Science.gov

Sample records for formation fortescue group

  1. REE chemistry and Sm-Nd systematics of late Archean weathering profiles in the Fortescue Group, Western Australia

    NASA Technical Reports Server (NTRS)

    MacFarlane, A. W.; Danielson, A.; Holland, H. D.; Jacobsen, S. B.

    1994-01-01

    Two weathering profiles, each consisting of an upper, sericite-rich zone and a lower, chlorite-rich zone, are preserved between flows of the Mt. Roe Basalt in the Fortescue Group, Hamersley Basin, Western Australia. REE concentrations in samples from these two profiles, which originally developed ca 2,760 Ma, show large variations depending on stratigraphic position. LREE abundances and (La/Yb)N are greatest at depths of 3-6 m below the paleosurface of the Mt. Roe #1 profile and are somewhat lower in samples above this level. The LREEs reach concentrations 6-9 times greater than in the underlying basalt, and thus appear to have been mobilized downward in the paleosol and concentrated in its middle part. LREE concentrations in the #2 profile show a similar distribution but with a sharp increase in all REE concentrations within 50 cm of the paleosurface. The distinction between the REE profiles in the two paleosols may be related to the difference in the overlying material. The #1 paleosol is overlain by a few meters of sediments and then by basalt, whereas the #2 paleosol is directly overlain by basalt. The LREEs appear to have been mobilized both during chemical weathering of the parental basalt and during later lower-greenschist-facies metamorphism and metasomatism of the paleosols. Remobilization of the REEs during the regional metamorphism of the Fortescue Group is confirmed by a whole-rock Sm-Nd reference isochron of Mt. Roe #1 samples with an age of 2,151 +/- 360 Ma. Variable initial 143Nd/144Nd values of unweathered basalt samples which may represent the paleosol protolith prevents a confident determination of the magnitude of LREE mobility. Both the initial mobilization of the REEs during weathering and the metasomatic remobilization appear to have taken place under redox conditions where Ce was present dominantly as Ce3+, because Ce anomalies are not developed within the sericite zone samples regardless of concentration. Europium anomalies in the

  2. REE chemistry and Sm-Nd systematics of late Archean weathering profiles in the Fortescue Group, Western Australia.

    PubMed

    MacFarlane, A W; Danielson, A; Holland, H D; Jacobsen, S B

    1994-04-01

    Two weathering profiles, each consisting of an upper, sericite-rich zone and a lower, chlorite-rich zone, are preserved between flows of the Mt. Roe Basalt in the Fortescue Group, Hamersley Basin, Western Australia. REE concentrations in samples from these two profiles, which originally developed ca 2,760 Ma, show large variations depending on stratigraphic position. LREE abundances and (La/Yb)N are greatest at depths of 3-6 m below the paleosurface of the Mt. Roe #1 profile and are somewhat lower in samples above this level. The LREEs reach concentrations 6-9 times greater than in the underlying basalt, and thus appear to have been mobilized downward in the paleosol and concentrated in its middle part. LREE concentrations in the #2 profile show a similar distribution but with a sharp increase in all REE concentrations within 50 cm of the paleosurface. The distinction between the REE profiles in the two paleosols may be related to the difference in the overlying material. The #1 paleosol is overlain by a few meters of sediments and then by basalt, whereas the #2 paleosol is directly overlain by basalt. The LREEs appear to have been mobilized both during chemical weathering of the parental basalt and during later lower-greenschist-facies metamorphism and metasomatism of the paleosols. Remobilization of the REEs during the regional metamorphism of the Fortescue Group is confirmed by a whole-rock Sm-Nd reference isochron of Mt. Roe #1 samples with an age of 2,151 +/- 360 Ma. Variable initial 143Nd/144Nd values of unweathered basalt samples which may represent the paleosol protolith prevents a confident determination of the magnitude of LREE mobility. Both the initial mobilization of the REEs during weathering and the metasomatic remobilization appear to have taken place under redox conditions where Ce was present dominantly as Ce3+, because Ce anomalies are not developed within the sericite zone samples regardless of concentration. Europium anomalies in the

  3. Hydrocarbons preserved in a ~2.7 Ga outcrop sample from the Fortescue Group, Pilbara Craton, Western Australia.

    PubMed

    Hoshino, Y; Flannery, D T; Walter, M R; George, S C

    2015-03-01

    The hydrocarbons preserved in an Archean rock were extracted, and their composition and distribution in consecutive slices from the outside to the inside of the rock were examined. The 2.7 Ga rock was collected from the Fortescue Group in the Pilbara region, Western Australia. The bitumen I (solvent-extracted rock) and bitumen II (solvent-extracted hydrochloric acid-treated rock) fractions have different hydrocarbon compositions. Bitumen I contains only trace amounts of aliphatic hydrocarbons and virtually no aromatic hydrocarbons. In contrast, bitumen II contains abundant aliphatic and aromatic hydrocarbons. The difference seems to reflect the weathering history and preservational environment of the investigated rock. Aliphatic hydrocarbons in bitumen I are considered to be mainly from later hydrocarbon inputs, after initial deposition and burial, and are therefore not indigenous. The lack of aromatic hydrocarbons in bitumen I suggests a severe weathering environment since uplift and exposure of the rock at the Earth's surface in the Cenozoic. On the other hand, the high abundance of aromatic hydrocarbons in bitumen II suggests that bitumen II hydrocarbons have been physically isolated from removal by their encapsulation within carbonate minerals. The richness of aromatic hydrocarbons and the relative scarcity of aliphatic hydrocarbons may reflect the original compositions of organic materials biosynthesised in ancient organisms in the Archean era, or the high thermal maturity of the rock. Cyanobacterial biomarkers were observed in the surficial slices of the rock, which may indicate that endolithic cyanobacteria inhabited the surface outcrop. The distribution of aliphatic and aromatic hydrocarbons implies a high thermal maturity, which is consistent with the lack of any specific biomarkers, such as hopanes and steranes, and the prehnite-pumpellyite facies metamorphic grade.

  4. Modern Subsurface Bacteria in Pristine 2.7 Ga-Old Fossil Stromatolite Drillcore Samples from the Fortescue Group, Western Australia

    PubMed Central

    Gérard, Emmanuelle; Moreira, David; Philippot, Pascal; Van Kranendonk, Martin J.; López-García, Purificación

    2009-01-01

    Background Several abiotic processes leading to the formation of life-like signatures or later contamination with actual biogenic traces can blur the interpretation of the earliest fossil record. In recent years, a large body of evidence showing the occurrence of diverse and active microbial communities in the terrestrial subsurface has accumulated. Considering the time elapsed since Archaean sedimentation, the contribution of subsurface microbial communities postdating the rock formation to the fossil biomarker pool and other biogenic remains in Archaean rocks may be far from negligible. Methodology/Principal Findings In order to evaluate the degree of potential contamination of Archean rocks by modern microorganisms, we looked for the presence of living indigenous bacteria in fresh diamond drillcores through 2,724 Myr-old stromatolites (Tumbiana Formation, Fortescue Group, Western Australia) using molecular methods based on the amplification of small subunit ribosomal RNA genes (SSU rDNAs). We analyzed drillcore samples from 4.3 m and 66.2 m depth, showing signs of meteoritic alteration, and also from deeper “fresh” samples showing no apparent evidence for late stage alteration (68 m, 78.8 m, and 99.3 m). We also analyzed control samples from drilling and sawing fluids and a series of laboratory controls to establish a list of potential contaminants introduced during sample manipulation and PCR experiments. We identified in this way the presence of indigenous bacteria belonging to Firmicutes, Actinobacteria, and Alpha-, Beta-, and Gammaproteobacteria in aseptically-sawed inner parts of drillcores down to at least 78.8 m depth. Conclusions/Significance The presence of modern bacterial communities in subsurface fossil stromatolite layers opens the possibility that a continuous microbial colonization had existed in the past and contributed to the accumulation of biogenic traces over geological timescales. This finding casts shadow on bulk analyses of early life

  5. A Fossil Group in Formation

    NASA Astrophysics Data System (ADS)

    Miller, Eric D.; Rappaport, Saul A.; McDonald, Michael; Bautz, Mark W.; Grant, Catherine E.; Veilleux, Sylvain

    2016-04-01

    In the current picture of hierarchical structure formation, galaxy groups play a vital role as the seeds from which large assemblies of matter form. Compact groups are also important environments in which to watch the fueling of star formation and AGN activity, as the conditions are ideal for galaxy-galaxy interactions. We have identified a galaxy system that may represent an intermediate or transition stage in group evolution. Shakhbazyan 1 (or SHK 1) is a remarkably compact collection of about ten massive, red-sequence galaxies within a region 100 kpc across. Several of these galaxies show signs of AGN activity, and new, deep optical observations with the Discovery Channel Telescope reveal an extended stellar envelope surrounding the galaxies. This envelope is much more extended than what would be expected from a superposition of normal galaxy envelopes, and it indicates a large amount of intra-group starlight, evidence that the galaxies in SHK 1 are dynamically interacting.We here present new Chandra spectral imaging observations of this unusual system that confirm the presence of an X-ray-emitting diffuse intra-group medium (IGM), with a temperature of 1.5 keV and X-ray luminosity of 1043 erg/s. Assuming hydrostatic equilibrium, the system is about 1/3 as massive as expected from the optical richness. In addition, three of the ten central galaxies exhibit signatures of X-ray AGN. The under-luminous IGM, high density of bright galaxies, and evidence for galaxy-galaxy interaction indicate that this system may be in a transition stage of galaxy merging, similar to that expected in the formation of a fossil group. Alternatively, SHK 1 may consist of multiple poor groups in the final stages of merging along our line of sight. We explore these scenarios and outline paths of future study for this enigmatic system.

  6. Group formation through indirect reciprocity

    NASA Astrophysics Data System (ADS)

    Oishi, Koji; Shimada, Takashi; Ito, Nobuyasu

    2013-03-01

    The emergence of group structure of cooperative relations is studied in an agent-based model. It is proved that specific types of reciprocity norms lead individuals to split into two groups only inside of which they are cooperative. The condition for the evolutionary stability of the norms is also obtained. This result suggests reciprocity norms, which usually promote cooperation, can cause society's separation into multiple groups.

  7. Spontaneous Group Formation in the Seceder Model

    NASA Astrophysics Data System (ADS)

    Dittrich, Peter; Liljeros, Fredrik; Soulier, Arne; Banzhaf, Wolfgang

    2000-04-01

    The seceder model shows how the local tendency to be different gives rise to the formation of groups. The model consists of a population of simple entities which reproduce and die. In a single reproduction event three individuals are chosen randomly and the individual which possesses the largest distance to their center is reproduced by creating a mutated offspring. The offspring replaces a randomly chosen individual of the population. The paper demonstrates the complex group formation behavior and its dependency on the population size.

  8. Group formation and ideology. Text and context.

    PubMed

    Hernandez, M

    1988-01-01

    The relationship between the phenomenon of 'mass formation' (Massenbildung) and the production and circulation of ideologies is examined. The explanation of the said relationship must take into account both the social dimension as well as the intrapsychic structure of the ideological. To achieve this a brief review of Freud's ideas on group psychology and of some definitions of ideology, namely those proposed by Ricoeur, Althusser and Habermas is expounded. In the same way as the understanding of the vicissitudes of identification is crucial to gain insight into 'mass formation', the investigation of the processes of idealization is vital to the understanding of the ideological.

  9. Learning Group Formation Based on Learner Profile and Context

    ERIC Educational Resources Information Center

    Muehlenbrock, Martin

    2006-01-01

    An important but often neglected aspect in Computer-Supported Collaborative Learning (CSCL) is the formation of learning groups. Until recently, most support for group formation was based on learner profile information. In addition, the perspective of ubiquitous computing and ambient intelligence allows for a wider perspective on group formation,…

  10. Managed Group Formation: An Approach to Team Formation in Policy Courses.

    ERIC Educational Resources Information Center

    Nelson, Reed E.; And Others

    1994-01-01

    Managed group formation uses student personal value data and sociometric nomination to optimize the influence of work group formation on student learning. Resulting work group formations are used to enhance the effectiveness of traditional course content and to increase students' sensitization to important group process issues in business policy.…

  11. Group-Level Formative Feedback and Metadiscourse

    ERIC Educational Resources Information Center

    Resendes, Monica; Scardamalia, Marlene; Bereiter, Carl; Chen, Bodong; Halewood, Cindy

    2015-01-01

    This research explores the ability of grade 2 students to engage in productive discussion about the state of their knowledge building using group-level feedback tools to support their metadiscourse. Two aspects of knowledge work were common to the comparison and experimental classes: "Knowledge Building talk" (KB talk) involving…

  12. Endogenous Group Formation via Unproductive Costs

    PubMed Central

    Aimone, Jason A.; Iannaccone, Laurence R.; Makowsky, Michael D.; Rubin, Jared

    2013-01-01

    Sacrifice is widely believed to enhance cooperation in churches, communes, gangs, clans, military units, and many other groups. We find that sacrifice can also work in the lab, apart from special ideologies, identities, or interactions. Our subjects play a modified VCM game—one in which they can voluntarily join groups that provide reduced rates of return on private investment. This leads to both endogenous sorting (because free-riders tend to reject the reduced-rate option) and substitution (because reduced private productivity favours increased club involvement). Seemingly unproductive costs thus serve to screen out free-riders, attract conditional cooperators, boost club production, and increase member welfare. The sacrifice mechanism is simple and particularly useful where monitoring difficulties impede punishment, exclusion, fees, and other more standard solutions. PMID:24808623

  13. The Formation of Effective Work Groups within an FE Classroom

    ERIC Educational Resources Information Center

    Russell, Megan

    2010-01-01

    Fascinated by the diversity of composition in effective work groups in Further Education (FE) classrooms, I studied group formation and composition in level 3 Biology classes over an academic year. Using information from the class teacher, observers and students, the importance of effective work groups (defining effectiveness in terms of…

  14. Enhancing the impact of groups: an evaluation of two group formats for smokers.

    PubMed

    Hajek, P; Belcher, M; Stapleton, J

    1985-11-01

    The effects of two different group formats constituting part of an otherwise identical smoking cessation programme were evaluated. Each group format was in use for one full calendar year. One hundred and thirty-two smokers were treated in 14 'therapist-oriented' (T-O) groups run in traditional didactic style and 138 in 14 'group-oriented' (G-O) groups, where the primary emphasis was on group resources (group support, group pressure and spontaneous modelling of coping responses). G-O groups were significantly more successful. The two types of groups did not differ in the number of clients who succeeded in stopping smoking just after the first meeting, i.e. before the difference in group formats could have any impact; but in the G-O groups more of those who failed initially persisted in trying and succeeded later in the course. Independently of the format, larger groups were more successful and in addition there was significant variation between single groups regardless of both format and size. Group processes seem to play an important role in smoking cessation and the way in which a group is structured can affect outcome.

  15. Talking therapy groups on acute psychiatric wards: patients' experience of two structured group formats.

    PubMed

    Radcliffe, Jonathan; Bird, Laura

    2016-08-01

    Aims and method We report the results of a clinical audit of patients' reactions to two types of talking therapy groups facilitated by assistant psychologists and psychology graduates on three acute wards. Patients' experiences of problem-solving and interpersonal group formats were explored via focus groups and structured interviews with 29 group participants. Results Both group formats generated high satisfaction ratings, with benefits related mostly to generic factors. Clinical implications Adequately trained and supported assistant psychologists and psychology graduates can provide supportive talking groups that patients find helpful.

  16. Star Formation and Environment in Compact Groups of Galaxies

    NASA Astrophysics Data System (ADS)

    Iglesias-Páramo, J.; Vílchez, J. M.

    H &alpha luminosities are presented in order to study the Star Formation Rates (SFRs) of a sample of galaxies in compact groups from Hickson's (1982) catalogue. Although the comparison of the SFRs of the disk galaxies in our sample with those of a sample of field galaxies yielded no difference between the average SFRs for disk galaxies in compact groups and in the field, environmental effects seem to influence the H &alpha luminosities of late and early-type galaxies in compact groups. No relationship was found between the total normalized H &alpha luminosities of the groups and some dynamical parameters, indicating that the dynamical state of the group does not influence the SFR of the group. The lack of dominant interaction induced starbursts in our sample is compatible with a scenario for compact groups of galaxies in which the dark matter of the group is arranged in a common halo, thereby preventing a fast collapse of the galaxies.

  17. Star Formation in Undergraduate ALFALFA Team Galaxy Groups and Clusters

    NASA Astrophysics Data System (ADS)

    Koopmann, Rebecca A.; Durbala, Adriana; Finn, Rose; Haynes, Martha P.; Coble, Kimberly A.; Craig, David W.; Hoffman, G. Lyle; Miller, Brendan P.; Crone-Odekon, Mary; O'Donoghue, Aileen A.; Troischt, Parker; Undergraduate ALFALFA Team; ALFALFA Team

    2017-01-01

    The Undergraduate ALFALFA Team (UAT) Groups project is a coordinated study of gas and star formation properties of galaxies in and around 36 nearby (z<0.03) groups and clusters of varied richness, morphological type mix, and X-ray luminosity. By studying a large range of environments and considering the spatial distributions of star formation, we probe mechanisms of gas depletion and morphological transformation. The project uses ALFALFA HI observations, optical observations, and digital databases like SDSS, and incorporates work undertaken by faculty and students at different institutions within the UAT. Here we present results from our wide area Hα and broadband R imaging project carried out with the WIYN 0.9m+MOSAIC/HDI at KPNO, including an analysis of radial star formation rates and extents of galaxies in the NGC 5846, Abell 779, NRGb331, and HCG 69 groups/clusters. This work has been supported by NSF grant AST-1211005 and AST-1637339.

  18. Cyclic diguanylate regulation of Bacillus cereus group biofilm formation.

    PubMed

    Fagerlund, Annette; Smith, Veronika; Røhr, Åsmund K; Lindbäck, Toril; Parmer, Marthe P; Andersson, K Kristoffer; Reubsaet, Leon; Økstad, Ole Andreas

    2016-08-01

    Biofilm formation can be considered a bacterial virulence mechanism. In a range of Gram-negatives, increased levels of the second messenger cyclic diguanylate (c-di-GMP) promotes biofilm formation and reduces motility. Other bacterial processes known to be regulated by c-di-GMP include cell division, differentiation and virulence. Among Gram-positive bacteria, where the function of c-di-GMP signalling is less well characterized, c-di-GMP was reported to regulate swarming motility in Bacillus subtilis while having very limited or no effect on biofilm formation. In contrast, we show that in the Bacillus cereus group c-di-GMP signalling is linked to biofilm formation, and to several other phenotypes important to the lifestyle of these bacteria. The Bacillus thuringiensis 407 genome encodes eleven predicted proteins containing domains (GGDEF/EAL) related to c-di-GMP synthesis or breakdown, ten of which are conserved through the majority of clades of the B. cereus group, including Bacillus anthracis. Several of the genes were shown to affect biofilm formation, motility, enterotoxin synthesis and/or sporulation. Among these, cdgF appeared to encode a master diguanylate cyclase essential for biofilm formation in an oxygenated environment. Only two cdg genes (cdgA, cdgJ) had orthologs in B. subtilis, highlighting differences in c-di-GMP signalling between B. subtilis and B. cereus group bacteria.

  19. Toward Effective Group Formation in Computer-Supported Collaborative Learning

    ERIC Educational Resources Information Center

    Sadeghi, Hamid; Kardan, Ahmad A.

    2016-01-01

    Group formation task as a starting point for computer-supported collaborative learning plays a key role in achieving pedagogical goals. Various approaches have been reported in the literature to address this problem, but none have offered an optimal solution. In this research, an online learning environment was modeled as a weighted undirected…

  20. Exploring Group Formation through Work and Play at Camp.

    ERIC Educational Resources Information Center

    Cain, Jim

    2003-01-01

    While working and playing together at camp, staff often work through most, if not all, of the stages of group formation, commonly referred to as forming, storming, norming, performing, and finally, transforming. Ten adventure-based games and activities are presented to help camp directors train staff and help them progress through these stages.…

  1. Exploring Technology Supported Collaborative and Cooperative Group Formation Mechanisms

    ERIC Educational Resources Information Center

    Carapina, Mia; Boticki, Ivica

    2015-01-01

    This paper reflects on the systematic literature review paper (in progress), which analyzes technology enhanced collaborative and cooperative learning in elementary education worldwide from 2004 to 2015, focusing on the exploration of technology mediated group formation. The review paper reports on only a few cases of technology supported methods…

  2. A New Group-Formation Method for Student Projects

    ERIC Educational Resources Information Center

    Borges, Jose; Dias, Teresa Galvao; Cunha, Joao Falcao E.

    2009-01-01

    In BSc/MSc engineering programmes at Faculty of Engineering of the University of Porto (FEUP), the need to provide students with teamwork experiences close to a real world environment was identified as an important issue. A new group-formation method that aims to provide an enriching teamwork experience is proposed. Students are asked to answer a…

  3. Promoting cooperation by reputation-driven group formation

    NASA Astrophysics Data System (ADS)

    Yang, Han-Xin; Wang, Zhen

    2017-02-01

    In previous studies of the spatial public goods game, each player is able to establish a group. However, in real life, some players cannot successfully organize groups for various reasons. In this paper, we propose a mechanism of reputation-driven group formation, in which groups can only be organized by players whose reputation reaches or exceeds a threshold. We define a player’s reputation as the frequency of cooperation in the last T time steps. We find that the highest cooperation level can be obtained when groups are only established by pure cooperators who always cooperate in the last T time steps. Effects of the memory length T on cooperation are also studied.

  4. Acritarchs of the Ediacaran Frecheirinha Formation, Ubajara Group, Northeastern Brazil.

    PubMed

    Chiglino, Leticia; Gaucher, Claudio; Sial, Alcides N; Ferreira, Valderez P

    2015-01-01

    We report for the first time the occurrence of organic-walled microfossils in Ediacaran limestones and marls of the Frecheirinha Formation, Ubajara Group, and the first Precambrian acritarchs so far reported for northeastern Brazil. The assemblage of the Frecheirinha Formation represents a low-diversity microflora comprising Leiosphaeridia, Lophosphaeridium and subordinated Bavlinella (=Sphaerocongregus). Their thermal alteration index (TAI) between 4+ and 5, suggests metamorphic temperatures exceeding 200-250°C. Higher temperatures are probably related to intruding granitic plutons (Meruoca, Mucambo). Reported δ13C values of carbonates of -3.5 ‰ VPDB (Vienna-Peedee Belemnite) at the base, passing up section into a positive plateau of up to +3.7 ‰, and corresponding 87Sr/86Sr values between 0.7075 and 0.7080 suggest an Ediacaran age. The acritarch assemblage is comparable to the Late Ediacaran Leiosphere Palynoflora (LELP) or Kotlin-Rovno assemblage, in broad agreement with chemostratigraphic data. Macrofossils belonging to the Ediacara fauna were reported from the overlying Jaibaras Group, which would constrain even further the depositional age of the Frecheirinha Formation to within ca. 575-555 Ma. A more comprehensive palynological study of the Frecheirinha Formation is necessary to confirm this age assignment.

  5. Cooperation driven by success-driven group formation.

    PubMed

    Szolnoki, Attila; Chen, Xiaojie

    2016-10-01

    In the traditional setup of the public goods game all players are involved in every available group and the mutual benefit is shared among competing cooperator and defector strategies. However, in real life situations the group formation of players could be more sophisticated because not all players are attractive enough for others to participate in a joint venture. What if only those players who are successful enough to the neighbors can initiate a group formation and establish a game? To elaborate this idea we employ a modified protocol and demonstrate that a carefully chosen threshold to establish a joint venture could efficiently improve the cooperation level even if the synergy factor would suggest a full defector state otherwise. The microscopic mechanism that is responsible for this effect is based on the asymmetric consequences of competing strategies: while the success of a cooperator provides a long-time well-being for the neighborhood, the temporary advantage of defection cannot be maintained if the protocol is based on the success of leaders.

  6. Cooperation driven by success-driven group formation

    NASA Astrophysics Data System (ADS)

    Szolnoki, Attila; Chen, Xiaojie

    2016-10-01

    In the traditional setup of the public goods game all players are involved in every available group and the mutual benefit is shared among competing cooperator and defector strategies. However, in real life situations the group formation of players could be more sophisticated because not all players are attractive enough for others to participate in a joint venture. What if only those players who are successful enough to the neighbors can initiate a group formation and establish a game? To elaborate this idea we employ a modified protocol and demonstrate that a carefully chosen threshold to establish a joint venture could efficiently improve the cooperation level even if the synergy factor would suggest a full defector state otherwise. The microscopic mechanism that is responsible for this effect is based on the asymmetric consequences of competing strategies: while the success of a cooperator provides a long-time well-being for the neighborhood, the temporary advantage of defection cannot be maintained if the protocol is based on the success of leaders.

  7. A model for the formation of the Local Group

    NASA Technical Reports Server (NTRS)

    Peebles, P. J. E.; Melott, A. L.; Holmes, M. R.; Jiang, L. R.

    1989-01-01

    Observational tests of a model for the formation of the Local Group are presented and analyzed in which the mass concentration grows by gravitational accretion of local-pressure matter onto two seed masses in an otherwise homogeneous initial mass distribution. The evolution of the mass distribution is studied in an analytic approximation and a numerical computation. The initial seed mass and separation are adjusted to produce the observed present separation and relative velocity of the Andromeda Nebula and the Galaxy. If H(0) is adjusted to about 80 km/s/Mpc with density parameter Omega = 1, then the model gives a good fit to the motions of the outer members of the Local Group. The same model gives particle orbits at radius of about 100 kpc that reasonably approximate the observed distribution of redshifts of the Galactic satellites.

  8. A model for the formation of the Local Group

    SciTech Connect

    Peebles, P.J.E.; Melott, A.L.; Holmes, M.R.; Jiang, L.R. Kansas Univ., Lawrence )

    1989-10-01

    Observational tests of a model for the formation of the Local Group are presented and analyzed in which the mass concentration grows by gravitational accretion of local-pressure matter onto two seed masses in an otherwise homogeneous initial mass distribution. The evolution of the mass distribution is studied in an analytic approximation and a numerical computation. The initial seed mass and separation are adjusted to produce the observed present separation and relative velocity of the Andromeda Nebula and the Galaxy. If H(0) is adjusted to about 80 km/s/Mpc with density parameter Omega = 1, then the model gives a good fit to the motions of the outer members of the Local Group. The same model gives particle orbits at radius of about 100 kpc that reasonably approximate the observed distribution of redshifts of the Galactic satellites. 47 refs.

  9. Heats of Formation and Bond Energies in Group III Compounds

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Allendorf, Mark D.; Melius, Carl F.; Arnold, James O. (Technical Monitor)

    1999-01-01

    We present heats of formation and bond energies for Group-III compounds obtained from calculations of molecular ground-state I electronic energies. Data for compounds of the form MXn are presented, where M = B, Al, Ga, and In, X = He H, Cl, and CH3, and n = 1-3. Energies for the B, Al, and Ga compounds are obtained from G2 predictions, while those for the In compounds are obtained from CCSD(T)/CBS calculations; these are the most accurate calculations for indium-containing compounds published to date. In most cases, the calculated thermochemistry is in good agreement with published values derived from experiments for those species that have well-established heats of formation. Bond energies obtained from the heats of formation follow the expected trend (Cl much greater than CH3 approx. H). However, the CH3M-(CH3)2 bond energies obtained for trimethylgallium and trimethylindium are considerably stronger (greater than 15 kcal/mol) than currently accepted values.

  10. Reputation drives cooperative behaviour and network formation in human groups.

    PubMed

    Cuesta, Jose A; Gracia-Lázaro, Carlos; Ferrer, Alfredo; Moreno, Yamir; Sánchez, Angel

    2015-01-19

    Cooperativeness is a defining feature of human nature. Theoreticians have suggested several mechanisms to explain this ubiquitous phenomenon, including reciprocity, reputation, and punishment, but the problem is still unsolved. Here we show, through experiments conducted with groups of people playing an iterated Prisoner's Dilemma on a dynamic network, that it is reputation what really fosters cooperation. While this mechanism has already been observed in unstructured populations, we find that it acts equally when interactions are given by a network that players can reconfigure dynamically. Furthermore, our observations reveal that memory also drives the network formation process, and cooperators assort more, with longer link lifetimes, the longer the past actions record. Our analysis demonstrates, for the first time, that reputation can be very well quantified as a weighted mean of the fractions of past cooperative acts and the last action performed. This finding has potential applications in collaborative systems and e-commerce.

  11. Reputation drives cooperative behaviour and network formation in human groups

    PubMed Central

    Cuesta, Jose A.; Gracia-Lázaro, Carlos; Ferrer, Alfredo; Moreno, Yamir; Sánchez, Angel

    2015-01-01

    Cooperativeness is a defining feature of human nature. Theoreticians have suggested several mechanisms to explain this ubiquitous phenomenon, including reciprocity, reputation, and punishment, but the problem is still unsolved. Here we show, through experiments conducted with groups of people playing an iterated Prisoner's Dilemma on a dynamic network, that it is reputation what really fosters cooperation. While this mechanism has already been observed in unstructured populations, we find that it acts equally when interactions are given by a network that players can reconfigure dynamically. Furthermore, our observations reveal that memory also drives the network formation process, and cooperators assort more, with longer link lifetimes, the longer the past actions record. Our analysis demonstrates, for the first time, that reputation can be very well quantified as a weighted mean of the fractions of past cooperative acts and the last action performed. This finding has potential applications in collaborative systems and e-commerce. PMID:25598347

  12. Formation of nanostructured Group IIA metal activated sensors: The transformation of Group IIA metal compound sites

    NASA Astrophysics Data System (ADS)

    Tune, Travis C.; Baker, Caitlin; Hardy, Neil; Lin, Arthur; Widing, Timothy J.; Gole, James L.

    2015-05-01

    Trends in the Group IIA metal oxides and hydroxides of magnesium, calcium, and barium are unique in the periodic table. In this study we find that they display novel trends as decorating nanostructures for extrinsic semiconductor interfaces. The Group IIA metal ions are strong Lewis acids. We form these M2+ ions in aqueous solution and bring these solutions in contact with a porous silicon interface to form interfaces for conductometric measurements. Observed responses are consistent with the formation of MgO whereas the heavier elements display behaviors which suggest the effect of their more basic nature. Mg(OH)2, when formed, represents a weak base whereas the heavier metal hydroxides of Ca, Sr, and Ba are strong bases. However, the hydroxides tend to give up hydrogen and act as Brönsted acids. For the latter elements, the reversible interaction response of nanostructures deposited to the porous silicon (PS) interface is modified, as the formation of more basic sites appears to compete with M2+ Lewis acidity and hydroxide Brönsted acidity. Mg2+ forms an interface whose response to the analytes NH3 and NO is consistent with MgO and well explained by the recently developing Inverse Hard/Soft Acid/Base model. The behavior of the Ca2+ and Ba2+ decorated interfaces as they interact with the hard base NH3 follows a reversal of the model, indicating a decrease in acidic character as the observed conductometric response suggests the interaction with hydroxyl groups. A change from oxide-like to hydroxide-like constituents is supported by XPS studies. The changes in conductometric response is easily monitored in contrast to changes associated with the Group IIA oxides and hydroxides observed in XPS, EDAX, IR, and NMR measurements.

  13. Asteroid mega-impacts and Precambrian banded iron formations: 2.63 Ga and 2.56 Ga impact ejecta/fallout at the base of BIF/argillite units, Hamersley Basin, Pilbara Craton, Western Australia

    NASA Astrophysics Data System (ADS)

    Glikson, Andrew; Vickers, John

    2007-02-01

    The temporal association between late Archaean to earliest Proterozoic asteroid impact ejecta/fallout units and overlying banded iron formations suggests that, in some instances, these impacts were closely followed by significant transformation in the nature of source terrains of the sediments. The Jeerinah Impact Layer (JIL) [B.M. Simonson, D. Davies, S.W. Hassler, Discovery of a layer of probable impact melt spherules in the late Archean Jeerinah Formation, Fortescue Group, Western Australia. Aust. J. Earth Sci. 47 (2000) 315-325; B.M. Simonson, S.W. Hassler, Revised correlations in the early Precambrian Hamersley Basin based on a horizon of resedimented impact spherules. Aust. J. Earth Sci. 44 (1997) 37-48; B.M. Simonson, B.P. Glass, Spherule layers - records of ancient impacts. Ann. Rev. Earth Planet. Sci. 32 (2004) 329-361; A.Y. Glikson, Early Precambrian asteroid impact-triggered tsunami: excavated seabed, debris flows, exotic boulders, and turbulence features associated with 3.47-2.47 Ga-old asteroid impact fallout units, Pilbara Craton, Western Australia. Astrobiology 4 (2001) 19-50; S.W. Hassler, B.M. Simonson, D.Y. Sumner, D. Murphy, Neoarchaean impact spherule layers in the Fortescue and Hamersley Groups, Western Australia: stratigraphic and depositional implications of re-correlation. Aust. J. Earth Sci. 52 (2005) 759-772; B. Rasmussen, C. Koeberl, Iridium anomalies and shocked quartz in a late Archean spherule layer from the Pilbara Craton: new evidence for a major asteroid impact at 2.63 Ga. Geology 32 (2004) 1029-1032; B. Rasmussen, T.S. Blake, I.R. Fletcher, U-Pb zircon age constraints on the Hamersley spherule beds: Evidence for a single 2.63 Ga Jeerinah-Carawine impact ejecta layer. Geology, 33 (2005) 725-728.] overlies an argillite-dominated unit (Jeerinah Formation, 2684 ± 6 Ma [A.F. Trendall, W. Compston, D.R. Nelson, J.R. deLaeter, V.C. Bennett, SHRIMP zircon ages constraining the depositional chronology of the Hamersley Group, Western

  14. Cortical mechanisms for afterimage formation: evidence from interocular grouping

    PubMed Central

    Dong, Bo; Holm, Linus; Bao, Min

    2017-01-01

    Whether the retinal process alone or retinal and cortical processes jointly determine afterimage (AI) formation has long been debated. Based on the retinal rebound responses, recent work proposes that afterimage signals are exclusively generated in the retina, although later modified by cortical mechanisms. We tested this notion with the method of “indirect proof”. Each eye was presented with a 2-by-2 checkerboard of horizontal and vertical grating patches. Each corresponding patch of the two checkerboards was perpendicular to each other, which produces binocular rivalry, and can generate percepts ranging from complete interocular grouping to either monocular pattern. The monocular percepts became more frequent with higher contrast. Due to adaptation, the visual system is less sensitive during the AIs than during the inductions with AI-similar contrast. If the retina is the only origin of AIs, comparable contrast appearance would require stronger retinal signals in the AIs than in the inductions, thus leading to more frequent monocular percepts in the AIs than in the inductions. Surprisingly, subjects saw the fully coherent stripes significantly more often in AIs. Our results thus contradict the retinal generation notion, and suggest that in addition to the retina, cortex is directly involved in the generation of AI signals. PMID:28112230

  15. Group Supervision in Psychotherapy. Main Findings from a Swedish Research Project on Psychotherapy Supervision in a Group Format

    ERIC Educational Resources Information Center

    Ogren, Marie-Louise; Sundin, Eva C.

    2009-01-01

    Psychotherapy supervision is considered crucial for psychotherapists in training. During the last decades, group supervision has been a frequently used format in many countries. Until recently, very few studies had evaluated the small-group format for training of beginner psychotherapists and psychotherapy supervisors. This article aims to…

  16. Dynamic Group Formation Based on a Natural Phenomenon

    ERIC Educational Resources Information Center

    Zedadra, Amina; Lafifi, Yacine; Zedadra, Ouarda

    2016-01-01

    This paper presents a new approach of learners grouping in collaborative learning systems. This grouping process is based on traces left by learners. The goal is the circular dynamic grouping to achieve collaborative projects. The proposed approach consists of two main algorithms: (1) the circular grouping algorithm and (2) the dynamic grouping…

  17. A Framework for Semantic Group Formation in Education

    ERIC Educational Resources Information Center

    Ounnas, Asma; Davis, Hugh C.; Millard, David E.

    2009-01-01

    Collaboration has long been considered an effective approach to learning. However, forming optimal groups can be a time consuming and complex task. Different approaches have been developed to assist teachers allocate students to groups based on a set of constraints. However, existing tools often fail to assign some students to groups creating a…

  18. Cognitive Behavior Therapy: A Comparison of Group and Individual Formats.

    ERIC Educational Resources Information Center

    Shaffer, Carolyn S.; And Others

    The relative efficacy of both group and individual cognitive behavior therapeutic approaches in treating anxiety and depression are evaluated and then compared to an interpersonal group therapy approach. The two major hypotheses are that group cognitive behavior therapy is at least as effective as individual cognitive behavior therapy, and that…

  19. Where Were You Fifth Period? Five Strategies for High School Group Formation in the 1990s.

    ERIC Educational Resources Information Center

    Fast, Jonathan

    1999-01-01

    Presents five strategies to help school social workers form groups during school hours. Advantages and disadvantages of each strategy are discussed, as well as how the formation of the group influences the nature of the group work. (Author/GCP)

  20. Reformers or Roadblocks: Educational Interest Groups and State Policy Formation

    ERIC Educational Resources Information Center

    Emerson, Joseph; Lemasters, Linda; Howerton, Everett

    2008-01-01

    Given the overt political nature of this topic, an additional theoretical postulate, the Triadic Theory of Power was also presented as another framework to conceptualize the external and internal forces which shape the formation of contemporary education policy. Predicated upon the scholarship of Nobel laureate James Q. Wilson, Andrew McFarland…

  1. An Ontology Engineering Approach to the Realization of Theory-Driven Group Formation

    ERIC Educational Resources Information Center

    Isotani, Seiji; Inaba, Akiko; Ikeda, Mitsuru; Mizoguchi, Riichiro

    2009-01-01

    One of the main difficulties during the design of collaborative learning activities is adequate group formation. In any type of collaboration, group formation plays a critical role in the learners' acceptance of group activities, as well as the success of the collaborative learning process. Nevertheless, to propose both an effective and…

  2. Cooperation during cultural group formation promotes trust towards members of out-groups

    PubMed Central

    Pan, Xiaofei Sophia; Houser, Daniel

    2013-01-01

    People often cooperate with members of their own group, and discriminate against members of other groups. Previous research establishes that cultural groups can form endogenously, and that these groups demonstrate in-group favouritism. Given the presence of cultural groups, the previous literature argues that cultural evolution selects for groups that exhibit parochial altruism. The source of initial variation in these traits, however, remains uninformed. We show here that a group's economic production environment may substantially influence parochial tendencies, with groups formed around more cooperative production (CP) displaying less parochialism than groups formed around more independent production (IP) processes. Participants randomized into CP and IP production tasks formed cultural groups, and subsequently played hidden-action trust games with in-group and out-group trustees. We found CP to be associated with significantly greater sharing and exchanging behaviours than IP. In trust games, significant parochial altruism (in-group favouritism combined with out-group discrimination) was displayed by members of IP groups. By contrast, members of CP groups did not engage in either in-group favouritism or out-group discrimination. Further, we found the absence of out-group discrimination in CP to persist even following ‘betrayal’. Finally, belief data suggest that members of CP are not more intrinsically generous than IP members, but rather more likely to believe that out-group trustees will positively reciprocate. Our results have important implications for anyone interested in building cooperative teams, and shed new light on connections between culture and cooperation. PMID:23658200

  3. Influence of Group Formation Choices on Academic Performance

    ERIC Educational Resources Information Center

    Seethamraju, Ravi; Borman, Mark

    2009-01-01

    With its multidisciplinary and applied foci, team-working skills are seen as especially critical in business courses in general and in business information systems courses in particular, and are specifically incorporated into desired graduate attributes by many universities. Past research has focused on the benefits of group working but little…

  4. Charged group surface accessibility determines micelleplexes formation and cellular interaction

    NASA Astrophysics Data System (ADS)

    Zhang, Yu; Liu, Yang; Sen, Soumyo; Král, Petr; Gemeinhart, Richard A.

    2015-04-01

    Micelleplexes are a class of nucleic acid carriers that have gained acceptance due to their size, stability, and ability to synergistically carry small molecules. MicroRNAs (miRNAs) are small non-coding RNA gene regulator that is consists of 19-22 nucleotides. Altered expression of miRNAs plays an important role in many human diseases. Using a model 22-nucleotide miRNA sequence, we investigated the interaction between charged groups on the micelle surface and miRNA. The model micelle system was formed from methoxy-poly(ethylene glycol)-b-poly(lactide) (mPEG-PLA) mixed with methoxy-poly(ethylene glycol)-b-poly(lactide)-b-oligoarginine (mPEG-PLA-Rx, x = 8 or 15). Surface properties of the micelles were varied by controlling the oligoarginine block length and conjugation density. Micelles were observed to have a core-shell conformation in the aqueous environment where the PLA block constituted the hydrophobic core, mPEG and oligoarginine formed a hydrophilic corona. Significantly different thermodynamic behaviors were observed during the interaction of single stranded miRNA with micelles of different surface properties, and the resulting micelleplexes mediated substantial cellular association. Depending upon the oligoarginine length and density, micelles exhibited miRNA loading capacity directly related to the presentation of charged groups on the surface. The effect of charged group accessibility of cationic micelle on micelleplex properties provides guidance on future miRNA delivery system design.Micelleplexes are a class of nucleic acid carriers that have gained acceptance due to their size, stability, and ability to synergistically carry small molecules. MicroRNAs (miRNAs) are small non-coding RNA gene regulator that is consists of 19-22 nucleotides. Altered expression of miRNAs plays an important role in many human diseases. Using a model 22-nucleotide miRNA sequence, we investigated the interaction between charged groups on the micelle surface and miRNA. The

  5. The Self-Formation of Collaborative Groups in a Problem Based Learning Environment

    ERIC Educational Resources Information Center

    Raiyn, Jamal; Tilchin, Oleg

    2016-01-01

    The aim of this paper is to present "the three steps method" of the self-formation of collaborative groups in a problem-based learning environment. The self-formation of collaborative groups is based on sharing of accountability among students for solving instructional problems. The steps of the method are planning collaborative problem…

  6. Formation of non-magmatic iron-meteorite group IIE

    NASA Astrophysics Data System (ADS)

    Wasson, John T.

    2017-01-01

    Instrumental neutron-activation (INAA) data for metal in 22 nonmagmatic IIE meteorites show narrow ranges in Ir and other refractory siderophiles; the Ir range is a factor of 2.6, a factor of ∼2 smaller than in nonmagmatic IAB-MG, and orders of magnitude smaller than in the large magmatic groups. Siderophile data show no evidence of fractional crystallization. IIE irons can be split into two sets, a larger main-set and a set of 6 Cu- (or FeS) rich irons. Elemental concentrations in metal from veins in H5 chondrite Portales Valley fall within the IIE range with the exceptions of Co (high) and Ga (low). H-group-chondrite and Au-normalized IIE abundances for siderophiles show that IIE irons are ∼30% higher than H in refractory siderophiles Re, Ir and W and are about 30% lower than H chondrites in the volatiles Ga and Sb, inconsistent with proposals that IIE irons formed from H chondrites. The IIE fractionations contrast with those in L chondrites which are about 15% lower than H in the three refractory elements and 40% higher than H in volatiles indicating that IIE irons did not form from H chondrites but from a more reduced and siderophile-rich kind of ordinary chondrite ("HH" chondrites). Most O-isotope data support a close relationship between IIE irons and H or HH chondrites; lower Δ17O in primitive (chondritic) silicates support an HH classification. Literature isotopic data for Ru and Mo also show that IIE metal formed from an ordinary chondrite parent; it appears that the silicates and metal were formed by melting of a single asteroid. There is no evidence for radiogenic (26Al) heating; this, the rapid cooling recorded in the sizes of parental gamma crystal in the metal and the absence of fractional crystallization strongly support the hypothesis that IIE melting was the result of impacts. To summarize, the weight of the evidence favors the conclusion that IIE meteorites were formed by one or more impacts on an HH asteroid. The target probably had a

  7. Networking the seceder model: Group formation in social and economic systems

    NASA Astrophysics Data System (ADS)

    Grönlund, Andreas; Holme, Petter

    2004-09-01

    The seceder model illustrates how the desire to be different from the average can lead to formation of groups in a population. We turn the original, agent based, seceder model into a model of network evolution. We find that the structural characteristics of our model closely match empirical social networks. Statistics for the dynamics of group formation are also given. Extensions of the model to networks of companies are also discussed.

  8. Networking the seceder model: Group formation in social and economic systems.

    PubMed

    Grönlund, Andreas; Holme, Petter

    2004-09-01

    The seceder model illustrates how the desire to be different from the average can lead to formation of groups in a population. We turn the original, agent based, seceder model into a model of network evolution. We find that the structural characteristics of our model closely match empirical social networks. Statistics for the dynamics of group formation are also given. Extensions of the model to networks of companies are also discussed.

  9. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  10. A Genetic Algorithm Approach for Group Formation in Collaborative Learning Considering Multiple Student Characteristics

    ERIC Educational Resources Information Center

    Moreno, Julian; Ovalle, Demetrio A.; Vicari, Rosa M.

    2012-01-01

    Considering that group formation is one of the key processes in collaborative learning, the aim of this paper is to propose a method based on a genetic algorithm approach for achieving inter-homogeneous and intra-heterogeneous groups. The main feature of such a method is that it allows for the consideration of as many student characteristics as…

  11. Prevalence, Formation, Maintenance, and Evaluation of Interdisciplinary Student Aging Interest Groups

    ERIC Educational Resources Information Center

    Jones, Katherine J.; Vandenberg, Edward V.; Bottsford, Lisa

    2011-01-01

    The authors describe the prevalence, formation, maintenance, and evaluation of student aging interest groups. They conducted a cross-sectional electronic survey of the 46 academic medical centers funded by the Donald W. Reynolds Foundation. To evaluate their group of approximately 50 students, the authors conducted an electronic pretest and…

  12. Exploring Teacher Beliefs and Use of Acceleration, Ability Grouping, and Formative Assessment

    ERIC Educational Resources Information Center

    Missett, Tracy C.; Brunner, Marguerite M.; Callahan, Carolyn M.; Moon, Tonya R.; Azano, Amy Price

    2014-01-01

    Few academic interventions for gifted students have generated more empirical support than acceleration and ability grouping, and formative assessment is advocated as a tool that educators can use to appropriately integrate accelerative practices and ability grouping into the classroom. However, the empirical support for accelerative practices,…

  13. The Role of Star Formation in Radio-Loud Galaxy Groups

    NASA Astrophysics Data System (ADS)

    Herbst, Hanna; Wilcots, E.; Hess, K.

    2010-01-01

    X-ray observations have shown that additional non-gravitational processes are required to explain the heating of the intergalactic medium in galaxy groups. The two most likely processes are galactic outflows from starbursts and feedback from AGN. Here, we look at star formation as a possible additional heating mechanism in X-ray luminous groups such as NGC 741, NGC 1052, NGC 524, and NGC 1587. We report on the results of optical imaging of these groups carried out using the WIYN 3.5m telescope with a specific emphasis on measuring the star formation rates of the resident galaxies in each group and estimating the impact of that star formation on the thermodynamics of the intragroup medium.

  14. Do I Know You? How Individual Recognition Affects Group Formation and Structure

    PubMed Central

    2017-01-01

    Groups in nature can be formed by interactions between individuals, or by external pressures like predation. It is reasonable to assume that groups formed by internal and external conditions have different dynamics and structures. We propose a computational model to investigate the effects of individual recognition on the formation and structure of animal groups. Our model is composed of agents that can recognize each other and remember previous interactions, without any external pressures, in order to isolate the effects of individual recognition. We show that individual recognition affects the number and size of groups, and the modularity of the social networks. This model can be used as a null model to investigate the effects of external factors on group formation and persistence. PMID:28125708

  15. A FORMATION SCENARIO OF YOUNG STELLAR GROUPS IN THE REGION OF THE SCORPIO CENTAURUS OB ASSOCIATION

    SciTech Connect

    Ortega, V. G.; Jilinski, E.; De la Reza, R.; Bazzanella, B.

    2009-04-15

    The main objective of this work is to investigate the role played by Lower Centaurus Crux (LCC) and Upper Centaurus Lupus (UCL), both subcomponents of the Scorpio Centaurus OB association (Sco-Cen), in the formation of the groups {beta} Pictoris, TW Hydrae, and the {eta} Chamaeleontis cluster. The dynamical evolution of all the stellar groups involved and of the bubbles and shells blown by LCC and UCL are calculated, and followed from the past to the present. This leads to a formation scenario in which (1) the groups {beta} Pictoris, TW Hydrae were formed in the wake of the shells created by LCC and UCL, (2) the young cluster {eta} Chamaeleontis was born as a consequence of the collision of the shells of LCC and UCL, and (3) the formation of Upper Scorpius (US), the other main subcomponent of the Sco-Cen association, may have been started by the same process that created {eta} Chamaeleontis.

  16. Scappoose Formation, Columbia County, Oregon: new evidence of age and relation to Columbia River basalt group

    SciTech Connect

    VanAtta, R.O.; Kelty, K.B.

    1985-05-01

    The Scappoose Formation, considered to be late Oligocene to early Miocene in age, was originally believed to be disconformably separated from both the underlying Pittsburg Bluff Formation and the overlying Yakima subgroup of the Columbia River Basalt Group. Recent mapping and petrography show that it lies disconformably on both the Keasey and Pittsburg Bluff Formations, and interfingers with the Yakima Basalt. The Scappoose is composed of fluvial sandstone, conglomerate, and carbonaceous to coal-bearing mud rock, intertongued with shallow neritic to estuarine siltstone, mud rock, and minor sandstone. Chemistry of basalt clasts from fluvial conglomerates reveals that they are derived from the Yakima subgroup. Basalt conglomerate and palagonitic sediments in the upper part of the formation are intercalated with Grande Ronde basalt (Yakima subgroup) flows at many localities. Flows of Yakima Basalt are also invasive into originally wet, unconsolidated Scappoose sediment. Grande Ronde basalt and the Frenchman Springs Member of the Wanapum basalt overlie conglomerate of the Scappoose. In places, the Scappoose Formation is absent, and Yakima Basalt lies directly on the Pittsburg Bluff and Keasey Formations. The thickness of both the Scappoose Formation and the Columbia River Basalt Group varies widely, indicating that both were deposited over a paleotopography with a relief up to 800 ft (245 m). The definition of the boundaries of the Scappoose Formation should be revised, owing to the disconformable relation of the Scappoose to both the underlying Keasey and Pittsburg Bluff Formations and to the Scappoose's intercalation with the overlying Yakima Basalt. Definition of age must also be revised, inasmuch as sedimentation of the formation was coeval with Columbia River Basalt volcanism.

  17. You want to give a good impression? Be honest! Moral traits dominate group impression formation.

    PubMed

    Brambilla, Marco; Sacchi, Simona; Rusconi, Patrice; Cherubini, Paolo; Yzerbyt, Vincent Y

    2012-03-01

    Research has shown that warmth and competence are core dimensions on which perceivers judge others and that warmth has a primary role at various phases of impression formation. Three studies explored whether the two components of warmth (i.e., sociability and morality) have distinct roles in predicting the global impression of social groups. In Study 1 (N= 105) and Study 2 (N= 112), participants read an immigration scenario depicting an unfamiliar social group in terms of high (vs. low) morality, sociability, and competence. In both studies, participants were asked to report their global impression of the group. Results showed that global evaluations were better predicted by morality than by sociability or competence-trait ascriptions. Study 3 (N= 86) further showed that the effect of moral traits on group global evaluations was mediated by the perception of threat. The importance of these findings for the impression-formation process is discussed.

  18. Group Formation Based on Learning Styles: Can It Improve Students' Teamwork?

    ERIC Educational Resources Information Center

    Kyprianidou, Maria; Demetriadis, Stavros; Tsiatsos, Thrasyvoulos; Pombortsis, Andreas

    2012-01-01

    This work explores the impact of teacher-led heterogeneous group formation on students' teamwork, based on students' learning styles. Fifty senior university students participated in a project-based course with two key organizational features: first, a web system (PEGASUS) was developed to help students identify their learning styles and…

  19. Effect of Peer Evaluation Format on Student Engagement in a Group Project

    ERIC Educational Resources Information Center

    Tessier, Jack T.

    2012-01-01

    Active participation in classrooms often involves group work. In order to examine the effect of using peer evaluations as part of that experience, this study measured the influence of four formats of peer evaluation on students' perceptions of fairness of the peer evaluation method, its impact on peer engagement, and peer evaluation scores. The…

  20. Comparing Two Cooperative Small Group Formats Used with Physical Therapy and Medical Students

    ERIC Educational Resources Information Center

    D'Eon, Marcel; Proctor, Peggy; Reeder, Bruce

    2007-01-01

    This study compared "Structured Controversy" (a semi-formal debate like small group activity) with a traditional open discussion format for medical and physical therapy students. We found that those students who had participated in Structured Controversy changed their personal opinion on the topic more than those who were in the Open Discussion…

  1. Chondrule formation, metamorphism, brecciation, an important new primary chondrule group, and the classification of chondrules

    NASA Technical Reports Server (NTRS)

    Sears, Derek W. G.; Shaoxiong, Huang; Benoit, Paul H.

    1995-01-01

    The recently proposed compositional classification scheme for meteoritic chondrules divides the chondrules into groups depending on the composition of their two major phases, olivine (or pyroxene) and the mesostasis, both of which are genetically important. The scheme is here applied to discussions of three topics: the petrographic classification of Roosevelt County 075 (the least-metamorphosed H chondrite known), brecciation (an extremely important and ubiquitous process probably experienced by greater than 40% of all unequilibrated ordinary chondrites), and the group A5 chondrules in the least metamorphosed ordinary chondrites which have many similarities to chondrules in the highly metamorphosed 'equilibrated' chondrites. Since composition provides insights into both primary formation properties of the chondruies and the effects of metamorphism on the entire assemblage it is possible to determine the petrographic type of RC075 as 3.1 with unique certainty. Similarly, the near scheme can be applied to individual chondrules without knowledge of the petrographic type of the host chondrite, which makes it especially suitable for studying breccias. Finally, the new scheme has revealed the existence of chondrules not identified by previous techniques and which appear to be extremely important. Like group A1 and A2 chondrules (but unlike group B1 chondrules) the primitive group A5 chondruies did not supercool during formation, but unlike group A1 and A2 chondrules (and like group B1 chondrules) they did not suffer volatile loss and reduction during formation. It is concluded that the compositional classification scheme provides important new insights into the formation and history of chondrules and chondrites which would be overlooked by previous schemes.

  2. Mapping the Star Formation History of the Local Group with NHST

    NASA Astrophysics Data System (ADS)

    Brown, T. M.

    2003-05-01

    The color-magnitude diagram (CMD) is the most fundamental tool for studying the star formation history of nearby stellar populations. Strong constraints on the ages of stellar populations come from CMDs reaching the main sequence, and with the Hubble Space Telescope (HST), it is possible to produce such a CMD for stars at any distance within the Local Group. Unfortunately, resolving the main sequence in old populations beyond the satellites of the Milky Way requires an enormous investment of HST time, meaning that only a few pencil beams can be explored within the remaining HST mission. In strong contrast, an 8 meter UV-optical space telescope, diffraction limited at 0.5 microns, could map the star formation history of all galaxies in the Local Group: It would take only one hour to resolve the main sequence in any Local Group galaxy, allowing the exploration of hundreds of sight-lines in a reasonable program.

  3. F-Formation Detection: Individuating Free-Standing Conversational Groups in Images

    PubMed Central

    Setti, Francesco; Russell, Chris; Bassetti, Chiara; Cristani, Marco

    2015-01-01

    Detection of groups of interacting people is a very interesting and useful task in many modern technologies, with application fields spanning from video-surveillance to social robotics. In this paper we first furnish a rigorous definition of group considering the background of the social sciences: this allows us to specify many kinds of group, so far neglected in the Computer Vision literature. On top of this taxonomy we present a detailed state of the art on the group detection algorithms. Then, as a main contribution, we present a brand new method for the automatic detection of groups in still images, which is based on a graph-cuts framework for clustering individuals; in particular, we are able to codify in a computational sense the sociological definition of F-formation, that is very useful to encode a group having only proxemic information: position and orientation of people. We call the proposed method Graph-Cuts for F-formation (GCFF). We show how GCFF definitely outperforms all the state of the art methods in terms of different accuracy measures (some of them are brand new), demonstrating also a strong robustness to noise and versatility in recognizing groups of various cardinality. PMID:25996922

  4. Molecularly oriented surface relief formation in polymethacrylates comprising N-benzylideneaniline derivative side groups

    NASA Astrophysics Data System (ADS)

    Kawatsuki, Nobuhiro; Hosoda, Risa; Kondo, Mizuho; Sasaki, Tomoyuki; Ono, Hiroshi

    2014-12-01

    Molecularly oriented surface relief (SR) formation in polymethacrylates with N-benzylideneaniline (NBA) derivative side groups is investigated by holographic exposure using a 325 nm He-Cd laser. Because the NBA moieties show a photoinduced orientation perpendicular to the polarization of light, polarization holography successfully forms a molecularly oriented SR structure in accordance with the polarization distribution that includes p-polarized components. Although intensity holography induces molecular orientation, it does not generate a satisfactory SR structure. In all the holographic modes, the SR depth depends on the direction of the C=N bonds in the NBA moieties and the photoproducts affect the SR formation ability.

  5. Formation of Pervaporation Membranes from Polyphosphazenes Having Hydrophilic and Hydrophobic Pendant Groups: Synthesis and Characterization

    SciTech Connect

    Stewart, Frederick Forrest; Harrup, Mason Kurt; Luther, Thomas Alan; Orme, Christopher Joseph; Lash, Robert Paul

    2001-02-01

    A series of new polyphosphazene polymers were synthesized using three different pendant groups with the goal of probing structure-function relationships between pendant group substitution and polymer swelling/water flux through thin dense films. Formation of polymers with relative degrees of hydrophilicity was probed by varying the stoichiometry of the pendant groups attached to the phosphazene backbone: p-methoxyphenol, 2-(2-methoxyethoxy)ethanol, and o-allylphenol. The polymers in this study were characterized using NMR, thermal methods, and dilute solution light-scattering techniques. These techniques revealed that the polymers were amorphous high polymers (Mw = 105-107) with varying ratios of pendant groups as determined by integration of the 1H- and 31P-NMR spectra. Thin dense film membranes were solution-cast with azo-bis(cyclohexane)carbonitrile included in the matrix and crosslinked using thermal initiation.

  6. Contribution of methyl group to secondary organic aerosol formation from aromatic hydrocarbon photooxidation

    NASA Astrophysics Data System (ADS)

    Li, Lijie; Qi, Li; Cocker, David R.

    2017-02-01

    The complete atmospheric oxidation pathways leading to secondary organic aerosol remain elusive for aromatic compounds including the role of methyl substitutes on oxidation. This study investigates the contribution of methyl group to Secondary Organic Aerosol (SOA) formation during the photooxidation of aromatic hydrocarbons under low NOx condition by applying methyl carbon labeled aromatic hydrocarbons ((13C2) m-xylene and (13C2) p-xylene). Particle and gas phase oxidation products are analyzed by a series of mass spectrometers (HR-TOF-AMS, PTR-MS and SIFT-MS). The methyl group carbon containing oxidation products partition to the particle-phase at a lower rate than the carbons originating from the aromatic ring as a result of ring opening reactions. Further, the methyl carbon in the original aromatic structure is at least 7 times less likely to be oxidized when forming products that partition to SOA than the aromatic ring carbon. Therefore, oxidation of the methyl group in xylenes exerts little impact on SOA formation in current study. This study provides supporting evidence for a recent finding - a similarity in the SOA formation and composition from aromatic hydrocarbons regardless of the alkyl substitutes.

  7. The ultraviolet and infrared star formation rates of compact group galaxies: an expanded sample

    NASA Astrophysics Data System (ADS)

    Lenkić, Laura; Tzanavaris, Panayiotis; Gallagher, Sarah C.; Desjardins, Tyler D.; Walker, Lisa May; Johnson, Kelsey E.; Fedotov, Konstantin; Charlton, Jane; Hornschemeier, Ann E.; Durrell, Pat R.; Gronwall, Caryl

    2016-07-01

    Compact groups of galaxies provide insight into the role of low-mass, dense environments in galaxy evolution because the low velocity dispersions and close proximity of galaxy members result in frequent interactions that take place over extended time-scales. We expand the census of star formation in compact group galaxies by Tzanavaris et al. (2010) and collaborators with Swift UVOT, Spitzer IRAC and MIPS 24 μm photometry of a sample of 183 galaxies in 46 compact groups. After correcting luminosities for the contribution from old stellar populations, we estimate the dust-unobscured star formation rate (SFRUV) using the UVOT uvw2 photometry. Similarly, we use the MIPS 24 μm photometry to estimate the component of the SFR that is obscured by dust (SFRIR). We find that galaxies which are MIR-active (MIR-`red'), also have bluer UV colours, higher specific SFRs, and tend to lie in H I-rich groups, while galaxies that are MIR-inactive (MIR-`blue') have redder UV colours, lower specific SFRs, and tend to lie in H I-poor groups. We find the SFRs to be continuously distributed with a peak at about 1 M⊙ yr-1, indicating this might be the most common value in compact groups. In contrast, the specific SFR distribution is bimodal, and there is a clear distinction between star-forming and quiescent galaxies. Overall, our results suggest that the specific SFR is the best tracer of gas depletion and galaxy evolution in compact groups.

  8. The anatomy of the NGC5044 group - II. Stellar populations and star formation histories

    NASA Astrophysics Data System (ADS)

    Mendel, J. Trevor; Proctor, Robert N.; Rasmussen, Jesper; Brough, Sarah; Forbes, Duncan A.

    2009-07-01

    The distribution of galaxy properties in groups and clusters holds important information on galaxy evolution and growth of structure in the Universe. While clusters have received appreciable attention in this regard, the role of groups as fundamental to formation of the present-day galaxy population has remained relatively unaddressed. Here, we present stellar ages, metallicities and α-element abundances derived using Lick indices for 67 spectroscopically confirmed members of the NGC5044 galaxy group with the aim of shedding light on galaxy evolution in the context of the group environment. We find that galaxies in the NGC5044 group show evidence for a strong relationship between stellar mass and metallicity, consistent with their counterparts in both higher and lower mass groups and clusters. Galaxies show no clear trend of age or α-element abundance with mass, but these data form a tight sequence when fitted simultaneously in age, metallicity and stellar mass. In the context of the group environment, our data support the tidal disruption of low-mass galaxies at small group-centric radii, as evident from an apparent lack of galaxies below ~109Msolar within ~100kpc of the brightest group galaxy. Using a joint analysis of absorption- and emission-line metallicities, we are able to show that the star-forming galaxy population in the NGC5044 group appears to require gas removal to explain the ~1.5dex offset between absorption- and emission-line metallicities observed in some cases. A comparison with other stellar population properties suggests that this gas removal is dominated by galaxy interactions with the hot intragroup medium.

