Science.gov

Sample records for formation-hosted lode gold

  1. Dual origins of lode gold deposits in the Canadian Cordillera

    NASA Astrophysics Data System (ADS)

    Nesbitt, Bruce E.; Murowchick, James B.; Muehlenbachs, Karlis

    1986-06-01

    From Late Jurassic to late Tertiary time, two geologically, geochemically, and genetically distinct gold mineralization processes were active in the Canadian Cordillera. One group of deposits can be characterized as epithermal because of its association with intermediate to felsic volcanics, regional caldera structures, low pH alteration zones, low Au/Ag values, and quartz-chalcedony-barite-fluorite gangue. The second group of deposits is mesothermal in character and has strong similarities to the Mother Lode deposits of California, being associated with transcurrent faults, intermediate pH alteration zones, and quartz ± carbonate, albite, mariposite, pyrite, arsenopyrite, scheelite gangue. Compared to epithermal deposits, mesothermal deposits have higher As, W, and Au/Ag values, higher CO2 content in fluid inclusions, and δ18O values of ore-forming fluids of +3‰ to +10‰ vs. -14‰ to -7‰ for epithermal deposits. Like the gold deposits in Nevada and Colorado, epithermal mineralization in the Canadian Cordillera formed from the shallow circulation of meteoric water in subaerial, intermediate to felsic volcanic complexes. In contrast, mesothermal gold deposits throughout the North American Cordillera are shown to be the product of deep circulation and evolution of meteoric water in structures associated with major, transcurrent fault zones. Similarities between Archean lode gold deposits and mesothermal deposits of the Cordillera suggest that Archean lode deposits may have been produced by processes similar to those involved in the formation of Cordilleran mesothermal deposits.

  2. Archaean lode gold deposits: the solute source problem

    SciTech Connect

    Kerrich, R.

    1985-01-01

    On a regional scale lode gold deposits typically occur throughout the entire spectrum of greenstone belt stratigraphy. In the Abitibi Belt lode deposits are sited at the base of the volcanic cycle (Noranda), at the boundary of two volcanic cycles (Timmins) and in the stratigraphically highest groups at Kirkland Lake and Bousquet. The gold deposits are preferentially disposed along major structures apparently demarking rift zones, where extension was accommodated by listric normal faults that subsequently acted as thrusts during compression. These major structures were also sites of emplacement of trondhjemite magmas, lamprophyres and potassic basalts. From previous work Abitibi Belt volcanism spans 2725 to 2703 Ma, batholith emplacement 2675 to 2685 Ma (U-Pb on zircons), and the terminal Matachewan dyke swarm which transects all major structures is 2690 +/- 93 Ma. The lode deposits have age corrected /sup 87/Sr//sup 86/Sr initials of 0.7015 to 0.7025, as well as more radiogenic Pb and higher ..mu.. relative to contemporaneous mantle Sr and Pb isotope ratios. Tourmaline, scheelite, piemontite and apatites separated from 14 deposits all possess /sup 87/Sr//sup 86/Sr 0.7015 to 0.7025. These more radiogenic values contra-indicate a direct mantle source for Sr and Pb, but rather indicate that all mineralizing fluids carry contributions from a felsic crustal source having a significant production of Rb, U and Th radiogenic daughter nuclides as well as from komatiites and tholeiites. Gold, along with an array of lithophile elements including K, Rb, Pb, Li, Sr and CO/sub 2/ were distilled from this mixed source.

  3. Yasny lode-placer cluster: Geological and structural features and gold potential

    NASA Astrophysics Data System (ADS)

    Mel'nikov, A. V.; Stepanov, V. A.

    2014-03-01

    The geological and structural features and gold potential of the Yasny lode-placer cluster in Amur province have been investigated. The lode-placer cluster is an intrusive domal uplift elongated in the nearmeridional direction and surrounded by Neogene loose sediments. The cluster comprises placers that yielded 15 t gold mined from there and small occurrences of gold-quartz and gold-base-metal lodes. Association of native gold with cinnabar in the Yasny Creek placer allows us to forecast a new source of gold-mercury mineralization in the basin of this creek, which could be compared with the Kyuchyus deposit in Yakutia. Gold nuggets 79 kg in total weight were mined from Gar-2 River placer. They are comparable in weight and association with quartz to the world's largest Holtermann Plate nugget from Australia. Gold-quartz lodes have been forecasted in the basin of the Gar-2 Creek.

  4. Mapping of prospectivity and estimation of number of undiscovered prospects for lode gold, southwestern Ashanti Belt, Ghana

    NASA Astrophysics Data System (ADS)

    Carranza, Emmanuel John M.; Owusu, Emmanuel A.; Hale, Martin

    2009-07-01

    In the southwestern part of the Ashanti Belt, the results of fractal and Fry analyses of the spatial pattern of 51 known mines/prospects of (mostly lode) gold deposits and the results of analysis of their spatial associations with faults and fault intersections suggest different predominant structural controls on lode gold mineralisation at local and district scales. Intersections of NNE- and NW-trending faults were likely predominantly involved in local-scale structural controls on lode gold mineralisation, whilst NNE-trending faults were likely predominantly involved in district-scale structural controls on lode gold mineralisation. The results of the spatial analyses facilitate the conceptualisation and selection of spatial evidence layers for lode gold prospectivity mapping in the study area. The applications of the derived map of lode gold prospectivity and a map of radial density of spatially coherent lode gold mines/prospects results in a one-level prediction of 37 undiscovered lode gold prospects. The applications of quantified radial density fractal dimensions of the spatial pattern of spatially coherent lode gold mines/prospects result in an estimate of 40 undiscovered lode gold prospects. The study concludes finally that analysis of the spatial pattern of discovered mineral deposits is the key to a strong link between mineral prospectivity mapping and assessment of undiscovered mineral deposits.

  5. Lode-gold mineralization in the Tanami region, northern Australia

    NASA Astrophysics Data System (ADS)

    Huston, David L.; Vandenberg, Leon; Wygralak, Andrew S.; Mernagh, Terrence P.; Bagas, Leon; Crispe, Andrew; Lambeck, Alexis; Cross, Andrew; Fraser, Geoff; Williams, Nick; Worden, Kurt; Meixner, Tony; Goleby, Bruce; Jones, Leonie; Lyons, Pat; Maidment, David

    2007-01-01

    at an angle consistent with tensional fractures opened during E-W- to ENE-WSW-directed transpression. Many of these deposits are hosted by reactive rock units such as carbonaceous siltstone and iron formation. Ore deposition occurred at depths ranging from 1.5 to 11 km from generally low to moderate salinity carbonic fluids with temperatures from 200 to 430°C, similar to lode-gold fluids elsewhere in the world. These fluids are interpreted as the product of metamorphic dewatering caused by enhanced heat flow, although it is also possible that the fluids were derived from coeval granites. Lead isotope data suggest that lead in the ore fluids had multiple sources. Hydrogen and oxygen isotope data are consistent with both metamorphic and magmatic origins for ore fluids. Gold deposition is interpreted to be caused by fluid unmixing and sulfidation of host rocks. Fluid unmixing is caused by three different processes: (1) CO2 unmixing caused by interaction of ore fluids with carbonaceous siltstone; (2) depressurization caused by pressure cycling in shear zones; and (3) boiling as ore fluids move to shallow levels. Deposits in the Tanami region may illustrate the continuum model of lode-gold deposition suggested by Groves (Mineralium Deposita 28:366-374, 1993) for Archean districts.

  6. Tectonostratigraphic setting of the Mother Lode gold belt, south of Placerville, California

    SciTech Connect

    Landefeld, L.A.

    1985-01-01

    Gold-quartz veins and alteration of the Mother Lode gold belt south of Placerville are hosted by the Melones fault zone (MFZ) in the south and by its splays in the north. The MFZ changes from south to north in the following manner: ductilely deformed serpentinite-hosted tectonic melange to a broad zone of ductile shearing to a 1 km wide mylonite-phyllonite zone. These strata have common protoliths but differ in metamorphic rank, structural style, gold deposit morphology and production, which can be explained by: 1) greatest uplift of the Sierran block in the south during Basin and Range tilting, 2) irregular shape of the Jura-Triassic convergent margin of western North America coupled with oblique convergence, 3) vertical and lateral variations in age, metamorphic rank and structural style typical of an active arc and basin which is forming while closing, 4) composition and volume of diagenetic, burial and later dynamic metamorphic fluids, 5) rheology and composition of different lithologies. The Mother Lode vein system formed as the MFZ locked up. The ore-forming fluids rose km's up the MFZ to form the vein system during repeated late-stage brittle faulting. As accretion ground to a halt in the MFZ, the accretion shifted west to emplace the Franciscan complex.

  7. Soil geochemistry of Mother Lode-type gold deposits in the Hodson mining district, central California, U.S.A.

    USGS Publications Warehouse

    Chaffee, M.A.; Hill, R.H.

    1989-01-01

    The Hodson mining district is in the westernmost foothills of the Sierra Nevada in California, about 17 km west of the town of Angels Camp. This district is part of the West Gold Belt, which lies about 12-16 km west of, and generally parallel to, the better known Mother Lode Gold Belt in central California. The district produced several million dollars worth of Au between about 1890 and 1940. ?? 1989.

  8. Map showing characteristics of lode gold in the Medford 1 degree by 2 degrees Quadrangle, Oregon-California

    USGS Publications Warehouse

    Page, Norman J; Johnson, Maureen G.; Peterson, Jocelyn A.

    1983-01-01

    About 500 lode gold occurrences, prospects, and mines have been reported from the Medford 1o x 2o quadrangle, Oregon-California. Summary descriptions of individual lode gold deposits and districts which include those occurrences in the Medford 1o x 2o quadrangle have been published by Brooks and Ramp (1968) and Hotz (1971) and by others cited in the reference lists in these two publications. As part of the Medford CUSMAP project between 1974 and 1980, some of these deposits were examined in the field during geologic mapping and geochemical sampling and most of the available information on individual deposits was compiled into a CRIB computer file (Computerized Resource Information Bank). This report is a summary of the more pertinent geologic and economic characteristics of the lode gold deposits for use in the resource evaluation part of the Medford CUSMAP project. The significant features described include the distribution of deposits and their relation to gross geologic and lithologic features, production information, mineralogy of the ore and gangue, gold-silver ratios, and speculations on possible genetic models for some types of deposits. 

  9. Age constraints on Tarkwaian palaeoplacer and lode-gold formation in the Tarkwa-Damang district, SW Ghana

    USGS Publications Warehouse

    Pigois, J.-P.; Groves, D.I.; Fletcher, I.R.; McNaughton, N.J.; Snee, L.W.

    2003-01-01

    Two major epigenetic gold-forming events are recorded in the world-class gold province of southwest Ghana. A pre-Tarkwaian event was the source of the world-class Tarkwa palaeoplacers whereas post-Birimian and Tarkwaian deformation, which was related to the Eburnean orogeny, gave rise to the world-class (e.g. Prestea) to giant (e.g. Obuasi) orogenic gold deposits which have made the region famous for more than 2,500 years. A maximum age of 2133 ?? 4 Ma for Tarkwaian sedimentation is provided by 71 of 111 concordant SHRIMP II U Pb dates from detrital zircons in Tarkwaian clastic rocks from Damang and Bippo Bin, northeast of Tarkwa. The overall data distribution broadly overlaps the relatively poorly constrained ages of Birimian volcanism and associated Dixcove-type granitoid emplacement, indicating syntectonic development of the Tarkwaian sedimentary basin. These zircon ages argue against derivation of the palaeoplacer gold from an orogenic gold source related to the compressional phase of an orogeny significantly older than the Eburnean orogeny. Instead, they suggest that the gold source was either orogenic gold lodes related to an earlier compressional phase of a diachronous Eburnean orogeny or ca. 2200-2100 Ma intrusion-related gold lode. The CO2-rich fluid inclusions in associated vein-quartz pebbles are permissive of either source. At the Damang deposit, an epigenetic, orogenic lode-gold system clearly overprinted, and sulphidised low-grade palaeoplacer hematite magnetite gold occurrences in the Banket Series conglomerate within the Tarkwaian sedimentary sequence. Gold mineralisation is demonstrably post-peak metamorphism, as gold-related alteration assemblages overprint metamorphic assemblages in host rocks. In alteration zones surrounding the dominant, subhorizontal auriferous quartz veins, there are rare occurrences of hydrothermal xenotime which give a SHRIMP U Pb age of 2063 ?? 9 Ma for gold mineralisation. The similar structural timing of epigenetic gold

  10. Arsenic speciation in pyrite and secondary weathering phases, Mother Lode gold district, Tuolumne County, California

    SciTech Connect

    Savage, K.S.; Tingle, Tracy N.; O'Day, Peggy A.; Waychunas, Glenn A.; Bird, Dennis K.

    2004-10-27

    Arsenian pyrite, formed during Cretaceous gold mineralization, is the primary source of As along the Melones fault zone in the southern Mother Lode Gold District of California. Mine tailings and associated weathering products from partially submerged inactive gold mines at Don Pedro Reservoir, on the Tuolumne River, contain approx. 20-1300 ppm As. The highest concentrations are in weathering crusts from the Clio mine and nearby outcrops which contain goethite or jarosite. As is concentrated up to 2150 ppm in the fine-grained (<63 mu-m) fraction of these Fe-rich weathering products. Individual pyrite grains in albite-chlorite schists of the Clio mine tailings contain an average of 1.2 wt. percent As. Pyrite grains are coarsely zoned, with local As concentrations ranging from approx. 0 to 5 wt. percent. Electron microprobe, transmission electron microscope, and extended X-ray absorption fine-structure spectroscopy (EXAFS) analyses indicate that As substitutes for S in pyrite and is not p resent as inclusions of arsenopyrite or other As-bearing phases. Comparison with simulated EXAFS spectra demonstrates that As atoms are locally clustered in the pyrite lattice and that the unit cell of arsenian pyrite is expanded by approx. 2.6 percent relative to pure pyrite. During weathering, clustered substitution of As into pyrite may be responsible for accelerating oxidation, hydrolysis, and dissolution of arsenian pyrite relative to pure pyrite in weathered tailings. Arsenic K-edge EXAFS analysis of the fine-grained Fe-rich weathering products are consistent with corner-sharing between As(V) tetrahedra and Fe(III)-octahedra. Determinations of nearest-neighbor distances and atomic identities, generated from least-squares fitting algorithms to spectral data, indicate that arsenate tetrahedra are sorbed on goethite mineral surfaces but substitute for SO4 in jarosite. Erosional transport of As-bearing goethite and jarosite to Don Pedro Reservoir increases the potential for As

  11. Arsenic speciation in pyrite and secondary weathering phases, Mother Lode gold district, Tuolumne County, California

    SciTech Connect

    Savage, K.S.; Tingle, Tracy N.; O'Day, Peggy A.; Waychunas, Glenn A.; Bird, Dennis K.

    2004-10-27

    Arsenian pyrite, formed during Cretaceous gold mineralization, is the primary source of As along the Melones fault zone in the southern Mother Lode Gold District of California. Mine tailings and associated weathering products from partially submerged inactive gold mines at Don Pedro Reservoir, on the Tuolumne River, contain approx. 20-1300 ppm As. The highest concentrations are in weathering crusts from the Clio mine and nearby outcrops which contain goethite or jarosite. As is concentrated up to 2150 ppm in the fine-grained (<63 mu-m) fraction of these Fe-rich weathering products. Individual pyrite grains in albite-chlorite schists of the Clio mine tailings contain an average of 1.2 wt. percent As. Pyrite grains are coarsely zoned, with local As concentrations ranging from approx. 0 to 5 wt. percent. Electron microprobe, transmission electron microscope, and extended X-ray absorption fine-structure spectroscopy (EXAFS) analyses indicate that As substitutes for S in pyrite and is not present as inclusions of arsenopyrite or other As-bearing phases. Comparison with simulated EXAFS spectra demonstrates that As atoms are locally clustered in the pyrite lattice and that the unit cell of arsenian pyrite is expanded by approx. 2.6 percent relative to pure pyrite. During weathering, clustered substitution of As into pyrite may be responsible for accelerating oxidation, hydrolysis, and dissolution of arsenian pyrite relative to pure pyrite in weathered tailings. Arsenic K-edge EXAFS analysis of the fine-grained Fe-rich weathering products are consistent with corner-sharing between As(V) tetrahedra and Fe(III)-octahedra. Determinations of nearest-neighbor distances and atomic identities, generated from least-squares fitting algorithms to spectral data, indicate that arsenate tetrahedra are sorbed on goethite mineral surfaces but substitute for SO4 in jarosite. Erosional transport of As-bearing goethite and jarosite to Don Pedro Reservoir increases the potential for As

  12. Legacy of the California Gold Rush: Environmental geochemistry of arsenic in the southern Mother Lode Gold District

    USGS Publications Warehouse

    Savage, K.S.; Bird, D.K.; Ashley, R.P.

    2000-01-01

    Gold mining activity in the Sierra Nevada foothills, both recently and during the California Gold Rush, has exposed arsenic-rich pyritic rocks to weathering and erosion. This study describes arsenic concentration and speciation in three hydrogeologic settings in the southern Mother Lode Gold District: mineralized outcrops and mine waste rock (overburden); mill tailings submerged in a water reservoir; and lake waters in this monomictic reservoir and in a monomictic lake developing within a recent open-pit mine. These environments are characterized by distinct modes of rock-water interaction that influence the local transport and fate of arsenic. Arsenic in outcrops and waste rock occurs in arsenian pyrite containing an average of 2 wt% arsenic. Arsenic is concentrated up to 1300 ppm in fine-grained, friable iron-rich weathering products of the arsenian pyrite (goethite, jarosite, copiapite), which develop as efflorescences and crusts on weathering outcrops. Arsenic is sorbed as a bidentate complex on goethite, and substitutes for sulfate in jarosite. Submerged mill tailings obtained by gravity core at Don Pedro Reservoir contain arsenic up to 300 ppm in coarse sand layers. Overlying surface muds have less arsenic in the solid fraction but higher concentrations in porewaters (up to 500 ??g/L) than the sands. Fine quartz tailings also contain up to 3.5 ppm mercury related to the ore processing. The pH values in sediment porewaters range from 3.7 in buried gypsum-bearing sands and tailings to 7 in the overlying lake sediments. Reservoir waters immediately above the cores contain up to 3.5 ??g/L arsenic; lake waters away from the submerged tailings typically contain less than 1 ??g/L arsenic. Dewatering during excavation of the Harvard open-pit mine produced a hydrologic cone of depression that has been recovering toward the pre-mining groundwater configuration since mining ended in 1994. Aqueous arsenic concentrations in the 80 m deep pit lake are up to 1000 ??g

  13. Magmatic-hydrothermal origin of the early Triassic Laodou lode gold deposit in the Xiahe-Hezuo district, West Qinling orogen, China: implications for gold metallogeny

    NASA Astrophysics Data System (ADS)

    Jin, Xiao-ye; Li, Jian-wei; Hofstra, Albert H.; Sui, Ji-xiang

    2016-12-01

    The Xiahe-Hezuo district in the West Qinling orogen contains numerous Au-(As-Sb) and Cu-Au-(W) deposits. The district is divided into eastern and western zones by the Xiahe-Hezuo Fault. The western zone is exposed at a shallow level and contains sediment-hosted disseminated Au-(As-Sb) deposits, whereas the eastern zone is exposed at a deeper level and contains Cu-Au-(W) skarn and lode gold deposits within or close to granitic intrusions. The Laodou gold deposit in the eastern zone consists of auriferous quartz-sulfide-tourmaline and minor quartz-stibnite veins that are structurally controlled by fault zones transecting the Laodou quartz diorite porphyry stock and enveloped by potassic and phyllic alteration. Both the veins and alteration halos commonly contain quartz, sericite, tourmaline, pyrite, and arsenopyrite, with minor galena, sphalerite, chalcopyrite, tetrahedrite, and enargite. Gold occurs mainly as invisible gold in pyrite or arsenopyrite and locally as inclusions less than 50 μm in diameter. The zircon U-Pb age of 247.6 ± 1.3 Ma (2σ) on the host quartz diorite porphyry and the sericite 40Ar/39Ar plateau ages of 249.1 ± 1.6 and 249.0 ± 1.5 Ma (2σ) on two ore-related hydrothermal sericite samples are within analytical errors of one another. At the formation temperature (275 °C) inferred from microthermometric measurements of fluid inclusion, sericite and tourmaline yield calculated δDH2O values of -70 to -45‰ and δ 18OH2O of 5.8 to 9.7‰, while quartz yields calculated δ 18OH2O values of 5.1˜5.7‰. Hydrothermal tourmaline in quartz-sulfide-tourmaline veins has δ 11B of -11.2 to -0.9‰ (mean of -6.3‰) that are similar to the values of magmatic tourmaline (-8.9 to -5.5‰ with a mean of -6.8‰) in the host quartz diorite porphyry. The δ 34S values of sulfide minerals range from -5.9 to +5.8‰ with a mean of -0.6‰ that is typical of magmatic sulfur. Pyrite from hydrothermally altered quartz diorite porphyry and quartz

  14. Styles of lode gold mineralization contributing to the placers of the Indian River and Black Hills Creek, Yukon Territory, Canada as deduced from microchemical characterization of placer gold grains

    NASA Astrophysics Data System (ADS)

    Chapman, Robert John; Mortensen, James Keith; Lebarge, William P.

