos. Detailed observation under CL allows to count up to 6-8 embryos, often seen aligned in the equatorial plane. The embryonic apparatus occupies often more than half of the diameter of specimens. The tendency towards large, very flat embryonic apparatuses (diameter measured in axial cuts up to 2,5 mm for a thickness of 0.2-0.3 mm) is closely correlated with abundant coralgal and microbial encrustations, oxide-stained carbonate/detrital mud and probably some preserved organic matter. The presence of multiple embryos has been reported by several authors and has

  5. Petrography and geochemistry of selected lignite beds in the Gibbons Creek mine (Manning Formation, Jackson Group, Paleocene) of east-central Texas

    USGS Publications Warehouse

    Warwick, P.D.; Crowley, S.S.; Ruppert, L.F.; Pontolillo, J.

    1997-01-01

    This study examined the petrographic and geochemical characteristics of two lignite beds (3500 and 4500 beds, Manning Formation, Jackson Group, Eocene) that are mined at the Gibbons Creek mine in east-central Texas. The purpose of the study was to identify the relations among sample ash yield, coal petrography, and trace-element concentrations in lignite and adjoining rock layers of the Gibbons Creek mine. Particular interest was given to the distribution of 12 environmentally sensitive trace elements (As, Be, Cd, Cr, Co, Hg, Mn, Ni, Pb, Sb, Se, and U) that have been identified as potentially hazardous air pollutants (HAPs) in the United States Clean Air Act Amendments of 1990. Eleven lignite, floor, and rock parting samples were collected from incremental channel samples of the 3500 and 4500 beds that were exposed in a highwall of pit A3 at the Gibbons Creek mine. Short proximate and ultimate and forms of sulfur analyses were performed on all lignite samples, and lignite and rock samples were analyzed for 60 major, minor and trace elements. Representative splits of all lignite samples were ground and cast into pellets, and polished for petrographic analyses in blue-light fluorescence and reflected white light to determine liptinite, inertinite, and huminite maceral group percentages. The following observations summarize our results and conclusions about the geochemistry, petrography, and sedimentology of the 3500 and 4500 beds of the Gibbons Creek lignite deposit: (1) Weighted average dry (db) ash yield for the two beds is 29.7%, average total sulfur content is 2.6%, and average calorific value is 7832 Btu (18.22 MJ/kg). Ash yields are greatest in the lower bench (59.33% db) of the 3500 bed and in the upper bench of the 4500 bed (74.61% db). (2) For lignite samples (on a whole-coal basis), the distributions of two of the HAPs (Pb and Sb) are positively related to ash yield, probably indicating an inorganic affinity for these elements. By using cluster analysis we

  6. Paleomagnetic results from the Upper Unkar Group and overlying Nankoweap Formation from the Grand Canyon Supergroup (GCSG), Arizona: Implications for Laurentia's Neoproterozoic APWP

    NASA Astrophysics Data System (ADS)

    Weil, A. B.; Geissman, J.; Van der Voo, R.

    2001-12-01

    Paleomagnetic sampling was carried out within the Cardenas basalts and an underlying suite of mafic intrusions from the uppermost Unkar Group (lower GCSG), as well as from the unconformably overlying Nankoweap Fm. The GCSG is one of the thickest and best preserved Neoproterozoic sequences in North America. The lower GCSG was deposited between 1200 Ma (cooling age of the underlying Vishnu schist) and about 1100 Ma (Rb-Sr dates on Cardenas basalts) during a failed rift event. The Nankoweap Fm. is hypothesized to have been deposited during extension subsequent to deposition of the lower GCSG; however, the relationship of the Nankoweap Fm. to the underlying lower GCSG and the overlying upper GCSG is poorly understood. The estimated age of the Nankoweap Fm. is 950 Ma. Sixteen sites were collected from the Cardenas basalts and from a suite of dikes and sills that intrude the Unkar Group. The dikes and sills are considered feeders to the Cardenas basalt, based on geochemical similarities and stratigraphic relationships. After thermal treatment the sixteen sites yield a stable characteristic magnetization direction of D = 286\\deg %, I = +58\\deg % (kappa = 26, alpha95 = 7), corresponding to a paleopole of 181\\deg % E, 33\\deg % N. The remanence in the intrusions is confirmed by a partial contact test on host Dox Formation strata. The samples collected along the margin of the dikes give statistically the same normal-polarity direction as the intrusion; however, samples more than several dike widths from the contact yield mainly unresolvable characteristic remanence directions. Nine sites were collected from the Nankoweap Fm., which unconformably overlies the Cardenas basalts. After thermal treatment the nine sites yield a stable characteristic magnetization direction of D = 257\\deg %, I = -3\\deg % (kappa = 80, alpha95 = 7.5), which corresponds to a paleopole of 165\\deg % E, 11\\deg % S. A fold test of the nine sites reveals a pre-folding magnetization acquisition

  7. Specific HIV-1 TAR RNA loop sequence and functional groups are required for human cyclin T1-Tat-TAR ternary complex formation.

    PubMed

    Richter, Sara; Cao, Hong; Rana, Tariq M

    2002-05-21

    Replication of human immunodeficiency virus requires Tat protein which activates elongation of RNA polymerase II transcription at the HIV-1 promoter through interaction with the cyclin T1 (CycT1) subunit of the positive transcription elongation factor complex (P-TEFb). Tat binds directly through its transactivation domain to the CycT1 subunit of the P-TEFb and induces loop sequence specific binding of the P-TEFb onto nascent HIV-1 TAR RNA. By using a gel electrophoresis method and a comprehensive set of TAR loop mutants, we have identified the sequence and structural determinants for high-affinity CycT1-Tat-TAR ternary complex formation. Our results show that CycT1 and Tat binding to TAR RNA is highly cooperative, and a capacity of 85%, a Hill coefficient of 2.7, and a dissociation constant (K(D)) of 2.45 nM were observed. These results indicate that there are three binding sites on TAR RNA. CycT1 does not bind TAR RNA in the absence of Tat, and Tat binding to TAR, while detectable, is very inefficient in the absence of CycT1. It is conceivable that the CycT1-Tat heterodimer directly binds to TAR RNA in the U-rich RNA bulge region and this binding facilitates the interactions of the CycT1-Tat heterodimer at the other two sites in the RNA loop region. On the basis of our results, we suggest a model where CycT1 interacts with Tat protein and positions the protein complex to make contacts with the G34 region of the loop sequence; G34 is critical for CycT1-Tat binding and forms a C30.G34 base pair. Two functional groups, O6 and N7, at nucleotide positions 32 and 34 in the TAR loop are essential for CycT1-Tat interactions with TAR RNA. The identity of two nucleotides, U31 and G33, is not critical, but they contribute to the stabilization of the RNA-protein complex. The presence of a single-nucleotide bulge of A35 or C35 is essential for distortion of the backbone RNA structure as well as the accessibility of functional groups in the major groove of the double

  8. Preventing aspartimide formation in Fmoc SPPS of Asp-Gly containing peptides--practical aspects of new trialkylcarbinol based protecting groups.

    PubMed

    Behrendt, Raymond; Huber, Simon; White, Peter

    2016-02-01

    In our efforts to develop a universal solution to the problem of aspartimide formation in Fmoc SPPS, we investigated the application of our new β-trialkylmethyl protected aspartic acid building blocks to the synthesis of peptides containing the Asp-Gly motif. The N(α)-Fmoc aspartic acid β-tri-(ethyl/propyl/butyl)methyl esters were used in the synthesis of the classic model peptide scorpion toxin II (VKDGYI), and their effectiveness in minimising aspartimide formation during extended piperidine treatments was evaluated. Furthermore, we compared their efficacy against that of the commonly used approach of adding acids to the Fmoc deprotection solution. Finally, we applied our aspartic acid building blocks to the stepwise Fmoc SPPS of teduglutide, a human GLP-2 analogue, whose synthesis is made challenging by extensive aspartimide formation. In all experiments, our approach led to almost complete reduction of aspartimide formation with accompanied suppression of aspartic acid epimerisation.

  9. Prediction of Enthalpy of Formation in the Solid State (at 298.15K) Using Second-Order Group Contributions—Part 2: Carbon-Hydrogen, Carbon-Hydrogen-Oxygen, and Carbon-Hydrogen-Nitrogen-Oxygen Compounds

    NASA Astrophysics Data System (ADS)

    Salmon, Anna; Dalmazzone, Didier

    2007-03-01

    A program has been undertaken to develop a new group contribution method, based on Benson's group additivity technique, estimate as precisely as possible solid state enthalpies of formation, at 298.15K, of C -H compounds, C -H-O compounds, and C -H-N-O compounds. A set of 1017 experimental values of the enthalpy of formation has been studied and compared to the predicted values of this new method as well as the method of Domalski and Hearing. This new estimation technique leads to a higher precision and reliability. With the inclusion of additional group values, a wider range of compounds can be studied (compared to the Domalski and Hearing technique). Comparison with a quantum mechanical method [Rice et al., Combust. Flame 118, 445 (1999)] shows that the list of group contribution values, ring strain corrections, and non-nearest neighbor interactions provided here yields better estimates overall.

  10. Stratigraphic and structural data for the Conasauga Group and the Rome Formation on the Copper Creek fault block near Oak Ridge, Tennessee: preliminary results from test borehole ORNL-JOY No. 2

    SciTech Connect

    Haase, C.S.; Walls, E.C.; Farmer, C.D.

    1985-06-01

    To resolve long-standing problems with the stratigraphy of the Conasauga Group and the Rome Formation on the Copper Creek fault block near Oak Ridge National Laboratory (ORNL), an 828.5-m-deep test borehole was drilled. Continuous rock core was recovered from the 17.7- to 828.5-m-deep interval; temperature, caliper, neutron, gamma-ray, and acoustic (velocity and televiewer) logs were obtained. The Conasauga Group at the study site is 572.4 m thick and comprises six formations that are - in descending stratigraphic order - Maynardville Limestone (98.8 m), Nolichucky Shale (167.9 m), Maryville Limestone (141.1 m), Rogersville Shale (39.6 m), Rutledge Limestone (30.8 m), and Pumpkin Valley Shale (94.2 m). The formations are lithologically complex, ranging from clastics that consist of shales, mudstones, and siltstones to carbonates that consist of micrites, wackestones, packstones, and conglomerates. The Rome Formation is 188.1 m thick and consists of variably bedded mudstones, siltstones, and sandstones. The Rome Formation thickness represents 88.1 m of relatively undeformed section and 100.0 m of highly deformed, jumbled, and partially repeated section. The bottom of the Rome Formation is marked by a tectonic disconformity that occurs within a 46-m-thick, intensely deformed interval caused by motion along the Copper Creek fault. Results from this study establish the stratigraphy and the lithology of the Conasauga Group and the Rome Formation near ORNL and, for the first time, allow for the unambiguous correlation of cores and geophysical logs from boreholes elsewhere in the ORNL vicinity. 45 refs., 26 figs., 2 tabs.

  11. The Distribution of Instructional Time and Its Effect on Group Cohesion in the Foreign Language Classroom: A Comparison of Intensive and Standard Format Courses

    ERIC Educational Resources Information Center

    Hinger, Barbara

    2006-01-01

    This paper argues for the influence of the distribution of instructional time on group cohesion in the foreign language classroom and postulates that concentrating classroom time enhances group cohesion. To test the hypothesis, a comparative classroom study of two groups of Spanish learners in their second year of learning, one following an…

  12. The hormonal and behavioral response to group formation, seasonal changes, and restraint stress in the highly social Malayan Flying Fox (Pteropus vampyrus) and the less social Little Golden-mantled Flying Fox (Pteropus pumilus) (Chiroptera: Pteropodidae).