  9. Activation of carboxyl group with cyanate: peptide bond formation from dicarboxylic acids.

    PubMed

    Danger, Grégoire; Charlot, Solenne; Boiteau, Laurent; Pascal, Robert

    2012-06-01

    The reaction of cyanate with C-terminal carboxyl groups of peptides in aqueous solution was considered as a potential pathway for the abiotic formation of peptide bonds under the condition of the primitive Earth. The catalytic effect of dicarboxylic acids on cyanate hydrolysis was definitely attributed to intramolecular nucleophilic catalysis by the observation of the 1H-NMR signal of succinic anhydride when reacting succinic acid with KOCN in aqueous solution (pH 2.2-5.5). The formation of amide bonds was noticed when adding amino acids or amino acid derivatives into the solution. The reaction of N-acyl aspartic acid derivatives was observed to proceed similarly and the scope of the cyanate-promoted reaction was analyzed from the standpoint of prebiotic peptide formation. The role of cyanate in activating peptide C-terminus constitutes a proof of principle that intramolecular reactions of adducts of peptides C-terminal carboxyl groups with activating agents represent a pathway for peptide activation in aqueous solution, the relevance of which is discussed in connexion with the issue of the emergence of homochirality.

  10. Spatialy Resolved Star Formation History Movies of 9 Dwarf Irregular Galaxies In The M81 Group.

    NASA Astrophysics Data System (ADS)

    Weisz, Daniel R.; Skillman, E.; Cannon, J.; Dolphin, A.; Kennicutt, R.; Lee, J.; Walter, F.

    2007-12-01

    The role of 'feedback' i.e., supernovae, stellar winds, outflows, in the process of star formation (SF), interstellar medium (ISHM) structure alteration, and galaxy evolution remains an interesting and open question. One way to help define the role of feedback is through observational constraints. Recent HST/ACS observations of 9 dwarf irregular galaxies (dIrrs) in the M81 group will help characterize the spatial and temporal components of feedback in a set of diverse dIrrs, spanning a factor of 6 magnitudes in luminosity, 1000 in current star formation rate, and 0.5 dex in metallicity. Here, I present movies that trace the star formation activity in the recent ( 0.5 Gyrs) history of each M81 dI in our sample. I am able to see how star formation events relate to one another both in time and space. We are able to clearly see the SF duty cycle, periods of activity and quiescence, as well as how events may serve to trigger future events by their spatial and temporal proximity. The M81 dIrr SF movies provide us with unique insight into how stars form and how they impact the evolution of each galaxy. Support for this work is provided by NASA/HST grant GO-10605.01.

  11. Effect of estradiol on planktonic growth, coaggregation, and biofilm formation of the Prevotella intermedia group bacteria.

    PubMed

    Fteita, Dareen; Könönen, Eija; Söderling, Eva; Gürsoy, Ulvi Kahraman

    2014-06-01

    Alterations in the quantity and quality of biofilms at gingival margin are considered to play a role in the initiation and development of pregnancy-related gingivitis. Prevotella intermedia sensu lato is able to consume estradiol, the major sex hormone secreted during pregnancy, in the absence of vitamin K. The aim of the study was to examine the effect of estradiol on the planktonic growth, coaggregation, polysaccharide production, and biofilm formation of the P. intermedia group bacteria, namely P. intermedia, Prevotella nigrescens, and Prevotella pallens. In all experiments, the type strain (ATCC) and a clinical strain (AHN) of P. intermedia, P. nigrescens, and P. pallens were incubated with the concentrations of 0, 30, 90, and 120 nmol/L of estradiol. Planktonic growth was assessed by means of the colony forming unit method, while coaggregation and biofilm formation were assessed by spectrophotometric methods. In the determination of protein and polysaccharide levels, the Bradford and phenol-sulfuric acid methods were used, respectively. P. pallens AHN 9283 and P. nigrescens ATCC 33563 increased their numbers at planktonic stage with increasing estradiol concentrations. In 48-h biofilm tests, elevated protein levels were found for both strains of P. intermedia, and the strains P. nigrescens ATCC 33563 and P. pallens AHN 9283 in the presence of estradiol. The P. intermedia strains also increased the levels of polysaccharide formation in the biofilm. Coaggregation of the P. intermedia group organisms with Fusobacterium nucleatum was enhanced only in P. intermedia AHN 8290. In conclusion, our in vitro experiments indicate that estradiol regulates planktonic growth, coaggregation, polysaccharide production, and biofilm formation characteristics of P. intermedia, P. nigrescens, and P. pallens differently. These results may, at least partly, explain the differences seen in their contribution to the pathogenesis of pregnancy-related gingivitis.

  12. Identification of non-heme diiron proteins that catalyze triple bond and epoxy group formation.

    PubMed

    Lee, M; Lenman, M; Banaś, A; Bafor, M; Singh, S; Schweizer, M; Nilsson, R; Liljenberg, C; Dahlqvist, A; Gummeson, P O; Sjödahl, S; Green, A; Stymne, S

    1998-05-08

    Acetylenic bonds are present in more than 600 naturally occurring compounds. Plant enzymes that catalyze the formation of the Delta12 acetylenic bond in 9-octadecen-12-ynoic acid and the Delta12 epoxy group in 12,13-epoxy-9-octadecenoic acid were characterized, and two genes, similar in sequence, were cloned. When these complementary DNAs were expressed in Arabidopsis thaliana, the content of acetylenic or epoxidated fatty acids in the seeds increased from 0 to 25 or 15 percent, respectively. Both enzymes have characteristics similar to the membrane proteins containing non-heme iron that have histidine-rich motifs.

  13. Chemoselective methylation of phenolic hydroxyl group prevents quinone methide formation and repolymerization during lignin depolymerization

    DOE PAGES

    Kim, Kwang Ho; Dutta, Tanmoy; Walter, Eric D.; ...

    2017-03-22

    Chemoselective blocking of the phenolic hydroxyl (Ar–OH) group by methylation was found to suppress secondary repolymerization and charring during lignin depolymerization. Methylation of Ar–OH prevents formation of reactive quinone methide intermediates, which are partly responsible for undesirable secondary repolymerization reactions. Instead, this structurally modified lignin produces more relatively low molecular weight products from lignin depolymerization compared to unmodified lignin. This result demonstrates that structural modification of lignin is desirable for production of low molecular weight phenolic products. Finally, this approach could be directed toward alteration of natural lignification processes to produce biomass that is more amenable to chemical depolymerization.

  14. Molecular tectonics: on the formation of 1-D silver coordination networks by thiacalixarenes bearing nitrile groups.

    PubMed

    Kozlova, Marina N; Ferlay, Sylvie; Solovieva, Svetlana E; Antipin, Igor S; Konovalov, Alexander I; Kyritsakas, Nathalie; Hosseini, Mir Wais

    2007-11-28

    Two new p-tert-butylthiacalix[4]arene derivatives 2 and 3 decorated at the lower rim with four nitrile groups have been prepared and structurally characterised in the crystalline phase. The two ligands, differing by the length of the spacer between the calix moiety and the nitrile group, adopt the 1,3-alternate conformation in the solid state. The ligand 3 bearing four (CH(2))(3)CN fragments behaves as a tecton in the presence of silver salts (AgX, X = BF(4), PF(6) or SbF(6)) and leads to the formation of analogous 1-D linear coordination networks. The tecton 3 acts as a bischelate unit and bridges consecutive silver cations adopting a tetrahedral coordination geometry. Anions and solvent molecules occupy the free space between networks and exhibit no specific interactions with the cationic architecture.

  15. New Aspects of the Formation of the β Pictoris Moving Group

    NASA Astrophysics Data System (ADS)

    Ortega, V. G.; de la Reza, R.; Jilinski, E.; Bazzanella, B.

    2004-07-01

    In a previous work, we explored the possibility that the β Pictoris moving group (BPMG), consisting of low-mass post-T Tauri stars, was formed near the Scorpius-Centaurus OB association. The cause of the formation could be a Type II supernova exploding either in Lower Centaurus Crux (LCC) or the Upper Centaurus Lupus (UCL), the two older subgroups of that association. Here we present new results for BPMG. A more detailed analysis of the orbit confinement in this group leads to a star distribution pattern at birth that can be considered as a representation of the density distribution in the natal cloud. We also propose a plausible origin for the supernova that could have triggered the star formation in BPMG by finding the past position of the runaway star HIP 46950. We find that this scenario is capable of explaining the origin of all the members of BPMG proposed by Zuckerman and coworkers and by Song and coworkers, with the exception of HIP 79881, which is probably an old main-sequence interloper.

  16. Ammonite zonation in condensed zone, middle Ozan formation (Taylor group, upper Cretaceous) in Northeast Texas

    SciTech Connect

    Echols, J.

    1984-04-01

    Recognition of condensed zones is important because they may be marker horizons that are useful in exploration. Such a zone is demonstrated by the occurrence of ammonites belonging to 12 species and 9 genera from the middle Ozan Formation (lower Taylor Marl) in northeast Texas. The 1-foot (0.3-m) thick bed of bioturbated glauconitic biomicrite contains many specimens of disarticulated vertebrates, molluscs, remanie' fossils (blackened phosphatic internal molds), and hiatus concretions. Four of 6 midcontinent ammonite range zones proposed by Cobban and others appear to be represented in the fauna, in ascending order, by Baculites aquilaensis Reeside, Delawarella delawarensis (Morton) (= zones of two unnamed species of Baculites), Baculites obtusus Meek, and Trachyscaphites spiniger porchi Adkins (=zones of Baculites mclearni and B. asperiformis). Young may be correct in assuming that the occurrence of Delawarella delawarensis and Baculites aquilaensis in the Ozan Formation may mean that rocks of the upper Austin Group and parts of the lower Taylor Group are the same age. If correlation with the midcontinent zonation is correct, then the sediments that formed the condensed zone slowly accumulated from 81 to 79 m.y. (mid early Campanian to early late Campanian). Several species of the fauna are preserved as both normal and remanie' fossils, indicating that members of these species lived in the area for an extended period of time, perhaps as a relict fauna. The fauna includes a mixture of cosmopolitan and endemic species (indicating open shelf environment) with several types of heteromorphs (indicating moderate water depths).

  17. QUENCHING OF STAR FORMATION IN SLOAN DIGITAL SKY SURVEY GROUPS: CENTRALS, SATELLITES, AND GALACTIC CONFORMITY

    SciTech Connect

    Knobel, Christian; Lilly, Simon J.; Woo, Joanna; Kovač, Katarina

    2015-02-10

    We re-examine the fraction of low-redshift Sloan Digital Sky Survey satellites and centrals in which star formation has been quenched, using the environment quenching efficiency formalism that separates out the dependence of stellar mass. We show that the centrals of the groups containing the satellites are responding to the environment in the same way as their satellites (at least for stellar masses above 10{sup 10.3} M {sub ☉}), and that the well-known differences between satellites and the general set of centrals arise because the latter are overwhelmingly dominated by isolated galaxies. The widespread concept of ''satellite quenching'' as the cause of environmental effects in the galaxy population can therefore be generalized to ''group quenching''. We then explore the dependence of the quenching efficiency of satellites on overdensity, group-centric distance, halo mass, the stellar mass of the satellite, and the stellar mass and specific star formation rate (sSFR) of its central, trying to isolate the effect of these often interdependent variables. We emphasize the importance of the central sSFR in the quenching efficiency of the associated satellites, and develop the meaning of this ''galactic conformity'' effect in a probabilistic description of the quenching of galaxies. We show that conformity is strong, and that it varies strongly across parameter space. Several arguments then suggest that environmental quenching and mass quenching may be different manifestations of the same underlying process. The marked difference in the apparent mass dependencies of environment quenching and mass quenching which produces distinctive signatures in the mass functions of centrals and satellites will arise naturally, since, for satellites at least, the distributions of the environmental variables that we investigate in this work are essentially independent of the stellar mass of the satellite.

  18. Funalichnus bhubani isp. nov. from Bhuban Formation, Surma Group (Lower -Middle Miocene) of Aizawl, Mizoram, India.

    PubMed

    Tiwari, Raghavendra Prasad; Rajkonwar, Chinmoy; Patel, Satish Jaychandbhai

    2013-01-01

    A new ichnospecies of the ichnogenus Funalichnus Pokorný is described from the Middle Bhuban Unit, Bhuban Formation, Surma Group (Lower - Middle Miocene) of Aizawl, Mizoram, India. Funalichnus bhubani isp. Nov. Is a large burrow displaying cylindrical segments that are oriented nearly perpendicular to the bedding plane. The new ichnospecies can be identified on the basis of general form, size, unlined passive filling and twisted rod-like structure. The association of Funalichnus bhubani isp. Nov. With Arenicolites, Diplocraterion, Ophiomorpha Psilonichnus Skolithos and Thalassinoides points to its bathymetric restriction. The deep extension of the burrow in clastic sediments provides a favourable condition for preservation in the shoreface environment and occurrence in fine- to medium-grained clastic sediments may be a preservational preference.

  19. Magnetic hyperfine coupling of a methyl group undergoing internal rotation: a case study of methyl formate.

    PubMed

    Tudorie, M; Coudert, L H; Huet, T R; Jegouso, D; Sedes, G

    2011-02-21

    The hyperfine structure of methyl formate was recorded in the 2-20 GHz range. A molecular beam coupled to a Fourier transform microwave spectrometer having an instrumental resolution of 0.46 kHz and limited by a Doppler width of a few kHz was used. A-type lines were found split by the magnetic hyperfine coupling while no splittings were observed for E-type lines. Symmetry considerations were used to account for the internal rotation of the methyl top and to derive effective hyperfine coupling Hamiltonians. Neglecting the spin-rotation magnetic coupling, the vanishing splittings of the E-type lines could be understood and analyses of the hyperfine patterns of the A-type lines were performed. The results are consistent with a hyperfine structure dominated by the magnetic spin-spin coupling due to the three hydrogen atoms of the methyl group.

  20. MASSIVE STARS IN THE LOCAL GROUP: Implications for Stellar Evolution and Star Formation

    NASA Astrophysics Data System (ADS)

    Massey, Philip

    The galaxies of the Local Group serve as important laboratories for understanding the physics of massive stars. Here I discuss what is involved in identifying various kinds of massive stars in nearby galaxies: the hydrogen-burning O-type stars and their evolved He-burning evolutionary descendants, the luminous blue variables, red supergiants, and Wolf-Rayet stars. Primarily I review what our knowledge of the massive star population in nearby galaxies has taught us about stellar evolution and star formation. I show that the current generation of stellar evolutionary models do well at matching some of the observed features and provide a look at the sort of new observational data that will provide a benchmark against which new models can be evaluated.

  1. Funalichnus bhubani isp. nov. from Bhuban Formation, Surma Group (Lower -Middle Miocene) of Aizawl, Mizoram, India

    PubMed Central

    Tiwari, Raghavendra Prasad; Rajkonwar, Chinmoy; Patel, Satish Jaychandbhai

    2013-01-01

    A new ichnospecies of the ichnogenus Funalichnus Pokorný is described from the Middle Bhuban Unit, Bhuban Formation, Surma Group (Lower - Middle Miocene) of Aizawl, Mizoram, India. Funalichnus bhubani isp. Nov. Is a large burrow displaying cylindrical segments that are oriented nearly perpendicular to the bedding plane. The new ichnospecies can be identified on the basis of general form, size, unlined passive filling and twisted rod-like structure. The association of Funalichnus bhubani isp. Nov. With Arenicolites, Diplocraterion, Ophiomorpha Psilonichnus Skolithos and Thalassinoides points to its bathymetric restriction. The deep extension of the burrow in clastic sediments provides a favourable condition for preservation in the shoreface environment and occurrence in fine- to medium-grained clastic sediments may be a preservational preference. PMID:24204992

  2. Possible Microfossils (Warrawoona Group, Towers Formation, Australia, approximately 3.3 - 3.5 Ga)

    NASA Technical Reports Server (NTRS)

    Morris, P. A.; Wentworth, S. J.; Allen, C. C.; McKay, D. S.

    1998-01-01

    Early in the twentieth century there were reports of Archean stromatolite-like structures that were similar to organic rich stromatolites from the base of the Cambrian (600 m.y.). It was not until the latter half of this century that fossilized Archean-age (3.9-2.5 Ga) life forms were found in the Fig Tree Formation of South Africa and the Towers Formation of Australia. Some of the ancient stromatolites contained streaks and clots of kerogen, pyrite grains, remnants of microbial cells, and filaments that represented various stages of preservation, while others appeared to lack fossils. A set of physical criteria was established for evaluating the biogenicity of these Archean discoveries: (1) rocks of unquestionable Archean age; (2) microfossils indigenous to Archean sediments; and (3) microfossils occurring in clasts that are syngenetic with deposition of the sedimentary unit. In the case of bedded cherts, the fossils should predate the cherts; (4) the microfossils are biogenic; and (5) replicate sampling of the fossil-iferous outcrop firmly demonstrates the provenance of these microfossils. Sample 002 from the Precambrian Paleobiology Research Group (PPRG) was examined. This stromatolitic carbonaceous chert contains microbial remains that meet the established criteria [10]. Using a scanning electron microscope (SEM), we have analyzed the morphologies and chemistry of these possible microbial remains.

  3. A novel role for high-mobility group a proteins in cellular senescence and heterochromatin formation.

    PubMed

    Narita, Masashi; Narita, Masako; Krizhanovsky, Valery; Nuñez, Sabrina; Chicas, Agustin; Hearn, Stephen A; Myers, Michael P; Lowe, Scott W

    2006-08-11

    Cellular senescence is a stable state of proliferative arrest that provides a barrier to malignant transformation and contributes to the antitumor activity of certain chemotherapies. Senescent cells can accumulate senescence-associated heterochromatic foci (SAHFs), which may provide a chromatin buffer that prevents activation of proliferation-associated genes by mitogenic transcription factors. Surprisingly, we show that the High-Mobility Group A (HMGA) proteins, which can promote tumorigenesis, accumulate on the chromatin of senescent fibroblasts and are essential structural components of SAHFs. HMGA proteins cooperate with the p16(INK4a) tumor suppressor to promote SAHF formation and proliferative arrest and stabilize senescence by contributing to the repression of proliferation-associated genes. These antiproliferative activities are canceled by coexpression of the HDM2 and CDK4 oncogenes, which are often coamplified with HMGA2 in human cancers. Our results identify a component of the senescence machinery that contributes to heterochromatin formation and imply that HMGA proteins also act in tumor suppressor networks.

  4. The star formation histories of local group dwarf galaxies. II. Searching for signatures of reionization

    SciTech Connect

    Weisz, Daniel R.; Dolphin, Andrew E.; Skillman, Evan D.; Holtzman, Jon; Gilbert, Karoline M.; Dalcanton, Julianne J.; Williams, Benjamin F.

    2014-07-10

    We search for signatures of reionization in the star formation histories (SFHs) of 38 Local Group dwarf galaxies (10{sup 4} < M{sub *} < 10{sup 9} M{sub ☉}). The SFHs are derived from color-magnitude diagrams using archival Hubble Space Telescope/Wide Field Planetary Camera 2 imaging. Only five quenched galaxies (And V, And VI, And XIII, Leo IV, and Hercules) are consistent with forming the bulk of their stars before reionization, when full uncertainties are considered. Observations of 13 of the predicted 'true fossils' identified by Bovill and Ricotti show that only two (Hercules and Leo IV) indicate star formation quenched by reionization. However, both are within the virial radius of the Milky Way and evidence of tidal disturbance complicates this interpretation. We argue that the late-time gas capture scenario posited by Ricotti for the low mass, gas-rich, and star-forming fossil candidate Leo T is observationally indistinguishable from simple gas retention. Given the ambiguity between environmental effects and reionization, the best reionization fossil candidates are quenched low mass field galaxies (e.g., KKR 25).

  5. Cross-dehydrogenative coupling (CDC): exploring C-C bond formations beyond functional group transformations.

    PubMed

    Li, Chao-Jun

    2009-02-17

    Synthetic chemists aspire both to develop novel chemical reactions and to improve reaction conditions to maximize resource efficiency, energy efficiency, product selectivity, operational simplicity, and environmental health and safety. Carbon-carbon bond formation is a central part of many chemical syntheses, and innovations in these types of reactions will profoundly improve overall synthetic efficiency. This Account describes our work over the past several years to form carbon-carbon bonds directly from two different C-H bonds under oxidative conditions, cross-dehydrogenative coupling (CDC). We have focused most of our efforts on carbon-carbon bonds formed via the functionalization of sp(3) C-H bonds with other C-H bonds. In the presence of simple and cheap catalysts such as copper and iron salts and oxidants such as hydrogen peroxide, dioxygen, tert-butylhydroperoxide, and 2,3-dichloro-5,6-dicyanobenzoquinone (DDQ), we can directly functionalize various sp(3) C-H bonds by other C-H bonds without requiring preactivation. We demonstrate (1) reaction of alpha-C-H bonds of nitrogen in amines, (2) reaction of alpha-C-H bonds of oxygen in ethers, (3) reaction of allylic and benzylic C-H bonds, and (4) reaction of alkane C-H bonds. These CDC reactions can tolerate a variety of functional groups, and some can occur under aqueous conditions. Depending on the specific transformation, we propose the in situ generation of different intermediates. These methods provide an alternative to the separate steps of prefunctionalization and defunctionalization that have traditionally been part of synthetic design. As a result, these methods will increase synthetic efficiencies at the most fundamental level. On an intellectual level, the development of C-C bond formations based on the reaction of only C-H bonds (possibly in water) challenges us to rethink some of the most fundamental concepts and theories regarding chemical reactivities. A successful reaction requires the

  6. Jesse Ewing Canyon Formation, an interpreted alluvial fan deposit in the basal Uinta Mountain Group (Middle Proterozoic), Utah

    SciTech Connect

    Sanderson, I.D.; Wiley, M.T.

    1986-07-01

    The Jesse Ewing Canyon Formation, a member of the Middle Proterozic Uinta Mountain Group, is here proposed as a formal lithostratigraphic unit. It consists of interbedded dark reddish-brown to dark gray conglomerate with predominant white, pale green, gray, or pink metaquartzite clasts, light to dark brown or reddish-brown quartz arenite, and reddish-brown, red, or maroon shale. This represents the first proposal of a formation in the Uinta Mountain Group in the eastern part of the range and follows by only a few years beginning efforts to establish formations in the group in the western part. The Jesse Ewing Canyon Formation locally constitutes the basal member of the Uinta Mountain Group and is here reaffirmed as an alluvial fan deposit, based on a detailed comparison of observed features to those of modern alluvial fans. This interpretation supports the hypothesis that the Uinta Trough is an aulacogen.

  7. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    NASA Astrophysics Data System (ADS)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  8. The Formation of the Local Group and the High Velocity Clouds

    NASA Astrophysics Data System (ADS)

    Spergel, D. N.; Blitz, L.; Teuben, P. J.; Hartmann, D.; Burton, B.

    1996-12-01

    We simulate the formation and evolution of the Local Group. The dynamics of the Local Group is governed primarily by the its two largest members, Andromeda (M31) and the Galaxy (M0) and secondarily by the tidal effects of neighboring galaxies. In the simulation, a long filament forms which contains M31 and M0. While the gas near M31 and M0 is likely shock heated, we expect that much of the gas in the filament is cold. The kinematics of this gas in the simulation is remarkably similar to the kinematics of the High Velocity Clouds (HVCs). This similarity suggests reinterpreting the HVCs as primarily extragalactic. In this model, the HVCs are similar to the Lyman alpha clouds. Recent work (Hernquist et al. 996) suggests that the Lyman alpha clouds are primarily condensations in the filaments between galaxies. We suggest a similar picture for most of the HVCs: they are gravitationally confined, rather than pressure confined, clouds infalling into the Local Group and are likely associated with a substantial amount of dark matter. In this picture, the two phase structure seen in some of the HVCs (Wakker & Schwarz 1991) would be due to self shielding that arises in gas clouds ionized by external UV (Murakami & Ikeuchi 1990). This model suggests that there is a substantial amount of gas in the HVCs: ~ 1 x 10(10) M_sun. This gas is and was a reservoir of relatively unprocessed gas for both M31 and our Galaxy and likely plays an important role in the evolution of both galaxies. Hernquist, L, Katz, N., Weinberg, D. & Miralda-Escude, J. 1996, ApJ L 457, 51 Murakami, I. & Ikeuchi, S. 1990 PASJ, 41 , L11. Wakker, B.P. & Schwarz, U.J. 1991 A & A, 250, 48.

  9. Chemical Evolution and Star Formation History of the Disks of Spirals in Local Group

    NASA Astrophysics Data System (ADS)

    Yin, J.

    2011-05-01

    Milky Way (MW), M31 and M33 are the only three spiral galaxies in our Local group. MW and M31 have similar mass, luminosity and morphology, while M33 is only about one tenth of MW in terms of its baryonic mass. Detailed theoretical researches on these three spirals will help us to understand the formation and evolution history of both spiral galaxies and Local group. Referring to the phenomenological chemical evolution model adopted in MW disk, a similar model is established to investigate the star formation and chemical enrichment history of these three local spirals. Firstly, the properties of M31 disk are studied by building a similar chemical evolution model which is able to successfully describe the MW disk. It is expected that a simple unified phenomenological chemical evolution model could successfully describe the radial and global properties of both disks. Comparing with the former work, we adopt an extensive data set as model constraints, including the star formation profile of M31 disk derived from the recent UV data of GALEX. The comparison among the observed properties of these two disks displays very interesting similarities in their radial profiles when the distance from the galactic center is expressed in terms of the corresponding scale length. This implies some common processes in their formation and evolution history. Based on the observed data of the gas mass surface density and SFR surface density, the SFR radial profile of MW can be well described by Kennicutt-Schmidt star formation law (K-S law) or modified K-S law (SFR is inversely proportional to the distance from the galactic center), but this is not applicable to the M31 disk. Detailed calculations show that our unified model describes fairly well all the main properties of the MW disk and most properties of M31 disk, provided that the star formation efficiency of M31 disk is adjusted to be twice as large as that of MW disk (as anticipated from the lower gas fraction of M31). However, the

  10. Correlations and Areal Distribution of the Table Mountain Formation, Stanislaus Group; Central Sierra Nevada, California

    NASA Astrophysics Data System (ADS)

    Torrez, G.; Carlson, C. W.; Putirka, K. D.; Pluhar, C. J.; Sharma, R. K.

    2011-12-01

    Late Cenozoic evolution of the western Cordillera is a matter of ongoing debate in geologic studies. Volcanic deposits within, and adjacent to the Sierra Nevada have played a significant role in many of these debates. With local faulting coincident with eruption of members of the Stanislaus Group at ca. 38°N, the composition and correlation of these volcanics can greatly aid our understanding of Sierra Nevada tectonics. At the crest of the central Sierra Nevada, 23 trachyandesite lava flows of the Table Mountain Formation, dated at ~10 Ma, cap Sonora Peak. These 23 flows compose the thickest and most complete known stratigraphic section of the Table Mountain Formation in the region. Located ~12 km east of Sonora Peak are 16 flows of trachyandesite at Grouse Meadow. We have collected a detailed set of geochemical and paleomagnetic data for flows of these two sections at Sonora Peak and Grouse Meadows in an attempt to correlate volcanic, paleomagnetic and structural events related to uplift and extension in the Sierra Nevada and the Walker Lane. Correlation of individual flows is possible based on: stratigraphic order, temporal gaps in deposition as determined by paleomagnetic remanence direction and nonconformities, and flow geochemistry. These correlations allow us to infer source localities, flow directions, and temporal changes in flow routes. The large number of flows present at Grouse Meadow provides an additional data set from which to correlate various localities in the region to those units not represented at Sonora Peak. Several flows which occur in the upper portions of the Sonora Peak and Grouse Meadow stratigraphic sections do not correlate between these localities. The causes of stratigraphic discontinuity potentially represent: tectonic isolation across the Sierran Crest, topographic isolation by the emplacement of younger flows, or the combination of the two. Additional to the correlation of individual flows at these localities, this study shows a

  11. Crystallographic evidence of sulfate evaporites in the Kromberg Formation, Onverwacht Group, South Africa

    SciTech Connect

    Fisher, G.L.; Lowe, D.R.

    1985-01-01

    The 3.5 Ga Kromberg Formation of the Onverwacht Group, Barberton Greenstone Belt, South Africa, includes a basal silicified shallow-water evaporite sequence deposited in a series of small fault-bounded basins. Other early Archean replaced and recrystallized evaporites have been interpreted to have included both primary gypsum and aragonite based on general crystal morphology and the overall similarity of these units to Phanerozoic evaporites. Crystal interfacial angle measurements, however, have not been widely reported to support interpretations of primary mineralogy. Although the primary evaporite minerals in the Kromberg Formation have been replaced by chert and druzy megaquartz, interfacial angles of silicified pseudohexagonal, prismatic to bladed crystals can be measured with a contact goniometer. Measurement of angles between the six prism faces display a biomodal distribution about 55/sup 0/ and 69/sup 0/. Within individual crystals, these angles show a general arrangement of two at 69/sup 0/ separated by sets of two angles at 55/sup 0/. These relationships closely resemble those of gypsum which has four angles of (010) (120)=55.75/sup 0/ and two of (120) (120)-68.50/sup 0/. No evidence has been found for the existence of aragonite which has six angles of (110) (110)=60/sup 0/. Textural and geometric crystal comparisons of these silicified crystals with Messinian algal-related selenite and modern gypsum support the proposal of a gypsum precursor. The common presence of gypsum in this and other greenstone belts suggests that the early Archean ocean may have been at or near saturation with respect to sulfate.

  12. Ultraviolet+Infrared Star Formation Rates: Hickson Compact Groups with Swift and Spitzer

    NASA Astrophysics Data System (ADS)

    Tzanavaris, P.; Hornschemeier, A. E.; Gallagher, S. C.; Johnson, K. E.; Gronwall, C.; Immler, S.; Reines, A. E.; Hoversten, E.; Charlton, J. C.

    2010-06-01

    We present Swift UVOT ultraviolet (UV; 1600-3000 Å) data with complete three-band UV photometry for a sample of 41 galaxies in 11 nearby (<4500 km s-1) Hickson Compact Groups (HCGs) of galaxies. We use UVOT uvw2-band (2000 Å) photometry to estimate the dust-unobscured component, SFRUV, of the total star formation rate, SFRTOTAL. We use Spitzer MIPS 24 μm photometry to estimate SFRIR, the component of SFRTOTAL that suffers dust extinction in the UV and is re-emitted in the IR. By combining the two components, we obtain SFRTOTAL estimates for all HCG galaxies. We obtain total stellar mass, M *, estimates by means of Two Micron All Sky Survey Ks -band luminosities, and use them to calculate specific star formation rates, SSFR ≡ SFRTOTAL/M *. SSFR values show a clear and significant bimodality, with a gap between low (lsim3.2 × 10-11 yr-1) and high-SSFR (gsim1.2 × 10-10 yr-1) systems. We compare this bimodality to the previously discovered bimodality in αIRAC, the MIR activity index from a power-law fit to the Spitzer IRAC 4.5-8 μm data for these galaxies. We find that all galaxies with αIRAC <= 0 ( >0) are in the high- (low-) SSFR locus, as expected if high levels of star-forming activity power MIR emission from polycyclic aromatic hydrocarbon molecules and a hot dust continuum. Consistent with this finding, all elliptical/S0 galaxies are in the low-SSFR locus, while 22 out of 24 spirals/irregulars are in the high-SSFR locus, with two borderline cases. We further divide our sample into three subsamples (I, II, and III) according to decreasing H I richness of the parent galaxy group to which a galaxy belongs. Consistent with the SSFR and αIRAC bimodality, 12 out of 15 type I (11 out of 12 type III) galaxies are in the high- (low-) SSFR locus, while type II galaxies span almost the full range of SSFR values. We use the Spitzer Infrared Nearby Galaxy Survey (SINGS) to construct a comparison subsample of galaxies that (1) match HCG galaxies in J-band total

  13. ULTRAVIOLET+INFRARED STAR FORMATION RATES: HICKSON COMPACT GROUPS WITH SWIFT AND SPITZER

    SciTech Connect

    Tzanavaris, P.; Hornschemeier, A. E.; Immler, S.; Johnson, K. E.; Reines, A. E.; Gronwall, C.; Hoversten, E.; Charlton, J. C.

    2010-06-10

    We present Swift UVOT ultraviolet (UV; 1600-3000 A) data with complete three-band UV photometry for a sample of 41 galaxies in 11 nearby (<4500 km s{sup -1}) Hickson Compact Groups (HCGs) of galaxies. We use UVOT uvw2-band (2000 A) photometry to estimate the dust-unobscured component, SFR{sub UV}, of the total star formation rate, SFR{sub TOTAL}. We use Spitzer MIPS 24 {mu}m photometry to estimate SFR{sub IR}, the component of SFR{sub TOTAL} that suffers dust extinction in the UV and is re-emitted in the IR. By combining the two components, we obtain SFR{sub TOTAL} estimates for all HCG galaxies. We obtain total stellar mass, M {sub *}, estimates by means of Two Micron All Sky Survey K{sub s} -band luminosities, and use them to calculate specific star formation rates, SSFR {identical_to} SFR{sub TOTAL}/M {sub *}. SSFR values show a clear and significant bimodality, with a gap between low ({approx}<3.2 x 10{sup -11} yr{sup -1}) and high-SSFR ({approx_gt}1.2 x 10{sup -10} yr{sup -1}) systems. We compare this bimodality to the previously discovered bimodality in {alpha}{sub IRAC}, the MIR activity index from a power-law fit to the Spitzer IRAC 4.5-8 {mu}m data for these galaxies. We find that all galaxies with {alpha}{sub IRAC} {<=} 0 ( >0) are in the high- (low-) SSFR locus, as expected if high levels of star-forming activity power MIR emission from polycyclic aromatic hydrocarbon molecules and a hot dust continuum. Consistent with this finding, all elliptical/S0 galaxies are in the low-SSFR locus, while 22 out of 24 spirals/irregulars are in the high-SSFR locus, with two borderline cases. We further divide our sample into three subsamples (I, II, and III) according to decreasing H I richness of the parent galaxy group to which a galaxy belongs. Consistent with the SSFR and {alpha}{sub IRAC} bimodality, 12 out of 15 type I (11 out of 12 type III) galaxies are in the high- (low-) SSFR locus, while type II galaxies span almost the full range of SSFR values. We use the

  14. Ultraviolet+Infrared Star Formation Rates: Hickson Compact Groups with Swift and SPitzer

    NASA Technical Reports Server (NTRS)

    Tzanavaris, P.; Hornschemeier, A. E.; Gallagher, S. C.; Johnson, K. E.; Gronwall, C.; Immler, S.; Reines, A. E.; Hoversten, E.; Charlton, J. C.

    2010-01-01

    We present Swift UVOT ultraviolet (UV; 1600-3000 A) data with complete three-band UV photometry for a sample of 41 galaxies in 11 nearby (<4500 km/s) Hickson Compact Groups (HCGs) of galaxies. We use UVOT uvw2-band (2000A) photometry to estimate the dust-unobscured component, SFR(sub uv), of the total star formation rate, SFR(sub TOTAL). We use Spitzer MIPS 24 micron photometry to estimate SFR(sub IR), the component of SFR(sub TOTAL) that suffers dust extinction in the UV and is re-emitted in the IR. By combining the two components, we obtain SFR(sub TOTAL) estimates for all HCG galaxies. We obtain total stellar mass, M(sub *) estimates by means of Two Micron All Sky Survey K(sub s)-band luminosities, and use them to calculate specific star formation rates, SSFR is identical with SFR(sub TOTAL)/ M (sub *). SSFR values show a clear and significant bimodality, with a gap between low (approximately <3.2 x 10(exp -11) / yr) and high-SSFR (approximately > 1.2 x lO)exp -10)/yr) systems. We compare this bimodality to the previously discovered bimodality in alpha-IRAC, the MIR activity index from a power-law fit to the Spitzer IRAC 4.5-8 micron data for these galaxies. We find that all galaxies with alpha-IRAC <= 0 (> 0) are in the high- (low-) SSFR locus, as expected if high levels of star-forming activity power MIR emission from polycyclic aromatic hydrocarbon molecules and a hot dust continuum. Consistent with this finding, all elliptical/SO galaxies are in the low-SSFR locus, while 22 out of 24 spirals / irregulars are in the high-SSFR locus, with two borderline cases. We further divide our sample into three subsamples (I, II, and III) according to decreasing H I richness of the parent galaxy group to which a galaxy belongs. Consistent with the SSFR and alpha-IRAC bimodality, 12 out of 15 type I (11 out of 12 type III) galaxies are in the high- (low-) SSFR locus, while type II galaxies span almost the full range of SSFR values. We use the Spitzer Infrared Nearby Galaxy

  15. Examining the Center: Positions, Dominance, and Star Formation Rates of Most Massive Group Galaxies at Intermediate Redshift

    NASA Astrophysics Data System (ADS)

    Connelly, Jennifer L.; Parker, Laura C.; McGee, Sean; Mulchaey, John S.; Finoguenov, Alexis; Balogh, Michael; Wilman, David; Group Environment Evolution Collaboration

    2015-01-01

    The group environment is believed to be the stage for many galaxy transformations, helping evolve blue star-forming galaxies to red passive ones. In local studies of galaxy clusters, the central member is usually a single dominant giant galaxy at the center of the potential with little star formation thought to be the result of galaxy mergers. In nearby groups, a range of morphologies and star formation rates are observed and the formation history is less clear. Further, the position and dominance of the central galaxy cannot be assumed in groups, which are less massive and evolved than clusters. To understand the connections between global group properties and properties of the central group galaxy at intermediate redshift, we examine galaxy groups from the Group Environment and Evolution Collaboration (GEEC) catalog, including both optically- and X-ray-selected groups at redshift z~0.4. The sample is diverse, containing a range in overall mass and evolutionary state. The number of groups is significant, membership is notably complete, and measurements span the IR to the UV allowing the properties of the members to be connected to those of the host groups. Having investigated trends in the global group properties previously, including mass and velocity substructure, we turn our attention now to the galaxy populations, focusing on the central regions of these systems. The most massive and second most massive group galaxies are identified by their stellar mass. The positions of the most massive galaxies (MMGs) are determined with respect to both the luminosity-weighted and X-ray center. Star formation rates are used to explore the fraction of passive/quiescent versus star-forming MMGs and the dominance of the MMGs in our group sample is also tested. Determinations of these characteristics and trends constitute the important first steps toward a detailed understanding of the relationships between the properties of host groups and their most massive galaxies and the

  16. Brightest group galaxies: stellar mass and star formation rate (paper I)

    NASA Astrophysics Data System (ADS)

    Gozaliasl, Ghassem; Finoguenov, Alexis; Khosroshahi, Habib G.; Mirkazemi, Mohammad; Erfanianfar, Ghazaleh; Tanaka, Masayuki

    2016-05-01

    We study the distribution and evolution of the stellar mass and the star formation rate (SFR) of the brightest group galaxies (BGGs) over 0.04 < z < 1.3 using a large sample of 407 X-ray galaxy groups selected from the COSMOS, AEGIS, and XMM-LSS fields. We compare our results with predictions from the semi-analytic models based on the Millennium simulation. In contrast to model predictions, we find that, as the Universe evolves, the stellar mass distribution evolves towards a normal distribution. This distribution tends to skew to low-mass BGGs at all redshifts implying the presence of a star-forming population of the BGGs with MS ˜ 1010.5 M⊙ which results in the shape of the stellar mass distribution deviating from a normal distribution. In agreement with the models and previous studies, we find that the mean stellar mass of BGGs grows with time by a factor of ˜2 between z = 1.3 and z = 0.1, however, the significant growth occurs above z = 0.4. The BGGs are not entirely a dormant population of galaxies, as low-mass BGGs in low-mass haloes are more active in forming stars than the BGGs in more massive haloes, over the same redshift range. We find that the average SFR of the BGGs evolves steeply with redshift and fraction of the passive BGGs increases as a function of increasing stellar mass and halo mass. Finally, we show that the specific SFR of the BGGs within haloes with M200 ≤ 1013.4 M⊙ decreases with increasing halo mass at z < 0.4.

  17. The Magellanic Satellites Survey: Searching for Hierarchical Structure Formation within the Local Group

    NASA Astrophysics Data System (ADS)

    Bechtol, Keith; Magellanic Satellites Survey (MagLiteS)

    2017-01-01

    A generic prediction of galaxy formation in the standard cosmological model with cold dark matter is the hierarchical assembly of structure on mass scales ranging from ultra-faint galaxies to galaxy clusters. In the Local Group, dozens of galaxies have been found orbiting the Milky Way and Andromeda. The question of whether the largest Milky Way satellites, the Large and Small Magellanic Clouds, brought in their own entourage of satellites has been a long standing puzzle, and has garnered renewed interest following the recent discovery of more than a dozen ultra-faint galaxy candidates in the southern hemisphere. The on-going Magellanic Satellites Survey (MagLiteS) aims to complete an annulus of contiguous deep optical imaging with Blanco/DECam around the periphery of the Magellanic Clouds, enabling a systematic search for ultra-faint galaxies and other low-surface-brightness stellar substructures associated with the Magellanic system. I will report on the progress of MagLiteS and discuss science highlights from the first observing season, including a new ultra-faint galaxy candidate located ~11 kpc from the Large Magellanic Cloud.

  18. Sequential palynostratigraphy of the Queen City and Weches formations (Middle Eocene Claiborne Group), southeast central Texas

    SciTech Connect

    Elsik, W.C. )

    1993-02-01

    Palynomorph sequences of several orders of magnitude were found in the Queen City and Weches formations respectively at Six Mile and Burleson bluffs on the Brazos River, Milam and Burleson counties, Texas. The long term development of the subtropical to tropical Claibornian palynoflora included Engelhardtia spp., Friedrichipollis claibornensis, Nudopollis terminalis, Pollenites laesius and Symplocoipollenites spp. Shorter term fluctuations in sea level were reflected by common herbaceous pollen in the Queen City, and common mangrove pollen in the Weches. Paleoenvironments were marginally to fully marine; dinocysts occurred throughout. The Wetzeliella group of dinocysts were present only in the Queen City at Six Mile Bluff. Late Paleocene to Early Eocene pollen, and Early Middle Eocene pollen with last effective occurrences near the Queen City and Weches boundary included Aesculiidites circumstriatus, Annona foveoreticulata and a new species of Platycarya. Five short term warmer-cooler couplet events were represented by successive abundance peaks of Juglandaceae followed by Ulmus; Alnus supports the three upper Ulmus peaks. One deep water event was recorded by an abundance of fresh water Pediastrum at the Queen City and Weches boundary. That boundary event was bracketed by two of the Alnus and Ulmus peaks.

  19. Selected Data for Wells and Test Holes Used in Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation in the Black Hills Area, South Dakota

    DTIC Science & Technology

    1999-01-01

    Selected Data for Wells and Test Holes Used in Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison...Test Holes Used in Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation...Structure-Contour Maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation in the Black Hills Area

  20. Final Update of the IAU Commission 4 Working Group on Standardizing Access to Ephemerides and File Format Specification

    NASA Astrophysics Data System (ADS)

    Hilton, James L.

    2015-08-01

    The IAU Commission 4 Working Group on Standardizing Access to Ephemerides recommends the use of the Spacecraft and Planet Kernel (SPK) format to provide a uniform format for the position ephemerides of planets and other natural solar system bodies, and the use of the Planetary Constants Kernel (PCK) for the orientation of these bodies. These formats are used by the SPICE system, developed by the Navigation and Ancillary Information Facility of NASA’s Jet Propulsion Laboratory. The working group's final report is currently undergoing final preparations for publication. A long version of this report will be available at the IAU Commission 4 - Ephemerides (or its successor) web site. This long version will contain a full description of that portion of the SPK and PCK formats required to duplicate these file types for this application.

  1. Report of the IAU Commission 4 Working Group on Standardizing Access to Ephemerides and File Format Specification

    DTIC Science & Technology

    2014-12-01

    Standardizing Access To Ephemerides And File Format Specification 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...TO EPHEMERIDES AND FILE FORMAT SPECIFICATION J. L. HILTON1, C. ACTON2, J.-E. ARLOT2, S.A. BELL2, N. CAPITAINE2, A. FIENGA2, W.M. FOLKNER2, M...4 Working Group on Standardizing Access to Ephemerides rec- ommends the use of the Spacecraft and Planet Kernel (SPK) file format to provide a uniform

  2. Molecular Structures, Acid-Base Properties, and Formation of Group 6 Transition Metal Hydroxides

    SciTech Connect

    Li, Shenggang; Guenther, Courtney L.; Kelley, Matthew S.; Dixon, David A.

    2011-04-28

    Density functional theory (DFT) and coupled cluster theory (CCSD(T)) were used to study the group 6 metal (M = Cr, Mo, W) hydroxides: MO3-m(OH)2m (m = 1-3), M2O6-m(OH)2m (m = 1-5), M3O9-m(OH)2m (m = 1, 2), and M4O11(OH)2. The calculations were done up to the complete basis set (CBS) limit for the CCSD(T) method. Molecular structures of many low-energy conformers/isomers were located. Brønsted acidities in the gas phase and pKa values in aqueous solution were predicted for MO3-m(OH)2m (m = 1-3) and MnO3n-1(OH)2 (n = 2-4). In addition, Brønsted basicities and Lewis acidities (fluoride affinities) were predicted for MO3-m(OH)2m (m = 1-3) as well as the metal oxide clusters MnO3n (n = 1-3). The metal hydroxides were predicted to be strong Brønsted acids and weak to modest Brønsted bases and Lewis acids. The pKa values can have values as negative as -31. Potential energy surfaces for the hydrolysis of the MnO3n (n = 1-4) clusters were calculated. Heats of formation of the metal hydroxides were predicted from the calculated reaction energies, and the agreement with the limited available experimental data is good. The first hydrolysis step leading to the formation of MnO3n-1(OH)2 was predicted to be exothermic, with the exothermicity becoming less negative as n increases and essentially converged at n = 3. Reaction rate constants for the hydrogen transfer steps were calculated using transition state theory and RRKM theory. Further hydrolysis of MnO3n-1(OH)2 tends to be endothermic especially for M = Cr. Fifty-five DFT exchange-correlation functionals were benchmarked for the calculations of the reaction energies, complexation energies, and reaction barriers by comparing to our CCSD(T) results. Overall, the DFT results for the potential energy surfaces are semiquantitatively correct, but no single functional works for all processes and all three metals. Among the functionals benchmarked, the wB97, wB97X, B1B95, B97-1, mPW1LYP, and X3LYP functionals have the best

  3. The role of diagnosticity in stereotype formation: perceiving group means and variances.

    PubMed

    Ford, T E; Stangor, C

    1992-09-01

    Three experiments tested the hypotheses that while forming stereotypes of social groups, people abstract the central tendency and variability of different attribute dimensions to determine which ones best differentiate the groups and that more differentiating dimensions are more likely to become stereotypical in the sense of becoming strongly associated with the groups in memory. Supporting these hypotheses. Experiment 1 found that, after viewing behaviors performed by members of 2 groups, Ss characterized the groups more in terms of attribute dimensions indicating larger differences between the central tendencies of the groups, and Experiment 2 showed that this effect did not occur when Ss formed impressions of only 1 group. Experiment 3 found that Ss also characterized groups more in terms of attribute dimensions indicating lower within-group variability.

  4. Fractured-aquifer hydrogeology from geophysical logs: Brunswick group and Lockatong Formation, Pennsylvania

    USGS Publications Warehouse

    Morin, Roger H.; Senior, Lisa A.; Decker, Edward R.

    2000-01-01

    The Brunswick Group and the underlying Lockatong Formation are composed of lithified Mesozoic sediments that constitute part of the Newark Basin in southeastern Pennsylvania. These fractured rocks form an important regional aquifer that consists of gradational sequences of shale, siltstone, and sandstone, with fluid transport occurring primarily in fractures. An extensive suite of geophysical logs was obtained in seven wells located at the borough of Lansdale, Pennsylvania, in order to better characterize the areal hydrogeologic system and provide guidelines for the refinement of numerical ground water models. Six of the seven wells are approximately 120 m deep and the seventh extends to a depth of 335 m. Temperature, fluid conductivity, and flowmeter logs are used to locate zones of fluid exchange and to quantify transmissivities. Electrical resistivity and natural gamma logs together yield detailed stratigraphic information, and digital acoustic televiewer data provide magnetically oriented images of the borehole wall from which almost 900 fractures are identified.Analyses of the geophysical data indicate that the aquifer penetrated by the deep well can be separated into two distinct structural domains, which may, in turn, reflect different mechanical responses to basin extension by different sedimentary units:1. In the shallow zone (above 125 m), the dominant fracture population consists of gently dipping bedding plane partings that strike N46°E and dip to the northwest at about 11 degrees. Fluid flow is concentrated in the upper 80 m along these subhorizontal fractures, with transmissivities rapidly diminishing in magnitude with depth.2. The zone below 125 m marks the appearance of numerous high-angle fractures that are orthogonal to the bedding planes, striking parallel but dipping steeply southeast at 77 degrees.This secondary set of fractures is associated with a fairly thick (approximately 60 m) high-resistivity, low-transmissivity sandstone unit that is

  5. Dispersal and group formation dynamics in a rare and endangered temperate forest bat (Nyctalus lasiopterus, Chiroptera: Vespertilionidae).

    PubMed

    Santos, João D; Meyer, Christoph F J; Ibáñez, Carlos; Popa-Lisseanu, Ana G; Juste, Javier

    2016-11-01

    For elusive mammals like bats, colonization of new areas and colony formation are poorly understood, as is their relationship with the genetic structure of populations. Understanding dispersal and group formation behaviors is critical not only for a better comprehension of mammalian social dynamics, but also for guiding conservation efforts of rare and endangered species. Using nuclear and mitochondrial markers, we studied patterns of genetic diversity and differentiation among and within breeding colonies of giant noctule bats (Nyctalus lasiopterus), their relation to a new colony still in formation, and the impact of this ongoing process on the regionwide genetic makeup. Nuclear differentiation among colonies was relatively low and mostly nonsignificant. Mitochondrial variation followed this pattern, contrasting with findings for other temperate bat species. Our results suggest that this may indicate a recent population expansion. On average, female giant noctules were not more closely related to other colony members than to foreign individuals. This was also true for members of the newly forming colony and those of another, older group sampled shortly after its formation, suggesting that contrary to findings for other temperate bats, giant noctule colonies are not founded by relatives. However, mother-daughter pairs were found in the same populations more often than expected under random dispersal. Given this indication of philopatry, the lack of mitochondrial differentiation among most colonies in the region is probably due to the combination of a recent population expansion and group formation events.

  6. Treatment Effectiveness of Anxiety Management Training in Small and Large Group Formats.

    ERIC Educational Resources Information Center

    Daley, Paul C.; And Others

    1983-01-01

    Compared relative efficiency of anxiety management training (AMT) in large group to AMT in small groups and to a wait-list control. Immediately after treatment, small group AMT participants reported significantly less general anxiety than controls. Seven-week follow-up revealed maintenance of this reduction of general anxiety.

  7. Natural compounds containing a catechol group enhance the formation of Nε-(carboxymethyl)lysine of the Maillard reaction.

    PubMed

    Fujiwara, Yukio; Kiyota, Naoko; Tsurushima, Keiichiro; Yoshitomi, Makiko; Mera, Katsumi; Sakashita, Naomi; Takeya, Motohiro; Ikeda, Tsuyoshi; Araki, Tomohiro; Nohara, Toshihiro; Nagai, Ryoji

    2011-04-01

    Inhibition of advanced glycation end-product (AGE) formation is a potential strategy for the prevention of clinical diabetes complications. Screening for new AGE inhibitors revealed several natural compounds that inhibited the formation of N(ε)-(carboxymethyl)lysine (CML), a major antigenic AGE structure, whereas natural compounds containing a catechol group, such as gallic acid and epicatechin, significantly enhanced CML formation. A similar enhancing effect was also observed by culturing THP-1 macrophages in the presence of catechol compounds. Although 4-methylcatechol significantly enhanced CML formation from glycated HSA (gHSA), a model for Amadori proteins, analogues of catechol such as 5-methylresorcinol and methylhydroquinone showed no enhancing effect. Even though 1mM 4-methylcatechol, epicatechin, and gallic acid significantly enhanced CML formation from gHSA, it was significantly inhibited by decreasing their concentration. The enhancing effect of 1mM catechol compounds was inhibited in the presence of the glutathione peroxidase system, thus demonstrating that hydrogen peroxide generated from catechol compounds plays an important role in the enhancement of CML formation. Furthermore, administration of 500mg/kg/day epicatechin to STZ-induced diabetic mice for 45days enhanced CML accumulation at the surface area of gastric epithelial cells in the stomach. This study provides the first evidence that high amounts of catechol-containing structures enhance oxidative stress, thus leading to enhanced CML formation, and this phenomenon may explain the paradoxical effect that some flavonoids have on redox status.

  8. Observations from practice: support group membership as a process of social capital formation among female survivors of domestic violence.

    PubMed

    Larance, Lisa Young; Porter, Maryann Lane

    2004-06-01

    This article explores the authors' practice observations of female domestic violence survivors' journey from first agency contact to active participation in a support group process. The authors have witnessed female victims of domestic violence challenging the social isolation imposed by their dominant partners as they search for meaning in their lives. As practitioners, they have observed women building trustful relationships and establishing supportive networks during the group process. In this article, the authors suggest that the support group process facilitates trust and network formation indicative of social capital.

  9. The Cheshire Cat Gravitational Lens: The Formation of a Massive Fossil Group

    NASA Astrophysics Data System (ADS)

    Irwin, Jimmy A.; Dupke, Renato; Carrasco, Eleazar R.; Maksym, W. Peter; Johnson, Lucas; White, Raymond E., III

    2015-06-01

    The Cheshire Cat is a relatively poor group of galaxies dominated by two luminous elliptical galaxies surrounded by at least four arcs from gravitationally lensed background galaxies that give the system a humorous appearance. Our combined optical/X-ray study of this system reveals that it is experiencing a line of sight merger between two groups with a roughly equal mass ratio with a relative velocity of ˜1350 km s-1. One group was most likely a low-mass fossil group, while the other group would have almost fit the classical definition of a fossil group. The collision manifests itself in a bimodal galaxy velocity distribution, an elevated central X-ray temperature and luminosity indicative of a shock, and gravitational arc centers that do not coincide with either large elliptical galaxy. One of the luminous elliptical galaxies has a double nucleus embedded off-center in the stellar halo. The luminous ellipticals should merge in less than a Gyr, after which observers will see a massive 1.2-1.5 × 1014 {M}⊙ fossil group with an {M}r=-24.0 brightest group galaxy at its center. Thus, the Cheshire Cat offers us the first opportunity to study a fossil group progenitor. We discuss the limitations of the classical definition of a fossil group in terms of magnitude gaps between the member galaxies. We also suggest that if the merging of fossil (or near-fossil) groups is a common avenue for creating present-day fossil groups, the time lag between the final galactic merging of the system and the onset of cooling in the shock-heated core could account for the observed lack of well-developed cool cores in some fossil groups.

  10. An Agent-Based Simulation for Investigating the Impact of Stereotypes on Task-Oriented Group Formation

    NASA Astrophysics Data System (ADS)

    Maghami, Mahsa; Sukthankar, Gita

    In this paper, we introduce an agent-based simulation for investigating the impact of social factors on the formation and evolution of task-oriented groups. Task-oriented groups are created explicitly to perform a task, and all members derive benefits from task completion. However, even in cases when all group members act in a way that is locally optimal for task completion, social forces that have mild effects on choice of associates can have a measurable impact on task completion performance. In this paper, we show how our simulation can be used to model the impact of stereotypes on group formation. In our simulation, stereotypes are based on observable features, learned from prior experience, and only affect an agent's link formation preferences. Even without assuming stereotypes affect the agents' willingness or ability to complete tasks, the long-term modifications that stereotypes have on the agents' social network impair the agents' ability to form groups with sufficient diversity of skills, as compared to agents who form links randomly. An interesting finding is that this effect holds even in cases where stereotype preference and skill existence are completely uncorrelated.

  11. Unconformities in the mid-Late Proterozoic Pahrump Group: Stratigraphic evidence from the upper member Crystal Spring Formation

    SciTech Connect

    Mbuyi, K.; Prave, A.R. . Dept. of Earth and Atmospheric Sciences)

    1993-04-01

    Deposition of the Pahrump Group rocks (Crystal Spring-Beck Spring-Kingston Peak Formations) in the Death Valley region of California post-dates 1.7 to 1.4 Ga gneissic basement rocks (Wright et al., 1976) and mostly predates the inferred 0.75 Ga glacial deposits of the Kingston Peak Formation. The 1.08 Ga age of the diabase sills in the middle Crystal Spring Formation provides an additional time constraint. Event though this time span is excessive when compared to better dated Phanerozoic successions, the Pahrump Group, nonetheless, has been assumed to be internally conformable. Results from the authors recent work invalidates that assumption. They have carefully measured 15 sections of upper member Crystal Spring Formation rocks and have mapped in detail the belt of exposures in the Saratoga, Saddle Peak, and Ibex Hills, and northern Kingston Range. Their data indicates that an unconformity of significant but unknown duration occurs within the upper member. Evidence for this unconformity includes: (1) local angular discordance of up to 20[degree]; (2) presence of an erosive-based breccia unit (0.10--30 m thick) that consists mostly of hornfelsic clasts derived from immediately subjacent rocks; and (3) erosional beveling and truncation of underlying rocks. In addition, the upward transition to Beck Spring deposition is marked by a disconformity (sequence boundary) that cuts down across and erosionally truncates strata of the upper member Crystal Spring Formation.

  12. The effect of natural organic matter polarity and molecular weight on NDMA formation from two antibiotics containing dimethylamine functional groups.

    PubMed

    Leavey-Roback, Shannon L; Krasner, Stuart W; Suffet, Irwin H Mel

    2016-12-01

    N-nitrosodimethylamine (NDMA) is a disinfection byproduct preferentially formed in chloraminated water. NDMA may be formed from certain chemicals containing dimethylamine (DMA) functional groups. This reaction may be slowed by the presence of natural organic matter (NOM). In this study, NOM fractionated by size or polarity was tested for its ability to slow or impede the formation of NDMA from two DMA-containing precursors, the antibiotics tetracycline and spiramycin. The high molecular weight NOM fractions (>10KDa) were shown to be the most effective in reducing the amount of NDMA formed from the precursor chemicals. The filtrate of a C-18 non-polar cartridge was also effective at reducing NDMA formation from tetracycline (spyramycin not tested). Therefore, polar and charged NOM components may be responsible for the reduction in NDMA formation. A possible mechanism for the reduction of NDMA formation from tetracycline is complexation due to the hydrogen bonding of the DMA functional group on tetracycline to polar phenolic functional groups in the NOM.

  13. Formation and Uses of Lay Advisory Groups for the Humanities. Project Report No. 14.

    ERIC Educational Resources Information Center

    Beckwith, Miriam M.

    Based on the experiences of several community colleges, this report examines successful and unsuccessful strategies utilized in the formation of lay advisory committees for the humanities. The report first presents brief descriptions of successful committee organization efforts at five institutions: Clark College (Vancouver, WA), Brevard Community…

  14. Divergent Mechanistic Routes for the Formation of gem-Dimethyl Groups in the Biosynthesis of Complex Polyketides

    SciTech Connect

    Poust, S; Phelan, RM; Deng, K; Katz, L; Petzold, CJ; Keasling, JD

    2015-01-07

    The gem-dimethyl groups in polyketide-derived natural products add steric bulk and, accordingly, lend increased stability to medicinal compounds, however, our ability to rationally incorporate this functional group in modified natural products is limited. In order to characterize the mechanism of gem-dimethyl group formation, with a goal toward engineering of novel compounds containing this moiety, the gem-dimethyl group producing polyketide synthase (PKS) modules of yersiniabactin and epothilone were characterized using mass spectrometry. The work demonstrated, contrary to the canonical understanding of reaction order in PKSs, that methylation can precede condensation in gem-dimethyl group producing PKS modules. Experiments showed that both PKSs are able to use dimethylmalonyl acyl carrier protein (ACP) as an extender unit. Interestingly, for epothilone module8, use of dimethylmalonyl-ACP appeared to be the sole route to form a gem-dimethylated product, while the yersiniabactin PKS could methylate before or after ketosynthase condensation.

  15. Item Construction Using Reflective, Formative, or Rasch Measurement Models: Implications for Group Work

    ERIC Educational Resources Information Center

    Peterson, Christina Hamme; Gischlar, Karen L.; Peterson, N. Andrew

    2017-01-01

    Measures that accurately capture the phenomenon are critical to research and practice in group work. The vast majority of group-related measures were developed using the reflective measurement model rooted in classical test theory (CTT). Depending on the construct definition and the measure's purpose, the reflective model may not always be the…

  16. Functional-Group-Tolerant, Silver-Catalyzed N-N Bond Formation by Nitrene Transfer to Amines.

    PubMed

    Maestre, Lourdes; Dorel, Ruth; Pablo, Óscar; Escofet, Imma; Sameera, W M C; Álvarez, Eleuterio; Maseras, Feliu; Díaz-Requejo, M Mar; Echavarren, Antonio M; Pérez, Pedro J

    2017-02-15

    Silver(I) promotes the highly chemoselective N-amidation of tertiary amines under catalytic conditions to form aminimides by nitrene transfer from PhI═NTs. Remarkably, this transformation proceeds in a selective manner in the presence of olefins and other functional groups without formation of the commonly observed aziridines or C-H insertion products. The methodology can be applied not only to rather simple tertiary amines but also to complex natural molecules such as brucine or quinine, where the products derived from N-N bond formation were exclusively formed. Theoretical mechanistic studies have shown that this selective N-amidation reaction proceeds through triplet silver nitrenes.

  17. Lithostratigraphy of the Calico Hills Formation and Prow Pass Tuff (Crater Flat Group) at Yucca Mountain, Nevada

    SciTech Connect

    Moyer, T.C.; Geslin, J.K.

    1995-07-01

    Lithostratigraphic relations within the Calico Hills Formation and Prow Pass Tuff (Crater Flat Group) were reconstructed from analysis of core samples and observation of outcrop exposures. The Calico Hills Formation is composed of five nonwelded pyroclastic units (each formed of one or more pyroclastic-flow deposits) that overlie an interval of bedded tuff and a basal volcaniclastic sandstone unit. The Prow Pass Tuff is divided into four pyroclastic units and an underlying interval of bedded tuff. The pyroclastic units of the Prow Pass Tuff are distinguished by the sizes and amounts of their pumice and lithic clasts and their degree of welding. Pyroclastic units of the Prow Pass Tuff are distinguished from those of the Calico Hills Formation by their phenocryst assemblage, chemical composition, and ubiquitous siltstone lithic clasts. Downhole resistivity tends to mirror the content of authigenic minerals, primarily zeolites, in both for-mations and may be useful for recognizing the vitric-zeolite boundary in the study area. Maps of zeolite distribution illustrate that the bedded tuff and basal sandstone units of the Calico Hills Formation are altered over a wider area than the pyroclastic units of both the Calico Hills Formation and the upper Prow Pass Tuff.

  18. Undergraduate ALFALFA Team: Analysis of Spatially-Resolved Star-Formation in Nearby Galaxy Groups and Clusters

    NASA Astrophysics Data System (ADS)

    Finn, Rose; Collova, Natasha; Spicer, Sandy; Whalen, Kelly; Koopmann, Rebecca A.; Durbala, Adriana; Haynes, Martha P.; Undergraduate ALFALFA Team

    2017-01-01

    As part of the Undergraduate ALFALFA Team, we are conducting a survey of the gas and star-formation properties of galaxies in 36 groups and clusters in the local universe. The galaxies in our sample span a large range of galactic environments, from the centers of galaxy groups and clusters to the surrounding infall regions. One goal of the project is to map the spatial distribution of star-formation; the relative extent of the star-forming and stellar disks provides important information about the internal and external processes that deplete gas and thus drive galaxy evolution. We obtained wide-field H-alpha observations with the WIYN 0.9m telescope at Kitt Peak National Observatory for galaxies in the vicinity of the MKW11 and NRGb004 galaxy groups and the Abell 1367 cluster. We present a preliminary analysis of the relative size of the star-forming and stellar disks as a function of galaxy morphology and local galaxy density, and we calculate gas depletion times using star-formation rates and HI gas mass. We will combine these results with those from other UAT members to determine if and how environmentally-driven gas depletion varies with the mass and X-ray properties of the host group or cluster. This work has supported by NSF grants AST-0847430, AST-1211005 and AST-1637339.