    2011-12-01

    Between 1978 and 2009, approximately 430,000 oz of placer gold were obtained from the Indian River and Black Hills Creek, which equates to roughly 20% of the production for the entire Yukon Territory during that period. The area is unglaciated, exposure is poor, and there are few known lode gold occurrences present. The technique of microchemical characterization of placer gold grains has been applied to illuminate the style(s) of source mineralization and their relationship to placer gold from the Klondike gold district immediately to the north. A total of 2,613 placer gold grains from 22 localities were characterised in terms of the Au, Ag, Cu, and Hg content of their alloy and associated suite of opaque mineral inclusions. A combination of alloy and inclusion mineralogy was used to define gold signatures which augmented the previous classification of orogenic gold in the Klondike. Gold type 3b (8-25% Ag) is the main component of the placers in lower Dominion Creek but is augmented and eventually replaced by type 3a gold (10-40% Ag) in placers in the main Indian River valley, probably through erosion of gold-bearing veins in the valley floor. Type 4 gold exhibits highly variable Ag which may contain Hg to a maximum of 11 wt.%. This gold type also hosts a distinctive inclusion assemblage of complex polymetallic sulphides, tellurides, sulfotellurides, and sulfosalts and has previously been ascribed to local low sulfidation epithermal mineralization. Placer gold in drainages radiating from Eureka Dome exhibits various proportions of types 3 and 4 gold depending on location, but type 3 gold forms the major component in Black Hills Creek and northerly flowing tributaries of the Indian River with the exception of Eureka and Montana creeks. Type 5 gold is found only in placers in the middle and lower Indian River. It is distinguished by slightly elevated (0.05-0.17%) Cu in the gold alloy, together with low (5-9%) Ag contents. Inclusions of Bi minerals, Cr

  15. Effects of mother lode-type gold mineralization on 187Os/188Os and platinum group element concentrations in peridotite: Alleghany District, California

    USGS Publications Warehouse

    Walker, R.J.; Böhlke, J.K.; McDonough, W.F.; Li, J.

    2007-01-01

    Osmium isotope compositions and concentrations of Re, platinum group elements (PGE), and Au were determined for host peridotites (serpentinites and barzburgites) and hydrothermally altered ultramafic wall rocks associated with Mother Lode-type hydrothermal gold-quartz vein mineralization in the Alleghany district, California. The host peridotites have Os isotope compositions and Re, PGE, and Au abundances typical of the upper mantle at their presumed formation age during the late Proterozoic or early Paleozoic. The hydrothermally altered rocks have highly variable initial Os isotope compositions with ??os, values (% deviation of 187OS/188OS from the chondritic average calculated for the approx. 120 Ma time of mineralization) ranging from -1.4 to -8.3. The lowest Os isotope compositions are consistent with Re depletion of a chondritic source (e.g., the upper mantle) at ca. 1.6 Ga. Most of the altered samples are enriched in Au and have depleted and fractionated abundances of Re and PGE relative to their precursor peridotites. Geoehemical characteristics of the altered samples suggest that Re and some PGE were variably removed from the ultramafic rocks during the mineralization event. In addition to Re, the Pt and Pd abundances of the most intensely altered rocks appear to have been most affected by mineralization. The 187Os-depleted isotopic compositions of some altered rocks are interpreted to be a result of preferential 187Os loss via destruction of Re-rich phases during the event. For these rocks, Os evidently is not a useful tracer of the mineralizing fluids. The results do, however, provide evidence for differential mobility of these elements, and mobility of 187Os relative to the initial bulk Os isotope composition during hydrothermal metasomatic alteration of ultramafic rocks. ?? 2007 Society of Economic Geologists, Inc.

  16. 43 CFR 3832.21 - How do I locate a lode or placer mining claim?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...) or is not a deposit of placer, alluvial (deposited by water), eluvial (deposited by wind), colluvial..., lode, or ledge by— (i) Tracing the vein or lode on the surface; or (ii) Drilling a hole, sinking a... bearing gold or valuable detrital minerals; (ii) Hosted in soils, alluvium (deposited by water),...

  17. Metalliferous lode deposits of Alaska

    USGS Publications Warehouse

    Berg, Henry C.; Cobb, Edward Huntington

    1967-01-01

    This report summarizes from repoAs of Federal and State agencies published before August 31, 1965, the geology of Alaska's metal-bearing lodes, including their structural or stratigraphic control, host rock, mode of origin, kinds of .Q minerals, grade, past production, and extent of exploration. In addition, the lists of mineral occurrences that accompany the 35 mineral-deposit location maps constitute an inventory of the State's known lodes. A total of 692 localities where m&alliferous deposits have been found are shown on the maps. The localities include 1,739 mines, prospects, and reported occurrences, of which 821 are described individually or otherwise cited in the text.

  18. Geology of the Alaska-Juneau lode system, Alaska

    USGS Publications Warehouse

    Twenhofel, William Stephens

    1952-01-01

    The Alaska-Juneau lode system for many years was one of the worlds leading gold-producing areas. Total production from the years 1893 to 1946 has amounted to about 94 million dollars, with principal values in contained gold but with some silver and lead values. The principal mine is the Alaska-Juneau mine, from which the lode system takes its name. The lode system is a part of a larger gold-bearing belt, generally referred to as the Juneau gold belt, along the western border of the Coast Range batholith. The rocks of the Alaska-Juneau lode system consist of a monoclinal sequence of steeply northeasterly dipping volcanic, state, and schist rocks, all of which have been metamorphosed by dynamic and thermal processes attendant with the intrusion of the Coast Range batholith. The rocks form a series of belts that trend northwest parallel to the Coast Range. In addition to the Coast Range batholith lying a mile to the east of the lode system, there are numerous smaller intrusives, all of which are sill-like in form and are thus conformable to the regional structure. The bedded rocks are Mesozoic in age; the Coast Range batholith is Upper Jurassic and Lower Cretaceous in age. Some of the smaller intrusives pre-date the batholith, others post-date it. All of the rocks are cut by steeply dipping faults. The Alaska-Juneau lode system is confined exclusively to the footwall portion of the Perseverance slate band. The slate band is composed of black slate and black phyllite with lesser amounts of thin-bedded quartzite. Intrusive into the slate band are many sill-like bodies of rocks generally referred to as meta-gabbro. The gold deposits of the lode system are found both within the slate rocks and the meta-gabbro rocks, and particularly in those places where meta-gabbro bodies interfinger with slate. Thus the ore bodies are found in and near the terminations of meta-gabbro bodies. The ore bodies are quartz stringer-lodes composed of a great number of quartz veins from 6

  19. Archean high-Mg monzodiorite-syenite, epidote skarn, and biotite-sericite gold lodes in the Granny Smith-Wallaby district, Australia: U-Pb and Re-Os chronometry of two intrusion-related hydrothermal systems

    NASA Astrophysics Data System (ADS)

    Mueller, Andreas G.; Hall, Gregory C.; Nemchin, Alexander A.; Stein, Holly J.; Creaser, Robert A.; Mason, Douglas R.

    2008-03-01

    constrain intrusion-related mineralization to 2,662 ± 3 Ma. The main-stage gold-pyrite ore (Au/Ag >10) forms hematite-stained sericite-dolomite-albite lodes in stacked D2 reverse faults, which offset skarn, syenite, and the biotite-calcite veins by up to 25 m. The molybdenite Re-Os age (2,661 ± 10 Ma) of the ore suggests a genetic link to intrusive activity but is in apparent conflict with a monazite-xenotime U-Pb age (2,651 ± 6 Ma), which differs from that of the skarn at the 95% confidence level. The time relationships at both gold deposits are inconsistent with orogenic models invoking a principal role for metamorphic fluids released during the main phase of compression in the fold belt. Instead, mineralization is related in space and time to late-orogenic, magnetite-series, high-Mg monzodiorite-syenite intrusions of mantle origin, characterized by Mg/(Mg + FeTOTAL) = 0.31-0.57, high Cr (34-96 ppm), Ni (22-63 ppm), Ba (1,056-2,321 ppm), Sr (1,268-2,457 ppm), Th (15-36 ppm), and rare earth elements (total REE: 343-523 ppm). At Wallaby, shared Ca-K-CO2 metasomatism and Th-REE enrichment (in allanite) link Au-Ag mineralization in biotite-calcite veins to the formation of the giant epidote skarn, implicating a Th + REE-rich syenite pluton at depth as the source of the oxidized hydrothermal fluid. At Granny Smith, lead isotope data and the Rb-Th-U signature of early hematite-bearing wall-rock alteration point to fluid released by the source pluton of the differentiated alkali granite dikes.

  20. Link between ridge subduction and gold mineralization in southern Alaska

    USGS Publications Warehouse

    Haeussler, Peter J.; Bradley, Dwight C.; Goldfarb, Richard; Snee, Lawrence W.; Taylor, Cliff D.

    1995-01-01

    40Ar/39Ar geochronology reveals that turbidite-hosted gold deposits in the southern Alaska accretionary prism are the same age as nearby near-trench plutons. These early Tertiary plutons and gold lodes formed above a slab window during subduction of an oceanic spreading center. Ridge subduction is a previously unrecognized tectonic process for the generation of lode gold.

  1. 43 CFR 3832.20 - Lode and placer mining claims.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Lode and placer mining claims. 3832.20... MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) LOCATING MINING CLAIMS OR SITES Types of Mining Claims § 3832.20 Lode and placer mining claims....

  2. 43 CFR 3832.20 - Lode and placer mining claims.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Lode and placer mining claims. 3832.20... MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) LOCATING MINING CLAIMS OR SITES Types of Mining Claims § 3832.20 Lode and placer mining claims....

  3. 43 CFR 3832.20 - Lode and placer mining claims.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Lode and placer mining claims. 3832.20... MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) LOCATING MINING CLAIMS OR SITES Types of Mining Claims § 3832.20 Lode and placer mining claims....

  4. 43 CFR 3832.20 - Lode and placer mining claims.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Lode and placer mining claims. 3832.20... MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) LOCATING MINING CLAIMS OR SITES Types of Mining Claims § 3832.20 Lode and placer mining claims....

  5. Geology and origin of epigenetic lode gold deposits, Tintina Gold Province, Alaska and Yukon: Chapter A in Recent U.S. Geological Survey studies in the Tintina Gold Province, Alaska, United States, and Yukon, Canada--results of a 5-year project

    USGS Publications Warehouse

    Goldfarb, Richard J.; Marsh, Erin E.; Hart, Craig J.R.; Mair, John L.; Miller, Marti L.; Johnson, Craig; Gough, Larry P.; Day, Warren C.

    2007-01-01

    -rich and 18O-rich crustal fluids, most commonly of low salinity. The older group of ores includes the low-grade intrusion-related gold systems at Fort Knox near Fairbanks and those in Yukon, with fluids exsolved from fractionating melts at depths of 3 to 9 kilometers and forming a zoned sequence of auriferous mineralization styles extending outward to the surrounding metasedimentary country rocks. The causative plutons are products of potassic mafic magmas generated in the subcontinental lithospheric mantle that interacted with overlying lower to middle crust to generate the more felsic ore-related intrusions. In addition, the older ores include spatially associated, high-grade, shear-zonerelated orogenic gold deposits formed at the same depths from upward-migrating metamorphic fluids; the Pogo deposit is a relatively deep-seated example of such. The younger gold ores, restricted to southwestern Alaska, formed in unmetamorphosed sedimentary rocks of the Kuskokwim basin within 1 to 2 kilometers of the surface. Most of these deposits formed via fluid exsolution from shallowly emplaced, highly evolved igneous complexes generated mainly as mantle melts. However, the giant Donlin Creek orogenic gold deposit is a product of either metamorphic devolatilization deep in the basin or of a gold-bearing fluid released from a flysch-melt igneous body.

  6. View north from within mining cut; portal of Fowler Lode ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View north from within mining cut; portal of Fowler Lode Adit (6'-long range pole for scale) - Steamboat Mine, Southeast slope of Steamboat Mountain, west of the junction of Forest Service Roads 1000300 and 1000365, Jacksonville, Jackson County, OR

  7. View north from USFS Road 300; portal of Fowler Lode ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View north from USFS Road 300; portal of Fowler Lode Adit - Steamboat Mine, Southeast slope of Steamboat Mountain, west of the junction of Forest Service Roads 1000300 and 1000365, Jacksonville, Jackson County, OR

  8. 43 CFR 3864.1-2 - Millsites applied for in conjunction with a lode claim.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Millsite Patents § 3864.1-2 Millsites applied for in conjunction with a lode claim. Where the original survey includes a lode claim and also a millsite the lode claim should be described in the...

  9. 43 CFR 3864.1-2 - Millsites applied for in conjunction with a lode claim.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Millsite Patents § 3864.1-2 Millsites applied for in conjunction with a lode claim. Where the original survey includes a lode claim and also a millsite the lode claim should be described in the...

  10. 43 CFR 3864.1-2 - Millsites applied for in conjunction with a lode claim.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Millsite Patents § 3864.1-2 Millsites applied for in conjunction with a lode claim. Where the original survey includes a lode claim and also a millsite the lode claim should be described in the...

  11. 43 CFR 3864.1-2 - Millsites applied for in conjunction with a lode claim.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Millsite Patents § 3864.1-2 Millsites applied for in conjunction with a lode claim. Where the original survey includes a lode claim and also a millsite the lode claim should be described in the...

  12. View west from USFS Road 369 toward Fowler Lode Adit ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View west from USFS Road 369 toward Fowler Lode Adit and O'Brien Ditch (left) and open-pit excavation (top-center, beyond trees); ridge saddle is in center - Steamboat Mine, Southeast slope of Steamboat Mountain, west of the junction of Forest Service Roads 1000300 and 1000365, Jacksonville, Jackson County, OR

  13. View north from portal of Fowler Lode Adit, showing section ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View north from portal of Fowler Lode Adit, showing section of tunnel interior (6'-long range pole for scale) - Steamboat Mine, Southeast slope of Steamboat Mountain, west of the junction of Forest Service Roads 1000300 and 1000365, Jacksonville, Jackson County, OR

  14. View northeast from USFS Road 300; Fowler Lode Adit portal ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View northeast from USFS Road 300; Fowler Lode Adit portal on left (location of original "steamboat pocket" on slope to right, above the road cut) - Steamboat Mine, Southeast slope of Steamboat Mountain, west of the junction of Forest Service Roads 1000300 and 1000365, Jacksonville, Jackson County, OR

  15. Isotopic studies of mariposite-bearing rocks from the south- central Mother Lode, California.

    USGS Publications Warehouse

    Kistler, R.W.; Dodge, F.C.W.; Silberman, M.L.

    1983-01-01

    Gold-bearing vein formation in the Mother Lode belt of the study area apparently occurred during the Early Cretaceous between 127 and 108 m.y. B.P. The hydrothermal fluids that carried the gold precipitated quartz and mariposite at approx 320oC, similar to the T of precipitation of gold-bearing quartz veins in the Allegheny district. The O- and H-isotopic composition calculated for the fluid indicate that it was similar to formation water or was metamorphic in origin. If the carbonate in the veins was in isotopic equilibrium with this same fluid, it apparently precipitated at a higher T of approx 400oC. The Sr in the carbonate is much less radiogenic than that in any known marine carbonate, but is similar in isotopic composition to that in metamorphosed mafic volcanic rocks of the general region. These mafic rocks could have been the source for the Sr in the hydrothermal veins. This observation supports the contention that the gold-mariposite-quartz-carbonate rocks were formed as an alteration product of serpentinite and other mafic igneous rocks.-A.P.

  16. Gold

    USGS Publications Warehouse

    Kirkemo, Harold; Newman, William L.; Ashley, Roger P.

    1998-01-01

    Through the ages, men and women have cherished gold, and many have had a compelling desire to amass great quantities of it -- so compelling a desire, in fact, that the frantic need to seek and hoard gold has been aptly named "gold fever." Gold was among the first metals to be mined because it commonly occurs in its native form -- that is, not combined with other elements -- because it is beautiful and imperishable, and because exquisite objects can be made from it.

  17. Gold in minerals and the composition of native gold

    USGS Publications Warehouse

    Jones, Robert Sprague; Fleischer, Michael

    1969-01-01

    Gold occurs in nature mainly as the metal and as various alloys. It forms complete series of solid solutions with silver, copper, nickel, palladium, and platinum. In association with the platinum metals, gold occurs as free gold as well as in solid solution. The native elements contain the most gold, followed by the sulfide minerals. Several gold tellurides are known, but no gold selenides have been reported, and only one sulfide, the telluride-sulfide mineral nagyagite, is known. The nonmetallic minerals carry the least gold, and the light-colored minerals generally contain less gold than the dark minerals. Some conclusions in the literature are conflicting in regard to the relation of fineness of native gold to its position laterally and vertically within a lode, the nature of the country rocks, and the location and size of nuggets in a streambed, as well as to the variation of fineness within an individual nugget.

  18. 43 CFR 3863.1-4 - Applications for placers containing known lodes.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Placer Mining Claim Patent Applications § 3863.1-4 Applications for placers containing known lodes. Applicants for patent to a placer claim, who are also in possession of a known vein or lode included...

  19. 43 CFR 3863.1-4 - Applications for placers containing known lodes.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ...) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Placer Mining Claim Patent Applications § 3863.1-4 Applications for placers containing known lodes. Applicants for patent to a placer claim, who are also in possession of a known vein or lode included...

  20. 43 CFR 3863.1-4 - Applications for placers containing known lodes.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Placer Mining Claim Patent Applications § 3863.1-4 Applications for placers containing known lodes. Applicants for patent to a placer claim, who are also in possession of a known vein or lode included...

  1. 43 CFR 3863.1-4 - Applications for placers containing known lodes.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Placer Mining Claim Patent Applications § 3863.1-4 Applications for placers containing known lodes. Applicants for patent to a placer claim, who are also in possession of a known vein or lode included...

  2. 76 FR 13600 - Payette National Forest, Idaho, Golden Hand #3 and #4 Lode Mining Claims, Plan of Operations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-14

    ... Forest Service Payette National Forest, Idaho, Golden Hand 3 and 4 Lode Mining Claims, Plan of Operations... withdrawing the Environmental Impact Statement (EIS) for The Golden Hand No. 3 and No. 4 Lode Mining Claims Proposed Plan of Operations. The project included mining operations on the lode claims along...

  3. Multiple origins of Canadian Cordilleran gold deposits: geologic-tectonic constraints

    SciTech Connect

    Nesbitt, B.E.; Murowchick, J.B.; Muehlenbachs, K.