    PubMed

    Reeder, DeeAnn M; Kosteczko, Nicole S; Kunz, Thomas H; Widmaier, Eric P

    2006-04-01

    This study examined behavioral and physiological responses (changes in inter-animal spacing, total glucocorticoids, testosterone, and body mass) to the formation of breeding and same-sex groups in two bat species, the socially gregarious Malayan Flying Fox (Pteropus vampyrus) and the less social Little Golden-mantled Flying Fox (Pteropus pumilus). We hypothesized that social instability, especially in the breeding groups and especially in P. vampyrus, would result in elevated glucocorticoids and that social facilitation of breeding and/or male-male competition would result in persistently higher levels of testosterone in breeding males. Seasonal rhythms in all measures were also predicted, and the glucocorticoid stress response was expected to vary by sex, season, and group type. Nearly all animals responded to group formation with elevated glucocorticoids, but, for breeding animals (especially aggressive male P. vampyrus), these responses persisted over time. In both species, breeding group formation resulted in elevated testosterone in males. Glucocorticoids, testosterone, testes volume, and body mass generally peaked in the breeding season in males (late summer and early autumn), but the seasonal glucocorticoid peak in females occurred in late winter and early spring. All animals responded to restraint stress with elevations in glucocorticoids that largely did not differ by sex, time of year, reproductive condition, group type, or, in lactating females, the presence of her pup. Changes in both behavior and physiology were more evident in P. vampyrus than in P. pumilus, and we believe that their underlying social differences influenced their responses to group formation and to the changing seasonal environment.

  13. Stratigraphy, sedimentology, and ichnology of the Late Pennsylvanian Glenshaw Formation (Lower Conemaugh Group), southern Dunkard basin, Ohio-Kentucky-West Virginia

    SciTech Connect

    Martino, R.L. . Dept. of Geology)

    1994-03-01

    Facies analysis of outcrops of the Glenshaw Formation was carried out at 45 localities over a 761 sq. km area. The glenshaw Formation is 61--76 m thick in the study area. Four marine units (Lower Brush Creek, Upper Brush Creek, Cambridge , and Ames) occur which contain invertebrate body fossils and/or trace fossils including Teichichnus, Rhizocorallium, Aulichnites, Paleophycus, Lockeia, and Curvolithus. Alluvial channel-fills contain internal features that reflect deposition in high sinuosity suspended or mixed load rivers. Paleocurrent data (N = 77) are broadly dispersed with a mean azimuth of 335 degrees. Overbank facies have yielded trackways from giant arthropods and Eryopoid amphibians (Limnopus). There are fewer marine units in the glenshaw than toward the north and west which has made direct detailed correlation of much of the formation problematic. The coal beds and marine units used previous stratigraphic studies may be extended through the recognition of non-coal-bearing paleosols and marine-influenced intervals distinguished by facies relations, and sedimentary and biogenic structures. Nine laterally persistent, paleosol-bounded packages occur which are comparable to allocyclic T-R units reported by Busch and Rollins (1984) from Pennsylvania and Ohio. Alternating episodes of soil formation and alluvial aggradation may reflect updip coastal plain responses to low stand incision of drainage lines and sediment bypassing followed by aggradation of alluvial systems in response to rising sea level. Climate changes may also have played a role in sediment flux.

  14. U.S.-Russian joint study report of geologic disposition options for excess plutonium from dismantled nuclear weapons: combined report, Group 5: burial in geological formations

    SciTech Connect

    Gupalo, T.A.; Jardine, L.J.

    1996-09-01

    This report summarizes the Joint U.S.-Russian Studies of the Geologic Disposal Working Group. The group evaluated a consistent set of geologic disposal options in conjunction with five other working groups for disposition of excess plutonium from dismantled weapons. Mutually agreed-to technical facts and findings were identified for all of the studied excess plutonium disposal forms. These findings were summarized in terms of five joint study criteria identified during the January 1994 Summit between Presidents Yeltsin and Clinton.

  15. Production and testing of the ENEA-Bologna VITJEFF32.BOLIB (JEFF-3.2) multi-group (199 n + 42 γ) cross section library in AMPX format for nuclear fission applications

    NASA Astrophysics Data System (ADS)

    Pescarini, Massimo; Orsi, Roberto; Frisoni, Manuela

    2017-09-01

    The ENEA-Bologna Nuclear Data Group produced the VITJEFF32.BOLIB multi-group coupled neutron/photon (199 n + 42 γ) cross section library in AMPX format, based on the OECD-NEA Data Bank JEFF-3.2 evaluated nuclear data library. VITJEFF32.BOLIB was conceived for nuclear fission applications as European counterpart of the ORNL VITAMIN-B7 similar library (ENDF/B-VII.0 data). VITJEFF32.BOLIB has the same neutron and photon energy group structure as the former ORNL VITAMIN-B6 reference library (ENDF/B-VI.3 data) and was produced using similar data processing methodologies, based on the LANL NJOY-2012.53 nuclear data processing system for the generation of the nuclide cross section data files in GENDF format. Then the ENEA-Bologna 2007 Revision of the ORNL SCAMPI nuclear data processing system was used for the conversion into the AMPX format. VITJEFF32.BOLIB contains processed cross section data files for 190 nuclides, obtained through the Bondarenko (f-factor) method for the treatment of neutron resonance self-shielding and temperature effects. Collapsed working libraries of self-shielded cross sections in FIDO-ANISN format, used by the deterministic transport codes of the ORNL DOORS system, can be generated from VITJEFF32.BOLIB through the cited SCAMPI version. This paper describes the methodology and specifications of the data processing performed and presents some results of the VITJEFF32.BOLIB validation.

  16. Enzymatic formation of a novel cell-adhesive hydrogel based on small peptides with a laterally grafted l-3,4-dihydroxyphenylalanine group

    NASA Astrophysics Data System (ADS)

    Xu, J. X.; Zhou, Z.; Wu, B.; He, B. F.

    2014-01-01

    We rationally designed a bioadhesive supramolecular hydrogel by introducing l-3,4-dihydroxylphenylalanine (DOPA) groups while properly integrating the enzymatic reactions and self-assembly processes. The effective presence of the catechol groups successfully promoted the adhesion and proliferation of human fibroblast cells.We rationally designed a bioadhesive supramolecular hydrogel by introducing l-3,4-dihydroxylphenylalanine (DOPA) groups while properly integrating the enzymatic reactions and self-assembly processes. The effective presence of the catechol groups successfully promoted the adhesion and proliferation of human fibroblast cells. Electronic supplementary information (ESI) available: Detailed experimental procedures, synthesis and characterization of the compounds and hydrogel preparation. See DOI: 10.1039/c3nr04528e

  17. Control of Rh{sup I}(CO){sub 2} formation on Rh/Al{sub 2}O{sub 3} catalysts by complexation of surface -OH groups using NH{sub 3}

    SciTech Connect

    Paul, D.K.; Marten, C.D.; Yates, J.T. Jr.

    1999-06-22

    It has been shown that the isolated -OH groups present on a Rh/Al{sub 2}O{sub 3} catalyst form a weak H-bonded complex by exposure to gas-phase NH{sub 3} at 298 K. This reversible complex suppresses the tendency for isolated -OH groups to participate in the oxidation of metallic Rh. forming Rh{sup I}(CO){sub 2}/Al{sub 2}O{sub 3} species in the presence of a CO atmosphere. There is no IR spectroscopic evidence for the formation of MH{sub 4}{sup +} during surface complexation. However, evidence for NH{sub 2} formation at Lewis base sites on Al{sub 2}O{sub 3} is found.

  18. Eustatic control on early dolomitization of cyclic peritidal carbonates: Evidence from the Early Ordovician Upper Knox Group, Appalachians and Middle to Late Cambrian Bonanza King Formation, southern Great basin

    SciTech Connect

    Montanez, I.P. )

    1991-03-01

    The origin of massive dolomite in ancient cyclic carbonate successions remains a poorly resolved issue reflecting the lack of modern analogs of extensive dolomitization. This paper presents evidence for extensive synsedimentary dolomitization of peritidal cyclic carbonates of the Early Ordovician upper Knox Group, Appalachians, and of the Middle to Late Cambrian Bonanza King Formation, southern Great basin. Early dolomitization of these Cambro-Ordovician carbonates was synchronous with regressive conditions governed by superimposed sea-level oscillations (fifth-, fourth-, and third-order).

  19. Regioselective Photoisomerization/C-C Bond Formation of Asymmetric B(ppy)(Mes)(Ar): The Role of the Aryl Groups on Boron.

    PubMed

    Mellerup, Soren K; Li, Cally; Peng, Tai; Wang, Suning

    2017-05-22

    Asymmetric N,C-chelate organoboron compounds bearing two different aryl groups at the boron center undergo photoisomerization reactions that involve exclusively the less bulky aryl group, generating various strongly colored "dark isomers". These species thermally isomerize to 4bH-azaborepin molecules by direct hydrogen atom transfer from a borirane cycle to the pyridyl moiety and ring expansion. Mechanistic insight into these highly regioselective transformations was obtained from kinetic data and through computational studies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. In situ formation of adhesive hydrogels based on PL with laterally grafted catechol groups and their bonding efficacy to wet organic substrates.

    PubMed

    Ye, Mingming; Jiang, Rui; Zhao, Jin; Zhang, Juntao; Yuan, Xubo; Yuan, Xiaoyan

    2015-12-01

    Adhesives with catechol moieties have been widely investigated in recent years. However, actually how much catechol groups for these mussel bio-inspired adhesives, especially in their natural form under physiological condition, is appropriate to bond with organic substrates has not been studied intensively. This study blends ε-polylysine (PL), featuring laterally grafted catechols under physiological conditions (pH 7.4), with oxidized dextran to form a hydrogel in situ via the Schiff base without introducing small cytotoxic molecules as crosslinking agents. It finds that the amount of catechol groups imposes an obvious influence on gelation time, swelling behavior, and hydrogel morphology. Both the storage modulus and adhesion strength are found to increase first and decrease afterwards with an increase of pendent catechol content. Furthermore, catechol hydrogen interactions and the decrease in the crosslink density derived from the decrease of amino groups on PL are simultaneously found to affect the storage modulus. Meanwhile, multiple hydrogen-bonding interactions of catechol with amino, hydroxyl, and carboxyl groups, which are in abundance on the surface of tissue, are mainly found to provide an adhesive force. The study finds that with more catechol, there is a greater chance that the cohesive force will weaken, making the entire adhesion strength of the hydrogel decrease. Using a cytotoxicity test, the nontoxicity of the hydrogel towards the growth of L929 cells is proven, indicating that hydrogels have potential applications in soft tissue repair under natural physiological conditions.

  1. Oxalates as Activating Groups for Alcohols in Visible Light Photoredox Catalysis: Formation of Quaternary Centers by Redox-Neutral Fragment Coupling

    PubMed Central

    MacMillan, David W. C.; Overman, Larry E.

    2015-01-01

    Alkyl oxalates are new bench-stable alcohol-activating groups for radical generation under visible light photoredox conditions. Using these precursors, the first net redox-neutral coupling of tertiary and secondary alcohols with electron-deficient alkenes is achieved. PMID:26322524

  2. Mutational analysis of bacteriophage T4 RNA ligase 1. Different functional groups are required for the nucleotidyl transfer and phosphodiester bond formation steps of the ligation reaction.