  19. Alcohol and group formation: a multimodal investigation of the effects of alcohol on emotion and social bonding.

    PubMed

    Sayette, Michael A; Creswell, Kasey G; Dimoff, John D; Fairbairn, Catharine E; Cohn, Jeffrey F; Heckman, Bryan W; Kirchner, Thomas R; Levine, John M; Moreland, Richard L

    2012-08-01

    We integrated research on emotion and on small groups to address a fundamental and enduring question facing alcohol researchers: What are the specific mechanisms that underlie the reinforcing effects of drinking? In one of the largest alcohol-administration studies yet conducted, we employed a novel group-formation paradigm to evaluate the socioemotional effects of alcohol. Seven hundred twenty social drinkers (360 male, 360 female) were assembled into groups of 3 unacquainted persons each and given a moderate dose of an alcoholic, placebo, or control beverage, which they consumed over 36 min. These groups' social interactions were video recorded, and the duration and sequence of interaction partners' facial and speech behaviors were systematically coded (e.g., using the facial action coding system). Alcohol consumption enhanced individual- and group-level behaviors associated with positive affect, reduced individual-level behaviors associated with negative affect, and elevated self-reported bonding. Our results indicate that alcohol facilitates bonding during group formation. Assessing nonverbal responses in social contexts offers new directions for evaluating the effects of alcohol.

  20. Formation of the lamellar structure in Group IA and IIID iron meteorites

    NASA Technical Reports Server (NTRS)

    Kowalik, J. A.; Williams, D. B.; Goldstein, J. I.

    1988-01-01

    Analytical EM, light microscopy, and electron microprobe analysis are used to study the lamellar plessite structure of Group IA and IIID iron meteorites. The alpha lamellae in IIID structures contained a compositional gradient from 6.1 + or - 0.7 wt pct Ni at the center of the alpha lamellae to 3.6 + or - 0.5 wt pct at the alpha/gamma interface. For the Group IA irons, compositions of 4 wt pct Ni in alpha and about 48 wt pct Ni in gamma are found. Convergent beam electron diffraction was used to characterize the orientation relations at the alpha/gamma interface in the lamellar regions of both Group IA and IIID. The phase transformations responsible for the observed lamellar structure in the IA and IIID chemical groups were also investigated.

  1. End Group Effects on the Hydrogel Formation of PEO-PPO-PEO Triblock Copolymers

    NASA Astrophysics Data System (ADS)

    Cohen, Aaron; Ryu, Chang Y.; Jung, Gyoo Y.; Hwang, Hee Sung

    2012-02-01

    Pluronic F108, a triblock copolymer consisting of outer polyethylene oxide (PEO) chains and an inner polypropylene oxide (PPO) chains, has been shown to be an effective hydrogel matrix for DNA separation by capillary electrophoresis using single-stranded conformation polymorphism. This presentation will discuss a new pathway to potentially enhance the separation abilities of F108 by altering the chain end groups of the block copolymers. F108 is believed to form a micelle in aqueous solutions with the hydrophobic group in the interior, thus we expect considerable interaction between the DNA sample and the end groups found at the hydrophilic brush layers of the micelle. The rheological properties of end group derivatives of F108, in combination of small angle x-ray scattering, can reveal structural differences in the micelles. In particular, gelation temperature of the end group derivatives can be linked to differences in the micelle structure. Dynamic light scattering can also be used to determine the effects of chain end groups on the hydrodynamic size of the block copolymer micelles in dilute solution.

  2. The activation energy values estimated by the Arrhenius equation as a controlling factor of platinum-group mineral formation

    NASA Astrophysics Data System (ADS)

    Petrou, Athinoula L.; Economou-Eliopoulos, Maria

    2009-03-01

    In ophiolite complexes and Ural/Alaskan-type intrusions the platinum-group element minerals (PGM) occur as laurite (RuS 2), erlichmanite (OsS 2), irarsite (IrAsS) and alloys (Os-Ir-Ru and Pt-Fe). They are commonly found as small inclusions (normally less than 10 μm, occasionally up to 100 μm) in chromite. The origin of coarse-grained PGM, in the form of 0.5-10 mm nuggets, in placer deposits related with mafic/ultramafic complexes remains still unclear. Literature data on grain size ( r) of platinum-group minerals (PGM) and their formation temperature (range of temperatures between 700 and 1100 °C), revealed an Arrhenius temperature dependence. Correlation of the rate of crystal formation that depends on temperature (T) with the size ( r) of the grain results in a linear relationship between ln( r) and 1/T. From the slope of the line n × ln( r) = -const. + Eact/ RT the activation energy for the formation of IPGM (Ir-platinum-group minerals) was estimated, for the first time in the present study, to be approximately 450 ± 45 kJ mol -1. Applying the Arrhenius equation, the corresponding formation temperature for extremely large IPGM grains (up to 1.3 mm) in chromite ores related to ophiolites was found to be approximately 740 °C. It seems to be consistent with a lower formation temperature than with the typical formation temperature of small PGM grains associated with ophiolitic chromitites. This suggests that coarse-grained PGM in mafic/ultramafic complexes, along the permeable shear zones, may have been re-crystallized during plastic deformation at relatively lower temperatures (700-800 °C), under appropriate pressure, temperature, redox conditions and an increased H 2O content. Thus, applying the plot of ln( r) versus 1/T on large Os-Ir-Ru-minerals (sulfides or alloys), characterized by an r value falling into the linear part of the graph and having evidence supporting their formation at relatively high temperatures, then the corresponding formation

  3. The Trier Social Stress Test for Groups (TSST-G): A new research tool for controlled simultaneous social stress exposure in a group format.

    PubMed

    von Dawans, Bernadette; Kirschbaum, Clemens; Heinrichs, Markus

    2011-05-01

    Psychological stress is an ubiquitous challenge across human cultures affecting mental and physical health. Recent evidence indicates that performance tasks combining elements of socio-evaluative threat and uncontrollability elicit reliable stress responses. The Trier Social Stress Test (TSST) is the most frequently used psychological protocol in stress research; however, to date it has only been available in a single-subject version. In particular, there is an increasing need in several emerging research fields such as stress research or social neurosciences for a standardized research tool to expose relatively large groups of subjects to controlled simultaneous stress. In search of a laboratory stressor that allows simultaneous stress exposure in a group format, we exposed a total of 25 healthy male participants to the Trier Social Stress Test for Groups (TSST-G; public speaking and mental arithmetic tasks in front of a panel of two evaluators in groups of six participants) and a specific control condition. Results showed that the TSST-G induced significant increases in cortisol, heart rate, and psychological stress responses. The TSST-G provides a novel, effective, and economical protocol for experimental paradigms requiring simultaneous stress induction in multiple participants.

  4. Environmental interactions in Space Exploration: Announcement of the formation of an Environmental Interactions Working Group

    NASA Technical Reports Server (NTRS)

    Kolecki, Joseph C.; Hillard, G. Barry

    1991-01-01

    With the advent of the Space Exploration Initiative, the possibility of designing and using systems on scales not heretofore attempted presents exciting new challenges in systems design and space science. The environments addressed by the Space Exploration Initiative include the surfaces of the Moon and Mars, as well as the varied plasma and field environments which will be encountered by humans and cargo enroute to these destinations. Systems designers will need to understand environmental interactions and be able to model these mechanisms from the earliest conceptual design stages through design completion. To the end of understanding environmental interactions and establishing robotic precursor mission requirements, an Environmental Interactions Working Group has been established as part of the Robotic Missions Working Group. The current paper describes the working group and gives an update of its current activities. Working group charter and operation are reviewed, background information on the environmental interactions and their characteristics is offered, and the current status of the group's activities is presented along with anticipations for the future.

  5. Insights into the formation of inorganic heterocycles via cyclocondensation of primary amines with group 15 and 16 halides.

    PubMed

    Chivers, Tristram; Laitinen, Risto S

    2017-01-31

    Cyclocondensation is a major preparative route for the generation of inorganic heterocycles especially in the case of ring systems involving a Group 15 or 16 element linked to nitrogen. This Perspective will consider recent experimental and computational studies involving the reactions of primary amines (or their synthetic equivalents) with pnictogen and chalcogen halides. The major focus will be a discussion of the identity and role of acyclic intermediates in the reaction pathways to ring formation, as well as the nature of the heterocycles so formed. The similarities and differences between the chemistry of group 15 and 16 systems are emphasised with a view to providing signposts for further investigations.

  6. On the Formation of Amide Polymers via Carbonyl-Amino Group Linkages in Energetically Processed Ices of Astrophysical Relevance

    NASA Astrophysics Data System (ADS)

    Förstel, Marko; Maksyutenko, Pavlo; Jones, Brant M.; Sun, Bing J.; Lee, Huan C.; Chang, Agnes H. H.; Kaiser, Ralf I.

    2016-04-01

    We report on the formation of organic amide polymers via carbonyl-amino group linkages in carbon monoxide and ammonia bearing energetically processed ices of astrophysical relevance. The first group comprises molecules with one carboxyl group and an increasing number of amine moieties starting with formamide (45 u), urea (60 u), and hydrazine carboxamide (75 u). The second group consists of species with two carboxyl (58 u) and up to three amine groups (73 u, 88 u, and 103 u). The formation and polymerization of these linkages from simple inorganic molecules via formamide und urea toward amide polymers is discussed in an astrophysical and astrobiological context. Our results show that long chain molecules, which are closely related to polypeptides, easily form by energetically processing simple, inorganic ices at very low temperatures and can be released into the gas phase by sublimation of the ices in star-forming regions. Our experimental results were obtained by employing reflectron time-of-flight mass spectroscopy, coupled with soft, single photon vacuum ultraviolet photoionization; they are complemented by theoretical calculations.

  7. ON THE FORMATION OF AMIDE POLYMERS VIA CARBONYL–AMINO GROUP LINKAGES IN ENERGETICALLY PROCESSED ICES OF ASTROPHYSICAL RELEVANCE

    SciTech Connect

    Förstel, Marko; Maksyutenko, Pavlo; Jones, Brant M.; Kaiser, Ralf I.; Sun, Bing J.; Lee, Huan C.; Chang, Agnes H. H. E-mail: hhchang@mail.ndhu.edu.tw

    2016-04-01

    We report on the formation of organic amide polymers via carbonyl–amino group linkages in carbon monoxide and ammonia bearing energetically processed ices of astrophysical relevance. The first group comprises molecules with one carboxyl group and an increasing number of amine moieties starting with formamide (45 u), urea (60 u), and hydrazine carboxamide (75 u). The second group consists of species with two carboxyl (58 u) and up to three amine groups (73 u, 88 u, and 103 u). The formation and polymerization of these linkages from simple inorganic molecules via formamide und urea toward amide polymers is discussed in an astrophysical and astrobiological context. Our results show that long chain molecules, which are closely related to polypeptides, easily form by energetically processing simple, inorganic ices at very low temperatures and can be released into the gas phase by sublimation of the ices in star-forming regions. Our experimental results were obtained by employing reflectron time-of-flight mass spectroscopy, coupled with soft, single photon vacuum ultraviolet photoionization; they are complemented by theoretical calculations.

  8. THE SUPPRESSION OF STAR FORMATION AND THE EFFECT OF THE GALAXY ENVIRONMENT IN LOW-REDSHIFT GALAXY GROUPS

    SciTech Connect

    Rasmussen, Jesper; Mulchaey, John S.; Bai, Lei; Ponman, Trevor J.; Raychaudhury, Somak; Dariush, Ali

    2012-10-01

    Understanding the interaction between galaxies and their surroundings is central to building a coherent picture of galaxy evolution. Here we use Galaxy Evolution Explorer imaging of a statistically representative sample of 23 galaxy groups at z Almost-Equal-To 0.06 to explore how local and global group environments affect the UV properties and dust-corrected star formation rates (SFRs) of their member galaxies. The data provide SFRs out to beyond 2R{sub 200} in all groups, down to a completeness limit and limiting galaxy stellar mass of 0.06 M{sub Sun} yr{sup -1} and 1 Multiplication-Sign 10{sup 8} M{sub Sun }, respectively. At fixed galaxy stellar mass, we find that the fraction of star-forming group members is suppressed relative to the field out to an average radius of R Almost-Equal-To 1.5 Mpc Almost-Equal-To 2R{sub 200}, mirroring results for massive clusters. For the first time, we also report a similar suppression of the specific SFR within such galaxies, on average by 40% relative to the field, thus directly revealing the impact of the group environment in quenching star formation within infalling galaxies. At fixed galaxy density and stellar mass, this suppression is stronger in more massive groups, implying that both local and global group environments play a role in quenching. The results favor an average quenching timescale of {approx}> 2 Gyr and strongly suggest that a combination of tidal interactions and starvation is responsible. Despite their past and ongoing quenching, galaxy groups with more than four members still account for at least {approx}25% of the total UV output in the nearby universe.

  9. Surface relief grating formation in luminescent dye doped photochromic polymer containing azobenzene side groups

    NASA Astrophysics Data System (ADS)

    Sznitko, Lech; Karpinski, Pawel; Bartkiewicz, Stanislaw; Miniewicz, Andrzej; Mysliwiec, Jaroslaw

    2013-08-01

    We study the formation of a surface relief grating and photoluminescence in a thin layers of a photochromic polymer doped with the luminescent dyes 3-(1,1-dicyanoethenyl)-1-phenyl-4,5-dihydro-1H-pyrazole and Rhodamine 6G. Surface topography measurements via Atomic Force Microscopy confirmed the existence of a surface relief grating with amplitudes as high as 650 nm both for doped and undoped photochromic polymers. Spectroscopic measurements carried out for polymers containing luminescent dyes have shown efficient photoluminescence and amplified spontaneous emission which is characteristic for gain media.

  10. Human group formation in online guilds and offline gangs driven by a common team dynamic.

    PubMed

    Johnson, Neil F; Xu, Chen; Zhao, Zhenyuan; Ducheneaut, Nicolas; Yee, Nicholas; Tita, George; Hui, Pak Ming

    2009-06-01

    Quantifying human group dynamics represents a unique challenge. Unlike animals and other biological systems, humans form groups in both real (offline) and virtual (online) spaces-from potentially dangerous street gangs populated mostly by disaffected male youths to the massive global guilds in online role-playing games for which membership currently exceeds tens of millions of people from all possible backgrounds, age groups, and genders. We have compiled and analyzed data for these two seemingly unrelated offline and online human activities and have uncovered an unexpected quantitative link between them. Although their overall dynamics differ visibly, we find that a common team-based model can accurately reproduce the quantitative features of each simply by adjusting the average tolerance level and attribute range for each population. By contrast, we find no evidence to support a version of the model based on like-seeking-like (i.e., kinship or "homophily").

  11. Human group formation in online guilds and offline gangs driven by a common team dynamic

    NASA Astrophysics Data System (ADS)

    Johnson, Neil F.; Xu, Chen; Zhao, Zhenyuan; Ducheneaut, Nicolas; Yee, Nicholas; Tita, George; Hui, Pak Ming

    2009-06-01

    Quantifying human group dynamics represents a unique challenge. Unlike animals and other biological systems, humans form groups in both real (offline) and virtual (online) spaces—from potentially dangerous street gangs populated mostly by disaffected male youths to the massive global guilds in online role-playing games for which membership currently exceeds tens of millions of people from all possible backgrounds, age groups, and genders. We have compiled and analyzed data for these two seemingly unrelated offline and online human activities and have uncovered an unexpected quantitative link between them. Although their overall dynamics differ visibly, we find that a common team-based model can accurately reproduce the quantitative features of each simply by adjusting the average tolerance level and attribute range for each population. By contrast, we find no evidence to support a version of the model based on like-seeking-like (i.e., kinship or “homophily”).

  12. Thermochemistry of organic, elementorganic and inorganic species. Part XX. Enthalpies of formation for free radicals of main group elements’ halogenides

    NASA Astrophysics Data System (ADS)

    Ponomarev, Dmitry; Takhistov, Viatcheslav; Slayden, Suzanne; Liebman, Joel

    2008-03-01

    General trends in thermochemistry for free radicals as the fragments of halogenated molecules of main group elements were found for the first time applying the series of isodesmic (working) reactions following the Benson's comparison of relative stabilities of free radicals in equations R+RH→ RH+R+Q, where Q is stabilization (destabilization) energy. The enthalpies of formation for parent molecules of main group elements' halogenides necessary for application of this and similar equations were presented earlier [A.V. Golovin, V.V. Takhistov, J. Mol. Struct., 784 (2006) 47.]. For fluorinated free radicals rad EF (E = Be-Ra), rad EF 2 ( rad EHF) (E = B-Tl, N-Bi) and rad EF 3 ( rad EH 2F, rad EHF 2) (E = C-Pb) the gradual decrease in stabilization by fluorine atoms was found when coming down the periodic table. This turned to destabilization for Tl, Sb, and Bi, and IVth group of elements (excluding carbon) with increasing destabilization in the row Si < Ge < Sn < Pb. The destabilization of free radicals by other halogens for IVth group of elements decreased in the row F > Cl > Br > I which was interpreted by involvement of polarizability (PAZ) effect of halogens increasing in this direction. For finding the enthalpies of formation for silicon and germanium-centered free radicals the data on ν ≡ E-H frequencies in IR-spectra were applied. Quite definite tendencies in structure/enthalpy of formation interrelationship were found for chlorinated, brominated and iodinated free radicals of IInd and IIIrd group of elements. In the VIth group the situation with F → Cl → Br → I replacement in stabilization of free radical center appeared completely different compared with II-IV groups. Owing to the high electronegativity of HO-group and low thermodynamic stability of HO rad radical all halogens highly stabilize rad OX radical and perform it in the row F < Cl-Br < I which is explained by increase of PAZ effect in this direction. All halogens are suggested to

  13. The International Dermatology Outcome Measures Group: formation of patient-centered outcome measures in dermatology.

    PubMed

    Gottlieb, Alice B; Levin, Adriane A; Armstrong, April W; Abernethy, April; Duffin, Kristina Callis; Bhushan, Reva; Garg, Amit; Merola, Joseph F; Maccarone, Mara; Christensen, Robin

    2015-02-01

    As quality standards are increasingly in demand throughout medicine, dermatology needs to establish outcome measures to quantify the effectiveness of treatments and providers. The International Dermatology Outcome Measures Group was established to address this need. Beginning with psoriasis, the group aims to create a tool considerate of patients and providers using the input of all relevant stakeholders in assessment of disease severity and response to treatment. Herein, we delineate the procedures through which consensus is being reached and the future directions of the project.

  14. Use of formative research and social network theory to develop a group walking intervention: Sumter County on the Move!

    PubMed

    Forthofer, Melinda; Burroughs-Girardi, Ericka; Stoisor-Olsson, Liliana; Wilcox, Sara; Sharpe, Patricia A; Pekuri, Linda M

    2016-10-01

    Although social support is a frequently cited enabler of physical activity, few studies have examined how to harness social support in interventions. This paper describes community-based formative research to design a walking program for mobilizing naturally occurring social networks to support increases in walking behavior. Focus group methods were used to engage community members in discussions about desired walking program features. The research was conducted with underserved communities in Sumter County, South Carolina. The majority of focus group participants were women (76%) and African American (92%). Several important themes emerged from the focus group results regarding attitudes toward walking, facilitators of and barriers to walking, ideal walking program characteristics, and strategies for encouraging community members to walk. Most noteably, the role of existing social networks as a supportive influence on physical activity was a recurring theme in our formative research and a gap in the existing evidence base. The resulting walking program focused on strategies for mobilizing, supporting and reinforcing existing social networks as mechanisms for increasing walking. Our approach to linking theory, empirical evidence and community-based formative research for the development of a walking intervention offers an example for practitioners developing intervention strategies for a wide range of behaviors.

  15. Petrography, diagenesis and geotechnical properties of the El-Rufuf Formation (Thebes Group), El-Kharga Oasis, Egypt

    NASA Astrophysics Data System (ADS)

    Bashed, M. A.; Sediek, K. N.

    1997-10-01

    The El-Rufuf Formation (Thebes Group) outcrops widely in Egypt. It is quarried as an ornamental building stone and used as slabs in walls and floors. It is also important in foundation construction. The geotechnical behaviour of these rocks is commonly related to stratigraphical position, controlled by their petrography and textural and diagenetic features. The El-Rufuf Formation of Naqb Assiut, El-Kharga Oasis, consists of 63 m of micritic and neomorphosed limestones which are marly at the base. Microfacies analysis of these limestones indicates an inner to middle shelf open marine environment. The most common diagenetic features are neomorphism, silicification, dissolution and stylolites. There are clear relationships between the measured compressive strength of rocks and the facies and diagenetic features. Neomorphic sparry limestone has the lowest compressive strength, while cherty biomicritic limestone shows the highest values. Micritic and biomicritic limestones show intermediate values. Some anisotropism of compressive strength values is recorded in the stylolitic limestones and in the foliated marly part of the formation. The present study reveals that the El-Rufuf limestones, according to Deere's (1968) classification, are low to medium strength rocks with low modulus ratios (DL-CL), while the marly parts of the formation are low strength rocks with low modulus ratios (EL). The rocks of the marly part of the El-Rufuf Formation are unstable with regard to water and therefore have a zero softness coefficient.

  16. Isolation, phylogenetic group, drug resistance, biofilm formation, and adherence genes of Escherichia coli from poultry in central China.

    PubMed

    Wang, Yang; Yi, Li; Wang, Yuxin; Wang, Yuanguo; Cai, Ying; Zhao, Wenpeng; Ding, Chan

    2016-12-01

    The isolation and identification, genetic typing, antibiotic sensitivity, and biofilm formation of avian Escherichia coli in central China was studied. A total of 256 isolates of E. coli were obtained, and classified into groups: A (50.78%, 130/256), B1 (11.72%, 30/256), B2 (17.58%, 45/256), and D (19.92%, 51/256). Drug susceptibility testing revealed that the strains showed a high drug resistance rate against penicillin, aztreonam, rifampicin, kanamycin, clindamycin, and gentamicin, with 92.19% of strains exhibiting multi-drug resistance. A biofilm assay revealed that 81.64% of isolates could form biofilms. Of the total isolates, 25.39% of isolates showed strong biofilm-formation ability, 31.25% showed moderate biofilm-formation ability, 28.90% showed weak biofilm-formation ability, and 18.36% were unable to form biofilms. Most adhesion-associated genes were distributed among 5 or 8 genes in strong biofilm-forming ability isolates. However, adhesion-associated genes distributed among 1 or 4 genes were found in weak biofilm-forming ability isolates and non-ability isolates. The results showed a high drug resistance rate and biofilm formation ability in E.coli strains isolated from poultry. The isolates which have strong biofilm-forming ability were mostly belong to pathogenic E. coli (B2, D). Furthermore, it was the first report to demonstrate a positive correlation between adhesion-encoding genes and biofilms phenotype.

  17. Modeling the Formation Process of Grouping Stimuli Sets through Cortical Columns and Microcircuits to Feature Neurons

    PubMed Central

    Williamson, Adam

    2013-01-01

    A computational model of a self-structuring neuronal net is presented in which repetitively applied pattern sets induce the formation of cortical columns and microcircuits which decode distinct patterns after a learning phase. In a case study, it is demonstrated how specific neurons in a feature classifier layer become orientation selective if they receive bar patterns of different slopes from an input layer. The input layer is mapped and intertwined by self-evolving neuronal microcircuits to the feature classifier layer. In this topical overview, several models are discussed which indicate that the net formation converges in its functionality to a mathematical transform which maps the input pattern space to a feature representing output space. The self-learning of the mathematical transform is discussed and its implications are interpreted. Model assumptions are deduced which serve as a guide to apply model derived repetitive stimuli pattern sets to in vitro cultures of neuron ensembles to condition them to learn and execute a mathematical transform. PMID:24369455

  18. Modeling the formation process of grouping stimuli sets through cortical columns and microcircuits to feature neurons.

    PubMed

    Klefenz, Frank; Williamson, Adam

    2013-01-01

    A computational model of a self-structuring neuronal net is presented in which repetitively applied pattern sets induce the formation of cortical columns and microcircuits which decode distinct patterns after a learning phase. In a case study, it is demonstrated how specific neurons in a feature classifier layer become orientation selective if they receive bar patterns of different slopes from an input layer. The input layer is mapped and intertwined by self-evolving neuronal microcircuits to the feature classifier layer. In this topical overview, several models are discussed which indicate that the net formation converges in its functionality to a mathematical transform which maps the input pattern space to a feature representing output space. The self-learning of the mathematical transform is discussed and its implications are interpreted. Model assumptions are deduced which serve as a guide to apply model derived repetitive stimuli pattern sets to in vitro cultures of neuron ensembles to condition them to learn and execute a mathematical transform.

  19. Facilitated Networking and Group Formation in an Online Community of Practice

    ERIC Educational Resources Information Center

    Fasso, Wendy

    2010-01-01

    In 2008 and 2009, a series of online professional development communities for groups of teacher-leaders in digital pedagogy was run. In each of the first two iterations, there was an early dropout of individuals who felt they "did not belong". Contributing to this sense of isolation was the immediate emergence of online networks in the…

  20. Personalized Education; Solving a Group Formation and Scheduling Problem for Educational Content

    ERIC Educational Resources Information Center

    Bahargam, Sanaz; Erdos, Dóra; Bestavros, Azer; Terzi, Evimaria

    2015-01-01

    Whether teaching in a classroom or a Massive Online Open Course it is crucial to present the material in a way that benefits the audience as a whole. We identify two important tasks to solve towards this objective; (1) group students so that they can maximally benefit from peer interaction and (2) find an optimal schedule of the educational…

  1. Integration of Structured Expressive Activities within a Humanistic Group Play Therapy Format for Preadolescents

    ERIC Educational Resources Information Center

    Bratton, Sue C.; Ceballos, Peggy L.; Ferebee, Kelly Webb

    2009-01-01

    The integration of expressive activities in play groups with preadolescents encourages them to reach more deeply into their own resources, enabling them to handle future challenges more effectively. Developmental and therapeutic rationale, along with research support, is given for the integration of creative activities into a humanistic play group…

  2. Designing Project-Based Courses with a Focus on Group Formation and Assessment

    ERIC Educational Resources Information Center

    Richards, Debbie

    2009-01-01

    The value and the pitfalls of project and group work are well recognized. The principles and elements which apply to projects in general, apply to project-based courses. Thoughtful and detailed planning, understanding of the stakeholders and their needs, a good design, appropriate testing, monitoring and quality control and continual management…

  3. Group Formation in Mobile Computer Supported Collaborative Learning Contexts: A Systematic Literature Review

    ERIC Educational Resources Information Center

    Amara, Sofiane; Macedo, Joaquim; Bendella, Fatima; Santos, Alexandre

    2016-01-01

    Learners are becoming increasingly divers. They may have much personal, social, cultural, psychological, and cognitive diversity. Forming suitable learning groups represents, therefore, a hard and time-consuming task. In Mobile Computer Supported Collaborative Learning (MCSCL) environments, this task is more difficult. Instructors need to consider…

  4. Delaware Mountain Group (DMG) hydrology-salt removal potential. [Castile formation

    SciTech Connect

    Wood, B.J.; Snow, R.E.; Cosler, D.J.; Haji-Djafari, S.

    1982-12-01

    This study has been performed to assess potential salt dissolution from the evaporite sequences by the underlying aquifer and to evaluate the impact of this process on the WIPP facility integrity. The hydrogeologic and geochemical characteristics of the DMG have been reviewed and the various salt dissolution hypotheses and mechanimsms have been examined. Based on analytical and numerical evaluations, the following conclusions have been reached: The potential dissolution mechanisms include diffusion and convection from halite layers to the Bell Canyon and Captain Reef aquifers. Computation of the present dissolution rate based on observed chloride concentration levels in the Bell Canyon aquifer indicates that diffusion and possibly very weak convection result in removal of halite from the Castile overlying the DMG. Evaluation of the DMG hydrogeologic conditions and review of the range of values for the hydrogeologic and geochemical parameters which influence salt removal indicate that general salt removal by the diffusion process would produce an advancement of the dissolution front of only 0.3 cm in 10,000 yr. Based on an analysis of potential changes in the hydrologic characteristics of the Bell Canyon aquifer, an increase in flow rate of even one order of magnitude would not increase the salt removal from the Castile Formation by more than 17% cm. analysis of implausible worst-case dissolution rates associated with both diffusive and convective dissolution at the Bell Canyon aquifer-Castile Formation interface suggests that the structural integrity of the WIPP facility located more than 400 m above would not be affected. In this analysis, it was determined that the theoretical maximum cavity radius would be seven meters over a fracture and one meter above a circular porous zone in a period of 10,000 yrs.

  5. The geological significance of the boundary between the Fort Sill and Signal Mountain Formations in the lower Arbuckle Group (Cambrian)

    SciTech Connect

    Hosey, R.; Donovan, R.N. . Geology Dept.)

    1993-02-01

    During the upper Cambrian, a transgression inundated the Southern Oklahoma aulacogen enveloping a landscape that consisted of hills of Cambrian-aged rhyolite up to 350 m in height. Initial deposits on this topography--the Reagan Formation--consist of siliciclastics that were deposited as alluvium and succeeding tidally-influenced marine sandstones and shales. The siliciclastics grains are made up of local rhyolite, quartz and authigenic glauconite. The overlying Honeycreek Formation is defined by the addition of carbonated detritus in the form of tidally-influenced pelmatozoan grainstones. The passage from the Honeycreek to the overlying Fort Sill Formation of the Arbuckle Group is marked by the incoming of beds of lime mudstone and the gradual disappearance of grainstones and siliciclastics. The contact between the Fort Sill and the overlying thinly-bedded dark grey bioclastic limestones of the Signal Mountain Formation is one of the most distinctive horizons in the Arbuckle Group. The contact evidently marks a substantial change in depositional environment. In detail the contact is sharp and shows evidence of minor erosion, although no karsting has been detected. The authors suggest that the contact surface records a regression, perhaps associated with dolomitization and followed by some erosion. A regression is also indicated by the local occurrence of a laminated tidal flat unit with traces of evaporites that outcrops in the far west of the Slick Hills immediately below the formation contact. They suggest that the Signal Mountains as a transgressive unit, incorporating siliciclastics transported into the area during the regression. It has been suggested that the unconformity reflects localized tectonism associated with the evolution of the Southern Oklahoma aulacogen. On the other hand the surface may correlate with a craton--wide Sauxian' hiatus.

  6. Early amygdala or hippocampus damage influences adolescent female social behavior during group formation.

    PubMed

    Moadab, Gilda; Bliss-Moreau, Eliza; Bauman, Melissa D; Amaral, David G

    2017-02-01

    This study continues a longitudinal analysis of rhesus macaque social behavior following bilateral neonatal ibotenic acid lesions of the amygdala or hippocampus, or sham operations. The social behavior of female subjects was evaluated at a critical developmental time point-the transition to adulthood. At approximately 4 years of age, female subjects were housed in small groups with other female subjects and reproductively viable adult males. As compared with neurologically intact control animals and animals with early amygdala damage, animals with early hippocampal damage were more social with their female peers. In contrast, as compared with control animals, animals with early amygdala damage spent less time with the males, engaged less frequently in behaviors typical of reproductive consortships, had higher frequencies of self-directed stereotypies, and became pregnant later. Males also generated fewer communicative signals toward animals with early amygdala damage than to control animals and animals with early hippocampus damage. Rates of sexual behavior were generally low for all animals, and there were no lesion-based differences in their frequencies. Discriminant function analyses demonstrated that patterns of affiliative social behaviors differed across the 3 experimental groups, both in terms of the social behaviors directed to the males, and the social behaviors generated by the males toward the females. In 4 of the 5 social groups, amygdala-lesioned animals were lowest ranked, potentially contributing to reduced sociability interactions with males. Other potential mechanisms and the experiments needed to elucidate them are discussed. (PsycINFO Database Record

  7. Properties of galaxy groups in the Sloan Digital Sky Survey - II. Active galactic nucleus feedback and star formation truncation

    NASA Astrophysics Data System (ADS)

    Weinmann, Simone M.; van den Bosch, Frank C.; Yang, Xiaohu; Mo, H. J.; Croton, Darren J.; Moore, Ben

    2006-11-01

    Successfully reproducing the galaxy luminosity function (LF) and the bimodality in the galaxy distribution requires a mechanism that can truncate star formation in massive haloes. Current models of galaxy formation consider two such truncation mechanisms: strangulation, which acts on satellite galaxies, and active galactic nucleus (AGN) feedback, which predominantly affects central galaxies. The efficiencies of these processes set the blue fraction of galaxies, fblue(L, M), as a function of galaxy luminosity, L, and halo mass, M. In this paper, we use a galaxy group catalogue extracted from the Sloan Digital Sky Survey (SDSS) to determine fblue(L, M). To demonstrate the potential power of these data as a benchmark for galaxy formation models, we compare the results to the semi-analytical model for galaxy formation of Croton et al. Although this model accurately fits the global statistics of the galaxy population, as well as the shape of the conditional LF, there are significant discrepancies when the blue fraction of galaxies as a function of mass and luminosity is compared between the observations and the model. In particular, the model predicts (i) too many faint satellites in massive haloes, (ii) a blue fraction of satellites that is much too low, and (iii) a blue fraction of centrals that is too high and with an inverted luminosity dependence. In the same order, we argue that these discrepancies owe to (i) the neglect of tidal stripping in the semi-analytical model, (ii) the oversimplified treatment of strangulation, and (iii) improper modelling of dust extinction and/or AGN feedback. The data presented here will prove useful to test and calibrate future models of galaxy formation and, in particular, to discriminate between various models for AGN feedback and other star formation truncation mechanisms.

  8. Hierarchical Formation in Action: Characterizing Accelerated Galaxy Evolution in Compact Groups Using Whole-sky WISE Data

    NASA Astrophysics Data System (ADS)

    Zucker, Catherine; Walker, Lisa May; Johnson, Kelsey; Gallagher, Sarah; Alatalo, Katherine; Tzanavaris, Panayiotis

    2016-04-01

    Compact groups provide an environment to study the growth of galaxies amid multiple prolonged interactions. With their dense galaxy concentrations and relatively low velocity dispersions, compact groups mimic the conditions of hierarchical galaxy assembly. Compact group galaxies are known to show a bimodality in Spitzer IRAC infrared color space: galaxies are preferentially either quiescent with low specific star formation rates (SSFRs) or prolifically forming stars—galaxies with moderate levels of specific star formation are rare. Previous Spitzer IRAC studies identifying this “canyon” have been limited by small number statistics. We utilize whole-sky Wide-field Infrared Survey Explorer (WISE) data to study 163 compact groups, thereby tripling our previous sample and including more galaxies with intermediate mid-IR colors indicative of moderate SSFRs. We define a distinct WISE mid-IR color space ≤ft({log}≤ft[\\tfrac{{f}12}{{f}4.6}\\right]\\right) versus ≤ft({log}≤ft[\\tfrac{{f}22}{{f}3.4}\\right]\\right) that we use to identify canyon galaxies from the larger sample. We confirm that compact group galaxies show a bimodal distribution in the mid-infrared and identify 37 canyon galaxies with reliable photometry and intermediate mid-IR colors. Morphologically, we find that the canyon harbors a large population of both Sa-Sbc and E/S0 type galaxies, and that they fall on the optical red sequence rather than the green valley. Finally, we provide a catalog of WISE photometry for 567 of 652 galaxies selected from the sample of 163 compact groups.

  9. Gap formation and phase transition of the anisotropic Kondo necklace model: Density matrix renormalization group analysis

    NASA Astrophysics Data System (ADS)

    Mendoza-Arenas, J. J.; Franco, R.; Silva-Valencia, J.

    2010-01-01

    We analyze the one-dimensional Kondo necklace model, at zero temperature, with an anisotropy parameter η in the interaction of the conduction chain, by means of the density matrix renormalization group. We calculate the energy gap and estimate the quantum critical points that separate a Kondo singlet state from an antiferromagnetic state, assuming a Kosterlitz-Thouless tendency. We also observe the correlation functions and the structure factors that support our critical points. The resulting phase diagram is presented and compared to that reported previously using Lanczos calculations. It is shown that the quantum critical points vary very slowly with η , but when η approaches zero, they drop abruptly.

  10. Life Before the Fall: Star Formation of Galaxies in Groups Prior to Cluster Assembly at z~0.37

    NASA Astrophysics Data System (ADS)

    Tran, Kim-Vy; Gonzalez, Anthony; Moustakas, John; Zaritsky, Dennis

    2005-06-01

    We propose to obtain a deep MIPS 24 micron map (18'x18') of a protocluster made of 4 distinct galaxy groups that are gravitationally bound to each other at z=0.37. The galaxy groups already have a total combined mass comparable to the Coma cluster, but they have at least 4 times as many emission line galaxies as Coma. The SG1120 complex thus provides an unprecedented opportunity for determining when and how star formation is quenched (or briefly enhanced) in the galaxies that will evolve into cluster members. MIPS is ideal for measuring the emission due to warm dust at mid-IR wavelengths. This sensitive tracer of integrated star formation enables us to identify weakly star-forming members (~1 solar mass/year) to very dusty, strongly star-forming ones, e.g. ultra-luminous infrared galaxies (ULIRGs) and the possible progenitors of post-starburst (E+A) members. Combining mid-IR with the deep, wide-field X-ray/optical/near-IR imaging and spectroscopy we already have in hand, we will trace how star formation varies as a function of environment and how quickly cluster galaxies build up their stellar masses.

  11. Chemically mediated group formation in soil-dwelling larvae and pupae of the beetle Trypoxylus dichotomus

    NASA Astrophysics Data System (ADS)

    Kojima, Wataru; Ishikawa, Yukio; Takanashi, Takuma

    2014-09-01

    Many insects form groups through interactions among individuals, and these are often mediated by chemical, acoustic, or visual cues and signals. In spite of the diversity of soil-dwelling insects, their aggregation behaviour has not been examined as extensively as that of aboveground species. We investigated the aggregation mechanisms of larvae of the Japanese rhinoceros beetle Trypoxylus dichotomus, which live in groups in humus soil. In two-choice laboratory tests, 2nd- and 3rd-instar larvae gathered at conspecific larvae irrespective of the kinship. The ablation of maxillae, which bear chemosensilla, abolished aggregation behaviour. Intact larvae also exhibited aggregation behaviour towards a larval homogenate. These results suggest that larval aggregation is mediated by chemical cues. We also demonstrated that the mature larvae of T. dichotomus built their pupal cells close to a mesh bag containing a conspecific pupal cell, which indicated that larvae utilize chemical cues emanating from these cells to select the pupation site. Thus, the larvae of T. dichotomus may use chemical cues from the conspecifics in two different contexts, i.e. larval aggregation and pupation site selection. Using conspecific cues, larvae may be able to choose suitable locations for foraging or building pupal cells. The results of the present study highlight the importance of chemical information in belowground ecology.

  12. Revision of the Western Australian pebble-mimic dragon species-group (Tympanocryptis cephalus: Reptilia: Agamidae).

    PubMed

    Doughty, Paul; Kealley, Luke; Shoo, Luke P; Melville, Jane

    2015-11-03

    Recent work on species complexes of the pebble-mimic dragons of the Australian genus Tympanocryptis has greatly clarified evolutionary relationships among taxa and also indicated that species diversity has been severely underestimated. Here we provide a morphological and molecular appraisal of variation in the T. cephalus species-group and find evidence for recognizing five species-level lineages from Western Australia. Four species-level lineages are strongly supported with a combined mitochondrial and nuclear DNA Bayesian analysis (a fifth population from the Gascoyne region lacked tissue samples). Morphologically, we found subtle, yet consistent, differences among the populations in scalation, color and pattern. True T. cephalus Günther is restricted to the coastal Pilbara region and characterized by five dark blotches on the dorsum, keeled ventrals, and other characters. Two other lineages within the Pilbara, from the Hamersley range and Fortescue/northern Pilbara region, differed from T. cephalus senso stricto by possessing a more elongate body and a plain dorsum. Furthermore, the Hamersley lineage differed from the Fortescue lineage by possessing slightly more reddish coloration and feeble keeling on the snout. Although there are few specimens and no tissue samples available for the Gascoyne population, these individuals are larger, have rugose scales on the snout, and possess scattered enlarged tubercles with three large blotches on the dorsum. The name T. cephalus gigas Mitchell is available for this population. The most widespread lineage, and the one best represented in collections and in field guides, occurs throughout central Western Australia. These Goldfield populations are characterized by a protruding snout, narrow rostral, and uniform reddish-brown coloration, often with a dark wash. Based on the genetic and morphological differences, we redescribe T. cephalus, resurrect and elevate T. gigas to a full species and designate a neotype for this taxon

  13. Intermolecular charge flux as the origin of infrared intensity enhancement upon halogen-bond formation of the peptide group.

    PubMed

    Torii, Hajime

    2010-07-21

    The changes in the vibrational properties of the peptide group upon formation of O...X and N...X halogen bonds are studied theoretically. Calculations are carried out for complexes of N-methylacetamide (NMA), a well known model molecule of the peptide group, with halogen-containing molecules. For comparison, calculations are also carried out for some NMA-water hydrogen-bonding complexes. It is shown that the infrared (IR) intensity of the amide I mode of the peptide group is enhanced significantly (up to about 520 km mol(-1) or 2.6 times) upon C=O...X halogen-bond formation, in spite of rather modest magnitudes of the intermolecular electric field and of the changes in the C=O bond length and in the amide I vibrational frequency as compared with the cases of the C=O...H(D) hydrogen bonding. From the analysis of the changes in the dipole derivative and in the electronic structure, it is shown that this IR intensity enhancement arises from the intermolecular charge flux. For the N...X halogen bonding complexes, some characteristic changes in the vibrational properties are seen, among which the IR intensity enhancement of the ND out-of-plane wagging mode is most notable. The reason why such large IR intensity enhancements are seen for these particular vibrational modes is examined.

  14. Sedimentological cross section of Cambro-Ordovician carbonate shelf (Knox group, Conassauga Formation) in central Alabama: facies, diagenesis, potential reservoirs

    SciTech Connect

    Sternbach, L.R.

    1984-04-01

    Cambro-Ordovician thrust-imbricated carbonates in central Alabama are the focus of renewed exploration interest. Samples from east-west-trending core holes within the surface-most thrust plates reconstruct the carbonate shelf and shelf-edge facies before deformation. The Upper Cambrian shelf margin now is in the subsurface of Talledega County; coeval dolostones in the western part of the state represent the former shelf interior. Rock analogs to former environments include the following. (1) Barrier shoals (Conasauga Formation) - dark colored, partially dolomitized ooid and skeletal grainstones. (2) Submerged back-barrier and offshelf dolomitized sediments (lower Knox Group) - western belt: finely crystalline algal thrombolites, fenestral dolopelmicrites, rippled beds; eastern belt: finely laminated dolostones, slope-derived pebbles and graded beds. (3) Tidal flats (upper Knox Group) - light-colored, crystalline dolostones, dolomitized pellet grainstones, algal laminites, pseudomorphs after sulfates and early diagenetic chertification. (4) Former emergent shelf -(Knox unconformity)-pelmicrite, skeletal wackestones, erosional chert pebble conglomerate. Multiple possibilities for hydrocarbon reservoirs appear throughout the sequence. Vuggy and intercrystalline dolostone porosity is primarily in the lower Knox formations. Primary interparticle pores are retained in lower Knox algal buildups. Breccia porosity occurs in the strata below the Knox unconformity through solution of the underlying Knox Group. Fractures in the subsurface are believed to enhance permeability in all porosity types.

  15. Sedimentological cross section of Cambro-Ordovician carbonate shelf (Knox group, Conasauga Formation) in central Alabama: facies, diagenesis, potential reservoirs

    SciTech Connect

    Sternbach, L.R.

    1984-04-01

    Cambro-Ordovician thrust-imbricated carbonates in central Alabama are the focus of renewed exploration interest. Samples from east-west-trending core holes within the surface-most thrust plates reconstruct the carbonate shelf and shelf-edge facies before deformation. The Upper Cambrian shelf margin now is in the subsurface of Talledega County; coeval dolostones in the western part of the state represent the former shelf interior. Rock analogs to former environments include the following. (1) Barrier shoals (Conasauga Formation) - dark colored, partially dolomitized ooid and skeletal grainstones. (2) Submerged back-barrier and offshelf dolomitized sediments (lower Knox Group) - western belt: finely crystalline algal thrombolites, fenestral dolopelmicrites, rippled beds; eastern belt: finely laminated dolostones, slope-derived pebbles and graded beds. (3) Tidal flats (upper Knox Group) - light-colored, crystalline dolostones, dolomitized pellet grainstones, algal laminites, pseudomorphs after sulfates and early diagenetic chertification. (4) Former emergent shelf -(Knox unconformity)-pelmicrite, skeletal wackestones, erosional chert pebble conglomerate. Multiple possibilities for hydrocarbon reservoirs appear throughout the sequence. Vuggy and intercrystalline dolostone porosity is primarily in the lower Knox formations. Primary interparticle pores are retained in lower Knox algal buildups. Breccia porosity occurs in the strata below the Knox unconformity through solution of the underlying Knox Group. Fractures in the subsurface are believed to enhance permeability in all porosity types.

  16. Lagoonal deposits in the Upper Cretaceous Rock Springs Formation (Mesaverde Group), southwest Wyoming

    USGS Publications Warehouse

    Kirschbaum, M.A.

    1989-01-01

    Most paleogeographic reconstructions of the Rock Springs Formation show shorelines having lobate to arcuate deltas. These shorelines are oriented NE-SW, with the sea to the southeast. Brackish-water bodies are usually shown in interdistributary areas or associated with abandoned delta lobes, and are open to the sea. In this study, a sedimentary sequence 30-50 m thick is interpreted as interdeltaic deposits. Brackish-water deposits within the sequence are interpreted as interdeltaic lagoons rather than interdistributary bays. Three facies associations (units) are recognized in nine measured sections of the study interval. Unit A consists of interbedded sandstone, mudrock and coal which occur in both fining- and coarsening-upward sequences less than 10 m thick. Fining-upward sequences decrease in thickness and frequency upwards in unit A and are interpreted as distributary channels. Coarsening-upward sequences associated with the channels are interpreted as crevasse splays that filled lakes or interdistributary bays. In the upper part of the unit where only minor channels are present, the coarsening-upward sequences are interpreted as bay deltas. Unit B consists of fossiliferous silty shale and bioturbated sandy siltstone. A low-diversity fauna of bivalves, gastropods, ostracods and foraminifers indicates that brackish-water conditions existed. Unit B intertongues with unit A to the northwest and with unit C to the southeast, and is interpreted as lagoonal deposits. Unit C consists of crossbedded and burrowed sandstone in beds 0.5-9 m thick. Sandstones are laterally continuous in the southeast but become tabular bodies enclosed within unit B to the northwest. Laterally continuous sandstones are interpreted as shoreface deposits on the basis of multidirectional crossbeds, marine trace fossils and continuity. Tabular sandstones are interpreted as flood-tidal deltas on the basis of NW-oriented crossbeds, pinchouts to the northwest and enclosure within unit B. Scoured

  17. ABO (histo) blood group phenotype development and human reproduction as they relate to ancestral IgM formation: A hypothesis.

    PubMed

    Arend, Peter

    2016-01-01

    The formation of a histo (blood) group) ABO phenotype and the exclusion of an autoreactive IgM or isoagglutinin activity arise apparently in identical glycosylation of complementary domains on cell surfaces and plasma proteins. The fundamental O-glycan emptiness of the circulating IgM, which during the neonatal amino acid sequencing of the variable regions is exerting germline-specific O-GalNAc glycan-reactive serine/threonine residues that in the plasma of the adult human blood group O individuals apparently remain associated with the open glycosidic sites on the ABOH convertible red cell surface, must raise suggestions on a transient expression of developmental glycans, which have been "lost" over the course of maturation. In fact, while the mammalian non-somatic, embryogenic stem cell (ESC)- germ cell (GC) transformation is characterized by a transient and genetically as-yet-undefined trans-species-functional O-GalNAc glycan expression, in the C57BL/10 mouse such expression was potentially identified in growth-dependent, blood group A-like GalNAc glycan-bearing, ovarian glycolipids complementary with the syngeneic anti-A reactive IgM, which does not appear in early ovariectomized animals. This non-somatically encoded, polyreactive, ancestral IgM molecule has not undergone clonal selection and does primarily not differentiate between self and non-self and might, due to amino acid hydroxyl groups, highly suggest substrate competition with subsequent O-glycosylations in ongoing ESC-GC transformations and affecting GC maturation. However, the membrane-bound somatic N/O-glycotransferases, which initiate, after formation of the zygote, the complex construction of the human ABO phenotypes in the trans cisternae of the Golgi apparatus, are associated and/or completed with soluble enzyme versions exerting identical specificities in plasma and likely competing vice versa by glycosylation of neonatal IgM amino acids, where they suggest to accomplish the clearance of anti

  18. Group additive values for the gas-phase standard enthalpy of formation, entropy and heat capacity of oxygenates.

    PubMed

    Paraskevas, Paschalis D; Sabbe, Maarten K; Reyniers, Marie-Françoise; Papayannakos, Nikos; Marin, Guy B

    2013-11-25

    A complete and consistent set of 60 Benson group additive values (GAVs) for oxygenate molecules and 97 GAVs for oxygenate radicals is provided, which allow to describe their standard enthalpies of formation, entropies and heat capacities. Approximately half of the GAVs for oxygenate molecules and the majority of the GAVs for oxygenate radicals have not been reported before. The values are derived from an extensive and accurate database of thermochemical data obtained by ab initio calculations at the CBS-QB3 level of theory for 202 molecules and 248 radicals. These compounds include saturated and unsaturated, α- and β-branched, mono- and bifunctional oxygenates. Internal rotations were accounted for by using one-dimensional hindered rotor corrections. The accuracy of the database was further improved by adding bond additive corrections to the CBS-QB3 standard enthalpies of formation. Furthermore, 14 corrections for non-nearest-neighbor interactions (NNI) were introduced for molecules and 12 for radicals. The validity of the constructed group additive model was established by comparing the predicted values with both ab initio calculated values and experimental data for oxygenates and oxygenate radicals. The group additive method predicts standard enthalpies of formation, entropies, and heat capacities with chemical accuracy, respectively, within 4 kJ mol(-1) and 4 J mol(-1) K(-1) for both ab initio calculated and experimental values. As an alternative, the hydrogen bond increment (HBI) method developed by Lay et al. (T. H. Lay, J. W. Bozzelli, A. M. Dean, E. R. Ritter, J. Phys. Chem.- 1995, 99, 14514) was used to introduce 77 new HBI structures and to calculate their thermodynamic parameters (Δ(f)H°, S°, C(p)°). The GAVs reported in this work can be reliably used for the prediction of thermochemical data for large oxygenate compounds, combining rapid prediction with wide-ranging application.

  19. Archean Age Fossils from Northwestern Australia (Approximately 3.3 to 3.5 GA, Warrawoona Group, Towers Formation)

    NASA Technical Reports Server (NTRS)

    Smith, Penny A. Morris

    1999-01-01

    Archean aged rocks from the Pilbara Block area of western Australia (Warrawoona Group, Towers Formation, -3.3-3.5 Ga) contain microfossils that are composed of various sizes of spheres and filaments. The first descriptions of these microfossils were published in the late 1970's (Dunlop, 1978; Dunlop, et. al., 1978). The authenticity of the microfossils is well established. The small size of the microfossils prevents isotope dating, at least with the present technology. Microbiologists, however, have established guidelines to determine the authenticity of the Archean aged organic remains (Schopf, Walter, 1992).

  20. A novel low-molecular-mass gelator with a redox active ferrocenyl group: tuning gel formation by oxidation.

    PubMed

    Liu, Jing; Yan, Junlin; Yuan, Xuanwei; Liu, Kaiqiang; Peng, Junxia; Fang, Yu

    2008-02-15

    A novel low-molecular-mass gelator containing a redox-active ferrocenyl group, cholesteryl glycinate ferrocenoylamide (CGF), was intentionally designed and prepared. It was demonstrated that the gelator gels 13 out of the 45 solvents tested. Scanning electron microscopy (SEM) measurements revealed that the gelator self-assembled into different supramolecular network structures in different gels. Chemical oxidation of the ferrocenyl residue resulted in phase transition of the gel from gel state to solution state. FTIR and (1)H NMR spectroscopy studies revealed that hydrogen bonding between the gelator molecules in the gel was one of the main driving forces for the formation of the gels.

  1. [Prognostic assessment for formation of a group of cardiovascular high risk among personnel participating in atomic submarines utilization].

    PubMed

    Sosiukin, A E; Vasiliuk, V B; Ivanchenko, A V; Saenko, S A; Semenchuk, O A; Dokhov, M A; Verveda, A B

    2014-01-01

    Ultrasound scanning of main vessels (common carotid, internal carotid, common and superficial femoral, posterior tibial arteries) in staffers of shipyard "Nerpa"--branch of JSC "Shipbuilding center Zvezdochka" (Snezhnogorsk city Murmansk region)--engaged into atomic submarines utilization. Findings are atherosclerotic changes in common carotid and common femoral arteries--increased thickness of intima-media complex over the reference values or atherosclerotic plaque formation. The changes were maximal in a group of males aged over 50 with length of service over 25 years. Discriminant analysis helped to suggest a mathematic model to forecast cardiovascular diseases in personnel of "Nerpa" shipyard.

  2. The first Pan-Podocnemididae turtle egg from the Presidente Prudente Formation (Late Cretaceous, Bauru Group), Brazil.

    PubMed

    Marsola, Júlio C De A; Grellet-Tinner, Gerald; Montefeltro, Felipe C; Langer, Max C

    2014-10-08

    Pan-Podocnemididae turtles are ubiquitous in Late Cretaceous rocks of the Bauru Group in southeastern Brazil. This group of side-necked turtles is particularly abundant in a turtle-bearing site of the Presidente Prudente Formation known as Tartaruguito. Here, we describe the first turtle egg (LPRP-USP 0052) from the Tartaruguito site. LPRP-USP 0052 is nearly complete but misses a pole and measures 5,1 and 2,9-2,2 centimeters due to its flattened minor axis. The egg morphology and microstructure were analyzed by observations performed with CT, Optic Microscopy, Scanning Electronic Microscopy and Wave Dispersion Energy analyses. The eggshell ranges from 145 to160 micrometers thick. Considering the matching morphology of the new specimen and its provenance from the stratigraphic horizon that yielded only the podocnemidids Bauruemys and Roxochelys, it is most likely that LPRP-USP 0052 was produced by a podocnemidid turtle. 

  3. Personality, Parasites, Political Attitudes, and Cooperation: A Model of How Infection Prevalence Influences Openness and Social Group Formation.

    PubMed

    Brown, Gordon D A; Fincher, Corey L; Walasek, Lukasz

    2016-01-01

    What is the origin of individual differences in ideology and personality? According to the parasite stress hypothesis, the structure of a society and the values of individuals within it are both influenced by the prevalence of infectious disease within the society's geographical region. High levels of infection threat are associated with more ethnocentric and collectivist social structures and greater adherence to social norms, as well as with socially conservative political ideology and less open but more conscientious personalities. Here we use an agent-based model to explore a specific opportunities-parasites trade-off (OPTO) hypothesis, according to which utility-maximizing agents place themselves at an optimal point on a trade-off between (a) the gains that may be achieved through accessing the resources of geographically or socially distant out-group members through openness to out-group interaction, and (b) the losses arising due to consequently increased risks of exotic infection to which immunity has not been developed. We examine the evolution of cooperation and the formation of social groups within social networks, and we show that the groups that spontaneously form exhibit greater local rather than global cooperative networks when levels of infection are high. It is suggested that the OPTO model offers a first step toward understanding the specific mechanisms through which environmental conditions may influence cognition, ideology, personality, and social organization.

  4. The star formation histories of local group dwarf galaxies. I. Hubble space telescope/wide field planetary camera 2 observations

    SciTech Connect

    Weisz, Daniel R.; Dolphin, Andrew E.; Skillman, Evan D.; Holtzman, Jon; Gilbert, Karoline M.; Dalcanton, Julianne J.; Williams, Benjamin F.

    2014-07-10

    We present uniformly measured star formation histories (SFHs) of 40 Local Group (LG) dwarf galaxies based on color-magnitude diagram (CMD) analysis from archival Hubble Space Telescope imaging. We demonstrate that accurate SFHs can be recovered from CMDs that do not reach the oldest main sequence turn-off (MSTO), but emphasize that the oldest MSTO is critical for precisely constraining the earliest epochs of star formation. We find that: (1) the average lifetime SFHs of dwarf spheroidals (dSphs) can be approximated by an exponentially declining SFH with τ ∼ 5 Gyr; (2) lower luminosity dSphs are less likely to have extended SFHs than more luminous dSphs; (3) the average SFHs of dwarf irregulars (dIrrs), transition dwarfs, and dwarf ellipticals can be approximated by the combination of an exponentially declining SFH (τ ∼ 3-4 Gyr) for lookback ages >10-12 Gyr ago and a constant SFH thereafter; (4) the observed fraction of stellar mass formed prior to z = 2 ranges considerably (80% for galaxies with M < 10{sup 5} M{sub ☉} to 30% for galaxies with M > 10{sup 7} M{sub ☉}) and is largely explained by environment; (5) the distinction between 'ultra-faint' and 'classical' dSphs is arbitrary; (6) LG dIrrs formed a significantly higher fraction of stellar mass prior to z = 2 than the Sloan Digital Sky Survey galaxies from Leitner and the SFHs from the abundance matching models of Behroozi et al. This may indicate higher than expected star formation efficiencies at early times in low mass galaxies. Finally, we provide all the SFHs in tabulated electronic format for use by the community.

  5. Siderophile element systematics of IAB complex iron meteorites: New insights into the formation of an enigmatic group

    NASA Astrophysics Data System (ADS)

    Worsham, Emily A.; Bermingham, Katherine R.; Walker, Richard J.

    2016-09-01

    Siderophile trace element abundances and the 187Re-187Os isotopic systematics of the metal phases of 58 IAB complex iron meteorites were determined in order to investigate formation processes and how meteorites within chemical subgroups may be related. Close adherence of 187Re-187Os isotopic data of most IAB iron meteorites to a primordial isochron indicates that the siderophile elements of most members of the complex remained closed to elemental disturbance soon after formation. Minor, presumably late-stage open-system behavior, however, is observed in some members of the sLM, sLH, sHL, and sHH subgroups. The new siderophile element abundance data are consistent with the findings of prior studies suggesting that the IAB subgroups cannot be related to one another by any known crystallization process. Equilibrium crystallization, coupled with crystal segregation, solid-liquid mixing, and subsequent fractional crystallization can account for the siderophile element variations among meteorites within the IAB main group (MG). The data for the sLM subgroup are consistent with equilibrium crystallization, combined with crystal segregation and mixing. By contrast, the limited fractionation of siderophile elements within the sLL subgroup is consistent with metal extraction from a chondritic source with little subsequent processing. The limited data for the other subgroups were insufficient to draw robust conclusions about crystallization processes involved in their formation. Collectively, multiple formational processes are represented in the IAB complex, and modeling results suggest that fractional crystallization within the MG may have been a more significant process than has been previously recognized.

  6. Geologic and hydrogeologic characteristics of the Ogallala Formation and White River Group, Belvoir Ranch near Cheyenne, Laramie County, Wyoming

    USGS Publications Warehouse

    Bartos, Timothy T.; Diehl, Sharon F.; Hallberg, Laura L.; Webster, Daniel M.

    2014-01-01

    The geologic and hydrogeologic characteristics of Tertiary lithostratigraphic units (Ogallala Formation and White River Group) that typically compose or underlie the High Plains aquifer system in southeastern Wyoming were described physically and chemically, and evaluated at a location on the Belvoir Ranch in Laramie County, Wyoming. On the basis of this characterization and evaluation, three Tertiary lithostratigraphic units were identified using physical and chemical characteristics determined during this study and previous studies, and these three units were determined to be correlative with three identified hydrogeologic units composing the groundwater system at the study site—a high-yielding aquifer composed of the entire saturated thickness of the heterogeneous and coarse-grained fluvial sediments assigned to the Ogallala Formation (Ogallala aquifer); an underlying confining unit composed primarily of very fine-grained volcaniclastic sediments and mudrocks assigned to the Brule Formation of the White River Group and some additional underlying sediments that belong to either the Brule or Chadron Formation, or both (Brule confining unit); and an underlying low-yielding aquifer composed primarily of poorly sorted fluvial sediments assigned to the Chadron Formation of the White River Group (Chadron aquifer). Despite widely varying sediment heterogeneity and consolidation, some limited hydraulic connection throughout the full vertical extent of the Ogallala aquifer was indicated but not conclusively proven by interpretation of similar chemical and isotopic characteristics, modern apparent groundwater ages, and similar hydraulic-head responses measured continuously in two Ogallala aquifer monitoring wells installed for this study at two different widely separated (83 feet) depth intervals. Additional work beyond the scope of this study, such as aquifer tests, would be required to conclusively determine hydraulic connection within the Ogallala aquifer. Groundwater

  7. Delivering a very brief psychoeducational program to cancer patients and family members in a large group format.

    PubMed

    Cunningham, A J; Edmonds, C V; Williams, D

    1999-01-01

    It is well established that brief psychoeducational programs for cancer patients will significantly improve mean quality of life. As this kind of adjunctive treatment becomes integrated into general cancer management, it will be necessary to devise cost-effective and efficacious programs that can be offered to relatively large numbers of patients. We have developed a very brief 4-session program that provides this service to 40-80 patients and family members per month (and seems capable of serving much larger numbers, depending on the capacity of the facility in which they assemble). Patients meet in a hospital auditorium for a large group, lecture-style program that offers training in basic coping skills: stress management, relaxation training, thought monitoring and changing, mental imagery and goal setting. Over the first year we have treated 363 patients and 150 family members. Improvements were assessed by changes in the POMS-Short Form, and both patients and family members were found to improve significantly over the course of the program. While this is not a randomized comparison, it suggests that the benefits gained from a large group in a classroom are not substantially less than the improvements that have been documented in the usual small group format, where more interactive discussions are possible.

  8. A new squamate lizard from the Upper Cretaceous Adamantina Formation (Bauru Group), São Paulo State, Brazil.

    PubMed

    Nava, William R; Martinelli, Agustín G

    2011-03-01

    The record of non-mosasaur squamates (Reptilia, Squamata) is sparse in the Cretaceus fossil record of Brazil and include six putative reports, three from the Aptian-Albian of the Araripe Basin (Tijubina pontei Bonfim-Júnior and Marques, Olindalacerta brasiliensis Evans and Yabumoto, and a lizard indet.) and three from the Upper Cretaceous of the Bauru Group (Pristiguana brasiliensis Estes and Price, Anilioidae gen. et sp. indet., and Squamata gen. et sp. indet.). In this contribution, a new genus and species of lizard, Brasiliguana prudentis gen. et sp. nov., is described based on an isolated left maxilla with teeth. The material was discovered in an outcrop of the Upper Cretaceous Adamantina Formation (Bauru Group) located in the proximity of Presidente Prudente Municipality, São Paulo State, Brazil. The new taxon is considered a basal non-Priscagamidae+Acrodonta iguanian based on the presence of a weakly inclined anterior margin of the maxillary nasal process and maxillary tooth shape and tooth implantation similar to that of iguanians rather than of other lizard groups (e.g. teiids). This finding significantly increases the squamate lizard diversity of South America, which is still poorly understood and sparsely represented in the fossil record.