    1985-01-01

    Detailed examination of geologic and geochemical characteristics of lode gold deposits in the Canadian Cordillera indicates that there are at least two different, yet synchronous styles of gold mineralization: Mother Lode and Epithermal. Epithermal type deposits are hosted by Late Jurassic to Tertiary intermediate to felsic volcanic units in accreted island arc terrains. They have many characteristics in common with the better known US epithermal deposits including potassic, silicic and low pH alteration zones, quartz-chalcedony-calcite-barite gangue and Au/Ag, < 1.0. Mother Lode vein systems are found in most terrains of the Canadian Cordillera and typically show a spatial correlation with major Early Cretaceous to Tertiary transcurrent or thrust faults, but no consistent correlation with felsic plutons. Host rocks for Mother Lode deposits include a wide variety of rock types with a nearly ubiquitous association with serpentinites. All of the units hosting ore have been metamorphosed to low to middle greenschist facies. Mother Lode deposits are accompanied by ankeritic, albitic, sericitic and silicic alteration, have a characteristic gangue assemblage of, Qz, Carb, Alb, Mariposite +/- Scheelite, Asp, Py, Po, Cp and a Au/Ag > 1. The deposits appear to have formed from deep circulation of meteoric water in major fracture zones, typically transcurrent faults. Subsequent upward movement and cooling of the fluids caused deposition of gold and associated gangue. Geologic and geochemical similarities of Mother Lode deposits to Archean gold deposits indicate that such an origin may well have been responsible for many Archean deposits, as well.

  4. Structural localization and origin of compartmentalized fluid flow, Comstock lode, Virginia City, Nevada

    USGS Publications Warehouse

    Berger, B.R.; Tingley, J.V.; Drew, L.J.

    2003-01-01

    Bonanza-grade orebodies in epithermal-style mineral deposits characteristically occur as discrete zones within spatially more extensive fault and/or fracture systems. Empirically, the segregation of such systems into compartments of higher and lower permeability appears to be a key process necessary for high-grade ore formation and, most commonly, it is such concentrations of metals that make an epithermal vein district world class. In the world-class silver- and gold-producing Comstock mining district, Nevada, several lines of evidence lead to the conclusion that the Comstock lode is localized in an extensional stepover between right-lateral fault zones. This evidence includes fault geometries, kinematic indicators of slip, the hydraulic connectivity of faults as demonstrated by veins and dikes along faults, and the opening of a normal-fault-bounded, asymmetric basin between two parallel and overlapping northwest-striking, lateral- to lateral-oblique-slip fault zones. During basin opening, thick, generally subeconomic, banded quartz-adularia veins were deposited in the normal fault zone, the Comstock fault, and along one of the bounding lateral fault zones, the Silver City fault. As deformation continued, the intrusion of dikes and small plugs into the hanging wall of the Comstock fault zone may have impeded the ability of the stepover to accommodate displacement on the bounding strike-slip faults through extension within the stepover. A transient period of transpressional deformation of the Comstock fault zone ensued, and the early-stage veins were deformed through boudinaging and hydraulic fragmentation, fault-motion inversion, and high- and low-angle axial rotations of segments of the fault planes and some fault-bounded wedges. This deformation led to the formation of spatially restricted compartments of high vertical permeability and hydraulic connectivity and low lateral hydraulic connectivity. Bonanza orebodies were formed in the compartmentalized zones of

  5. Significant Metalliferous and Selected Non-Metalliferous Lode Deposits, and Selected Placer Districts of Northeast Asia

    USGS Publications Warehouse

    Ariunbileg, Sodov; Biryul'kin, Gennandiy V.; Byamba, Jamba; Davydov, Yury V.; Dejidmaa, Gunchin; Distanov, Elimir G.; Dorjgotov, Dangindorjiin; Gamyanin, Gennadiy N.; Gerel, Ochir; Fridovskiy, Valeriy Y.; Gotovsuren, Ayurzana; Hwang, Duk-Hwan; Kochnev, Anatoliy P.; Kostin, Alexei V.; Kuzmin, Mikhail I.; Letunov, Sergey A.; Jiliang, Li; Xujun, Li; Malceva, Galina D.; Melnikov, V.D.; Nikitin, Valeriy; Obolenskiy, Alexander A.; Ogasawara, Masatsugu; Orolmaa, Demberel; Parfenov, Leonid M.; Popov, Nikolay V.; Prokopiev, Andrei V.; Ratkin, Vladimir; Rodionov, Sergey M.; Seminskiy, Zhan V.; Shpikerman, Vladimir I.; Smelov, Alexander P.; Sotnikov, Vitaly I.; Spiridonov, Alexander V.; Stogniy, Valeriy V.; Sudo, Sadahisa; Fengyue, Sun; Jiapeng, Sun; Weizhi, Sun; Supletsov, Valeriy M.; Timofeev, Vladimir F.; Tyan, Oleg A.; Vetluzhskikh, Valeriy G.; Aihua, Xi; Yakovlev, Yakov V.; Hongquan, Yan; Zhizhin, Vladimir I.; Zinchuk, Nikolay N.; Zorina, Lydia M.

    2003-01-01

    Introduction This report contains a digtial database on lode deposits and placer districts of Northeast Asia. This region includes Eastern Siberia, Russian Far East, Mongolia, Northeast China, South Korea, and Japan. In folders on this site are a detailed database, a bibliography of cited references, descriptions of mineral deposit models, and a mineral deposit location map. Data are provided for 1,674 significant lode deposits and 91 significant placer districts of the region.

  6. Formation of gold mineralization in ultramafic alkalic magmatic complexes

    NASA Astrophysics Data System (ADS)

    Ryabchikov, I. D.; Kogarko, L. N.; Sazonov, A. M.; Kononkova, N. N.

    2016-06-01

    Study of mineral inclusions within alluvial gold particles of the Guli Complex (East Siberia) and findings of lode gold in rocks of the same intrusion have demonstrated that gold mineralization occurs in interstitions of both early high-magnesium rocks (dunite) and later alkalic and carbonatite rocks. In dunite the native gold occurs in association with Fe-Ni sulfides (monosulfide solid solution, pentlandite, and heazlewoodite). Formation of the gold-bearing alloys took place under a low oxygen potential over a broad range of temperatures: from those close to 600°C down to below 400°C.

  7. Structure of magnetite lodes at the Estyunino iron deposit in the central Urals

    NASA Astrophysics Data System (ADS)

    Rudnitsky, V. F.; Aleshin, K. B.; Kuznetsov, A. Zh.; Ivanchenko, V. S.

    2013-11-01

    The structure of magnetite lodes is determined by iron and sulfur distribution, as well as texture and structure of ore. These features have been revealed by documentation of cores from ore intervals in exploration boreholes penetrating two main lodes 21 and 22 of the Estyunino iron deposit. The documentation of cores was accompanied by sampling for microscopic examination of texture and structure of ore and selection of Fe and S contents in ore. Then these data were summarized as sections of the lodes. It was established that the structure of magnetite lodes is characterized by conformable ore layers distinguished by texture, structure, and Fe and S contents. Banded and spotty ores containing less than 50% magnetite are predominant. Layers of homogeneous massive ore are infrequent. The textural pattern indicates a volcaniclastic nature of host rocks. The spotty texture is characteristic of hyaloclastites with vitreous shards. The banded texture with oriented distribution of fiamme is inherent to volcaniclastic rocks. In both cases, magnetite selectively replaces dark-colored vitreous fragments and is also dispersed in the salic matrix and lava fragments. No indications of crosscutting superposed relationships are observed. The available data can be satisfactorily explained by an impregnation-metasomatic mode of ore deposition.

  8. Radioactivity at the Copper Creek copper lode prospect, Eagle district, east-central Alaska

    USGS Publications Warehouse

    Wedow, Helmuth; Tolbert, Gene Edward

    1952-01-01

    Investigation of radioactivity anomalies at the Copper Creek copper lode prospect, Eagle district, east-central Alaska, during 1949 disclosed that the radioactivity is associated with copper mineralization in highly metamorphosed sedimentary rocks. These rocks are a roof pendant in the Mesozoic "Charley River" batholith. The radioactivity is probably all due to uranium associated with bornite and malachite.

  9. Nature and composition of gold-forming fluids at Umm Rus area, Eastern Desert, Egypt: evidence from fluid inclusions in vein materials

    NASA Astrophysics Data System (ADS)

    Harraz, H. Z.; El-Dahhar, M. A.

    1993-04-01

    The Umm Rus gold lode is housed along fractures in granitoid-gabbroic rocks, being largely controlled by a NE-SW trending fracture system that affected the Eastern Desert. Mineralogically, the gold lode consists of quartz and carbonate gangue enclosing minor amounts of auriferous pyrite and arsenopyrite. Trace amounts of sphalerite, galena, marcasite and pyrrhotite are also present. The lode can be divided into: (i) Au-poor, pyrite-quartz vein, (ii) Au-rich, pyrite-arsenopyrite-quartz vein and (iii) gangue dominant. Inspection of primary inclusions from the Umm Rus gold lode showed that the ore was formed from CO 2-H 2O-rich fluids (ca. 30-46 mol % CO 2) of low salinity (6.75-7.75 wt. % NaCl equiv.) and alkaline to neutral pH with a density of 0.76-0.85 g/cc. These data are consistent with dissolution of gold as a bisulphide complex. Deposition of Au most likely occurred over a temperature range of 250-300°C and at pressures around 0.35 Kbars. The deposition may have occurred in response to separation of a liquid CO 2-phase from an originally CO 2-H 2O-rich aqueous fluids. The style of mineralization at Umm Rus bears certain resemblances to Au-bearing quartz veins in the Archaean deposits of Canada and Australia and the "Mother Lode" deposits of the U.S.A.

  10. Geochemistry of placer gold, Koyukuk-Chandalar mining district, Alaska

    USGS Publications Warehouse

    Mosier, E.L.; Cathrall, J.B.; Antweiler, J.C.; Tripp, R.B.

    1989-01-01

    The Koyukuk-Chandalar mining district of the Brooks Range mineral belt in north-central Alaska contains numerous placer gold deposits but few known lode gold sources. Gold grains, collected from 46 placer localities and 6 lode gold sites in the district, were analyzed for Ag and 37 trace elements utilizing direct current-arc optical emission spectroscopy. When possible, several measurements were made on each sample and averaged. Gold content was calculated by the summation of the 38 elements determined and subtracting from 100. The objectives of our study were to characterize the deposits by defining the type and number of distinct geochemical characteristics for the Au, to determine relationships of Au in placer deposits to possible lode sources (placer and lode), to identify possible primary sources of placer gold, and to study processes of placer formation. Interpretation of results emphasize that the Au grains are almost invariably ternary (Au-Ag-Cu) alloys. The average Cu content is 0.040% and the average Ag content and fineness [(Au/Au+Ag)??1,000] are 10.5% and 893 parts per thousand, respectively, for the 46 placer localities. Six geochemically distinct types of placer gold can be identified in the Koyukuk-Chandalar mining district based on Ag and Cu values. One type with an average Ag content of 21.2%, an average Cu content of 0.007%, and 786 average fineness is found only in the eastern part of the district. Placer gold grains that have an average Ag content of 6.0%, an average Cu content of 0.276%, and 940 average fineness were found in the western part of the district. Four intermediate types generally occur in order across the district. Variations in the chemistry of the placer gold can be related to variable depositional environments at the primary gold sources. Placer gold geochemistry is important in determining the origin and depositional environment of the primary Au sources and could add to the knowledge of the thermal history of the southcentral

  11. East asian gold: Deciphering the anomaly of phanerozoic gold in precambrian cratons

    USGS Publications Warehouse

    Goldfarb, R.J.; Hart, C.; Davis, G.; Groves, D.

    2007-01-01

    Early Cretaceous orogenic gold deposits in eastern Asia are globally unique in that large Phanerozoic lode gold deposits occur in Archean-Paleoproterozoic cratons. In the northern Pacific region, ca. 125 Ma orogenic gold deposits in the North China, Yangzte, and Siberian craton margins, as well as in young terranes in California, may ultimately relate to the giant Cretaceous mantle plume in the southern Pacific basin and the relatively rapid tectonic consequences along both continental margins from resulting Pacific plate reconfigurations. In eastern Asia, such consequences include reactivation of and fluid flow along major fault systems, with fluid focusing into simultaneously forming, isolated core complexes of uncertain genesis. Deposition of gold ores in previously devolatilized high-grade Precambrian metamorphic rocks requires an exotic source of ore fluid, most likely subducted Mesozoic oceanic crust and/or overlying sediment. An implication is that Phanerozoic metamorphic core complexes in other destabilized craton margins could host large gold resources. ?? 2007 by Economic Geology.

  12. Characteristics of gold deposits in northern Sonora, Mexico: a preliminary report

    USGS Publications Warehouse

    Silberman, M.L.; Giles, D.A.; Graubard, C.

    1988-01-01

    The complex geology of northern Sonora has a variety of environments suitable for gold mineralisation, and many of the gold prospects occur within or adjacent to the southwestern boundary of the megashear in Precambrian, Mesozoic and Tertiary rocks. The characteristics types of gold deposits have been delineated by reconnaissance field investigations of the authors. There are four main environments of lode gold deposits present in Sonora: epithermal veins and breccias; discontinuous quartz veins; structurally controlled Au; and carbonate sedimentary-hosted disseminated Au. -after Authors

  13. Concentration of gold in in situ laterites from Mato Grosso

    NASA Astrophysics Data System (ADS)

    Michel, Dominique

    1987-07-01

    The gold concentration studied is located in lateritic soils overlying Precambrian schists of the Cuiaba Group in Mato Grosso, Brazil. The following five horizons may be recognized from bottom to top: (1) a gray-blue altered schist horizon, (2) a red argillaceous alterite, (3) a horizon characterized by iron oxihydroxide-rich pebbles and quartz fragments in an iron oxihydroxide-rich matrix and clays, (4) an iron crust, and (5) the present soil. The most significant gold content is found in the third horizon just below the iron crust. According to geological study and morphological observations of the gold particles, the gold ore mined today is the result of two combined processes, i.e., the ferrallitic alteration of quartz lodes enclosed in schists and the effect of the red argillaceous alterite which acts as an impervious structure preventing the largest gold grains from migrating downward during their mechanical concentration.

  14. Oblique map of the northern Sierra Nevada, California, showing location of gold-bearing areas

    USGS Publications Warehouse

    Alpha, T.R.; Dodge, F.C.W.; Bliss, J.D.

    1987-01-01

    Locations of lode gold prospects and mines shown on the map were obtained from the U.S. Geological Survey's Mineral Resource Data System (MRDS), a computerized mineral-resource information file, and plotted in their respective locations (D.F. Huber, written commun., 1986). Some locations from two northern counties, missing from the MRDS retrival, were added. The twenty lode mines believed to be the most productive are cited in table 1. A total of nearly 4,000 sites, including both prospects and mines, were initially plotted, but about a third of those were obscured by topography on the oblique map. Locations of Tertiary river channels and gold-dredging fields were taken from published general references modified by examining specific sources and by cursory field examination. Seven of the major dredge fields are identified in table 2.

  15. Lebediny gold deposit, Central Aldan: Mineral parageneses, stages, and formation conditions

    NASA Astrophysics Data System (ADS)

    Dobrovol'skaya, M. G.; Razin, M. V.; Prokof'ev, V. Yu.

    2016-07-01

    The mineral parageneses and succession of their formation are considered for the first time for the Zverevsky, Orekhovy, and Vodonosny ore lodes of the Lebediny gold deposit and the Radostny prospect in the Central Aldan ore district, which are genetically related to the epoch of Mesozoic tectonomagmatic reactivation. The orebodies, represented by two morphological varieties—ribbonlike lodes and steeply dipping veins—are hosted in lower part of the Vendian-Cambrian dolomitic sequence, which is cut through by Mesozoic subalkaline intrusive bodies. The chemistry of fahlore and rare minerals, including native gold and bismuth, altaite, aikinite, tetradymite, and sulfosalts of lillianite series, has been studied. Native gold is related to the late hydrothermal process and occurs in skarn and in quartz-tremolite-sulfide and quartz-carbonate-sulfide veins. The data on stable sulfur (δ34S) isotopes of sulfides, oxygen (δ18O) and carbon (δ13C) isotopes of carbonates, as well as on fluid inclusions in various generations of tremolite and quartz, provide evidence for the heterogeneity of ore-bearing solutions, their relationships to magmatism, the depth of the source feeding each specific lode, and different sources of ore-forming hydrothermal solutions.

  16. Geochemistry and origin of gold mineralization in the Kolar Schist Belt

    NASA Technical Reports Server (NTRS)

    Siddaiah, N. Siva; Rajamani, V.

    1988-01-01

    Geological, mineralogical, mineral-textural and geochemical data of the sulfide lodes in the belt indicate that the gold mineralization could be related to low temperature, low Eh and high pH rock-dominated geothermal systems set up in the submarine volcanic pile prior to amphibolite metamorphism. A relatively long-lived geothermal system produced an economic deposit, whereas short-lived ones, because of rapid burial by younger basalts throttled the geothermal system and diffused the discharge yielding low grade ore bodies. The source for gold and iron could be iron enriched tholeiites derived from source regions enriched in komatiitic melt components and komatiitic rocks derived by very low extents of melting of metasomatised mantle sources. On the other hand, the geographical restriction of the quartz-calcite lodes, their mineralogical and geochemical data and their estimated temperature of formation all seem to suggest that a major part of the hydrothermal fluids, and a significant portion of gold could have been derived from mantle derived intrusive, sanukitoid type magma sources, similar to the Champion Gneiss occurring on the eastern part of the belt. However, the possibility of some input by remobilization of a premetamorphic sulfide protore to quartz lodes cannot be ruled out completely.

  17. Platiniferous gold-tourmaline aggregates in the gold-palladium belt of Minas Gerais, Brazil: implications for regional boron metasomatism

    NASA Astrophysics Data System (ADS)

    Cabral, Alexandre Raphael; Tupinambá, Miguel; Zeh, Armin; Lehmann, Bernd; Wiedenbeck, Michael; Brauns, Michael; Kwitko-Ribeiro, Rogerio

    2017-02-01

    The platiniferous gold-palladium belt of Minas Gerais, Brazil, forms an approximately 240-km-long, roughly north-south-trending domain that includes numerous auriferous lodes and platiniferous alluvium. The belt transects two Precambrian terranes, the Quadrilátero Ferrífero in the southern part, and the southern Serra do Espinhaço in the northern part. Both terranes were overprinted by regional fluid flow that led to tourmalinisation, with or without hematitisation, and precious-metal mineralisation. Here, we report the occurrence of coarse-grained gold-tourmaline aggregates and integrate recently obtained ages and tourmaline boron-isotope values published elsewhere. One type of aggregate is unique because it has patches that are close to stoichiometric PdPt, in which gold content varies from 2.5 to 33.5 at.%. The gold-tourmaline aggregates seem to be the ultimate expression of the boron metasomatism.

  18. Constraints on the composition of ore fluids and implications for mineralising events at the Cleo gold deposit, Eastern Goldfields Province, Western Australia

    USGS Publications Warehouse

    Brown, S.M.; Johnson, C.A.; Watling, R.J.; Premo, W.R.

    2003-01-01

    The Cleo gold deposit, 55 km south of Laverton in the Eastern Goldfields Province of Western Australia, is characterised by banded iron-formation (BIF)-hosted ore zones in the gently dipping Sunrise Shear Zone and high-grade vein-hosted ore in the Western Lodes. There is evidence that gold mineralisation in the Western Lodes (which occurred at ca 2655 Ma) post-dates the majority of displacement along the Sunrise Shear Zone, but it remains uncertain if the ore in both structures formed simultaneously or separately. Overall, the Pb, Nd, Sr, C. O and S isotopic compositions of ore-related minerals from both the Western Lodes and ore zones in the Sunrise Shear Zone are similar. Early low-salinity aqueous-carbonic fluids and late high-salinity fluids with similar characteristics are trapped in inclusions in quartz veins from both the Sunrise Shear Zone and the Western Lodes. The early CO2, CO2-H2O, and H2O- dominant inclusions are interpreted as being related to ore formation, and to have formed from a single low-salinity aqueous-carbonic fluid as a result of intermittent fluid immiscibility. Homogenisation temperatures indicate that these inclusions were trapped at approximately 280??C and at approximately 4 km depth, in the deeper epizonal range. Differences between the ore zones are detected in the trace-element composition of gold samples, with gold from the Sunrise Shear Zone enriched in Ni, Pb, Sn, Te and Zn, and depleted In As, Bi, Cd, Cu and Sb, relative to gold from the Western Lodes. Although there are differences in gold composition between the Sunrise Shear Zone and Western Lodes, and hence the metal content of ore fluids may have varied slightly between the different ore zones, no other systematic fluid or solute differences are detected between the ore zones. Given the fact that the ore fluids in each zone have very similar bulk properties, the considerable differences in gold grade, sulfide mineral abundance, and ore textures between the two ore zones

  19. Mercury contamination from historical gold mining in California

    USGS Publications Warehouse

    Alpers, Charles N.; Hunerlach, Michael P.; May, Jason T.; Hothem, Roger L.