    PubMed

    Wang, Li Kai; Ho, C Kiong; Pei, Yi; Shuman, Stewart

    2003-08-08

    T4 RNA ligase 1 (Rnl1) exemplifies an ATP-dependent RNA ligase family that includes fungal tRNA ligase (Trl1) and a putative baculovirus RNA ligase. Rnl1 acts via a covalent enzyme-AMP intermediate generated by attack of Lys-99 N zeta on the alpha phosphorus of ATP. Mutation of Lys-99 abolishes ligase activity. Here we tested the effects of alanine mutations at 19 conserved positions in Rnl1 and thereby identified 9 new residues essential for ligase activity: Arg-54, Lys-75, Phe-77, Gly-102, Lys-119, Glu-227, Gly-228, Lys-240, and Lys-242. Seven of the essential residues are located within counterparts of conserved nucleotidyltransferase motifs I (99KEDG102), Ia (118SK119), IV (227EGYVA231), and V (238HFKIK242) that comprise the active sites of DNA ligases, RNA capping enzymes, and T4 RNA ligase 2. Three other essential residues, Arg-54, Lys-75 and Phe-77, are located upstream of the AMP attachment site within a conserved domain unique to the Rnl1-like ligase family. We infer a shared evolutionary history and active site architecture in Rnl1 (a tRNA repair enzyme) and Trl1 (a tRNA splicing enzyme). We determined structure-activity relationships via conservative substitutions and examined mutational effects on the isolated steps of Rnl1 adenylylation (step 1) and phosphodiester bond formation (step 3). Lys-75, Lys-240, and Lys-242 were found to be essential for step 1 and overall ligation of 5'-phosphorylated RNA but not for phosphodiester bond formation. These results suggest that the composition of the Rnl1 active site is different during steps 1 and 3. Mutations at Arg-54 and Lys-119 abolished the overall RNA ligation reaction without affecting steps 1 and 3. Arg-54 and Lys-119 are thereby implicated as specific catalysts of the RNA adenylation reaction (step 2) of the ligation pathway.

  3. Clinical user experiences of observation and response charts: focus group findings of using a new format chart incorporating a track and trigger system.

    PubMed

    Elliott, Doug; Allen, Emily; Perry, Lin; Fry, Margaret; Duffield, Christine; Gallagher, Robyn; Iedema, Rick; McKinley, Sharon; Roche, Michael

    2015-01-01

    Optimising clinical responses to deteriorating patients is an international indicator of acute healthcare quality. Observation charts incorporating track and trigger systems are an initiative to improve early identification and response to clinical deterioration. A suite of track and trigger 'Observation and Response Charts' were designed in Australia and initially tested in simulated environments. This paper reports initial clinical user experiences and views following implementation of these charts in adult general medical-surgical wards. Across eight trial sites, 44 focus groups were conducted with 218 clinical ward staff, mostly nurses, who received training and had used the charts in routine clinical practice for the preceding 2-6 weeks. Transcripts of audio recordings were analysed for emergent themes using an inductive approach. In this exploration of initial user experiences, key emergent themes were: tensions between vital sign 'ranges versus precision' to support decision making; using a standardised 'generalist chart in a range of specialist practice' areas; issues of 'clinical credibility', 'professional autonomy' and 'influences of doctors' when communicating abnormal signs; and 'permission and autonomy' when escalating care according to the protocol. Across themes, participants presented a range of positive, negative or mixed views. Benefits were identified despite charts not always being used up to their optimal design function. Participants reported tensions between chart objectives and clinical practices, revealing mismatches between design characteristics and human staff experiences. Overall, an initial view of 'increased activity/uncertain benefit' was uncovered. Findings particularly reinforced the significant influences of organisational work-based cultures, disciplinary boundaries and interdisciplinary communication on implementation of this new practice chart. Optimal use of all chart design characteristics will be possible when these

  4. Evolutionary tree design: An exploratory study of the influence of linear versus branching format on visitors' interpretation and understanding across age groups

    NASA Astrophysics Data System (ADS)

    MacDonald, Teresa Elise

    This exploratory study sought to investigate the influence of tree graphic design---specifically linear versus branching depictions of taxa---on visitors in three different age groups (aged 11-13, 14-18, adults) interpretation and understanding using a multiple-case study strategy. The findings from this research indicate that linear and branched depictions elicit qualitatively different narratives and explanations about the relationships between the taxa in all age groups. Branched tree graphics support scientifically appropriate explanations of evolutionary relationships, i.e. that taxa are related via shared or common ancestry; while linear representations reinforce intuitive interpretations of ancestor-descendant or anagenic relationships. Furthermore, differences in the language used for linear and branched trees suggests that there is a spectrum within an analogy of developmental change that is thought to serve as a transitional concept between intuitive and scientific understanding--with 'evolved from' for branched depictions of taxa representing a shift towards an interpretation of shared ancestry rather than an individual transformation from one thing into another. In addition, branched graphics appear to support the correct reading and interpretation of shared or common ancestry in tree diagrams. Mixed reasoning was common and overall reasoning patterns were broadly similar among participants in all age groups, however, older youth (aged 14 to 18) and adults often provided more detail in their explanations and sometimes included references to evolutionary ideas such as variation, inheritance and selection.

  5. Host group formation decreases exposure to vector-borne disease: a field experiment in a ‘hotspot’ of West Nile virus transmission

    PubMed Central

    Krebs, Bethany L.; Anderson, Tavis K.; Goldberg, Tony L.; Hamer, Gabriel L.; Kitron, Uriel D.; Newman, Christina M.; Ruiz, Marilyn O.; Walker, Edward D.; Brawn, Jeffrey D.

    2014-01-01

    Animals can decrease their individual risk of predation by forming groups. The encounter-dilution hypothesis extends the potential benefits of gregariousness to biting insects and vector-borne disease by predicting that the per capita number of insect bites should decrease within larger host groups. Although vector-borne diseases are common and can exert strong selective pressures on hosts, there have been few tests of the encounter-dilution effect in natural systems. We conducted an experimental test of the encounter-dilution hypothesis using the American robin (Turdus migratorius), a common host species for the West Nile virus (WNV), a mosquito-borne pathogen. By using sentinel hosts (house sparrows, Passer domesticus) caged in naturally occurring communal roosts in the suburbs of Chicago, we assessed sentinel host risk of WNV exposure inside and outside of roosts. We also estimated per capita host exposure to infected vectors inside roosts and outside of roosts. Sentinel birds caged inside roosts seroconverted to WNV more slowly than those outside of roosts, suggesting that social groups decrease per capita exposure to infected mosquitoes. These results therefore support the encounter-dilution hypothesis in a vector-borne disease system. Our results suggest that disease-related selective pressures on sociality may depend on the mode of disease transmission. PMID:25339722

  6. Adenine derivatives as phosphate-activating groups for the regioselective formation of 3',5'-linked oligoadenylates on montmorillonite: possible phosphate-activating groups for the prebiotic synthesis of RNA

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Ferris, J. P.

    1997-01-01

    Methyladenine and adenine N-phosphoryl derivatives of adenosine 5'-monophosphate (5'-AMP) and uridine 5'-monophosphate (5'-UMP) are synthesized, and their structures are elucidated. The oligomerization reactions of the adenine derivatives of 5'-phosphoramidates of adenosine on montmorillonite are investigated. 1-Methyladenine and 3-methyladenine derivatives on montmorillonite yielded oligoadenylates as long as undecamer, and the 2-methyladenine and adenine derivatives on montmorillonite yielded oligomers up to hexamers and pentamers, respectively. The 1-methyladenine derivative yielded linear, cyclic, and A5'ppA-derived oligonucleotides with a regioselectivity for the 3',5'-phosphodiester linkages averaging 84%. The effect of pKa and amine structure of phosphate-activating groups on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidate of adenosine are discussed. The binding and reaction of methyladenine and adenine N-phosphoryl derivatives of adenosine are described.

  7. Adenine derivatives as phosphate-activating groups for the regioselective formation of 3',5'-linked oligoadenylates on montmorillonite: possible phosphate-activating groups for the prebiotic synthesis of RNA

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Ferris, J. P.

    1997-01-01

    Methyladenine and adenine N-phosphoryl derivatives of adenosine 5'-monophosphate (5'-AMP) and uridine 5'-monophosphate (5'-UMP) are synthesized, and their structures are elucidated. The oligomerization reactions of the adenine derivatives of 5'-phosphoramidates of adenosine on montmorillonite are investigated. 1-Methyladenine and 3-methyladenine derivatives on montmorillonite yielded oligoadenylates as long as undecamer, and the 2-methyladenine and adenine derivatives on montmorillonite yielded oligomers up to hexamers and pentamers, respectively. The 1-methyladenine derivative yielded linear, cyclic, and A5'ppA-derived oligonucleotides with a regioselectivity for the 3',5'-phosphodiester linkages averaging 84%. The effect of pKa and amine structure of phosphate-activating groups on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidate of adenosine are discussed. The binding and reaction of methyladenine and adenine N-phosphoryl derivatives of adenosine are described.

  8. Geochemistry and diagenesis of stratabound calcite cement layers within the Rannoch Formation of the Brent Group, Murchison Field, North Viking Graben (northern North Sea)

    NASA Astrophysics Data System (ADS)

    Prosser, D. J.; Daws, J. A.; Fallick, A. E.; Williams, B. P. J.

    1993-11-01

    Up to four calcite-cemented horizons (doggers) form impermeable barriers to fluid flow within the Middle Jurassic Rannoch Formation and are correlatable across the Murchison Field. Calcite precipitated during early diagenesis, within high porosity/permeability sandstones at the top of coarsening (shoaling) upward shoreface cycles. Calcite δ 13C and δ 18O compositions range from -4.1 to -13.4‰ PDB, and -6.6 to -16.7‰ PDB, respectively. Sr concentrations of up to 1334 ppm are consistent with marine carbonate sources (probably shell fragments), but no viable intraformational carbonate source has been identified in the Murchison Field area. Initial 87Sr/ 86Sr compositions (0.71109-0.71266) are higher than Middle Jurassic seawater (0.7073), and consistent with precipitation from modified porewaters containing significant proportions of continentally derived "meteoric" fluids enriched in 87Sr as a result of basement weathering, or percolation through hinterland soils/unconsolidated detritus. An internal source of 87Sr is not considered viable in view of the high proportion (up to 25‰ clastic constituents) of unaltered detrital alkali feldspar and mica within the Rannoch Formation. Geochemical and isotope data indicate correlations between increasing δ 18O composition and increasing iron and magnesium content within calcite. Calcium concentrations decrease with increasing δ 18O for calcites. Geochemical data trends can be interpreted differently in terms of either "static" or "evolving" δ 18O porewater models. Static δ 18O porewater models using Jurassic/Early Cretaceous "meteoric" water ( δ 18O = -6‰; SMOW) predict cement precipitation temperatures of 17-77°C. However, δ 13C compositions are more depleted than those typical of carbon derived from shell debris, and correlation between decreasing δ 18O and decreasing δ 13C suggests modification of a meteoric-derived porewater system during burial via contribution of low δ 13C carbon derived from a deep

  9. Humphry Fortescue Osmond (1917-2004), a radical and conventional psychiatrist: The transcendent years.

    PubMed

    Kaplan, Robert M

    2016-02-01

    This article describes the life and work of the psychiatrist Humphry Osmond who pursued a radical path as a psychiatrist while he remained within the establishment. To the public mind however, he is best known as the man who introduced Aldous Huxley to mescaline and coined the iconic word psychedelic. From an early stage of his career, Henry Osmond embraced new ideas to break the nexus in psychiatry at a time when neither biological nor psychoanalytic treatments were shown to have much benefit. To do this, he joined the radical social experiment in health in the Canadian province of Saskatchewan where he initiated a range of innovations that attracted international attention, as well as controversy over his espousal of the use of hallucinogens better to understand the experiences of psychotic patients.

  10. A study on the ability of quaternary ammonium groups attached to a polyurethane foam wound dressing to inhibit bacterial attachment and biofilm formation.