  9. Origin of iron oxide spherules in the banded iron formation of the Bababudan Group, Dharwar Craton, Southern India

    NASA Astrophysics Data System (ADS)

    Orberger, Beate; Wagner, Christiane; Wirth, Richard; Quirico, Eric; Gallien, Jean Paul; Derré, Colette; Montagnac, Gilles; Noret, Aurélie; Jayananda, Mudlappa; Massault, Marc; Rouchon, Virgile

    2012-06-01

    The banded iron formation of the Bababudan Group (Western Dharwar Craton, India) is composed of millimetric to centimetric alternating quartz and grey to red Fe-oxide bands. Major phases are quartz and martite (hematized magnetite) with minor Fe-sulfides and Ca-Mg-Fe-carbonates. Micrometric Fe-oxide spherules fill cavities in discontinuous micrometric layers of Fe-oxides that occur in the massive quartz layers and at the interface of massive Fe-oxide and quartz layers. The spherules are composed of micrometric radial plates of hematite intergrown with nanometric magnetite. These spherules contain carbonaceous matter (CM) with nanometric Fe-particles and have low N contents (˜900 ppm; CM1). The spherule formation is attributed to a low temperature hydrothermal process (150-200 °C) at around 2.52 Ga, possibly favored by the presence of CM. These hydrothermal fluids dissolved diagenetic interstitial sulfides or carbonates creating cavities which, provided space for the spherule precipitation. Carbonaceous matter of semi-anthracite maturity is encapsulated in quartz grains adjacent to the Fe-oxide spherules (CM2) and it is thus concluded that CM1 and CM2 are most likely contemporaneous and of the same origin, either incorporated at the time of BIF formation or during the hydrothermal event at 2.52 Ga from the underlying phyllitised black shales. Carbonaceous matter (CM3) was also found around the Fe-oxide spherules and the martite grains. CM3 has much higher N contents (>5000 ppm), is of a lower maturity than CM1 and CM2, and is related to weathering, which is also indicated by the presence of goethite and kaolinite. The δ13C of all CMs varies from -19.4 to -24.7‰, similar to values measured in the underlying phyllitised black shales and likely reflect denitrifying microbial activity.

  10. Group IVA phospholipase A2-associated production of MMP-9 in macrophages and formation of atherosclerotic lesions.

    PubMed

    Ii, Hiromi; Hontani, Naoya; Toshida, Issei; Oka, Mayuko; Sato, Takashi; Akiba, Satoshi

    2008-03-01

    Matrix metalloproteinase-9 (MMP-9) is involved in atherogenesis, and the production of MMP-9 in macrophages is considered to be mediated by the arachidonic acid cascade. The present study examined the possible involvement of group IVA phospholipase A2 (IVA-PLA2), a key enzyme in the arachidonic acid cascade, in the production of MMP-9 induced by oxidized low-density lipoprotein (oxLDL) in macrophages and high-fat diet-induced formation of atherosclerotic lesions using IVA-PLA2-deficient mice (C57BL/6 background). In wild-type mouse peritoneal macrophages, oxLDL induced an increase in MMP-9 in the culture medium. The oxLDL-promoted production of MMP-9 was markedly reduced in IVA-PLA2-deficient macrophages compared to wild-type macrophages. Feeding of wild-type mice with a high-fat diet caused the formation of early atherosclerotic lesions in the aortic root with increases in MMP-9 and macrophages in the lesions and with higher serum levels of total cholesterol. Such lesions were apparently less severe in IVA-PLA2-deficient mice fed a high-fat diet, despite higher total cholesterol levels. Under the conditions, a high-fat diet reduced the serum levels of high-density lipoprotein-cholesterol (HDL-C) in wild-type mice. However, IVA-PLA2-deficient mice fed a high-fat diet were protected against the decrease in HDL-C levels. The present results suggest that IVA-PLA2 is involved in the oxLDL-induced production of MMP-9 in macrophages and the high-fat diet-induced formation of early atherosclerotic lesions. The protection against the lesions in IVA-PLA2-deficient mice may be ascribable, in part, to the impaired production of MMP-9 and/or the maintained levels of HDL-C.

  11. Low Temperature Magnetic Properties of the Late Archean Boolgeeda Iron Formation (Hamersley Group, Western Australia): Environmental Implications

    NASA Astrophysics Data System (ADS)

    Carlut, Julie; Isambert, Aude; Bouquerel, Hélène; Pecoits, Ernesto; Philippot, Pascal; Vennin, Emmanuelle; Ader, Magali; Thomazo, Christophe; Buoncristiani, Jean-François; Baton, Franck; Muller, Elodie; Deldicque, Damien

    2015-05-01

    The origin of the iron oxides in Archean and Paleoproterozoic Banded Iron Formations is still a debated question. We report low and high temperature magnetic properties, susceptibility and saturation magnetization results joined with scanning microscope observations within a 35 meters section of the Late Archean Boolgeeda Iron Formation of the Hamersley Group, Western Australia. With the exception of two volcanoclastic intervals characterized by low susceptibility and magnetization, nearly pure magnetite is identified as the main magnetic carrier in all iron-rich layers including hematite-rich jasper beds. Two populations of magnetically distinct magnetites are reported from a 2 meter-thick interval within the section. Each population shows a specific Verwey transition temperature: one around 120-124 K and the other in the range of 105-110 K. This temperature difference is interpreted to reflect two distinct stoichiometry and likely two episodes of crystallization. The 120-124K transition is attributed to nearly pure stoichiometric magnetite, SEM and microprobe observations suggest that the lower temperature transition is related to chemically impure silician magnetite. Microbial-induced partial substitution of iron by silicon is suggested here. This is supported by an increase in Total Organic Carbon (TOC) in the same interval.

  12. Selected data for wells and test holes used in structure-contour maps of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation in the Black Hills area, South Dakota

    USGS Publications Warehouse

    Carter, J.M.

    1999-01-01

    This report presents selected data on wells and test holes that were used in the construction of structure-contour maps of selected formations that contain major aquifers in the Black Hills area of western South Dakota. Altitudes of the top of the Inyan Kara Group, Minnekahta Limestone, Minnelusa Formation, Madison Limestone, and Deadwood Formation are presented for the wells and test holes presented in this report.

  13. Social conflict and the formation of emergent groups in a technological disaster: The Exxon Valdez oil spill and the response of residents in the area of Homer, Alaska

    SciTech Connect

    Button, G.V.

    1993-01-01

    To date there has been a paucity of research on the formation of emergent groups in the wake of technological disasters. A majority of researchers have contended that whereas natural disasters engender social cohesion and stimulate the formation of emergent groups, technological disasters have the tendency to constrain such formation because of the social conflict which follows in the wake of a technological disaster. This thesis challenges that assumption and examines both the nature of the social conflict and the formation of emergent groups that occurred in the aftermath of this country's largest environmental disaster: the Exxon Valdez oil spill. An anthropological perspective is employed. The investigator examines the formation of such groups in the area of Homer, Alaska. The differential response to the disaster and the ensuing social conflict is examined by a combination of participant-observation methods, formal and informal, in-depth interviews, and archival records. This investigation reveals that although there was considerable social conflict, there was also sufficient social cohesion to promote the formation of emergent group responses to the oil spill and the cleanup that followed. Moreover, it finds that the resultant conflict and the formation of such groups was attributable in part to a widely reported sense of a loss of control' and considerable uncertainty about many of the facts' surrounding the spill. This included uncertainty about who was ultimately in control of the cleanup and which clean-up technologies and remediation efforts were most urgent and useful. This thesis concludes that, contrary to the expectations of most social scientists, emergent groups can form in the wake of a technological disaster. Moreover, given the sense of urgency and the common perception of disaster victims that authorities are both unable and unwilling to respond to disasters, the formation of such groups is inevitable.

  14. Strong far-infrared cooling lines, peculiar CO kinematics, and possible star-formation suppression in Hickson compact group 57

    SciTech Connect

    Alatalo, K.; Appleton, P. N.; Ogle, P. M.; Rich, J. A.; Xu, C. K.; Lisenfeld, U.; Bitsakis, T.; Guillard, P.; Charmandaris, V.; Cluver, M.; Jarrett, T.; Dopita, M. A.; Kewley, L. J.; Freeland, E.; Rasmussen, J.; Verdes-Montenegro, L.

    2014-11-10

    We present [C II] and [O I] observations from Herschel and CO(1-0) maps from the Combined Array for Research in Millimeter Astronomy (CARMA) of the Hickson compact group HCG 57, focusing on the galaxies HCG 57a and HCG 57d. HCG 57a has been previously shown to contain enhanced quantities of warm molecular hydrogen consistent with shock or turbulent heating. Our observations show that HCG 57d has strong [C II] emission compared to L {sub FIR} and weak CO(1-0), while in HCG 57a, both the [C II] and CO(1-0) are strong. HCG 57a lies at the upper end of the normal distribution of the [C II]/CO and [C II]/FIR ratios, and its far-infrared (FIR) cooling supports a low-density, warm, diffuse gas that falls close to the boundary of acceptable models of a photon-dominated region. However, the power radiated in the [C II] and warm H{sub 2} emissions have similar magnitudes, as seen in other shock-dominated systems and predicted by recent models. We suggest that shock heating of the [C II] is a viable alternative to photoelectric heating in violently disturbed, diffuse gas. The existence of shocks is also consistent with the peculiar CO kinematics in the galaxy, indicating that highly noncircular motions are present. These kinematically disturbed CO regions also show evidence of suppressed star formation, falling a factor of 10-30 below normal galaxies on the Kennicutt-Schmidt relation. We suggest that the peculiar properties of both galaxies are consistent with a highly dissipative, off-center collisional encounter between HCG 57d and 57a, creating ring-like morphologies in both systems. Highly dissipative gas-on-gas collisions may be more common in dense groups because of the likelihood of repeated multiple encounters. The possibility of shock-induced star-formation suppression may explain why a subset of these HCG galaxies has been found previously to fall in the mid-infrared green valley.

  15. Outcome differences between individual and group formats when identical and nonidentical treatments, patients, and doses are compared: A 25-year meta-analytic perspective.

    PubMed

    Burlingame, Gary M; Seebeck, Jyssica D; Janis, Rebecca A; Whitcomb, Kaitlyn E; Barkowski, Sarah; Rosendahl, Jenny; Strauss, Bernhard

    2016-12-01

    There are mixed findings regarding the differential efficacy of the group and individual format. One explanation of these mixed findings is that nearly all-recent meta-analyses use between-study effect sizes to test format equivalence introducing uncontrolled differences in patients, treatments, and outcome measures. Only 3 meta-analyses were located from the past 20 years that directly tested format differences in the same study using within-study effect sizes; mixed findings were reported with a primary limitation being the small number of studies. However, we located 67 studies that compared both formats in the same study. Format equivalence (g = -0.01) with low effect size heterogeneity (variability) was found in 46 studies that compared identical treatments, patients, and doses on primary outcome measures. Format equivalence (g = -0.06) with moderate effect size heterogeneity was found for 21 studies that compared nonidentical treatments; however, allegiance to a specific format moderated differences in effect sizes. There were no differences between formats for rates of treatment acceptance, dropout, remission, and improvement. Additionally, there were no differences in outcome between formats by patient diagnosis; however, differences in pre-to-post improvement were explained by diagnosis with depression, anxiety, and substance disorder posting the highest outcomes and medical and childhood disorders the lowest. Findings are discussed with reference to the practical challenges of implementing groups in clinical practice from an agency, clinician, and reimbursement perspective. (PsycINFO Database Record

  16. Heat evolution of micelle formation, dependence of enthalpy, and heat capacity on the surfactant chain length and head group.

    PubMed

    Opatowski, Ella; Kozlov, Michael M; Pinchuk, Ilya; Lichtenberg, Dov

    2002-02-15

    Micelle formation by many surfactants is endothermic at low temperatures but exothermic at high temperatures. In this respect, dissociation of micelles (demicellization) is similar to dissolving hydrocarbons in water. However, a remarkable difference between the two processes is that dissolving hydrocarbons is isocaloric at about 25 degrees C, almost independently of the hydrocarbon chain length, whereas the temperature (T*) at which demicellization of different surfactants is athermal varies over a relatively large range. We have investigated the temperature dependence of the heat of demicellization of three alkylglucosides with hydrocarbon chains of 7, 8, and 9 carbon atoms. At about 25 degrees C, the heat of demicellization of the three studied alkylglucosides varied within a relatively small range (DeltaH=-7.8+/-0.4 kJ/mol). The temperature dependence of DeltaH(demic) indicates that within the studied temperature range the heat capacity of demicellization (DeltaC(P,demic)) is about constant. The value of DeltaC(P,demic) exhibited an apparently linear dependence on the surfactant's chain length (DeltaC(P,demic)/n(CH(2))=47+/-7 kJ/mol K). Our interpretation of these results is that (i) the transfer of the head groups from micelles to water is exothermic and (ii) the temperature dependence of the heat associated with water-hydrocarbon interactions is only slightly affected by the head group. This implies that the deviation of the value of T* from 25 degrees C results from the contribution of the polar head to the overall heat of demicellization. Calorimetric studies of other series of amphiphiles will have to be conducted to test whether the latter conclusion is general.

  17. An improved lossless group compression algorithm for seismic data in SEG-Y and MiniSEED file formats

    NASA Astrophysics Data System (ADS)

    Li, Huailiang; Tuo, Xianguo; Shen, Tong; Henderson, Mark Julian; Courtois, Jérémie; Yan, Minhao

    2017-03-01

    An improved lossless group compression algorithm is proposed for decreasing the size of SEG-Y files to relieve the enormous burden associated with the transmission and storage of large amounts of seismic exploration data. Because each data point is represented by 4 bytes in SEG-Y files, the file is broken down into 4 subgroups, and the Gini coefficient is employed to analyze the distribution of the overall data and each of the 4 data subgroups within the range [0,255]. The results show that each subgroup comprises characteristic frequency distributions suited to distinct compression algorithms. Therefore, the data of each subgroup was compressed using its best suited algorithm. After comparing the compression ratios obtained for each data subgroup using different algorithms, the Lempel-Ziv-Markov chain algorithm (LZMA) was selected for the compression of the first two subgroups and the Deflate algorithm for the latter two subgroups. The compression ratios and decompression times obtained with the improved algorithm were compared with those obtained with commonly employed compression algorithms for SEG-Y files with different sizes. The experimental results show that the improved algorithm provides a compression ratio of 75-80%, which is more effective than compression algorithms presently applied to SEG-Y files. In addition, the proposed algorithm is applied to the miniSEED format used in natural earthquake monitoring, and the results compared with those obtained using the Steim2 compression algorithm, the results again show that the proposed algorithm provides better data compression.

  18. Toxin Profile, Biofilm Formation, and Molecular Characterization of Emetic Toxin-Producing Bacillus cereus Group Isolates from Human Stools.

    PubMed

    Oh, Su Kyung; Chang, Hyun-Joo; Choi, Sung-Wook; Ok, Gyeongsik; Lee, Nari

    2015-11-01

    Emetic toxin-producing Bacillus cereus group species are an important problem, because the staple food for Korean is grains such as rice. In this study, we determined the prevalence (24 of 129 isolates) of emetic B. cereus in 36,745 stool samples from sporadic food-poisoning cases in Korea between 2007 and 2008. The toxin gene profile, toxin production, and biofilm-forming ability of the emetic B. cereus isolates were investigated. Repetitive element sequence polymorphism polymerase chain reaction fingerprints (rep-PCR) were also used to assess the intraspecific biodiversity of these isolates. Emetic B. cereus was present in 0.07% of the sporadic food-poisoning cases. The 24 emetic isolates identified all carried the nheABC and entFM genes and produced NHE enterotoxin. However, they did not have hemolysin BL toxin or related genes. A relationship between biofilm formation and toxin production was not observed in this study. The rep-PCR fingerprints of the B. cereus isolates were not influenced by the presence of toxin genes, or biofilm-forming ability. The rep-PCR assay discriminated emetic B. cereus isolates from nonemetic isolates, even if this assay did not perfectly discriminate these isolates. Further study on emetic isolates possessing a high degree of diversity may be necessary to evaluate the performance of the subtyping assay to discriminate emetic and nonemetic B. cereus isolates and could provide a more accurate indication of the risk from B. cereus strains.

  19. Explosive Lava-Water Interactions in Elysium Planitia, Mars: Constraints on the Formation of the Tartarus Colles Cone Groups

    NASA Astrophysics Data System (ADS)

    Hamilton, C. W.; Fagents, S. A.; Wilson, L.

    2009-12-01

    Volcanic rootless cones (VRCs) are typically generated by explosive molten fuel-coolant interactions (MFCIs) involving lava and groundwater. VRCs are significant in planetary environments because they imply the presence of active lava flows and an underlying volatile phase (e.g., groundwater or ice) at the time of cone formation. Rootless MFCIs require volatilization of groundwater before the core lava temperature descends below its solidus. Therefore, integrated geological mapping of VRC groups, age-dating of their host lava flow surfaces, and thermodynamic modeling of lava-permafrost interactions can provide constraints on where and when near-surface ground ice has been present in volcanic regions. This information is valuable for developing models of global climate change on Mars and for determining the relationships between climate and planetary volatile accretion, outgassing history, distribution of water and evolution of the hydrological cycle, abundance and stability of liquid water, surface weathering environments, and the development of environments that could support life. Photogeological mapping reveals that the Tartarus Colles Region, located in eastern Elysium Planitia (25-27°N, 170-171°E), Mars, includes >167 VRC groups ranging in area from <1 to 1258 km2 with a total area of 2014 km2. Crater size-frequency relationships suggest that the Tartarus Colles lava flow formed ~75-250 Ma ago. Within the Tartarus Colles Region, VRCs preferentially form where lava is >30 m thick. Based on the results of our thermodynamic modeling, we infer that VRCs did not form where the lava was <30 m thick because the upper 16-21 m of the substrate was partially desiccated. The common occurrence of VRCs in association with 30-60 m thick lava suggests that at the time of the cone-forming eruptions there was an ice table at <37 m depth. We therefore conclude that during the Late to Middle Amazonian a global cryosphere was present at mid-latitudes at a depth <37 m, but that

  20. Appendix: Final Update of the IAU Division A Commission 4 Working Group on Standardizing Access to Ephemerides and File Format Specification

    NASA Astrophysics Data System (ADS)

    Hilton, James L.; Acton, Charles; Arlot, Jean-Eudes; Bell, Steven A.; Capitaine, Nicole; Fienga, Agnès; Folkner, William M.; Gastineau, Mickaël; Pavlov, Dmitry; Pitjeva, Elena V.; Skripnichenko, Vladimir I.; Wallace, Patrick

    2016-04-01

    The IAU Commission 4 Working Group on Standardizing Access to Ephemerides recommends the use of the Spacecraft and Planet Kernel (SPK) format to provide a uniform format for the position ephemerides of planets and other natural solar system bodies, and the use of the Planetary Constants Kernel (PCK) for the orientation of these bodies. These formats are used by the SPICE system, developed by the Navigation and Ancillary Information Facility of NASA's Jet Propulsion Laboratory. The working group's final report is currently undergoing final preparations for publication. A long version of this report will be available at the IAU Commission 4: Ephemerides (or its successor) web site. This long version will contain a full description of that portion of the SPK and PCK formats required to duplicate these file types for this application.

  1. Doubts about the crucial role of the rising-tube mechanism in the formation of sunspot groups

    NASA Astrophysics Data System (ADS)

    Getling, A. V.; Ishikawa, R.; Buchnev, A. A.

    2015-02-01

    Some preliminary processing results are presented for a dataset obtained with the Solar Optical Telescope on the Hinode satellite. The idea of the project is to record, nearly simultaneously, the full velocity and magnetic-field vectors in growing active regions and sunspot groups at a photospheric level. Our ultimate aim is to elaborate observational criteria to distinguish between the manifestations of two mechanisms of sunspot-group formation - the rising of an Ω -shaped flux tube of a strong magnetic field and the in situ amplification and structuring of magnetic field by convection (the convective mechanism is briefly described). Observations of a young bipolar subregion developing within AR 11313 were carried out on 9-10 October 2011. During each 2-h observational session, 5576-Å filtergrams and Dopplergrams were obtained at a time cadence of 2 min, and one or two 32-min-long spectropolarimetric fast-mode scans were done. Based on the series of filtergrams, the trajectories of corks are computed, using a technique similar to but more reliable than local correlation tracking (LCT), and compared with the magnetic maps. At this stage of the investigation, only the vertical magnetic field and the horizontal flows are used for a qualitative analysis. According to our preliminary findings, the velocity pattern in the growing active region has nothing to do with a spreading flow on the scale of the entire bipolar region, which could be expected if a tube of strong magnetic field emerged. No violent spreading flows on the scale of the entire growing magnetic region can be identified. Instead, normal mesogranular and supergranular flows are preserved. Signs of small-scale structuring of the magnetic field can be detected in the area where new spots develop, and signs of the presence of separatrices between the magnetic polarities can be found, such that the surface flows converge to but not diverge from these separatrix curves. The observed scenario of evolution

  2. Few-cycle laser-pulse collapse in Kerr media: The role of group-velocity dispersion and X -wave formation

    NASA Astrophysics Data System (ADS)

    Faccio, Daniele; Clerici, Matteo; Averchi, Alessandro; Lotti, Antonio; Jedrkiewicz, Ottavia; Dubietis, Audrius; Tamosauskas, Gintaras; Couairon, Arnaud; Bragheri, Francesca; Papazoglou, Dimitris; Tzortzakis, Stelios; di Trapani, Paolo

    2008-09-01

    We study ultrashort laser-pulse propagation and filamentation dynamics in dispersive Kerr media. We identify the regime for which the filamentation threshold (Pth) is considerably higher than the critical power (Pcr) for monochromatic beam collapse in pure Kerr media. In particular, we compare the threshold for the formation of filaments with that for the formation of X -waves. At powers Pcrgroup-velocity dispersion, and no filaments or X -waves are formed. At P⩾Pth , we observe X -wave formation and a weak filamentation regime. At P≫Pth , we observe both X -waves and fully formed filaments.

  3. Correlation, sedimentology, structural setting, chemical composition, and provenance of selected formations in Mesoproterozoic Lemhi Group, central Idaho

    USGS Publications Warehouse

    Tysdal, Russell G.; Lindsey, David A.; Taggart, Joseph E.

    2003-01-01

    A unit of the Mesoproterozoic Apple Creek Formation of the Lemhi Range previously was correlated with part of the lower subunit of the Mesoproterozoic Yellowjacket Formation in the Salmon River Mountains. Strata currently assigned to the middle subunit of the Yellowjacket Formation lie conformably above the Apple Creek unit in the Salmon River Mountains, and are here renamed the banded siltite unit and reassigned to the Apple Creek Formation. Almost all of the banded siltite unit is preserved within the Salmon River Mountains, where it grades upward into clastic rocks that currently are assigned to the upper subunit of the Yellowjacket Formation and that here are reassigned to the Gunsight Formation. The banded siltite unit of the Apple Creek Formation is composed of a turbidite sequence, as recognized by previous workers. Uppermost strata of the unit were reworked by currents, possibly storm generated, and adjusted to a high water content by developing abundant soft-sediment deformation features. Basal strata of the overlying Gunsight Formation in the Salmon River Mountains display abundant hummocky crossbeds, storm-generated features deposited below fair-weather wave base, that are conformable above the storm-reworked deposits. The hummocky crossbedded strata grade upward into marine shoreface strata deposited above fair-weather wave base, which in turn are succeeded by fluvial strata. Hummocky and shoreface strata are absent from the Gunsight Formation in the Lemhi Range. The major thickness of the Gunsight Formation in both the Salmon River Mountains and the Lemhi Range is composed of fluvial rocks, transitional in the upper part into marine rocks of the Swauger Formation. The fluvial strata are mainly characterized by stacked sheets of metasandstone and coarse siltite; they are interpreted as deposits of braided rivers. The Poison Creek thrust fault of the Lemhi Range extends northwestward through the study area in the east-central part of the Salmon River

  4. A Search for Triggered Star Formation in the Compact Group of Galaxies NGC 5851, NGC 5852 and CGCG 077-007

    NASA Astrophysics Data System (ADS)

    Olsen, Charlotte Alexandra; Basu-Zych, Antara; Hornschemeier, Ann E.; NASA / GSFC X-ray Galaxies Group

    2017-01-01

    Galaxy interactions provide ideal conditions for triggering star formation, and impact galaxy evolution and the structure of the universe. The aim of this research is to study the key factors during galaxy interactions that influence star formation events by studying close pairs of galaxies to find the relationship between interaction properties (e.g. relative velocities and distances, mass ratios, orientation, and merger stage) and star formation rate (SFR). We present our analysis on one compact group of star-forming galaxies CGCG 077-007, NGC 5851, and their quiescent companion NGC 5852. Within this group we investigate the conditions where galaxy interactions cause higher SFR or supermassive black hole accretion (i.e. AGN activity), which might rather quench SFR. Areas of increased star formation are classified by the identification of the most UV bright regions within the galaxies. We find these areas by taking the Swift UVOT W2 filter and subtracting from it the Sloan Digital Sky Survey (SDSS) z-band image in order to remove the underlying stellar population. The regions identified by this process allow us to conduct a multi-wavelength study of stellar populations within this compact group. We use Spectral Energy Distribution models to fit ultraviolet to mid-infrared photometry from Swift UVOT, SDSS, 2MASS and WISE and measure global star formation histories for the galaxies and for the identified star forming regions within the galaxies. In the future we will include analysis of Swift XRT data to place constraints on AGN activity, and relate to the star formation history. This group serves as a pilot study and we will apply these methods to a sample of 30 galaxy groups and close pairs in order to investigate the relationship between galaxy interactions, SFR, and AGN activity and gain deeper insight into how mergers drive galaxy evolution.

  5. The Star Formation Histories of Local Group Dwarf Galaxies. III. Characterizing Quenching in Low-mass Galaxies

    NASA Astrophysics Data System (ADS)

    Weisz, Daniel R.; Dolphin, Andrew E.; Skillman, Evan D.; Holtzman, Jon; Gilbert, Karoline M.; Dalcanton, Julianne J.; Williams, Benjamin F.

    2015-05-01

    We explore the quenching of low-mass galaxies (104 ≲ {{M}\\star } ≲ 108 {{M}⊙ }) as a function of lookback time using the star formation histories (SFHs) of 38 Local Group dwarf galaxies. The SFHs were derived by analyzing color-magnitude diagrams of resolved stellar populations in archival Hubble Space Telescope/Wide Field Planetary Camera 2 imaging. We find: (1) lower-mass galaxies quench earlier than higher-mass galaxies; (2) inside of Rvirial there is no correlation between a satellite’s current proximity to a massive host and its quenching epoch; and (3) there are hints of systematic differences in the quenching times of M31 and Milky Way (MW) satellites, although the sample size and uncertainties in the SFHs of M31 dwarfs prohibit definitive conclusions. Combined with results from the literature, we qualitatively consider the redshift evolution (z = 0-1) of the quenched galaxy fraction over ˜7 dex in stellar mass (104 ≲ {{M}\\star } ≲ 1011.5 {{M}⊙ }). The quenched fraction of all galaxies generally increases toward the present, with both the lowest and highest-mass systems exhibiting the largest quenched fractions at all redshifts. In contrast, galaxies between {{M}\\star } ˜ 108-1010 {{M}⊙ } have the lowest quenched fractions. We suggest that such intermediate-mass galaxies are the least efficient at quenching. Finally, we compare our quenching times with predictions for infall times for low-mass galaxies associated with the MW. We find that some of the lowest-mass satellites (e.g., CVn II, Leo IV) may have been quenched before infall, while higher-mass satellites (e.g., Leo I, Fornax) typically quench ˜1-4 Gyr after infall. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained from the Data Archive at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA constract NAS 5-26555.

  6. Formation of Monolayers by the Coadsorption of Thiols on Gold: Variation in the Length of the Head Group, Tail Group, and Solvent

    DTIC Science & Technology

    1989-05-01

    oleophobic monolayer) and the other by a polar or polarizable group (yielding a hydrophilic or oleophilic monolayer). In these systems the contact...particular mechanism, and we prefer not to speculate further. Experimental Section Materials . Ethanol (U.S. Industrials Co.) was deoxygenated with nitrogen...8217 solution reacts violently with most organic materials and must be handled with extreme care. Adsorption solutions containing two thiols were prepared in

  7. [Mechanisms in group formation and cohesion in Tupaia glis Diard, 1820. Results of long-term studies of a family group].

    PubMed

    Richarz, K

    1979-10-01

    In long-term studies of a family group, all the partner-orientated interactions are quantitatively registered and analysed in connection with the usuage of space by the animals. From this, the connections between the interactions and respectively status forms of the group members are recognizable. During the growing-up period of the juveniles in the group, beginning with the first leaving of the nest box at the age of about 33 days, three phases can be differentiated. A phase of "integration" of about 5 to 8 days, in which the behavior patterns between adults and juveniles are polarized on licking mouth with the adults and scent marking the juveniles, is obviously the presupposition for including the rising generation in the relational system (including the space system) of the adults. This phase is followed by a "neutral phase", lasting about 30 days, during which the juveniles stand in connection with the adults by means of a space bonding, in which relatively few interactions occur. Through the joint use of parental resting places and through the resting in close spatial neighbourhood, a true retention of experience for the juveniles must be thought of. At the age of about 60 days an 'ambivalent phase" begins, in which the contacts between parents and the offspring increases again, with an alteration and a superposition of sexual and agonistic interactions. Besides, the sex-specific differences become recognizable: the male interacts with his daughters increasingly sexually, with the sons he is more and more aggressive; the relations of the mother with the female offspring are ambivalent, during which she shows male behaviour patterns and with her sons the female scarcely has contact. Lying in bodily contact has, beyond the importance for a pair bonding, significance for a group bonding. Licking the mouth as an element of the care system (infantile behavior) can be used as an appeasement gesture. The age of 90--100 days, in which the parents frequently have

  8. Data Collection Design for Equivalent Groups Equating: Using a Matrix Stratification Framework for Mixed-Format Assessment

    ERIC Educational Resources Information Center

    Mbella, Kinge Keka

    2012-01-01

    Mixed-format assessments are increasingly being used in large scale standardized assessments to measure a continuum of skills ranging from basic recall to higher order thinking skills. These assessments are usually comprised of a combination of (a) multiple-choice items which can be efficiently scored, have stable psychometric properties, and…

  9. Evidence for inter- and intraspecies biofilm formation variability among a small group of coagulase-negative staphylococci.

    PubMed

    Oliveira, Fernando; Lima, Cláudia Afonso; Brás, Susana; França, Ângela; Cerca, Nuno

    2015-10-01

    Coagulase-negative staphylococci (CoNS) are common bacterial colonizers of the human skin. They are often involved in nosocomial infections due to biofilm formation in indwelling medical devices. While biofilm formation has been extensively studied in Staphylococcus epidermidis, little is known regarding other CoNS species. Here, biofilms from six different CoNS species were characterized in terms of biofilm composition and architecture. Interestingly, the ability to form a thick biofilm was not associated with any particular species, and high variability on biofilm accumulation was found within the same species. Cell viability assays also revealed different proportions of live and dead cells within biofilms formed by different species, although this parameter was particularly similar at the intraspecies level. On the other hand, biofilm disruption assays demonstrated important inter- and intraspecies differences regarding extracellular matrix composition. Lastly, confocal laser scanning microscopy experiments confirmed this variability, highlighting important differences and common features of CoNS biofilms. We hypothesized that the biofilm formation heterogeneity observed was rather associated with biofilm matrix composition than with cells themselves. Additionally, our results indicate that polysaccharides, DNA and proteins are fundamental pieces in the process of CoNS biofilm formation.

  10. Formative Assessment: Using Concept Cartoon, Pupils' Drawings, and Group Discussions to Tackle Children's Ideas about Biological Inheritance

    ERIC Educational Resources Information Center

    Chin, Christine; Teou, Lay-Yen

    2010-01-01

    This study was carried out in the context of formative assessment where assessment and learning were integrated to enhance both teaching and learning. The purpose of the study was to: (a) identify pupils' ideas about biological inheritance through the use of a concept cartoon, pupils' drawings and talk, and (b) devise scaffolding structures that…

  11. Identity Formation in Early and Middle Adolescents from Various Ethnic Groups: From Three Dimensions to Five Statuses

    ERIC Educational Resources Information Center

    Crocetti, Elisabetta; Rubini, Monica; Luyckx, Koen; Meeus, Wim

    2008-01-01

    We used three identity processes (i.e., commitment, in-depth exploration, and reconsideration of commitment) from a recently developed model of identity formation to derive empirically identity statuses in a sample of 1952 early and middle adolescents. By means of cluster analysis, we identified five statuses: achievement, foreclosure, moratorium,…

  12. Formation of Pickering emulsions stabilized via interaction between nanoparticles dispersed in aqueous phase and polymer end groups dissolved in oil phase.

    PubMed

    Okada, Masahiro; Maeda, Hayata; Fujii, Syuji; Nakamura, Yoshinobu; Furuzono, Tsutomu

    2012-06-26

    The influence of end groups of a polymer dissolved in an oil phase on the formation of a Pickering-type hydroxyapatite (HAp) nanoparticle-stabilized emulsion and on the morphology of HAp nanoparticle-coated microspheres prepared by evaporating solvent from the emulsion was investigated. Polystyrene (PS) molecules with varying end groups and molecular weights were used as model polymers. Although HAp nanoparticles alone could not function as a particulate emulsifier for stabilizing dichloromethane (oil) droplets, oil droplets could be stabilized with the aid of carboxyl end groups of the polymers dissolved in the oil phase. Lower-molecular-weight PS molecules containing carboxyl end groups formed small droplets and deflated microspheres, due to the higher concentration of carboxyl groups on the droplet/microsphere surface and hence stronger adsorption of the nanoparticles at the water/oil interface. In addition, Pickering-type suspension polymerization of styrene droplets stabilized by PS molecules containing carboxyl end groups successfully led to the formation of spherical HAp-coated microspheres.

  13. Submillimeter continuum emission from galaxies - Star formation and the interstellar medium in the local group dwarf IC 10

    SciTech Connect

    Thronson, H.A. Jr.; Hunter, D.A.; Casey, S.; Harper, D.A. Lowell Observatory, Flagstaff, AZ Yerkes Observatory, Williams Bay, WI )

    1990-05-01

    Far-infrared (95 and 160 micron) maps and visual broad-band and line images of the nearby, luminous irregular galaxy IC 10 are discussed. Observations of the dust emission make it possible to constrain the total mass of gas and the rate of star formation derived for the galaxy. The total star-formation rate is estimated to be about 0.15 solar mass/yr, and the e-folding time for exhaustion of the interstellar gas due to the star formation is only a few billion years. To determine the source of the cool dust in emission at approximately 100-250 microns from many galaxies, 60, 100, and 160 micron photometry, obtained previously, is compared; and CO, H I, and dust emission is correlated. Based on the correlation between the various cool components of the interstellar medium, it is concluded that the likely location of the dust that dominates the emission at about 160, and possibly 100, microns is within both the diffuse atomic gas and in surface layers of molecular clouds. 57 refs.

  14. The group A3 chondrules of Krymka: Further evidence for major evaporative loss during the formation of chondrules

    NASA Technical Reports Server (NTRS)

    Huang, S.; Benoit, P. H.; Sears, D. W. G.

    1993-01-01

    Like Semarkona (type 3.0), Krymka (type 3.1) contains two distinct types of chondrule (namely groups A and B) which differ in their bulk compositions, phase compositions, and CL properties. The group A chondrules in both meteorites show evidence for major loss of material by evaporation(i.e. elemental abundance patterns, size, redox state, olivine-pyroxene abundances). Group A and B chondrules probably formed from common or very similar precursors by the same processes acting with different intensities, group A suffering greater mass-loss by evaporation and reduction of FeO and SiO2. While Krymka chondrules share many primary mineralogical and compositional properties with Semarkona chondrules, the minimal metamorphism it has suffered has also had a significant effect on its chondrules.

  15. Petrologic and isotopic data from the Cretaceous (Campanian) Blackhawk Formation and Star Point Sandstone (Mesaverde Group), Wasatch Plateau, Utah

    USGS Publications Warehouse

    Fishman, Neil S.; Turner, Christine E.; Peterson, Fred

    2013-01-01

    The presence of discrete minerals associated with coal—whether (1) detrital or authigenic constituents of the coals or in thin mudstone or siltstone units interbedded with coals, or (2) authigenic phases that formed along cleats—might influence its utilization as an energy resource. The build-up of sintered ash deposits on the surfaces of heat exchangers in coal-fired power plants, due to the alteration of minerals during combustion of the coal, can seriously affect the functioning of the boiler and enhance corrosion of combustion equipment. In particular, the presence of sodium in coals has been considered a key factor in the fouling of boilers; however, other elements (such as calcium or magnesium) and the amount of discrete minerals burned with coal can also play a significant role in the inefficiency of and damage to boilers. Previous studies of the quality of coals in the Cretaceous (Campanian) Blackhawk Formation of the Wasatch Plateau, Utah, revealed that the sodium content of the coals varied across the region. To better understand the origin and distribution of sodium in these coals, petrologic studies were undertaken within a sedimentological framework to evaluate the timing and geochemical constraints on the emplacement of sodium-bearing minerals, particularly analcime, which previously had been identified in coals in the Blackhawk Formation. Further, the study was broadened to include not just coals in the Blackhawk Formation from various localities across the Wasatch Plateau, but also sandstones interbedded with the coals as well as sandstones in the underlying Star Point Sandstone. The alteration history of the sandstones in both formations was considered a key component of this study because it records the nature and timing of fluids passing through them and the associated precipitation of sodium-bearing minerals; thus, the alteration history could place constraints on the distribution and timing of sodium mineralization in the interbedded or

  16. Controlling the Formation of Ionic-Liquid-based Aqueous Biphasic Systems by Changing the Hydrogen-Bonding Ability of Polyethylene Glycol End Groups.

    PubMed

    Pereira, Jorge F B; Kurnia, Kiki A; Freire, Mara G; Coutinho, João A P; Rogers, Robin D

    2015-07-20

    The formation of aqueous biphasic systems (ABS) when mixing aqueous solutions of polyethylene glycol (PEG) and an ionic liquid (IL) can be controlled by modifying the hydrogen-bond-donating/-accepting ability of the polymer end groups. It is shown that the miscibility/immiscibility in these systems stems from both the solvation of the ether groups in the oxygen chain and the ability of the PEG terminal groups to preferably hydrogen bond with water or the anion of the salt. The removal of even one hydrogen bond in PEG can noticeably affect the phase behavior, especially in the region of the phase diagram in which all the ethylene oxide (EO) units of the polymeric chain are completely solvated. In this region, removing or weakening the hydrogen-bond-donating ability of PEG results in greater immiscibility, and thus, in a higher ability to form ABS, as a result of the much weaker interactions between the IL anion and the PEG end groups.

  17. Diverse microbially induced sedimentary structures from 1 Ga lakes of the Diabaig Formation, Torridon Group, northwest Scotland

    NASA Astrophysics Data System (ADS)

    Callow, Richard H. T.; Battison, Leila; Brasier, Martin D.

    2011-08-01

    The siliciclastic lacustrine rocks of the ~ 1000 Ma Diabaig Formation, northwest Scotland, contain a remarkable diversity of macroscopic structures on bedding planes that can be compared with various kinds of microbially induced sedimentary structures (MISS). Field sedimentological investigations, combined with laboratory analysis of bedding planes and petrographic study of thin sections have allowed us to characterise a range of depositional environments and document the spectrum of biological structures. MISS are reported from frequently subaerial environments, through commonly submerged facies, and down to permanently sub-wavebase settings. Palaeoenvironmental conditions (water depth, exposure, hydrodynamic energy) control the distribution of MISS within these facies. This demonstrates that mat-forming microbial communities were arguably well adapted to low light levels or periodic exposure. Some MISS from the Diabaig Formation are typical of Precambrian microbial mats, including reticulate fabrics and 'old elephant skin' textures. In addition to these, a number of new and unusual fabrics of putative microbial origin are described, including linear arrays of ridges and grooves (cf. 'Arumberia') and discoidal structures that are comparable with younger Ediacaran fossils such as Beltanelliformis. These observations indicate that benthic microbial ecosystems were thriving in freshwater lake systems ~ 1000 Ma, and indicate how microbially induced sedimentary structures may be applied as facies indicators for Proterozoic lacustrine environments. The discovery of structures closely resembling Ediacaran fossils (cf. Beltanelliformis) also serves to highlight the difficulty of interpreting simple discoidal bedding plane structures as metazoan fossils.

  18. The elusive concept of 'internal objects' (1934-1943). Its role in the formation of the Klein Group.

    PubMed

    Hinshelwood, R D

    1997-10-01

    The author traces a debate about the concept of 'internal objects' that took place between 1937 and 1943 at a time when a group of British analysts was forming around Melanie Klein. The debate is set within a complex of personal, group and organisational dynamics, which the paper makes a start on unravelling. The history of the British Psycho-Analytical Society at this time exemplifies Bion's notion of group schism. The events in the Society's history demonstrate defensive aspects of the interaction between the opposed groups, which support members against various anxieties. These include the stress of the work of analysis, but also in this instance the particular anxieties deriving from the collapse of psychoanalysis in Europe, the state of war of the country as a whole, and the death of Freud shortly after he came to London. This psychoanalytic anxiety/defence model clarifies some aspects of the debate about internal objects, and demonstrates the way in which these various anxieties and defences become organised around a scientific debate in a scientific society.

  19. Observations From Practice: Support Group Membership as a Process of Social Capital Formation Among Female Survivors of Domestic Violence

    ERIC Educational Resources Information Center

    Larance, Lisa Young; Porter, Maryann Lane

    2004-01-01

    This article explores the authors' practice observations of female domestic violence survivors' journey from first agency contact to active participation in a support group process. The authors have witnessed female victims of domestic violence challenging the social isolation imposed by their dominant partners as they search for meaning in their…

  20. Identifying priorities to improve maternal and child nutrition among the Khmu ethnic group, Laos: a formative study.

    PubMed

    de Sa, Joia; Bouttasing, Namthipkesone; Sampson, Louise; Perks, Carol; Osrin, David; Prost, Audrey

    2013-10-01

    Chronic malnutrition in children remains highly prevalent in Laos, particularly among ethnic minority groups. There is limited knowledge of specific nutrition practices among these groups. We explored nutritional status, cultural beliefs and practices of Laos' Khmu ethnic group to inform interventions for undernutrition as part of a Primary Health Care (PHC) project. Mixed methods were used. For background, we disaggregated anthropometric and behavioural indicators from Laos' Multiple Indicator Cluster Survey. We then conducted eight focus group discussions and 33 semi-structured interviews with Khmu villagers and health care workers, exploring beliefs and practices related to nutrition. The setting was two rural districts in Luang Prabang province, in one of which the PHC project had been established for 3 years. There was a higher prevalence of stunting in the Khmu than in other groups. Disaggregation showed nutrition behaviours were associated with ethnicity, including exclusive breastfeeding. Villagers described strong adherence to post-partum food restrictions for women, while little change was described in intake during pregnancy. Most children were breastfed, although early introduction of pre-lacteal foods was noted in the non-PHC district. There was widespread variation in introduction and diversity of complementary foods. Guidance came predominantly from the community, with some input from health care workers. Interventions to address undernutrition in Khmu communities should deliver clear, consistent messages on optimum nutrition behaviours. Emphasis should be placed on dietary diversity for pregnant and post-partum mothers, encouraging exclusive breastfeeding and timely, appropriate complementary feeding. The impact of wider governmental policies on food security needs to be further assessed.

  1. Existence of two groups of Staphylococcus aureus strains isolated from bovine mastitis based on biofilm formation, intracellular survival, capsular profile and agr-typing.

    PubMed

    Bardiau, Marjorie; Caplin, Jonathan; Detilleux, Johann; Graber, Hans; Moroni, Paolo; Taminiau, Bernard; Mainil, Jacques G

    2016-03-15

    Staphylococcus (S.) aureus is recognised worldwide as an important pathogen causing contagious acute and chronic bovine mastitis. Chronic mastitis account for a significant part of all bovine cases and represent an important economic problem for dairy producers. Several properties (biofilm formation, intracellular survival, capsular expression and group agr) are thought to be associated with this chronic status. In a previous study, we found the existence of two groups of strains based on the association of these features. The aim of the present work was to confirm on a large international and non-related collection of strains the existence of these clusters and to associate them with case history records. In addition, the genomes of eight strains were sequenced to study the genomic differences between strains of each cluster. The results confirmed the existence of both groups based on capsular typing, intracellular survival and agr-typing: strains cap8-positive, belonging to agr group II, showing a low invasion rate and strains cap5-positive, belonging to agr group I, showing a high invasion rate. None of the two clusters were associated with the chronic status of the cow. When comparing the genomes of strains belonging to both clusters, the genes specific to the group "cap5-agrI" would suggest that these strains are better adapted to live in hostile environment. The existence of these two groups is highly important as they may represent two clusters that are adapted differently to the host and/or the surrounding environment.

  2. Compounds of tin(IV) - catalysts of amide formation. Effect of temperature and nature of leaving group

    SciTech Connect

    Oleinik, N.M.; Garkusha-Bozhko, I.P.; Usanova, I.V.

    1988-09-20

    The effect of substitution of the ester oxygen atom by sulfur in p-nitrophenyl acetate on its aminolysis rate with benzylamine in beneze at 25/degree/C in the presence of dibutyltin dibenzoate as catalyst was studied. Such substitution leads to a decrease in the catalytic activity by approximately a half, and this is explained by the smaller capacity of the sulfur atom for the formation of hydrogen bonds. The effect of temperature on the rate of the reaction of N-benzyl-oxycarbonylglycine p-nitrophenyl ester with glycine tert-butyl ester in benzene in the presence of dibutyltin dibenzoate was also investigated in the range of 10-50/degree/C. The Arrhenius equation is not fulfilled in this case. The obtained facts demonstrate the multistage character of the catalytic reaction and do not contradict the authors previously proposed bifunctional mechanism of catalysis by tin(IV) compounds.

  3. Some like it hot: Linking diffuse X-ray luminosity, baryonic mass, and star formation rate in compact groups of galaxies

    SciTech Connect

    Desjardins, Tyler D.; Gallagher, Sarah C.; Hornschemeier, Ann E.; Tzanavaris, Panayiotis; Walker, Lisa May; Johnson, Kelsey E.; Brandt, William N.; Charlton, Jane C.

    2014-08-01

    We present an analysis of the diffuse X-ray emission in 19 compact groups (CGs) of galaxies observed with Chandra. The hottest, most X-ray luminous CGs agree well with the galaxy cluster X-ray scaling relations in L{sub X} -T and L{sub X} -σ, even in CGs where the hot gas is associated with only the brightest galaxy. Using Spitzer photometry, we compute stellar masses and classify Hickson CGs 19, 22, 40, and 42, and RSCGs 32, 44, and 86 as fossil groups using a new definition for fossil systems that includes a broader range of masses. We find that CGs with total stellar and H I masses ≳ 10{sup 11.3} M{sub ☉} are often X-ray luminous, while lower-mass CGs only sometimes exhibit faint, localized X-ray emission. Additionally, we compare the diffuse X-ray luminosity against both the total UV and 24 μm star formation rates of each CG and optical colors of the most massive galaxy in each of the CGs. The most X-ray luminous CGs have the lowest star formation rates, likely because there is no cold gas available for star formation, either because the majority of the baryons in these CGs are in stars or the X-ray halo, or due to gas stripping from the galaxies in CGs with hot halos. Finally, the optical colors that trace recent star formation histories of the most massive group galaxies do not correlate with the X-ray luminosities of the CGs, indicating that perhaps the current state of the X-ray halos is independent of the recent history of stellar mass assembly in the most massive galaxies.

  4. Some Like it Hot: Linking Diffuse X-Ray Luminosity, Baryonic Mass, and Star Formation Rate in Compact Groups of Galaxies

    NASA Technical Reports Server (NTRS)

    Desjardins, Tyler D.; Gallagher, Sarah C.; Hornschemeier, Ann E.; Mulchaey, John S.; Walker, Lisa May; Brandt, Willian N.; Charlton, Jane C.; Johnson, Kelsey E.; Tzanavaris, Panayiotis

    2014-01-01

    We present an analysis of the diffuse X-ray emission in 19 compact groups (CGs) of galaxies observed with Chandra. The hottest, most X-ray luminous CGs agree well with the galaxy cluster X-ray scaling relations in L(x-T) and (L(x-sigma), even in CGs where the hot gas is associated with only the brightest galaxy. Using Spitzer photometry, we compute stellar masses and classify Hickson CGs 19, 22, 40, and 42, and RSCGs 32, 44, and 86 as fossil groups using a new definition for fossil systems that includes a broader range of masses. We find that CGs with total stellar and Hi masses are great than or equal to 10(sup (11.3) solar mass are often X-ray luminous, while lower-mass CGs only sometimes exhibit faint, localized X-ray emission. Additionally, we compare the diffuse X-ray luminosity against both the total UV and 24 micron star formation rates of each CG and optical colors of the most massive galaxy in each of the CGs. The most X-ray luminous CGs have the lowest star formation rates, likely because there is no cold gas available for star formation, either because the majority of the baryons in these CGs are in stars or the X-ray halo, or due togas stripping from the galaxies in CGs with hot halos. Finally, the optical colors that trace recent star formation histories of the most massive group galaxies do not correlate with the X-ray luminosities of the CGs, indicating that perhaps the current state of the X-ray halos is independent of the recent history of stellar mass assembly in the most massive galaxies.

  5. Child and Family-Focused Cognitive-Behavioral Therapy for Pediatric Bipolar Disorder: Pilot Study of Group Treatment Format

    PubMed Central

    West, Amy E.; Jacobs, Rachel H.; Westerholm, Robert; Lee, Adabel; Carbray, Julie; Heidenreich, Jodi; Pavuluri, Mani N.

    2009-01-01

    Introduction: This study is a preliminary report of a group adaptation of child- and family-focused cognitive behavior therapy (CFF-CBT) for pediatric bipolar disorder (PBD). Methods: CFF-CBT group treatment was provided to twenty six families who had children with a diagnosis of PBD ranging between six- and twelve-years-old. Results: Results indicated that CFF-CBT was feasible and acceptable to families. CFF-CBT resulted in significant improvement in manic, but not depressive, symptoms and in children’s psychosocial functioning post-treatment. In addition, although not statistically significant, parents reported an increased ability to cope with their child’s illness. Results of this study suggest that group psychosocial treatment provided alongside pharmacotherapy may help attain remission of symptoms, as well as increase overall psychosocial coping and well-being in both children and parents. Conclusion: Future work must include a more rigorous test of CFF-CBT in a randomized controlled trial. PMID:19718425

  6. Views of parents, teachers and children on health promotion in kindergarten--first results from formative focus groups and observations.

    PubMed

    Sansolios, Sanne; Mikkelsen, Bent Egberg

    2011-10-01

    The aim of the study was to capture the views of children, parents and teachers on the topic of physical activity in kindergarten through observation and focus group interviews. The study was conducted in the kindergartens from the sampling group in the Danish part of PERISCOPE. 1(st) methodology: Children interviewed inside by the researcher on preferable movements and settings and then observed outside during their playtime. 2(nd) methodology: Children asked to draw themselves playing their most preferred physical activity. Parents and kindergarten teachers interviewed in two different groups, using an identical guide. Children are skilled in taking advantage of the space and facilities available for physical activity; girls need more support than boys to initiate physical activity; children are happy with the facilities and the toys available in the kindergarten. Teachers feel an increasing pressure to take more responsibility and initiatives for the children's health habits. Parents state that if more physical activity is initiated in the kindergarten, it could make children request domestic activity. Physical activity and movement concept are too abstract for children of this age to talk about: they quickly lose their focus and concentration. The new methodology of videotaping gives the researcher the chance to interpret facial expressions to capture movement, talk and actions, and to make a distinction among children, as they tend to interrupt each other. However, this method contains a weakness, if used alone, by the fact that the shooting is only a reflection of what the video camera has recorded.

  7. Paleomagnetism of the Late Triassic Petrified Forest Formation, Chinle Group, western United States: Further evidence of “large” rotation of the Colorado Plateau

    NASA Astrophysics Data System (ADS)

    Steiner, Maureen B.; Lucas, Spencer G.

    2000-11-01

    Paleomagnetic poles and magnetostratigraphy were obtained from the late Carnian and early Norian Petrified Forest Formation. The remanent magnetization characteristics of this variegated claystones formation are correlated closely with stratal color; red strata display univectorial magnetizations directed to the origin of orthogonal axes plots between 300° and 630°C, whereas progressively greater overlap in magnetization component stabilities is exhibited by purple, blue, and green strata. Rock-magnetic, petrographic, and microprobe investigations indicate that detrital titanohematite is the carrier of much of the characteristic magnetization, with a smaller contribution from magnetite in green and portions of the red strata. Eight magnetic polarity intervals were observed in three quarters of the formation (155 m) good correlation is observed with the coeval portion of the Newark Supergroup. Paleopoles from the late Carnian Blue Mesa and the early Norian Painted Desert Members of the Petrified Forest Formation are identical and agree well with other Chinle Group paleopoles from the Colorado Plateau; the tight cluster formed by all poles indicates that little or no apparent polar wander (APW) with respect to North America occurred during the Late Triassic (late Carnian through Rhaetian time). In addition, Chinle Group paleopoles derived from strata located on the North American (NA) craton also are tightly grouped and indicative of a paucity of significant APW through the Late Triassic. With that same observation from the coeval Newark Supergroup, three independent Late Triassic data sets from different tectonic settings in NA indicate minimal or no APW during more than 20 m.y. The combination of the vertebrate fauna and magnetostratigraphy within the Chinle Group provides a high degree of age control, allowing comparisons among coeval Colorado Plateau (CP) and NA craton paleopoles at about a 250-500 kyr level. CP Chinle Group paleopoles are displaced 9±3

  8. A brief lithostratigraphic review of the Abrahamskraal and Koonap formations of the Beaufort Group, South Africa: Towards a basin-wide stratigraphic scheme for the Middle Permian Karoo

    NASA Astrophysics Data System (ADS)

    Day, Michael Oliver; Rubidge, Bruce Sidney

    2014-12-01

    The basal strata of the Beaufort Group of the South African Karoo Basin, comprising the western Abrahamskraal and eastern Koonap formations, contain the most time extensive record of Middle Permian fossil tetrapods and hold the key to understanding Middle Permian biodiversity change in the continental realm. To determine faunal stratigraphic ranges a reliable lithostratigraphic framework for Middle Permian Beaufort deposits is essential. Until now this has proved difficult to achieve, largely due to the homogeneity of the fluvial succession coupled with structural complexity as a result of Cape Fold Belt orogenesis. Accordingly, the Abrahamskraal Formation has been only locally subdivided on the basis of sandstone packages but regional stratigraphic subdivision has not yet achieved satisfactorily. Collation of stratigraphic sections from around the Karoo Basin for this study demonstrates the presence of four sandstone packages are present within the Abrahamskraal Formation in the south-western corner of the basin. These sandstone packages are given member status, based upon the nomenclature of Le Roux (1985) with the addition of the newly recognised Grootfontein Member. The Combrinkskraal and Grootfontein Members occur in the lower half of the Abrahamskraal Formation and are laterally persistent along the southern margin of the basin. The Koornplaats Member is more restricted to the south west corner of the basin, where it quite thick, suggesting the narrowing of the highly channelized area. The overlying Moordenaars Member, more extensive towards the north than underlying packages, indicates subsequent northwesterly expansion of the locus of active channelization with time. Although thin sandstone packages in the more easterly positioned and stratigraphically equivalent Koonap Formation, this does not facilitate lithostratigraphic subdivision of this part of the stratigraphic succession and may indicate a different form of fluvial architecture. Our study provides

  9. A re-evaluation of the stratigraphy and sedimentology of the Day Point Formation (Chazy Group): A new look at old reefs

    SciTech Connect

    Falkenberg, J.; Mehrtens, C.J. . Dept. of Geology)

    1993-03-01

    The Day Point Formation (Chazy Group, Middle Ordovician) outcrops in the Champlain Valley of New York and Vermont. The stratigraphy of the Day Point Formation is complex, containing lithologic sequences that are unique at different localities around the Champlain Valley. The formation exhibits complex lateral interfingering of seven lithofacies: (1) Highly bioturbated sandstone with symmetrical and bifurcating ripples. (2) Bioturbated, brachiopod rich, wackestone facies. (3) Planar cross-bedded, interlayered sand and sandy packstone. (4) Interlayered sand and shale grading into sand and limestone layers. (5) Grainstone which, at some localities, contains mound-shaped bryozoan reefs, at other localities thin non-reefal sheet-like layers are present. The grainstone also has planar laminated and cross stratified beds. (6) Fine-grained, calcareous sandstone with planar and herringbone cross bedding, which in places contains small bryozoan reefs and thin sheet-reefs. (7) Planar cross bedded packstone containing bryozoan reefs and thin sheet-like non-reefal layers. The thin reefal layers are found where the mound-shaped reefs are absent. The sand units are found only in the lower portion of the Day Point Formation. The bryozoan reefs and non-reefal layers are associated with the sand beds in the lower portion of the Day Point Formation, and either live within the sand or on top of it. The bryozoans that form the non-reefal layers, found in the limestones, are contained within thin layers of sand. In contrast, no sand is found in the upper section of the Day Point Formation, yet the bryozoan reefs flourish.

  10. Addition of surfactants in ozonated water cleaning for the suppression of functional group formation and particle adhesion on the SiO2 surface

    NASA Astrophysics Data System (ADS)

    Yang, Jahyun; Im, Kyungtaek; Lim, Sangwoo

    2011-04-01

    Various kinds of surfactants were added to a cleaning solution and deionized (DI) water, and their effect on the suppression of organic function group formation and particle adhesion to a SiO2 surface was analyzed using multi-internal reflection Fourier transform infrared spectroscopy. The results implied that attached organic functional groups are affected by the chemical structure of a surfactant in DI water. Furthermore, the addition of anionic glycolic acid ethoxylate 4-tert-butylphenyl ether (GAE4E) is the most effective in terms of preventing organic group attachment and particle adhesion to the SiO2 surface, whether it was added to the cleaning solution or post-cleaning rinse water, with or without polystyrene latex particles. Moreover, it was possible to completely prevent particle adhesion to the SiO2 surface with the proper addition of GAE4E in DIO3 solution.

  11. An active site rearrangement within the Tetrahymena group I ribozyme releases nonproductive interactions and allows formation of catalytic interactions

    PubMed Central

    Sengupta, Raghuvir N.; Van Schie, Sabine N.S.; Giambaşu, George; Dai, Qing; Yesselman, Joseph D.; York, Darrin; Piccirilli, Joseph A.; Herschlag, Daniel

    2016-01-01

    Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such “off-pathway” species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2′- and 3′-deoxy (–H) and −amino (–NH2) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3′-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2′-OH making no interaction. Upon S binding, a rearrangement occurs that allows both –OH groups to contact a different active site metal ion, termed MC, to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. PMID:26567314

  12. Diagrammatic restored section of the Inyan Kara group, Morrison formation, and Unkpapa sandstone of the western side of the Black Hills, Wyoming and South Dakota

    USGS Publications Warehouse

    Mapel, W.J.; Gott, G.B.

    1959-01-01

    The Inyan Kara group of Early Creaceous age and the underlying Morrison formation and Unkapa sandstone of Late Jurassic age comprise about 300 to 850 feet of gently dipping predominantly nonmarine rocks that crop out along the flanks of the Black Hills in northeastern Wyoming and western South Dakota. Terailed mapping and stratigraphic studies of these rocks were made from 1952 to 1957 by the U.S. Geological Survey on behalf of the Division of Raw Materials of the U.S. Atomic Energy Commission. One of the results of the studies is a correlation of formational and informational units along the western side of the Black Hills for a distance of about 140 miles. The generalized section above, which has a greatly exaggerated vertical scale, shoes the main lithologic units that have been traced and correlated, and  the stratigraphic position of uranium deposits in various parts of the Black Hills in relation to these units. Geologists who have this sheet and the areas for which each is responsible are shown on the accompanying map. The brief text below summarizes some of the broad stratigraphic relations within the Inyan Kara group and underlying formations.

  13. Burial history of Lockport formation (Middle Silurian), New York, in light of studies of Ellenburger group (Lower Ordovician), west Texas-southeastern New Mexico

    SciTech Connect

    Lee, Y.I.; Ergin, M.; Friedman, G.M.

    1986-05-01

    For studies of burial depth of the Lockport Formation (Middle Silurian) of the Appalachian basin, the authors used as a control data from petrographic, stable isotope, and two-phase fluid-inclusion analyses of carbonate rocks cored from 5000 to 23,000 ft (1.5 to 7 km) burial depth of the Ellenburger Group, west Texas and southeastern New Mexico. The coarse to very coarse crystalline nature of the host-rock dolomite, the vug-filling and fracture-filling saddle dolomite containing relatively light oxygen isotope compositions ranging from -6 to -12 per thousand (PDB), and the high mean homogenization temperatures for saddle dolomite formation from 100/sup 0/ to 260/sup 0/C, all suggest diagenetic changes occurred under deep burial conditions. Using Ellenburger carbonates as a control for burial depth diagenesis studies of saddle dolomite of the surface-exposed Lockport Formation, New York, other literature, and the regional conodont color alteration index (CAI) of 2-3, a former burial depth for the Lockport Formation strata of up to 5 km is indicated, much greater than the present estimation of less than 2 km of paleogeographic reconstruction. This depth was confirmed by delta/sup 18/O values ranging from -9 to -11 per thousand, and two-phase fluid-inclusion homogenization temperatures ranging from 110/sup 0/ to 200/sup 0/C with an average of 150/sup 0/C.

  14. [Search for destruction factors of bacterial biofilms: comparison of phage properties in a group of Pseudomonas putida bacteriophages and specificity of their halo-formation products].

    PubMed

    Shaburova, O V; Krylov, S V; Veĭko, V P; Pleteneva, E A; Burkal'tseva, M V; Miroshnokov, K A; Kornelissen, A; Lavogne, R; Sykilinda, N N; Kadykov, V A; Mesianzhinov, V V; Volckaert, G; Krylov, V N

    2009-02-01

    Comparison of Pseudomonas putida group of phages attributed to five species (af, phi15, phi27, phi2F, and pf16) with their common property of halo-formation (formation of lightening zones) around phage plaques was conducted. The halo around phage plaques appears as a result of reduction or disappearance of bacterial polysaccharide capsules. The concentration of viable bacteria remains unchanged within the halo. A comparison of specificities of halo-formation products from various phages was conducted by a simple method. These products were shown to be highly specific and inactive on other species of pseudomonads. Phage-resistant P. putida mutants scored with respect to various phages, which lost phage adsorption ability, were tolerant to the effect of halo-formation products in most cases. Apparently, the capsular polysaccharides, which serve as a substrate for depolymerases and are the primary phage receptors, may be often lost. Results of partial sequencing of the af phage genome revealed an open reading frame that encodes the enzyme transglycosylase similar rather to transglycosylases of oligotrophic bacteria belonging to different species than to lysozymes of other phages. Possibly, it is a polyfunctional enzyme combining functions of lysozyme and an enzyme that executes the penetration of phage particle across extracellular slime and capsule.