    2005-01-01

    Mercury contamination from historical gold mines represents a potential risk to human health and the environment. This fact sheet provides background information on the use of mercury in historical gold mining and processing operations in California, with emphasis on historical hydraulic mining areas. It also describes results of recent USGS projects that address the potential risks associated with mercury contamination. Miners used mercury (quicksilver) to recover gold throughout the western United States. Gold deposits were either hardrock (lode, gold-quartz veins) or placer (alluvial, unconsolidated gravels). Underground methods (adits and shafts) were used to mine hardrock gold deposits. Hydraulic, drift, or dredging methods were used to mine the placer gold deposits. Mercury was used to enhance gold recovery in all the various types of mining operations; historical records indicate that more mercury was used and lost at hydraulic mines than at other types of mines. On the basis of USGS studies and other recent work, a better understanding is emerging of mercury distribution, ongoing transport, transformation processes, and the extent of biological uptake in areas affected by historical gold mining. This information has been used extensively by federal, state, and local agencies responsible for resource management and public health in California.

  20. The Tintina Gold Belt - A global perspective

    USGS Publications Warehouse

    Goldfarb, Richard J.; Hart, Craig J.R.; Miller, Marti L.; Miller, Lance D.; Farmer, G. Lang; Groves, David I.; Tucker, T.L.; Smith, M.T.

    1999-01-01

    The so-called Tintina Gold Belt extends for more than 1000 km along the length of the northern North American Cordillera. Middle to Late Cretaceous Au deposits within the belt have various similar characteristics, among which are a spatial and temporal association with magmatism; Bi-W-Te signatures in deposits hosted by granitod stocks and As-Sb signatures where hosted by sedimentary rocks and dyke systems; and δ180 values consistently > 12 per mil for Au-bearing quartz. Nevertheless significant differences in structural styles, levels of deposit emplacement, ore-fluid chemistry, and Au grades suggest that the characteristics represent a broad range of deposit types. Many of these are best classified as orogenic Au deposits in the Yukon-Tanana terrane, as epithermal and porphyry-style Au deposits in the Kuskokwim region, and as Au-bearing, granite-related veins and stockworks, replacements, and skarns, as well as associated polymetallic lodes, in central Yukon. The diverse types of Au deposits and associated plutons of the Tintina Gold Belt collectively define a 45-m.y.-long period of arc magmatism that migrated northwesterly, for about 1000 km, across the active collisional margin of Cretaceous northwestern North America. The initiation of fluid flow and plutonism in Albian time seems to correlate with the onset of oblique subduction and dextral strike-slip on the Denali-Farewell, Tintina-Kaltag, and related fault systems. Initial Au-vein formation and subduction-related magmatism at about 115-110 Ma (e.g., including the Goodpaster and Fortymile districts), within the seaward side of the Yukon-Tanana terrane, correlate with the arrival of the Wrangellia superterrane off the continental margin. Dextral translation of the allochthonous Wrangellia block was associated with the migration of the thermal pulse to the northwest at about 95-90 Ma. Orogenic (or so­ called mesotherrnal) and granitoid-related Au deposits formed across the width of the Yukon

  1. Gold distribution on the sea floor off the Klamath Mountains, California

    USGS Publications Warehouse

    Moore, George William; Silver, Eli A.

    1968-01-01

    Analyses of 82 samples collected from the surface of the continental shelf between the Oregon-California border and Eureka, Calif., indicate that the background gold content on this shelf is about 0.1 ppb (part per billion). Four anomalous tracts, which range in extent from 10 to 30 square kilometers, have gold values above 10 ppb, and the richest sample contains 300 ppb. The anomalous areas seem to lack a close correlation with water depth, but they are related to areas underlain by soft Cenozoic strata that contain small quantities of dispersed gold originally derived from lodes in the Klarnath Mountains. This relationship suggests that the offshore gold accumulations are lag concentrates produced from the Cenozoic deposits by wave erosion during the postglacial rise in sea level. Gold contents at the surface are too low for economic recovery, and drilling will be required to determine whether the anomalous areas are underlain by higher grade material.

  2. Dependence of rock properties on the Lode angle: Experimental data, constitutive model, and bifurcation analysis

    NASA Astrophysics Data System (ADS)

    Chemenda, Alexandre I.; Mas, Daniel

    2016-11-01

    The overwhelming majority of experimental tests on rocks have only been conducted for a single value of the Lode angle θ corresponding to the axisymmetric compression (AC). There are now sufficiently extensive data sets from both AC and axisymmetric extension (AE) tests (corresponding to two extreme θ values) for two materials (synthetic rock analog GRAM1 and Solnhofen Limestone). These data cover a wide range of the confining pressure (from brittle faulting to ductile flow). Very recently the data from true 3-D tests (for different θ) also covering both brittle and ductile fields were published for Castlegate and Bentheim Sandstone as well. The results from all these tests summarized and processed in this paper constitute a solid basis which allows general conclusions to be drawn about the dependence of rock behavior on θ. In all cases, the yield/failure envelopes were shown to be θ-dependent so that the material strength at low mean stress σ is smaller under AE than under AC, while at high σ, it is the opposite. The brittle-ductile transition under AE occurs at σ 1.5 times greater than under AC, meaning that under AE the material is more prone to fracture development. The angle between the most compressive stress and the forming deformation localization bands is systematically higher for AE than for AC for the same σ. Based on these data we formulate a new three-invariant constitutive model with convex and concave yield functions (YFs) which is used for the bifurcation analysis. The results of this analysis agree with the experimental data (for both YFs) and reveal that the θ-dependence of rock properties encourages the strain localization. The major factors defining this dependence are the θ-dependence of the YFs but also of the dilatancy factor which is greater for AE than for AC. The theoretical results show that the failure (deformation band) plane can deviate from the intermediate stress direction and can become parallel to the maximum compressive

  3. Giant Mesozoic gold provinces related to the destruction of the North China craton

    NASA Astrophysics Data System (ADS)

    Li, Jian-Wei; Bi, Shi-Jian; Selby, David; Chen, Lei; Vasconcelos, Paulo; Thiede, David; Zhou, Mei-Fu; Zhao, Xin-Fu; Li, Zhan-Ke; Qiu, Hua-Ning

    2012-10-01

    Lode gold deposits in Precambrian cratons represent the world's major gold source and were mostly generated during formation and stabilization of the cratons. However, there is an extraordinary exception in the North China craton (NCC), where lode gold deposits formed after prolonged stabilization of the craton. Molybdenite Re-Os and hydrothermal sericite and biotite 40Ar/39Ar dating of major gold deposits from the Xiaoqinling district, southern NCC, bracket their emplacement in the range of 154.1±1.1 to 118.9±1.2 Ma (n=23), postdating formation of the craton by more than 1.7 billion years. Fluid inclusions extracted from gold-bearing pyrite have elevated 3He/4He ratios (1.52-0.22 Ra) and mantle-like Ne isotopes (20Ne/22Ne=10.02-9.22 and 21Ne/22Ne=0.033-0.027), indicating presence of mantle-derived fluids in the ore system. Measured δ34S of pyrite and δD and δ18O of hydrothermal micas and fluid inclusion waters in auriferous quartz further confirm a magmatic/mantle source for sulfur and ore fluids. Gold deposits of similar ages also widely occur in the eastern and northern margins of the NCC, which, together with those in the Xiaoqinling district, have a total reserve of ˜2500 t gold, forming the only known giant late Mesozoic gold province in the world's Precambrian cratons. These deposits formed coevally with extensive felsic to mafic magmatism, development of intracontinental rift basins, and exhumation of metamorphic core complexes across the eastern NCC, events interpreted as indicating thinning and destruction of the lithosphere beneath the craton. Rising of asthenosphere coupled with destruction of the lithosphere has generated voluminous mafic and felsic magmas that provided sufficient fluids, sulfur and, by inference, other ore components to form the giant gold provinces.

  4. Noble gases, K, U, Th, and Pb in native gold

    NASA Astrophysics Data System (ADS)

    Engster, O.; Niedermann, S.; Thalmann, C.; Frei, R.; Kramers, J.; KräHenbühl, U.; Liu, Y. Z.; Hofmann, B.; Boer, R. H.; Reimold, W. U.; Bruno, L.

    1995-12-01

    We present determinations of the noble gas and Pb isotopic abundances and of K, Th, and U concentrations of native gold. Our results demonstrate that gold is an excellent carrier for crustal volatiles, but direct dating of gold using the U, Th-4He, 40K-40Ar, and U fission Xe methods was not successful for various reasons. The main significance of this work is the great sensitivity of gold for trapped gases as well as for gases that were produced in situ which gives the prospects of using gold and its fluid and solid inclusions for the study of paleogas composition. Numerous nuclear effects characterize the noble gas inventory of placer gold from Switzerland and Italy, vein gold from Italy, South Africa, and Venezuela, and lode gold from South Africa. The degassing patterns obtained by mass spectrometry show a low-temperature release of volatiles around 500°C from fluid inclusions mainly in vein gold and a high-temperature release from solid inclusions and the gold itself. The low-temperature volatiles represent species that were trapped when the gold crystallized. We investigated the following trapped species: the isotopes of He, Ne, Ar, Kr, Xe, and Pb, and the abundances of K, U, Th, H2O, and CO2. The crustal gases trapped by gold comprise 3He from 6Li(n,α)3H → β- → 3He, 4He and 40Ar from the U, Th, and K decay, and Xe from 238U fission. We observe 4He/40Ar = 3.9 for the radiogenic trapped gases of tertiary gold and a ratio of 1.4 for Archean gold. These ratios are consistent with the production ratios from U and K at the respective times and demonstrate that gold can be used as a sampler of ancient atmospheric gases. The concentrations of U and Th range from a few parts per billion to a few parts per million, and those of K and Pb range up to some tens of parts per million. The antiquity of trapped Pb is indicated by the Pb-Pb model age of about 3000 Ma for the lead extracted from vein gold and quartz of the Lily gold mine (South Africa). Gold also

  5. Gold Rush!

    ERIC Educational Resources Information Center

    Brahier, Daniel J.

    1997-01-01

    Describes a mathematical investigation of gold--how it is weighed, stored, used, and valued. For grades 3-4, children estimate the value of treasure chests filled with gold coins and explore the size and weight of gold bars. Children in grades 5-6 explore how gold is mined and used, and how the value of gold changes over time. (PVD)

  6. Gold grade variation and particle microchemistry in exploration pits of the Batouri gold district, SE Cameroon

    NASA Astrophysics Data System (ADS)

    Vishiti, A.; Suh, C. E.; Lehmann, B.; Egbe, J. A.; Shemang, E. M.

    2015-11-01

    The Batouri area hosts lode-gold mineralization under several-m-thick lateritic cover. Pitting to bed rock on a geochemical Au anomaly defined from previous reconnaissance soil sampling identified five horizons ranging from saprock at the base to laterite at the top. Analysis of bulk samples from each horizon by fire assay shows that most of the horizons are barren although 119 ppb and 48 ppb Au values were obtained from one laterite horizon and one saprolite horizon, respectively, from two separate pits. All the horizons were panned and particulate gold was also recovered only from these two horizons. The gold grains from both horizons are morphologically and compositionally indistinguishable with rare quartz, pyrite and galena inclusions. The grains have irregular, sub-rounded, bean to elongated shapes and they show a remarkable core-rim zonation. Electron microprobe analysis of the grains recorded high gold content in the rims (86.3-100 wt%) and along fissures within the grains (95.1-100 wt%). The cores are relatively Ag rich (11.8-14 wt% Ag) while the rims (0.63-13.7 wt% Ag, most of the values fall within the lower limit of this range) and fissures (0.03-5.02 wt% Ag) are poor in Ag. The low Ag concentration in the rims and along fissures is attributed to preferential leaching of Ag; a process recognized in gold grains and platiniferous alloys from alluvia. The core composition of the grains is similar to that of primary gold composition in the bedrock. These results show that gold in the soil is relic particulate gold derived from the primary source with no evidence of secondary gold precipitation in the weathering cycle. In all the pits no horizon was systematically enriched in gold suggesting there has been no chemical remobilization of gold in this environment. Rather the dispersion of gold here is in the particulate form. Therefore combining particulate gold features with assay data is relevant to exploration in such tropical environments.

  7. Integrating geologic and satellite imagery data for high-resolution mapping and gold exploration targets in the South Eastern Desert, Egypt

    NASA Astrophysics Data System (ADS)

    Zoheir, Basem; Emam, Ashraf

    2012-05-01

    The granitoid-greenstone belts of the Arabian-Nubian Shield are well-endowed with lode gold and massive sulfide ores. Although generally characterized by excellent outcrops and arid desert realm, poor accessibility and lack of finance have been always retardant to detailed geologic mapping of vast areas of the shield. Lack of comprehensive geological information and maps at appropriate scales would definitely hinder serious exploration programs. In this study, band ratioing, principal component analysis (PCA), false-color composition (FCC), and frequency filtering (FFT-RWT) of ASTER and ETM+ data have substantially improved visual interpretation for detailed mapping of the Gebel Egat area in South Eastern Desert of Egypt. By compiling field, petrographic and spectral data, controls on gold mineralization have been assessed in terms of association of gold lodes with particular lithological units and structures. Contacts between foliated island arc metavolcanics and ophiolites or diorite are likely to be favorable loci for auriferous quartz veins, especially where the NW-SE foliation is deflected into steeply dipping NNW-trending shear planes. High-resolution mapping of the greenstone belt, structures and alteration zones associated with gold lodes in the study area suggests that dilatation by foliation deflection was related to emplacement of the Egat granitic intrusion, attendant with a sinistral transpression regime (i.e., ˜640-550 Ma?). Gold mineralization associated with granitoid intrusions in transpression-induced pull-apart structures elsewhere in the Eastern Desert (e.g., Fawakhir, Sukari and Hangaliya mines) emphasize the reliability of this setting as a model for gold exploration targets in greenstone terrains of Egypt, and may be elsewhere in the Arabian-Nubian Shield.

  8. Constraints of mineralogical characterization of gold ore: Implication for genesis, controls and evolution of gold from Kundarkocha gold deposit, eastern India

    NASA Astrophysics Data System (ADS)

    Sahoo, P. R.; Venkatesh, A. S.

    2015-01-01

    reactions along with additional input of hydrothermal fluid paved the way for expulsion of lattice-bound gold from sulfides to concentrate as nuggets/main lode within shear fractures channelizing the fluid flow. Thermometry results of the arsenopyrite-pyrite-pyrrhotite assemblage yielded a temperature range from 375 to 390 °C which is the ideal condition for gold precipitation. Native silver, gersdorffite and arsenian-ullmannite are being reported for the first time from this deposit indicating the complexity and wide variety of mineral phases associated with gold implying magmatic-hydrothermal input of the source fluid.

  9. The Association of Tourmaline With Cassiterite Ores: Implications for the Genesis of the World's Richest Tin Lode

    NASA Astrophysics Data System (ADS)

    Mlynarczyk, M. S.; Williams-Jones, A. E.

    2004-05-01

    The San Rafael deposit in the Eastern Cordillera of the Peruvian Central Andes is the world's richest hydrothermal tin lode, with a total resource of ~1 million tonnes Sn (metal) at an average tin grade of 4.7 wt.%. The mineralization is of the cassiterite-sulfide type and occurs in a vertically extensive vein-breccia system, centered on a shallow-level, Late Oligocene granitoid stock. The tin ores form cassiterite-quartz-chlorite-bearing veins and breccias, hosted by several large fault-jogs at depth in the lode. By contrast, the copper ores, which contain disseminated acicular cassiterite, are localized in the upper part of the system. Both ore types are associated with a very distinctive strong chloritic alteration, which was preceded by intense sericitization, tourmalinization and tourmaline veining. Tourmaline also continued to crystallize during tin mineralization. The early hydrothermal tourmaline is the Mg-rich variety, dravite, which forms tourmaline-quartz veins and tourmaline-quartz microbreccias. This was followed by the appearance of buergerite (a rare, Fe-rich variety of tourmaline) with cassiterite and chlorite, at the transition to the tin ore stage. Fe-rich tourmaline (buergerite ?) is also common as overgrowths on earlier dravite in the strongly chloritized wallrock, adjacent to tin mineralization. These observations corroborate evidence from mass-balance calculations, that the ore-fluid was very iron-rich. Potentially, the most interesting feature of the tourmaline chemistry from the perspective of tin mineralization is the oxidation state of Fe. All tourmaline samples analyzed have Fe3+/Fe2+ ratios that are unusually high for an S-type tin granite. However, tourmaline accompanying tin mineralization has a significantly lower Fe3+/Fe2+ ratio. This suggests that the rich tin ores of San Rafael were produced by a sudden injection of "late", deep-seated, reducing, (presumably magmatic) fluids, strongly enriched in iron, and that cassiterite

  10. Detection and mapping of hydrothermally altered rocks in the vicinity of the Comstock Lode, Virginia Range, Nevada, using enhanced Landsat images

    USGS Publications Warehouse

    Ashley, Roger P.; Goetz, A.F.H.; Rowan, L.C.; Abrams, M.J.

    1979-01-01

    The Virginia Range, immediately southeast of Reno, Nev., consists mainly of flows, breccias, and turfs of Miocene age. Most of these volcanic rocks are of intermediate composition; rhyodacite is the most common rock type. Basalt, rhyolite and rhyolite tuff, and tuffaceous sedimentary rocks of Miocene and Pliocene age also cover substantial areas in the range. Pre-Tertiary metasedimentary, metavolcanic, and granitic rocks are exposed in scattered inliers, mostly along the southern and eastern margins of the range. Several large areas and many small areas within the volcanic pile were subjected to hydrothermal alteration during and after the period of intermediate volcanic activity. Economic precious metal mineralization is spatially and temporally associated with the hydrothermal alteration in several areas. The most important deposit is the Comstock Lode, which produced 192 million troy ounces of silver and 8.3 million troy ounces of gold from epithermal veins (Bonham, 1969). The hydrothermally altered rocks include silicified, advanced argillic, montmorillonite-bearing argillic, and propylitic types. The first three types typically contain pyrite, and some propylitic rocks contain pyrite as well. Supergene oxidation of these pyritic rocks produces limonitic bleached rocks. The term 'limonite,' as used here, refers to any combination of the minerals hematite, goethite, and Jarosite. Where vegetation cover is sparse to moderate, these limonitic rocks are readily identified on Landsat images enhanced by the color-ratio composite technique developed by Rowan and others (1974), so the altered areas can be mapped. About 30 percent tree cover (here mainly pinyon pine) is sufficient to change the spectral signature of individual picture elements (pixels) enough so that limonitic materials can no longer be uniquely identified. As in all other areas where this technique has been applied, limonitic unaltered rocks with intermediate to high albedos have the same appearance on

  11. Tectonic setting of synorogenic gold deposits of the Pacific Rim

    USGS Publications Warehouse

    Goldfarb, R.J.; Phillips, G.N.; Nokleberg, W.J.