    PubMed

    Tran, Phat L; Hamood, Abdul N; de Souza, Anselm; Schultz, Gregory; Liesenfeld, Bernd; Mehta, Dilip; Reid, Ted W

    2015-01-01

    Bacterial infection of acute and chronic wounds impedes wound healing significantly. Part of this impediment is the ability of bacterial pathogens to grow in wound dressings. In this study, we examined the effectiveness of a polyurethane (PU) foam wound dressings coated with poly diallyl-dimethylammonium chloride (pDADMAC-PU) to inhibit the growth and biofilm development by three main wound pathogens, Staphylococcus aureus, Pseudomonas aeruginosa, and Acinetobacter baumannii, within the wound dressing. pDADMAC-PU inhibited the growth of all three pathogens. Time-kill curves were conducted both with and without serum to determine the killing kinetic of pDADMAC-PU. pDADMAC-PU killed S. aureus, A. baumannii, and P. aeruginosa. The effect of pDADMAC-PU on biofilm development was analyzed quantitatively and qualitatively. Quantitative analysis, colony-forming unit assay, revealed that pDADMAC-PU dressing produced more than eight log reduction in biofilm formation by each pathogen. Visualization of the biofilms by either confocal laser scanning microscopy or scanning electron microscopy confirmed these findings. In addition, it was found that the pDADMAC-PU-treated foam totally inhibited migration of bacteria through the foam for all three bacterial strains. These results suggest that pDADMAC-PU is an effective wound dressing that inhibits the growth of wound pathogens both within the wound and in the wound dressing.

  11. Can ancient shelf sand ridges be mistaken for Gilbert-type deltas? Examples from the Vryheid Formation, Ecca Group, KwaZulu-Natal, South Africa

    NASA Astrophysics Data System (ADS)

    Green, Andrew N.; Smith, Alan M.

    2012-11-01

    Medium scale clinoforms within sandstones of the Vryheid Formation, northern KwaZulu-Natal, South Africa have in the past been interpreted as the products of Gilbert-type or river-dominated deltaic deposition. Detailed sedimentary logging of these rocks reveals a tempestite association, overlain by a series of moderate to very large scale climbing bedforms. These are intersected at various stratigraphic levels by massive sandstone filled channels, some with subordinate rippled bases, which are orthogonally orientated to the largest scale bedding surfaces (clinoforms) of the climbing bedform association. The sedimentary architecture is dominated by the south-easterly, south-westerly and north-westerly dipping clinoforms, all orientated oblique to the east-west trending palaeo-coastline. Local dip direction reversals are commonplace. This is at odds with Gilbert-type or river-dominated deltaic settings where: (1) sediment progrades normal to the shoreline; (2) distributary channels do not intersect the underlying deltaic foresets orthogonally; and (3) wave action is typically limited. We subsequently interpret the succession as a shelf sand ridge that evolved on a subaqueous delta, fed by sediment exchange from the upper to lower shoreface via a series of rippled scour depressions. To foster such thick (˜30 m) shelf ridge development, it is likely that these remained attached to the shoreface for a significant period of time. In light of these findings, caution should be adopted in applying a blanket deltaic interpretation of shallow marine deposits comprising similar medium scale clinoforms.

  12. [Experimental and theoretical studies of the formation of DNA complexes with biologically active ligands containing chromophore groups, depending on the ionic strength of the solution].

    PubMed

    Kruglova, E B; Zinenko, T L

    1993-01-01

    The binding of two ligands--dyes pyronin G (PG) and methylene blue (MB)--to DNA depending on the Na+ concentration was studied spectrophotometrically in the visible and UV ranges. The theoretical model taking into account the binding of a dye to DNA by means of aggregation and intercalation on two independent lattices was used for computation of the complexation parameters. The results of optimization of spectrophotometric concentration dependences show that the ligand occupies two phosphates in the process of aggregation on a negatively charged matrix. In is shown that the position of isobestic points can serve as an additional criterion for choosing the best values of the cooperativity parameters, absorption spectra of ligands in the aggregated state, and other parameters of the complex formation. The obtained intercalation constants show a linear dependence of 1gK(int) vs 1g C0Na for both PG and MB. These equations were used in a modified version of the computer program which allows optimization of the absorption spectra for DNA-ligand mixtures in a wide range of Na+ concentrations simultaneously, and estimation of the constant for Na+ binding to DNA phosphate (K1 < 10).

  13. Raman and NMR kinetics study of the formation of amidoamines containing N-hydroxyethyl groups and investigations on their Cu(II) complexes in water

    NASA Astrophysics Data System (ADS)

    Bergamonti, Laura; Graiff, Claudia; Tegoni, Matteo; Predieri, Giovanni; Bellot-Gurlet, Ludovic; Lottici, Pier Paolo

    2017-01-01

    Three amidoamines containing the N-hydroxyethyl group (HOEt), namely (HOEt)2N(CH2)2C(O)NH2 (1), [(HOEt)2N(CH2)2C(O)NH]2CH2 (2) and HOEtN[(CH2)2C(O)NH2]2 (3) have been synthesized by reacting diethanolamine HOEt2NH with acrylamide and N,N‧-methylenebisacrylamide (respectively 1 and 2) and ethanolamine HOEtNH2 with acrylamide (3). Four other compounds corresponding to 1 and 2, but derived from sec-amines Me2NH (4 and 5) and Et2NH (6 and 7) have been prepared for the sake of comparison of the spectroscopic features. All compounds have been obtained by the well-known aza-Michael addition between an N-nucleophile and an activated vinyl group. The reaction in water between diethanolamine and acrylamide leading to 1 has been monitored in situ by Raman and NMR spectroscopy, both techniques confirming second order kinetics and giving values for kinetic constants in excellent agreement. The coordination ability of 1 and 2 towards Cu2 + in water has been studied by the Job's plot method. Spectroscopic data indicate that ligand 1 prevalently forms a 4:1 Ligand/Metal complex with a (N,O3) coordination set on the equatorial plane of Cu2 +, whereas ligand 2, containing two amide functionalities bridged by a methylene group, appears able to form a 1:1 Ligand/Metal chelate species, again with a (N,O3) donor set around copper.

  14. Petroleum systems and geologic assessment of undiscovered oil and gas, Cotton Valley group and Travis Peak-Hosston formations, East Texas basin and Louisiana-Mississippi salt basins provinces of the northern Gulf Coast region. Chapters 1-7.

    USGS Publications Warehouse

    ,

    2006-01-01

    The purpose of the U.S. Geological Survey's (USGS) National Oil and Gas Assessment is to develop geologically based hypotheses regarding the potential for additions to oil and gas reserves in priority areas of the United States. The USGS recently completed an assessment of undiscovered oil and gas potential of the Cotton Valley Group and Travis Peak and Hosston Formations in the East Texas Basin and Louisiana-Mississippi Salt Basins Provinces in the Gulf Coast Region (USGS Provinces 5048 and 5049). The Cotton Valley Group and Travis Peak and Hosston Formations are important because of their potential for natural gas resources. This assessment is based on geologic principles and uses the total petroleum system concept. The geologic elements of a total petroleum system include hydrocarbon source rocks (source rock maturation, hydrocarbon generation and migration), reservoir rocks (sequence stratigraphy and petrophysical properties), and hydrocarbon traps (trap formation and timing). The USGS used this geologic framework to define one total petroleum system and eight assessment units. Seven assessment units were quantitatively assessed for undiscovered oil and gas resources.

  15. Model-measurement comparison of functional group abundance in α-pinene and 1,3,5-trimethylbenzene secondary organic aerosol formation

    NASA Astrophysics Data System (ADS)

    Ruggeri, Giulia; Bernhard, Fabian A.; Henderson, Barron H.; Takahama, Satoshi

    2016-07-01

    Secondary organic aerosol (SOA) formed by α-pinene and 1,3,5-trimethylbenzene photooxidation under different NOx regimes is simulated using the Master Chemical Mechanism v3.2 (MCM) coupled with an absorptive gas-particle partitioning module. Vapor pressures for individual compounds are estimated with the SIMPOL.1 group contribution model for determining apportionment of reaction products to each phase. We apply chemoinformatic tools to harvest functional group (FG) composition from the simulations and estimate their contributions to the overall oxygen to carbon ratio. Furthermore, we compare FG abundances in simulated SOA to measurements of FGs reported in previous chamber studies using Fourier transform infrared spectroscopy. These simulations qualitatively capture the dynamics of FG composition of SOA formed from both α-pinene and 1,3,5-trimethylbenzene in low-NOx conditions, especially in the first hours after start of photooxidation. Higher discrepancies are found after several hours of simulation; the nature of these discrepancies indicates sources of uncertainty or types of reactions in the condensed or gas phase missing from current model implementation. Higher discrepancies are found in the case of α-pinene photooxidation under different NOx concentration regimes, which are reasoned through the domination by a few polyfunctional compounds that disproportionately impact the simulated FG abundance in the aerosol phase. This manuscript illustrates the usefulness of FG analysis to complement existing methods for model-measurement evaluation.

  16. Innate health threat among a visibly hidden immigrant group: a formative field data analysis for HIV/AIDS prevention among Zimbabwean workers in Botswana.

    PubMed

    Kim, Do Kyun; Chikombero, Mandi; Modie-Moroka, Tirelo

    2013-01-01

    As a result of the collapse of the national economy and political instability, Zimbabwe has experienced a diaspora in recent years. Although Zimbabweans are now the largest immigrant group in most sub-Saharan countries, Zimbabwean immigrants are a mostly illegal and socioeconomically marginalized population. This study explores the lives of Zimbabwean workers in Botswana from a health communication perspective and provides suggestions for accelerating the diffusion of HIV/AIDS prevention information and practices among the target population. In particular, this ethnographic report portrays how the Zimbabwean workers in Botswana make sense of their surroundings and perceive information on HIV/AIDS prevention and other public health risks. Field data analysis highlights several communication features among the immigrants, including reliance on interpersonal communication, high rate of mobile phone adoption, inaccurate public awareness on HIV/AIDS and prevention messages, and stagnated communication with health care services. By connecting Dervin's sensemaking theory to Roger's diffusion of innovations theory, the suggestions from this study can be applied to design HIV/AIDS prevention interventions for the immigrants and socioeconomically marginalized groups.

  17. Britholite-group minerals as sensitive indicators of changing fluid composition during pegmatite formation: evidence from the Keivy alkaline province, Kola peninsula, NW Russia

    NASA Astrophysics Data System (ADS)

    Zozulya, Dmitry R.; Lyalina, Lyudmila M.; Savchenko, Yevgeny E.

    2017-09-01

    The Keivy alkaline province, Kola Peninsula, NW Russia, consists of vast alkali granite massifs and several dike-like nepheline syenite bodies. It contains numerous rare-metal occurrences, formed by a complex sequence of magmatic, late-magmatic and post-magmatic (including pegmatitic) processes. The Sakharjok nepheline syenite pegmatite contains a remarkably diverse number of britholite group minerals, pointing to different physico-chemical conditions in the fluid. REE and actinides distribution in the host rock indicates that the late-magmatic (and pegmatitic) fluids were alkaline, with significant amounts of F and CO2. From REE and F variations of the britholite group minerals possible fluid compositions at different stages are suggested. The earliest fluorbritholite-(Ce) formed locally from a late magmatic, high temperature F-rich fluid. Fluorbritholite-(Y) presumably crystallized from a F-bearing and CO2-rich fluid; marked F saturation resulted in precipitation of abundant fluorite due to a temperature drop. Variations in REE and F contents in the most abundant fluorcalciobritholite indicate a successive decrease of F in the fluid during its evolution. The relationship between intergrown fluorapatite and fluorcalciobritholite and the presence of zones with a REE-rich fluorapatite between them indicate a continuous to sudden crystallization in this mineral sequence. The crystallization of the latest "calciobritholite" is related to the input into the fluid of CO2 and/or H2O.

  18. Britholite-group minerals as sensitive indicators of changing fluid composition during pegmatite formation: evidence from the Keivy alkaline province, Kola peninsula, NW Russia

    NASA Astrophysics Data System (ADS)

    Zozulya, Dmitry R.; Lyalina, Lyudmila M.; Savchenko, Yevgeny E.