  15. The influence of functional groups of self-assembled monolayers on fibrous capsule formation and cell recruitment.

    PubMed

    Barbosa, Judite N; Madureira, Pedro; Barbosa, Mário A; Aguas, Artur P

    2006-03-15

    The contribution of the surface chemistry of an implant to the thickness of the fibrous capsule formed after implantation was herein investigated. For that, self-assembled monolayers (SAMs) of alkanethiols on gold with different terminal functional groups (COOH, OH, and CH(3)) were used. These surfaces were implanted in subcutaneous air pouches of BALB/c mice and the ensuing fibrous capsules were evaluated and compared with the initial inflammatory response caused by the implant. The thickness of the fibrous capsules that are under organization around the implant was measured 1 week after implantation by histology. Inflammatory exudates were collected from the air pouches 24 h after the implantation of SAMs and were analyzed by flow cytometry. A significant increase in the thickness of fibrous capsules was seen around implanted CH(3)-terminated SAMs, and also in gold surfaces, in comparison with the air pouch wall of sham-operated mice and of COOH- and OH-covered SAMs. The CH(3)-coated implants also recruited higher numbers of inflammatory cells; this enhancement involved a significant number of Mac-1(+) cells. Our data indicate that implant surfaces coated with CH(3) induce thick fibrous capsules and this may be the result of the stronger inflammatory effect of CH(3) in comparison with COOH or OH chemical groups.

  16. Contrasting Sr isotope ratios in plagioclase from different formations of the mid-Miocene Columbia River Basalt Group

    NASA Astrophysics Data System (ADS)

    Starkel, W. A.; Wolff, J.; Eckberg, A.; Ramos, F.

    2008-12-01

    Many early Columbia River Basalt flows of the Steens and Imnaha Formations are characterized by abundant, texturally complex, coarse plagioclase phenocrysts. In Imnaha lavas, the feldspars typically have more radiogenic 87Sr/86Sr than whole rock and matrix, and may exhibit complex isotopic zoning that is not correlated with An content. Imnaha plagioclase grains are interpreted as variably-contaminated crystals produced when high-crystallinity mid-crustal basaltic intrusions exchanged interstitial melt with adjacent partly-melted crustal rock; this isotopically variable debris was then remobilized by subsequent intrusion of mantle-derived basalt and brought to the surface as an isotopically heterogeneous mixture. In contrast, plagioclase grains in the texturally very similar Steens lavas are isotopically near-homogeneous and 87Sr/86Sr is not significantly displaced from that of the bulk rock. This is consistent with magma- crust interaction at low degrees of crustal melting during the early stages of the Columbia River flood basalt episode, where Steens and Imnaha lavas were erupted from distinct magma systems hosted by different types of crust that exerted different degrees of isotopic leverage on the mantle-derived magmas [1]. Thermal input to the Steens system declined at the same time as the Imnaha magmatic flux increased to ultimately produce the huge outpouring of Grande Ronde lavas, which are mixtures of mantle- and crust-derived liquids, the latter produced during high degrees of crustal melting during the time of peak magmatic flux. [1] Wolff et al. (2008) Nature Geoscience 1, 177-180.

  17. Cyclopropane-ring formation in the acyl groups of chlorosome glycolipids is crucial for acid resistance of green bacterial antenna systems.

    PubMed

    Mizoguchi, Tadashi; Tsukatani, Yusuke; Harada, Jiro; Takasaki, Shin; Yoshitomi, Taichi; Tamiaki, Hitoshi

    2013-07-01

    Green photosynthetic bacteria have unique light-harvesting antenna systems called chlorosomes. Chlorobaculum tepidum, a model organism of the bacteria, biosynthesized monogalactosyl- and rhamnosylgalactosyldiacylglycerides possessing a methylene-bridged palmitoleyl group characterized by a cis-substituted cyclopropane ring as the dominant glycolipids of its chlorosome surface. The formation of the cyclopropane ring was chemically inhibited by supplementation of sinefungin, an analog of S-adenosyl-L-methionine, into the bacterial cultivation. The presence of the cyclopropane ring reinforced acid resistance of the light-harvesting chlorosomes and suppressed acidic demetalation (pheophytinization) of bacteriochlorophyll-c pigments constructing the core part of chlorosomes. The ring-formation would represent direct and post-synthetic modifications of chlorosome membrane properties and was tolerant of acidic environments.

  18. [The difficult concept of "internal objects" (1934-1943). Its significance for the formation of the Klein group].

    PubMed

    Hinshelwood, R D

    1996-06-01

    Although the concept of "inner objects" developed by Melanie Klein is hardly a major object of discussion today, it caused a furore in the ranks of the British Psychoanalytical Society in the thirties and forties. Notably the analysts from Vienna were unable to agree to the existence of inner objects engendered via processes of internalisation. The author traces the course of these discussions of a clinical problem and the confusion they caused, placing them at the same time in a specific historical context. He sees the controversy as the expression of conflicts and fears unsettling the British Psychoanalytical Society during that period, caused on the one hand by the necessary integration of the exiled Freud family and on the other by tensions within its own ranks leading ultimately to a division of the Society and the constitution of the Klein Group.

  19. Usefulness of postoperative hip irradiation in the prevention of heterotopic bone formation in a high risk group of patients

    SciTech Connect

    MacLennan, I.; Keys, H.M.; Evarts, C.M.; Rubin, P.

    1984-01-01

    Heterotopic ossification is a complication of total hip arthroplasty in 14 to 30% of patients. Significant functional impairment will occur in up to 28% of patients with ectopic bone. The high risk group includes those with preexisting heterotopic bone in either hip, those suffering from hypertrophic osteoarthritis or ankylosing spondylitis and patients who have had multiple procedures on the hip. Fifty-eight patients (67 hips) were irradiated after surgical removal of ectopic bone (53 hips) or received radiation prophylaxis of heterotopic ossification (14 hips). Ninety-five percent of patients had either no bone visible or insignificant amounts of ectopic bone visible on postoperative hip X-rays. Only 5% of patients showed significant persistence of ectopic bone. Postoperative hip function was dramatically improved compared to preoperative function in all patients treated. The importance of early commencement of irradiation is emphasized.

  20. Effect of the phospholipid chain length and head group on beta-phase formation of poly(9,9-dioctylfluorene) enclosed in liposomes.

    PubMed

    Tapia, María J; Monteserín, María; Burrows, Hugh D; Seixas de Melo, João S; Estelrich, Joan

    2013-01-01

    We have studied the effect of head group and alkyl chain length on β-phase formation in poly(9,9-dioctylfluorene) (PFO) solubilized in phospholipid liposomes. Systems studied have three different alkyl chain lengths (1,2-dimyristoyl-sn-glycero-3-phosphatidylcholine [DMPC], 1,2-didodecanoyl-sn-glycero-3-phosphatidylcholine [DLPC], 1,2-dipalmitoyl-sn-glycero-3-phosphatidylcholine [DPPC]) and head groups (1,2-dimyristoyl-sn-glycero-3-phosphate monosodium salt [DMPA], 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine [DMPE] and 1,2-dimyristoyl-sn-glycero-3-phospho-l-serine sodium salt [DMPS]). Changes in liposome size upon addition of PFO are followed by dynamic light scattering. All the phospholipids induce the formation of PFO β-phase, which is followed by the emission intensity and deconvolution of the absorption spectra. Both the head group and alkyl chain length affect the yield of β-phase. The photophysics of PFO incorporated in liposomes is characterized by stationary and time-resolved fluorescence, whereas the polymer-phospholipid interactions have been studied by the effect of the PFO concentration on the phospholipid phase transitions (differential scanning calorimetry [DSC]).

  1. Millimeter-scale variations of stable isotope abundances in carbonates from banded iron-formations in the Hamersley Group of Western Australia

    NASA Technical Reports Server (NTRS)

    Baur, M. E.; Hayes, J. M.; Studley, S. A.; Walter, M. R.

    1985-01-01

    Several diamond drill cores from formations within the Hamersley Group of Western Australia have been studied for evidence of short-range variations in the isotopic compositions of the carbonates. For a set of 32 adjacent microbands analyzed in a specimen from the Marra Mamba Iron Formation, carbon isotope compositions of individual microbands ranged from -2.8 to -19.8 per mil compared to PDB and oxygen isotope compositions ranged from 10.2 to 20.8 per mil compared to SMOW. A pattern of alternating abundances was present, with the average isotopic contrasts between adjacent microbands being 3.0 per mil for carbon and 3.1 per mil for oxygen. Similar results were obtained for a suite of 34 microbands (in four groups) from the Bruno's Band unit of the Mount Sylvia Formation. Difficulties were experienced in preparing samples of single microbands from the Dales Gorge Member of the Brockman Iron Formation, but overall isotopic compositions were in good agreement with values reported by previous authors. Chemical analyses showed that isotopically light carbon and oxygen were correlated with increased concentrations of iron. The preservation of these millimeter-scale variations in isotopic abundances is interpreted as inconsistent with a metamorphic origin for the isotopically light carbon in the BIF carbonates. A biological origin is favored for the correlated variations in 13C and Fe, and it is suggested that the 13C-depleted carbonates may derive either from fermentative metabolism or from anaerobic respiration. A model is presented in which these processes occur near the sediment-water interface and are coupled with an initial oxidative precipitation of the iron.

  2. Comparative palynology of clastics and lignites from the Manning Formation, Jackson Group, Upper Eocene, Grimes County, TX

    SciTech Connect

    Gennett, J.A.

    1996-09-01

    The 3500 lignite seam at the Gibbons Creek Mine in Grimes County, TX was sampled for pollen and spores at 10 cm intervals. The majority of samples are dominated (to 60%) by Momipites from the Juglandaceae (walnut family), as is typical of Jackson Group sediments. Other palynomorph taxa vary systematically, with a peak of pollen of the freshwater tree Nyssa (blackgum) and associated Rboipites angustus (to 17%) occurring at the base. Higher in the seam, increase (to 55%) of Cupuliferoipollenites (a chestnut-like grain) and Cyrillaceae-pollenites? ventosus (to 7%) percentages may indicate a higher salinity environment. A Chrysophyllum (satin leaf) peak (to 25%) near the top of the seam suggests relatively shallow fresh-water conditions. Core samples from an interval above the lignites represent a transgressive-regressive cycle in inner shelf clastics. These samples were taken at 40 cm or greater intervals and reveal the regional pollen flora. Although minor changes occur, palynomorph spectra are for the most part homogenous. The dominant grain is again Momipites coryloides, but in general percentages are lower (to 35%). Cupuliferoipollenites (to 17%), Chrysophyllum (to 5%), and Rhoipites angustus (to 3%) are not less important, but do not peak as they do in the lignite spectra. Palm leaf megafossils; in one sample suggest a clastic wetland; in this sample palm pollen (mostly Arecipites, representing the modern saw palmetto) reaches 73%. Another sample contains high (26%) percentages of the fern spore Lygodiumsporites adriennis. High percentages of these two taxa do not occur in the lignite samples.

  3. Formation of selfbound states in a one-dimensional nuclear model—a renormalization group based density functional study

    NASA Astrophysics Data System (ADS)

    Kemler, Sandra; Pospiech, Martin; Braun, Jens

    2017-01-01

    In nuclear physics, density functional theory (DFT) provides the basis for state-of-the art studies of ground-state properties of heavy nuclei. However, the direct relation of the density functional underlying these calculations and the microscopic nuclear forces is not yet fully understood. We present a combination of DFT and renormalization group (RG) techniques which allows to study selfbound many-body systems from microscopic interactions. We discuss its application with the aid of systems of identical fermions interacting via a long-range attractive and short-range repulsive two-body force in one dimension. We compute ground-state energies, intrinsic densities, and density correlation functions of these systems and compare our results to those obtained from other methods. In particular, we show how energies of excited states as well as the absolute square of the ground-state wave function can be extracted from the correlation functions within our approach. The relation between many-body perturbation theory and our DFT-RG approach is discussed and illustrated with the aid of the calculation of the second-order energy correction for a system of N identical fermions interacting via a general two-body interaction. Moreover, we discuss the control of spuriously emerging fermion self-interactions in DFT studies within our framework. In general, our approach may help to guide the development of energy functionals for future quantitative DFT studies of heavy nuclei from microscopic interactions.

  4. Horseradish peroxidase-catalyzed formation of hydrogels from chitosan and poly(vinyl alcohol) derivatives both possessing phenolic hydroxyl groups.

    PubMed

    Sakai, Shinji; Khanmohammadi, Mehdi; Khoshfetrat, Ali Baradar; Taya, Masahito

    2014-10-13

    Horseradish peroxidase-catalyzed cross-linking was applied to prepare hydrogels from aqueous solutions containing chitosan and poly(vinyl alcohol) derivatives both possessing phenolic hydroxyl groups (denoted as Ph-chitosan and Ph-PVA, respectively). Comparing the hydrogels prepared from the solution of 1.0% (w/v) Ph-chitosan and 3.0% (w/v) Ph-PVA and that of 3.0% (w/v) Ph-chitosan and 1.0% (w/v) Ph-PVA, the gelation time of the former hydrogel was 47 s, while was 10s longer than that of the latter one. The breaking point for the former hydrogel under stretching (114% strain) was approximately twice larger than that for the latter one. The swelling ratio of the former hydrogel in saline was about half of the latter one. Fibroblastic cells did not adhere on the former hydrogel but adhered and spread on the latter one. The growth of Escherichia coli cells was fully suppressed on the latter hydrogel during 48 h cultivation.

  5. RESOLVING THE GALAXIES WITHIN A GIANT Ly{alpha} NEBULA: WITNESSING THE FORMATION OF A GALAXY GROUP?

    SciTech Connect

    Prescott, Moire K. M.; Dey, Arjun; Jannuzi, Buell T.; Brodwin, Mark; Chaffee, Frederic H.; Desai, Vandana; Soifer, B. T.; Eisenhardt, Peter; Le Floc'h, Emeric; Matsuda, Yuichi

    2012-06-20

    Detailed analysis of the substructure of Ly{alpha} nebulae can put important constraints on the physical mechanisms at work and the properties of galaxies forming within them. Using high-resolution Hubble Space Telescope (HST) imaging of a Ly{alpha} nebula at z Almost-Equal-To 2.656, we have taken a census of the compact galaxies in the vicinity, used optical/near-infrared colors to select system members, and put constraints on the morphology of the spatially extended emission. The system is characterized by (1) a population of compact, low-luminosity ({approx}0.1 L*) sources-17 primarily young, small (R{sub e} Almost-Equal-To 1-2 kpc), disky galaxies including an obscured active galactic nucleus-that are all substantially offset ({approx}>20 kpc) from the line-emitting nebula; (2) the lack of a central galaxy at or near the peak of the Ly{alpha} emission; and (3) several nearly coincident, spatially extended emission components-Ly{alpha}, He II, and UV continuum-that are extremely smooth. These morphological findings are difficult to reconcile with theoretical models that invoke outflows, cold flows, or resonant scattering, suggesting that while all of these physical phenomena may be occurring, they are not sufficient to explain the powering and large extent of Ly{alpha} nebulae. In addition, although the compact galaxies within the system are irrelevant as power sources, the region is significantly overdense relative to the field galaxy population (by at least a factor of four). These observations provide the first estimate of the luminosity function of galaxies within an individual Ly{alpha} nebula system and suggest that large Ly{alpha} nebulae may be the seeds of galaxy groups or low-mass clusters.

  6. Resolving the Galaxies within a Giant Lyα Nebula: Witnessing the Formation of a Galaxy Group?

    NASA Astrophysics Data System (ADS)

    Prescott, Moire K. M.; Dey, Arjun; Brodwin, Mark; Chaffee, Frederic H.; Desai, Vandana; Eisenhardt, Peter; Le Floc'h, Emeric; Jannuzi, Buell T.; Kashikawa, Nobunari; Matsuda, Yuichi; Soifer, B. T.

    2012-06-01

    Detailed analysis of the substructure of Lyα nebulae can put important constraints on the physical mechanisms at work and the properties of galaxies forming within them. Using high-resolution Hubble Space Telescope (HST) imaging of a Lyα nebula at z ≈ 2.656, we have taken a census of the compact galaxies in the vicinity, used optical/near-infrared colors to select system members, and put constraints on the morphology of the spatially extended emission. The system is characterized by (1) a population of compact, low-luminosity (~0.1 L*) sources—17 primarily young, small (Re ≈ 1-2 kpc), disky galaxies including an obscured active galactic nucleus—that are all substantially offset (gsim20 kpc) from the line-emitting nebula; (2) the lack of a central galaxy at or near the peak of the Lyα emission; and (3) several nearly coincident, spatially extended emission components—Lyα, He II, and UV continuum—that are extremely smooth. These morphological findings are difficult to reconcile with theoretical models that invoke outflows, cold flows, or resonant scattering, suggesting that while all of these physical phenomena may be occurring, they are not sufficient to explain the powering and large extent of Lyα nebulae. In addition, although the compact galaxies within the system are irrelevant as power sources, the region is significantly overdense relative to the field galaxy population (by at least a factor of four). These observations provide the first estimate of the luminosity function of galaxies within an individual Lyα nebula system and suggest that large Lyα nebulae may be the seeds of galaxy groups or low-mass clusters.

  7. Density functional study of hydrogen bond formation between methanol and organic molecules containing Cl, F, NH2, OH, and COOH functional groups.

    PubMed

    Kolev, Stefan K; St Petkov, Petko; Rangelov, Miroslav A; Vayssilov, Georgi N

    2011-12-08

    Various hydrogen-bonded complexes of methanol with different proton accepting and proton donating molecules containing Cl, F, NH(2), OH, OR, and COOH functional groups have been modeled using DFT with hybrid B3LYP and M05-2X functionals. The latter functional was found to provide more accurate estimates of the structural and thermodynamic parameters of the complexes of halides, amines, and alcohols. The characteristics of these complexes are influenced not only by the principle hydrogen bond of the methanol OH with the proton acceptor heteroatom, but also by additional hydrogen bonds of a C-H moiety with methanol oxygen as a proton acceptor. The contribution of the former hydrogen bond in the total binding enthalpy increases in the order chlorides < fluorides < alcohols < amines, while the contribution of the second type of hydrogen bond increases in the reverse order. A general correlation was found between the binding enthalpy of the complex and the electrostatic potential at the hydrogen center participating in the formation of the hydrogen bond. The calculated binding enthalpies of different complexes were used to clarify which functional groups can potentially form a hydrogen bond to the 2'-OH hydroxyl group in ribose, which is strong enough to block it from participation in the intramolecular catalytic activation of the peptide bond synthesis. Such blocking could result in inhibition of the protein biosynthesis in the living cell if the corresponding group is delivered as a part of a drug molecule in the vicinity of the active site in the ribosome. According to our results, such activity can be accomplished by secondary or tertiary amines, alkoxy groups, deprotonated carboxyl groups, and aliphatic fluorides, but not by the other modeled functional groups.

  8. Group additivity values for estimating the enthalpy of formation of organic compounds: an update and reappraisal. 2. C, H, N, O, S, and halogens.

    PubMed

    Holmes, John L; Aubry, Christiane

    2012-07-05

    This study extends a previous publication on group additivity values (GAVs) for the elements C, H, and O, to include the elements nitrogen, sulfur, and the halogens. The present state and utility of the Benson additivity schemes for estimating the enthalpy of formation (Δ(f)H(0)) of organic compounds are again described, extending them to include more elements. Old and new GAVs for a wide variety of compounds are provided and are revised where necessary. When new terms are proposed, or old ones are significantly altered, the rationale for so doing is presented. GAV derived ring strain values for benzene and pyridine indicate that the aromatic stabilization of each is essentially the same. As before, the thermochemical consequences of replacing one functional group by another are also shown, thus permitting quick shortcuts to the estimation of new Δ(f)H(0) values.

  9. [The role of the students' research groups in the formation of the system of values as a personality trait of the future doctor].

    PubMed

    Svistushkin, V M; Morozova, S V; Savvateeva, D M

    2017-01-01

    This publication was designed to report the experience gained by the Department of Ear, Throat and Nose Diseases at I.M. Sechenov First Moscow State Medical University in the matters concerning the education of the students involved in the activities of research groups. The main causes for which the senior students should be attracted to doing research work in the framework of the university-based scientific societies are considered. Special emphasis is laid on the role of the students' research groups in the formation of the system of values as a personality trait of the future doctor. The experience gained during the recent years with the organization of inter-institutional students' competitions (otorhinolaryngological olympiads) is discussed.

  10. Fission track ages of detrital zircons from sandstones of the Umpqua Group and Tyee Formation, Oregon coast range

    SciTech Connect

    Vance, J.A. . Dept. of Geological Sciences); Brandon, M.T. . Dept. of Geology and Geophysics)

    1993-04-01

    Detrital zircons from Paleogene sandstones of the Umpqua Group (UG) and the Tyee Fm (TF) yield contrasting FT age patterns which distinguish these two units and cast new light on their regional extent, correlation and provenance. In the Roseburg (Rg) area of the southern Oregon Coast Range, where most widely exposed, the UG consists of continental and marine clastic beds which overlie submarine lavas of the Coast Range Basalt. K-Ar And Ar-Ar dating of the basement basalts shows a younging trend from about 62 Ma at Rg at the south to 56 Ma at Siletz River and 53 Ma at Tillamook to the north. Detrital zircons from the Rg area are characterized by old FT ages. Of 192 grains dated, 90% are older than 90 Ma; the median age is 129 Ma. A diorite cobble from an UG conglomerate gave a zircon FT age of 105 Ma. These ages point to a source in the Jurassic plutons in the Klamath Mountains nearby to the south. The authors have determined FT cooling ages of 110 and 120 Ma for zircons from the Mt. Ashland and Grants Pass plutons. Continental and shallow marine clastic strata of the TF overly the UG beds west of Rg. The UG is not widely exposed north of Rg where it thins and pinches out above the Coast Range Basalt and is overlain by a northern turbidite facies of the TF. Three TF sandstones from the latitude of Rg and three others from west and south of Corvallis yielded distinctive and identical zircon FT age patterns characterized by young ages. Of 335 zircons dated, 80% are younger than 90 Ma; the median age is 61 Ma. This maximum age is very close to that of the overlying Tillamook and Fisher Fms. The flood of detrital zircons with young FT ages in the TF marks the abrupt change from a nearby Klamath source for the UG beds to a distant, easterly TF source in a recently uplifted plutonic-metamorphic terrane.

  11. Subsurface study of Lower Ordovician Prairie du Chien group and underlying Cambrian formations and their relation to pre-Glenwood unconformity in southern peninsula of Michigan

    SciTech Connect

    Wheeler, C.T. Jr.

    1987-09-01

    Prior to discovery of commercial gas in Lower Ordovician Prairie du Chien sandstones at Falmouth field, Missaukee County, in April 1981, only 119 wells had reached underlying Cambrian rocks in Michigan's Southern Peninsula. The resulting deep basin drilling activity to January 1, 1987, has resulted in 17 Prairie du Chien gas discoveries in the north-central part of the Michigan basin and an additional 46 Cambrian penetrations. This study also utilized 235 Prairie du Chien partial penetrations. It is now possible to correlate with relative certainty the standard Cambrian formations of the subsurface of southern Michigan to wells within and on the other margins of the basin. These, in ascending order, are Mount Simon, Eau Claire, Dresbach, Franconia, and Trempealeau. Because of the previous lack of control, these units were commonly misidentified in northern wells in previous studies. The present study largely corroborates previous recent work. Four ascending formations of the Prairie du Chien Group were also correlated throughout the basin: Umlor, Foster, Bruggers, and Goodwell (newly proposed). Two type wells demonstrate the character of the Goodwell Formation. The Bruggers Sandstones has been further divided into four informal zones, based on extending correlations of thin, silty dolomite marker beds on gamma-ray logs from the Goodwell and Woodville fields area, Newaygo County. Gas is produced from these Brugger zones. Twelve detailed stratigraphic cross sections (using 183 wells) and a pre-Glenwood paleogeologic map demonstrate marked basin-wide pre-Middle Ordovician erosional truncation.

  12. Reactivity of the nitro-group of a π-conjugated polymer upon the interface formation with chromium: a photoelectron spectroscopy investigation

    NASA Astrophysics Data System (ADS)

    Iucci, G.; Polzonetti, G.; Altamura, P.; Paolucci, G.; Goldoni, A.; D'Amato, R.; Russo, M. V.

    1999-12-01

    X-ray photoelectron spectroscopy was used in order to investigate the interface formation between chromium and thin films of a newly synthesised π-conjugated polymer P(PA- pNO 2PA); the investigated material is a block copolymer consisting of phenylacetylene (PA) and para-nitro phenylacetylene ( pNO 2PA) units {[-(CHC-R) n-(CHC-R') m-] N; RC 6H 5, R'C 6H 4NO 2}. Chromium was evaporated stepwise in situ onto the polymer surface and the XPS spectra of the substrate polymer and of the metal overlayer were studied as a function of increasing chromium thickness. In the early stages of the interface formation, chromium was found to interact mainly with the nitrogen atoms of the -NO 2 groups, that are reduced to nitride-like species; the N-O bond is broken, as evidenced by the modifications occurring in the N1s and O1s spectra. The changes in the C1s spectra upon increasing metal deposition suggest the formation of a chromium-arene π-complex at low chromium coverage and of carbide-like species at higher chromium thickness.

  13. Hydroxy-group effect on the regioselectivity in a photochemical oxetane formation reaction (the Paternò-Büchi Reaction) of geraniol derivatives.

    PubMed

    Hisamoto, Ken; Hiraga, Yoshikazu; Abe, Manabu

    2011-09-01

    The Paternò-Büchi (PB) reaction of geraniol derivatives 1, which contain allylic alcohol functionality and unfunctionalized double bonds, with benzophenone was investigated to see the effect of the hydroxyl group on the regioselectivity of the oxetane formation, i.e., 2/3. At low concentration of geraniol (1a), oxetanes 2a and 3a were formed in a ratio of 2a/3a = ca. 50/50. The oxetane 2a is derived from the PB reaction at the allylic alcohol moiety, whereas the PB reaction at the unfunctionalized double bond produces the oxetane 3a. The PB reaction of the hydroxy-protected methyl ether 1b and acetate 1c gave selectively oxetanes 3b,c derived from the reaction at the more nucleophilic double bond, 2/3∼ 15/85. The hydroxyl-group effect was found to be small, but apparently increased the formation of 2a in the PB reaction with geraniol (1a).

  14. A new turtle from the Upper Cretaceous Bauru Group of Brazil, updated phylogeny and implications for age of the Santo Anastácio Formation

    NASA Astrophysics Data System (ADS)

    Menegazzo, Mirian Costa; Bertini, Reinaldo José; Manzini, Flávio Fernando

    2015-03-01

    A new Podocnemidinura specimen from the Upper Cretaceous Bauru Group (Paraná Basin) of southeastern Brazil was described. The Bauru Group provided an important portrait of the Brazilian Mesozoic terrestrial biota, which boasts a vertebrate fauna formed from fishes, frogs, lacertilians, crocodyliforms, dinosaurs and mammals; records of palynomorphs; and invertebrate fauna consisted of gastropods, bivalves, ostracods and conchostracans. Nevertheless, the age of these continental deposits is not precisely estimated, which prevents global correlations, and its fauna is argued to be endemic. The new specimen described is the first turtle from the Santo Anastácio Formation, and its morphological comparison with other South American forms provided a significant advancement in the understanding of the age of this unit (Late Cretaceous). This study permitted a revision of the turtle taxa of the Bauru Group. As a result, some taxa were considered synonym, including the new Santo Anastácio form. The specimen is still unnamed due to the absence of skull characters that preclude its accurate positioning within the Bauru Group skull-based taxa. In addition, the phylogenetic affinities of this taxon were analyzed into Podocnemidinura clade.

  15. Unique Footprint in the scl1.3 Locus Affects Adhesion and Biofilm Formation of the Invasive M3-Type Group A Streptococcus

    PubMed Central

    Bachert, Beth A.; Choi, Soo J.; LaSala, Paul R.; Harper, Tiffany I.; McNitt, Dudley H.; Boehm, Dylan T.; Caswell, Clayton C.; Ciborowski, Pawel; Keene, Douglas R.; Flores, Anthony R.; Musser, James M.; Squeglia, Flavia; Marasco, Daniela; Berisio, Rita; Lukomski, Slawomir

    2016-01-01

    The streptococcal collagen-like proteins 1 and 2 (Scl1 and Scl2) are major surface adhesins that are ubiquitous among group A Streptococcus (GAS). Invasive M3-type strains, however, have evolved two unique conserved features in the scl1 locus: (i) an IS1548 element insertion in the scl1 promoter region and (ii) a nonsense mutation within the scl1 coding sequence. The scl1 transcript is drastically reduced in M3-type GAS, contrasting with a high transcription level of scl1 allele in invasive M1-type GAS. This leads to a lack of Scl1 expression in M3 strains. In contrast, while scl2 transcription and Scl2 production are elevated in M3 strains, M1 GAS lack Scl2 surface expression. M3-type strains were shown to have reduced biofilm formation on inanimate surfaces coated with cellular fibronectin and laminin, and in human skin equivalents. Repair of the nonsense mutation and restoration of Scl1 expression on M3-GAS cells, restores biofilm formation on cellular fibronectin and laminin coatings. Inactivation of scl1 in biofilm-capable M28 and M41 strains results in larger skin lesions in a mouse model, indicating that lack of Scl1 adhesin promotes bacterial spread over localized infection. These studies suggest the uniquely evolved scl1 locus in the M3-type strains, which prevents surface expression of the major Scl1 adhesin, contributed to the emergence of the invasive M3-type strains. Furthermore these studies provide insight into the molecular mechanisms mediating colonization, biofilm formation, and pathogenesis of group A streptococci. PMID:27630827

  16. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing ); Chingnien Chen )

    1991-10-15

    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  17. Thermochemistry of organic, elementorganic and inorganic species. Part XXI: Enthalpies of formation for bi- and triradicals of main group elements’ halogenides

    NASA Astrophysics Data System (ADS)

    Ponomarev, Dmitry; Takhistov, Viatcheslav; Slayden, Suzanne; Liebman, Joel

    2008-03-01

    General trends in thermochemistry of bi- and triradicals as the fragments of halogenated molecules of main group elements :EX (:EHX; :EX 2) and triradicals ·:EX, respectively, where X-halogens F-I were found for the first time. The enthalpy of formation for methylene CH 2 was drastically changed in present work with adopted values 79 ( 3B 1) and 88 ( 1A 1) compared with currently used values ˜93 and ˜102 kcal mol -1, respectively. This happened mainly because of the drastic change in the enthalpy of formation for ketene CH 2dbnd C dbnd O molecule from currently used value -11.4 to -24 kcal mol -1 [A.V. Golovin, D.A. Ponomarev, V.V. Takhistov, This Journal 524 (2000) 259] which was the source of experimental determination of ΔHf0 :CH 2. Other experimental data are provided for support of the lower values of the ΔHf0 for :CH 2. It was established that halogens F-I stabilize all biradicals :EX (E = B-Tl, N-Bi) and :EHX (:EX 2) (E = C-Pb) compared with the free radicals of these elements. This was interpreted by essentially smaller thermodynamic stability of bi- compared with mono (free)radicals the former extracting larger stabilization at H → X replacement from the same halogen compared with more stable free radicals. The expected increase in stabilization of biradicals is observed when coming down the periodic table while due to lower stability of biradicals all halogens reveal similar (contrary to free radicals) stabilization effects. Finding unknown values and correcting some literature data on the enthalpies of formation for mono-, bi- and triradicals we could estimate their thermodynamic stabilities. It was established that only about 40 molecules, radicals and biradicals from more than 800 hydrides and halogenides possess higherΔHf0 values compared with their fragments with elements in lower valent states with H 2 (rarely HX) as a partner. This might be treated only in the sense that the parent species are less stable than the system [fragment + H 2 (or

  18. An unusual Middle Permian flora from the Blaine Formation (Pease River Group: Leonardian-Guadalupian Series) of King County, West Texas

    USGS Publications Warehouse

    DiMichele, W.A.; Hook, R.W.; Nelson, W.J.; Chaney, D.S.

    2004-01-01

    A new Middle Permian plant assemblage from South Ash Pasture in King County, Texas, may be the youngest and is certainly the most unusual flora known from the Permian of either West Texas or adjoining north-central Texas. Found serendipitously in the evaporite-rich upper Blaine Formation (Pease River Group, Guadalupian Series), the flora is of very low diversity despite intensive collecting efforts, and the affinities of nearly all taxa are enigmatic. The most common elements are parallel-veined leaves that resemble cordaites but that could be isolated pinnules of a pinnate leaf. Gigantopterid foliage is present but not assignable to any known taxon. A single foliar conifer specimen is too incomplete for assignment. Numerous reproductive organs, however, and an abundance of axes may represent conifers. Conchostracans, palaeoniscoid fish scales, and small heteropolar coprolites also occur in the deposit, which originated as a small, claystone-dominated channel fill in a coastal plain setting.

  19. Conversion of membrane lipid acyl groups to triacylglycerol and formation of lipid bodies upon nitrogen starvation in biofuel green algae Chlorella UTEX29.

    PubMed

    Goncalves, Elton C; Johnson, Jodie V; Rathinasabapathi, Bala

    2013-11-01

    Algal lipids are ideal biofuel sources. Our objective was to determine the contributors to triacylglycerol (TAG) accumulation and lipid body formation in Chlorella UTEX29 under nitrogen (N) deprivation. A fivefold increase in intracellular lipids following N starvation for 24 h confirmed the oleaginous characteristics of UTEX29. Ultrastructural studies revealed increased number of lipid bodies and decreased starch granules in N-starved cells compared to N-replete cells. Lipid bodies were observed as early as 3 h after N removal and plastids collapsed after 48 h of stress. Moreover, the identification of intracellular pyrenoids and differences in the expected nutritional requirements for Chlorella protothecoides (as UTEX29 is currently classified) led us to conduct a phylogenetic study using 18S and actin cDNA sequences. This indicated UTEX29 to be more phylogenetically related to Chlorella vulgaris. To investigate the fate of different lipids after N starvation, radiolabeling using ¹⁴C-acetate was used. A significant decrease in ¹⁴C-galactolipids and phospholipids matched the increase in ¹⁴C-TAG starting at 3 h of N starvation, consistent with acyl groups from structural lipids as sources for TAG under N starvation. These results have important implications for the identification of key steps controlling oil accumulation in N-starved biofuel algae and demonstrate membrane recycling during lipid body formation.

  20. Galaxy And Mass Assembly (GAMA): Gas Fueling of Spiral Galaxies in the Local Universe. I. The Effect of the Group Environment on Star Formation in Spiral Galaxies

    NASA Astrophysics Data System (ADS)

    Grootes, M. W.; Tuffs, R. J.; Popescu, C. C.; Norberg, P.; Robotham, A. S. G.; Liske, J.; Andrae, E.; Baldry, I. K.; Gunawardhana, M.; Kelvin, L. S.; Madore, B. F.; Seibert, M.; Taylor, E. N.; Alpaslan, M.; Brown, M. J. I.; Cluver, M. E.; Driver, S. P.; Bland-Hawthorn, J.; Holwerda, B. W.; Hopkins, A. M.; Lopez-Sanchez, A. R.; Loveday, J.; Rushton, M.

    2017-03-01

    We quantify the effect of the galaxy group environment (for group masses of 1012.5–1014.0 M ⊙) on the current star formation rate (SFR) of a pure, morphologically selected sample of disk-dominated (i.e., late-type spiral) galaxies with redshift ≤0.13. The sample embraces a full representation of quiescent and star-forming disks with stellar mass M * ≥ 109.5 M ⊙. We focus on the effects on SFR of interactions between grouped galaxies and the putative intrahalo medium (IHM) of their host group dark matter halos, isolating these effects from those induced through galaxy–galaxy interactions, and utilizing a radiation transfer analysis to remove the inclination dependence of derived SFRs. The dependence of SFR on M * is controlled for by measuring offsets Δlog(ψ *) of grouped galaxies about a single power-law relation in specific SFR, {\\psi }* \\propto {M}* -0.45+/- 0.01, exhibited by non-grouped “field” galaxies in the sample. While a small minority of the group satellites are strongly quenched, the group centrals and a large majority of satellites exhibit levels of ψ * statistically indistinguishable from their field counterparts, for all M *, albeit with a higher scatter of 0.44 dex about the field reference relation (versus 0.27 dex for the field). Modeling the distributions in Δlog(ψ *), we find that (i) after infall into groups, disk-dominated galaxies continue to be characterized by a similar rapid cycling of gas into and out of their interstellar medium shown prior to infall, with inflows and outflows of ∼1.5–5 x SFR and ∼1–4 x SFR, respectively; and (ii) the independence of the continuity of these gas flow cycles on M * appears inconsistent with the required fueling being sourced from gas in the circumgalactic medium on scales of ∼100 kpc. Instead, our data favor ongoing fueling of satellites from the IHM of the host group halo on ∼Mpc scales, i.e., from gas not initially associated with the galaxies upon infall. Consequently

  1. Prediction of Enthalpy of Formation in the Solid State (at 298.15 K) using Second-Order Group Contributions. Part 1. Carbon-Hydrogen and Carbon-Hydrogen-Oxygen Compounds

    NASA Astrophysics Data System (ADS)

    Salmon, Anna; Dalmazzone, Didier

    2006-09-01

    A predictive method, based on Benson's group additivity technique, is developed for calculating the enthalpy of formation in the solid phase, at 298.15K, of carbon-hydrogen compounds and carbon-hydrogen-oxygen compounds. A complete database compiles 398 experimental enthalpies of formation. The whole group contribution values, ring strain corrections, and nonnearest neighbor interactions evaluated are listed. Finally a comparison with Cohen's method indicates that this new estimation method leads to higher precision and reliability.

  2. Mechanistic Insights of Ethanol Steam Reforming over Ni–CeO x (111): The Importance of Hydroxyl Groups for Suppressing Coke Formation

    DOE PAGES

    Liu, Zongyuan; Duchoň, Tomáš; Wang, Huanru; ...

    2015-07-30

    We have studied the reaction of ethanol and water over Ni–CeO2-x(111) model surfaces to elucidate the mechanistic steps associated with the ethanol steam reforming (ESR) reaction. Our results provide insights about the importance of hydroxyl groups to the ESR reaction over Ni-based catalysts. Systematically, we have investigated the reaction of ethanol on Ni–CeO2-x(111) at varying Ce³⁺ concentrations (CeO1.8–2.0) with absence/presence of water using a combination of soft X-ray photoelectron spectroscopy (sXPS) and temperature-programmed desorption (TPD). Consistent with previous reports, upon annealing, metallic Ni formed on reduced ceria while NiO was the main component on fully oxidized ceria. Ni⁰ is themore » active phase leading to both the C–C and C–H cleavage of ethanol but is also responsible for carbon accumulation or coking. We have identified a Ni₃C phase that formed prior to the formation of coke. At temperatures above 600K, the lattice oxygen from ceria and the hydroxyl groups from water interact cooperatively in the removal of coke, likely through a strong metal–support interaction between nickel and ceria that facilitates oxygen transfer.« less

  3. Formation of lysosulfatide, 3',6'-anhydropsychosine, ceramide, and sphingosine by saponification of cerebroside sulfate. Effect of the sulfate group on the hydrolysis.

    PubMed

    Nonaka, G; Kishimoto, Y; Seyama, Y; Yamakawa, T

    1979-02-01

    Saponification of cerebroside sulfate (sulfatide) by refluxing with 1 N KOH in 90% n-butanol for 1 h yielded ceramide, sphingosine, lysosulfatide (psychosine-3'-sulfate ester) and a hitherto unknown compound. The latter compound was identified as 3,6-anhydrogalactosyl sphingosine (3',6'-anhydropsychosine) from its mass spectrum. The structure of lysosulfatide was confirmed by reacylating it to sulfatide by condensing it with lignoceroyl chloride. The resulting sulfatide, which was chromatographically identical to control sulfatides, was not oxidized by periodate. The sulfatide was also permethylated and methanolyzed. The sugar moiety obtained was identified as methyl 2,4,6-tri-O-methylgalactoside by gas-liquid chromatography and thin-layer chromatography. The presence of the sulfate group in lysosulfatide was further confirmed by IR spectroscopy and the presence of radioactivity when it was prepared from [35S]sulfatide. The effect of the sulfate group on cleavage of the galactoside linkage and on the formation of the 3,6-anhydro derivative is discussed.

  4. Mechanistic Insights of Ethanol Steam Reforming over Ni–CeO x (111): The Importance of Hydroxyl Groups for Suppressing Coke Formation

    SciTech Connect

    Liu, Zongyuan; Duchoň, Tomáš; Wang, Huanru; Peterson, Erik W.; Zhou, Yinghui; Luo, Si; Zhou, Jing; Matolín, Vladimir; Stacchiola, Dario J.; Rodriguez, José A.; Senanayake, Sanjaya D.

    2015-07-30

    We have studied the reaction of ethanol and water over Ni–CeO2-x(111) model surfaces to elucidate the mechanistic steps associated with the ethanol steam reforming (ESR) reaction. Our results provide insights about the importance of hydroxyl groups to the ESR reaction over Ni-based catalysts. Systematically, we have investigated the reaction of ethanol on Ni–CeO2-x(111) at varying Ce³⁺ concentrations (CeO1.8–2.0) with absence/presence of water using a combination of soft X-ray photoelectron spectroscopy (sXPS) and temperature-programmed desorption (TPD). Consistent with previous reports, upon annealing, metallic Ni formed on reduced ceria while NiO was the main component on fully oxidized ceria. Ni⁰ is the active phase leading to both the C–C and C–H cleavage of ethanol but is also responsible for carbon accumulation or coking. We have identified a Ni₃C phase that formed prior to the formation of coke. At temperatures above 600K, the lattice oxygen from ceria and the hydroxyl groups from water interact cooperatively in the removal of coke, likely through a strong metal–support interaction between nickel and ceria that facilitates oxygen transfer.

  5. Influence of surface oxygenated groups on the formation of active Cu species and the catalytic activity of Cu/AC catalyst for the synthesis of dimethyl carbonate

    NASA Astrophysics Data System (ADS)

    Zhang, Guoqiang; Li, Zhong; Zheng, Huayan; Hao, Zhiqiang; Wang, Xia; Wang, Jiajun

    2016-12-01

    Activated carbon (AC) supported Cu catalysts are employed to study the influence of surface oxygenated groups on the formation of active Cu species and the catalytic activity of Cu/AC catalyst for oxidative carbonylation of methanol to dimethyl carbonate (DMC). The AC supports are thermal treated under different temperatures in order to adjust the levels of surface oxygenated groups. The AC supports are characterized by BET, TPD-MS and XRD, and the Cu/AC catalysts are characterized by BET, XRD, TEM, XPS, AAS, CH3OH-TPD and N2O chemisorption. The results show that as the treatment temperature is below 800 °C, the BET surface area of the corresponding AC supports are nearly unchanged and close to that of the original AC (1529.6 m2/g). But as the thermal treatment temperature is elevated from 1000 to 1600 °C, the BET surface area of AC supports gradually decreases from 1407.6 to 972.2 m2/g. After loading of Cu, the BET surface area of copper catalysts is in the range of 834.4 to 1545.3 m2/g, which is slightly less than that of the respective supports. When AC is thermal treated at 400 and 600 °C, the unstable carboxylic acid and anhydrides groups are selectively removed, which has weakened the mobility and agglomeration of Cu species during the calcination process, and thus improve the Cu species dispersion over AC support. But as the treatment temperature is elevated from 600 °C to 1200 °C, the Cu species dispersion begins to decline suggesting further removal of stable surface oxygenated groups is unfavorable for Cu species dispersion. Moreover, higher thermal treatment temperature (above 1200 °C) promotes the graphitization degree of AC and leds to the decrease of Cu loading on AC support. Meanwhile, the removal of surface oxygenated groups by thermal treatment is conducive to the formation of more π-sites, and thus promote the reduction of Cu2+ to Cu+ and Cu0 as active centers. The specific surface area of (Cu+ + Cu0) is improved by thermal treatment of AC

  6. Grouped exposed metal heaters

    SciTech Connect

    Vinegar, Harold J.; Coit, William George; Griffin, Peter Terry; Hamilton, Paul Taylor; Hsu, Chia-Fu; Mason, Stanley Leroy; Samuel, Allan James; Watkins, Ronnie Wade

    2010-11-09

    A system for treating a hydrocarbon containing formation is described. The system includes two or more groups of elongated heaters. The group includes two or more heaters placed in two or more openings in the formation. The heaters in the group are electrically coupled below the surface of the formation. The openings include at least partially uncased wellbores in a hydrocarbon layer of the formation. The groups are electrically configured such that current flow through the formation between at least two groups is inhibited. The heaters are configured to provide heat to the formation.

  7. Grouped exposed metal heaters

    DOEpatents

    Vinegar, Harold J [Bellaire, TX; Coit, William George [Bellaire, TX; Griffin, Peter Terry [Brixham, GB; Hamilton, Paul Taylor [Houston, TX; Hsu, Chia-Fu [Granada Hills, CA; Mason, Stanley Leroy [Allen, TX; Samuel, Allan James [Kular Lumpar, ML; Watkins, Ronnie Wade [Cypress, TX

    2012-07-31

    A system for treating a hydrocarbon containing formation is described. The system includes two or more groups of elongated heaters. The group includes two or more heaters placed in two or more openings in the formation. The heaters in the group are electrically coupled below the surface of the formation. The openings include at least partially uncased wellbores in a hydrocarbon layer of the formation. The groups are electrically configured such that current flow through the formation between at least two groups is inhibited. The heaters are configured to provide heat to the formation.

  8. Production history matching to determine reservoir properties of important coal groups in the Upper Pottsville formation, Brookwood and Oak Grove fields, Black Warrior Basin, Alabama

    PubMed Central

    Karacan, C. Özgen

    2015-01-01

    The Black Warrior Basin of Alabama is one of the most important coal mining and coalbed methane production areas in the United States. Methane control efforts through degasification that started almost 25 years ago for the sole purpose of ensuring mining safety resulted in more than 5000 coalbed methane wells distributed within various fields throughout the basin. The wells are completed mostly in the Pratt, Mary Lee, and Black Creek coal groups of the Upper Pottsville formation and present a unique opportunity to understand methane reservoir properties of these coals and to improve their degasification performances. The Brookwood and Oak Grove fields in the Black Warrior Basin are probably two of the most important fields in the basin due to current longwall coal mining activities. In this work, methane and water productions of 92 vertical wellbores drilled, some completed 20 years ago, over a current large coal mine district located in these two fields, were analyzed by history matching techniques. The boreholes were completed at the Mary Lee coal group, or at combinations of the Pratt, Mary Lee, and Black Creek groups. History matching models were prepared and performed according to properties of each coal group. Decline curve analyses showed that effective exponential decline rates of the wells were between 2% and 25% per year. Results of production history matching showed, although they varied by coal group, that pressure decreased as much as 80% to nearly 25 psi in some areas and resulted in corresponding decreases in methane content. Water saturation in coals decreased from 100% to between 20 and 80%, improving gas relative permeabilities to as much as 0.8. As a result of primary depletion, permeability of coal seams increased between 10 and 40% compared to their original permeability, which varied between 1 and 10 md depending on depth and coal seam. These results not only can be used for diagnostic and interpretation purposes, but can be used as parameter

  9. Explosive lava-water interactions in Elysium Planitia, Mars: Geologic and thermodynamic constraints on the formation of the Tartarus Colles cone groups

    NASA Astrophysics Data System (ADS)

    Hamilton, Christopher W.; Fagents, Sarah A.; Wilson, Lionel

    2010-09-01

    Volcanic rootless constructs (VRCs) are the products of explosive lava-water interactions. VRCs are significant because they imply the presence of active lava and an underlying aqueous phase (e.g., groundwater or ice) at the time of their formation. Combined mapping of VRC locations, age-dating of their host lava surfaces, and thermodynamic modeling of lava-substrate interactions can therefore constrain where and when water has been present in volcanic regions. This information is valuable for identifying fossil hydrothermal systems and determining relationships between climate, near-surface water abundance, and the potential development of habitable niches on Mars. We examined the western Tartarus Colles region (25-27°N, 170-171°E) in northeastern Elysium Planitia, Mars, and identified 167 VRC groups with a total area of ˜2000 km2. These VRCs preferentially occur where lava is ˜60 m thick. Crater size-frequency relationships suggest the VRCs formed during the late to middle Amazonian. Modeling results suggest that at the time of VRC formation, near-surface substrate was partially desiccated, but that the depth to the midlatitude ice table was $\\lesssim$42 m. This ground ice stability zone is consistent with climate models that predict intermediate obliquity (˜35°) between 75 and 250 Ma, with obliquity excursions descending to ˜25-32°. For lava thicknesses ranging from 30 to 60 m and ground ice fractions ranging from 0.1 to 0.3, an ice volume of ˜4-23 km3 could have been melted and/or vaporized by the time the lava solidified, and the associated hydrothermal systems could have retained temperatures >273 K for up to ˜1300 years.

  10. Stratigraphic correlation of the Awahab and Tafelberg Formations, Etendeka Group, Namibia, and location of an eruptive site for flood basalt volcanism

    NASA Astrophysics Data System (ADS)

    Marsh, J. S.; Milner, S. C.

    2007-08-01

    Detailed field and geochemical investigations in the vicinity of the type section of the Tafelberg Formation of the early Cretaceous Etendeka Group, NW Namibia, have revealed the existence of a large eruptive vent in the lower part of the regional volcanic sequence produced by Strombolian and Vulcanian eruptions. The vent is filled with the thick, differentiated, ponded Kudu-Run olivine-rich basaltic flow, which has a distinctive low Zr/Y geochemical signature as well as a Tafelberg-type tabular basalt and the Nil Desperandum latite. Field evidence indicates that the Kudu-Run basalt and the latite were erupted from fissures located within the vent. Associated with the vent is an extensive pyroclastic apron extending from the vent edge and which is interbedded with the regional stratigraphy. Blocks of Precambrain basement lithologies occur within this deposit and indicate that the vent was excavated to a depth of at least 350 m below the palaeosurface at that time. The original Tafelberg Formation type section described by Erlank et al. [Erlank, A.J., Marsh, J.S., Duncan, A.R., Miller, R.McG., Hawkesworth, C.H., Betton, P.J., Rex, D.C. 1984. Geochemistry and petrogenesis of the Etendeka volcanic rocks from SWA/Namibia, 195-247. In: Erlank, A.J. (Ed.), Petrogenesis of Volcanic Rocks of the Karoo province. Special Publication of the Geological Society of South Africa, vol. 13, 395 p.] the Tafelberg Gully section, crosses from the lower part of the regional sequence into the intra-vent sequence and returns to the regional sequence higher up. In doing so it includes some of the localized intra-vent flows and excludes a number of flows which are part of the regional sequence in its lower part, thus rendering it inappropriate as a type section. A revised type section for the Tafelberg Formation is described by combining the upper part of the Tafelberg Gully section with a new section of 14 flows at the base of the regional sequence in the Tafelberg North (TBN) section

  11. Formative Work to Develop a Tailored HIV Testing Smartphone App for Diverse, At-Risk, HIV-Negative Men Who Have Sex With Men: A Focus Group Study

    PubMed Central

    Torres, Maria Beatriz; Joe, Jennifer; Danh, Thu; Gass, Bobbi; Horvath, Keith J

    2016-01-01

    Background Although gay, bisexual, and other men who have sex with men (MSM) are disproportionately affected by human immunodeficiency virus (HIV) infection, few test for HIV at regular intervals. Smartphone apps may be an ideal tool to increase regular testing among MSM. However, the success of apps to encourage regular testing among MSM will depend on how frequently the apps are downloaded, whether they continue to be used over months or years, and the degree to which such apps are tailored to the needs of this population. Objective The primary objectives of this study were to answer the following questions. (1) What features and functions of smartphone apps do MSM believe are associated with downloading apps to their mobile phones? (2) What features and functions of smartphone apps are most likely to influence MSM’s sustained use of apps over time? (3) What features and functions do MSM prefer in an HIV testing smartphone app? Methods We conducted focus groups (n=7, with a total of 34 participants) with a racially and ethnically diverse group of sexually active HIV-negative MSM (mean age 32 years; 11/34 men, 33%, tested for HIV ≥10 months ago) in the United States in Miami, Florida and Minneapolis, Minnesota. Focus groups were digitally recorded, transcribed verbatim, and deidentified for analysis. We used a constant comparison method (ie, grounded theory coding) to examine and reexamine the themes that emerged from the focus groups. Results Men reported cost, security, and efficiency as their primary reasons influencing whether they download an app. Usefulness and perceived necessity, as well as peer and posted reviews, affected whether they downloaded and used the app over time. Factors that influenced whether they keep and continue to use an app over time included reliability, ease of use, and frequency of updates. Poor performance and functionality and lack of use were the primary reasons why men would delete an app from their phone. Participants also

  12. Mixed-Format Test Score Equating: Effect of Item-Type Multidimensionality, Length and Composition of Common-Item Set, and Group Ability Difference

    ERIC Educational Resources Information Center

    Wang, Wei

    2013-01-01

    Mixed-format tests containing both multiple-choice (MC) items and constructed-response (CR) items are now widely used in many testing programs. Mixed-format tests often are considered to be superior to tests containing only MC items although the use of multiple item formats leads to measurement challenges in the context of equating conducted under…

  13. Paleomagnetic and magnetostratigraphic investigations of the whitehorse group/quartermaster (Dewey Lake) formation (upper permian-lowermost triassic) in the Palo Duro basin, northwest Texas, USA

    NASA Astrophysics Data System (ADS)

    Collins, Dylan R.

    In northwest Texas, upper Permian to lowermost Triassic hematite-cemented detrital sedimentary rocks, which include a small number of regionally extensive ash beds, were deposited during the time interval of the greatest mass extinction event sequences in Earth history. The magnetic polarity stratigraphy, as well as key rock magnetic properties, of the upper Whitehorse Group (WH) and Quartermaster formations (QM) at selected sections in the Palo Duro Basin, have been determined using thermal, and chemical demagnetization approaches and anisotropy of magnetic susceptibility, acquisition of isothermal remanent magnetization (IRM) and backfield demagnetization, and thermal demagnetization of three component IRM methods. Demagnetization results show that the WH/QM contains a primary/near-primary characteristic remanent magnetization at each level sampled and thus the magnetic polarity stratigraphy for each section can be compared with existing polarity time scales across the Permian-Triassic boundary. Estimated site mean directions yield a paleomagnetic pole for the latest Permian for North America of 57.8°N, 130.6°E from 38 sampled sites.

  14. Studies in Neotropical paleobotany. XI. Late Tertiaryvegetation and environments of southeastern Guatemala: palynofloras fromthe Mio-Pliocene Padre Miguel Group and the Pliocene HerreriaFormation.

    PubMed

    Graham, A

    1998-10-01

    Plant microfossils are reported from the late Tertiary Padre MiguelGroup and the Pliocene Herrería Formation of southeasternGuatemala. The most abundant palynomorphs are cf. Acrostichum(maximum 45%), Cyperaceae (29%), cf. Antrophyum(27%), monolete fern spores (16%), and Pinus(11%). Pollen grains of Picea, Juglans,Quercus, and Ulmus, primarily from the Padre Miguelflora, reveal the presence of a northern cool-temperate element. Theyounger Herrería flora is more lowland and warm temperate. Inthe absence of evidence for substantially higher elevations, thedifferences between the Neogene and modern vegetation are attributedmostly to climate. MAT (mean annual temperature) is estimated2°-3°C cooler than at present for the Padre Miguel flora,and ∼3.5°C warmer for the Herrería flora. There islittle evidence for arid vegetation, and the tropical rain forest wasabsent or poorly represented. These data are consistent with those ofother fossil floras in the region and with trends suggested by isotopicpaleotemperature analysis and global sea-level changes. The Guatemalaassemblages further provide evidence that the current version of thetropical rain forest is recent in origin and has undergone considerablechange in its range and composition throughout the lateCenozoic.

  15. Preliminary paleomagnetic results from the Triassic Prida Formation (Lower Star Peak Group), west-central Nevada, and implications for latitudinal displacement

    SciTech Connect

    Geissman, J.Wm. ); Gillett, S.L. ); Oldow, J.S. )

    1990-05-01

    Paleomagnetic data were obtained from two oppositely dipping carbonate sections of the Triassic Prida Formation, lower Star Peak Group, in the Humboldt Range of west-central Nevada. Progressive demagnetization of the rocks indicated that the remanent magnetization consists of three or fewer vector components. A characteristic component, with the highest unblocking temperatures, was most effectively isolated by low temperature (200-300C) thermal followed by progressive alternating field demagnetization. The sections yield in situ mean directions that differ significantly, but that have similar inclinations (Star Canyon: D=311, I=+34, {alpha}95=5, k=22, N=38 samples; Fossil Hill: D=281, I=+33, {alpha}95=2{degree}, k=2814, N=3 section means, 154 samples). The directions diverge upon simple structural correction, from which the authors infer that at least one and probably both of the sections were remagnetized, probably in latest Middle to Late Jurassic time. These data cannot be used to indicate significant southward translation of Golconda allochthon rocks, as inferred from magnetizations in underlying volcanic rocks. The translation interpretation may require revision if magnetizations in the volcanic rocks are also secondary.

  16. Coal geology of the Paleocene-Eocene Calvert Bluff Formation (Wilcox Group) and the Eocene Manning Formation (Jackson Group) in east-central Texas; field trip guidebook for the Society for Organic Petrology, Twelfth Annual Meeting, The Woodlands, Texas, August 30, 1995

    USGS Publications Warehouse

    Warwick, Peter D.; Crowley, Sharon S.

    1995-01-01

    The Jackson and Wilcox Groups of eastern Texas (fig. 1) are the major lignite producing intervals in the Gulf Region. Within these groups, the major lignite-producing formations are the Paleocene-Eocene Calvert Bluff Formation (Wilcox) and the Eocene Manning Formation (Jackson). According to the Keystone Coal Industry Manual (Maclean Hunter Publishing Company, 1994), the Gulf Coast basin produces about 57 million short tons of lignite annually. The state of Texas ranks number 6 in coal production in the United States. Most of the lignite is used for electric power generation in mine-mouth power plant facilities. In recent years, particular interest has been given to lignite quality and the distribution and concentration of about a dozen trace elements that have been identified as potential hazardous air pollutants (HAPs) by the 1990 Clean Air Act Amendments. As pointed out by Oman and Finkelman (1994), Gulf Coast lignite deposits have elevated concentrations of many of the HAPs elements (Be, Cd, Co, Cr, Hg, Mn, Se, U) on a as-received gm/mmBtu basis when compared to other United States coal deposits used for fuel in thermo-electric power plants. Although regulations have not yet been established for acceptable emissions of the HAPs elements during coal burning, considerable research effort has been given to the characterization of these elements in coal feed stocks. The general purpose of the present field trip and of the accompanying collection of papers is to investigate how various aspects of east Texas lignite geology might collectively influence the quality of the lignite fuel. We hope that this collection of papers will help future researchers understand the complex, multifaceted interrelations of coal geology, petrology, palynology and coal quality, and that this introduction to the geology of the lignite deposits of east Texas might serve as a stimulus for new ideas to be applied to other coal basins in the U.S. and abroad.

  17. Multiple embryos in the Lepidocyclina pustulosa group as possible indicators of palaeoenvironmental conditions: The case of the Late Eocene Toluviejo Formation (Sinú Domain, Caribbean, Colombia

    NASA Astrophysics Data System (ADS)

    Baumgartner-Mora, Claudia; Baumgartner, Peter O.; Rincón Martínez, Daniel; Salazar Ortiz, Edward A.

    2016-04-01

    The Middle-Late Eocene Toluviejo Formation of the Sinú-San Jacinto folded belt (Caribbean, Colombia) contains 15-75 m thick, grey, massive limestone sequences that are interbedded with terrigenous nearshore to offshore mudstones to quartzose sandstones and conglomerates. The formation accumulated in a transitional continent-ocean setting, probably on oceanic crust. We studied over 80 polished thin sections under light microscopy and cathodoluminescence (CL) to analyse carbonate microfacies and Larger Benthic Foraminifera (LBF). The overall facies distribution is 3-fold: (1) Facies close to the shoreline are dominated by low diversity operculinid assemblages, rich in detrital elements. (2) Shallow offshore facies are characterized by round lepidocyclinids, associated with, and often encrusted by, corallinacean algae, Sporolithon and structureless microbial crusts. The matrix is rich in carbonate/detrital mud and sand-sized detritals. (3) Distal offshore facies on structural highs show abundance of flat, current-sorted lepidoclinids without a noticeable detrital component. Facies 1 and 2 are clearly under the influence of suspension- and dissolved-nutrient input, probably carried offshore by freshwater lids of river plumes. Facies (2) contains abundant specimens of the Lepidocyclina pustulosa group of which the macrospheric forms show complicated embryonic apparatuses, which suppose double or multiple embryos. Detailed observation under CL allows to count up to 6-8 embryos, often seen aligned in the equatorial plane. The embryonic apparatus occupies often more than half of the diameter of specimens. The tendency towards large, very flat embryonic apparatuses (diameter measured in axial cuts up to 2,5 mm for a thickness of 0.2-0.3 mm) is closely correlated with abundant coralgal and microbial encrustations, oxide-stained carbonate/detrital mud and probably some preserved organic matter. The presence of multiple embryos has been reported by several authors and has

  18. Petrography and geochemistry of selected lignite beds in the Gibbons Creek mine (Manning Formation, Jackson Group, Paleocene) of east-central Texas

    USGS Publications Warehouse

    Warwick, P.D.; Crowley, S.S.; Ruppert, L.F.; Pontolillo, J.

    1997-01-01

    This study examined the petrographic and geochemical characteristics of two lignite beds (3500 and 4500 beds, Manning Formation, Jackson Group, Eocene) that are mined at the Gibbons Creek mine in east-central Texas. The purpose of the study was to identify the relations among sample ash yield, coal petrography, and trace-element concentrations in lignite and adjoining rock layers of the Gibbons Creek mine. Particular interest was given to the distribution of 12 environmentally sensitive trace elements (As, Be, Cd, Cr, Co, Hg, Mn, Ni, Pb, Sb, Se, and U) that have been identified as potentially hazardous air pollutants (HAPs) in the United States Clean Air Act Amendments of 1990. Eleven lignite, floor, and rock parting samples were collected from incremental channel samples of the 3500 and 4500 beds that were exposed in a highwall of pit A3 at the Gibbons Creek mine. Short proximate and ultimate and forms of sulfur analyses were performed on all lignite samples, and lignite and rock samples were analyzed for 60 major, minor and trace elements. Representative splits of all lignite samples were ground and cast into pellets, and polished for petrographic analyses in blue-light fluorescence and reflected white light to determine liptinite, inertinite, and huminite maceral group percentages. The following observations summarize our results and conclusions about the geochemistry, petrography, and sedimentology of the 3500 and 4500 beds of the Gibbons Creek lignite deposit: (1) Weighted average dry (db) ash yield for the two beds is 29.7%, average total sulfur content is 2.6%, and average calorific value is 7832 Btu (18.22 MJ/kg). Ash yields are greatest in the lower bench (59.33% db) of the 3500 bed and in the upper bench of the 4500 bed (74.61% db). (2) For lignite samples (on a whole-coal basis), the distributions of two of the HAPs (Pb and Sb) are positively related to ash yield, probably indicating an inorganic affinity for these elements. By using cluster analysis we

  19. Paleomagnetic results from the Upper Unkar Group and overlying Nankoweap Formation from the Grand Canyon Supergroup (GCSG), Arizona: Implications for Laurentia's Neoproterozoic APWP

    NASA Astrophysics Data System (ADS)

    Weil, A. B.; Geissman, J.; Van der Voo, R.