    1998-01-01

    More than 420 million oz of gold were concentrated in circum-Pacific synorogenic quartz loades mainly during two periods of continental growth, one along the Gondwanan margin in the Palaeozoic and the other in the northern Pacific basin between 170 and 50 Ma. These ores have many features in common and can be grouped into a single type of lode gold deposit widespread throughout clastic sedimentary-rock dominant terranes. The auriferous veins contain only a few percent sulphide minerals, have gold:silver ratios typically greater than 1:1, show a distinct association with medium grade metamorphic rocks, and may be associated with large-scale fault zone. Ore fluids are consistently of low salinity and are CO2-rich. In the early and middle Palaeozoic in the southern Pacific basin, a single immense turbidite sequence was added to the eastern margin of Gondwanaland. Deformation of these rocks in southeastern Australia was accompanied by deposition of at least 80 million oz of gold in the Victorian sector of the Lachlan fold belt mainly during the Middle and Late Devonian. Lesser Devonian gold accumulations characterized the more northerly parts of the Gondwanan margin within the Hodgkinson-Broken River and Thomson fold belts. Additional lodes were emplaced in this flyschoid sequence in Devonian or earlier Palaeozoic times in what is now the Buller Terrane, Westland, New Zealand. Minor post-Devonian growth of Gondwanaland included terrane collision and formation of gold-bearing veins in the Permian in Australia's New England fold belt and in the Jurassic-Early Cretaceous in New Zealand's Otago schists. Collision and accretion of dozens of terranes for a 100-m.y.-long period against the western margin of North America and eastern margin of Eurasia led to widespread, lattest Jurassic to Eocene gold veining in the northern Pacific basin. In the former location, Late Jurassic and Early Cretaceous veins and related placer deposits along the western margin of the Sierra Nevada

  12. Mercury Contamination from Historic Gold Mining in California

    USGS Publications Warehouse

    Alpers, Charles N.; Hunerlach, Michael P.

    2000-01-01

    Mercury contamination from historic gold mines represents a potential risk to human health and the environment. This fact sheet provides background information on the use of mercury in historic gold mining and processing operations in California, and describes a new USGS project that addresses the potential risks associated with mercury from these sources, with emphasis on historic hydraulic mining areas. Miners used mercury (quicksilver) to recover gold throughout the western United States at both placer (alluvial) and hardrock (lode) mines. The vast majority of mercury lost to the environment in California was from placer-goldmines, which used hydraulic, drift, and dredging methods. At hydraulic mines, placer ores were broken down with monitors (or water cannons, fig. 1) and the resulting slurry was directed throughsluices and drainage tunnels, where goldparticles combined with liquid mercury to form gold?mercury amalgam. Loss ofmercury in this process was 10 to 30 percent per season (Bowie, 1905), resulting in highly contaminated sediments at mine sites (fig. 2). Elevated mercury concentrations in present-day mine waters and sediments indicate thathundreds to thousands of pounds of mercury remain at each of the many sites affected by hydraulic mining. High mercury levels in fish, amphibians, and invertebrates downstream of the hydraulic mines are a consequence of historic mercury use. On the basis of USGS studies and other recent work, a better understanding is emerging of mercury distribution, ongoing transport, transformation processes, and the extent of biological uptake in areas affected by historic gold mining. This information will be useful to agencies responsible for prudent land and resource management and for protecting public health.

  13. Mining the Mother Lode.

    ERIC Educational Resources Information Center

    Avery, Robert K.

    1995-01-01

    Argues that communication as an academic discipline is at a critical point in its evolution, and the western region is poised to play a most influential role during the next few years. Challenges members of the Western States Communication Association to resist potential institutional assaults by leading the communication discipline in a…

  14. Epithermal and plutonic gold mineralizations related to paleoproterozoic acid magmatism in the Tapajós Gold province, Amazonian craton, Brazil

    NASA Astrophysics Data System (ADS)

    Juliani, C.; Corrêa-Silva, R. H.; Monteiro, L. V.; Bettencourt, J. S.; dall Agnol, R.

    2003-04-01

    The Tapajós Gold Province (TGP) is part of the Tapajós-Parima geologic province, that includes ˜2.1 Ga volcano-sedimentary sequences (Jacareacanga Group) and the magmatic arcs of the Cuiú-Cuiú Complex (˜2.01 Ga), Creporizäo Intrusive Suite (1.97-1.95 Ga), Rio das Tropas Tonalite (˜1.90 Ga) and Parauari Intrusive Suite (˜1.88 Ga). Andesitic to rhyolitic volcanic and volcaniclastic rocks of the Iriri Group (1.88 Ga) overlie plutonic rocks and are cut by anorogenic Maloquinha Intrusive Suite (˜1.87 Ga). Paleoproterozoic fluvial to marine sequences (Buiuçú Formation), and several mafic intrusion events are also identified in the TGP. Paleoproterozoic gold mineralizations in the TGP are mainly classified as mesothermal orogenic lodes, intrusion-related gold systems, and epithermal and mesothermal lodes in shear zones. Recently, it was discovered a 1.869 Ga epithermal high-sulfidation (quartz-alunite) and low-sulfidation (adularia-sericite) gold and base metal mineralizations hosted in calc-alkaline volcanic and volcaniclastic rocks of the Iriri Group. In the high-sulfidation mineralization, hydrothermal breccias are strongly affected by high-temperature advanced argillic alteration, with alunite, natroalunite, woodhouseiite-svanbergite, andalusite, diaspore and enargite, besides argillic and propylitic hydrothermal alterations. Over the hydrothermal breccia pipe occurs a hematite-rich silica cap and in the deeper zones sericitic alteration is also present. The epithermal high- and low-sulfidation mineralizations are geneticaly linked to stocks of hydrothermalized granophyry, and rhyolitic and rhyodacitic porphyry dikes and are hosted by late ring composite volcanoes, related to evolution of nested ash-flow caldera complexes. The caldera genesis is atributed to emplacement of shalow late- to post-tectonic calc-alkaline batholits of the Parauari Intrusive Suite in back-arc rifts. The mesozonal relatively reduced Batalha Granite hosts gold mineralizations and

  15. Absolute timing of sulfide and gold mineralization: A comparison of Re-Os molybdenite and Ar-Ar mica methods from the Tintina Gold Belt, Alaska

    USGS Publications Warehouse

    Selby, D.; Creaser, R.A.; Hart, C.J.R.; Rombach, C.S.; Thompson, J.F.H.; Smith, M.T.; Bakke, A.A.; Goldfarb, R.J.

    2002-01-01

    New Re-Os molybdenite dates from two lode gold deposits of the Tintina Gold Belt, Alaska, provide direct timing constraints for sulfide and gold mineralization. At Fort Knox, the Re-Os molybdenite date is identical to the U-Pb zircon age for the host intrusion, supporting an intrusive-related origin for the deposit. However, 40Ar/39Ar dates from hydrothermal and igneous mica are considerably younger. At the Pogo deposit, Re-Os molybdenite dates are also much older than 40Ar/39Ar dates from hydrothermal mica, but dissimilar to the age of local granites. These age relationships indicate that the Re-Os molybdenite method records the timing of sulfide and gold mineralization, whereas much younger 40Ar/39Ar dates are affected by post-ore thermal events, slow cooling, and/or systemic analytical effects. The results of this study complement a growing body of evidence to indicate that the Re-Os chronometer in molybdenite can be an accurate and robust tool for establishing timing relations in ore systems.

  16. Gold Coating

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Epner Technology Inc. responded to a need from Goddard Space Flight Center for the ultimate in electroplated reflectivity needed for the Mars Global Surveyor Mars Orbiter Laser Altimeter (MOLA). Made of beryllium, the MOLA mirror was coated by Epner Technology Laser Gold process, specially improved for the project. Improved Laser Gold- coated reflectors have found use in an epitaxial reactor built for a large semiconductor manufacturer as well as the waveguide in Braun-Thermoscan tympanic thermometer and lasing cavities in various surgical instruments.

  17. Gold Nanoantennas

    SciTech Connect

    2012-01-01

    An array of gold nanoantennas laced into an artificial membrane enhances the fluorescence intensity of three different molecules when they pass through plasmonic hot spots in the array. Watch for the blue, green and red flashes. The photobleaching at the end of each fluorescence event (white flashes) is indicative of single molecule observations.

  18. Biomineralization of gold: biofilms on bacterioform gold.

    PubMed

    Reith, Frank; Rogers, Stephen L; McPhail, D C; Webb, Daryl

    2006-07-14

    Bacterial biofilms are associated with secondary gold grains from two sites in Australia. 16S ribosomal DNA clones of the genus Ralstonia that bear 99% similarity to the bacterium Ralstonia metallidurans-shown to precipitate gold from aqueous gold(III) tetrachloride-were present on all DNA-positive gold grains but were not detected in the surrounding soils. These results provide evidence for the bacterial contribution to the authigenic formation of secondary bacterioform gold grains and nuggets.

  19. Is It Real Gold?

    ERIC Educational Resources Information Center

    Harris, Harold H.

    1999-01-01

    Features acid tests for determining whether jewelry is "real" gold or simply gold-plated. Describes the carat system of denoting gold content and explains how alloys are used to create various shades of gold jewelry. Addresses the question of whether gold jewelry can turn a wearer's skin green by considering various oxidation reactions.…

  20. Orogenesis, high-T thermal events, and gold vein formation within metamorphic rocks of the Alaskan Cordillera

    USGS Publications Warehouse

    Goldfarb, R.J.; Snee, L.W.; Pickthorn, W.J.

    1993-01-01

    Mesothermal, gold-bearing quartz veins are widespread within allochthonous terranes of Alaska that are composed dominantly of greenschist-facies metasedimentary rocks. The most productive lode deposits are concentrated in south-central and southeastern Alaska; small and generally nonproductive gold-bearing veins occur upstream from major placer deposits in interior and northern Alaska. Ore-forming fluids in all areas are consistent with derivation from metamorphic devolatilisation reactions, and a close temporal relationship exists between high-T tectonic deformation, igneous activity, and gold mineralization. Ore fluids were of consistently low salinity, CO2-rich, and had ??18O values of 7 ???-12??? and ??D values between -15??? and -35???. Upper-crustal temperatures within the metamorphosed terranes reached at least 450-500??C before onset of significant gold-forming hydrothermal activity. In southern Alaska, gold deposits formed during latter stages of Tertiary, subduction-related, collisional orogenesis and were often temporally coeval with calc-alkaline magmatism. -from Authors

  1. Gold deposits of the northern margin of the North China craton: Multiple late Paleozoic-Mesozoic mineralizing events

    USGS Publications Warehouse

    Hart, C.J.R.; Goldfarb, R.J.; Qiu, Y.; Snee, L.; Miller, L.D.; Miller, M.L.

    2002-01-01

    The northern margin of the North China craton is well-endowed with lode gold deposits hosting a resource of approximately 900 tonnes (t) of gold. The ???1,500-km-long region is characterized by east-trending blocks of metamorphosed Archean and Proterozoic strata that were episodically uplifted during Variscan, Indosinian, and Yanshanian deformational and magmatic events. At least 12 gold deposits from the Daqinshan, Yan-Liao (includes the Zhangjiakou, Yanshan, and Chifeng gold districts), and Changbaishan gold provinces contain resources of 20-100 t Au each. Most deposits are hosted in uplifted blocks of Precambrian metamorphic rocks, although felsic Paleozoic and Mesozoic plutons are typically proximal and host ???30% of the deposits. The lodes are characterized by sulfide-poor quartz veins in brittle structures with low base metal values and high Au:Ag ratios. Although phyllic alteration is most common, intensive alkali feldspar metasomatism characterizes the Wulashan, Dongping, and Zhongshangou deposits, but is apparently coeval with Variscan alkalic magmatism only at Wulashan. Stepwise 40Ar-39Ar geochronology on 16 samples from gangue and alteration phases, combined with unpublished SHRIMP U-Pb dates on associated granitoids, suggest that gold mineralizing events occured during Variscan, Indosinian, and Yanshanian orogenies at circa 350, 250, 200, 180, 150, and 129 Ma. However, widespread Permo-Triassic (???250 Ma) and Early Jurassic (???180 Ma) thermal events caused variable resetting of most of the white mica and K-feldspar argon spectra, as well as previously reported K-Ar determinations. Compiled and new stable isotope and fluid inclusion data show that most ??18O values for ore-stage veins range from 8 to 14???, indicating a fluid in equilibrium with the Precambrian metamorphic basement rocks; ??D values from fluid inclysions range widely from -64 to -154???, which is indicative of a local meteoric component in some veins; and highly variable ??34S data

  2. Iron isotope constraints on the mineralization processes of the Sandaowanzi telluride gold deposit, NE China

    NASA Astrophysics Data System (ADS)

    Li, Xingxing; Liu, Junlai; Lu, Di; Ren, Shunli; Liu, Zhengyang

    2016-04-01

    Iron isotopes have been widely applied to interpret the fluid evolution, supergene alteration and the metallogenic material sources of the hydrothermal deposit. It may also have significant potentials on the research of the deposit. The Sandaowanzi telluride gold deposit, located in the Great Hinggan Range metallogenic Belt in NE China, is a large epithermal gold deposit of low-sulphidation type. It has a total reserve of ≥25t of Au and an average of 15 g/t. Gold-bearing quartz veins or gold lodes strike to the NW and dip 50-80°northeastward. Ore bodies, including low-grade ores along margins and high-grade ores in the central parts, principally occur in quartz veins. More than the 95 percent Au budgets are hosted in gold-silver tellurides. A six-stage paragenetic sequence of mineralization is revealed according to the compositions and microstructures of the mineral assemblages. Although sulfide minerals in the bonanza quartz veins are rare, pyrite are widespread in quartz veins and altered host rocks. Meanwhile there are always chalcopyrite veins within bonanza quartz veins. Pyrite Fe isotope compositions from different levels (from +50m to +210m) of the main ore body of the Sandaowanzi gold ore deposit are investigated. There is an overall variation in δ57Fe values from -0.09 to +0.99 (av. 0.33). Among them, twenty three samples from different mining levels give positiveδ57Fe values, with the maximum positive value at the economic bonanza ores (level +130m). Four samples, however, possess negative values, one at level 170m, one at level 130m, and two at level 50m, respectively. The two negative values from the levels 170m and 130m are near the cores of the high grade ore body. The two negative values from the level 50m occur at one end of the lode ore body. The above data set shows that the δ57Fe values are not homogeneous at different levels of the ore body. On the other hand, a general trend for the positive values is that the highest δ57Fe value is

  3. Metamorphism and gold mineralization in the Blue Ridge, Southernmost Appalachians

    USGS Publications Warehouse

    Stowell, H.H.; Lesher, C.M.; Green, N.L.; Sha, P.; Guthrie, G.M.; Sinha, A.K.

    1996-01-01

    Lode gold mineralization in the Blue Ridge of the southernmost Appalachians is hosted by metavolcanic rocks (e.g., Anna Howe mine, AL; Royal Vindicator mine, GA), metaplutonic rocks (e.g., Hog Mountain mine, AL), and metasedimentary rocks (e.g., Lowe, Tallapoosa, and Jones Vein mines, AL). Most gold occurs in synkinematic quartz ?? plagioclase ?? pyrite ?? pyrrhotite ?? chlorite veins localized along polydeformational faults that juxtapose rocks with significantly different peak metamorphic mineral assemblages. Mineralogy, chemistry, and O and H isotope studies suggest that the three types of host rocks have undergone differing amounts and types of alteration during mineralization. Limited wall-rock alteration in metavolcanic- and metasediment-hosted deposits, and relatively extensive wall-rock alteration in granitoid-hosted deposits, suggests that most deposits formed from fluids that were close to equilibrium with metavolcanic and metasedimentary rocks. Stable isotope compositions of the fluids calculated from vein minerals and vein selvages are consistent with a predominantly metasedimentary fluid source, but vary from deposit to deposit (-22 to -47??? ??D, 4-5??? ??18O, and 5-7??? ??34S at Anna Howe and Royal Vindicator; -48 to -50??? ??D, 9-13??? ??18O, and ca. 19??? ??34S at Lowe and Jones Vein; and -22 to -23??? ??D, 8-11??? ??18O, 9-10??? ??34S, and -6 ??13C at Hog Mountain). Silicate mineral thermobarometry of vein, vein selvage, and wall-rock mineral assemblages indicate that mineralization and regional metamorphism occured at greenschist to amphibolite facies (480?? ?? 75??C at Anna Howe, 535?? ?? 50??C at 6.4 ?? 1 kbars at Lowe, 530?? ?? 50??C at 6.9 ?? 1 kbars at Tallapoosa, and 460?? ?? 50??C at 5.5 ?? 1 kbars at Hog Mountain). Oxygen isotope fractionation between vein minerals and selvage minerals consistently records equilibration temperatures that are similar to or slightly lower than those estimated from silicate thermometry. Auriferous veins

  4. Geology, distribution, and classification of gold deposits in the western Qinling belt, central China

    USGS Publications Warehouse

    Mao, J.; Qiu, Y.; Goldfarb, R.J.; Zhang, Z.; Garwin, S.; Fengshou, R.

    2002-01-01

    Gold deposits of the western Qinling belt occur within the western part of the Qinling-Dabie-Sulu orogen, which is located between the Precambrian North China and Yangtze cratons and east of the Songpan-Ganzi basin. The early Paleozoic to early Mesozoic orogen can be divided into northern, central, and southern zones, separated by the Shangdan and Lixian-Shanyang thrust fault systems. The northern zone consists of an early Paleozoic arc accreted to the North China craton by ca. 450 Ma. The central zone, which contains numerous orogenic gold deposits, is dominated by clastic rocks formed in a late Paleozoic basin between the converging cratonic blocks. The southern zone is characterized by the easternmost exposure of Triassic sedimentary rocks of the Songpan-Ganzi basin. These Early to Late Triassic turbidities, in part calcareous, of the immense Songpan-Ganzi basin also border the western Qinling belt to the west. Carlinlike gold deposits are abundant (1) along a westward extension of the southern zone defined by a window of early Paleozoic clastic rocks extending into the basin, and (2) within the easternmost margin of the basinal rocks to the south of the extension, and in adjacent cover rocks of the Yangtze craton. Triassic and Early Jurassic synkinematic granitoids are widespread across the western Qinling belt, as well as in the Songpan-Ganzi basin. Orogenic lode gold deposits along brittle-ductile shear zones occur within greenschist-facies, highly deformed, Devonian and younger clastic rocks of the central zone. Mainly coarse-grained gold, along with pyrite, pyrrhotite, arsenopyrite, and minor base metal sulfides, occur in networks of quartz veinlets, brecciated wall rock, and are dissminated in altered wall rock. Isotopic dates suggest that the deposits formed during the Late Triassic to Middle Jurassic as the leading edge of the Yangtze craton was thrust beneath rocks of the western Qinling belt. Many gold-bearing placers are distributed along the river

  5. Microchemical signature of alluvial gold from two contrasting terrains in Cameroon

    NASA Astrophysics Data System (ADS)

    Omang, B. O.; Suh, C. E.; Lehmann, B.; Vishiti, A.; Chombong, N. N.; Fon, A. N.; Egbe, J. A.; Shemang, E. M.

    2015-12-01

    The microchemical signature of alluvial gold particles has wide application in constraining their primary sources. In this study, we apply this concept to investigate the composition of gold-bearing alloys from alluvial samples draining two geologically distinct terrains in southern and eastern Cameroon where the search for primary gold has remained elusive. The first set of gold grains (Lom grains) are from the Lom river drainage system with predominantly metasedimentary Pan-African rocks in the catchment region while the second set of grains (Nyong grains) are from the Mbal and Ebap tributaries of the Nyong river draining over a Paleoproterozoic complex comprising metamorphosed ultramafic rocks, amphibolites and granulitic gneisses. The gold grains recovered from these fluvial networks after panning were first studied under an electron microscope in order to evaluate their morphological features and subsequently embedded in epoxy resin, polished, and their compositions determined by both electron microprobe (EMPA) and laser ablation (LA-ICP-MS) techniques. The Lom grains are irregular to sub rounded with extensively pitted surfaces while the Nyong grains are predominantly rounded, oblong and with smooth surfaces. Nyong grains are devoid of inclusions while galena and pyrite are entombed in the Lom grains. Both set of grains are essentially Au-Ag alloys although the Ag content of the cores of the Nyong grains from both EMPA and LA-ICP-MS analytical techniques are significantly lower (0.05-6.07 wt% Ag; 93.54-99.29 wt% Au) than for Lom gold (0.06-22.75 wt% Ag; 78.76-99.86 wt% Au). X-ray element distribution maps do not show any zonal variation in core composition suggesting the gold grains derived from lode sources with single episode of hydrothermal gold deposition. Also the Nyong grains have significant amounts of Pt, Pd and Cr suggesting a link with ultramafic rocks while the Lom grains have substantial Sb and Zn levels pointing to hydrothermal quartz veining as

  6. Orogenic-type copper-gold-arsenic-(bismuth) mineralization at Flatschach (Eastern Alps), Austria

    NASA Astrophysics Data System (ADS)

    Raith, Johann G.; Leitner, Thomas; Paar, Werner H.