    2017-01-01

    The Keivy alkaline province, Kola Peninsula, NW Russia, consists of vast alkali granite massifs and several dike-like nepheline syenite bodies. It contains numerous rare-metal occurrences, formed by a complex sequence of magmatic, late-magmatic and post-magmatic (including pegmatitic) processes. The Sakharjok nepheline syenite pegmatite contains a remarkably diverse number of britholite group minerals, pointing to different physico-chemical conditions in the fluid. REE and actinides distribution in the host rock indicates that the late-magmatic (and pegmatitic) fluids were alkaline, with significant amounts of F and CO2. From REE and F variations of the britholite group minerals possible fluid compositions at different stages are suggested. The earliest fluorbritholite-(Ce) formed locally from a late magmatic, high temperature F-rich fluid. Fluorbritholite-(Y) presumably crystallized from a F-bearing and CO2-rich fluid; marked F saturation resulted in precipitation of abundant fluorite due to a temperature drop. Variations in REE and F contents in the most abundant fluorcalciobritholite indicate a successive decrease of F in the fluid during its evolution. The relationship between intergrown fluorapatite and fluorcalciobritholite and the presence of zones with a REE-rich fluorapatite between them indicate a continuous to sudden crystallization in this mineral sequence. The crystallization of the latest "calciobritholite" is related to the input into the fluid of CO2 and/or H2O.

  19. tRNA-dependent peptide bond formation by the transferase PacB in biosynthesis of the pacidamycin group of pentapeptidyl nucleoside antibiotics.

    PubMed

    Zhang, Wenjun; Ntai, Ioanna; Kelleher, Neil L; Walsh, Christopher T

    2011-07-26

    Pacidamycins are a family of uridyl tetra/pentapeptide antibiotics with antipseudomonal activities through inhibition of the translocase MraY in bacterial cell wall assembly. The biosynthetic gene cluster for pacidamycins has recently been identified through genome mining of the producer Streptomyces coeruleorubidus, and the highly dissociated nonribosomal peptide assembly line for the uridyl tetrapeptide scaffold of pacidamycin has been characterized. In this work a hypothetical protein PacB, conserved in known uridyl peptide antibiotics gene clusters, has been characterized by both genetic deletion and enzymatic analysis of the purified protein. PacB catalyzes the transfer of the alanyl residue from alanyl-tRNA to the N terminus of the tetrapeptide intermediate yielding a pentapeptide on the thio-templated nonribosomal peptide synthetase (NRPS) assembly line protein PacH. PacB thus represents a new group of tRNA-dependent peptide bond-forming enzymes in secondary metabolite biosynthesis in addition to the recently identified cyclodipeptide synthases. The characterization of PacB completes the assembly line reconstitution of pacidamycin pentapeptide antibiotic scaffolds, bridging the primary and secondary metabolic pathways by hijacking an aminoacyl-tRNA to the antibiotic biosynthetic pathway.

  20. Petrogenesis of the western highlands of the moon - Evidence from a diverse group of whitlockite-rich rocks from the Fra Mauro formation

    NASA Technical Reports Server (NTRS)

    Snyder, Gregory A.; Taylor, Lawrence A.; Liu, Yun-Gang; Schmitt, Roman A.

    1992-01-01

    A group of KREEPy basalts has been discovered in Apollo 14 soils. These samples exhibit similarities to both HA and VHK basalts, albeit with much higher REE abundances, and contain up to 2 vol pct whitlockite and can be explained by assimilation of a K-, REE- and P-rich fluids by an original HA or VHK basalt. This KREEP component could have been produced late in the evolution of the lunar magma ocean and is similar in composition to QMD at Apollo 14. Two rocks have trace element compositions that are representative of actual KREEP. One of the samples appears to be petrographically pristine and could represent an actual KREEP basalt rock. Five subophitic high-Al basalts represent sampling of either a slowly cooled impact melt sheet or, more likely, the same basalt flow. Two 'quasi-pristine' highland rocks confirm the postulate of a connection between KREEP and the alkali suite. A newly discovered alkali anorthosite is a plagioclase cumulate with about 15 percent trapped KREEPy liquid.

  1. Heterozygosity for p53 (Trp53+/-) accelerates epithelial tumor formation in fanconi anemia complementation group D2 (Fancd2) knockout mice.

    PubMed

    Houghtaling, Scott; Granville, Laura; Akkari, Yassmine; Torimaru, Yumi; Olson, Susan; Finegold, Milton; Grompe, Markus

    2005-01-01

    Fanconi anemia (FA) is an autosomal recessive disease characterized by progressive bone marrow failure and an increased susceptibility to cancer. FA is genetically heterogeneous, consisting of at least 11 complementation groups, FA-A through L, including FA-D1 (BRCA2) and D2. We have previously reported an increased incidence of epithelial tumors in Fancd2 knockout mice. To further investigate the role of the FA pathway in tumor prevention, Fancd2 mutant mice were crossed to mice with a null mutation in the tumor suppressor gene, Trp53. The tumor spectrum in Fancd2(-/-)/Trp53(+/-) mice included sarcomas expected in Trp53 heterozygotes, as well as mammary and lung adenocarcinomas that occur rarely in Trp53 heterozygotes. These tumors occurred earlier than in Fancd2(-/-) control mice. Therefore, the Fancd2(-/-)/Trp53(+/-) mice represent an improved model for the study of adenocarcinoma in FA. In addition, it was found that Fancd2(-/-) mouse embryonic fibroblasts but not Fancd2(-/-)/Trp53(-/-) mouse embryonic fibroblasts arrest following DNA damage. Therefore, Trp53 is required for the S phase checkpoint activation observed in Fancd2 mutant cells. Fancd2(-/-)/Trp53(-/-) cells showed an increase in aneuploidy and had multiple gross chromosomal rearrangements.

  2. Activation of White Phosphorus by Low-Valent Group 5 Complexes: Formation and Reactivity of cyclo-P4 Inverted Sandwich Compounds

    PubMed Central

    2015-01-01

    We report the synthesis and comprehensive study of the electronic structure of a unique series of dinuclear group 5 cyclo-tetraphosphide inverted sandwich complexes. White phosphorus (P4) reacts with niobium(III) and tantalum(III) β-diketiminate (BDI) tert-butylimido complexes to produce the bridging cyclo-P4 phosphide species {[(BDI)(NtBu)M]2(μ-η3:η3P4)} (1, M = Nb; 2, M = Ta) in fair yields. 1 is alternatively synthesized upon hydrogenolysis of (BDI)Nb(NtBu)Me2 in the presence of P4. The trinuclear side product {[(BDI)NbNtBu]3(μ-P12)} (3) is also identified. Protonation of 1 with [HOEt2][B(C6F5)4] does not occur at the phosphide ring but rather involves the BDI ligand to yield {[(BDI#)Nb(NtBu)]2(μ-η3:η3P4)}[B(C6F5)4]2 (4). The monocation and dication analogues {[(BDI)(NtBu)Nb]2(μ-η3:η3P4)}{B(ArF)4}n (5, n = 1; 6, n = 2) are both synthesized by oxidation of 1 with AgBArF. DFT calculations were used in combination with EPR and UV–visible spectroscopies to probe the nature of the metal–phosphorus bonding. PMID:25469924

  3. Formation of iron(III) (hydr)oxides on polyaspartate- and alginate-coated substrates: effects of coating hydrophilicity and functional group.

    PubMed

    Ray, Jessica R; Lee, Byeongdu; Baltrusaitis, Jonas; Jun, Young-Shin

    2012-12-18

    To better understand the transport of contaminants in aqueous environments, we need more accurate information about heterogeneous and homogeneous nucleation of iron(III) hydroxide nanoparticles in the presence of organics. We combined synchrotron-based grazing incidence small-angle X-ray scattering (GISAXS) and SAXS and other nanoparticle and substrate surface characterization techniques to observe iron(III) (hydr)oxide [10⁻⁴ M Fe(NO₃)₃ in 10 mM NaNO₃] precipitation on quartz and on polyaspartate- and alginate-coated glass substrates and in solution (pH = 3.7 ± 0.2). Polyaspartate was determined to be the most negatively charged substrate and quartz the least; however, after 2 h, total nanoparticle volume calculations--from GISAXS--indicate that positively charged precipitation on quartz is twice that of alginate and 10 times higher than on polyaspartate, implying that electrostatics do not govern iron(III) (hydr)oxide nucleation. On the basis of contact angle measurements and surface characterization, we concluded that the degree of hydrophilicity may control heterogeneous nucleation on quartz and organic-coated substrates. The arrangement of functional groups at the substrate surface (--OH and --COOH) may also contribute. These results provide new information for elucidating the effects of polymeric organic substrate coatings on the size, volume, and location of nucleating iron hydroxides, which will help predict nanoparticle interactions in natural and engineered systems.

  4. Petrogenesis of the western highlands of the moon - Evidence from a diverse group of whitlockite-rich rocks from the Fra Mauro formation

    NASA Technical Reports Server (NTRS)

    Snyder, Gregory A.; Taylor, Lawrence A.; Liu, Yun-Gang; Schmitt, Roman A.

    1992-01-01

    A group of KREEPy basalts has been discovered in Apollo 14 soils. These samples exhibit similarities to both HA and VHK basalts, albeit with much higher REE abundances, and contain up to 2 vol pct whitlockite and can be explained by assimilation of a K-, REE- and P-rich fluids by an original HA or VHK basalt. This KREEP component could have been produced late in the evolution of the lunar magma ocean and is similar in composition to QMD at Apollo 14. Two rocks have trace element compositions that are representative of actual KREEP. One of the samples appears to be petrographically pristine and could represent an actual KREEP basalt rock. Five subophitic high-Al basalts represent sampling of either a slowly cooled impact melt sheet or, more likely, the same basalt flow. Two 'quasi-pristine' highland rocks confirm the postulate of a connection between KREEP and the alkali suite. A newly discovered alkali anorthosite is a plagioclase cumulate with about 15 percent trapped KREEPy liquid.

  5. Facilitating organisational development using a group-based formative assessment and benchmarking method: design and implementation of the International Family Practice Maturity Matrix.

    PubMed

    Elwyn, Glyn; Bekkers, Marie-Jet; Tapp, Laura; Edwards, Adrian; Newcombe, Robert; Eriksson, Tina; Braspenning, Jozé; Kuch, Christine; Adzic, Zlata Ozvacic; Ayankogbe, Olayinka; Cvetko, Tatjana; In 't Veld, Kees; Karotsis, Antonis; Kersnik, Janko; Lefebvre, Luc; Mecini, Ilir; Petricek, Goranka; Pisco, Luis; Thesen, Janecke; Turón, José María; van Rossen, Edward; Grol, Richard

    2010-12-01

    Well-organised practices deliver higher-quality care. Yet there has been very little effort so far to help primary care organisations achieve higher levels of team performance and to help them identify and prioritise areas where quality improvement efforts should be concentrated. No attempt at all has been made to achieve a method which would be capable of providing comparisons--and the stimulus for further improvement--at an international level. The development of the International Family Practice Maturity Matrix took place in three phases: (1) selection and refinement of organisational dimensions; (2) development of incremental scales based on a recognised theoretical framework; and (3) testing the feasibility of the approach on an international basis, including generation of an automated web-based benchmarking system. This work has demonstrated the feasibility of developing an organisational assessment tool for primary care organisations that is sufficiently generic to cross international borders and is applicable across a diverse range of health settings, from state-organised systems to insurer-based health economies. It proved possible to introduce this assessment method in 11 countries in Europe and one in Africa, and to generate comparison benchmarks based on the data collected. The evaluation of the assessment process was uniformly positive with the view that the approach efficiently enables the identification of priorities for organisational development and quality improvement at the same time as motivating change by virtue of the group dynamics. We are not aware of any other organisational assessment method for primary care which has been 'born international,' and that has involved attention to theory, dimension selection and item refinement. The principal aims were to achieve an organisational assessment which gains added value by using interaction, engagement comparative benchmarks: aims which have been achieved. The next step is to achieve wider

  6. Molecular beam epitaxy of III-P{sub x}As{sub 1−x} solid solutions: Mechanism of composition formation in the sublattice of a group V element

    SciTech Connect

    Emelyanov, E. A. Putyato, M. A.; Semyagin, B. R.; Feklin, D. F.; Preobrazhensky, V. V.