    2001-12-01

    Paleomagnetic sampling was carried out within the Cardenas basalts and an underlying suite of mafic intrusions from the uppermost Unkar Group (lower GCSG), as well as from the unconformably overlying Nankoweap Fm. The GCSG is one of the thickest and best preserved Neoproterozoic sequences in North America. The lower GCSG was deposited between 1200 Ma (cooling age of the underlying Vishnu schist) and about 1100 Ma (Rb-Sr dates on Cardenas basalts) during a failed rift event. The Nankoweap Fm. is hypothesized to have been deposited during extension subsequent to deposition of the lower GCSG; however, the relationship of the Nankoweap Fm. to the underlying lower GCSG and the overlying upper GCSG is poorly understood. The estimated age of the Nankoweap Fm. is 950 Ma. Sixteen sites were collected from the Cardenas basalts and from a suite of dikes and sills that intrude the Unkar Group. The dikes and sills are considered feeders to the Cardenas basalt, based on geochemical similarities and stratigraphic relationships. After thermal treatment the sixteen sites yield a stable characteristic magnetization direction of D = 286\\deg %, I = +58\\deg % (kappa = 26, alpha95 = 7), corresponding to a paleopole of 181\\deg % E, 33\\deg % N. The remanence in the intrusions is confirmed by a partial contact test on host Dox Formation strata. The samples collected along the margin of the dikes give statistically the same normal-polarity direction as the intrusion; however, samples more than several dike widths from the contact yield mainly unresolvable characteristic remanence directions. Nine sites were collected from the Nankoweap Fm., which unconformably overlies the Cardenas basalts. After thermal treatment the nine sites yield a stable characteristic magnetization direction of D = 257\\deg %, I = -3\\deg % (kappa = 80, alpha95 = 7.5), which corresponds to a paleopole of 165\\deg % E, 11\\deg % S. A fold test of the nine sites reveals a pre-folding magnetization acquisition

  20. Prediction of Enthalpy of Formation in the Solid State (at 298.15K) Using Second-Order Group Contributions—Part 2: Carbon-Hydrogen, Carbon-Hydrogen-Oxygen, and Carbon-Hydrogen-Nitrogen-Oxygen Compounds

    NASA Astrophysics Data System (ADS)

    Salmon, Anna; Dalmazzone, Didier

    2007-03-01

    A program has been undertaken to develop a new group contribution method, based on Benson's group additivity technique, estimate as precisely as possible solid state enthalpies of formation, at 298.15K, of C -H compounds, C -H-O compounds, and C -H-N-O compounds. A set of 1017 experimental values of the enthalpy of formation has been studied and compared to the predicted values of this new method as well as the method of Domalski and Hearing. This new estimation technique leads to a higher precision and reliability. With the inclusion of additional group values, a wider range of compounds can be studied (compared to the Domalski and Hearing technique). Comparison with a quantum mechanical method [Rice et al., Combust. Flame 118, 445 (1999)] shows that the list of group contribution values, ring strain corrections, and non-nearest neighbor interactions provided here yields better estimates overall.

  1. Preventing aspartimide formation in Fmoc SPPS of Asp-Gly containing peptides--practical aspects of new trialkylcarbinol based protecting groups.

    PubMed

    Behrendt, Raymond; Huber, Simon; White, Peter

    2016-02-01

    In our efforts to develop a universal solution to the problem of aspartimide formation in Fmoc SPPS, we investigated the application of our new β-trialkylmethyl protected aspartic acid building blocks to the synthesis of peptides containing the Asp-Gly motif. The N(α)-Fmoc aspartic acid β-tri-(ethyl/propyl/butyl)methyl esters were used in the synthesis of the classic model peptide scorpion toxin II (VKDGYI), and their effectiveness in minimising aspartimide formation during extended piperidine treatments was evaluated. Furthermore, we compared their efficacy against that of the commonly used approach of adding acids to the Fmoc deprotection solution. Finally, we applied our aspartic acid building blocks to the stepwise Fmoc SPPS of teduglutide, a human GLP-2 analogue, whose synthesis is made challenging by extensive aspartimide formation. In all experiments, our approach led to almost complete reduction of aspartimide formation with accompanied suppression of aspartic acid epimerisation.

  2. The Distribution of Instructional Time and Its Effect on Group Cohesion in the Foreign Language Classroom: A Comparison of Intensive and Standard Format Courses

    ERIC Educational Resources Information Center

    Hinger, Barbara

    2006-01-01

    This paper argues for the influence of the distribution of instructional time on group cohesion in the foreign language classroom and postulates that concentrating classroom time enhances group cohesion. To test the hypothesis, a comparative classroom study of two groups of Spanish learners in their second year of learning, one following an…

  3. Stratigraphic and structural data for the Conasauga Group and the Rome Formation on the Copper Creek fault block near Oak Ridge, Tennessee: preliminary results from test borehole ORNL-JOY No. 2

    SciTech Connect

    Haase, C.S.; Walls, E.C.; Farmer, C.D.

    1985-06-01

    To resolve long-standing problems with the stratigraphy of the Conasauga Group and the Rome Formation on the Copper Creek fault block near Oak Ridge National Laboratory (ORNL), an 828.5-m-deep test borehole was drilled. Continuous rock core was recovered from the 17.7- to 828.5-m-deep interval; temperature, caliper, neutron, gamma-ray, and acoustic (velocity and televiewer) logs were obtained. The Conasauga Group at the study site is 572.4 m thick and comprises six formations that are - in descending stratigraphic order - Maynardville Limestone (98.8 m), Nolichucky Shale (167.9 m), Maryville Limestone (141.1 m), Rogersville Shale (39.6 m), Rutledge Limestone (30.8 m), and Pumpkin Valley Shale (94.2 m). The formations are lithologically complex, ranging from clastics that consist of shales, mudstones, and siltstones to carbonates that consist of micrites, wackestones, packstones, and conglomerates. The Rome Formation is 188.1 m thick and consists of variably bedded mudstones, siltstones, and sandstones. The Rome Formation thickness represents 88.1 m of relatively undeformed section and 100.0 m of highly deformed, jumbled, and partially repeated section. The bottom of the Rome Formation is marked by a tectonic disconformity that occurs within a 46-m-thick, intensely deformed interval caused by motion along the Copper Creek fault. Results from this study establish the stratigraphy and the lithology of the Conasauga Group and the Rome Formation near ORNL and, for the first time, allow for the unambiguous correlation of cores and geophysical logs from boreholes elsewhere in the ORNL vicinity. 45 refs., 26 figs., 2 tabs.

  4. Stratigraphy, sedimentology, and ichnology of the Late Pennsylvanian Glenshaw Formation (Lower Conemaugh Group), southern Dunkard basin, Ohio-Kentucky-West Virginia

    SciTech Connect

    Martino, R.L. . Dept. of Geology)

    1994-03-01

    Facies analysis of outcrops of the Glenshaw Formation was carried out at 45 localities over a 761 sq. km area. The glenshaw Formation is 61--76 m thick in the study area. Four marine units (Lower Brush Creek, Upper Brush Creek, Cambridge , and Ames) occur which contain invertebrate body fossils and/or trace fossils including Teichichnus, Rhizocorallium, Aulichnites, Paleophycus, Lockeia, and Curvolithus. Alluvial channel-fills contain internal features that reflect deposition in high sinuosity suspended or mixed load rivers. Paleocurrent data (N = 77) are broadly dispersed with a mean azimuth of 335 degrees. Overbank facies have yielded trackways from giant arthropods and Eryopoid amphibians (Limnopus). There are fewer marine units in the glenshaw than toward the north and west which has made direct detailed correlation of much of the formation problematic. The coal beds and marine units used previous stratigraphic studies may be extended through the recognition of non-coal-bearing paleosols and marine-influenced intervals distinguished by facies relations, and sedimentary and biogenic structures. Nine laterally persistent, paleosol-bounded packages occur which are comparable to allocyclic T-R units reported by Busch and Rollins (1984) from Pennsylvania and Ohio. Alternating episodes of soil formation and alluvial aggradation may reflect updip coastal plain responses to low stand incision of drainage lines and sediment bypassing followed by aggradation of alluvial systems in response to rising sea level. Climate changes may also have played a role in sediment flux.

  5. Enzymatic formation of a novel cell-adhesive hydrogel based on small peptides with a laterally grafted l-3,4-dihydroxyphenylalanine group

    NASA Astrophysics Data System (ADS)

    Xu, J. X.; Zhou, Z.; Wu, B.; He, B. F.

    2014-01-01

    We rationally designed a bioadhesive supramolecular hydrogel by introducing l-3,4-dihydroxylphenylalanine (DOPA) groups while properly integrating the enzymatic reactions and self-assembly processes. The effective presence of the catechol groups successfully promoted the adhesion and proliferation of human fibroblast cells.We rationally designed a bioadhesive supramolecular hydrogel by introducing l-3,4-dihydroxylphenylalanine (DOPA) groups while properly integrating the enzymatic reactions and self-assembly processes. The effective presence of the catechol groups successfully promoted the adhesion and proliferation of human fibroblast cells. Electronic supplementary information (ESI) available: Detailed experimental procedures, synthesis and characterization of the compounds and hydrogel preparation. See DOI: 10.1039/c3nr04528e

  6. Control of Rh{sup I}(CO){sub 2} formation on Rh/Al{sub 2}O{sub 3} catalysts by complexation of surface -OH groups using NH{sub 3}

    SciTech Connect

    Paul, D.K.; Marten, C.D.; Yates, J.T. Jr.

    1999-06-22

    It has been shown that the isolated -OH groups present on a Rh/Al{sub 2}O{sub 3} catalyst form a weak H-bonded complex by exposure to gas-phase NH{sub 3} at 298 K. This reversible complex suppresses the tendency for isolated -OH groups to participate in the oxidation of metallic Rh. forming Rh{sup I}(CO){sub 2}/Al{sub 2}O{sub 3} species in the presence of a CO atmosphere. There is no IR spectroscopic evidence for the formation of MH{sub 4}{sup +} during surface complexation. However, evidence for NH{sub 2} formation at Lewis base sites on Al{sub 2}O{sub 3} is found.

  7. Eustatic control on early dolomitization of cyclic peritidal carbonates: Evidence from the Early Ordovician Upper Knox Group, Appalachians and Middle to Late Cambrian Bonanza King Formation, southern Great basin

    SciTech Connect

    Montanez, I.P. )

    1991-03-01

    The origin of massive dolomite in ancient cyclic carbonate successions remains a poorly resolved issue reflecting the lack of modern analogs of extensive dolomitization. This paper presents evidence for extensive synsedimentary dolomitization of peritidal cyclic carbonates of the Early Ordovician upper Knox Group, Appalachians, and of the Middle to Late Cambrian Bonanza King Formation, southern Great basin. Early dolomitization of these Cambro-Ordovician carbonates was synchronous with regressive conditions governed by superimposed sea-level oscillations (fifth-, fourth-, and third-order).

  8. In situ formation of adhesive hydrogels based on PL with laterally grafted catechol groups and their bonding efficacy to wet organic substrates.

    PubMed

    Ye, Mingming; Jiang, Rui; Zhao, Jin; Zhang, Juntao; Yuan, Xubo; Yuan, Xiaoyan

    2015-12-01

    Adhesives with catechol moieties have been widely investigated in recent years. However, actually how much catechol groups for these mussel bio-inspired adhesives, especially in their natural form under physiological condition, is appropriate to bond with organic substrates has not been studied intensively. This study blends ε-polylysine (PL), featuring laterally grafted catechols under physiological conditions (pH 7.4), with oxidized dextran to form a hydrogel in situ via the Schiff base without introducing small cytotoxic molecules as crosslinking agents. It finds that the amount of catechol groups imposes an obvious influence on gelation time, swelling behavior, and hydrogel morphology. Both the storage modulus and adhesion strength are found to increase first and decrease afterwards with an increase of pendent catechol content. Furthermore, catechol hydrogen interactions and the decrease in the crosslink density derived from the decrease of amino groups on PL are simultaneously found to affect the storage modulus. Meanwhile, multiple hydrogen-bonding interactions of catechol with amino, hydroxyl, and carboxyl groups, which are in abundance on the surface of tissue, are mainly found to provide an adhesive force. The study finds that with more catechol, there is a greater chance that the cohesive force will weaken, making the entire adhesion strength of the hydrogel decrease. Using a cytotoxicity test, the nontoxicity of the hydrogel towards the growth of L929 cells is proven, indicating that hydrogels have potential applications in soft tissue repair under natural physiological conditions.

  9. Oxalates as Activating Groups for Alcohols in Visible Light Photoredox Catalysis: Formation of Quaternary Centers by Redox-Neutral Fragment Coupling

    PubMed Central

    MacMillan, David W. C.; Overman, Larry E.

    2015-01-01

    Alkyl oxalates are new bench-stable alcohol-activating groups for radical generation under visible light photoredox conditions. Using these precursors, the first net redox-neutral coupling of tertiary and secondary alcohols with electron-deficient alkenes is achieved. PMID:26322524

  10. Mutational analysis of bacteriophage T4 RNA ligase 1. Different functional groups are required for the nucleotidyl transfer and phosphodiester bond formation steps of the ligation reaction.

    PubMed

    Wang, Li Kai; Ho, C Kiong; Pei, Yi; Shuman, Stewart

    2003-08-08

    T4 RNA ligase 1 (Rnl1) exemplifies an ATP-dependent RNA ligase family that includes fungal tRNA ligase (Trl1) and a putative baculovirus RNA ligase. Rnl1 acts via a covalent enzyme-AMP intermediate generated by attack of Lys-99 N zeta on the alpha phosphorus of ATP. Mutation of Lys-99 abolishes ligase activity. Here we tested the effects of alanine mutations at 19 conserved positions in Rnl1 and thereby identified 9 new residues essential for ligase activity: Arg-54, Lys-75, Phe-77, Gly-102, Lys-119, Glu-227, Gly-228, Lys-240, and Lys-242. Seven of the essential residues are located within counterparts of conserved nucleotidyltransferase motifs I (99KEDG102), Ia (118SK119), IV (227EGYVA231), and V (238HFKIK242) that comprise the active sites of DNA ligases, RNA capping enzymes, and T4 RNA ligase 2. Three other essential residues, Arg-54, Lys-75 and Phe-77, are located upstream of the AMP attachment site within a conserved domain unique to the Rnl1-like ligase family. We infer a shared evolutionary history and active site architecture in Rnl1 (a tRNA repair enzyme) and Trl1 (a tRNA splicing enzyme). We determined structure-activity relationships via conservative substitutions and examined mutational effects on the isolated steps of Rnl1 adenylylation (step 1) and phosphodiester bond formation (step 3). Lys-75, Lys-240, and Lys-242 were found to be essential for step 1 and overall ligation of 5'-phosphorylated RNA but not for phosphodiester bond formation. These results suggest that the composition of the Rnl1 active site is different during steps 1 and 3. Mutations at Arg-54 and Lys-119 abolished the overall RNA ligation reaction without affecting steps 1 and 3. Arg-54 and Lys-119 are thereby implicated as specific catalysts of the RNA adenylation reaction (step 2) of the ligation pathway.

  11. Host group formation decreases exposure to vector-borne disease: a field experiment in a ‘hotspot’ of West Nile virus transmission

    PubMed Central

    Krebs, Bethany L.; Anderson, Tavis K.; Goldberg, Tony L.; Hamer, Gabriel L.; Kitron, Uriel D.; Newman, Christina M.; Ruiz, Marilyn O.; Walker, Edward D.; Brawn, Jeffrey D.

    2014-01-01

    Animals can decrease their individual risk of predation by forming groups. The encounter-dilution hypothesis extends the potential benefits of gregariousness to biting insects and vector-borne disease by predicting that the per capita number of insect bites should decrease within larger host groups. Although vector-borne diseases are common and can exert strong selective pressures on hosts, there have been few tests of the encounter-dilution effect in natural systems. We conducted an experimental test of the encounter-dilution hypothesis using the American robin (Turdus migratorius), a common host species for the West Nile virus (WNV), a mosquito-borne pathogen. By using sentinel hosts (house sparrows, Passer domesticus) caged in naturally occurring communal roosts in the suburbs of Chicago, we assessed sentinel host risk of WNV exposure inside and outside of roosts. We also estimated per capita host exposure to infected vectors inside roosts and outside of roosts. Sentinel birds caged inside roosts seroconverted to WNV more slowly than those outside of roosts, suggesting that social groups decrease per capita exposure to infected mosquitoes. These results therefore support the encounter-dilution hypothesis in a vector-borne disease system. Our results suggest that disease-related selective pressures on sociality may depend on the mode of disease transmission. PMID:25339722

  12. Adenine derivatives as phosphate-activating groups for the regioselective formation of 3',5'-linked oligoadenylates on montmorillonite: possible phosphate-activating groups for the prebiotic synthesis of RNA

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Ferris, J. P.

    1997-01-01

    Methyladenine and adenine N-phosphoryl derivatives of adenosine 5'-monophosphate (5'-AMP) and uridine 5'-monophosphate (5'-UMP) are synthesized, and their structures are elucidated. The oligomerization reactions of the adenine derivatives of 5'-phosphoramidates of adenosine on montmorillonite are investigated. 1-Methyladenine and 3-methyladenine derivatives on montmorillonite yielded oligoadenylates as long as undecamer, and the 2-methyladenine and adenine derivatives on montmorillonite yielded oligomers up to hexamers and pentamers, respectively. The 1-methyladenine derivative yielded linear, cyclic, and A5'ppA-derived oligonucleotides with a regioselectivity for the 3',5'-phosphodiester linkages averaging 84%. The effect of pKa and amine structure of phosphate-activating groups on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidate of adenosine are discussed. The binding and reaction of methyladenine and adenine N-phosphoryl derivatives of adenosine are described.

  13. Geochemistry and diagenesis of stratabound calcite cement layers within the Rannoch Formation of the Brent Group, Murchison Field, North Viking Graben (northern North Sea)

    NASA Astrophysics Data System (ADS)

    Prosser, D. J.; Daws, J. A.; Fallick, A. E.; Williams, B. P. J.

    1993-11-01

    Up to four calcite-cemented horizons (doggers) form impermeable barriers to fluid flow within the Middle Jurassic Rannoch Formation and are correlatable across the Murchison Field. Calcite precipitated during early diagenesis, within high porosity/permeability sandstones at the top of coarsening (shoaling) upward shoreface cycles. Calcite δ 13C and δ 18O compositions range from -4.1 to -13.4‰ PDB, and -6.6 to -16.7‰ PDB, respectively. Sr concentrations of up to 1334 ppm are consistent with marine carbonate sources (probably shell fragments), but no viable intraformational carbonate source has been identified in the Murchison Field area. Initial 87Sr/ 86Sr compositions (0.71109-0.71266) are higher than Middle Jurassic seawater (0.7073), and consistent with precipitation from modified porewaters containing significant proportions of continentally derived "meteoric" fluids enriched in 87Sr as a result of basement weathering, or percolation through hinterland soils/unconsolidated detritus. An internal source of 87Sr is not considered viable in view of the high proportion (up to 25‰ clastic constituents) of unaltered detrital alkali feldspar and mica within the Rannoch Formation. Geochemical and isotope data indicate correlations between increasing δ 18O composition and increasing iron and magnesium content within calcite. Calcium concentrations decrease with increasing δ 18O for calcites. Geochemical data trends can be interpreted differently in terms of either "static" or "evolving" δ 18O porewater models. Static δ 18O porewater models using Jurassic/Early Cretaceous "meteoric" water ( δ 18O = -6‰; SMOW) predict cement precipitation temperatures of 17-77°C. However, δ 13C compositions are more depleted than those typical of carbon derived from shell debris, and correlation between decreasing δ 18O and decreasing δ 13C suggests modification of a meteoric-derived porewater system during burial via contribution of low δ 13C carbon derived from a deep

  14. Raman and NMR kinetics study of the formation of amidoamines containing N-hydroxyethyl groups and investigations on their Cu(II) complexes in water

    NASA Astrophysics Data System (ADS)

    Bergamonti, Laura; Graiff, Claudia; Tegoni, Matteo; Predieri, Giovanni; Bellot-Gurlet, Ludovic; Lottici, Pier Paolo

    2017-01-01

    Three amidoamines containing the N-hydroxyethyl group (HOEt), namely (HOEt)2N(CH2)2C(O)NH2 (1), [(HOEt)2N(CH2)2C(O)NH]2CH2 (2) and HOEtN[(CH2)2C(O)NH2]2 (3) have been synthesized by reacting diethanolamine HOEt2NH with acrylamide and N,N‧-methylenebisacrylamide (respectively 1 and 2) and ethanolamine HOEtNH2 with acrylamide (3). Four other compounds corresponding to 1 and 2, but derived from sec-amines Me2NH (4 and 5) and Et2NH (6 and 7) have been prepared for the sake of comparison of the spectroscopic features. All compounds have been obtained by the well-known aza-Michael addition between an N-nucleophile and an activated vinyl group. The reaction in water between diethanolamine and acrylamide leading to 1 has been monitored in situ by Raman and NMR spectroscopy, both techniques confirming second order kinetics and giving values for kinetic constants in excellent agreement. The coordination ability of 1 and 2 towards Cu2 + in water has been studied by the Job's plot method. Spectroscopic data indicate that ligand 1 prevalently forms a 4:1 Ligand/Metal complex with a (N,O3) coordination set on the equatorial plane of Cu2 +, whereas ligand 2, containing two amide functionalities bridged by a methylene group, appears able to form a 1:1 Ligand/Metal chelate species, again with a (N,O3) donor set around copper.

  15. Petroleum systems and geologic assessment of undiscovered oil and gas, Cotton Valley group and Travis Peak-Hosston formations, East Texas basin and Louisiana-Mississippi salt basins provinces of the northern Gulf Coast region. Chapters 1-7.

    USGS Publications Warehouse

    ,

    2006-01-01

    The purpose of the U.S. Geological Survey's (USGS) National Oil and Gas Assessment is to develop geologically based hypotheses regarding the potential for additions to oil and gas reserves in priority areas of the United States. The USGS recently completed an assessment of undiscovered oil and gas potential of the Cotton Valley Group and Travis Peak and Hosston Formations in the East Texas Basin and Louisiana-Mississippi Salt Basins Provinces in the Gulf Coast Region (USGS Provinces 5048 and 5049). The Cotton Valley Group and Travis Peak and Hosston Formations are important because of their potential for natural gas resources. This assessment is based on geologic principles and uses the total petroleum system concept. The geologic elements of a total petroleum system include hydrocarbon source rocks (source rock maturation, hydrocarbon generation and migration), reservoir rocks (sequence stratigraphy and petrophysical properties), and hydrocarbon traps (trap formation and timing). The USGS used this geologic framework to define one total petroleum system and eight assessment units. Seven assessment units were quantitatively assessed for undiscovered oil and gas resources.

  16. Can ancient shelf sand ridges be mistaken for Gilbert-type deltas? Examples from the Vryheid Formation, Ecca Group, KwaZulu-Natal, South Africa

    NASA Astrophysics Data System (ADS)

    Green, Andrew N.; Smith, Alan M.

    2012-11-01

    Medium scale clinoforms within sandstones of the Vryheid Formation, northern KwaZulu-Natal, South Africa have in the past been interpreted as the products of Gilbert-type or river-dominated deltaic deposition. Detailed sedimentary logging of these rocks reveals a tempestite association, overlain by a series of moderate to very large scale climbing bedforms. These are intersected at various stratigraphic levels by massive sandstone filled channels, some with subordinate rippled bases, which are orthogonally orientated to the largest scale bedding surfaces (clinoforms) of the climbing bedform association. The sedimentary architecture is dominated by the south-easterly, south-westerly and north-westerly dipping clinoforms, all orientated oblique to the east-west trending palaeo-coastline. Local dip direction reversals are commonplace. This is at odds with Gilbert-type or river-dominated deltaic settings where: (1) sediment progrades normal to the shoreline; (2) distributary channels do not intersect the underlying deltaic foresets orthogonally; and (3) wave action is typically limited. We subsequently interpret the succession as a shelf sand ridge that evolved on a subaqueous delta, fed by sediment exchange from the upper to lower shoreface via a series of rippled scour depressions. To foster such thick (˜30 m) shelf ridge development, it is likely that these remained attached to the shoreface for a significant period of time. In light of these findings, caution should be adopted in applying a blanket deltaic interpretation of shallow marine deposits comprising similar medium scale clinoforms.

  17. A study on the ability of quaternary ammonium groups attached to a polyurethane foam wound dressing to inhibit bacterial attachment and biofilm formation.

    PubMed

    Tran, Phat L; Hamood, Abdul N; de Souza, Anselm; Schultz, Gregory; Liesenfeld, Bernd; Mehta, Dilip; Reid, Ted W

    2015-01-01

    Bacterial infection of acute and chronic wounds impedes wound healing significantly. Part of this impediment is the ability of bacterial pathogens to grow in wound dressings. In this study, we examined the effectiveness of a polyurethane (PU) foam wound dressings coated with poly diallyl-dimethylammonium chloride (pDADMAC-PU) to inhibit the growth and biofilm development by three main wound pathogens, Staphylococcus aureus, Pseudomonas aeruginosa, and Acinetobacter baumannii, within the wound dressing. pDADMAC-PU inhibited the growth of all three pathogens. Time-kill curves were conducted both with and without serum to determine the killing kinetic of pDADMAC-PU. pDADMAC-PU killed S. aureus, A. baumannii, and P. aeruginosa. The effect of pDADMAC-PU on biofilm development was analyzed quantitatively and qualitatively. Quantitative analysis, colony-forming unit assay, revealed that pDADMAC-PU dressing produced more than eight log reduction in biofilm formation by each pathogen. Visualization of the biofilms by either confocal laser scanning microscopy or scanning electron microscopy confirmed these findings. In addition, it was found that the pDADMAC-PU-treated foam totally inhibited migration of bacteria through the foam for all three bacterial strains. These results suggest that pDADMAC-PU is an effective wound dressing that inhibits the growth of wound pathogens both within the wound and in the wound dressing.

  18. Innate health threat among a visibly hidden immigrant group: a formative field data analysis for HIV/AIDS prevention among Zimbabwean workers in Botswana.

    PubMed

    Kim, Do Kyun; Chikombero, Mandi; Modie-Moroka, Tirelo

    2013-01-01

    As a result of the collapse of the national economy and political instability, Zimbabwe has experienced a diaspora in recent years. Although Zimbabweans are now the largest immigrant group in most sub-Saharan countries, Zimbabwean immigrants are a mostly illegal and socioeconomically marginalized population. This study explores the lives of Zimbabwean workers in Botswana from a health communication perspective and provides suggestions for accelerating the diffusion of HIV/AIDS prevention information and practices among the target population. In particular, this ethnographic report portrays how the Zimbabwean workers in Botswana make sense of their surroundings and perceive information on HIV/AIDS prevention and other public health risks. Field data analysis highlights several communication features among the immigrants, including reliance on interpersonal communication, high rate of mobile phone adoption, inaccurate public awareness on HIV/AIDS and prevention messages, and stagnated communication with health care services. By connecting Dervin's sensemaking theory to Roger's diffusion of innovations theory, the suggestions from this study can be applied to design HIV/AIDS prevention interventions for the immigrants and socioeconomically marginalized groups.

  19. Model-measurement comparison of functional group abundance in α-pinene and 1,3,5-trimethylbenzene secondary organic aerosol formation

    NASA Astrophysics Data System (ADS)

    Ruggeri, Giulia; Bernhard, Fabian A.; Henderson, Barron H.; Takahama, Satoshi

    2016-07-01

    Secondary organic aerosol (SOA) formed by α-pinene and 1,3,5-trimethylbenzene photooxidation under different NOx regimes is simulated using the Master Chemical Mechanism v3.2 (MCM) coupled with an absorptive gas-particle partitioning module. Vapor pressures for individual compounds are estimated with the SIMPOL.1 group contribution model for determining apportionment of reaction products to each phase. We apply chemoinformatic tools to harvest functional group (FG) composition from the simulations and estimate their contributions to the overall oxygen to carbon ratio. Furthermore, we compare FG abundances in simulated SOA to measurements of FGs reported in previous chamber studies using Fourier transform infrared spectroscopy. These simulations qualitatively capture the dynamics of FG composition of SOA formed from both α-pinene and 1,3,5-trimethylbenzene in low-NOx conditions, especially in the first hours after start of photooxidation. Higher discrepancies are found after several hours of simulation; the nature of these discrepancies indicates sources of uncertainty or types of reactions in the condensed or gas phase missing from current model implementation. Higher discrepancies are found in the case of α-pinene photooxidation under different NOx concentration regimes, which are reasoned through the domination by a few polyfunctional compounds that disproportionately impact the simulated FG abundance in the aerosol phase. This manuscript illustrates the usefulness of FG analysis to complement existing methods for model-measurement evaluation.

  20. Britholite-group minerals as sensitive indicators of changing fluid composition during pegmatite formation: evidence from the Keivy alkaline province, Kola peninsula, NW Russia

    NASA Astrophysics Data System (ADS)

    Zozulya, Dmitry R.; Lyalina, Lyudmila M.; Savchenko, Yevgeny E.

    2017-01-01

    The Keivy alkaline province, Kola Peninsula, NW Russia, consists of vast alkali granite massifs and several dike-like nepheline syenite bodies. It contains numerous rare-metal occurrences, formed by a complex sequence of magmatic, late-magmatic and post-magmatic (including pegmatitic) processes. The Sakharjok nepheline syenite pegmatite contains a remarkably diverse number of britholite group minerals, pointing to different physico-chemical conditions in the fluid. REE and actinides distribution in the host rock indicates that the late-magmatic (and pegmatitic) fluids were alkaline, with significant amounts of F and CO2. From REE and F variations of the britholite group minerals possible fluid compositions at different stages are suggested. The earliest fluorbritholite-(Ce) formed locally from a late magmatic, high temperature F-rich fluid. Fluorbritholite-(Y) presumably crystallized from a F-bearing and CO2-rich fluid; marked F saturation resulted in precipitation of abundant fluorite due to a temperature drop. Variations in REE and F contents in the most abundant fluorcalciobritholite indicate a successive decrease of F in the fluid during its evolution. The relationship between intergrown fluorapatite and fluorcalciobritholite and the presence of zones with a REE-rich fluorapatite between them indicate a continuous to sudden crystallization in this mineral sequence. The crystallization of the latest "calciobritholite" is related to the input into the fluid of CO2 and/or H2O.

  1. tRNA-dependent peptide bond formation by the transferase PacB in biosynthesis of the pacidamycin group of pentapeptidyl nucleoside antibiotics.

    PubMed

    Zhang, Wenjun; Ntai, Ioanna; Kelleher, Neil L; Walsh, Christopher T

    2011-07-26

    Pacidamycins are a family of uridyl tetra/pentapeptide antibiotics with antipseudomonal activities through inhibition of the translocase MraY in bacterial cell wall assembly. The biosynthetic gene cluster for pacidamycins has recently been identified through genome mining of the producer Streptomyces coeruleorubidus, and the highly dissociated nonribosomal peptide assembly line for the uridyl tetrapeptide scaffold of pacidamycin has been characterized. In this work a hypothetical protein PacB, conserved in known uridyl peptide antibiotics gene clusters, has been characterized by both genetic deletion and enzymatic analysis of the purified protein. PacB catalyzes the transfer of the alanyl residue from alanyl-tRNA to the N terminus of the tetrapeptide intermediate yielding a pentapeptide on the thio-templated nonribosomal peptide synthetase (NRPS) assembly line protein PacH. PacB thus represents a new group of tRNA-dependent peptide bond-forming enzymes in secondary metabolite biosynthesis in addition to the recently identified cyclodipeptide synthases. The characterization of PacB completes the assembly line reconstitution of pacidamycin pentapeptide antibiotic scaffolds, bridging the primary and secondary metabolic pathways by hijacking an aminoacyl-tRNA to the antibiotic biosynthetic pathway.

  2. Heterozygosity for p53 (Trp53+/-) accelerates epithelial tumor formation in fanconi anemia complementation group D2 (Fancd2) knockout mice.

    PubMed

    Houghtaling, Scott; Granville, Laura; Akkari, Yassmine; Torimaru, Yumi; Olson, Susan; Finegold, Milton; Grompe, Markus

    2005-01-01

    Fanconi anemia (FA) is an autosomal recessive disease characterized by progressive bone marrow failure and an increased susceptibility to cancer. FA is genetically heterogeneous, consisting of at least 11 complementation groups, FA-A through L, including FA-D1 (BRCA2) and D2. We have previously reported an increased incidence of epithelial tumors in Fancd2 knockout mice. To further investigate the role of the FA pathway in tumor prevention, Fancd2 mutant mice were crossed to mice with a null mutation in the tumor suppressor gene, Trp53. The tumor spectrum in Fancd2(-/-)/Trp53(+/-) mice included sarcomas expected in Trp53 heterozygotes, as well as mammary and lung adenocarcinomas that occur rarely in Trp53 heterozygotes. These tumors occurred earlier than in Fancd2(-/-) control mice. Therefore, the Fancd2(-/-)/Trp53(+/-) mice represent an improved model for the study of adenocarcinoma in FA. In addition, it was found that Fancd2(-/-) mouse embryonic fibroblasts but not Fancd2(-/-)/Trp53(-/-) mouse embryonic fibroblasts arrest following DNA damage. Therefore, Trp53 is required for the S phase checkpoint activation observed in Fancd2 mutant cells. Fancd2(-/-)/Trp53(-/-) cells showed an increase in aneuploidy and had multiple gross chromosomal rearrangements.

  3. Petrogenesis of the western highlands of the moon - Evidence from a diverse group of whitlockite-rich rocks from the Fra Mauro formation

    NASA Technical Reports Server (NTRS)

    Snyder, Gregory A.; Taylor, Lawrence A.; Liu, Yun-Gang; Schmitt, Roman A.

    1992-01-01

    A group of KREEPy basalts has been discovered in Apollo 14 soils. These samples exhibit similarities to both HA and VHK basalts, albeit with much higher REE abundances, and contain up to 2 vol pct whitlockite and can be explained by assimilation of a K-, REE- and P-rich fluids by an original HA or VHK basalt. This KREEP component could have been produced late in the evolution of the lunar magma ocean and is similar in composition to QMD at Apollo 14. Two rocks have trace element compositions that are representative of actual KREEP. One of the samples appears to be petrographically pristine and could represent an actual KREEP basalt rock. Five subophitic high-Al basalts represent sampling of either a slowly cooled impact melt sheet or, more likely, the same basalt flow. Two 'quasi-pristine' highland rocks confirm the postulate of a connection between KREEP and the alkali suite. A newly discovered alkali anorthosite is a plagioclase cumulate with about 15 percent trapped KREEPy liquid.

  4. Humphry Fortescue Osmond (1917-2004), a radical and conventional psychiatrist: The transcendent years.

    PubMed

    Kaplan, Robert M

    2016-02-01

    This article describes the life and work of the psychiatrist Humphry Osmond who pursued a radical path as a psychiatrist while he remained within the establishment. To the public mind however, he is best known as the man who introduced Aldous Huxley to mescaline and coined the iconic word psychedelic. From an early stage of his career, Henry Osmond embraced new ideas to break the nexus in psychiatry at a time when neither biological nor psychoanalytic treatments were shown to have much benefit. To do this, he joined the radical social experiment in health in the Canadian province of Saskatchewan where he initiated a range of innovations that attracted international attention, as well as controversy over his espousal of the use of hallucinogens better to understand the experiences of psychotic patients.

  5. Artificial Neural Network-Group Contribution Method for Predicting Standard Enthalpy of Formation in the Solid State: C-H, C-H-O, C-H-N, and C-H-N-O Compounds

    NASA Astrophysics Data System (ADS)

    Guella, Soufiane; Argoub, Kadda; Benkouider, Ali Mustapha; Yahiaoui, Ahmed; Kessas, Rachid; Bagui, Farid

    2015-11-01

    In this work, an artificial neural network-group contribution model is developed to predict the standard enthalpy of formation in the solid (crystal) state of pure compounds. Several classes of hydrocarbon compounds CH, oxygenated compounds CHO, nitrogen compounds CHN, and energetic compounds CHNO are investigated to propose a comprehensive and predictive model. The new model is developed and tested for 1222 organic compounds containing complex molecular structures. The performance of the new model has been compared with previous work and is shown to be far more accurate. The obtained results show an average absolute deviation of 9.33 {kJ}{\\cdot }{mol}^{-1} and a coefficient of determination of 0.9972 for the experimental values.

  6. Molecular beam epitaxy of III-P{sub x}As{sub 1−x} solid solutions: Mechanism of composition formation in the sublattice of a group V element

    SciTech Connect

    Emelyanov, E. A. Putyato, M. A.; Semyagin, B. R.; Feklin, D. F.; Preobrazhensky, V. V.

    2015-02-15

    The effect of substrate temperature, As{sub 2} and P{sub 2} molecular flux densities, and growth rate on the composition of III-P{sub x}As{sub 1−x} solid solution layers prepared by molecular beam epitaxy is experimentally investigated. Experimental data in a wide range of growth conditions are analyzed. The results obtained are presented in the form of a kinetic model for describing the process of formation of the composition in the Group V sublattice of the III-P{sub x}As{sub 1−x} solid solution upon molecular beam epitaxy. The model can be used for choosing the growth conditions of the III-P{sub x}As{sub 1−x} (001) solid-solution layers of a specified composition.

  7. The Group Tree of Experience.

    ERIC Educational Resources Information Center

    Ping, Ki

    1994-01-01

    Describes a group activity that uses a tree as a metaphor to reflect both group and personal growth during adventure activities. The tree's roots represent the group's formation, the branches and leaves represent the group's diversity and capabilities, and the seeds represent the personal learning and growth that took place within the group.…

  8. pH-induced conformational changes in human ABO(H) blood group glycosyltransferases confirm the importance of electrostatic interactions in the formation of the semi-closed state.

    PubMed

    Johal, Asha R; Blackler, Ryan J; Alfaro, Javier A; Schuman, Brock; Borisova, Svetlana; Evans, Stephen V

    2014-03-01

    The homologous human ABO(H) A and B blood group glycosyltransferases GTA and GTB have two mobile polypeptide loops surrounding their active sites that serve to allow substrate access and product egress and to recognize and sequester substrates for catalysis. Previous studies have established that these enzymes can move from the "open" state to the "semi-closed" then "closed" states in response to addition of a substrate. The contribution of electrostatic interactions to these conformational changes has now been demonstrated by the determination at various pH of the structures of GTA, GTB and the chimeric enzyme ABBA. At near-neutral pH, GTA displays the closed state in which both mobile loops order around the active site, whereas ABBA and GTB display the open state. At low pH, the apparent protonation of the DXD motif in GTA leads to the expulsion of the donor analog to yield the open state, whereas at high pH, both ABBA and GTB form the semi-closed state in which the first mobile loop becomes an ordered α-helix. Step-wise deprotonation of GTB in increments of 0.5 between pH 6.5 and 10.0 shows that helix ordering is gradual, which indicates that the formation of the semi-closed state is dependent on electrostatic forces consistent with the binding of substrate. Spectropolarimetric studies of the corresponding stand-alone peptide in solution reveal no tendency toward helix formation from pH 7.0 to 10.0, which shows that pH-dependent stability is a product of the larger protein environment and underlines the importance of substrate in active site ordering.

  9. A SPECTROSCOPICALLY CONFIRMED EXCESS OF 24 mum SOURCES IN A SUPER GALAXY GROUP AT z = 0.37: ENHANCED DUSTY STAR FORMATION RELATIVE TO THE CLUSTER AND FIELD ENVIRONMENT

    SciTech Connect

    Tran, Kim-Vy H.; Saintonge, Amelie; Moustakas, John; Bai, Lei; Zaritsky, Dennis; Gonzalez, Anthony H.; Kautsch, Stefan J.; Holden, Bradford P.

    2009-11-01

    To trace how dust-obscured star formation varies with environment, we compare the fraction of 24 mum sources in a super galaxy group to the field and a rich galaxy cluster at z approx 0.35. We draw on multi-wavelength observations{sup 9}Based on observations made with (1) The ESO telescopes at Paranal Observatories under program IDs 072.A-0367, 076.B-0362, 078.B-0409; (2) the NASA/ESA Hubble Space Telescope (GO-10499); STScI is operated by the association of Universities for Research in Astronomy, Inc. under the NASA contract NAS 5-26555; (3) the Spitzer Space Telescope, which is operated by the Jet Propulsion Laboratory, California Institute of Technology under a contract with NASA; support for this work was provided by NASA through an award issued by JPL/Caltech (GO-20683); (4) the Chandra X-ray Observatory Center, which is operated by the Smithsonian Astrophysical Observatory for and on behalf of the National Aeronautics Space Administration under contract NAS8-03060; and (5) the Magellan 6.5 m telescope operated by OCIW. that combine Hubble, Chandra, and Spitzer imaging with extensive optical spectroscopy (>1800 redshifts) to isolate galaxies in each environment and thus ensure a uniform analysis. We focus on the four galaxy groups (sigma{sub 1D} = 303-580 km s{sup -1}) in supergroup 1120-12 that will merge to form a galaxy cluster comparable in mass to Coma. We find that (1) the fraction of supergroup galaxies with SFR{sub IR} >= 3 M {sub sun} yr{sup -1} is 4 times higher than in the cluster (32% +- 5% versus 7% +- 2%); (2) the supergroup's infrared luminosity function confirms that it has a higher density of IR members compared to the cluster and includes bright IR sources (log(L {sub IR})[erg s{sup -1}] >45) not found in galaxy clusters at z approx< 0.35; and (3) there is a strong trend of decreasing 24 mum fraction with increasing galaxy density, i.e., an infrared-density relation, not observed in the cluster. These dramatic differences are surprising

  10. IVS Working Group 4: VLBI Data Structures

    NASA Technical Reports Server (NTRS)

    Gipson, John

    2010-01-01

    In 2007 the IVS Directing Board established IVS Working Group 4 on VLBI Data Structures. This note discusses the current VLBI data format, goals for a new format, the history and formation of the Working Group, and a timeline for the development of a new VLBI data format.

  11. Group X

    SciTech Connect

    Fields, Susannah

    2007-08-16

    This project is currently under contract for research through the Department of Homeland Security until 2011. The group I was responsible for studying has to remain confidential so as not to affect the current project. All dates, reference links and authors, and other distinguishing characteristics of the original group have been removed from this report. All references to the name of this group or the individual splinter groups has been changed to 'Group X'. I have been collecting texts from a variety of sources intended for the use of recruiting and radicalizing members for Group X splinter groups for the purpose of researching the motivation and intent of leaders of those groups and their influence over the likelihood of group radicalization. This work included visiting many Group X websites to find information on splinter group leaders and finding their statements to new and old members. This proved difficult because the splinter groups of Group X are united in beliefs, but differ in public opinion. They are eager to tear each other down, prove their superiority, and yet remain anonymous. After a few weeks of intense searching, a list of eight recruiting texts and eight radicalizing texts from a variety of Group X leaders were compiled.

  12. Chapter 7. The GIS project for the geologic assessment of undiscovered oil and gas in the Cotton Valley group and Travis Peak and Hosston formations, East Texas basin and Louisiana-Mississippi salt basins provinces.

    USGS Publications Warehouse

    Biewick, Laura R.H.

    2006-01-01

    A geographic information system (GIS) focusing on the Upper Jurassic-Lower Cretaceous Cotton Valley Group and the Lower Cretaceous Travis Peak and Hosston Formations in the northern Gulf Coast region was developed as a visual-analysis tool for the U.S. Geological Survey's 2002 assessment of undiscovered, technically recoverable oil and natural gas resources in the East Texas Basin and Louisiana-Mississippi Salt Basins Provinces. The Central Energy Resources Team of the U.S. Geological Survey has also developed an Internet Map Service to deliver the GIS data to the public. This mapping tool utilizes information from a database about the oil and natural gas endowment of the United States-including physical locations of geologic and geographic data-and converts the data into visual layers. Portrayal and analysis of geologic features on an interactive map provide an excellent tool for understanding domestic oil and gas resources for strategic planning, formulating economic and energy policies, evaluating lands under the purview of the Federal Government, and developing sound environmental policies. Assessment results can be viewed and analyzed or downloaded from the internet web site, http://energy.cr.usgs.gov/oilgas/noga/ .

  13. Group Flow and Group Genius

    ERIC Educational Resources Information Center

    Sawyer, Keith

    2015-01-01

    Keith Sawyer views the spontaneous collaboration of group creativity and improvisation actions as "group flow," which organizations can use to function at optimum levels. Sawyer establishes ideal conditions for group flow: group goals, close listening, complete concentration, being in control, blending egos, equal participation, knowing…

  14. Isopermutation group

    SciTech Connect

    Muktibodh, A. S.

    2015-03-10

    The concept of ‘Isotopy’ as formulated by Ruggero Maria Santilli [1, 2, 3] plays a vital role in the development of Iso mathematics. Santilli defined iso-fields of characteristic zero. In this paper we extend this definition to define Iso-Galois fields [4] which are essentially of non-zero characteristic. Isotopically isomorphic realizations of a group define isopermutation group which gives a clear cut distinction between automorphic groups and isotopic groups.

  15. Home Groups.

    ERIC Educational Resources Information Center

    Stahler, Theresa M.

    All students enrolled in the entry level foundations course in the College of Education of Kutztown University (Pennsylvania) participate in home groups, a cooperative learning strategy. Each student is assigned to a five- or six-person home group on the first day of class. Although group placements are made on the basis of class lists, every…

  16. Galaxy groups

    SciTech Connect

    Brent Tully, R.

    2015-02-01

    Galaxy groups can be characterized by the radius of decoupling from cosmic expansion, the radius of the caustic of second turnaround, and the velocity dispersion of galaxies within this latter radius. These parameters can be a challenge to measure, especially for small groups with few members. In this study, results are gathered pertaining to particularly well-studied groups over four decades in group mass. Scaling relations anticipated from theory are demonstrated and coefficients of the relationships are specified. There is an update of the relationship between light and mass for groups, confirming that groups with mass of a few times 10{sup 12}M{sub ⊙} are the most lit up while groups with more and less mass are darker. It is demonstrated that there is an interesting one-to-one correlation between the number of dwarf satellites in a group and the group mass. There is the suggestion that small variations in the slope of the luminosity function in groups are caused by the degree of depletion of intermediate luminosity systems rather than variations in the number per unit mass of dwarfs. Finally, returning to the characteristic radii of groups, the ratio of first to second turnaround depends on the dark matter and dark energy content of the universe and a crude estimate can be made from the current observations of Ω{sub matter}∼0.15 in a flat topology, with a 68% probability of being less than 0.44.

  17. Group Counseling: Health Related.

    ERIC Educational Resources Information Center

    McFadden, Johnnie

    1979-01-01

    Diabetes and sickle cell anemia (SCA) are two health-related characteristics that distinguish young people from their peers. This article outlines the problems of children with diabetes and SCA and presents the goals and format for group counseling of these populations and their parents. (Author/BEF)

  18. GROUP INEQUALITY

    PubMed Central

    Bowles, Samuel; Loury, Glenn C.; Sethi, Rajiv

    2014-01-01

    We explore the combined effect of segregation in social networks, peer effects, and the relative size of a historically disadvantaged group on the incentives to invest in market-rewarded skills and the dynamics of inequality between social groups. We identify conditions under which group inequality will persist in the absence of differences in ability, credit constraints, or labor market discrimination. Under these conditions, group inequality may be amplified even if initial group differences are negligible. Increases in social integration may destabilize an unequal state and make group equality possible, but the distributional and human capital effects of this depend on the demographic composition of the population. When the size of the initially disadvantaged group is sufficiently small, integration can lower the long-run costs of human capital investment in both groups and result in an increase the aggregate skill share. In contrast, when the initially disadvantaged group is large, integration can induce a fall in the aggregate skill share as the costs of human capital investment rise in both groups. We consider applications to concrete cases and policy implications. PMID:25554727

  19. Whitehead Groups of Spinor Groups

    NASA Astrophysics Data System (ADS)

    Monastyrnyĭ, A. P.; Yanchevskiĭ, V. I.

    1991-02-01

    The Whitehead groups of spinor groups are studied. The known Kneser-Tits conjecture for spinor groups is reduced to a spinor analogue of the Tannaka-Artin problem, namely, to the question of whether the group K1Spin(D), where D is a division ring of exponent 2 , is trivial. A counterexample to the Kneser-Tits problem is constructed in the class of spinor groups. The group K1Spin(D) is computed. The stability of the Whitehead groups of spinor groups under purely transcendental extensions of the ground field is established. The R-equivalence on the k-points of spinor groups and the weak approximation problem are considered. The study of spinor group completes the study of the Whitehead groups of algebraic groups of classical type, that was started in studying reduced K-theory (V.P. Platonov) and was continued for reduced unitary K-theory (V.I. Yanchevskiĭ) and Hermitian K-theory (Platonov and Yanchevskiĭ). Bibliography: 50 titles.

  20. The evolution of groups and clusters

    NASA Astrophysics Data System (ADS)

    Gottlöber, S.; Klypin, A.; Kravtsov, A. V.; Turchaninov, V.

    Using high resolution N -body simulations we study the formation and evolution of clusters and groups in a &Lambda CDM cosmological model. Groups of galaxies already form before z = 4. Merging of groups and accretion leads to cluster formation at z <&sim2. Some of the groups merge into large isolated halos.

  1. Group Theatre.

    ERIC Educational Resources Information Center

    Clark, Brian

    The group interpretation approach to theatre production is defined as a method that will lead to production of plays that will appeal to "all the layers of the conscious and unconscious mind." In practice, it means that the group will develop and use resources of the theatre that orthodox companies too often ignore. The first two chapters of this…

  2. Pattern Formation

    NASA Astrophysics Data System (ADS)

    Hoyle, Rebecca

    2006-03-01

    From the stripes of a zebra and the spots on a leopard's back to the ripples on a sandy beach or desert dune, regular patterns arise everywhere in nature. The appearance and evolution of these phenomena has been a focus of recent research activity across several disciplines. This book provides an introduction to the range of mathematical theory and methods used to analyse and explain these often intricate and beautiful patterns. Bringing together several different approaches, from group theoretic methods to envelope equations and theory of patterns in large-aspect ratio-systems, the book also provides insight behind the selection of one pattern over another. Suitable as an upper-undergraduate textbook for mathematics students or as a fascinating, engaging, and fully illustrated resource for readers in physics and biology, Rebecca Hoyle's book, using a non-partisan approach, unifies a range of techniques used by active researchers in this growing field. Accessible description of the mathematical theory behind fascinating pattern formation in areas such as biology, physics and materials science Collects recent research for the first time in an upper level textbook Features a number of exercises - with solutions online - and worked examples

  3. Group Grammar

    ERIC Educational Resources Information Center

    Adams, Karen

    2015-01-01

    In this article Karen Adams demonstrates how to incorporate group grammar techniques into a classroom activity. In the activity, students practice using the target grammar to do something they naturally enjoy: learning about each other.

  4. The origin and distribution of HAPs elements in relation to maceral composition of the A1 lignite bed (Paleocene, Calvert Bluff Formation, Wilcox Group), Calvert mine area, east-central Texas

    USGS Publications Warehouse

    Crowley, S.S.; Warwick, P.D.; Ruppert, L.F.; Pontolillo, J.

    1997-01-01

    The origin and distribution of twelve potentially Hazardous Air Pollutants (HAPs; As, Be, Cd, Cr, Co, Hg, Mn, Ni, Pb Sb, Se, and U) identified in the 1990 Clean Air Act Amendments were examined in relation to the maceral composition of the A1 bed (Paleocene, Calvert Bluff Formation, Wilcox Group) of the Calvert mine in east-central Texas. The 3.2 m-thick A1 bed was divided into nine incremental channel samples (7 lignite samples and 2 shaley coal samples) on the basis of megascopic characteristics. Results indicate that As, Cd, Cr, Ni, Pb, Sb, and U are strongly correlated with ash yield and are enriched in the shaley coal samples. We infer that these elements are associated with inorganic constituents in the coal bed and may be derived from a penecontemporaneous stream channel located several kilometers southeast of the mining block. Of the HAPs elements studied, Mn and Hg are the most poorly correlated to ash yield. We infer an organic association for Mn; Hg may be associated with pyrite. The rest of the trace elements (Be, Co, and Se) are weakly correlated with ash yield. Further analytical work is necessary to determine the mode of occurrence for these elements. Overall, concentrations of the HAPs elements are generally similar to or less than those reported in previous studies of lignites of the Wilcox Group, east-central region, Texas. Petrographic analysis indicates the following ranges in composition for the seven lignite samples: liptinites (5-8%), huminites (88-95%), and inertinites (trace amounts to 7%). Samples from the middle portion of the A1 bed contain abundant crypto-eugelinite compared to the rest of the samples; this relationship suggests that the degradation of plant material was an important process during the development of the peat mire. With the exception of Hg and Mn, relatively low levels of the HAPs elements studied are found in the samples containing abundant crypto-eugelinite. We infer that the peat-forming environment for this portion

  5. Group Learning.

    ERIC Educational Resources Information Center

    Black, Susan

    1992-01-01

    Research suggests that cooperative learning works best when students are first taught group-processing skills, such as leadership, decision making, communication, trust building, and conflict management. Inadequate teacher training and boring assignments can torpedo cooperative learning efforts. Administrators should reassure teachers with…

  6. Physically detached 'compact groups'

    NASA Technical Reports Server (NTRS)

    Hernquist, Lars; Katz, Neal; Weinberg, David H.

    1995-01-01

    A small fraction of galaxies appear to reside in dense compact groups, whose inferred crossing times are much shorter than a Hubble time. These short crossing times have led to considerable disagreement among researchers attempting to deduce the dynamical state of these systems. In this paper, we suggest that many of the observed groups are not physically bound but are chance projections of galaxies well separated along the line of sight. Unlike earlier similar proposals, ours does not require that the galaxies in the compact group be members of a more diffuse, but physically bound entity. The probability of physically separated galaxies projecting into an apparent compact group is nonnegligible if most galaxies are distributed in thin filaments. We illustrate this general point with a specific example: a simulation of a cold dark matter universe, in which hydrodynamic effects are included to identify galaxies. The simulated galaxy distribution is filamentary and end-on views of these filaments produce apparent galaxy associations that have sizes and velocity dispersions similar to those of observed compact groups. The frequency of such projections is sufficient, in principle, to explain the observed space density of groups in the Hickson catalog. We discuss the implications of our proposal for the formation and evolution of groups and elliptical galaxies. The proposal can be tested by using redshift-independent distance estimators to measure the line-of-sight spatial extent of nearby compact groups.

  7. Student Perceptions of Small-Group Learning

    ERIC Educational Resources Information Center

    Florez, Ida Rose; McCaslin, Mary

    2008-01-01

    Background/Context: Elementary school teachers regularly arrange students in small groups for learning activities. A rich literature discusses various types of small-group learning formats and how those formats affect achievement. Few studies, however, have examined students' perceptions of small-group learning experiences. Our work extends the…

  8. Local Group

    NASA Astrophysics Data System (ADS)

    Mateo, M.; Murdin, P.

    2000-11-01

    Not long after EDWIN HUBBLE established that galaxies are `island universes' similar to our home galaxy, the MILKY WAY, he realized that a few of these external galaxies are considerably closer to us than any others. In 1936 he first coined the term `Local Group' in his famous book The Realm of the Nebulae to identify our nearest galactic neighbors. More than 60 yr later, the galaxies of the Loca...

  9. Underrepresented groups

    NASA Technical Reports Server (NTRS)

    Peters, David A.

    1990-01-01

    The problem with the shortage of under represented groups in science and engineering is absolutely crucial, especially considering that U.S. will experience a shortage of 560,000 science and engineering personnel by the year 2010. Most studies by the National Science Foundation also concluded that projected shortages cannot be alleviated without significant increases in the involvement of Blacks, Hispanics, Native Americans, handicapped persons, and women.

  10. Special Education Teachers' Knowledge and Use of Brain-Based Teaching, Common Core State Standards, Formative Feedback Practices and Instructional Efficacy for the Diverse Learning Needs of Students in High and Low Proficiency Groups

    ERIC Educational Resources Information Center

    Walker-Thompson, Malasia

    2014-01-01

    This study examined special education teachers' knowledge and use of: brain-based teaching strategies, Common Core State Standards, formative feedback, and instructional efficacy for diverse students. The study identified the differences amongst special education teachers' responses on the dimensions of brain-based teaching strategies, Common Core…

  11. Group Connections: Whole Group Teaching.

    ERIC Educational Resources Information Center

    Griffiths, Dorothy

    2002-01-01

    A learner-centered approach to adult group instruction involved learners in investigating 20th-century events. The approach allowed learners to concentrate on different activities according to their abilities and gave them opportunities to develop basic skills and practice teamwork. (SK)

  12. Cardiovascular group

    NASA Technical Reports Server (NTRS)

    Blomqvist, Gunnar

    1989-01-01

    As a starting point, the group defined a primary goal of maintaining in flight a level of systemic oxygen transport capacity comparable to each individual's preflight upright baseline. The goal of maintaining capacity at preflight levels would seem to be a reasonable objective for several different reasons, including the maintenance of good health in general and the preservation of sufficient cardiovascular reserve capacity to meet operational demands. It is also important not to introduce confounding variables in whatever other physiological studies are being performed. A change in the level of fitness is likely to be a significant confounding variable in the study of many organ systems. The principal component of the in-flight cardiovascular exercise program should be large-muscle activity such as treadmill exercise. It is desirable that at least one session per week be monitored to assure maintenance of proper functional levels and to provide guidance for any adjustments of the exercise prescription. Appropriate measurements include evaluation of the heart-rate/workload or the heart-rate/oxygen-uptake relationship. Respiratory gas analysis is helpful by providing better opportunities to document relative workload levels from analysis of the interrelationships among VO2, VCO2, and ventilation. The committee felt that there is no clear evidence that any particular in-flight exercise regimen is protective against orthostatic hypotension during the early readaptation phase. Some group members suggested that maintenance of the lower body muscle mass and muscle tone may be helpful. There is also evidence that late in-flight interventions to reexpand blood volume to preflight levels are helpful in preventing or minimizing postflight orthostatic hypotension.

  13. Correlation properties of loose groups

    SciTech Connect

    Maia, M.A.G.; Da Costa, L.N. )

    1990-02-01

    The two-point spatial correlation function for loose groups of galaxies is computed, using the recently compiled catalog of groups in the southern hemisphere. It is found that the correlation function for groups has a similar slope to that of galaxies but with a smaller amplitude, confirming an earlier result obtained from a similar analysis of the CfA group catalog. This implies that groups of galaxies are more randomly distributed than galaxies, which may be consistent with the predictions of Kashlinsky (1987) for a gravitational clustering scenario for the formation of large-scale structures. 21 refs.

  14. Novel cytochrome p450 bioactivation of a terminal phenyl acetylene group: formation of a one-carbon loss benzaldehyde and other oxidative products in the presence of N-acetyl cysteine or glutathione.

    PubMed

    Subramanian, Raju; Tam, Janet; Aidasani, Divesh; Reid, Darren L; Skiles, Gary L

    2011-05-16

    Compounds 1 (N1-(3-ethynylphenyl)-6-methyl-N5-(3-(6-(methylamino)pyrimidin-4-yl)pyridin-2-yl) isoquinoline-1,5-diamine) and 2 (N-(3-ethynylphenyl)-6,7-bis(2-methoxyethoxy)quinazolin-4-amine; Erlotinib/Tarceva) are kinase inhibitors that contain a terminal phenyl acetylene moiety. When incubated in the presence of P450 and NADPH, the anticipated phenyl acetic acid metabolite was formed. When 10 mM of N-acetyl-l-cysteine was added to the incubation mixtures, the phenyl acetic acid product was reduced and at 25 mM or higher concentration of NAC, formation of the phenyl acetic acid was abolished. Instead, the phenyl acetylene moiety lost a carbon and formed a benzaldehyde product. Other oxidation products incorporating one or more equivalents of NAC were also observed. The identities of the metabolites were characterized by MS and NMR. Addition of deferoxamine or ascorbic acid diminished the formation of the NAC influenced products. Similar products were also observed when 1 or 2 were incubated in P450 reactions supplemented with GSH, in Fenton reactions supplemented with NAC or GSH, and in peroxidase reactions supplemented with NAC. We propose the thiols act as a pro-oxidant readily undergoing a one-electron oxidation to form thiyl radicals which in turn initiates the formation of other peroxy radicals that drive the reaction to the observed products. These in vitro findings suggest that one-electron oxidation of thiols may promote the cooxidation of xenobiotic substrates.

  15. Group evaporation

    NASA Technical Reports Server (NTRS)

    Shen, Hayley H.

    1991-01-01

    Liquid fuel combustion process is greatly affected by the rate of droplet evaporation. The heat and mass exchanges between gas and liquid couple the dynamics of both phases in all aspects: mass, momentum, and energy. Correct prediction of the evaporation rate is therefore a key issue in engineering design of liquid combustion devices. Current analytical tools for characterizing the behavior of these devices are based on results from a single isolated droplet. Numerous experimental studies have challenged the applicability of these results in a dense spray. To account for the droplets' interaction in a dense spray, a number of theories have been developed in the past decade. Herein, two tasks are examined. One was to study how to implement the existing theoretical results, and the other was to explore the possibility of experimental verifications. The current theoretical results of group evaporation are given for a monodispersed cluster subject to adiabatic conditions. The time evolution of the fluid mechanic and thermodynamic behavior in this cluster is derived. The results given are not in the form of a subscale model for CFD codes.

  16. Formative Assessment Probes: Is It a Rock? Continuous Formative Assessment

    ERIC Educational Resources Information Center

    Keeley, Page

    2013-01-01

    A lesson plan is provided for a formative assessment probe entitled "Is It a Rock?" This probe is designed for teaching elementary school students about rocks through the use of a formative assessment classroom technique (FACT) known as the group Frayer Model. FACT activates students' thinking about a concept and can be used to…

  17. C-H bond activation of the methyl group of the supporting ligand in an osmium(III) complex upon reaction with H2O2: formation of an organometallic osmium(IV) complex.

    PubMed

    Sugimoto, Hideki; Ashikari, Kenji; Itoh, Shinobu

    2013-01-18

    Oxidation of the hydroxoosmium(III) complex resulted in C-H bond activation of the methyl group of the supporting ligand (N,N'-dimethyl-2,11-diaza[3.3](2,6)pyridinophane). The product was an osmium(IV) complex exhibiting a seven-coordinate structure with an additional Os-CH(2) bond.

  18. Galaxy formation

    SciTech Connect

    Silk, J.

    1984-11-01

    Implications of the isotropy of the cosmic microwave background on large and small angular scales for galaxy formation are reviewed. In primeval adiabatic fluctuations, a universe dominated by cold, weakly interacting nonbaryonic matter, e.g., the massive photino is postulated. A possible signature of photino annihilation in our galactic halo involves production of cosmic ray antiprotons. If the density is near its closure value, it is necessary to invoke a biasing mechanism for suppressing galaxy formation throughout most of the universe in order to reconcile the dark matter density with the lower astronomical determinations of the mean cosmological density. A mechanism utilizing the onset of primordial massive star formation to strip gaseous protogalaxies is described. Only the densest, early collapsing systems form luminous galaxies. (ESA)

  19. Comet formation

    NASA Astrophysics Data System (ADS)

    Blum, J.