    2015-10-01

    high Hg content (up to 11 mass %). The Cu-Au deposits in the Flatschach area show similarities with meso- to epizonal orogenic lode gold deposits regarding the geological setting, the structural control of mineralization, the type of alteration, the early (stage 1) sulfide assemblage and composition of gold. Unique about the Flatschach district is the lower-temperature overprint of copper arsenides (domeykite and koutekite) and copper sulfides (djurleite, yarrowite/spionkopite) on earlier formed sulfide mineralization. Based on mineralogical considerations temperature of stage 2 mineralization was between about 70 °C and 160 °C. Gold was locally mobilized during this low-temperature hydrothermal overprint as well as during stage 3 supergene oxidation and cementation processes.

  7. Gold distribution in As-deficient pyrite and telluride mineralogy of the Yangzhaiyu gold deposit, Xiaoqinling district, southern North China craton

    NASA Astrophysics Data System (ADS)

    Bi, Shi-Jian; Li, Jian-Wei; Zhou, Mei-Fu; Li, Zhan-Ke

    2011-12-01

    The Mesozoic Yangzhaiyu lode gold deposit is situated in the southern edge of the North China craton. Gold mineralization is hosted in Archean amphibolite facies metamorphic rocks, and consists mainly of auriferous quartz veins. Pyrite is the predominant sulfide mineral, with minor amounts of chalcopyrite, sphalerite, and galena. Based on morphology and paragenesis, there are three generations of pyrite, termed as first generation (G1), second generation (G2), and third generation (G3). They have distinct contents, occurrences, and distribution patterns of gold. The coarse-grained, euhedral G1 pyrite contains negligible to low levels of gold, whereas both invisible and visible gold are present in the fine- to medium-grained G2 pyrite that is characterized by abundance of microfractures and porosities, forming a foam-like texture. Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) depth profiles indicate that invisible gold occurs either as solid solution or as nanoparticles of gold-bearing tellurides in the G2 pyrite. Visible gold is widespread and present as irregular grains and stringers of native gold mostly along grain boundaries or filling microfractures of pyrite, likely resulting from remobilization of invisible gold once locked in the G2 pyrite. The G3 pyrite, invariably intergrown with chalcopyrite, sphalerite, and galena, contains the highest levels of invisible gold. There is a positive correlation between Au, Ag, and Te, indicating that gold occurs as submicroscopic Au-bearing telluride inclusions in the host minerals. Whenever gold, either invisible or visible, is present, As is always below or only marginally higher than the detection limit of LA-ICP-MS. This indicates that As played an insignificant role in gold mineralization. Tellurides are widespread in the auriferous quartz veins, consisting mainly of petzite, calaverite, hessite, altaite, and tellurobismuthite. Native gold commonly occurs as intergrowths with tellurides

  8. Primary distribution of silver and copper in native gold from six deposits in the Western United States

    USGS Publications Warehouse

    Desborough, G.A.; Heidel, R.H.; Raymond, W.H.; Tripp, J.

    1971-01-01

    Electron-microprobe analyses and mineragraphic studies of native gold demonstrate considerable variations in the primary intergrain and intragrain distribution of silver. The gold grains have from 1-55 weight percent silver; copper is present in grains from only one locality and ranges from 0.1-0.6 weight percent. Some gold grains have strong zoning of silver whereas others have no detectable zoning. Gold grains from some deposits show remarkable intergrain homogeneity of silver and/or copper content, but others exhibit extreme heterogeneity. We believe that the inhomogeneities and variations in silver content recognized and emphasized here are features of primary deposition. We also recognize low-silver rims with sharp boundaries bordering many of the grains examined but believe these are developed in a relatively oxidizing, low-temperature environment and are not primary lode features. Opaque mineral inclusions of primary origin in gold grains are common in some deposits, scarce in many, and virtually absent from others. These inclusions may be of value in characterizing some gold deposits. For the majority of gold crystals from Copper Basin, Arizona, the lowest silver content observed was in the central portion of each grain and the highest silver content was in the rim. This is believed to be due an increase in the proportion of silver to gold in solution during growth of the crystals. Analysis of sized fractions of 331 gold grains from Pennsylvania Mountain, Colorado, shows no systematic correlation of grain size with silver content. Electron microprobe step-scanning of gold from Alder Gulch, Montana, suggests more than one mineralization event took place. Pyrite and acanthite inclusions less than 0.05 mm in the largest dimension, are present in some grains from this deposit. Inclusions of pyrite, pyrrhotite, chalcopyrite, and an isotropic Co-As-S mineral are present in the low-silver, copper-bearing gold from Ninemile Creek, Montana. The presence of copper

  9. Metal and fluid sources in a potential world-class gold deposit: El-Sid mine, Egypt

    NASA Astrophysics Data System (ADS)

    Helmy, Hassan; Zoheir, Basem

    2015-04-01

    Lode gold mineralization at the El-Sid mine area is associated with the ca. 600 Ma Fawakhir granite intrusion, which cuts the ~737 Ma ophiolite nappes in the Central Eastern Desert of Egypt. The mineralized quartz veins are hosted by ~E- and NE-trending fault/fracture sets cutting the western boundary of the intrusion and sheared ophiolites. The results of electron microprobe analyses of gold-associated hydrothermal sulfide and silicate minerals suggest that Au was mobilized alongside Ni, Co, Cr and As from the adjacent ophiolitic serpentinite. After granite emplacement, hydrothermal fluids interacted with the sheared serpentinite, leaching metals and re-depositing them in the faults/fractures and adjacent wall rock in a cyclic process. Low-salinity aqueous-carbonic fluids with significant quantities of volatile species (CO2, CH4, and N2 ± H2S) leached and transported Au from deep to shallow crustal levels. Carbon dioxide had a buffering effect on the Au-bearing hydrothermal solution, maintaining its pH within a narrow near-neutral range, where elevated gold concentration was transported by complexation with reduced magmatic sulfur in a reducing environment. Gold deposition along fault/fracture conduits in the Fawakhir granite and adjacent serpentinite resulted from interplay of pressure drop, fluctuations in oxygen and sulfur fugacities, and exsolution of the volatile phases. Infiltration of meteoric water may have contributed to the formation of the late stage gold-sulfide mineralization that formed at shallower levels during terrane uplift. Sulfidation of the Fe-rich magmatic minerals was, on the other hand, the overriding process in the wall rock as evidenced by abundant disseminated sulfides with gold inclusions. Considering the structural control by regional shear zones (fluid conduits) and the voluminous granitic and ophiolitic rocks (metal sources), a high tonnage gold deposit amenable to open pit mining at the El-Sid mine area is very likely.

  10. Magmatic-vapor expansion and the formation of high-sulfidation gold deposits: Chemical controls on alteration and mineralization

    USGS Publications Warehouse

    Henley, R.W.; Berger, B.R.

    2011-01-01

    Large bulk-tonnage high-sulfidation gold deposits, such as Yanacocha, Peru, are the surface expression of structurally-controlled lode gold deposits, such as El Indio, Chile. Both formed in active andesite-dacite volcanic terranes. Fluid inclusion, stable isotope and geologic data show that lode deposits formed within 1500. m of the paleo-surface as a consequence of the expansion of low-salinity, low-density magmatic vapor with very limited, if any, groundwater mixing. They are characterized by an initial 'Sulfate' Stage of advanced argillic wallrock alteration ?? alunite commonly with intense silicification followed by a 'Sulfide' Stage - a succession of discrete sulfide-sulfosalt veins that may be ore grade in gold and silver. Fluid inclusions in quartz formed during wallrock alteration have homogenization temperatures between 100 and over 500 ??C and preserve a record of a vapor-rich environment. Recent data for El Indio and similar deposits show that at the commencement of the Sulfide Stage, 'condensation' of Cu-As-S sulfosalt melts with trace concentrations of Sb, Te, Bi, Ag and Au occurred at > 600 ??C following pyrite deposition. Euhedral quartz crystals were simultaneously deposited from the vapor phase during crystallization of the vapor-saturated melt occurs to Fe-tennantite with progressive non-equilibrium fractionation of heavy metals between melt-vapor and solid. Vugs containing a range of sulfides, sulfosalts and gold record the changing composition of the vapor. Published fluid inclusion and mineralogical data are reviewed in the context of geological relationships to establish boundary conditions through which to trace the expansion of magmatic vapor from source to surface and consequent alteration and mineralization. Initially heat loss from the vapor is high resulting in the formation of acid condensate permeating through the wallrock. This Sulfate Stage alteration effectively isolates the expansion of magmatic vapor in subsurface fracture arrays

  11. Fluid inclusions in quartz-pebbles of the gold-bearing Tarkwaian conglomerates of Ghana as guides to their provenance area

    NASA Astrophysics Data System (ADS)

    Klemd, R.; Hirdes, W.; Olesch, M.; Oberthür, T.

    1993-11-01

    Quartz-pebbles of the early Proterozoic Au-bearing Tarkwaian conglomerates in Ghana reveal several original (inherited) pre-sedimentary fluid inclusions. These inclusions are CO2-N2 rich and display a distinct high density (up to 1.15 g/cm3). The unusual high density and composition compare well with CO2-N2-rich inclusions in quartz-vein type gold deposits of the Birimian Supergroup in Ghana and Burkina Faso. This type of fluid inclusions has not been reported from any other lode-gold deposit of greenstone affiliation and is thus a specific characteristic for Birimian-hosted gold deposits. Therefore, it can be used as an unequivocal pathfinder for epigenetic as well as for syn-sedimentary gold mineralization of the early Proterozoic of West Africa. The inherited fluid inclusions with the unique physicochemical characteristics suggest that the Tarkwaian quartz-pebbles and possibly some gold were derived from Au-quartz vein deposits comparable in mineralogy, petrography and genesis to those along the NW-margin of the Ashanti belt (e.g. Ashanti Mine, Prestea Mine).

  12. Geology of the Mother Load gold belt and adjacent foothills metamorphic belt, California

    SciTech Connect

    Landefeld, L.A.

    1985-01-01

    The late Jurassic Mother Lode gold-quartz vein system south of the Consumnes River is hosted by portions of 1) a submarine volcanic arc and overlying epiclastic basin, and 2) the ultramafic-mafic plutonic subarc basement. During accretion to the Paleozoic shelf of western North America, the subarc basement tectonically intruded the disrupted arc basin, incorporating hanging wall lithologies to produce the tectonic melange of the Melones fault zone (MFZ). Late orogenic dikes intrude the margins of the MFZ and adjacent wall rocks. These dikes were altered during the gold-quartz vein formation. The proximal to medial volcanic strata are, from oldest to youngest: 1) island arc tholeiitic pillow basalts, 2) a thin radiolarian chert bed grading into 3) a submarine volcaniclastic sequence, and 4) sporadically distributed flows of calc-alkaline basalt through boninite. Cessation of volcanic activity is marked by the deposition of an organic carbon-rich epiclastic sequence. The intensely folded strata in JT rocks east of the MFZ may be basinward lateral equivalents of the JT strata west of the MFZ. Differences in style of deformation and metamorphic rank in the strata are typical of vertical and lateral variations in basins where one part is passive and another part is tectonically active as the basin closes.

  13. Gold deposits and occurrences of the Greater Caucasus, Georgia Republic: Their genesis and prospecting criteria

    USGS Publications Warehouse

    Kekelia, S.A.; Kekelia, M.A.; Kuloshvili, S.I.; Sadradze, N.G.; Gagnidze, N.E.; Yaroshevich, V.Z.; Asatiani, G.G.; Doebrich, J.L.; Goldfarb, R.J.; Marsh, E.E.

    2008-01-01

    trapping pressures of 0.2 to 0.5??kbar. Ore-forming fluids, with approximately 5 to 20??mol% non-aqueous gas, evolved from N2-dominant to CO2-dominant during evolution of the hydrothermal system. ??34S values of + 1 to + 4??? for ore-related sulfides at Zopkhito are consistent with a sedimentary rock source for the sulfur, and ??18O quartz measurements of 16 to 21??? are consistent with either a magmatic or metamorphic fluid. More than 60 gold-bearing lodes and placers in the Svaneti district occur along the thrust between the Southern Slope and Main Zones. Lode gold potential was first recognized in the historic placer district in the 1980s, with many auriferous quartz veins cutting Middle Jurassic igneous rocks. Brecciated veins in the 18??t Au Lukhra deposit cut a small granodioritic to dioritic stock; the latter intrudes Devonian schist immediately north of the thrust. Presently, there are three recognized ore zones in the deposit, with the most significant occurring over an area 140??m in length and 12??m-wide, with typical grades of 7 to 9??g/t Au. Reconnaissance fluid-inclusion studies of ore samples from the Lukhra deposit indicate minimum trapping temperatures of 220????C. Measurements of ??18Oquartz of about 10??? suggest buffering of isotopic composition by the igneous host rocks.

  14. Recent U.S. Geological Survey Studies in the Tintina Gold Province, Alaska, United States, and Yukon, Canada-Results of a 5-Year Project

    USGS Publications Warehouse

    Gough, Larry P.; Day, Warren C.

    2010-01-01

    This report presents summary papers of work conducted between 2002 and 2007 under a 5-year project effort funded by the U.S. Geological Survey Mineral Resources Program, formerly entitled 'Tintina Metallogenic Province: Integrated Studies on Geologic Framework, Mineral Resources, and Environmental Signatures.' As the project progressed, the informal title changed from 'Tintina Metallogenic Province' project to 'Tintina Gold Province' project, the latter being more closely aligned with the terminology used by the mineral industry. As Goldfarb and others explain in the first chapter of this report, the Tintina Gold Province is a convenient term used by the mineral exploration community for a 'region of very varied geology, gold deposit types, and resource potential'. The Tintina Gold Province encompasses roughly 150,000 square kilometers, bounded by the Kaltag-Tintina fault system on the north and the Farewell-Denali fault system on the south. It extends westward in a broad arc, some 200 km wide, from northernmost British Columbia, through the Yukon, through southeastern and central Alaska, to southwestern Alaska. The climate is subarctic and, in Alaska, includes major physiographic delineations and ecoregions such as the Yukon-Tanana Upland, Tanana-Kuskokwim Lowlands, Yukon River Lowlands, and the Kuskokwim Mountains. Although the Tintina Gold Province is historically important for some of the very first placer and lode gold discoveries in northern North America, it has recently seen resurgence in mineral exploration, development, and mining activity. This resurgence is due to both new discoveries (for example, Pogo and Donlin Creek) and to the application of modern extraction methods to previously known, but economically restrictive, low-grade, bulk-tonnage gold resources (for example, Fort Knox, Clear Creek, and Scheelite Dome). In addition, the Tintina Gold Province hosts numerous other mineral deposit types, possessing both high and low sulfide content, which

  15. Geology and geochemistry of the shear-hosted Julie gold deposit, NW Ghana

    NASA Astrophysics Data System (ADS)

    Amponsah, Prince Ofori; Salvi, Stefano; Béziat, Didier; Siebenaller, Luc; Baratoux, Lenka; Jessell, Mark W.

    2015-12-01

    The Leo Man Craton in West Africa is host to numerous economic gold deposits. If some regions, such as the SW of Ghana, are well known for world-class mineralizations and have been extensively studied, gold occurrences elsewhere in the craton have been discovered only in the last half a century or so, and very little is known about them. The Julie gold deposit, located in the Paleoproterozoic Birimian terrane of NW Ghana, is one such case. This deposit is hosted in a series of granitoid intrusives of TTG composition, and consists of a network of deformed, boudinaged quartz lodes (A-type veins) contained within an early DJ1 E-W trending shear zone with dextral characteristics. A conjugate set of veins (C-type) perpendicular to the A-type veins contains low grade mineralization. The main ore zone defines a lenticular corridor about 20-50 m in width and about 3.5 km along strike, trending E-W and dipping between 30 and 60°N. The corridor is strongly altered, by an assemblage of sericite + quartz + ankerite + calcite + tourmaline + pyrite. This is surrounded by a second alteration assemblage, consisting of albite + sericite + calcite + chlorite + pyrite + rutile, which marks a lateral alteration that fades into the unaltered rock. Mass balance calculations show that during alteration overall mass was conserved and elemental transfer is generally consistent with sulfidation, sericitization and carbonatization of the host TTG. Gold is closely associated with pyrite, which occurs as disseminated grains in the veins and in the host rock, within the mineralized corridor. SEM imagery and LA-ICP-MS analyses of pyrites indicate that in A-type veins gold is associated with bismuth, tellurium, lead and silver, while in C-type veins it is mostly associated with silver. Pyrites in A-type veins contain gold as inclusions and as free gold on its edges and fractures, while pyrites from C-type veins contains mostly free gold. Primary and pseudosecondary fluid inclusions from both

  16. GOLD PLATING PROCESS

    DOEpatents

    Seegmiller, R.

    1957-08-01

    An improved bath is reported for plating gold on other metals. The composition of the plating bath is as follows: Gold cyanide from about 15 to about 50 grams, potassium cyanide from about 70 to about 125 grams, and sulfonated castor oil from about 0.1 to about 10 cc. The gold plate produced from this bath is smooth, semi-hard, and nonporous.

  17. New constraints on fluid sources in orogenic gold deposits, Victoria, Australia

    NASA Astrophysics Data System (ADS)

    Fu, Bin; Kendrick, Mark A.; Fairmaid, Alison M.; Phillips, David; Wilson, Christopher J. L.; Mernagh, Terrence P.

    2012-03-01

    Fluid inclusion microthermometry, Raman spectroscopy and noble gas plus halogen geochemistry, complemented by published stable isotope data, have been used to assess the origin of gold-rich fluids in the Lachlan Fold Belt of central Victoria, south-eastern Australia. Victorian gold deposits vary from large turbidite-hosted `orogenic' lode and disseminated-stockwork gold-only deposits, formed close to the metamorphic peak, to smaller polymetallic gold deposits, temporally associated with later post-orogenic granite intrusions. Despite the differences in relative timing, metal association and the size of these deposits, fluid inclusion microthermometry indicates that all deposits are genetically associated with similar low-salinity aqueous, CO2-bearing fluids. The majority of these fluid inclusions also have similar 40Ar/36Ar values of less than 1500 and 36Ar concentrations of 2.6-58 ppb (by mass) that are equal to or much greater than air-saturation levels (1.3-2.7 ppb). Limited amounts of nitrogen-rich fluids are present at a local scale and have the highest measured 40Ar/36Ar values of up to 5,700, suggesting an external or distinct source compared to the aqueous fluids. The predominance of low-salinity aqueous-carbonic fluids with low 40Ar/36Ar values, in both `orogenic' and `intrusion-related' gold deposits, is attributed to fluid production from common basement volcano-sedimentary sequences and fluid interaction with sedimentary cover rocks (turbidites). Aqueous fluid inclusions in the Stawell-Magdala deposit of western Victoria (including those associated with N2) preserve mantle-like Br/Cl and I/Cl values. In contrast, fluid inclusions in deposits in the eastern structural zones, which contain more abundant shales, have elevated molar I/Cl ratios with maximum values of 5,170 × 10-6 in the Melbourne Zone. Br/I ratios in this zone range from 0.5 to 3.0 that are characteristic of fluid interaction with organic-rich sediments. The maximum I/Cl and characteristic

  18. Assessment method for epithermal gold deposits in Northeast Washington State using weights-of-evidence GIS modeling

    USGS Publications Warehouse

    Boleneus, D.E.; Raines, G.L.; Causey, J.D.; Bookstrom, A.A.; Frost, T.P.; Hyndman, P.C.