    2015-02-15

    The effect of substrate temperature, As{sub 2} and P{sub 2} molecular flux densities, and growth rate on the composition of III-P{sub x}As{sub 1−x} solid solution layers prepared by molecular beam epitaxy is experimentally investigated. Experimental data in a wide range of growth conditions are analyzed. The results obtained are presented in the form of a kinetic model for describing the process of formation of the composition in the Group V sublattice of the III-P{sub x}As{sub 1−x} solid solution upon molecular beam epitaxy. The model can be used for choosing the growth conditions of the III-P{sub x}As{sub 1−x} (001) solid-solution layers of a specified composition.

  7. Artificial Neural Network-Group Contribution Method for Predicting Standard Enthalpy of Formation in the Solid State: C-H, C-H-O, C-H-N, and C-H-N-O Compounds

    NASA Astrophysics Data System (ADS)

    Guella, Soufiane; Argoub, Kadda; Benkouider, Ali Mustapha; Yahiaoui, Ahmed; Kessas, Rachid; Bagui, Farid

    2015-11-01

    In this work, an artificial neural network-group contribution model is developed to predict the standard enthalpy of formation in the solid (crystal) state of pure compounds. Several classes of hydrocarbon compounds CH, oxygenated compounds CHO, nitrogen compounds CHN, and energetic compounds CHNO are investigated to propose a comprehensive and predictive model. The new model is developed and tested for 1222 organic compounds containing complex molecular structures. The performance of the new model has been compared with previous work and is shown to be far more accurate. The obtained results show an average absolute deviation of 9.33 {kJ}{\\cdot }{mol}^{-1} and a coefficient of determination of 0.9972 for the experimental values.

  8. The Group Tree of Experience.

    ERIC Educational Resources Information Center

    Ping, Ki

    1994-01-01

    Describes a group activity that uses a tree as a metaphor to reflect both group and personal growth during adventure activities. The tree's roots represent the group's formation, the branches and leaves represent the group's diversity and capabilities, and the seeds represent the personal learning and growth that took place within the group.…

  9. The Group Tree of Experience.

    ERIC Educational Resources Information Center

    Ping, Ki

    1994-01-01

    Describes a group activity that uses a tree as a metaphor to reflect both group and personal growth during adventure activities. The tree's roots represent the group's formation, the branches and leaves represent the group's diversity and capabilities, and the seeds represent the personal learning and growth that took place within the group.…

  10. pH-induced conformational changes in human ABO(H) blood group glycosyltransferases confirm the importance of electrostatic interactions in the formation of the semi-closed state.

    PubMed

    Johal, Asha R; Blackler, Ryan J; Alfaro, Javier A; Schuman, Brock; Borisova, Svetlana; Evans, Stephen V

    2014-03-01

    The homologous human ABO(H) A and B blood group glycosyltransferases GTA and GTB have two mobile polypeptide loops surrounding their active sites that serve to allow substrate access and product egress and to recognize and sequester substrates for catalysis. Previous studies have established that these enzymes can move from the "open" state to the "semi-closed" then "closed" states in response to addition of a substrate. The contribution of electrostatic interactions to these conformational changes has now been demonstrated by the determination at various pH of the structures of GTA, GTB and the chimeric enzyme ABBA. At near-neutral pH, GTA displays the closed state in which both mobile loops order around the active site, whereas ABBA and GTB display the open state. At low pH, the apparent protonation of the DXD motif in GTA leads to the expulsion of the donor analog to yield the open state, whereas at high pH, both ABBA and GTB form the semi-closed state in which the first mobile loop becomes an ordered α-helix. Step-wise deprotonation of GTB in increments of 0.5 between pH 6.5 and 10.0 shows that helix ordering is gradual, which indicates that the formation of the semi-closed state is dependent on electrostatic forces consistent with the binding of substrate. Spectropolarimetric studies of the corresponding stand-alone peptide in solution reveal no tendency toward helix formation from pH 7.0 to 10.0, which shows that pH-dependent stability is a product of the larger protein environment and underlines the importance of substrate in active site ordering.

  11. A SPECTROSCOPICALLY CONFIRMED EXCESS OF 24 mum SOURCES IN A SUPER GALAXY GROUP AT z = 0.37: ENHANCED DUSTY STAR FORMATION RELATIVE TO THE CLUSTER AND FIELD ENVIRONMENT

    SciTech Connect

    Tran, Kim-Vy H.; Saintonge, Amelie; Moustakas, John; Bai, Lei; Zaritsky, Dennis; Gonzalez, Anthony H.; Kautsch, Stefan J.; Holden, Bradford P.

    2009-11-01

    To trace how dust-obscured star formation varies with environment, we compare the fraction of 24 mum sources in a super galaxy group to the field and a rich galaxy cluster at z approx 0.35. We draw on multi-wavelength observations{sup 9}Based on observations made with (1) The ESO telescopes at Paranal Observatories under program IDs 072.A-0367, 076.B-0362, 078.B-0409; (2) the NASA/ESA Hubble Space Telescope (GO-10499); STScI is operated by the association of Universities for Research in Astronomy, Inc. under the NASA contract NAS 5-26555; (3) the Spitzer Space Telescope, which is operated by the Jet Propulsion Laboratory, California Institute of Technology under a contract with NASA; support for this work was provided by NASA through an award issued by JPL/Caltech (GO-20683); (4) the Chandra X-ray Observatory Center, which is operated by the Smithsonian Astrophysical Observatory for and on behalf of the National Aeronautics Space Administration under contract NAS8-03060; and (5) the Magellan 6.5 m telescope operated by OCIW. that combine Hubble, Chandra, and Spitzer imaging with extensive optical spectroscopy (>1800 redshifts) to isolate galaxies in each environment and thus ensure a uniform analysis. We focus on the four galaxy groups (sigma{sub 1D} = 303-580 km s{sup -1}) in supergroup 1120-12 that will merge to form a galaxy cluster comparable in mass to Coma. We find that (1) the fraction of supergroup galaxies with SFR{sub IR} >= 3 M {sub sun} yr{sup -1} is 4 times higher than in the cluster (32% +- 5% versus 7% +- 2%); (2) the supergroup's infrared luminosity function confirms that it has a higher density of IR members compared to the cluster and includes bright IR sources (log(L {sub IR})[erg s{sup -1}] >45) not found in galaxy clusters at z approx< 0.35; and (3) there is a strong trend of decreasing 24 mum fraction with increasing galaxy density, i.e., an infrared-density relation, not observed in the cluster. These dramatic differences are surprising

  12. First record of petrified Permian pecopterids from the Paraná Basin, Brazil (Corumbataí Formation, Passa Dois Group, northeastern State of São Paulo): Morphology, anatomy and paleoecological implications

    NASA Astrophysics Data System (ADS)

    Tavares, Tatiane M. V.; Rohn, Rosemarie

    2009-02-01

    Petrified pecopterids are described for the first time in the Paraná Basin. They were collected at an outcrop of the Corumbataí Formation (Passa Dois Group, Middle Permian) in the Municipality of Piracicaba (State of São Paulo, Brazil). The assemblage is composed of Pecopteris taguaiensis Rohn and Rösler, 1986, Pecopteris sp. 1, Pecopteris sp. 2 and Pecopteris sp. 3. An emendation to the diagnosis of P. taguaiensis is proposed on the basis of the characteristics shown by the preserved three-dimensional external leaf morphology and partially by the epidermis (not available in the previously described impressions). The small size of the pinnules, the thick, downward-rolled leaf lamina, the thick veins, the straight walls of the epidermal cells, and the trichomes of the four pecopterid taxa may be interpreted as xeromorphic features developed in response to relatively dry climatic conditions and/or direct incidence of the sunlight. The leaves were impregnated with silica before the final burial, considering that they are fragmented, not deformed and associated with angular breccia clasts.

  13. Chapter 7. The GIS project for the geologic assessment of undiscovered oil and gas in the Cotton Valley group and Travis Peak and Hosston formations, East Texas basin and Louisiana-Mississippi salt basins provinces.

    USGS Publications Warehouse

    Biewick, Laura

    2006-01-01

    A geographic information system (GIS) focusing on the Upper Jurassic-Lower Cretaceous Cotton Valley Group and the Lower Cretaceous Travis Peak and Hosston Formations in the northern Gulf Coast region was developed as a visual-analysis tool for the U.S. Geological Survey's 2002 assessment of undiscovered, technically recoverable oil and natural gas resources in the East Texas Basin and Louisiana-Mississippi Salt Basins Provinces. The Central Energy Resources Team of the U.S. Geological Survey has also developed an Internet Map Service to deliver the GIS data to the public. This mapping tool utilizes information from a database about the oil and natural gas endowment of the United States-including physical locations of geologic and geographic data-and converts the data into visual layers. Portrayal and analysis of geologic features on an interactive map provide an excellent tool for understanding domestic oil and gas resources for strategic planning, formulating economic and energy policies, evaluating lands under the purview of the Federal Government, and developing sound environmental policies. Assessment results can be viewed and analyzed or downloaded from the internet web site, http://energy.cr.usgs.gov/oilgas/noga/ .

  14. IVS Working Group 4: VLBI Data Structures

    NASA Technical Reports Server (NTRS)

    Gipson, John

    2010-01-01

    In 2007 the IVS Directing Board established IVS Working Group 4 on VLBI Data Structures. This note discusses the current VLBI data format, goals for a new format, the history and formation of the Working Group, and a timeline for the development of a new VLBI data format.

  15. Concept Formation.

    ERIC Educational Resources Information Center

    Vaidya, Narendera

    This document, published in India by the Regional College of Education, deals with 13 subjects: the tough context (thinking), definitions of concept, functions of concept, the process of concept formation, discriminant learning, mediation process, second signalling system, factors affecting concept formation, studies in concept formation, the…

  16. Group X

    SciTech Connect

    Fields, Susannah

    2007-08-16

    This project is currently under contract for research through the Department of Homeland Security until 2011. The group I was responsible for studying has to remain confidential so as not to affect the current project. All dates, reference links and authors, and other distinguishing characteristics of the original group have been removed from this report. All references to the name of this group or the individual splinter groups has been changed to 'Group X'. I have been collecting texts from a variety of sources intended for the use of recruiting and radicalizing members for Group X splinter groups for the purpose of researching the motivation and intent of leaders of those groups and their influence over the likelihood of group radicalization. This work included visiting many Group X websites to find information on splinter group leaders and finding their statements to new and old members. This proved difficult because the splinter groups of Group X are united in beliefs, but differ in public opinion. They are eager to tear each other down, prove their superiority, and yet remain anonymous. After a few weeks of intense searching, a list of eight recruiting texts and eight radicalizing texts from a variety of Group X leaders were compiled.

  17. Group Flow and Group Genius

    ERIC Educational Resources Information Center

    Sawyer, Keith

    2015-01-01

    Keith Sawyer views the spontaneous collaboration of group creativity and improvisation actions as "group flow," which organizations can use to function at optimum levels. Sawyer establishes ideal conditions for group flow: group goals, close listening, complete concentration, being in control, blending egos, equal participation, knowing…

  18. Pattern Formation

    NASA Astrophysics Data System (ADS)

    Hoyle, Rebecca

    2006-03-01

    From the stripes of a zebra and the spots on a leopard's back to the ripples on a sandy beach or desert dune, regular patterns arise everywhere in nature. The appearance and evolution of these phenomena has been a focus of recent research activity across several disciplines. This book provides an introduction to the range of mathematical theory and methods used to analyse and explain these often intricate and beautiful patterns. Bringing together several different approaches, from group theoretic methods to envelope equations and theory of patterns in large-aspect ratio-systems, the book also provides insight behind the selection of one pattern over another. Suitable as an upper-undergraduate textbook for mathematics students or as a fascinating, engaging, and fully illustrated resource for readers in physics and biology, Rebecca Hoyle's book, using a non-partisan approach, unifies a range of techniques used by active researchers in this growing field. Accessible description of the mathematical theory behind fascinating pattern formation in areas such as biology, physics and materials science Collects recent research for the first time in an upper level textbook Features a number of exercises - with solutions online - and worked examples

  19. Isopermutation group

    SciTech Connect

    Muktibodh, A. S.