    2014-07-01

    There has been vast progress in our understanding of planetesimal formation over the past decades, owing to a number of laboratory experiments as well as to refined models of dust and ice agglomeration in protoplanetary disks. Coagulation rapidly forms cm-sized ''pebbles'' by direct sticking in collisions at low velocities (Güttler et al. 2010; Zsom et al. 2010). For the further growth, two model approaches are currently being discussed: (1) Local concentration of pebbles in nebular instabilities until gravitational instability occurs (Johansen et al. 2007). (2) A competition between fragmentation and mass transfer in collisions among the dusty bodies, in which a few ''lucky winners'' make it to planetesimal sizes (Windmark et al. 2012a,b; Garaud et al. 2013). Predictions of the physical properties of the resulting bodies in both models allow a distinction of the two formation scenarios of planetesimals. In particular, the tensile strength (i.e, the inner cohesion) of the planetesimals differ widely between the two models (Skorov & Blum 2012; Blum et al. 2014). While model (1) predicts tensile strengths on the order of ˜ 1 Pa, model (2) results in rather compactified dusty bodies with tensile strengths in the kPa regime. If comets are km-sized survivors of the planetesimal-formation era, they should in principle hold the secret of their formation process. Water ice is the prime volatile responsible for the activity of comets. Thermophysical models of the heat and mass transport close to the comet-nucleus surface predict water-ice sublimation temperatures that relate to maximum sublimation pressures well below the kPa regime predicted for formation scenario (2). Model (1), however, is in agreement with the observed dust and gas activity of comets. Thus, a formation scenario for cometesimals involving gravitational instability is favored (Blum et al. 2014).

  20. Local Group Cosmology

    NASA Astrophysics Data System (ADS)

    Martínez-Delgado, David

    2013-11-01

    List of contributors; List of participants; Preface; Acknowledgments; Abbreviations; 1. The formation of the Milky Way in the CDM paradigm Ken Freeman; 2. Dark matter content and tidal effects in Local Group dwarf galaxies Steven R. Majewski; 3. Notes on the missing satellites problem James Bullock; 4. The Milky Way satellite galaxies Pavel Kroupa; 5. Stellar tidal streams Rodrigo Ibata; 6. Tutorial: the analysis of colour-magnitude diagrams David Valls-Gabaud; 7. Tutorial: modeling tidal streams using N-body simulations Jorge Peñarrubia.

  1. Flexible formation configuration for terrain following flight: Formation keeping constraints

    NASA Astrophysics Data System (ADS)

    Latyshev, Simon

    This work suggests a control method for the terrain-following formation motion of a group of communicating autonomous agents. The presented approach centers on defining a suitable set of constraints for formation keeping task that shall be fulfilled while agents are negotiating an unknown terrain toward the predefined goal location. It allows agents to maintain a general geometric formation shape, while allowing each individual formation member freedom of maneuver, required for terrain collision free motion. Formation structure is defined with the use of virtual leader. Formation keeping constraints are defined with plane surfaces, specified relative to position and navigation vector of the virtual leader. Formation navigation and guidance constraints are defined using navigation vectors of formation members and the virtual leader. Alternative designs for the constraints derived with parabolic, cone, and cylindrical surfaces are considered. Formation control is derived using the Udwadia-Kalaba equation, following corresponding approach to the development of control methods for constraint based dynamical systems, including leader-follower systems defined using geometric constraints. Approach to terrain following motion requiring agents to stay within bounds of cylindrical corridor volumes built around their respective navigation vectors is assumed. Individual formation primitives and multi-level, hierarchical, formation structures are considered. Simulations, based on three degrees of freedom nonlinear model of an agent, performed using Mathematica and specifically developed combined Maya-Mathematica modeling and simulation system, demonstrate that a flexible terrain following formation motion is achieved with the presented sets of constraints.

  2. IRIG Serial Time Code Formats

    DTIC Science & Technology

    2016-08-01

    TELECOMMUNICATIONS AND TIMING GROUP IRIG STANDARD 200-16 IRIG SERIAL TIME CODE FORMATS DISTRIBUTION A: APPROVED FOR...ARNOLD ENGINEERING DEVELOPMENT COMPLEX NATIONAL AERONAUTICS AND SPACE ADMINISTRATION This page intentionally left blank. IRIG SERIAL TIME CODE ...Serial Time Code Formats, RCC 200-16, August 2016 v Table of Contents Preface

  3. SAS FORMATS: USES AND ABUSES

    EPA Science Inventory

    SAS formats are a very powerful tool. They allow you to display the data in a more readable manner without modifying it. Formats can also be used to group data into categories for use in various procedures like PROC FREQ, PROC TTEST, and PROC MEANS (as a class variable). As ...

  4. SAS FORMATS: USES AND ABUSES

    EPA Science Inventory

    SAS formats are a very powerful tool. They allow you to display the data in a more readable manner without modifying it. Formats can also be used to group data into categories for use in various procedures like PROC FREQ, PROC TTEST, and PROC MEANS (as a class variable). As w...

  5. Taphofacies of Lower-Middle Pennsylvanian marine invertebrates from the Monte Alegre and Itaituba formations, part of the outcropped marine sequence of the Tapajós Group (Southern Amazonas Basin, Brazil) - regional palaeoecological models

    NASA Astrophysics Data System (ADS)

    Moutinho, L. P.; Scomazzon, A. K.; Nascimento, S.; Lemos, V. B.

    2016-10-01

    One of the most relevant characteristics of the Pennsylvanian shallow-water carbonates of the Amazonas Basin is its diverse and well preserved invertebrate fossiliferous assemblages. In order to better understand the origin of these fossil concentrations, taphonomic data were obtained along well exposed areas of the uppermost part of the Monte Alegre Formation and basal part of the Itaituba Formation, which, based on conodonts, fusulinids and palynomorphs is of Atokan age. The taphonomic data focused on invertebrate organisms were supported by petrographic analysis. The understanding of the stacking pattern of the strata in the studied section allowed the identification of five type taphofacies, which contributed in the development of regional palaeoecological models, expressed as block-diagrams. These characterize the distribution of the environmental parameters, the composition of the faunal associations and the distribution and amplitude of the taphonomic processes that created the taphonomic signatures of the bioclastic elements throughout the supratidal to lower intertidal/deep subtidal depositional environments pertinent to the studied depositional environment. The regional palaeoecological models here presented are related to the particularities of the depositional environments of the studied rocks and are exclusive for the characterization of this intracratonic basin set influenced by high frequency climatic variations. Lithofacies, biofacies and taphofacies associations also reflect depositional conditions pertinent to the studied regional context, differing from the elements observed in modern intracratonic contexts analogous to the one studied, from different sedimentary basins around the world. Therefore, invertebrate taphonomy, supported by the analysis of sedimentary facies, fulfills the purposes recommended in this work, demonstrating its potential as a tool for palaeoecological analysis in the Pennsylvanian outcropping section in the southern

  6. A Functional Analytic Approach to Group Psychotherapy

    ERIC Educational Resources Information Center

    Vandenberghe, Luc

    2009-01-01

    This article provides a particular view on the use of Functional Analytical Psychotherapy (FAP) in a group therapy format. This view is based on the author's experiences as a supervisor of Functional Analytical Psychotherapy Groups, including groups for women with depression and groups for chronic pain patients. The contexts in which this approach…

  7. Researching Women's Groups Findings, Limitations, and Recommendations

    ERIC Educational Resources Information Center

    Leech, Nancy L.; Kees, Nathalie L.

    2005-01-01

    There is not a "typical" women's group, nor are there "typical" women's issues. Every women's group is diverse, with as many viewpoints and perspectives as there are members in the group. Using the group format for women is common practice with many counselors. It is interesting that there has been little empirical research reported on women's…

  8. Common Group Problems: A Field Study.

    ERIC Educational Resources Information Center

    Weinberg, Sanford B.; And Others

    1981-01-01

    A field study of a naturally functioning group (N=125) was conducted to identify common group problems. Trained observers attended group meetings and described the problems encountered. Difficulties of cohesion, leadership, sub-group formation, and personality conflict were identified. (RC)

  9. Identification of a new alpha1,2-fucosyltransferase involved in O-antigen biosynthesis of Escherichia coli O86:B7 and formation of H-type 3 blood group antigen.

    PubMed

    Li, Mei; Shen, Jie; Liu, Xianwei; Shao, Jun; Yi, Wen; Chow, Christine S; Wang, Peng G

    2008-11-04

    Escherichia coli O86 possesses high human blood group B activity because of its O-antigen structure, sharing the human blood group B epitope. In this study, the wbwK gene of E. coli O86:B7 was expressed and purified as the GST fusion protein. Thereafter, the wbwK gene was biochemically identified to encode an alpha1,2-fucosyltransferase through radioactivity assays, as well as mass spectrometry and NMR spectroscopy. WbwK shows strict substrate specificity and only recognizes Gal beta1,3GalNAc alpha-OR (T-antigen and derivatives) as the acceptor to generate the H-type 3 blood group antigen. In contrast to other alpha1,2-fucosyltransferases, WbwK does not display activity toward the simple substrate Gal beta-OMe. Comparison with another recently characterized alpha1,2-fucosyltransferase (WbsJ) of E. coli O128:B12 indicates a low level of amino acid identity between them; however, they share a common acceptor substrate, Gal beta1,3GalNAc alpha-OR. Domain swapping between WbwK and WbsJ revealed that the smaller variable domains located in the C-terminus determine substrate specificity, whereas the larger variable domain in the N-terminus might play a role in forming the correct conformation for substrate binding or for localization of the alpha1,2-fucosyltransferase involved in O-antigen biosynthesis. In addition, milligram scale biosynthesis of the H-type 3 blood group antigen was explored using purified recombinant WbwK. WbwK may have potential applications in masking T-antigen, the tumor antigen, in vivo.

  10. Facilities removal working group

    SciTech Connect

    1997-03-01

    This working group`s first objective is to identify major economic, technical, and regulatory constraints on operator practices and decisions relevant to offshore facilities removal. Then, the group will try to make recommendations as to regulatory and policy adjustments, additional research, or process improvements and/or technological advances, that may be needed to improve the efficiency and effectiveness of the removal process. The working group will focus primarily on issues dealing with Gulf of Mexico platform abandonments. In order to make the working group sessions as productive as possible, the Facilities Removal Working Group will focus on three topics that address a majority of the concerns and/or constraints relevant to facilities removal. The three areas are: (1) Explosive Severing and its Impact on Marine Life, (2) Pile and Conductor Severing, and (3) Deep Water Abandonments This paper will outline the current state of practice in the offshore industry, identifying current regulations and specific issues encountered when addressing each of the three main topics above. The intent of the paper is to highlight potential issues for panel discussion, not to provide a detailed review of all data relevant to the topic. Before each panel discussion, key speakers will review data and information to facilitate development and discussion of the main issues of each topic. Please refer to the attached agenda for the workshop format, key speakers, presentation topics, and panel participants. The goal of the panel discussions is to identify key issues for each of the three topics above. The working group will also make recommendations on how to proceed on these key issues.

  11. Stabilizing clayey formations

    SciTech Connect

    Lipowski, S. A.; Miskel Jr., J. J.; Schick, M. J.

    1985-03-19

    Process for treating a clayey geological formation to prevent, inhibit or reduce swelling or migrating of clay particles in a formation by treating the formation with an effective amount of a quaternized oligomer which is the reaction product of a polyamine having a primary amino group and a tertiary amino group with a difunctional reactant to form a precondensate monomer which is then chain extended and quaternized by reaction with a dihalogenated hydrocarbon ether. A preferred oligomer is a product of: (I) about 1.0 mole of a precondensate which is the reaction product of (A) from about 2.0 to about 3.0 mole of a polyamine having a primary amino group and a tertiary amino group, the polyamine having a non-cyclic backbone containing between 1 and 6 carbon atoms, with (B) about 1.0 mole of a difunctional reactant which is a diester of a mixture of dicarboxylic acids such as adipic, glutaric and succinic acid, with (II) from about 1.0 to about 1.2 mole of a chain extender such as dichloroethylether. Process is useful in oil producing operations.

  12. Ichnology of deglaciation deposits from the Upper Carboniferous Rio do Sul Formation (Itararé Group, Paraná Basin) at central-east Santa Catarina State (southern Brazil)

    NASA Astrophysics Data System (ADS)

    Lima, João Henrique Dobler; Netto, Renata Guimarães; Corrêa, Camila Graziele; Lavina, Ernesto Luiz Corrêa

    2015-11-01

    Trace fossil assemblages dominated by arthropod trackways are common in sediments deposited during the Late Paleozoic Ice Age. Ichnofaunas preserved in glacially-influenced sedimentary successions were previously reported from Paraná Basin in southern Brazil. The ichnofauna of the Rio do Sul Formation preserved in the rhythmites exposed in Trombudo Central quarries (Santa Catarina State, southern Brazil) is revised in this paper. Cruziana problematica, Diplichnites gouldi, Diplopodichnus biformis, Glaciichnium liebegastensis, Gluckstadtella elongata isp. nov., Helminthoidichnites tenuis, Mermia carickensis, Protovirgularia dichotoma, Treptichnus pollardi and Umfolozia sinuosa were recorded. Two trace fossil suites were recognized. The undermat miners suite is dominated by H. tenuis, indicating the presence of surface grazers (insect larvae, isopods and amphipods). C. problematica, D. gouldi and U. sinuosa dominate the overmat grazers suite, as result of displacement of terrestrial and aquatic arthropods. The integrated sedimentological and ichnological data from Trombudo Central region suggests colonization of ephemeral, shallow water bodies filled by freshwater from glacier melting. The deposition of the rhythmites took place in a glaciolacustrine context represented by shallow ponds in marginal marine settings.

  13. Cloud Formation

    NASA Astrophysics Data System (ADS)

    Graham, Mark Talmage

    2004-05-01

    Cloud formation is crucial to the heritage of modern physics, and there is a rich literature on this important topic. In 1927, Charles T.R. Wilson was awarded the Nobel Prize in physics for applications of the cloud chamber.2 Wilson was inspired to study cloud formation after working at a meteorological observatory on top of the highest mountain in Scotland, Ben Nevis, and testified near the end of his life, "The whole of my scientific work undoubtedly developed from the experiments I was led to make by what I saw during my fortnight on Ben Nevis in September 1894."3 To form clouds, Wilson used the sudden expansion of humid air.4 Any structure the cloud may have is spoiled by turbulence in the sudden expansion, but in 1912 Wilson got ion tracks to show up by using strobe photography of the chamber immediately upon expansion.5 In the interim, Millikan's study in 1909 of the formation of cloud droplets around individual ions was the first in which the electron charge was isolated. This study led to his famous oil drop experiment.6 To Millikan, as to Wilson, meteorology and physics were professionally indistinct. With his meteorological physics expertise, in WWI Millikan commanded perhaps the first meteorological observation and forecasting team essential to military operation in history.7 But even during peacetime meteorology is so much of a concern to everyone that a regular news segment is dedicated to it. Weather is the universal conversation topic, and life on land could not exist as we know it without clouds. One wonders then, why cloud formation is never covered in physics texts.

  14. A theoretical study on the strength of the C-NO2 bond and ring strain upon the formation of the intermolecular H-bonding interaction between HF and nitro group in nitrocyclopropane, nitrocyclobutane, nitrocyclopentane or nitrocyclohexane.

    PubMed

    Qiu, Wei; Ren, Fu-de; Shi, Wen-jing; Wang, Yan-hong

    2015-05-01

    As a follow-up to our investigation into the influence of H-bond on the C-NO2 trigger bond, a comparison of the effect of the H-bond on the ring strain energy with the C-NO2 bond dissociation energy was carried out in the HF complex with nitrocyclopropane, nitrocyclobutane, nitrocyclopentane, and nitrocyclohexane by using the DFT-B3LYP and MP2 (full) methods with the 6-311++G(2df,2p) and aug-cc-pVTZ basis sets. The C-NO2 bond length decreases with strengthening of trigger-bond while the ring perimeter increases companied by weakening of ring strain upon the complex formation. The H-bonding energy correlates well with the increment of ring perimeter and the change of ring bond angle. For nitrocyclopropane∙∙∙HF, the effect of H-bond on the ring strain energy is notable, while for the other complex, it is negligible. Therefore, for nitrocyclopropane∙∙∙HF, the origin of the change of explosive sensitivity might be due to the increment of the C-NO2 bond dissociation energy and decrease of the ring strain energy, while for the other complex, it might be only due to the strengthening of C-NO2 bond. The analysis of electron density shifts shows that the C-C bond in ring loses density while the C-NO2 bond gains density, leading to the weakened ring strain and strengthened C-NO2 bond, and thus the possibly reduced explosive sensitivity.

  15. Involvement of cytoskeletal proteins in the barrier function of the human erythrocyte membrane. I. Impairment of resealing and formation of aqueous pores in the ghost membrane after modification of SH groups.

    PubMed

    Klonk, S; Deuticke, B

    1992-04-29

    Resealed human erythrocyte ghosts prepared by a two-step procedure were shown to have small residual barrier defects with the properties of aqueous pores, such as size discrimination of hydrophilic nonelectrolytes (erythritol to sucrose), indicative of an apparent pore radius of about 0.7 nm, and a low activation energy (about 12-20 kJ/mol (mannitol, sucrose)) of the leak fluxes. As in other cases (Deuticke et al. (1991) Biochim. Biophys. Acta 1067, 111-122) these leak fluxes can be inhibited by phloretin. Treatment of such resealed ghosts with the mild SH oxidizing agent, diamide, induces additional membrane leaks to the same extent and with the same properties as in native erythrocytes (Deuticke et al. (1983) Biochim. Biophys. Acta 731, 196-210), including reversibility of the leak by SH reducing agents, inhibition by phloretin and stimulation by alkanols. In contrast, resealed ghosts prepared either from diamide-treated erythrocytes or by adding diamide to the 'open' membranes prior to reconstitution of high ionic strength and raising the temperature, exhibit a state of greater leakiness. This leakiness is somewhat different in its origin from the former class of leaks, since it can also be produced by N-ethylmaleimide, which is essentially ineffective when added to the membrane in its 'tight' state. The leaks induced in the 'open' state of the membrane, which can be regarded as a consequence of an impaired resealing, are nevertheless reversible by reducing agents added after resealing and are comparable in many, but not all their characteristics to leaks induced in the 'tight' state of the membrane. Resealing in the presence of the isothiocyanostilbenes DIDS or SITS mimicks the leak forming effect of diamide by modifying a small population of SH groups, while amino groups seem not to be involved. The findings indicate and substantiate an important role of the redox state of membrane skeletal protein sulfhydryls in the maintenance and the re-establishment of the

  16. Stereotype Formation: Biased by Association

    ERIC Educational Resources Information Center

    Le Pelley, Mike E.; Reimers, Stian J.; Calvini, Guglielmo; Spears, Russell; Beesley, Tom; Murphy, Robin A.

    2010-01-01

    We propose that biases in attitude and stereotype formation might arise as a result of learned differences in the extent to which social groups have previously been predictive of behavioral or physical properties. Experiments 1 and 2 demonstrate that differences in the experienced predictiveness of groups with respect to evaluatively neutral…

  17. Amphiplex Formation

    NASA Astrophysics Data System (ADS)

    Petersen, Shannon; Laaser, Jennifer; Lodge, Timothy

    2015-03-01

    Polymer-micelle complexes are currently under heavy investigation due to their potential applications in targeted drug delivery and gene therapy, yet the dynamics of the complex formation is still relatively unstudied. By varying the ratios of poly(styrene sulfonate) chains and cationic poly(dimethylaminoethyl methacrylate)-b-poly(styrene) micelles and the ionic strength of the system, we created a variety of complex configurations of different sizes and charges. The complexes were characterized dynamic light scattering and zeta potential measurements which provided information regarding the hydrodynamic radius, distribution of sizes, and effective charge.

  18. Planet Formation

    NASA Technical Reports Server (NTRS)

    Lissauer, Jack J.; Fonda, Mark (Technical Monitor)

    2002-01-01

    Modern theories of star and planet formation and of the orbital stability of planetary systems are described and used to discuss possible characteristics of undiscovered planetary systems. The most detailed models of planetary growth are based upon observations of planets and smaller bodies within our own Solar System and of young stars and their environments. Terrestrial planets are believed to grow via pairwise accretion until the spacing of planetary orbits becomes large enough that the configuration is stable for the age of the system. Giant planets begin their growth as do terrestrial planets, but they become massive enough that they are able to accumulate substantial amounts of gas before the protoplanetary disk dissipates. These models predict that rocky planets should form in orbit about most single stars. It is uncertain whether or not gas giant planet formation is common, because most protoplanetary disks may dissipate before solid planetary cores can grow large enough to gravitationally trap substantial quantities of gas. A potential hazard to planetary systems is radial decay of planetary orbits resulting from interactions with material within the disk. Planets more massive than Earth have the potential to decay the fastest, and may be able to sweep up smaller planets in their path. The implications of the giant planets found in recent radial velocity searches for the abundances of habitable planets are discussed, and the methods that are being used and planned for detecting and characterizing extrasolar planets are reviewed.

  19. Basic Skills for Leadership of Counseling Groups.

    ERIC Educational Resources Information Center

    Pearson, Richard E.

    1981-01-01

    Identifies a set of basic group leadership skills to be used in a systematic skills training approach. The skills involve teaching and group management. Definitions and examples of the skills are provided, and the adaptation of a microcounseling format for training in group leadership skills is discussed. (Author)

  20. Habit formation

    PubMed Central

    Smith, Kyle S.; Graybiel, Ann M.

    2016-01-01

    Habits, both good ones and bad ones, are pervasive in animal behavior. Important frameworks have been developed to understand habits through psychological and neurobiological studies. This work has given us a rich understanding of brain networks that promote habits, and has also helped us to understand what constitutes a habitual behavior as opposed to a behavior that is more flexible and prospective. Mounting evidence from studies using neural recording methods suggests that habit formation is not a simple process. We review this evidence and take the position that habits could be sculpted from multiple dissociable changes in neural activity. These changes occur across multiple brain regions and even within single brain regions. This strategy of classifying components of a habit based on different brain signals provides a potentially useful new way to conceive of disorders that involve overly fixed behaviors as arising from different potential dysfunctions within the brain's habit network. PMID:27069378

  1. Habit formation.

    PubMed

    Smith, Kyle S; Graybiel, Ann M

    2016-03-01

    Habits, both good ones and bad ones, are pervasive in animal behavior. Important frameworks have been developed to understand habits through psychological and neurobiological studies. This work has given us a rich understanding of brain networks that promote habits, and has also helped us to understand what constitutes a habitual behavior as opposed to a behavior that is more flexible and prospective. Mounting evidence from studies using neural recording methods suggests that habit formation is not a simple process. We review this evidence and take the position that habits could be sculpted from multiple dissociable changes in neural activity. These changes occur across multiple brain regions and even within single brain regions. This strategy of classifying components of a habit based on different brain signals provides a potentially useful new way to conceive of disorders that involve overly fixed behaviors as arising from different potential dysfunctions within the brain's habit network.

  2. Composition and method of stimulating subterranean formations

    SciTech Connect

    Dill, W.R.; Walker, M.L.; Ford, G.F.

    1987-07-14

    This patent describes a method of treating a subterranean formation containing iron comprising contacting a subterranean formation with an aqueous fluid containing a compound consisting essentially of at least one member selected from the group consisting of: dihydroxymaleic acid, salts of dihydroxymaleic acid, glucono-deltalactone present in an amount sufficient to prevent the precipitation of ferric iron during contact with the subterranean formation.

  3. Group typicality, group loyalty and cognitive development.

    PubMed

    Patterson, Meagan M

    2014-09-01

    Over the course of childhood, children's thinking about social groups changes in a variety of ways. Developmental Subjective Group Dynamics (DSGD) theory emphasizes children's understanding of the importance of conforming to group norms. Abrams et al.'s study, which uses DSGD theory as a framework, demonstrates the social cognitive skills underlying young elementary school children's thinking about group norms. Future research on children's thinking about groups and group norms should explore additional elements of this topic, including aspects of typicality beyond loyalty.

  4. Formation of Bidisperse Particle Clouds

    NASA Astrophysics Data System (ADS)

    Er, Jenn Wei; Zhao, Bing; Law, Adrian W. K.; Adams, E. Eric

    2014-11-01

    When a group of dense particles is released instantaneously into water, their motion has been conceptualized as a circulating particle thermal (Ruggerber 2000). However, Wen and Nacamuli (1996) observed the formation of particle clumps characterized by a narrow, fast moving core shedding particles into wakes. They observed the clump formation even for particles in the non-cohesive range as long as the source Rayleigh number was large (Ra > 1E3) or equivalently the source cloud number (Nc) was small (Nc < 3.2E2). This physical phenomenon has been investigated by Zhao et al. (2014) through physical experiments. They proposed the theoretical support for Nc dependence and categorized the formation processes into cloud formation, transitional regime and clump formation. Previous works focused mainly on the behavior of monodisperse particles. The present study further extends the experimental investigation to the formation process of bidisperse particles. Experiments are conducted in a glass tank with a water depth of 90 cm. Finite amounts of sediments with various weight proportions between coarser and finer particles are released from a cylindrical tube. The Nc being tested ranges from 6E-3 to 9.9E-2, which covers all the three formation regimes. The experimental results showed that the introduction of coarse particles promotes cloud formation and reduce the losses of finer particles into the wake. More quantitative descriptions of the effects of source conditions on the formation processes will be presented during the conference.

  5. Barrier Formation

    PubMed Central

    Lyaruu, D.M.; Medina, J.F.; Sarvide, S.; Bervoets, T.J.M.; Everts, V.; DenBesten, P.; Smith, C.E.; Bronckers, A.L.J.J.

    2014-01-01

    Enamel fluorosis is an irreversible structural enamel defect following exposure to supraoptimal levels of fluoride during amelogenesis. We hypothesized that fluorosis is associated with excess release of protons during formation of hypermineralized lines in the mineralizing enamel matrix. We tested this concept by analyzing fluorotic enamel defects in wild-type mice and mice deficient in anion exchanger-2a,b (Ae2a,b), a transmembrane protein in maturation ameloblasts that exchanges extracellular Cl− for bicarbonate. Defects were more pronounced in fluorotic Ae2a,b−/− mice than in fluorotic heterozygous or wild-type mice. Phenotypes included a hypermineralized surface, extensive subsurface hypomineralization, and multiple hypermineralized lines in deeper enamel. Mineral content decreased in all fluoride-exposed and Ae2a,b−/− mice and was strongly correlated with Cl−. Exposure of enamel surfaces underlying maturation-stage ameloblasts to pH indicator dyes suggested the presence of diffusion barriers in fluorotic enamel. These results support the concept that fluoride stimulates hypermineralization at the mineralization front. This causes increased release of protons, which ameloblasts respond to by secreting more bicarbonates at the expense of Cl− levels in enamel. The fluoride-induced hypermineralized lines may form barriers that impede diffusion of proteins and mineral ions into the subsurface layers, thereby delaying biomineralization and causing retention of enamel matrix proteins. PMID:24170372

  6. Geochemistry of the Halogens (I, Br, Cl) and Evolution of the Seawater During the Archean

    NASA Astrophysics Data System (ADS)

    Avice, G.; Marty, B.; Burgess, R.; Goldsmith, S. L.

    2015-12-01

    Halogens (I, Cl, Br) on Earth are depleted relative to the results of the condensation sequence of elements from the solar nebula [1]. The cause of this depletion remains unknown but might be related to loss from impacts or to the presence of an hidden reservoir (e.g. core). The presence of fluid inclusions in hydrothermal quartz of various ages is an opportunity to follow the evolution of the composition of the atmosphere (N, noble gases) through time [2] but also of halogens in seawater (their main reservoir). Such studies may help to constrain what is the origin of these volatile elements on Earth. For this purpose, we analysed quartz from hydrothermal veins and pods of various localities and ages (e.g. Barberton Greenstone Belt (South Africa; 3.2 Ga), Fortescue Group (Australia; 2.7 Ga)) by crushing and step-heating following the extended Ar-Ar method [3]. In Barberton and Fortescue Gp. quartz, a hydrothermal component characterized by excess 40Ar (40ArE) and closely associated with chlorine is clearly identified from crushing and step-heating results and permits to define a 40ArE/Cl used to correct Ar-Ar data for this contribution. In the case of Barberton, the correction for the hydrothermal component leads to an approximate formation age of the quartz of 3.2 (+/- 0.1) Ga. In Barberton quartz, halogens elemental ratios obtained during crushing and step-heating experiments are highly enriched in iodine and bromine (I/Cl=2-7x10-4; Br/Cl=4-10x10-3) relative to modern seawater. These results are similar to those found in a previous study of Barberton fluid inclusions [3] and can be interpreted as indicators that organic carbon was not sufficiently abundant at this time and/or this location to efficiently pump Br and I during sediment burial. Iodine and bromine, in Fortescue Gp. quartz, are less enriched suggesting that, in that case, organic activity already acted as pump for these elements. [1] Sharp & Draper (2013) EPSL, 369-370, p. 71-77 [2] Pujol et al. (2011

  7. Group B Strep Infection in Adults

    MedlinePlus

    ... Related Links Active Bacterial Core surveillance (ABCs) CDC Streptococcus Laboratory Sepsis Group B Strep Infection in Adults ... Related Links Active Bacterial Core surveillance (ABCs) CDC Streptococcus Laboratory Sepsis Language: English Español (Spanish) File Formats ...

  8. Group Cohesion in Experiential Growth Groups

    ERIC Educational Resources Information Center

    Steen, Sam; Vasserman-Stokes, Elaina; Vannatta, Rachel

    2014-01-01

    This article explores the effect of web-based journaling on changes in group cohesion within experiential growth groups. Master's students were divided into 2 groups. Both used a web-based platform to journal after each session; however, only 1 of the groups was able to read each other's journals. Quantitative data collected before and…

  9. Group theories: relevance to group safety studies.

    PubMed

    Benevento, A L

    1998-01-01

    Promoting safety in the workplace has been attempted in a variety of ways. Increasingly, industries are using groups such as safety teams and quality circles to promote worker safety. Group influences on individual behavior and attitudes have long been studied in the social psychology literature, but the theories have not been commonly found outside the psychology arena. This paper describes the group theories of group polarization, risky shift, social loafing, groupthink and team think and attempts to apply these theories to existing studies that examine work group influences on safety. Interesting parallels were found but only one study examined group influences as their primary focus of research. Since groups are increasingly used for safety promotion, future research on safety that studies group influences with respect to current group theories is recommended.

  10. Pollutant Assessments Group Procedures Manual

    SciTech Connect

    Chavarria, D.E.; Davidson, J.R.; Espegren, M.L.; Kearl, P.M.; Knott, R.R.; Pierce, G.A.; Retolaza, C.D.; Smuin, D.R.; Wilson, M.J.; Witt, D.A. ); Conklin, N.G.; Egidi, P.V.; Ertel, D.B.; Foster, D.S.; Krall, B.J.; Meredith, R.L.; Rice, J.A.; Roemer, E.K. )

    1991-02-01

    This procedures manual combines the existing procedures for radiological and chemical assessment of hazardous wastes used by the Pollutant Assessments Group at the time of manuscript completion (October 1, 1990). These procedures will be revised in an ongoing process to incorporate new developments in hazardous waste assessment technology and changes in administrative policy and support procedures. Format inconsistencies will be corrected in subsequent revisions of individual procedures.

  11. Constructing Group Learning.

    ERIC Educational Resources Information Center

    Heimlich, Joe E.

    1996-01-01

    Presents guidelines for constructing group learning activities, describes group learning methods (discussion, gaming, role play, simulation, projects), and provides tips for facilitating group activities. (SK)

  12. Group Dynamic Processes in Email Groups

    ERIC Educational Resources Information Center

    Alpay, Esat

    2005-01-01

    Discussion is given on the relevance of group dynamic processes in promoting decision-making in email discussion groups. General theories on social facilitation and social loafing are considered in the context of email groups, as well as the applicability of psychodynamic and interaction-based models. It is argued that such theories may indeed…

  13. Formative Considerations Using Integrative CALL.

    ERIC Educational Resources Information Center

    Callahan, Philip; Shaver, Peter

    2001-01-01

    Addresses technical and learning issues relating to a formative implementation of a computer assisted language learning (CALL) browser-based intermediate Russian program. Instruction took place through a distance education implementation and in a grouped classroom using a local-area network. Learners indicated the software was clear, motivating,…

  14. SAS FORMATS: USES AND ABUSES

    EPA Science Inventory

    SAS formats are a very powerful tool. They allow you to display the data in a more readable manner without modifying the data. They can also be used to group data into categories for use in various procedures like PROC FREQ, PROC TTEST, and PROC MEANS (as a class variable). ...

  15. Properties of intra-group stars and galaxies in galaxy groups: `normal' versus `fossil' groups

    NASA Astrophysics Data System (ADS)

    Sommer-Larsen, Jesper

    2006-06-01

    Cosmological [cold dark matter (ΛCDM)] TreeSPH simulations of the formation and evolution of 12 galaxy groups of virial mass ~1014Msolar have been performed. The simulations invoke star formation, chemical evolution with non-instantaneous recycling, metallicity-dependent radiative cooling, strong star-burst driven galactic super-winds and effects of a meta-galactic ultraviolet (UV) field. The intra-group (IG) stars are found to contribute 12-45 per cent of the total group B-band luminosity at z = 0. The lowest fractions are found for groups with only a small difference between the R-band magnitudes of the first and second ranked group galaxy (Δm12,R <~ 0.5), the larger fractions are typical of `fossil' groups (FGs, Δm12,R >= 2). A similar conclusion is obtained from BVRIJK surface brightness profiles of the IG star populations. The IG stars in the four FGs are found to be older than the ones in the eight `normal' groups (non-FGs), on average by about 0.3-0.5 Gyr. The typical colour of the IG stellar population is B - R = 1.4-1.5, for both types of systems in good agreement with observations. The mean iron abundance of the IG stars is slightly sub-solar in the central part of the groups (r ~ 100 kpc) decreasing to about 40 per cent solar at about half the virial radius. The IG stars are α-element enhanced with a trend of [O/Fe] increasing with r and an overall [O/Fe] ~ 0.45 dex, indicative of dominant enrichment from Type II supernovae. The abundance properties are similar for both types of systems. The velocity distributions of the IG stars are, at r >~ 30 kpc, significantly more radially anisotropic for FGs than for the non-FGs; this also holds for the velocity distributions of the group galaxies. This indicates that an important characteristic determining whether a group becomes fossil or not, apart from its formation time, as discussed by D'Onghia et al., is the `initial' velocity distribution of the group galaxies. For FGs, one can dynamically infer the

  16. Distinguishing regional- and local-scale metasomatic systems at the Prairie Downs Zn-Pb deposit

    NASA Astrophysics Data System (ADS)

    White, Alistair J. R.; Pearce, Mark A.; Meadows, Holly R.

    2016-10-01

    Geochemical alteration in mafic rocks of the Fortescue Group around the Prairie Downs Zn-Pb-(Cu-Ag) deposit, Western Australia, is the result of two overprinting metasomatic systems. The first, a regional-scale event, well documented across the Fortescue Basin to the north, resulted in extensive depletion in alkalis, Mg, and heavier first transition series metals (Mn-Zn), and formation of mineral assemblages progressing towards pure epidote/pumpellyite-quartz end-members. The second, more localised event, was associated with Zn-Pb-(Cu-Ag) mineralisation and resulted in Ca-loss accompanied by enrichment in a broad transition metal and metalloid suite (Zn-Pb-Sn-Ag-K-Ba-Tl-Sb-Ge-U-Th-Cd-Hg-Se-REE) that is comparable to many sedimentary exhalative (SEDEX) systems, and possibly represents modification or remobilisation of an earlier ore system. The mineralisation-related alteration was superimposed on the earlier regional-scale metasomatism: previously unaltered basalts underwent Zn-bearing chlorite and biotite growth, with loss of amphibole and epidote; regionally metasomatised rocks now comprise assemblages dominated by quartz, muscovite and baileychlore (Zn chlorite). These altered basalts do not contain any sulphide minerals and all Zn is hosted within chlorite in a broad halo around the main sulphide zones, thereby providing a larger exploration target. Geochemical modelling with HCh indicates that the observed alteration assemblages can be generated through interaction of rocks with large volumes of a saline, Zn-K-bearing fluid (fluid/rock 1000). This study highlights the importance of understanding the regional geochemical background when investigating local metasomatic systems in order to correctly characterise them, determine their origin and position in a regional tectonic framework, and to correctly identify vectors towards mineralisation to aid future exploration.

  17. Formation enthalpies of peroxy-substituted silanes

    NASA Astrophysics Data System (ADS)

    Dibrivnyi, V. N.; Pavlovskii, Yu. P.; van-Chin-Syan, Yu. Ya.

    2010-05-01

    Enthalpies of combustion and formation of four peroxy-substituted silanes containing one or several peroxide groups bonded directly to the silicon atom were determined experimentally. The [O-(Si)(O)] group contribution and the correction for the pair interaction of peroxide groups were determined.

  18. Group Projects in Social Work Education: The Influence of Group Characteristics and Moderators on Undergraduate Student Outcomes

    ERIC Educational Resources Information Center

    Postlethwait, Ariana E.

    2016-01-01

    This study examined the impact of group size, group formation, group conflict, and division of labor on student outcomes in a group project for a sample of 112 BSW research seminar students at a large university in the Midwest. Students completed surveys on their experiences with the group project at the end of the semester. Multiple regression…

  19. Perfluoroalkyl polytriazines containing pendent iododifluoromethyl groups

    NASA Technical Reports Server (NTRS)

    Rosser, R. W.; Psarras, T. (Inventor)

    1980-01-01

    New perfluoroalkyl polytriazines containing pendent iododifluoromethyl groups are prepared by the reaction of perfluoroalkyl dinitriles with ammonia to form poly(imidoylamidines), followed by the cyclization of the imidoylamidine groups with, e.g., various mixtures of a perfluoroacyl fluoride with an omega iodoperfluoroacyl fluoride. The polytriazines obtained can be cured by heat which causes crosslinking at the iododifluoromethyl groups by elimination of iodine and formation of carbon-to-carbon bonds.

  20. Group target tracking using game theory

    NASA Astrophysics Data System (ADS)

    Sadjadi, Firooz A.; Kober, Wolfgang

    2001-10-01

    The problem of tracking of a group of targets is considered in this paper. We will present an overview of an investigation into this problem by first using the targets velocity state vectors covariance matrix to establish target grouping and then by exploiting concepts derived from game theory, in particular the leader-follower techniques, and graph theory to represent and establish relationships that influence the tracking of objects that belong to a group formation.

  1. 2004 NAI-ADP Deep Diamond Drill Cores: Transects Through Archean Time in the Pilbara Craton, Australia

    NASA Astrophysics Data System (ADS)

    Buick, R.; Dunlop, J. S.; Bonser, L. C.

    2004-12-01

    In July-August 2004, the NASA Astrobiology Drilling Program sponsored the coring of 3 deep diamond-drill holes in the Pilbara Craton of northwest Australia. The holes targeted the lowest grade and least deformed sedimentary sections of 4 stratigraphic units: the 2.4-2.6 Ga Hamersley Group, the 2.7 Ga Tumbiana Formation of the Fortescue Group, the 3.4 Ga Warrawoona Group, and the 3.5 Ga Coonterunah Group. ABDP 8 cored the unconformity between the Warrawoona and Coonterunah Groups to a depth of 330 metres, intersecting it at 155 metres. Because of syn-depositional erosion, the Strelley Pool Chert was attenuated and the alteration zone beneath the unconformity was scoured and filled to a depth of 10 metres by quartz arenite. As a result, no definitive lithological determination on its status as a potential paleosol could be made. Secondary oxidative alteration was present in Coonterunah cherts to depths of at least 220 metres down-hole. ABDP 9 cored 984 metres of the lower Hamersley Group, from the Dales Gorge Member of the Brockman Iron Formation into the Paraburdoo Member of the Wittenoom Formation. Though the hole was intended to penetrate the uppermost Fortescue Group, drilling was terminated early because of equipment damage by fractured rock, loss of water circulation clogging the hole with cuttings and unanticipated thickening of the Paraburdoo Member by dilational fracturing, expansive brecciation and cavity formation. 79 samples for organic geochemical analysis of biomarker syngenesis were collected under clean conditions immediately the core surfaced. A horizon of impact spherules was intersected in the Bee Gorge Member of the Wittenoom Formation; unlike surface exposures, it was markedly silicified and chloritized in drill-core. ABDP 10 cored 210 metres of the Tumbiana Formation, intersecting the entire Meentheena Carbonate Member, the upper Mingah Tuff Member and terminating just below 4 scoriaceous basalt flows. Large and complex calcareous stromatolites

  2. Can Groups Learn?

    ERIC Educational Resources Information Center

    Cohen, Elizabeth G.; Lotan, Rachel A.; Abram, Percy L.; Scarloss, Beth A.; Schultz, Susan E.

    2002-01-01

    Evaluated the work of sixth grade students' creative problem-solving groups, proposing that providing students with specific guidelines about what makes an exemplary group product would improve the character of the discussion and quality of the group product. Student groups did learn as a result of their discussions and creation of group products.…

  3. Small Groups in Action

    ERIC Educational Resources Information Center

    Suessmuth, Patrick

    1974-01-01

    Small groups can sometimes be difficult to set up and work with properly. A number of tips for small group instruction are divided into seven areas: (1) presenting tasks; (2) group seating; (3) task time; (4) answering questions; (5) teacher's role in observing groups; (6) group noise level patterns; and (7) serial take-ups. (BP)

  4. Group Work: How to Use Groups Effectively

    ERIC Educational Resources Information Center

    Burke, Alison

    2011-01-01

    Many students cringe and groan when told that they will need to work in a group. However, group work has been found to be good for students and good for teachers. Employers want college graduates to have developed teamwork skills. Additionally, students who participate in collaborative learning get better grades, are more satisfied with their…

  5. Group Time: Building Language at Group Time

    ERIC Educational Resources Information Center

    Church, Ellen Booth

    2004-01-01

    This article features energizing and surprising activities for children at group time. In the drawing activity, children are asked to give instructions on how to draw a picture using vocabulary and descriptive language. In the mailbox activity, children will be surprised to discover that they have mail at group time. Mailboxes can be used for…

  6. A Group Process Model for Problem Identification and Program Planning

    ERIC Educational Resources Information Center

    Delbecq, Andre L.; Van De Ven, Andrew H.

    1971-01-01

    This article sets forth a group process approach useful for practicing administrators charged with a program development task. Meeting formats are suggested for involving critical reference groups in successive phases of program Development. (Author)

  7. Group B Strep Infection

    MedlinePlus

    ... Questions OverviewWhat is group B strep?Group B streptococcus, or group B strep for short, is a ... can develop an infection of the lungs (called pneumonia), bloodstream (called sepsis), or the fluid around the ...

  8. The Group Experience

    ERIC Educational Resources Information Center

    Wadsworth, John

    2008-01-01

    Knowledge of group dynamics and leadership activities is a component of the CORE Standards for the Master's degree curriculum in Rehabilitation Counseling. A group experience is often included as a learning activity in rehabilitation counselor education curricula as an instructional method of imparting knowledge of group dynamics. Group experience…

  9. Common File Formats.

    PubMed

    Mills, Lauren

    2014-03-21

    An overview of the many file formats commonly used in bioinformatics and genome sequence analysis is presented, including various data file formats, alignment file formats, and annotation file formats. Example workflows illustrate how some of the different file types are typically used.

  10. Access grid: Immersive group-to-group collaborative visualization

    SciTech Connect

    Childers, L.; Disz, T.; Olson, R.; Papka, M. E.; Stevens, R.; Udeshi, T.

    2000-07-12

    Immersive projection displays have played an important role in enabling large-format virtual reality systems such as the CAVE and CAVE like devices and the various immersive desks and desktop-like displays. However, these devices have played a minor role so far in advancing the sense of immersion for conferencing systems. The Access Grid project led by Argonne is exploring the use of large-scale projection based systems as the basis for building room oriented collaboration and semi-immersive visualization systems. The authors believe these multi-projector systems will become common infrastructure in the future, largely based on their value for enabling group-to-group collaboration in an environment that can also support large-format projector based visualization. Creating a strong sense of immersion is an important goal for future collaboration technologies. Immersion in conferencing applications implies that the users can rely on natural sight and audio cues to facilitate interactions with participants at remote sites. The Access Grid is a low cost environment aimed primarily at supporting conferencing applications, but it also enables semi-immersive visualization and in particular, remote visualization. In this paper, they describe the current state of the Access Grid project and how it relates and compares to other environments. They also discuss augmentations to the Access Grid that will enable it to support more immersive visualizations. These enhancements include stereo, higher performance rendering support, tracking and non-uniform projection surface.

  11. Faint dwarfs in nearby groups

    SciTech Connect

    Speller, Ryan; Taylor, James E. E-mail: taylor@uwaterloo.ca

    2014-06-20

    The number and distribution of dwarf satellite galaxies remain a critical test of cold dark matter-dominated structure formation on small scales. Until recently, observational information about galaxy formation on these scales has been limited mainly to the Local Group. We have searched for faint analogues of Local Group dwarfs around nearby bright galaxies, using a spatial clustering analysis of the photometric catalog of the Sloan Digital Sky Survey (SDSS) Data Release 8. Several other recent searches of SDSS have detected clustered satellite populations down to Δm{sub r} ≡ (m{sub r,} {sub sat} – m{sub r,} {sub main}) ∼ 6-8, using photometric redshifts to reduce background contamination. SDSS photometric redshifts are relatively imprecise, however, for faint and nearby galaxies. Instead, we use angular size to select potential nearby dwarfs and consider only the nearest isolated bright galaxies as primaries. As a result, we are able to detect an excess clustering signal from companions down to Δm{sub r} = 12, 4 mag fainter than most recent studies. We detect an overdensity of objects at separations <400 kpc, corresponding to about 4.6 ± 0.5 satellites per central galaxy, consistent with the satellite abundance expected from the Local Group, given our selection function. Although the sample of satellites detected is incomplete by construction, since it excludes the least and most compact dwarfs, this detection provides a lower bound on the average satellite luminosity function, down to luminosities corresponding to the faintest ''classical'' dwarfs of the Local Group.

  12. Formate Formation and Formate Conversion in Biological Fuels Production

    PubMed Central

    Crable, Bryan R.; Plugge, Caroline M.; McInerney, Michael J.; Stams, Alfons J. M.

    2011-01-01

    Biomethanation is a mature technology for fuel production. Fourth generation biofuels research will focus on sequestering CO2 and providing carbon-neutral or carbon-negative strategies to cope with dwindling fossil fuel supplies and environmental impact. Formate is an important intermediate in the methanogenic breakdown of complex organic material and serves as an important precursor for biological fuels production in the form of methane, hydrogen, and potentially methanol. Formate is produced by either CoA-dependent cleavage of pyruvate or enzymatic reduction of CO2 in an NADH- or ferredoxin-dependent manner. Formate is consumed through oxidation to CO2 and H2 or can be further reduced via the Wood-Ljungdahl pathway for carbon fixation or industrially for the production of methanol. Here, we review the enzymes involved in the interconversion of formate and discuss potential applications for biofuels production. PMID:21687599

  13. Group Psychotherapy in Iceland.

    PubMed

    Ívarsson, Ómar

    2015-10-01

    In this overview of group psychotherapy in Iceland, an attempt will be made to describe how it is practiced today, give some glimpses into its earlier history, and clarify seven issues: (1) the standing of group psychotherapy in Iceland, its previous history, and the theoretical orientation of dynamic group therapy in the country; (2) the role of group therapy in the health care system; (3) how training in group therapy is organized; (4) the relationship between group psychotherapy research and clinical practice; (5) which issues/processes can be identified as unique to therapy groups in Iceland; and (6) how important are group-related issues within the social background of the country; and (7) what group work holds for the future.

  14. The Professional Carers' Group: Supporting Group Work for Young Sexual Abusers.

    ERIC Educational Resources Information Center

    Griffin, Susanne; And Others

    1997-01-01

    Describes the context, format, and goals of the Professional Carers' Group, a professional network designed to support a centralized treatment project for young people who have sexually abused others. Ways that group-based work with potentially isolated local professionals may help a treatment program maintain a systemic perspective is discussed.…

  15. The GROOP Effect: Groups Mimic Group Actions

    ERIC Educational Resources Information Center

    Tsai, Jessica Chia-Chin; Sebanz, Natalie; Knoblich, Gunther

    2011-01-01

    Research on perception-action links has focused on an interpersonal level, demonstrating effects of observing individual actions on performance. The present study investigated perception-action matching at an inter-group level. Pairs of participants responded to hand movements that were performed by two individuals who used one hand each or they…

  16. Working with Groups.

    ERIC Educational Resources Information Center

    Morris, Joan, Ed.

    1984-01-01

    Describes nine Canadian programs for counseling groups of students. Topics include introducing computer-assisted guidance, future challenges for counselors, sociometry, sexuality, parent counseling, reluctant students, shyness, peer groups, education for living, and guidance advisory committees. (JAC)

  17. What Makes Groups Tick.

    ERIC Educational Resources Information Center

    Allcorn, Seth

    1985-01-01

    By reviewing this analysis of the behavior of both groups and individuals in groups, human resources managers can learn to tell whether committees, task forces, and departments may be encouraging or inhibiting the work they set out to do. (Author)

  18. Group B streptococcus - pregnancy

    MedlinePlus

    ... medlineplus.gov/ency/patientinstructions/000511.htm Group B streptococcus - pregnancy To use the sharing features on this page, please enable JavaScript. Group B streptococcus (GBS) is a type of bacteria that some ...

  19. The group selection controversy.

    PubMed

    Leigh, E G

    2010-01-01

    Many thought Darwinian natural selection could not explain altruism. This error led Wynne-Edwards to explain sustainable exploitation in animals by selection against overexploiting groups. Williams riposted that selection among groups rarely overrides within-group selection. Hamilton showed that altruism can evolve through kin selection. How strongly does group selection influence evolution? Following Price, Hamilton showed how levels of selection interact: group selection prevails if Hamilton's rule applies. Several showed that group selection drove some major evolutionary transitions. Following Hamilton's lead, Queller extended Hamilton's rule, replacing genealogical relatedness by the regression on an actor's genotypic altruism of interacting neighbours' phenotypic altruism. Price's theorem shows the generality of Hamilton's rule. All instances of group selection can be viewed as increasing inclusive fitness of autosomal genomes. Nonetheless, to grasp fully how cooperation and altruism evolve, most biologists need more concrete concepts like kin selection, group selection and selection among individuals for their common good.

  20. Gestalt Interactional Groups

    ERIC Educational Resources Information Center

    Harman, Robert L.; Franklin, Richard W.

    1975-01-01

    Gestalt therapy in groups is not limited to individual work in the presence of an audience. Describes several ways to involve gestalt groups interactionally. Interactions described focus on learning by doing and discovering, and are noninterpretive. (Author/EJT)

  1. Subsurface stratigraphy of Medina Group (Lower Silurian), Clinton Group (Lower to Upper Silurian), and Lockport Group (Upper Silurian) of New York

    SciTech Connect

    Kearney, M.W.; Rickard, L.V.

    1984-12-01

    A network of ten regional cross sections across New York reveals the detailed subsurface stratigraphy of the Medina Group (Lower Silurian), Clinton Group (Lower to Upper Silurian), and Lockport Group (Upper Silurian). Both ..gamma..-ray logs and sample logs were used to correlate from outcrop to subcrop and well to well throughout the subsurface of New York. Approximately 250 well logs and 125 sample logs were incorporated into this study. The study indicates that the Median Group can be subdivided into the Whirlpool, Power Glen, and Grimsby Formations. The Clinton Group is subdivided into 16 formations. In the west, the Clinton Group includes the Thorold, Reynales, Irondequoit, and Rochester Formations. In central and eastern New York, this group is subdivided into the Oneida, Bear Creek, Kodak, Sodus, Wolcott, Otsquaqo, Willowvale, Sauquoit, Williamson, Irondequoit, Dawes, and Heidimer Formations. Two formations are recognized in the Lockport Group: the Sconondoa and Ilion Formations. In addition to the stratigraphy, the cross sections also display the regional geometry of this rock sequence, vertical and lateral changes in lithology, and the presence and nature of several unconformities.

  2. Teaching Statistics in an Activity Encouraging Format

    ERIC Educational Resources Information Center

    Knypstra, Sytse

    2009-01-01

    In a statistics course for bachelor students in econometrics a new format was adopted in which students were encouraged to study more actively and in which cooperative learning and peer teaching was implemented. Students had to work in groups of two or three students where each group had to perform certain tasks. One of these tasks was: explaining…

  3. Practice and Group Learning

    ERIC Educational Resources Information Center

    Hager, Paul

    2014-01-01

    Although learning has always been a central topic for philosophy of education, little attention has been paid to the notion of group learning. This article outlines and discusses some plausible examples of group learning. Drawing on these examples, various principles and issues that surround the notion of group learning are identified and…

  4. Customizing Group Therapy.

    ERIC Educational Resources Information Center

    Chambliss, Catherine; Oxman, Elaine

    The group therapy context provides unparalleled opportunities for cost effective learning. However, within group meetings, therapists must strive to tailor psychological services to address the particular needs of individual patients. Creative means of customizing patients experiences within group are needed in order to address consumer needs…

  5. Internet Discussion Groups.

    ERIC Educational Resources Information Center

    Bull, Glen; Bull, Gina; Sigmon, Tim

    1997-01-01

    Discusses newsgroups, listservs, and Web-based discussion groups. Highlights include major categories of international USENET discussion groups; newsgroups versus mailing lists; newsreaders; news servers; newsgroup subscriptions; newsgroups versus Web discussion groups; linking newsgroups, mailing lists, and the Web; and setting up a news host. A…

  6. Parent Group Spotlight

    ERIC Educational Resources Information Center

    Parenting for High Potential, 2014

    2014-01-01

    This issue's "Parent Group Spotlight" features Deborah Simon, president of West Sound Gifted, Talented & Twice-Exceptional (WSGT2e), who started a parent group in Washington in 2013. In just one year, this small, but mighty group has held community forums, attended school board meetings, and helped influence local gifted programming.…

  7. Infant Group Care Risks.

    ERIC Educational Resources Information Center

    Kendall, Earline D.

    Children under 3 years of age who are in group care face special health risks. The U.S. Centers for Disease Control indicate the existence of a causal relationship between infant group day care and certain diseases that are spread through contact at day care centers. Children in group care who are still in diapers are especially vulnerable to…

  8. Integrated Play Groups

    ERIC Educational Resources Information Center

    Glovak, Sandra

    2007-01-01

    As an occupational therapist running social play groups with sensory integration for children on the autism spectrum, the author frequently doubted the wisdom of combining several children on the spectrum into a group. In fact, as the owner of a clinic she said, "No more!" The groups seemed like a waste of parents' time and money, and she refused…

  9. Spin line groups.

    PubMed

    Lazić, Nataša; Milivojević, Marko; Damnjanović, Milan

    2013-11-01

    Spin line groups describe the symmetries of spin arrangements in quasi-one-dimensional systems. These groups are derived for the first family of line groups. Among them, magnetic groups are singled out as a special case. Spin arrangements generated by the derived groups are first discussed for single-orbit systems and then the conclusions are extended to multi-orbit cases. The results are illustrated by the examples of a CuO2 zigzag chain, a (13)C nanotube and the hexaferrite Ba2Mg2Fe12O22. Applications to neutron diffraction and classical ground-state determination are indicated.

  10. Open-system behavior during chondrule formation

    NASA Technical Reports Server (NTRS)

    Sears, D. W. G.; Shaoxiong, H.; Benoit, P. H.

    1994-01-01

    The question of whether chondrules behaved as open systems during formation is crucial to our understanding of both chondrule and chondrite formation. The very large range of chondrule types is best summarized by the compositional classification scheme, wherein the primitive chondrule groups (i.e., those not produced by metamorphic processes) are A1, A2, A5, and B1. In the Semarkona (LL3.0) chondrite, 10.5%, 25.0%, 5.0%, and 56.9% (by number) of the chondrules are groups A1, A2, A5, and B1, respectively. We argue that groups A1 and A2 were produced by reduction and evaporation during chondrule formation of material originally resembling group B1 chondrules.

  11. Star Formation in Galaxies

    NASA Technical Reports Server (NTRS)

    1987-01-01

    Topics addressed include: star formation; galactic infrared emission; molecular clouds; OB star luminosity; dust grains; IRAS observations; galactic disks; stellar formation in Magellanic clouds; irregular galaxies; spiral galaxies; starbursts; morphology of galactic centers; and far-infrared observations.

  12. Simple Ontology Format (SOFT)

    SciTech Connect

    Sorokine, Alexandre

    2011-10-01

    Simple Ontology Format (SOFT) library and file format specification provides a set of simple tools for developing and maintaining ontologies. The library, implemented as a perl module, supports parsing and verification of the files in SOFt format, operations with ontologies (adding, removing, or filtering of entities), and converting of ontologies into other formats. SOFT allows users to quickly create ontologies using only a basic text editor, verify it, and portray it in a graph layout system using customized styles.

  13. Organocatalytic Hydrophosphonylation Reaction of Carbonyl Groups.

    PubMed

    Herrera, Raquel P

    2017-02-07

    This revision is covering the limited examples reported for a pivotal strategy in the formation of C-P bonds such as the asymmetric organocatalytic hydrophosphonylation of carbonyl groups (Pudovik reaction). The scope and limitations, and the proposed mechanisms for the scarce different possibilities of asymmetric induction are also shown. The recent evolution and future trends of this undeveloped approach are commented.

  14. Group Psychotherapy in Italy.

    PubMed

    Giannone, Francesca; Giordano, Cecilia; Di Blasi, Maria

    2015-10-01

    This article describes the history and the prevailing orientations of group psychotherapy in Italy (psychoanalytically oriented, psychodrama, CBT groups) and particularly group analysis. Provided free of charge by the Italian health system, group psychotherapy is growing, but its expansion is patchy. The main pathways of Italian training in the different group psychotherapy orientations are also presented. Clinical-theoretical elaboration on self development, psychopathology related to group experiences, and the methodological attention paid to objectives and methods in different clinical groups are issues related to group therapy in Italy. Difficulties in the relationship between research and clinical practice are discussed, as well as the empirical research network that tries to bridge the gap between research and clinical work in group psychotherapy. The economic crisis in Italy has led to massive cuts in health care and to an increasing demand for some forms of psychological treatment. For these reasons, and because of its positive cost-benefit ratio, group psychotherapy is now considered an important tool in the national health care system to expand the clinical response to different forms of psychological distress.

  15. The Local Group as an Astrophysical Laboratory

    NASA Astrophysics Data System (ADS)

    Livio, Mario; Brown, Thomas M.

    2006-05-01

    1. History of the Local Group S. van den Bergh; 2. Primordial nucleosynthesis G. Steigman; 3. Galactic structure R. F. G. Wyse; 4. The Large Magellanic Cloud: structure and kinematics R. P. van der Marel; 5. The Local Group as an astrophysical laboratory for massive star feedback M. S. Oey; 6. Hot gas in the Local Group and low-redshift intergalactic medium K. R. Sembach; 7. Stages of satellite accretion M. E. Putman; 8. The star formation history in the Andromeda halo T. M. Brown; 9. Bulge populations in the Local Group R. M. Rich; 10. The Local Group as a laboratory for the chemical evolution of galaxies D. R. Garnett; 11. Massive stars in the Local Group: Star formation and stellar evolution P. Massey; 12. Massive young clusters in the Local Group J. Maíz-Apellániz; 13. Magellanic Cloud planetary nebulae as probes of stellar evolution and populations L. Stanghellini; 14. The old globular clusters: or, life among the ruins W. E. Harris; 15. Chemical evolution models of Local Group galaxies M. Tosi.

  16. The Local Group as an Astrophysical Laboratory

    NASA Astrophysics Data System (ADS)

    Livio, Mario; Brown, Thomas M.

    2011-04-01

    1. History of the Local Group S. van den Bergh; 2. Primordial nucleosynthesis G. Steigman; 3. Galactic structure R. F. G. Wyse; 4. The Large Magellanic Cloud: structure and kinematics R. P. van der Marel; 5. The Local Group as an astrophysical laboratory for massive star feedback M. S. Oey; 6. Hot gas in the Local Group and low-redshift intergalactic medium K. R. Sembach; 7. Stages of satellite accretion M. E. Putman; 8. The star formation history in the Andromeda halo T. M. Brown; 9. Bulge populations in the Local Group R. M. Rich; 10. The Local Group as a laboratory for the chemical evolution of galaxies D. R. Garnett; 11. Massive stars in the Local Group: Star formation and stellar evolution P. Massey; 12. Massive young clusters in the Local Group J. Maíz-Apellániz; 13. Magellanic Cloud planetary nebulae as probes of stellar evolution and populations L. Stanghellini; 14. The old globular clusters: or, life among the ruins W. E. Harris; 15. Chemical evolution models of Local Group galaxies M. Tosi.

  17. What's your group worth?

    PubMed

    Greenberg, M R

    1986-01-01

    With the advent of acquisitions and mergers of healthcare organizations, it has become necessary for medical group practices to know what they are worth. The traditional balance sheet valuation ignores what is perhaps the most important consideration of all: a group's earning potential. Discussed in this article are the many facets of the complex valuation process, including both tangible and intangible assets, and the author provides a method for adequately determining a range of values for a medical group.

  18. E-Group Arrangements

    NASA Astrophysics Data System (ADS)

    Aylesworth, Grant R.

    Group E at Uaxactún has long been considered an ancient Maya observatory in which an observer could see the sun rise along architectural alignments at the solstices and equinoxes. E-Groups named for the architectural complex list identified in Group E at Uaxactún, typically consist of a large radial pyramid on their west side and three temples on a raised platform on their east side.

  19. Immersive group-to-group telepresence.

    PubMed

    Beck, Stephan; Kunert, André; Kulik, Alexander; Froehlich, Bernd

    2013-04-01

    We present a novel immersive telepresence system that allows distributed groups of users to meet in a shared virtual 3D world. Our approach is based on two coupled projection-based multi-user setups, each providing multiple users with perspectively correct stereoscopic images. At each site the users and their local interaction space are continuously captured using a cluster of registered depth and color cameras. The captured 3D information is transferred to the respective other location, where the remote participants are virtually reconstructed. We explore the use of these virtual user representations in various interaction scenarios in which local and remote users are face-to-face, side-by-side or decoupled. Initial experiments with distributed user groups indicate the mutual understanding of pointing and tracing gestures independent of whether they were performed by local or remote participants. Our users were excited about the new possibilities of jointly exploring a virtual city, where they relied on a world-in-miniature metaphor for mutual awareness of their respective locations.

  20. Group Sparse Additive Models

    PubMed Central

    Yin, Junming; Chen, Xi; Xing, Eric P.

    2016-01-01

    We consider the problem of sparse variable selection in nonparametric additive models, with the prior knowledge of the structure among the covariates to encourage those variables within a group to be selected jointly. Previous works either study the group sparsity in the parametric setting (e.g., group lasso), or address the problem in the nonparametric setting without exploiting the structural information (e.g., sparse additive models). In this paper, we present a new method, called group sparse additive models (GroupSpAM), which can handle group sparsity in additive models. We generalize the ℓ1/ℓ2 norm to Hilbert spaces as the sparsity-inducing penalty in GroupSpAM. Moreover, we derive a novel thresholding condition for identifying the functional sparsity at the group level, and propose an efficient block coordinate descent algorithm for constructing the estimate. We demonstrate by simulation that GroupSpAM substantially outperforms the competing methods in terms of support recovery and prediction accuracy in additive models, and also conduct a comparative experiment on a real breast cancer dataset.