    2001-01-01

    contrast values calculated for themes according to areal correlation with the training sites. Predictor themes having acceptable weights and contrast values are combined into a preliminary model to predict the locations of undiscovered epithermal gold deposits. This model facilitates ranking of tracts as non-permissive, permissive or favorable categories based on exclusionary, passive, and active criteria through evaluation of probabilistic data provided by interaction of predictor themes. The method is very similar to the visual inspection method of drawing conclusions from anomalies on a manually overlain system of maps. This method serves as a model for future mineral assessment procedures because of its objective nature. To develop a model to predict future exploration activity, the locations of lode mining claims were summarized for 1980, 1985, 1990, and 1996. Land parcels containing historic claims were identified either as those with mining claims present in 1980 or valid claims present in 1985. Current claim parcels were identified as those containing valid lode claims in either 1990 or 1996. A consistent parcel contains both historic and current claims. The epithermal gold and mining claim activity models were combined into an assessment (or mineral resource-activity) model to assist in land use decisions by providing a prediction of mineral exploration activity on federal land in the next decade. Ranks in the assessment model are: (1) no activity, (2) low activity, (3) low to moderate activity, (4) moderate activity and (5) high activity.

  19. Paleozoic-early Mesozoic gold deposits of the Xinjiang Autonomous Region, northwestern China

    USGS Publications Warehouse

    Rui, Z.; Goldfarb, R.J.; Qiu, Y.; Zhou, T.; Chen, R.; Pirajno, F.; Yun, G.

    2002-01-01

    The late Paleozoic-early Mesozoic tectonic evolution of Xinjiang Autonomous Region, northwestern China provided a favorable geological setting for the formation of lode gold deposits along the sutures between a number of the major Eastern Asia cratonic blocks. These sutures are now represented by the Altay Shan, Tian Shan, and Kunlun Shan ranges, with the former two separated by the Junggar basin and the latter two by the immense Tarim basin. In northernmost Xinjiang, final growth of the Altaid orogen, southward from the Angara craton, is now recorded in the remote mid- to late Paleozoic Altay Shan. Accreted Early to Middle Devonian oceanic rock sequences contain typically small, precious-metal bearing Fe-Cu-Zn VMS deposits (e.g. Ashele). Orogenic gold deposits are widespread along the major Irtysh (e.g. Duyolanasayi, Saidi, Taerde, Kabenbulake, Akexike, Shaerbulake) and Tuergen-Hongshanzui (e.g. Hongshanzui) fault systems, as well as in structurally displaced terrane slivers of the western Junggar (e.g. Hatu) and eastern Junggar areas. Geological and geochronological constraints indicate a generally Late Carboniferous to Early Permian episode of gold deposition, which was coeval with the final stages of Altaid magmatism and large-scale, right-lateral translation along older terrane-bounding faults. The Tian Shan, an exceptionally gold-rich mountain range to the west in the Central Asian republics, is only beginning to be recognized for its gold potential in Xinjiang. In this easternmost part to the range, northerly- and southerly-directed subduction/accretion of early to mid-Paleozoic and mid- to late Paleozoic oceanic terranes, respectively, to the Precambrian Yili block (central Tian Shan) was associated with 400 to 250 Ma arc magmatism and Carboniferous through Early Permian gold-forming hydrothermal events. The more significant resulting deposits in the terranes of the southern Tian Shan include the Sawayaerdun orogenic deposit along the Kyrgyzstan border and

  20. Chalcogenide centred gold complexes.

    PubMed

    Gimeno, M Concepción; Laguna, Antonio

    2008-09-01

    Chalcogenide-centred gold complexes are an important class of compounds in which a central chalcogen is surrounded by several gold atoms or gold and other metals. They have special characteristics such as unusual geometries, electron deficiency and properties such as luminescence or non-linear optical properties. The best known species are the trinuclear [E(AuPR3)3]+, 'oxonium' type species, that have high synthetic applicability, not only in other chalcogen-centred species, but in many other organometallic derivatives. The aurophilic interactions play an important role in the stability, preference for a particular geometry and luminescence properties in this type of derivatives (critical review, 117 references).

  1. Gold nanoprobes for theranostics

    PubMed Central

    Panchapakesan, Balaji; Book-Newell, Brittany; Sethu, Palaniappan; Rao, Madhusudhana; Irudayaraj, Joseph

    2011-01-01

    Gold nanoprobes have become attractive diagnostic and therapeutic agents in medicine and life sciences research owing to their reproducible synthesis with atomic level precision, unique physical and chemical properties, versatility of their morphologies, flexibility in functionalization, ease of targeting, efficiency in drug delivery and opportunities for multimodal therapy. This review highlights some of the recent advances and the potential for gold nanoprobes in theranostics. PMID:22122586

  2. Gold-bearing skarns

    USGS Publications Warehouse

    Theodore, Ted G.; Orris, Greta J.; Hammerstrom, Jane M.; Bliss, James D.

    1991-01-01

    In recent years, a significant proportion of the mining industry's interest has been centered on discovery of gold deposits; this includes discovery of additional deposits where gold occurs in skarn, such as at Fortitude, Nevada, and at Red Dome, Australia. Under the classification of Au-bearing skarns, we have modeled these and similar gold-rich deposits that have a gold grade of at least 1 g/t and exhibit distinctive skarn mineralogy. Two subtypes, Au-skarns and byproduct Au-skarns, can be recognized on the basis of gold, silver, and base-metal grades, although many other geological factors apparently are still undistinguishable largely because of a lack of detailed studies of the Au-skarns. Median grades and tonnage for 40 Au-skarn deposits are 8.6 g/t Au, 5.0 g/t Ag, and 213,000 t. Median grades and tonnage for 50 byproduct and Au-skarn deposits are 3.7 g/t Au, 37 g/t Ag, and 330,000 t. Gold-bearing skarns are generally calcic exoskarns associated with intense retrograde hydrosilicate alteration. These skarns may contain economic amounts of numerous other commodities (Cu, Fe, Pb, Zn, As, Bi, W, Sb, Co, Cd, and S) as well as gold and silver. Most Au-bearing skarns are found in Paleozoic and Cenozoic orogenic-belt and island-arc settings and are associated with felsic to intermediate intrusive rocks of Paleozoic to Tertiary age. Native gold, electru, pyrite, pyrrhotite, chalcopyrite, arsenopyrite, sphalerite, galena, bismuth minerals, and magnetite or hematite are the most common opaque minerals. Gangue minerals typically include garnet (andradite-grossular), pyroxene (diopside-hedenbergite), wollastonite, chlorite, epidote, quartz, actinolite-tremolite, and (or) calcite.

  3. Getting the Gold Treatment

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Epner Technology, Inc., worked with Goddard Space Center to apply gold coating to the Vegetation Canopy Lidar (VCL) mirror. This partnership resulted in new commercial applications for Epner's LaserGold(R) process in the automotive industry. Previously, the company did not have equipment large enough to handle the plating of the stainless steel panels cost effectively. Seeing a chance to renew this effort, Epner Technology and Goddard entered into an agreement by which NASA would fund the facility needed to do the gold-plating, and Epner Technology would cover all other costs as part of their internal research and development. The VCL mirror project proceeded successfully, fulfilling Goddard's needs and leaving Epner Technology with a new facility to provide LaserGold for the automotive industry. The new capability means increased power savings and improvements in both quality and production time for BMW Manufacturing Corporation of Spartanburg, South Carolina, and Cadillac of Detroit, Michigan, as well as other manufacturers who have implemented Epner Technology's LaserGold process. LaserGold(R) is a registered trademark of Epner Technology, Inc.

  4. Magnetic signatures related to orogenic gold mineralization, Central Lapland Greenstone Belt, Finland

    NASA Astrophysics Data System (ADS)

    Airo, M.-L.; Mertanen, S.

    2008-03-01

    A number of lode-gold occurrences are hosted by hydrothermally altered greenstones along the southern boundary of the Palaeoproterozoic Central Lapland Greenstone Belt. The hydrothermally altered and mineralised zones are related to a major thrust and shear zone system that extends much across northern Finland. Spatial correlation between mineralized zones, brittle structural features and chemical alteration was explored and identified from high-resolution aeromagnetic data, in combination with airborne electromagnetic and gamma-ray spectrometric data and coupled with petrophysical and palaeomagnetic studies. The most prominent magnetic, ductile signatures formed during the Svecofennian Orogeny (1900-1800 Ma), resulting in elastic, curved, continuous magnetic patterns. These elastic anomaly patterns were disturbed by tectonic stress from S-SW, resulting in parallel, regularly oriented fracture families and thrust faults normal to the main stress direction. According to aeromagnetic, palaeomagnetic and structural evidence, the thrust zone was active during the latest stage of the orogenic event, but was also reactivated at a later date. Airborne gamma-ray data reveals zones of potassic alteration in the ultramafic rock units in the vicinity of cross-sections of these two fault sets. Chemical and mineralogical changes during alteration and metamorphism strongly affected the mafic and ultramafic host rocks throughout the deformation zone. The strong potassium enrichment and coinciding destruction of magnetic minerals resulted in enhanced potassium concentration and reduction of magnetic anomaly amplitudes. Palaeomagnetic results indicate that the remanent magnetization for the altered ultramafic rocks along the thrust zone is of chemical origin (CRM) and was acquired at 1880-1840 Ma, which is presumed also to be the age of the chemical alteration related to gold mineralization.

  5. Geology of the world-class Kiaka polyphase gold deposit, West African Craton, Burkina Faso

    NASA Astrophysics Data System (ADS)

    Fontaine, Arnaud; Eglinger, Aurélien; Ada, Koumangdiwè; André-Mayer, Anne-Sylvie; Reisberg, Laurie; Siebenaller, Luc; Le Mignot, Elodie; Ganne, Jérôme; Poujol, Marc

    2017-02-01

    veinlets and D4 pervasive muscovite, ± chlorite, ± calcite in quartz-carbonate vein selvages and associated with pyrrhotite + arsenopyrite ± electrum, ± native gold and tellurobismuthite. The latter stage (2) could be divided into two sub-stages based on mineralogy and crosscutting relationship. A weighted average Re-Os pyrrhotite age at 2157 ± 24 Ma (Re-Os age based on 3 replicates) constraints the timing of the disseminated gold stage and represents the first absolute age for gold mineralization in the Manga Fada N'Gourma area. The timing of gold at Kiaka may be also coeval with one of the two lode gold event at ∼ ca. 2.16-2.15 Ga and occurred concomitant with tectono-thermal activity during Eo-Eburnean orogeny. The study of the Kiaka gold deposit emphasizes the importance of a multi-scale and multidisciplinary approach (field observations, petrography geothermobarometry and geochronology) to decipher the polyphase character of some Paleoproterozoic gold deposits.

  6. In vivo liberation of gold ions from gold implants. Autometallographic tracing of gold in cells adjacent to metallic gold.

    PubMed

    Danscher, Gorm

    2002-05-01

    For some years, the implantation of small pieces of gold has been used as an unauthorised remedy for osteoarthritis and pain. The aim of the present study was to evaluate whether gold ions are released from gold implants. Pieces of pure gold were placed in the connective tissue of skin, bone and brains of anaesthetised animals. Ten days to several months later the animals were anaesthetised and killed by transcardial perfusion. Tissue blocks containing the gold pieces were cut, and the sections were silver-enhanced by autometallography. It was found that gold ions are released from the implanted gold and diffuse out into the surrounding tissue. The gold-containing cells in connective tissues were macrophages, mast cells and fibroblasts. In the brain, gold accumulated in astrocytes and neurons. Proton-induced X-ray emission spectroscopy analysis of the tissue surrounding gold implants confirmed that gold ions are liberated. The findings suggest that the gold implant technique, on a local scale, mimics systemic treatment with a gold-containing drug.

  7. Biorecovery of gold

    USGS Publications Warehouse

    Eisler, R.

    2003-01-01

    Recovery of ionic and metallic gold (Au) from a wide variety of solutions by selected species of bacteria, yeasts, fungi, algae, and higher plants is documented. Gold accumulations were up to 7.0 g/kg dry weight (DW) in various species of bacteria, 25.0 g/kg DW in freshwater algae, 84.0 g/kg DW in peat, and 100.0 g/kg DW in dried fungus mixed with keratinous material. Mechanisms of accumulation include oxidation, dissolution, reduction, leaching, and sorption. Uptake patterns are significantly modified by the physicochemical milieu. Crab exoskeletons accumulate up to 4.9 g Au/kg DW; however, gold accumulations in various tissues of living teleosts, decapod crustaceans, and bivalve molluscs are negligible.

  8. Gold-bismuth clusters.

    PubMed

    Martínez, Ana

    2014-08-07

    Metal clusters have interesting characteristics, such as the relationship between properties and size of the cluster. This is not always apparent, so theoretical studies can provide relevant information. In this report, optimized structures and electron donor-acceptor properties of AunBim clusters are reported (n + m = 2-7, 20). Density functional theory calculations were performed to obtain optimized structures. The ground states of gold clusters formed with up to seven atoms are planar. The presence of Bi modifies the structure, and the clusters become 3-D. Several optimized geometries have at least one Bi atom bonded to gold or bismuth atoms and form structures similar to NH3. This fragment is also present in clusters with 20 atoms, where the formation of Au3Bi stabilizes the structures. Bismuth clusters are better electron donors and worse electron acceptors than gold clusters. Mixed clusters fall in between these two extremes. The presence of Bi atoms in gold clusters modifies the electron donor-acceptor properties of the clusters, but there is no correlation between the number of Bi atoms present in the cluster and the capacity for donating electrons. The effect of planarity in Au19Bi clusters is the same as that in Au20 clusters. The properties of pure gold clusters are certainly interesting, but clusters formed by Bi and Au are more important because the introduction of different atoms modifies the geometry, the stability, and consequently the physical and chemical properties. Apparently, the presence of Bi may increase the reactivity of gold clusters, but further studies are necessary to corroborate this hypothesis.

  9. Chemistry for oncotheranostic gold nanoparticles.

    PubMed

    Trouiller, Anne Juliette; Hebié, Seydou; El Bahhaj, Fatima; Napporn, Teko W; Bertrand, Philippe

    2015-06-24

    This review presents in a comprehensive ways the chemical methods used to functionalize gold nanoparticles with focus on anti-cancer applications. The review covers the parameters required for the synthesis gold nanoparticles with defined shapes and sizes, method for targeted delivery in tumours, and selected examples of anti-cancers compounds delivered with gold nanoparticles. A short survey of bioassays for oncology based on gold nanoparticles is also presented.

  10. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, James F.; Furuya, Frederic R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab').sub.2 fragments thereof are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy.

  11. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.; Furuya, F.R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab')[sub 2] fragments are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy. 7 figs.

  12. Earth's continental crustal gold endowment

    NASA Astrophysics Data System (ADS)

    Frimmel, H. E.

    2008-03-01

    The analysis of the temporal distribution of gold deposits, combined with gold production data as well as reserve and resource estimates for different genetic types of gold deposit, revealed that the bulk of the gold known to be concentrated in ore bodies was added to the continental crust during a giant Mesoarchaean gold event at a time (3 Ga) when the mantle temperature reached a maximum and the dominant style of tectonic movement changed from vertical, plume-related to subhorizontal plate tectonic. A magmatic derivation of the first generation of crustal gold from a relatively hot mantle that was characterized by a high degree of partial melting is inferred from the gold chemistry, specifically high Os contents. While a large proportion of that gold is still present in only marginally modified palaeoplacer deposits of the Mesoarchaean Witwatersrand Basin in South Africa, accounting for about 40% of all known gold, the remainder has been recycled repeatedly on a lithospheric scale, predominantly by plate-tectonically induced magmatic and hydrothermal fluid circulation, to produce the current variety of gold deposit types. Post-Archaean juvenile gold addition to the continental crust has been limited, but a mantle contribution to some of the largest orogenic or intrusion-related gold deposits is indicated, notably for the Late Palaeozoic Tien Shan gold province. Magmatic fluids in active plate margins seem to be the most effective transport medium for gold mobilization, giving rise to a large proportion of volcanic-arc related gold deposits. Due to their generally shallow crustal level of formation, they have a low preservation potential. In contrast, those gold deposits that form at greater depth are more widespread also in older rocks. This explains the high proportion of orogenic (including intrusion-related) gold (32%) amongst all known gold deposits. The overall proportion of gold concentrated in known ore bodies is only 7 × 10- 7 of the estimated total

  13. Gold and gold working in Late Bronze Age Northern Greece.

    PubMed

    Vavelidis, M; Andreou, S

    2008-04-01

    Numerous objects of gold displaying an impressive variety of types and manufacturing techniques are known from the Late Bronze Age (LBA) contexts of Mycenaean Greece, but very little is known about the origin and processing of gold during the second millennium B.C: . Ancient literature and recent research indicate that northern Greece is probably the richest gold-bearing region in Greece, and yet, very little evidence exists regarding the exploitation of its deposits and the production as well as use of gold in the area during prehistory. The unusual find of a group of small stone crucibles at the prehistoric settlement of Thessaloniki Toumba, one with visible traces of gold melting, proves local production and offers a rare opportunity to examine the process of on-site gold working. Furthermore, the comparison of the chemical composition of prehistoric artefacts from two settlements with those of gold deposits in their immediate areas supports the local extraction of gold and opens up the prospect for some of the Mycenaean gold to have originated in northern Greece. The scarcity of gold items in northern Greek LBA contexts may not represent the actual amount of gold produced and consumed, but could be a result of the local social attitudes towards the circulation and deposition of artefacts from precious metals.

  14. GOLD PRESSURE VESSEL SEAL

    DOEpatents

    Smith, A.E.

    1963-11-26

    An improved seal between the piston and die member of a piston-cylinder type pressure vessel is presented. A layer of gold, of sufficient thickness to provide an interference fit between the piston and die member, is plated on the contacting surface of at least one of the members. (AEC)

  15. Digging for Gold

    ERIC Educational Resources Information Center

    Waters, John K.

    2012-01-01

    In the case of higher education, the hills are more like mountains of data that "we're accumulating at a ferocious rate," according to Gerry McCartney, CIO of Purdue University (Indiana). "Every higher education institution has this data, but it just sits there like gold in the ground," complains McCartney. Big Data and the new tools people are…

  16. 'Cascade Gold' raspberry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ‘Cascade Gold’ is a new gold fruited, floricane fruiting raspberry cultivar (Rubus idaeus L.) jointly released by Washington State University (WSU), Oregon State University (OSU) and the U.S. Department of Agriculture (USDA). It has been evaluated at Puyallup, Wash. in plantings from 1988 to 2008. ...

  17. Gold Nanoparticle Microwave Synthesis

    SciTech Connect

    Krantz, Kelsie E.; Christian, Jonathan H.; Coopersmith, Kaitlin; Washington, II, Aaron L.; Murph, Simona H.

    2016-07-27

    At the nanometer scale, numerous compounds display different properties than those found in bulk material that can prove useful in areas such as medicinal chemistry. Gold nanoparticles, for example, display promise in newly developed hyperthermia therapies for cancer treatment. Currently, gold nanoparticle synthesis is performed via the hot injection technique which has large variability in final particle size and a longer reaction time. One underdeveloped area by which these particles could be produced is through microwave synthesis. To initiate heating, microwaves agitate polar molecules creating a vibration that gives off the heat energy needed. Previous studies have used microwaves for gold nanoparticle synthesis; however, polar solvents were used that partially absorbed incident microwaves, leading to partial thermal heating of the sample rather than taking full advantage of the microwave to solely heat the gold nanoparticle precursors in a non-polar solution. Through this project, microwaves were utilized as the sole heat source, and non-polar solvents were used to explore the effects of microwave heating only as pertains to the precursor material. Our findings show that the use of non-polar solvents allows for more rapid heating as compared to polar solvents, and a reduction in reaction time from 10 minutes to 1 minute; this maximizes the efficiency of the reaction, and allows for reproducibility in the size/shape of the fabricated nanoparticles.

  18. Isotopic ages from intrusive rocks near the Stuyahok gold placer deposits, south-central Holy Cross quadrangle, Alaska: A section in Geologic studies in Alaska by the U.S. Geological Survey, 1998

    USGS Publications Warehouse

    Miller, Marti L.; Tucker, Robert D.; Layer, Paul W.; Bundtzen, Thomas K.