    2015-03-10

    The concept of ‘Isotopy’ as formulated by Ruggero Maria Santilli [1, 2, 3] plays a vital role in the development of Iso mathematics. Santilli defined iso-fields of characteristic zero. In this paper we extend this definition to define Iso-Galois fields [4] which are essentially of non-zero characteristic. Isotopically isomorphic realizations of a group define isopermutation group which gives a clear cut distinction between automorphic groups and isotopic groups.

  20. Home Groups.

    ERIC Educational Resources Information Center

    Stahler, Theresa M.

    All students enrolled in the entry level foundations course in the College of Education of Kutztown University (Pennsylvania) participate in home groups, a cooperative learning strategy. Each student is assigned to a five- or six-person home group on the first day of class. Although group placements are made on the basis of class lists, every…

  1. Hot Groups.

    ERIC Educational Resources Information Center

    Vail, Kathleen

    1996-01-01

    Collaborators sparked by creative ideas and obsessed by a common task may not realize they're part of a "hot group"--a term coined by business professors Harold J. Leavitt and Jean Lipman-Blumen. Spawned by group decision making and employee empowerment, hot groups can flourish in education settings. They're typically small, short lived,…

  2. Group Counseling: Health Related.

    ERIC Educational Resources Information Center

    McFadden, Johnnie

    1979-01-01

    Diabetes and sickle cell anemia (SCA) are two health-related characteristics that distinguish young people from their peers. This article outlines the problems of children with diabetes and SCA and presents the goals and format for group counseling of these populations and their parents. (Author/BEF)

  3. Group Counseling: Health Related.

    ERIC Educational Resources Information Center

    McFadden, Johnnie

    1979-01-01

    Diabetes and sickle cell anemia (SCA) are two health-related characteristics that distinguish young people from their peers. This article outlines the problems of children with diabetes and SCA and presents the goals and format for group counseling of these populations and their parents. (Author/BEF)

  4. Galaxy groups

    SciTech Connect

    Brent Tully, R.

    2015-02-01

    Galaxy groups can be characterized by the radius of decoupling from cosmic expansion, the radius of the caustic of second turnaround, and the velocity dispersion of galaxies within this latter radius. These parameters can be a challenge to measure, especially for small groups with few members. In this study, results are gathered pertaining to particularly well-studied groups over four decades in group mass. Scaling relations anticipated from theory are demonstrated and coefficients of the relationships are specified. There is an update of the relationship between light and mass for groups, confirming that groups with mass of a few times 10{sup 12}M{sub ⊙} are the most lit up while groups with more and less mass are darker. It is demonstrated that there is an interesting one-to-one correlation between the number of dwarf satellites in a group and the group mass. There is the suggestion that small variations in the slope of the luminosity function in groups are caused by the degree of depletion of intermediate luminosity systems rather than variations in the number per unit mass of dwarfs. Finally, returning to the characteristic radii of groups, the ratio of first to second turnaround depends on the dark matter and dark energy content of the universe and a crude estimate can be made from the current observations of Ω{sub matter}∼0.15 in a flat topology, with a 68% probability of being less than 0.44.

  5. GROUP INEQUALITY

    PubMed Central

    Bowles, Samuel; Loury, Glenn C.; Sethi, Rajiv

    2014-01-01

    We explore the combined effect of segregation in social networks, peer effects, and the relative size of a historically disadvantaged group on the incentives to invest in market-rewarded skills and the dynamics of inequality between social groups. We identify conditions under which group inequality will persist in the absence of differences in ability, credit constraints, or labor market discrimination. Under these conditions, group inequality may be amplified even if initial group differences are negligible. Increases in social integration may destabilize an unequal state and make group equality possible, but the distributional and human capital effects of this depend on the demographic composition of the population. When the size of the initially disadvantaged group is sufficiently small, integration can lower the long-run costs of human capital investment in both groups and result in an increase the aggregate skill share. In contrast, when the initially disadvantaged group is large, integration can induce a fall in the aggregate skill share as the costs of human capital investment rise in both groups. We consider applications to concrete cases and policy implications. PMID:25554727

  6. Whitehead Groups of Spinor Groups

    NASA Astrophysics Data System (ADS)

    Monastyrnyĭ, A. P.; Yanchevskiĭ, V. I.

    1991-02-01

    The Whitehead groups of spinor groups are studied. The known Kneser-Tits conjecture for spinor groups is reduced to a spinor analogue of the Tannaka-Artin problem, namely, to the question of whether the group K1Spin(D), where D is a division ring of exponent 2 , is trivial. A counterexample to the Kneser-Tits problem is constructed in the class of spinor groups. The group K1Spin(D) is computed. The stability of the Whitehead groups of spinor groups under purely transcendental extensions of the ground field is established. The R-equivalence on the k-points of spinor groups and the weak approximation problem are considered. The study of spinor group completes the study of the Whitehead groups of algebraic groups of classical type, that was started in studying reduced K-theory (V.P. Platonov) and was continued for reduced unitary K-theory (V.I. Yanchevskiĭ) and Hermitian K-theory (Platonov and Yanchevskiĭ). Bibliography: 50 titles.

  7. The evolution of groups and clusters

    NASA Astrophysics Data System (ADS)

    Gottlöber, S.; Klypin, A.; Kravtsov, A. V.; Turchaninov, V.

    Using high resolution N -body simulations we study the formation and evolution of clusters and groups in a &Lambda CDM cosmological model. Groups of galaxies already form before z = 4. Merging of groups and accretion leads to cluster formation at z <&sim2. Some of the groups merge into large isolated halos.

  8. The origin and distribution of HAPs elements in relation to maceral composition of the A1 lignite bed (Paleocene, Calvert Bluff Formation, Wilcox Group), Calvert mine area, east-central Texas

    USGS Publications Warehouse

    Crowley, S.S.; Warwick, P.D.; Ruppert, L.F.; Pontolillo, J.

    1997-01-01

    The origin and distribution of twelve potentially Hazardous Air Pollutants (HAPs; As, Be, Cd, Cr, Co, Hg, Mn, Ni, Pb Sb, Se, and U) identified in the 1990 Clean Air Act Amendments were examined in relation to the maceral composition of the A1 bed (Paleocene, Calvert Bluff Formation, Wilcox Group) of the Calvert mine in east-central Texas. The 3.2 m-thick A1 bed was divided into nine incremental channel samples (7 lignite samples and 2 shaley coal samples) on the basis of megascopic characteristics. Results indicate that As, Cd, Cr, Ni, Pb, Sb, and U are strongly correlated with ash yield and are enriched in the shaley coal samples. We infer that these elements are associated with inorganic constituents in the coal bed and may be derived from a penecontemporaneous stream channel located several kilometers southeast of the mining block. Of the HAPs elements studied, Mn and Hg are the most poorly correlated to ash yield. We infer an organic association for Mn; Hg may be associated with pyrite. The rest of the trace elements (Be, Co, and Se) are weakly correlated with ash yield. Further analytical work is necessary to determine the mode of occurrence for these elements. Overall, concentrations of the HAPs elements are generally similar to or less than those reported in previous studies of lignites of the Wilcox Group, east-central region, Texas. Petrographic analysis indicates the following ranges in composition for the seven lignite samples: liptinites (5-8%), huminites (88-95%), and inertinites (trace amounts to 7%). Samples from the middle portion of the A1 bed contain abundant crypto-eugelinite compared to the rest of the samples; this relationship suggests that the degradation of plant material was an important process during the development of the peat mire. With the exception of Hg and Mn, relatively low levels of the HAPs elements studied are found in the samples containing abundant crypto-eugelinite. We infer that the peat-forming environment for this portion

  9. Group Theatre.

    ERIC Educational Resources Information Center

    Clark, Brian

    The group interpretation approach to theatre production is defined as a method that will lead to production of plays that will appeal to "all the layers of the conscious and unconscious mind." In practice, it means that the group will develop and use resources of the theatre that orthodox companies too often ignore. The first two chapters of this…

  10. Group Grammar

    ERIC Educational Resources Information Center

    Adams, Karen

    2015-01-01

    In this article Karen Adams demonstrates how to incorporate group grammar techniques into a classroom activity. In the activity, students practice using the target grammar to do something they naturally enjoy: learning about each other.

  11. A Comparison of Equating/Linking Using the Stocking-Lord Method and Concurrent Calibration with Mixed-Format Tests in the Non-Equivalent Groups Common-Item Design under IRT

    ERIC Educational Resources Information Center

    Tian, Feng

    2011-01-01

    There has been a steady increase in the use of mixed-format tests, that is, tests consisting of both multiple-choice items and constructed-response items in both classroom and large-scale assessments. This calls for appropriate equating methods for such tests. As Item Response Theory (IRT) has rapidly become mainstream as the theoretical basis for…

  12. Special Education Teachers' Knowledge and Use of Brain-Based Teaching, Common Core State Standards, Formative Feedback Practices and Instructional Efficacy for the Diverse Learning Needs of Students in High and Low Proficiency Groups

    ERIC Educational Resources Information Center

    Walker-Thompson, Malasia

    2014-01-01

    This study examined special education teachers' knowledge and use of: brain-based teaching strategies, Common Core State Standards, formative feedback, and instructional efficacy for diverse students. The study identified the differences amongst special education teachers' responses on the dimensions of brain-based teaching strategies, Common Core…

  13. Special Education Teachers' Knowledge and Use of Brain-Based Teaching, Common Core State Standards, Formative Feedback Practices and Instructional Efficacy for the Diverse Learning Needs of Students in High and Low Proficiency Groups

    ERIC Educational Resources Information Center

    Walker-Thompson, Malasia

    2014-01-01

    This study examined special education teachers' knowledge and use of: brain-based teaching strategies, Common Core State Standards, formative feedback, and instructional efficacy for diverse students. The study identified the differences amongst special education teachers' responses on the dimensions of brain-based teaching strategies, Common Core…

  14. Energy saving in flight formation.

    PubMed

    Weimerskirch, H; Martin, J; Clerquin, Y; Alexandre, P; Jiraskova, S

    2001-10-18

    Many species of large bird fly together in formation, perhaps because flight power demands and energy expenditure can be reduced when the birds fly at an optimal spacing, or because orientation is improved by communication within groups. We have measured heart rates as an estimate of energy expenditure in imprinted great white pelicans (Pelecanus onocrotalus) trained to fly in 'V' formation, and show that these birds save a significant amount of energy by flying in formation. This advantage is probably a principal reason for the evolution of flight formation in large birds that migrate in groups.

  15. Group Learning.

    ERIC Educational Resources Information Center

    Black, Susan

    1992-01-01

    Research suggests that cooperative learning works best when students are first taught group-processing skills, such as leadership, decision making, communication, trust building, and conflict management. Inadequate teacher training and boring assignments can torpedo cooperative learning efforts. Administrators should reassure teachers with…

  16. Student Perceptions of Small-Group Learning

    ERIC Educational Resources Information Center

    Florez, Ida Rose; McCaslin, Mary

    2008-01-01

    Background/Context: Elementary school teachers regularly arrange students in small groups for learning activities. A rich literature discusses various types of small-group learning formats and how those formats affect achievement. Few studies, however, have examined students' perceptions of small-group learning experiences. Our work extends the…

  17. Student Perceptions of Small-Group Learning

    ERIC Educational Resources Information Center

    Florez, Ida Rose; McCaslin, Mary

    2008-01-01

    Background/Context: Elementary school teachers regularly arrange students in small groups for learning activities. A rich literature discusses various types of small-group learning formats and how those formats affect achievement. Few studies, however, have examined students' perceptions of small-group learning experiences. Our work extends the…

  18. Physically detached 'compact groups'

    NASA Technical Reports Server (NTRS)

    Hernquist, Lars; Katz, Neal; Weinberg, David H.