  1. EXPERIMENTS IN GROUP PREDICTION,

    DTIC Science & Technology

    GROUP DYNAMICS, *ATTITUDES(PSYCHOLOGY)), (*PREDICTIONS, ACCURACY), PROBLEM SOLVING, DECISION MAKING, CONFORMITY , QUESTIONNAIRES, EXPERIMENTAL DESIGN, SOCIAL PSYCHOLOGY, FEEDBACK, RELIABILITY, STATISTICAL ANALYSIS

  2. IGS Data Center Working Group Report

    NASA Technical Reports Server (NTRS)

    Noll, Carey E.

    2004-01-01

    At its 18th meeting held December 09, 2001 in San Francisco, the IGS Governing Board recommended the formation of a working group to focus on data center issues. This working group will tackle many of the problems facing the IGS data centers as well as develop new ideas to aid users both internal and external to the IGS. The direction of the IGS has changed since its start in 1992 and many new working groups, projects, data sets, and products have been created and incorporated into the service since that time. Therefore, this may be an appropriate time to revisit the requirements of data centers within the IGS.

  3. Instrumentation Working Group Summary

    NASA Technical Reports Server (NTRS)

    Zaller, Michelle; Miake-Lye, Richard

    1999-01-01

    The Instrumentation Working Group compiled a summary of measurement techniques applicable to gas turbine engine aerosol precursors and particulates. An assessment was made of the limits, accuracy, applicability, and technology readiness of the various techniques. Despite advances made in emissions characterization of aircraft engines, uncertainties still exist in the mechanisms by which aerosols and particulates are produced in the near-field engine exhaust. To adequately assess current understanding of the formation of sulfuric acid aerosols in the exhaust plumes of gas turbine engines, measurements are required to determine the degree and importance of sulfur oxidation in the turbine and at the engine exit. Ideally, concentrations of all sulfur species would be acquired, with emphasis on SO2 and SO3. Numerous options exist for extractive and non-extractive measurement of SO2 at the engine exit, most of which are well developed. SO2 measurements should be performed first to place an upper bound on the percentage of SO2 oxidation. If extractive and non-extractive techniques indicate that a large amount of the fuel sulfur is not detected as SO2, then efforts are needed to improve techniques for SO3 measurements. Additional work will be required to account for the fuel sulfur in the engine exhaust. Chemical Ionization Mass Spectrometry (CI-MS) measurements need to be pursued, although a careful assessment needs to be made of the sampling line impact on the extracted sample composition. Efforts should also be placed on implementing non-intrusive techniques and extending their capabilities by maximizing exhaust coverage for line-of-sight measurements, as well as development of 2-D techniques, where feasible. Recommendations were made to continue engine exit and combustor measurements of particulates. Particulate measurements should include particle size distribution, mass fraction, hydration properties, and volatile fraction. However, methods to ensure that unaltered

  4. On complements of coradicals of finite groups

    NASA Astrophysics Data System (ADS)

    Vedernikov, V. A.; Sorokina, M. M.

    2016-06-01

    Let F be an ω-local Fitting formation, and G a finite group that can be represented in the form of a product of n subnormal subgroups whose F-coradicals are ω-soluble, and whose Sylow p-subgroups are abelian for any p\\inω. It is established that there exist ω-complements of the F-coradical of G. New theorems on the existence of complements of coradicals of a group are obtained as corollaries. For an ω-local formation F, conditions are established for the existence of complements and ω-complements of the F-coradical of a group in any of its extensions. Bibliography: 21 titles.

  5. Study Abroad: The Reality of Building Dynamic Group Learning.

    ERIC Educational Resources Information Center

    Ransbury, Molly K.; Harris, Sandra A.

    1994-01-01

    The collaborative effort of a professor of human development with expertise in group process and a general education professor with expertise in Greek mythology and culture uses a case study format to apply theoretical models of group dynamics to the travel and learning experience of study abroad. Implications for course design and group process…

  6. An Aftercare Group Model for Adolescent Substance Abusers.

    ERIC Educational Resources Information Center

    Coleman, Sally

    1987-01-01

    Discusses what makes an aftercare group for adolescent substance abusers function productively and describes the format that seems to work best for young adolescents in an aftercare group. Emphasizes importance of group facilitator skills in areas of leadership, safety, and structure in helping adolescents gain re-identification as abstaining…

  7. Do weight loss and adherence cluster within behavioral treatment groups?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: Weight loss programs are often conducted in a group format, but it is unclear whether weight losses or adherence cluster within treatment group and whether characteristics of the group (e.g., size or homogeneity) affect outcomes. We examined these questions within Look AHEAD, a multicente...

  8. Democratic Group Work

    ERIC Educational Resources Information Center

    Laursen, Erik K.; Tate, Thomas F.

    2012-01-01

    For a century, democratic values have called for abandoning coercive approaches and teaching children and youth to be responsible citizens. The authors explore strategies for creating respectful environments and positive group cultures with challenging youth. They offer suggestions to adult group facilitators to support youth in developing…

  9. User Working Group Members

    Atmospheric Science Data Center

    2014-04-29

    User Working Group Members   Mail for the entire group may be directed to:  larc-asdc-uwg@lists.nasa.gov   Member Status Affiliation E-mail Contact Bob Holz (Co-Chair in 2010) Co-Chair University of ...

  10. Beam dynamics group summary

    SciTech Connect

    Peggs, S.

    1994-12-31

    This paper summarizes the activities of the beam dynamics working group of the LHC Collective Effects Workshop that was held in Montreux in 1994. It reviews the presentations that were made to the group, the discussions that ensued, and the consensuses that evolved.

  11. Group Work. Research Brief

    ERIC Educational Resources Information Center

    Walker, Karen

    2010-01-01

    According to Johnson and Johnson, group work helps increase student retention and satisfaction, develops strong oral communication and social skills, as well as higher self-esteem (University of Minnesota, n.d.). Group work, when planned and implemented deliberately and thoughtfully helps students develop cognitive and leadership skills as well as…

  12. Fairness and Ability Grouping.

    ERIC Educational Resources Information Center

    Strike, Kenneth A.

    1983-01-01

    A recent controversy regarding ability grouping is that it is often perceived as a means whereby racial or class bias can be subtly transformed into mechanisms of discrimination which exhibit the appearance of fairness and objectivity. This article addresses the question of fairness in ability grouping. (CJB)

  13. Topologies on Abelian Groups

    NASA Astrophysics Data System (ADS)

    Zelenyuk, E. G.; Protasov, I. V.

    1991-04-01

    A filter phi on an abelian group G is called a T-filter if there exists a Hausdorff group topology under which phi converges to zero. G{phi} will denote the group G with the largest topology among those making phi converge to zero. This method of defining a group topology is completely equivalent to the definition of an abstract group by defining relations. We shall obtain characterizations of T-filters and of T-sequences; among these, we shall pay particular attention to T-sequences on the integers. The method of T-sequences will be used to construct a series of counterexamples for several open problems in topological algebra. For instance there exists, on every infinite abelian group, a topology distinguishing between sequentiality and the Fréchet-Urysohn property (this solves a problem posed by V.I. Malykhin) we also find a topology on the group of integers admitting no nontrivial continuous character, thus solving a problem of Nienhuys. We show also that on every infinite abelian group there exists a free ultrafilter which is not a T-ultrafilter.

  14. Grouping for Inequity

    ERIC Educational Resources Information Center

    Macqueen, Suzanne Elizabeth

    2013-01-01

    The inequity of streaming as a method of organising classes was established by research conducted in the 1960s and 1970s. While the practice produces small advantages for limited groups of students, it hinders the academic and social advancement of the majority. Although streaming has declined, new forms of achievement grouping have emerged, with…

  15. Heart Disease Management by Women: Does Intervention Format Matter?

    ERIC Educational Resources Information Center

    Clark, Noreen M.; Janz, Nancy K.; Dodge, Julia A.; Lin, Xihong; Trabert, Britton L.; Kaciroti, Niko; Mosca, Lori; Wheeler, John R.; Keteyian, Steven

    2009-01-01

    A randomized controlled trial of two formats of a program (Women Take PRIDE) to enhance management of heart disease by patients was conducted. Older women (N = 575) were randomly assigned to a group or self-directed format or to a control group. Data regarding symptoms, functional health status, and weight were collected at baseline and at 4, 12,…

  16. Heart Disease Management by Women: Does Intervention Format Matter?

    ERIC Educational Resources Information Center

    Clark, Noreen M.; Janz, Nancy K.; Dodge, Julia A.; Lin, Xihong; Trabert, Britton L.; Kaciroti, Niko; Mosca, Lori; Wheeler, John R.; Keteyian, Steven

    2014-01-01

    A randomized controlled trial of two formats of a program (Women Take PRIDE) to enhance management of heart disease by patients was conducted. Older women (N = 575) were randomly assigned to a group or self-directed format or to a control group. Data regarding symptoms, functional health status, and weight were collected at baseline and at 4, 12,…

  17. Perceiving persons and groups.

    PubMed

    Hamilton, D L; Sherman, S J

    1996-04-01

    This article analyzes the similarities and differences in forming impressions of individuals and in developing conceptions of groups. In both cases, the perceiver develops a mental conception of the target (individual or group) on the basis of available information and uses that information to make judgments about that person or group. However, a review of existing evidence reveals differences in the outcomes of impressions formed of individual and group targets, even when those impressions are based on the very same behavioral information. A model is proposed to account for these differences. The model emphasizes the role of differing expectancies of unity and coherence in individual and group targets, which in turn engage different mechanisms for processing information and making judgments. Implications of the model are discussed.

  18. Star Formation for Predictive Primordial Galaxy Formation

    NASA Astrophysics Data System (ADS)

    Milosavljević, Miloš; Safranek-Shrader, Chalence

    The elegance of inflationary cosmology and cosmological perturbation theory ends with the formation of the first stars and galaxies, the initial sources of light that launched the phenomenologically rich process of cosmic reionization. Here we review the current understanding of early star formation, emphasizing unsolved problems and technical challenges. We begin with the first generation of stars to form after the Big Bang and trace how they influenced subsequent star formation. The onset of chemical enrichment coincided with a sharp increase in the overall physical complexity of star forming systems. Ab-initio computational treatments are just now entering the domain of the predictive and are establishing contact with local observations of the relics of this ancient epoch.

  19. Using Cooperative Small Groups in Introductory Accounting Classes: A Practical Approach.

    ERIC Educational Resources Information Center

    Miglietti, Cynthia

    2002-01-01

    Effective use of cooperative learning groups requires the following: attention to group formation, orientation that sets clear expectations and guidelines, activities to develop teamwork skills, peer evaluation, and other assessments that recognize and measure individual effort on group projects. (SK)

  20. New Particle Formation Study Final Campaign Report

    SciTech Connect

    Smith, JN; McMurry, PH

    2015-01-01

    The scientific foci of the New Particle Formation Study were the formation and evolution of atmospheric aerosols and the impacts of newly formed particles on cloud processes. Specifically, we planned to: (1) to identify the species and mechanisms responsible for the initial steps of new particle formation, i.e., the formation of thermodynamically stable clusters; (2) investigate the role of acid-base chemistry in new particle growth through measurements of ammonia and amines as well as organic and inorganic acids in both atmospheric nanoparticles and the gas phase; (3) investigate the contribution of other surface area or volume-controlled processes to nanoparticle formation and growth; (4) create a comprehensive dataset related to new particle formation and growth that can be used as input for our own thermodynamic models as well as the modeling efforts by our Department of Energy (DOE) Aerosol Life Cycle working group collaborators; (5) characterize the increase of the number and activity of cloud condensation nuclei (CCN) due to particle formation and growth; (6) determine the regional extent of new particle formation to address the role that atmospheric transport plays in determining the impacts, if any, of new particle formation on cloud number and properties.

  1. Super-computer simulation for galaxy formation

    NASA Astrophysics Data System (ADS)

    Jing, Yipeng

    2001-06-01

    Numerical simulations are widely used in the studies of galaxy formation. Here we briefly review their important role in the galaxy formation research, their relations with analytical models, and their limitations as well. Then a progress report is given about our collaboration with a group in the University of Tokyo, including the simulation samples we have obtained, some of the results we have published, and the joint projects which are in progress.

  2. GLOBAL PROPERTIES OF NEUTRAL HYDROGEN IN COMPACT GROUPS

    SciTech Connect

    Walker, Lisa May; Johnson, Kelsey E.; Gallagher, Sarah C.; Privon, George C.; Kepley, Amanda A.; Whelan, David G.; Desjardins, Tyler D.; Zabludoff, Ann I.

    2016-02-15

    Compact groups of galaxies provide a unique environment to study the evolution of galaxies amid frequent gravitational encounters. These nearby groups have conditions similar to those in the earlier universe when galaxies were assembled and give us the opportunity to witness hierarchical formation in progress. To understand how the compact group environment affects galaxy evolution, we examine the gas and dust in these groups. We present new single-dish GBT neutral hydrogen (H i) observations of 30 compact groups and define a new way to quantify the group H i content as the H i-to-stellar mass ratio of the group as a whole. We compare the H i content with mid-IR indicators of star formation and optical [g − r] color to search for correlations between group gas content and star formation activity of individual group members. Quiescent galaxies tend to live in H i-poor groups, and galaxies with active star formation are more commonly found in H i-rich groups. Intriguingly, we also find “rogue” galaxies whose star formation does not correlate with group H i content. In particular, we identify three galaxies (NGC 2968 in RSCG 34, KUG 1131+202A in RSCG 42, and NGC 4613 in RSCG 64) whose mid-IR activity is discrepant with the H i. We speculate that this mismatch between mid-IR activity and H i content is a consequence of strong interactions in this environment that can strip H i from galaxies and abruptly affect star formation. Ultimately, characterizing how and on what timescales the gas is processed in compact groups will help us understand the interstellar medium in complex, dense environments similar to the earlier universe.

  3. Model predictive formation control of helicopter systems

    NASA Astrophysics Data System (ADS)

    Saffarian, Mehdi

    In this thesis, a robust formation control framework for formation control of a group of helicopters is proposed and designed. The dynamic model of the helicopter has been developed and verified through simulations. The control framework is constructed using two main control schemes for navigation of a helicopter group in three-dimensional (3D) environments. Two schemes are designed to maintain the position of one helicopter with respect to one or two other neighboring members, respectively. The developed parameters can uniquely define the position of the helicopters with respect to each other and can be used for any other aerial and under water vehicles such as airplanes, spacecrafts and submarines. Also, since this approach is modular, it is possible to use it for desired number and form of the group helicopters. Using the defined control parameters, two decentralized controllers are designed based on Nonlinear Model Predictive Control (NMPC) algorithm technique. The framework performance has been tested through simulation of different formation scenarios.

  4. Sequentially triggered star formation in OB associations

    NASA Astrophysics Data System (ADS)

    Preibisch, Thomas; Zinnecker, Hans

    We discuss observational evidence for sequential and triggered star formation in galactic and extragalactic OB associations. We will first review in detail the star formation process in the Scorpius-Centaurus OB association, the nearest OB association to the Sun, where several recent extensive studies have provided comprehensive information on the stellar content and the ages of the different OB subgroups. These data have allowed us to reconstruct the star formation history of the association in some detail and provided important insight into the activity in the rho Oph and Lupus dark clouds, and with the origin of several young stellar groups in the southern sky. After discussing evidence for triggered star formation in and around various other Galactic OB associations (e.g. Ori OB1, Per OB2) we will compare the observational results with recent models of rapid star formation in the turbulent interstellar medium (cf. Briceno et al. chapter in Protostars and Planets V, in press).

  5. Groups and Violence

    NASA Astrophysics Data System (ADS)

    Bhavnani, Ravi; Miodownik, Dan; Riolo, Rick

    Violence can take place along a multitude of cleavages, e.g., (1) between political groups like the Kach Movement, pitting West Bank settlers against Israeli governments supporting the land-for-peace agenda; (2) between religious groups, such as Christians and Muslims in the Nigerian cities of Jos and Kaduna; (3) along class lines, as in India between Dalits and members of the Brahminical upper castes, upwardly mobile intermediate castes, and even other backward castes such as the Thevars; and (4) between ethnic groups such as the Hutu and Tutsi, both within and across state boundaries in Rwanda and neighboring Burundi.

  6. Group key management

    SciTech Connect

    Dunigan, T.; Cao, C.

    1997-08-01

    This report describes an architecture and implementation for doing group key management over a data communications network. The architecture describes a protocol for establishing a shared encryption key among an authenticated and authorized collection of network entities. Group access requires one or more authorization certificates. The implementation includes a simple public key and certificate infrastructure. Multicast is used for some of the key management messages. An application programming interface multiplexes key management and user application messages. An implementation using the new IP security protocols is postulated. The architecture is compared with other group key management proposals, and the performance and the limitations of the implementation are described.

  7. Conformal Carroll groups

    NASA Astrophysics Data System (ADS)

    Duval, C.; Gibbons, G. W.; Horvathy, P. A.

    2014-08-01

    Conformal extensions of Lévy-Leblond's Carroll group, based on geometric properties analogous to those of Newton-Cartan space-time are proposed. The extensions are labeled by an integer k. This framework includes and extends our recent study of the Bondi-Metzner-Sachs (BMS) and Newman-Unti (NU) groups. The relation to conformal Galilei groups is clarified. Conformal Carroll symmetry is illustrated by ‘Carrollian photons’. Motion both in the Newton-Cartan and Carroll spaces may be related to that of strings in the Bargmann space.

  8. Cyclic soft groups and their applications on groups.

    PubMed

    Aktaş, Hacı; Özlü, Serif

    2014-01-01

    In crisp environment the notions of order of group and cyclic group are well known due to many applications. In this paper, we introduce order of the soft groups, power of the soft sets, power of the soft groups, and cyclic soft group on a group. We also investigate the relationship between cyclic soft groups and classical groups.

  9. Tropical cyclone formation

    SciTech Connect

    Montgomery, M.T.; Farrell, B.F. )

    1993-01-15

    The physics of tropical cyclone formation is not well understood, and more is known about the mature hurricane than the formative mechanisms that produce it. It is believed part of the reason for this can be traced to insufficient upper-level atmospheric data. Recent observations suggest that tropical cyclones are initiated by asymmetric interactions associated with migratory upper-level potential vorticity disturbances and low-level disturbances. Favored theories of cyclones formation, however, focus on internal processes associated with cumulus convection and/or air-sea interaction. This work focuses on external mechanisms of cyclone formation and, using both a two- and three-dimensional moist geostrophic momentum model, investigates the role of upper-level potential vorticity disturbances on the formation process. A conceptual model of tropical cyclone formation is proposed, and implications of the theory are discussed. 71 refs., 5 figs., 1 tab.

  10. Adaptable formations utilizing heterogeneous unmanned systems

    NASA Astrophysics Data System (ADS)

    Barnes, Laura E.; Garcia, Richard; Fields, MaryAnne; Valavanis, Kimon

    2009-05-01

    This paper addresses the problem of controlling and coordinating heterogeneous unmanned systems required to move as a group while maintaining formation. We propose a strategy to coordinate groups of unmanned ground vehicles (UGVs) with one or more unmanned aerial vehicles (UAVs). UAVs can be utilized in one of two ways: (1) as alpha robots to guide the UGVs; and (2) as beta robots to surround the UGVs and adapt accordingly. In the first approach, the UAV guides a swarm of UGVs controlling their overall formation. In the second approach, the UGVs guide the UAVs controlling their formation. The unmanned systems are brought into a formation utilizing artificial potential fields generated from normal and sigmoid functions. These functions control the overall swarm geometry. Nonlinear limiting functions are defined to provide tighter swarm control by modifying and adjusting a set of control variables forcing the swarm to behave according to set constraints. Formations derived are subsets of elliptical curves but can be generalized to any curvilinear shape. Both approaches are demonstrated in simulation and experimentally. To demonstrate the second approach in simulation, a swarm of forty UAVs is utilized in a convoy protection mission. As a convoy of UGVs travels, UAVs dynamically and intelligently adapt their formation in order to protect the convoy of vehicles as it moves. Experimental results are presented to demonstrate the approach using a fully autonomous group of three UGVs and a single UAV helicopter for coordination.

  11. Tectonic reevaluation of the Walden Creek Group

    SciTech Connect

    Carter, M.W.; Hatcher, R.D. Jr. . Dept. of Geological Sciences)

    1992-01-01

    Detailed mapping has focused on the internal stratigraphy and contact relationships of the Walden Creek Group (WCG). In the western part of the study area near Reliance, TN, interbedded siltstone and sandstone of the Sandsuck Formation lies stratigraphically beneath Lower Cambrian Chilhowee Group quartzites and shales. Near Pond and Hankins Mountains, Sandsuck Formation limestones flank a major NE-plunging syncline cored by feldspathic sandstone and quartz-pebble conglomerate. The Miller Cove fault separates the Sandsuck Formation from banded grayish-green slate, carbonate, and blue quartz-pebble conglomerate of the Wilhite Formation. The gradational contact is similar to that observed farther south in the Ocoee Gorge where overturned slate and siltstone of the WCG grade into graywacke and dark slate of the Great Smoky Group (GSG), and places additional important limitations on the southern extent of the Greenbrier fault that separates the WCG and GSG to the NE in the Great Smoky Mountains National Park. Leucogranite boulders exposed along the contact are similar to leucogranite exposed farther east in basement massifs beneath Snowbird Group. The restricted occurrence of these boulders along part of the contact between the WCG and the GSG may indicate fault reactivation and exhumation of basement and SG-GSG cover during the latter stages of Late Proterozoic rifting of Larentia. The depositional history of the WCG in SE TN thus probably began with deep-water sedimentation in a reactivated rift basin. This was followed by a period of alternating submarine fan and off-shelf sedimentation that filled the basin, then formation of shallow-water carbonate bank conditions toward the end of the WCG depositional cycle.

  12. Star Formation Regions in LDN 1667

    NASA Astrophysics Data System (ADS)

    Gyulbudaghian, A. L.

    2015-09-01

    A group of three star formation regions in the dark cloud LDN 1667 is examined. All three of these regions contain Trapezium type systems. 12C(1-0) observations are made of the part of the molecular cloud LDN 1667 associated with one of the star formation regions. Three molecular clouds were detected, one of which (the main cloud) has a red and a blue outflow. Three stars from the star formation regions are found to have annular nebulae and one star has a conical nebula. The dark cloud LDN 1667 is associated with a radial system of dark globules which is formed by the star HD 57061.

  13. SIRTF and star formation

    NASA Technical Reports Server (NTRS)

    Shu, Frank H.

    1988-01-01

    Four problems in the field of star formation that can be attacked to advantage with SIRTF are discussed: (1) the patterns of star formation in spiral galaxies, (2) the physical mechanism for bimodal star formation, (3) the nature of bipolar outflows from young stellar objects, and (4) the birth of brown dwarfs. In each case, SIRTF can provide the crucial combination of high angular resolution with great sensitivity over a broad range of wavelengths that is needed to address the relevant issues.

  14. UnitedHealth Group

    Cancer.gov

    UnitedHealth Group provides accessible and affordable services, improved quality of care, coordinated health care efforts, and a supportive environment for shared decision making between patients and their physicians.

  15. SRNL Atmospheric Technologies Group

    ScienceCinema

    Viner, Brian; Parker, Matthew J.

    2016-07-12

    The Savannah River National Laboratory, Atmospheric Technologies Group, conducts a best-in class Applied Meteorology Program to ensure the Department of Energy’s Savannah River Site is operated safely and complies with stringent environmental regulations.

  16. Indictment of Ability Grouping

    ERIC Educational Resources Information Center

    Tuckman, Bruce

    1972-01-01

    The use of ability grouping restricts students to interact with others who have been identified as similar in ability and carries with it the stigma of failure and the operation of the self-fulfilling prophecy. (Author)

  17. Building Bunk Group Buddies.

    ERIC Educational Resources Information Center

    Nelson, Denise Cabrero

    2000-01-01

    Describes how camp counselors can foster camaraderie among campers through participative decision making, name games, listening, adventure courses, storytelling, spending time in nature, decorating cabins, avoiding favoritism, setting rules, admitting faults, setting group goals, and praising sincere efforts. (TD)

  18. Functional Group Analysis.

    ERIC Educational Resources Information Center

    Smith, Walter T., Jr.; Patterson, John M.

    1980-01-01

    Discusses analytical methods selected from current research articles. Groups information by topics of general interest, including acids, aldehydes and ketones, nitro compounds, phenols, and thiols. Cites 97 references. (CS)

  19. Group Support Systems (GSS)

    NASA Technical Reports Server (NTRS)

    Hamel, Gary P.; Wijesinghe, R.

    1996-01-01

    Groupware is a term describing an emerging computer software technology enhancing the ability of people to work together as a group, (a software driven 'group support system'). This project originated at the beginning of 1992 and reports were issued describing the activity through May 1995. These reports stressed the need for process as well as technology. That is, while the technology represented a computer assisted method for groups to work together, the Group Support System (GSS) technology als required an understanding of the facilitation process electronic meetings demand. Even people trained in traditional facilitation techniques did not necessarily aimlessly adopt groupware techniques. The latest phase of this activity attempted to (1) improve the facilitation process by developing training support for a portable groupware computer system, and (2) to explore settings and uses for the portable groupware system using different software, such as Lotus Notes.

  20. Is Group Counseling Neglected?

    ERIC Educational Resources Information Center

    Owen, Susanne M.

    1972-01-01

    Group counseling is valuable for the psychological and social readjustment of newly disabled persons and their families, with the counselor and physician having major roles in personal rehabilitation. (AG)

  1. User Working Group Charter

    Atmospheric Science Data Center

    2014-04-29

    ... Amended 2010   The Langley Atmospheric Science Data Center (ASDC) User Working Group (UWG) is chartered by the Earth Observing ... of the ASDC user interface, development of the Information Management System (IMS), and ASDC user conferences requirements for and ...

  2. SRNL Atmospheric Technologies Group

    SciTech Connect

    Viner, Brian; Parker, Matthew J.

    2016-05-10

    The Savannah River National Laboratory, Atmospheric Technologies Group, conducts a best-in class Applied Meteorology Program to ensure the Department of Energy’s Savannah River Site is operated safely and complies with stringent environmental regulations.

  3. Group Capability Model

    NASA Technical Reports Server (NTRS)

    Olejarski, Michael; Appleton, Amy; Deltorchio, Stephen

    2009-01-01

    The Group Capability Model (GCM) is a software tool that allows an organization, from first line management to senior executive, to monitor and track the health (capability) of various groups in performing their contractual obligations. GCM calculates a Group Capability Index (GCI) by comparing actual head counts, certifications, and/or skills within a group. The model can also be used to simulate the effects of employee usage, training, and attrition on the GCI. A universal tool and common method was required due to the high risk of losing skills necessary to complete the Space Shuttle Program and meet the needs of the Constellation Program. During this transition from one space vehicle to another, the uncertainty among the critical skilled workforce is high and attrition has the potential to be unmanageable. GCM allows managers to establish requirements for their group in the form of head counts, certification requirements, or skills requirements. GCM then calculates a Group Capability Index (GCI), where a score of 1 indicates that the group is at the appropriate level; anything less than 1 indicates a potential for improvement. This shows the health of a group, both currently and over time. GCM accepts as input head count, certification needs, critical needs, competency needs, and competency critical needs. In addition, team members are categorized by years of experience, percentage of contribution, ex-members and their skills, availability, function, and in-work requirements. Outputs are several reports, including actual vs. required head count, actual vs. required certificates, CGI change over time (by month), and more. The program stores historical data for summary and historical reporting, which is done via an Excel spreadsheet that is color-coded to show health statistics at a glance. GCM has provided the Shuttle Ground Processing team with a quantifiable, repeatable approach to assessing and managing the skills in their organization. They now have a common

  4. Magnetograph group summary

    NASA Technical Reports Server (NTRS)

    Jones, Harrison P.

    1989-01-01

    The Magnetograph Group focussed on the techniques and many practical problems of interleaving ground-based measurements of magnetic fields from diverse sites and instruments to address the original scientific objectives. The predominant view of the discussion group was that present instrumentation and analysis resources do not warrant immediate, specific plans for further worldwide campaigns of cooperative magnetograph observing. The several reasons for this view, together with many caveats, qualifications, and suggestions for future work are presented.

  5. Basic Pile Group Behavior.

    DTIC Science & Technology

    1983-09-01

    geotechnical engineer to obtain the values of the soil modulus and the coefficient of horizontal subgrade reaction. The methods provided in this Appendix must...describes a computerized method for pile group design and analysis as practiced in the Corps of Engineers and proposes criteria for sys- tematizing... Engineers , and to propose criteria for systematizing this method in a computer program. This paper describes a computerized method of pile group analysis

  6. Mountain gorilla ranging patterns: influence of group size and group dynamics.

    PubMed

    Caillaud, Damien; Ndagijimana, Felix; Giarrusso, Anthony J; Vecellio, Veronica; Stoinski, Tara S

    2014-08-01

    Since the 1980s, the Virunga mountain gorilla population has almost doubled, now reaching 480 individuals living in a 430-km(2) protected area. Analysis of the gorillas' ranging patterns can provide critical information on the extent and possible effects of competition for food and space. We analyzed 12 years of daily ranging data and inter-group encounter data collected on 11 gorilla groups monitored by the Karisoke Research Center in Rwanda. During that period, the study population increased in size by almost 50% and the number of groups tripled. Groups had small yearly home ranges compared to other known gorilla populations, with an average 90% kernel density estimate of 8.07 km2 and large between-group variations (3.17-23.59 km2). Most groups had consistent home range location over the course of the study but for some, we observed gradual range shifts of up to 4 km. Neighboring groups displayed high home range overlap, which increased dramatically after the formation of new groups. On average, each group used only 28.6% of its 90% kernel home range exclusively, and in some areas up to six different groups had overlapping home ranges with little or no exclusive areas. We found a significant intra-group positive relationship between the number of weaned individuals in a group and the home range size, but the fitted models only explained 17.5% and 13.7% of the variance in 50% and 90% kernel home range size estimates, respectively. This suggests that despite the increase in size, the study population is not yet experiencing marked effects of feeding competition. However, the increase in home range overlap resulting from the formation of new groups led to a sixfold increase in the frequency of inter-group encounters, which exposes the population to elevated risks of fight-related injuries and infanticide.

  7. Preliminary Results from the AIDP-2 and AIDP-3 Drill Cores Hint at Systematic Mo Enrichments in the ~2.65 Ga Roy Hill Shale

    NASA Astrophysics Data System (ADS)

    Roy, M.; Ostrander, C. M.; Lyons, T. W.; Olson, S. L.; Buick, R.; Anbar, A. D.

    2014-12-01

    In order to better understand the timing of the earliest oxygenation of Earth's surface environment, we are pursuing a multi-proxy investigation of paleoredox conditions in diamond drill cores through sedimentary rocks of the Archean Fortescue & Hamersley Groups. These cores were recovered in 2012 by the Agouron Institute from the Pilbara Craton of Western Australia. The AIDP-2 core samples a stratigraphic succession of carbonate and sulfidic, organic-rich shale in the Carawine Dolomite and Jeerinah Formation representing a shallow near-shore depositional setting. Core AIDP-3 samples a transition from BIF in the Marra Mamba Formation to organic-rich shales in the underlying Jeerinah Formation representing a deeper offshore depositional setting. We have analyzed 322 black shale samples from the Roy Hill Member of the Jeerinah Formation deposited just before the transition from the Fortescue to Hamersley Group. Roy Hill black shale units are mostly pyritic in AIDP-3, but are less so in AIDP-2. The Roy Hill Member of AIDP-3 extends from 2.629 Ga to2.676 Ga and contains the 2.632Ga Jeerinah impact layer, whereas the Roy Hill member of AIDP-2 is slightly older, lying beneath the Jeerinah impact layer, and has been dated to 2.636 Ga to >2.643 Ga [1]. Our initial findings reveal that Mo concentrations range between 0.7 and 7 ppm in the Roy Hill black shale member of AIDP-2 and AIDP-3. Corresponding Mo/Al ratios range between 1-9×10-5 ppm/ppm, indicating slight Mo enrichment relative to average continental crust. These results are consistent with a previous study by Scott et al. [2], which suggested little or no Mo enrichment. However, the higher resolution sampling in this study allows us to clearly resolve the Mo/Al depth profiles in these late Archean cores. These data suggest that the variations we see are not due to analytical scatter or sample variability, but instead represent real variations in Mo scavenged into these sediments. Ongoing work is focused on

  8. GLOBAL STAR FORMATION REVISITED

    SciTech Connect

    Silk, Joseph; Norman, Colin E-mail: norman@stsci.edu

    2009-07-20

    A general treatment of disk star formation is developed from a dissipative multiphase model, with the dominant dissipation due to cloud collisions. The Schmidt-Kennicutt (SK) law emerges naturally for star-forming disks and starbursts. We predict that there should be an inverse correlation between Tully-Fisher law and SK law residuals. The model is extended to include a multiphase treatment of supernova feedback that leads to a turbulent pressure-regulated generalization of the star formation law and is applicable to gas-rich starbursts. Enhanced pressure, as expected in merger-induced star formation, enhances star formation efficiency. An upper limit is derived for the disk star formation rate in starbursts that depends on the ratio of global ISM to cloud pressures. We extend these considerations to the case where the interstellar gas pressure in the inner galaxy is dominated by outflows from a central active galactic nucleus (AGN). During massive spheroid formation, AGN-driven winds trigger star formation, resulting in enhanced supernova feedback and outflows. The outflows are comparable to the AGN-boosted star formation rate and saturate in the super-Eddington limit. Downsizing of both SMBH and spheroids is a consequence of AGN-driven positive feedback. Bondi accretion feeds the central black hole with a specific accretion rate that is proportional to the black hole mass. AGN-enhanced star formation is mediated by turbulent pressure and relates spheroid star formation rate to black hole accretion rate. The relation between black hole mass and spheroid velocity dispersion has a coefficient (Salpeter time to gas consumption time ratio) that provides an arrow of time. Highly efficient, AGN-boosted star formation can occur at high redshift.

  9. Coordinating Group report

    SciTech Connect

    Not Available

    1994-01-01

    In December 1992, western governors and four federal agencies established a Federal Advisory Committee to Develop On-site Innovative Technologies for Environmental Restoration and Waste Management (the DOIT Committee). The purpose of the Committee is to advise the federal government on ways to improve waste cleanup technology development and the cleanup of federal sites in the West. The Committee directed in January 1993 that information be collected from a wide range of potential stakeholders and that innovative technology candidate projects be identified, organized, set in motion, and evaluated to test new partnerships, regulatory approaches, and technologies which will lead to improve site cleanup. Five working groups were organized, one to develop broad project selection and evaluation criteria and four to focus on specific contaminant problems. A Coordinating Group comprised of working group spokesmen and federal and state representatives, was set up to plan and organize the routine functioning of these working groups. The working groups were charged with defining particular contaminant problems; identifying shortcomings in technology development, stakeholder involvement, regulatory review, and commercialization which impede the resolution of these problems; and identifying candidate sites or technologies which could serve as regional innovative demonstration projects to test new approaches to overcome the shortcomings. This report from the Coordinating Group to the DOIT Committee highlights the key findings and opportunities uncovered by these fact-finding working groups. It provides a basis from which recommendations from the DOIT Committee to the federal government can be made. It also includes observations from two public roundtables, one on commercialization and another on regulatory and institutional barriers impeding technology development and cleanup.

  10. Formative Assessment Probes

    ERIC Educational Resources Information Center

    Eberle, Francis; Keeley, Page

    2008-01-01

    Formative assessment probes can be effective tools to help teachers build a bridge between students' initial ideas and scientific ones. In this article, the authors describe how using two formative assessment probes can help teachers determine the extent to which students make similar connections between developing a concept of matter and a…

  11. Ice Formation on Wings

    NASA Technical Reports Server (NTRS)

    Ritz, L

    1939-01-01

    This report makes use of the results obtained in the Gottingen ice tunnel in which the atmospheric conditions are simulated and the process of ice formation photographed. The effect of ice formation is threefold: 1) added weight to the airplane; 2) a change in the lift and drag forces; 3) a change in the stability characteristics.

  12. School Formative Feedback Systems

    ERIC Educational Resources Information Center

    Halverson, Richard

    2010-01-01

    Data-driven instructional improvement relies on developing coherent systems that allow school staff to generate, interpret, and act upon quality formative information on students and school programs. This article offers a formative feedback system model that captures how school leaders and teachers structure artifacts and practices to create…

  13. Understanding Alliance Formation Patterns

    DTIC Science & Technology

    2015-12-01

    most of the alliance formations throughout history. Using logistic regression models and statistical analysis for different historical periods from... historical periods, especially under conditions of war and peace and based on the polarity of the international system. The approach presented in the...alliance formation, historical periods, geographical proximity, trade exchange, regime type, national material capability, system-level conditions 15

  14. Formative Assessment in Context

    ERIC Educational Resources Information Center

    Oxenford-O'Brian, Julie

    2013-01-01

    This dissertation responds to critical gaps in current research on formative assessment practice which could limit successful implementation of this practice within the K-12 classroom context. The study applies a socio cultural perspective of learning to interpret a cross-case analysis of formative assessment practice occurring during one…

  15. Instructions to working groups

    NASA Technical Reports Server (NTRS)

    Foushee, H. Clayton

    1987-01-01

    The key to the success of this workshop is your active participation in the working group process. The goals of this workshop are to address four major questions regarding Cockpit Resource Management (CRM) Training. To some extent the working group topic areas parallel these issues, but in some cases they do not. However, it is important for all of the working groups to keep these general questions in mind during their deliberations: (1) What are the essential elements of an optimal CRM Training program; (2) What are the strengths and weaknesses of current approaches to CRM Training; (3) How can CRM Training best be implemented, and what barriers exist; and (4) Is CRM Training effective, do we know, and if not, how can we find out.

  16. Illinois Wind Workers Group

    SciTech Connect

    David G. Loomis

    2012-05-28

    The Illinois Wind Working Group (IWWG) was founded in 2006 with about 15 members. It has grown to over 200 members today representing all aspects of the wind industry across the State of Illinois. In 2008, the IWWG developed a strategic plan to give direction to the group and its activities. The strategic plan identifies ways to address critical market barriers to the further penetration of wind. The key to addressing these market barriers is public education and outreach. Since Illinois has a restructured electricity market, utilities no longer have a strong control over the addition of new capacity within the state. Instead, market acceptance depends on willing landowners to lease land and willing county officials to site wind farms. Many times these groups are uninformed about the benefits of wind energy and unfamiliar with the process. Therefore, many of the project objectives focus on conferences, forum, databases and research that will allow these stakeholders to make well-educated decisions.

  17. Upgraded Coal Interest Group

    SciTech Connect

    Evan Hughes

    2009-01-08

    The Upgraded Coal Interest Group (UCIG) is an EPRI 'users group' that focuses on clean, low-cost options for coal-based power generation. The UCIG covers topics that involve (1) pre-combustion processes, (2) co-firing systems and fuels, and (3) reburn using coal-derived or biomass-derived fuels. The UCIG mission is to preserve and expand the economic use of coal for energy. By reducing the fuel costs and environmental impacts of coal-fired power generation, existing units become more cost effective and thus new units utilizing advanced combustion technologies are more likely to be coal-fired.

  18. Bell, group and tangle

    SciTech Connect

    Solomon, A. I.

    2010-03-15

    The 'Bell' of the title refers to bipartite Bell states, and their extensions to, for example, tripartite systems. The 'Group' of the title is the Braid Group in its various representations; while 'Tangle' refers to the property of entanglement which is present in both of these scenarios. The objective of this note is to explore the relation between Quantum Entanglement and Topological Links, and to show that the use of the language of entanglement in both cases is more than one of linguistic analogy.

  19. The Life Design Group: A Case Study Vignette in Group Career Construction Counseling

    ERIC Educational Resources Information Center

    Barclay, Susan R.; Stoltz, Kevin B.

    2016-01-01

    Providing cost efficient, yet effective, student services, including career services, is a critical component in higher education. Career services must include the perspectives of the 21st-century work place. We advocate for the delivery of career development services in a group format using a narrative approach to career counseling with college…

  20. Evidence for the correlation of the upper part of the Llewellyn Formation (Pennsylvania Anthracite region), with the Monongahela Formation

    USGS Publications Warehouse

    Eggleston, J.R.; Wnuk, C.; Edmunds, W.E.

    1996-01-01

    A plant fossil assemblage from the roof shale of the No. 25 anthracite bed in Pennsylvania indicates that the upper part of the Llewellyn Formation is much younger than the lower part of the Allegheny Group or Conemaugh Group correlation that was indicated by Read and Mamay (1960). These results confirm the conclusions of Fontaine and White (1880), White (1900), and Darrah (1969) who suggested that the highest coals of the Llewellyn Formation could be equivalent to the Monongahela Group.

  1. Group cohesion in cognitive-behavioral group therapy for social phobia.

    PubMed

    Taube-Schiff, Marlene; Suvak, Michael K; Antony, Martin M; Bieling, Peter J; McCabe, Randi E

    2007-04-01

    Cognitive-behavior therapy (CBT) for Social Phobia is effective in both group and individual formats. However, the impact of group processes on treatment efficacy remains relatively unexplored. In this study we examined group cohesion ratings made by individuals at the midpoint and endpoint of CBT groups for social phobia. Symptom measures were also completed at the beginning and end of treatment. We found that cohesion ratings significantly increased over the course of the group and were associated with improvement over time in social anxiety symptoms, as well as improvement on measures of general anxiety, depression, and functional impairment. In conclusion, findings are consistent with the idea that changes in group cohesion are related to social anxiety symptom reduction and, therefore, speak to the importance of nonspecific therapeutic factors in treatment outcome.

  2. Valuing Support Groups

    ERIC Educational Resources Information Center

    Graziosi, Elena

    2010-01-01

    For people living with or caring for someone with a disability, being able to talk to someone who can relate to their feelings of frustration during difficult times, offer practical advice on an issue, or even understand the importance of a small success, can make a difference. Support groups are a mainstay for individuals coping with daily…

  3. Internet Cancer Support Groups

    PubMed Central

    Chee, Wonshik; Tsai, Hsiu-Min; Lin, Li-Chen; Cheng, Ching-Yu

    2006-01-01

    Internet Cancer Support Groups (ICSGs) are an emerging form of support group on Internet specifically for cancer patients. Previous studies have indicated the effectiveness of ICSGs as a research setting or a data-collection method. Yet recent studies have also indicated that ICSGs tend to serve highly educated, high-income White males who tend to be at an early stage of cancer. In this article, a total of 317 general ICSGs and 229 ethnic-specific ICSGs searched through Google.com, Yahoo.com, http://Msn.com, AOL.com, and ACOR.org are analyzed from a feminist perspective. The written records of group discussions and written memos by the research staff members were also analyzed using content analysis. The idea categories that emerged about these groups include (a) authenticity issues; (b) ethnicity and gender issues; (c) intersubjectivity issues; and (d) potential ethical issues. The findings suggest that (a) researchers adopt multiple recruitment strategies through various Internet sites and/or real settings; (b) researchers raise their own awareness of the potential influences of the health-related resources provided by ICSGs and regularly update their knowledge related to the federal and state standards and/or policies related to ICSGs; and (c) researchers consider adopting a quota-sampling method. PMID:15681976

  4. LCDs Revolutionize Group Training.

    ERIC Educational Resources Information Center

    Mandell, Mel

    1987-01-01

    Describes a screen projector based on liquid crystal display (LCD) that duplicates the monitor of a microcomputer and may be used in group training sessions for demonstration purposes. Suggestions of what features to look for and a buyer's guide are provided. (CLB)

  5. Test Group Rethinks Questions

    ERIC Educational Resources Information Center

    Gewertz, Catherine

    2012-01-01

    A group that is developing tests for half the states in the nation has dramatically reduced the length of its assessment in a bid to balance the desire for a more meaningful and useful exam with concerns about the amount of time spent on testing. The decision by the Smarter Balanced Assessment Consortium reflects months of conversation among its…

  6. Working Group Report: Neutrinos

    SciTech Connect

    de Gouvea, A.; Pitts, K.; Scholberg, K.; Zeller, G. P.

    2013-10-16

    This document represents the response of the Intensity Frontier Neutrino Working Group to the Snowmass charge. We summarize the current status of neutrino physics and identify many exciting future opportunities for studying the properties of neutrinos and for addressing important physics and astrophysics questions with neutrinos.

  7. Dimensions of Group Interaction

    ERIC Educational Resources Information Center

    Dawidowicz, Paula

    2008-01-01

    The correlation between positive and negative group interactions and one or another of individuals' attitudes or characteristics--moral development, critical thinking, resilience, and self efficacy--has been examined previously. However, no systemic examination of individuals' development of patterns of these characteristics and those patterns'…

  8. American Ethnic Groups.

    ERIC Educational Resources Information Center

    Sowell, Thomas, Ed.; Collins, Lynn D., Ed.

    The essays in this volume focus on the historical and social evolution of six American ethnic groups. Thomas Sowell discusses similarities and differences in the experiences of antebellum "free persons of color," emancipated slaves and their descendants, and West Indian immigrants, and examines trends in the socioeconomic status of black…

  9. Abandoning wells working group

    SciTech Connect

    1997-03-01

    The primary objective of this working group is to identify major technical, regulatory, and environmental issues that are relevant to the abandonment of offshore wellbores. Once the issues have been identified, the working group also has the objective of making recommendations or providing potential solutions for consideration. Areas for process improvement will be identified and {open_quotes}best practices{close_quotes} will be discussed and compared to {open_quotes}minimum standards.{close_quotes} The working group will primarily focus on wellbore abandonment in the Gulf of Mexico. However, workshop participants are encouraged to discuss international issues which may be relevant to wellbore abandonment practices in the Gulf of Mexico. The Abandoning Wells Group has identified several major areas for discussion that have concerns related to both operators and service companies performing wellbore abandonments in the Gulf of Mexico. The following broad topics were selected for the agenda: (1) MMS minimum requirements and state regulations. (2) Co-existence of best practices, new technology, and P & A economics. (3) Liability and environmental issues relating to wellbore abandonment.

  10. Leukosis/Sarcoma Group

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The leukosis/sarcoma (L/S) group of diseases designates a variety of transmissible benign and malignant neoplasms of chickens caused by members that belong to the family Retroviridae. Because the expansion of the literature on this disease, it is no longer feasible to cite all relevant publications ...

  11. Functional Group Analysis.

    ERIC Educational Resources Information Center

    Smith, Walter T., Jr.; Patterson, John M.

    1984-01-01

    Literature on analytical methods related to the functional groups of 17 chemical compounds is reviewed. These compounds include acids, acid azides, alcohols, aldehydes, ketones, amino acids, aromatic hydrocarbons, carbodiimides, carbohydrates, ethers, nitro compounds, nitrosamines, organometallic compounds, peroxides, phenols, silicon compounds,…

  12. The Pressure Group Cooker.

    ERIC Educational Resources Information Center

    Graves, Bill

    1992-01-01

    Administrators across the nation have encountered vigorous challenges against textbooks, practices, and procedures that critics find laden with occult and New Age values. Attacks are becoming more aggressive, better organized, and well financed. This article and accompanying sidebars discuss pressure group tactics and ways to counter them. The…

  13. National Melon Research Group

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The National Melon Research Group met with the Cucurbitaceae 2010 conference in Charleston, South Carolina at 7:00 P.M. on November 17. The discussion was focused solely on cucurbit powdery mildew (CPM). Several reported increased problem with CPM or apparent changes in race. Ales Lebeda (Palacký Un...

  14. Ground Rules for Groups.

    ERIC Educational Resources Information Center

    Schwarz, Roger M.

    1994-01-01

    Tips for effective groups include the following: test assumptions, share relevant information, focus on interests, be specific, agree on meanings, explain reasons, disagree openly, invite feedback, jointly design solutions, discuss nondiscussable issues, keep focused, eliminate distractions, expect all to participate, decide by consensus, and…

  15. Modeling Small Group Learning

    ERIC Educational Resources Information Center

    Draskovic, I.; Holdrinet, R.; Bulte, J.; Bolhuis, S.; Van Leeuwe, J.

    2004-01-01

    This article presents findings from an empirical study on the relations between the variables comprising learning mechanisms in small collaborative groups. Variables comprising the central learning mechanisms component were "task related interactions," "knowledge elaborations," and "subjective estimation of knowledge acquisition." Student related…

  16. International Study Tour Groups

    ERIC Educational Resources Information Center

    O'Reilly, Frances L.; Matt, John J.; McCaw, William P.; Kero, Patty; Stewart, Courtney; Haddouch, Reda

    2014-01-01

    Using the context of international study tour groups, this study examined the personal and professional transformation that occurred among host faculty and staff at The University of Montana-Missoula as a result of their interactions with traveling academics from other countries. Data were collected from participant responses (n = 27) using a…

  17. Grouping Illumination Frameworks

    ERIC Educational Resources Information Center

    Zdravkovic, Suncica; Economou, Elias; Gilchrist, Alan

    2012-01-01

    According to Koffka (1935), the lightness of a target surface is determined by the relationship between the target and the illumination frame of reference to which it belongs. However, each scene contains numerous illumination frames, and judging each one separately would lead to an enormous amount of computing. Grouping those frames that are in…

  18. Assessing Minority Group Children.

    ERIC Educational Resources Information Center

    Phillips, Beeman N., Ed.

    Contents of this book include the following collection of articles: "Assessing Minority Group Children: Challenges for School Psychologists," Thomas Oakland; "The NEA Testing Moratorium," Boyd Bosma; "Cultural Myopia: The Need for a Corrective Lens," Martin H. Gerry; "Assumptions Underlying Psychological Testing," T. Ernest Newland;…

  19. External Interest Group Impingements.

    ERIC Educational Resources Information Center

    Millard, Richard M.

    The history of the interrelation among state approval, accreditation, and institutional eligibility is considered. It is suggested that faculty and college administrators can be either an internal or external group in relationship to the planning process. The federal government, or the state government, passes legislation that may have both…

  20. Native American Cultural Groups.

    ERIC Educational Resources Information Center

    Roy, Loriene, Comp.

    Part of a larger report on the Four Directions Project, an American Indian technology innovation project, this section includes 13 "pathfinders" to locating information on Native American and other indigenous cultural groups. The pathfinders were designed by students in the Graduate School of Library and Information Science at the…

  1. An Intergenerational Women's Group.

    ERIC Educational Resources Information Center

    Fogler, Janet

    1989-01-01

    Discusses the Intergenerational Women's Group, formed to provide social support and an interchange of ideas between women of different generations. Provides a model for such a program that may be offered in geriatric medical clinics. Discusses the impact of intergenerational support for both the old and the young. (Author/BHK)

  2. Media Criticism Group Speech

    ERIC Educational Resources Information Center

    Ramsey, E. Michele

    2004-01-01

    Objective: To integrate speaking practice with rhetorical theory. Type of speech: Persuasive. Point value: 100 points (i.e., 30 points based on peer evaluations, 30 points based on individual performance, 40 points based on the group presentation), which is 25% of course grade. Requirements: (a) References: 7-10; (b) Length: 20-30 minutes; (c)…

  3. Mechanisms of human kidney stone formation.

    PubMed

    Evan, Andrew P; Worcester, Elaine M; Coe, Fredric L; Williams, James; Lingeman, James E

    2015-01-01

    The precise mechanisms of kidney stone formation and growth are not completely known, even though human stone disease appears to be one of the oldest diseases known to medicine. With the advent of the new digital endoscope and detailed renal physiological studies performed on well phenotyped stone formers, substantial advances have been made in our knowledge of the pathogenesis of the most common type of stone former, the idiopathic calcium oxalate stone former as well as nine other stone forming groups. The observations from our group on human stone formers and those of others on model systems have suggested four entirely different pathways for kidney stone formation. Calcium oxalate stone growth over sites of Randall's plaque appear to be the primary mode of stone formation for those patients with hypercalciuria. Overgrowths off the ends of Bellini duct plugs have been noted in most stone phenotypes, do they result in a clinical stone? Micro-lith formation does occur within the lumens of dilated inner medullary collecting ducts of cystinuric stone formers and appear to be confined to this space. Lastly, cystinuric stone formers also have numerous small, oval, smooth yellow appearing calyceal stones suggestive of formation in free solution. The scientific basis for each of these four modes of stone formation are reviewed and used to explore novel research opportunities.

  4. How Do Students Define Their Roles and Responsibilities in Online Learning Group Projects?

    ERIC Educational Resources Information Center

    Williams, Karen C.; Morgan, Kari; Cameron, Bruce A.

    2011-01-01

    The goal of this study was to explore the processes of group role formation in online class settings. Qualitative analysis was used to code chat logs and discussion threads in six undergraduate Family and Consumer Sciences online courses that required online group projects. Four themes related to the process of group role formation emerged:…

  5. The Use of Online Focus Groups to Design an Online Food Safety Education Intervention

    ERIC Educational Resources Information Center

    Mayer, Ashley Bramlett; Harrison, Judy A.

    2012-01-01

    In the development of an online food safety education intervention for college students, online focus groups were used to determine the appropriate format and messages. Focus groups are often used in qualitative research and formative evaluation of public health programs, yet traditional focus groups can be both difficult and expensive to…

  6. Challenges in planet formation

    NASA Astrophysics Data System (ADS)

    Morbidelli, Alessandro; Raymond, Sean N.

    2016-10-01

    Over the past two decades, large strides have been made in the field of planet formation. Yet fundamental questions remain. Here we review our state of understanding of five fundamental bottlenecks in planet formation. These are the following: (1) the structure and evolution of protoplanetary disks; (2) the growth of the first planetesimals; (3) orbital migration driven by interactions between protoplanets and gaseous disk; (4) the origin of the Solar System's orbital architecture; and (5) the relationship between observed super-Earths and our own terrestrial planets. Given our lack of understanding of these issues, even the most successful formation models remain on shaky ground.

  7. Wood formation in Angiosperms.

    PubMed

    Déjardin, Annabelle; Laurans, Françoise; Arnaud, Dominique; Breton, Christian; Pilate, Gilles; Leplé, Jean-Charles

    2010-04-01

    Wood formation is a complex biological process, involving five major developmental steps, including (1) cell division from a secondary meristem called the vascular cambium, (2) cell expansion (cell elongation and radial enlargement), (3) secondary cell wall deposition, (4) programmed cell death, and (5) heartwood formation. Thanks to the development of genomic studies in woody species, as well as genetic engineering, recent progress has been made in the understanding of the molecular mechanisms underlying wood formation. In this review, we will focus on two different aspects, the lignification process and the control of microfibril angle in the cell wall of wood fibres, as they are both key features of wood material properties.

  8. Hydrogen Sulfide Inhibits Amyloid Formation

    PubMed Central

    2015-01-01

    Amyloid fibrils are large aggregates of misfolded proteins, which are often associated with various neurodegenerative diseases such as Alzheimer’s, Parkinson’s, Huntington’s, and vascular dementia. The amount of hydrogen sulfide (H2S) is known to be significantly reduced in the brain tissue of people diagnosed with Alzheimer’s disease relative to that of healthy individuals. These findings prompted us to investigate the effects of H2S on the formation of amyloids in vitro using a model fibrillogenic protein hen egg white lysozyme (HEWL). HEWL forms typical β-sheet rich fibrils during the course of 70 min at low pH and high temperatures. The addition of H2S completely inhibits the formation of β-sheet and amyloid fibrils, as revealed by deep UV resonance Raman (DUVRR) spectroscopy and ThT fluorescence. Nonresonance Raman spectroscopy shows that disulfide bonds undergo significant rearrangements in the presence of H2S. Raman bands corresponding to disulfide (RSSR) vibrational modes in the 550–500 cm–1 spectral range decrease in intensity and are accompanied by the appearance of a new 490 cm–1 band assigned to the trisulfide group (RSSSR) based on the comparison with model compounds. The formation of RSSSR was proven further using a reaction with TCEP reduction agent and LC-MS analysis of the products. Intrinsic tryptophan fluorescence study shows a strong denaturation of HEWL containing trisulfide bonds. The presented evidence indicates that H2S causes the formation of trisulfide bridges, which destabilizes HEWL structure, preventing protein fibrillation. As a result, small spherical aggregates of unordered protein form, which exhibit no cytotoxicity by contrast with HEWL fibrils. PMID:25545790

  9. The Slope Test: Applications in Formative Evaluation.

    ERIC Educational Resources Information Center

    Baggaley, Jon; Brauer, Aaron-Henry

    1989-01-01

    Discusses problems with formative evaluation of educational materials and examines the slope test when used in a pretest/posttest multiple group (PPMG) design to adjust posttest scores treatment interaction studies. An example is given of the utility of the slope test and analysis of covariance procedure using an educational film about AIDS. (five…

  10. Register Formation among Sri Lankan University Youth

    ERIC Educational Resources Information Center

    Zubair, Cala A.

    2011-01-01

    This linguistic and ethnographic project examines register formation among a community of Sri Lankan university youth. The Raggers group at the University of Peradeniya (Kandy, Sri Lanka) has strict rules forbidding the use of English and supporting a register of Sinhala made up of linguistic features from different Sinhala varieties. Detailing…

  11. The NeXus data format

    PubMed Central

    Könnecke, Mark; Akeroyd, Frederick A.; Bernstein, Herbert J.; Brewster, Aaron S.; Campbell, Stuart I.; Clausen, Björn; Cottrell, Stephen; Hoffmann, Jens Uwe; Jemian, Pete R.; Männicke, David; Osborn, Raymond; Peterson, Peter F.; Richter, Tobias; Suzuki, Jiro; Watts, Benjamin; Wintersberger, Eugen; Wuttke, Joachim

    2015-01-01

    NeXus is an effort by an international group of scientists to define a common data exchange and archival format for neutron, X-ray and muon experiments. NeXus is built on top of the scientific data format HDF5 and adds domain-specific rules for organizing data within HDF5 files, in addition to a dictionary of well defined domain-specific field names. The NeXus data format has two purposes. First, it defines a format that can serve as a container for all relevant data associated with a beamline. This is a very important use case. Second, it defines standards in the form of application definitions for the exchange of data between applications. NeXus provides structures for raw experimental data as well as for processed data. PMID:26089752

  12. The NeXus data format

    SciTech Connect

    Könnecke, Mark; Akeroyd, Frederick A.; Bernstein, Herbert J.; Brewster, Aaron S.; Campbell, Stuart I.; Clausen, Björn; Cottrell, Stephen; Hoffmann, Jens Uwe; Jemian, Pete R.; Männicke, David; Osborn, Raymond; Peterson, Peter F.; Richter, Tobias; Suzuki, Jiro; Watts, Benjamin; Wintersberger, Eugen; Wuttke, Joachim

    2015-01-30

    NeXus is an effort by an international group of scientists to define a common data exchange and archival format for neutron, X-ray and muon experiments. NeXus is built on top of the scientific data format HDF5 and adds domain-specific rules for organizing data within HDF5 files, in addition to a dictionary of well defined domain-specific field names. The NeXus data format has two purposes. First, it defines a format that can serve as a container for all relevant data associated with a beamline. This is a very important use case. Second, it defines standards in the form of application definitions for the exchange of data between applications. NeXus provides structures for raw experimental data as well as for processed data.

  13. The NeXus data format

    DOE PAGES

    Könnecke, Mark; Akeroyd, Frederick A.; Bernstein, Herbert J.; ...

    2015-01-30

    NeXus is an effort by an international group of scientists to define a common data exchange and archival format for neutron, X-ray and muon experiments. NeXus is built on top of the scientific data format HDF5 and adds domain-specific rules for organizing data within HDF5 files, in addition to a dictionary of well defined domain-specific field names. The NeXus data format has two purposes. First, it defines a format that can serve as a container for all relevant data associated with a beamline. This is a very important use case. Second, it defines standards in the form of application definitionsmore » for the exchange of data between applications. NeXus provides structures for raw experimental data as well as for processed data.« less

  14. Functional group analysis

    SciTech Connect

    Smith, W.T. Jr.; Patterson, J.M.

    1986-04-01

    Analytical methods for functional group analysis are reviewed. Literature reviewed is from the period of December 1983 through November 1985 and presents methods for determining the following compounds: acids, acid halides, active hydrogen, alcohols, aldehydes, ketones, amides, amines, amino acids, anhydrides, aromatic hydrocarbons, azo compounds, carbohydrates, chloramines, esters, ethers, halogen compounds, hydrazines, isothiocyanates, nitro compounds, nitroso compounds, organometallic compounds, oxiranes, peroxides, phenols, phosphorus compounds, quinones, silicon compounds, sulfates, sulfonyl chlorides, thioamides, thiols, and thiosemicarbazones. 150 references.

  15. Management Agenda Task Group

    DTIC Science & Technology

    2005-02-01

    Report FY04-4 • Recommendations related to business management priorities for the Secretary of Defense February...Business Board (DBB) formed this Task Group to assess and make recommendations to the Department of Defense on management priorities for the next four...This list should be drawn from the four primary areas of DBB focus over the past three years: human resources, financial management, acquisition

  16. Dust Devil Formation

    NASA Astrophysics Data System (ADS)

    Rafkin, S.; Jemmett-Smith, B.; Fenton, L.; Lorenz, R.; Takemi, T.; Ito, J.; Tyler, D.

    2016-11-01

    The essential dynamical characteristic of convective vortices, including dust devils, is a highly localized vorticity tube that extends into the vertical. This chapter is concerned with both the generation of vorticity and the subsequent focusing of that vorticity into a tight vortex, and with the environmental conditions that are conducive to the formation of convective vortices in general and dust devils in particular. A review of observations, theory, and modeling of dust devil formation is provided.

  17. Plant Formate Dehydrogenase

    SciTech Connect

    John Markwell

    2005-01-10

    The research in this study identified formate dehydrogenase, an enzyme that plays a metabolic role on the periphery of one-carbon metabolism, has an unusual localization in Arabidopsis thaliana and that the enzyme has an unusual kinetic plasticity. These properties make it possible that this enzyme could be engineered to attempt to engineer plants with an improved photosynthetic efficiency. We have produced transgenic Arabidopsis and tobacco plants with increased expression of the formate dehydrogenase enzyme to initiate further studies.

  18. Formation of Giant Planets

    NASA Technical Reports Server (NTRS)

    Lin, Douglas

    1999-01-01

    Under the support of NASA Origins grant, we studied the formation of gaps in protoplanetary disks due the tidal interaction between a fully grown protoplanet and protostellar disk. The result of this study is published in the Astrophysical Journal, (vol 514, 344-367, 1999) and in several conference proceedings. The main focus of this work is to analyze planet-disk interaction during the final stages of protoplanetary formation.

  19. Display formats manual

    NASA Technical Reports Server (NTRS)

    Runnels, R. L.

    1973-01-01

    The standards and procedures for the generation of operational display formats to be used in the Mission Control Center (MCC) display control system are presented. The required effort, forms, and fundamentals for the design, specifications, and production of display formats are identified. The principles of display design and system constraints controlling the creation of optimum operational displays for mission control are explained. The basic two types of MCC display systems for presenting information are described.

  20. Group Variables and Gaming Success.

    ERIC Educational Resources Information Center

    Norris, Dwight R.; Niebuhr, Robert E.

    1980-01-01

    Describes a study designed to determine the effects of group cohesiveness on group performance in a management game and, to examine the effects voluntary v assigned group membership has on the cohesiveness of the group. (Author/LLS)