    1995-01-01

    A small fraction of galaxies appear to reside in dense compact groups, whose inferred crossing times are much shorter than a Hubble time. These short crossing times have led to considerable disagreement among researchers attempting to deduce the dynamical state of these systems. In this paper, we suggest that many of the observed groups are not physically bound but are chance projections of galaxies well separated along the line of sight. Unlike earlier similar proposals, ours does not require that the galaxies in the compact group be members of a more diffuse, but physically bound entity. The probability of physically separated galaxies projecting into an apparent compact group is nonnegligible if most galaxies are distributed in thin filaments. We illustrate this general point with a specific example: a simulation of a cold dark matter universe, in which hydrodynamic effects are included to identify galaxies. The simulated galaxy distribution is filamentary and end-on views of these filaments produce apparent galaxy associations that have sizes and velocity dispersions similar to those of observed compact groups. The frequency of such projections is sufficient, in principle, to explain the observed space density of groups in the Hickson catalog. We discuss the implications of our proposal for the formation and evolution of groups and elliptical galaxies. The proposal can be tested by using redshift-independent distance estimators to measure the line-of-sight spatial extent of nearby compact groups.

  19. Galaxy formation

    SciTech Connect

    Silk, J.

    1984-11-01

    Implications of the isotropy of the cosmic microwave background on large and small angular scales for galaxy formation are reviewed. In primeval adiabatic fluctuations, a universe dominated by cold, weakly interacting nonbaryonic matter, e.g., the massive photino is postulated. A possible signature of photino annihilation in our galactic halo involves production of cosmic ray antiprotons. If the density is near its closure value, it is necessary to invoke a biasing mechanism for suppressing galaxy formation throughout most of the universe in order to reconcile the dark matter density with the lower astronomical determinations of the mean cosmological density. A mechanism utilizing the onset of primordial massive star formation to strip gaseous protogalaxies is described. Only the densest, early collapsing systems form luminous galaxies. (ESA)

  20. Cantor Groups

    ERIC Educational Resources Information Center

    Mathes, Ben; Dow, Chris; Livshits, Leo

    2011-01-01

    The Cantor subset of the unit interval [0, 1) is "large" in cardinality and also "large" algebraically, that is, the smallest subgroup of [0, 1) generated by the Cantor set (using addition mod 1 as the group operation) is the whole of [0, 1). In this paper, we show how to construct Cantor-like sets which are "large" in cardinality but "small"…

  1. Local Group

    NASA Astrophysics Data System (ADS)

    Mateo, M.; Murdin, P.

    2000-11-01

    Not long after EDWIN HUBBLE established that galaxies are `island universes' similar to our home galaxy, the MILKY WAY, he realized that a few of these external galaxies are considerably closer to us than any others. In 1936 he first coined the term `Local Group' in his famous book The Realm of the Nebulae to identify our nearest galactic neighbors. More than 60 yr later, the galaxies of the Loca...

  2. Underrepresented groups

    NASA Technical Reports Server (NTRS)

    Peters, David A.

    1990-01-01

    The problem with the shortage of under represented groups in science and engineering is absolutely crucial, especially considering that U.S. will experience a shortage of 560,000 science and engineering personnel by the year 2010. Most studies by the National Science Foundation also concluded that projected shortages cannot be alleviated without significant increases in the involvement of Blacks, Hispanics, Native Americans, handicapped persons, and women.

  3. Comet formation

    NASA Astrophysics Data System (ADS)

    Blum, J.

    2014-07-01

    There has been vast progress in our understanding of planetesimal formation over the past decades, owing to a number of laboratory experiments as well as to refined models of dust and ice agglomeration in protoplanetary disks. Coagulation rapidly forms cm-sized ''pebbles'' by direct sticking in collisions at low velocities (Güttler et al. 2010; Zsom et al. 2010). For the further growth, two model approaches are currently being discussed: (1) Local concentration of pebbles in nebular instabilities until gravitational instability occurs (Johansen et al. 2007). (2) A competition between fragmentation and mass transfer in collisions among the dusty bodies, in which a few ''lucky winners'' make it to planetesimal sizes (Windmark et al. 2012a,b; Garaud et al. 2013). Predictions of the physical properties of the resulting bodies in both models allow a distinction of the two formation scenarios of planetesimals. In particular, the tensile strength (i.e, the inner cohesion) of the planetesimals differ widely between the two models (Skorov & Blum 2012; Blum et al. 2014). While model (1) predicts tensile strengths on the order of ˜ 1 Pa, model (2) results in rather compactified dusty bodies with tensile strengths in the kPa regime. If comets are km-sized survivors of the planetesimal-formation era, they should in principle hold the secret of their formation process. Water ice is the prime volatile responsible for the activity of comets. Thermophysical models of the heat and mass transport close to the comet-nucleus surface predict water-ice sublimation temperatures that relate to maximum sublimation pressures well below the kPa regime predicted for formation scenario (2). Model (1), however, is in agreement with the observed dust and gas activity of comets. Thus, a formation scenario for cometesimals involving gravitational instability is favored (Blum et al. 2014).

  4. Group Connections: Whole Group Teaching.

    ERIC Educational Resources Information Center

    Griffiths, Dorothy

    2002-01-01

    A learner-centered approach to adult group instruction involved learners in investigating 20th-century events. The approach allowed learners to concentrate on different activities according to their abilities and gave them opportunities to develop basic skills and practice teamwork. (SK)

  5. Formative Assessment Probes: Is It a Rock? Continuous Formative Assessment

    ERIC Educational Resources Information Center

    Keeley, Page

    2013-01-01

    A lesson plan is provided for a formative assessment probe entitled "Is It a Rock?" This probe is designed for teaching elementary school students about rocks through the use of a formative assessment classroom technique (FACT) known as the group Frayer Model. FACT activates students' thinking about a concept and can be used to…

  6. Formative Assessment Probes: Is It a Rock? Continuous Formative Assessment

    ERIC Educational Resources Information Center

    Keeley, Page

    2013-01-01

    A lesson plan is provided for a formative assessment probe entitled "Is It a Rock?" This probe is designed for teaching elementary school students about rocks through the use of a formative assessment classroom technique (FACT) known as the group Frayer Model. FACT activates students' thinking about a concept and can be used to…

  7. Novel cytochrome p450 bioactivation of a terminal phenyl acetylene group: formation of a one-carbon loss benzaldehyde and other oxidative products in the presence of N-acetyl cysteine or glutathione.

    PubMed

    Subramanian, Raju; Tam, Janet; Aidasani, Divesh; Reid, Darren L; Skiles, Gary L

    2011-05-16

    Compounds 1 (N1-(3-ethynylphenyl)-6-methyl-N5-(3-(6-(methylamino)pyrimidin-4-yl)pyridin-2-yl) isoquinoline-1,5-diamine) and 2 (N-(3-ethynylphenyl)-6,7-bis(2-methoxyethoxy)quinazolin-4-amine; Erlotinib/Tarceva) are kinase inhibitors that contain a terminal phenyl acetylene moiety. When incubated in the presence of P450 and NADPH, the anticipated phenyl acetic acid metabolite was formed. When 10 mM of N-acetyl-l-cysteine was added to the incubation mixtures, the phenyl acetic acid product was reduced and at 25 mM or higher concentration of NAC, formation of the phenyl acetic acid was abolished. Instead, the phenyl acetylene moiety lost a carbon and formed a benzaldehyde product. Other oxidation products incorporating one or more equivalents of NAC were also observed. The identities of the metabolites were characterized by MS and NMR. Addition of deferoxamine or ascorbic acid diminished the formation of the NAC influenced products. Similar products were also observed when 1 or 2 were incubated in P450 reactions supplemented with GSH, in Fenton reactions supplemented with NAC or GSH, and in peroxidase reactions supplemented with NAC. We propose the thiols act as a pro-oxidant readily undergoing a one-electron oxidation to form thiyl radicals which in turn initiates the formation of other peroxy radicals that drive the reaction to the observed products. These in vitro findings suggest that one-electron oxidation of thiols may promote the cooxidation of xenobiotic substrates.

  8. Flexible formation configuration for terrain following flight: Formation keeping constraints

    NASA Astrophysics Data System (ADS)

    Latyshev, Simon

    This work suggests a control method for the terrain-following formation motion of a group of communicating autonomous agents. The presented approach centers on defining a suitable set of constraints for formation keeping task that shall be fulfilled while agents are negotiating an unknown terrain toward the predefined goal location. It allows agents to maintain a general geometric formation shape, while allowing each individual formation member freedom of maneuver, required for terrain collision free motion. Formation structure is defined with the use of virtual leader. Formation keeping constraints are defined with plane surfaces, specified relative to position and navigation vector of the virtual leader. Formation navigation and guidance constraints are defined using navigation vectors of formation members and the virtual leader. Alternative designs for the constraints derived with parabolic, cone, and cylindrical surfaces are considered. Formation control is derived using the Udwadia-Kalaba equation, following corresponding approach to the development of control methods for constraint based dynamical systems, including leader-follower systems defined using geometric constraints. Approach to terrain following motion requiring agents to stay within bounds of cylindrical corridor volumes built around their respective navigation vectors is assumed. Individual formation primitives and multi-level, hierarchical, formation structures are considered. Simulations, based on three degrees of freedom nonlinear model of an agent, performed using Mathematica and specifically developed combined Maya-Mathematica modeling and simulation system, demonstrate that a flexible terrain following formation motion is achieved with the presented sets of constraints.

  9. SAS FORMATS: USES AND ABUSES

    EPA Science Inventory

    SAS formats are a very powerful tool. They allow you to display the data in a more readable manner without modifying it. Formats can also be used to group data into categories for use in various procedures like PROC FREQ, PROC TTEST, and PROC MEANS (as a class variable). As w...

  10. SAS FORMATS: USES AND ABUSES

    EPA Science Inventory

    SAS formats are a very powerful tool. They allow you to display the data in a more readable manner without modifying it. Formats can also be used to group data into categories for use in various procedures like PROC FREQ, PROC TTEST, and PROC MEANS (as a class variable). As ...

  11. SAS FORMATS: USES AND ABUSES

    EPA Science Inventory

    SAS formats are a very powerful tool. They allow you to display the data in a more readable manner without modifying it. Formats can also be used to group data into categories for use in various procedures like PROC FREQ, PROC TTEST, and PROC MEANS (as a class variable). As w...

  12. SAS FORMATS: USES AND ABUSES

    EPA Science Inventory

    SAS formats are a very powerful tool. They allow you to display the data in a more readable manner without modifying it. Formats can also be used to group data into categories for use in various procedures like PROC FREQ, PROC TTEST, and PROC MEANS (as a class variable). As ...

  13. Cardiovascular group

    NASA Technical Reports Server (NTRS)

    Blomqvist, Gunnar

    1989-01-01

    As a starting point, the group defined a primary goal of maintaining in flight a level of systemic oxygen transport capacity comparable to each individual's preflight upright baseline. The goal of maintaining capacity at preflight levels would seem to be a reasonable objective for several different reasons, including the maintenance of good health in general and the preservation of sufficient cardiovascular reserve capacity to meet operational demands. It is also important not to introduce confounding variables in whatever other physiological studies are being performed. A change in the level of fitness is likely to be a significant confounding variable in the study of many organ systems. The principal component of the in-flight cardiovascular exercise program should be large-muscle activity such as treadmill exercise. It is desirable that at least one session per week be monitored to assure maintenance of proper functional levels and to provide guidance for any adjustments of the exercise prescription. Appropriate measurements include evaluation of the heart-rate/workload or the heart-rate/oxygen-uptake relationship. Respiratory gas analysis is helpful by providing better opportunities to document relative workload levels from analysis of the i