    2000-01-01

    In the Stuyahok area of the south-central Holy Cross quadrangle, Alaska, felsic to intermediate dikes and sills intrude Lower Cretaceous volcanic and volcaniclastic rocks of the Koyukuk terrane. These previously undated intrusions are the probable source of at least 933 kg (30,000 oz) of past placer gold production. Additional placer, and perhaps lode, resources are likely present at Stuyahok. New U/Pb and 40Ar/39Ar isotopic data indicate two of the dikes are early Tertiary in age (63.6+0.2 Ma and 60.4+1.1 Ma, respectively). In addition to helping constrain the age of gold mineralization, these early Tertiary ages suggest the Stuyahok dikes are part of a Late Cretaceous and early Tertiary belt of gold mineralized felsic dikes that lie in the Kuskokwim mineral belt. Also reported herein are previously unpublished conventional K-Ar ages of 69.4+2.1 Ma and 69.3+2.1 Ma for two felsic intrusions from the western edge of this mineralized belt, the Marshall–Kako Creek area, which lies about 40 km west-southwest of the Stuyahok area.

  19. Gold Nanoparticles Cytotoxicity

    NASA Astrophysics Data System (ADS)

    Mironava, Tatsiana

    Over the last two decades gold nanoparticles (AuNPs) have been used for many scientific applications and have attracted attention due to the specific chemical, electronic and optical size dependent properties that make them very promising agents in many fields such as medicine, imagine techniques and electronics. More specifically, biocompatible gold nanoparticles have a huge potential for use as the contrast augmentation agent in X-ray Computed Tomography and Photo Acoustic Tomography for early tumor diagnostic as well these nanoparticles are extensively researched for enhancing the targeted cancer treatment effectiveness such as photo-thermal and radiotherapy. In most biomedical applications biocompatible gold nanoparticles are labeled with specific tumor or other pathology targeting antibodies and used for site specific drug delivery. However, even though gold nanoparticles poses very high level of anti cancer properties, the question of their cytotoxicity ones they are released in normal tissue has to be researched. Moreover, the huge amount of industrially produced gold nanoparticles raises the question of these particles being a health hazard, since the penetration is fairly easy for the "nano" size substances. This study focuses on the effect of AuNPs on a human skin tissue, since it is fall in both categories -- the side effects for biomedical applications and industrial workers and users' exposure during production and handling. Therefore, in the present project, gold nanoparticles stabilized with the biocompatible agent citric acid were generated and characterized by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM). The cytotoxic effect of AuNPs release to healthy skin tissue was modeled on 3 different cell types: human keratinocytes, human dermal fibroblasts, and human adipose derived stromal (ADS) cells. The AuNPs localization inside the cell was found to be cell type dependent. Overall cytotoxicity was found to be dependent

  20. Spiky gold nanoshells.

    PubMed

    Sanchez-Gaytan, Brenda L; Park, So-Jung

    2010-12-21

    We report a high-yield synthetic method for a new type of metal nanostructure, spiky gold nanoshells, which combine the morphological characteristics of hollow metal nanoshells and nanorods. Our method utilizes block copolymer assemblies and polymer beads as templates for the growth of spiky nanoshells. Various shapes of spiky metal nanoshells were prepared in addition to spherical nanoshells by using block copolymer assemblies such as rod-like micelles, vesicles, and bilayers as templates. Furthermore, spiky gold shells encapsulating magnetic nanoparticles or quantum dots were prepared based on the ability of block copolymers to self-assemble with various types of nanoparticles and molecules. The capability to encapsulate other materials in the core, the shape tunability, and the highly structured surface of spiky nanoshells should benefit a range of imaging, sensing, and medical applications of metal nanostructures.

  1. Radioactive gold ring dermatitis

    SciTech Connect

    Miller, R.A.; Aldrich, J.E. )

    1990-08-01

    A superficial squamous cell carcinoma developed in a woman who wore a radioactive gold ring for more than 30 years. Only part of the ring was radioactive. Radiation dose measurements indicated that the dose to basal skin layer was 2.4 Gy (240 rad) per week. If it is assumed that the woman continually wore her wedding ring for 37 years since purchase, she would have received a maximum dose of approximately 4600 Gy.

  2. 'Pot of Gold'

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows the rock dubbed 'Pot of Gold' (upper left), located near the base of the 'Columbia Hills' in Gusev Crater. The rock's nodules and layered appearance have inspired rover team members to investigate the rock's detailed chemistry in coming sols. This picture was taken on sol 158 (June 13, 2004).

  3. Gold-gold junction electrodes:the disconnection method.

    PubMed

    Dale, Sara E C; Vuorema, Anne; Ashmore, Ellen M Y; Kasprzyk-Horden, Barbara; Sillanpää, Mika; Denuault, Guy; Marken, Frank

    2012-02-01

    The formation of gold-gold junction electrodes for application in electroanalysis is described here based on electro-deposition from a non-cyanide gold plating bath. Converging growth of two hemispherical gold deposits on two adjacent platinum microelectrodes (both 100 µm diameter in glass, ca. 45 µm gap) followed by careful etching in aqueous chloride solution was employed. During growth both gold hemispheres "connect" and during etching "disconnection" is evident in a drop in current. Gold-gold junctions with sub-micron gaps are formed and applied for the electroanalytical detection of sub-micromolar concentrations of hydroquinone in 0.1 M phosphate buffer pH 7 (E(rev) = 0.04 V vs. SCE) and sub-micromolar concentration of dopamine in 0.1 M phosphate buffer pH 7 (E(rev) = 0.14 V vs. SCE). The potential future uses in analysis and limitations of gold-gold junction electrodes are discussed.

  4. Magmatism and Epithermal Gold-Silver Deposits of the Southern Ancestral Cascade Arc, Western Nevada and Eastern California

    USGS Publications Warehouse

    John, David A.; du Bray, Edward A.; Henry, Christopher D.; Vikre, Peter

    2015-01-01

    Many epithermal gold-silver deposits are temporally and spatially associated with late Oligocene to Pliocene magmatism of the southern ancestral Cascade arc in western Nevada and eastern California. These deposits, which include both quartz-adularia (low- and intermediate-sulfidation; Comstock Lode, Tonopah, Bodie) and quartz-alunite (high-sulfidation; Goldfield, Paradise Peak) types, were major producers of gold and silver. Ancestral Cascade arc magmatism preceded that of the modern High Cascades arc and reflects subduction of the Farallon plate beneath North America. Ancestral arc magmatism began about 45 Ma, continued until about 3 Ma, and extended from near the Canada-United States border in Washington southward to about 250 km southeast of Reno, Nevada. The ancestral arc was split into northern and southern segments across an inferred tear in the subducting slab between Mount Shasta and Lassen Peak in northern California. The southern segment extends between 42°N in northern California and 37°N in western Nevada and was active from about 30 to 3 Ma. It is bounded on the east by the northeast edge of the Walker Lane. Ancestral arc volcanism represents an abrupt change in composition and style of magmatism relative to that in central Nevada. Large volume, caldera-forming, silicic ignimbrites associated with the 37 to 19 Ma ignimbrite flareup are dominant in central Nevada, whereas volcanic centers of the ancestral arc in western Nevada consist of andesitic stratovolcanoes and dacitic to rhyolitic lava domes that mostly formed between 25 and 4 Ma. Both ancestral arc and ignimbrite flareup magmatism resulted from rollback of the shallowly dipping slab that began about 45 Ma in northeast Nevada and migrated south-southwest with time. Most southern segment ancestral arc rocks have oxidized, high potassium, calc-alkaline compositions with silica contents ranging continuously from about 55 to 77 wt%. Most lavas are porphyritic and contain coarse plagioclase

  5. Industry Forum Navy Gold Coast

    DTIC Science & Technology

    2014-08-13

    NAVFAC Southwest Lora E. Morrow Deputy for Small Business NAVFAC Southwest NAVFAC Southwest Industry Forum Navy Gold Coast August...REPORT DATE 13 AUG 2014 2. REPORT TYPE 3. DATES COVERED 00-00-2014 to 00-00-2014 4. TITLE AND SUBTITLE Industry Forum Navy Gold Coast 5a...S) 12. DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release; distribution unlimited 13. SUPPLEMENTARY NOTES NDIA 27th Navy Gold Coast

  6. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  7. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  8. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Gold coin and gold certificates in... EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued before January 30, 1934, are exchangeable, as...

  9. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  10. 31 CFR 100.4 - Gold coin and gold certificates in general.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Gold coin and gold certificates in... MONETARY OFFICES, DEPARTMENT OF THE TREASURY EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued...

  11. Surface-stabilized gold nanocatalysts

    DOEpatents

    Dai, Sheng [Knoxville, TN; Yan, Wenfu [Oak Ridge, TN

    2009-12-08

    A surface-stabilized gold nanocatalyst includes a solid support having stabilizing surfaces for supporting gold nanoparticles, and a plurality of gold nanoparticles having an average particle size of less than 8 nm disposed on the stabilizing surfaces. The surface-stabilized gold nanocatalyst provides enhanced stability, such as at high temperature under oxygen containing environments. In one embodiment, the solid support is a multi-layer support comprising at least a first layer having a second layer providing the stabilizing surfaces disposed thereon, the first and second layer being chemically distinct.

  12. Experimental abrasion of detrital gold

    USGS Publications Warehouse

    Yeend, Warren E.

    1975-01-01

    The physical breakdown and abrasion rates of gold were studied using a tumbler to simulate natural high-energy environments. The gold fragments were tumbled for periods ranging from 30 to 240 h with different combinations of sand, cobbles, and water at velocities of 0.5 and 2.0 mi/h (0.85 and 3.22 km/h). With sand and gravel, the common bedload of the rivers that deposited the gold-bearing Tertiary sedimentary rocks of the Sierra Nevada, gold is abraded at rates of 0.015 to 0.007 percent (by weight) per hour of travel (at 0.5 mi/h or 0.845 km/h). Cobbles, rather than sand, are responsible for most of the physical changes and abrasion of the gold. Ten gold fragments tumbled for 120 h with cobbles and water (no sand) were broken down to 68 recoverable fragments and lost about 25 percent of their weight to particles smaller than could be recovered using conventional panning techniques. Gold tumbled for 120 h with sand and water lost less than 1 percent of its weight. Gold was abraded faster by wet sand than by dry sand. Velocity appears to be more important as a factor in abrasion of gold than travel distance a fourfold increase in velocity produced a tenfold increase in hourly abrasion rates of gold. Scanning electron microscope examination of the gold fragments after the tumbling experiments revealed differences in surface texture between fragments tumbled with (1) sand, (2) sand and cobbles, and (3) cobbles only.

  13. Magmatic-vapor expansion and the formation of high-sulfidation gold deposits: Structural controls on hydrothermal alteration and ore mineralization

    USGS Publications Warehouse

    Berger, B.R.; Henley, R.W.

    2011-01-01

    High-sulfidation copper-gold lode deposits such as Chinkuashih, Taiwan, Lepanto, Philippines, and Goldfield, Nevada, formed within 1500. m of the paleosurface in volcanic terranes. All underwent an early stage of extensive advanced argillic silica-alunite alteration followed by an abrupt change to spatially much more restricted stages of fracture-controlled sulfide-sulfosalt mineral assemblages and gold-silver mineralization. The alteration as well as ore mineralization stages of these deposits were controlled by the dynamics and history of syn-hydrothermal faulting. At the Sulfate Stage, aggressive advanced argillic alteration and silicification were consequent on the in situ formation of acidic condensate from magmatic vapor as it expanded through secondary fracture networks alongside active faults. The reduction of permeability at this stage due to alteration decreased fluid flow to the surface, and progressively developed a barrier between magmatic-vapor expansion constrained by the active faults and peripheral hydrothermal activity dominated by hot-water flow. In conjunction with the increased rock strength resulting from alteration, subsequent fault-slip inversion in response to an increase in compressional stress generated new, highly permeable fractures localized by the embrittled, altered rock. The new fractures focused magmatic-vapor expansion with much lower heat loss so that condensation occurred. Sulfide Stage sulfosalt, sulfide, and gold-silver deposition then resulted from destabilization of vapor phase metal species due to vapor decompression through the new fracture array. The switch from sulfate to sulfide assemblages is, therefore, a logical consequence of changes in structural permeability due to the coupling of alteration and fracture dynamics rather than to changes in the chemistry of the fluid phase at its magmatic source. ?? 2010.

  14. When cyclopropenes meet gold catalysts

    PubMed Central

    Miege, Frédéric

    2011-01-01

    Summary Cyclopropenes as substrates entered the field of gold catalysis in 2008 and have proven to be valuable partners in a variety of gold-catalyzed reactions. The different contributions in this growing research area are summarized in this review. PMID:21804867

  15. Antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.

    1988-06-28

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be about 5.0 nm. Methods and reagents are disclosed in which antibodies or Fab' fragments thereof are covalently bound to a stable cluster of gold atoms. 2 figs.

  16. Pressure, temperature, and timing of mineralization of the sedimentary rock-hosted orogenic gold deposit at Klipwal, southeastern Kaapvaal Craton, South Africa

    NASA Astrophysics Data System (ADS)

    Chinnasamy, Sakthi Saravanan; Uken, Ron; Reinhardt, Jürgen; Selby, David; Johnson, Spencer

    2015-08-01

    Gold mineralization in the Klipwal Shear Zone (KSZ) at the Klipwal Gold Mine is confined to laminated quartz-carbonate lodes, stringers, and associated alteration in sandstone and siltstone of the Delfkom Formation in the upper Mozaan Group of the Mesoarchaean Pongola Supergroup. The moderately dipping brittle-ductile KSZ strikes N-S with an oblique-reverse, sinistral sense of shear. The deformational events that are recognized include an early compressional phase that produced anastomosing shears defined by shear fabrics with numerous shear-parallel laminated quartz-carbonate fault-fill veins and, in places, extensional quartz vein stockworks, and a late brittle reactivation phase that produced fault breccias, displacing earlier extensional veins. Three closely spaced economic reefs (lodes) are developed: the main R-reef constitutes the KSZ, while the J- and H-reefs represent footwall splays. Alteration comprises chlorite, muscovite, epidote, feldspar, and carbonates along with pyrite, arsenopyrite, and chalcopyrite ± pyrrhotite. An inner alteration zone is dominated by laminated quartz-carbonate veins with alternating quartz-carbonate-rich and muscovite-chlorite-rich laminae, whereas the proximal zone is characterized by alteration halos of K-feldspar, albite, epidote, chlorite, and muscovite along with carbonates and associated quartz veins. Chlorite thermometry from the inner and proximal zones yielded temperatures of 267 to 312 °C. Arsenopyrite compositions provide temperatures in the same range, 255 to 318 °C. Fluid inclusion microthermometry and Raman spectrometry of quartz veins in the mineralized reefs reveal the presence of metamorphogenic aqueous-gaseous fluid with an average salinity of 6.5 wt% NaCl equiv. Fluid compositions and estimated pressure-temperature (P-T) range (1.1 to 2.5 kbar at 255 to 318 °C) are typical of orogenic gold deposits. Devolatilization during the regional facies metamorphism of the Pongola Supergroup is considered the likely

  17. Synthesis of gold structures by gold-binding peptide governed by concentration of gold ion and peptide.

    PubMed

    Kim, Jungok; Kim, Dong-Hun; Lee, Sylvia J; Rheem, Youngwoo; Myung, Nosang V; Hur, Hor-Gil

    2016-08-01

    Although biological synthesis methods for the production of gold structures by microorganisms, plant extracts, proteins, and peptide have recently been introduced, there have been few reports pertaining to controlling their size and morphology. The gold ion and peptide concentrations affected on the size and uniformity of gold plates by a gold-binding peptide Midas-11. The higher concentration of gold ions produced a larger size of gold structures reached 125.5 μm, but an increased amount of Midas-11 produced a smaller size of gold platelets and increased the yield percentage of polygonal gold particles rather than platelets. The mechanisms governing factors controlling the production of gold structures were primarily related to nucleation and growth. These results indicate that the synthesis of gold architectures can be controlled by newly isolated and substituted peptides under different reaction conditions.

  18. 20th-Century Gold Rush.

    ERIC Educational Resources Information Center

    Wargo, Joseph G.

    1992-01-01

    Presents Nevada's gold rush activities spurred by technological advancements in search methods. Describes the events that led to the twentieth-century gold rush, the techniques for finding deposits and the geological formation process of disseminated gold deposits. Vignettes present the gold extraction process, cross-section, and profile of a…

  19. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 41 Public Contracts and Property Management 2 2014-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  20. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 2 2013-07-01 2012-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  1. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 41 Public Contracts and Property Management 2 2012-07-01 2012-07-01 false Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  2. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 41 Public Contracts and Property Management 2 2011-07-01 2007-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  3. 41 CFR 101-45.002 - Gold.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed...

  4. Enhancement of gold recovery using bioleaching from gold concentrate

    NASA Astrophysics Data System (ADS)

    Choi, S. H.; Cho, K. H.; Kim, B. J.; Choi, N. C.; Park, C. Y.

    2012-04-01

    The gold in refractory ores is encapsulated as fine particles (sometimes at a molecular level) in the crystal structure of the sulfide (typically pyrite with or without arsenopyrite) matrix. This makes it impossible to extract a significant amount of refractory gold by cyanidation since the cyanide solution cannot penetrate the pyrite/arsenopyrite crystals and dissolve gold particles, even after fine grinding. To effectively extract gold from these ores, an oxidative pretreatment is necessary to break down the sulfide matrix. The most popular methods of pretreatment include nitric acid oxidation, roasting, pressure oxidation and biological oxidation by microorganisms. This study investigated the bioleaching efficiency of Au concentrate under batch experimental conditions (adaptation cycles and chemical composition adaptation) using the indigenous acidophilic bacteria collected from gold mine leachate in Sunsin gold mine, Korea. We conducted the batch experiments at two different chemical composition (CuSO4 and ZnSO4), two different adaptation cycles 1'st (3 weeks) and 2'nd (6 weeks). The results showed that the pH in the bacteria inoculating sample decreased than initial condition and Eh increased. In the chemical composition adaptation case, the leached accumulation content of Fe and Pb was exhibited in CuSO4 adaptation bacteria sample more than in ZnSO4 adaptation bacteria samples, possibly due to pre-adaptation effect on chalcopyrite (CuFeS2) in gold concentrate. And after 21 days on the CuSO4 adaptation cycles case, content of Fe and Pb was appeared at 1'st adaptation bacteria sample(Fe - 1.82 and Pb - 25.81 times per control sample) lower than at 2'nd adaptation bacteria sample(Fe - 2.87 and Pb - 62.05 times per control sample). This study indicates that adaptation chemical composition and adaptation cycles can play an important role in bioleaching of gold concentrate in eco-/economic metallurgy process.

  5. The physical hydrology of magmatic-hydrothermal systems: High-resolution 18O records of magmatic-meteoric water interaction from the Yankee Lode tin deposit (Mole Granite, Australia)

    NASA Astrophysics Data System (ADS)

    Fekete, Szandra; Weis, Philipp; Driesner, Thomas; Heinrich, Christoph A.; Baumgartner, Lukas; Bouvier, Anne-Sophie

    2016-04-01

    Magmatic-hydrothermal ore deposits are important economic Cu, Au, Mo and Sn resources (Sillitoe, 2010, Kesler, 1994). The ore formation is a result of superimposed enrichment processes and metals can precipitate due to fluid-rock interaction and/or temperature drop caused by convection or mixing with meteoric fluid (Heinrich and Candela 2014). Microthermometry and LA-ICP MS trace element analyses of fluid inclusions of a well-characterized quartz sample from the Yankee Lode quartz-cassiterite vein deposit (Mole Granite, Australia) suggest that tin precipitation was driven by dilution of hot magmatic water by meteoric fluids (Audétat et al.1998). High resolution in situ oxygen isotope measurements of quartz have the potential to detect changing fluid sources during the evolution of a hydrothermal system. We analyzed the euhedral growth zones of this previously well-studied quartz sample. Growth temperatures are provided by Audétat et al. (1998) and Audétat (1999). Calculated δ 18O values of the quartz- and/or cassiterite-precipitating fluid show significant variability through the zoned crystal. The first and second quartz generations (Q1 and Q2) were precipitated from a fluid of magmatic isotopic composition with δ 18O values of ˜ 8 - 10 ‰. δ 18O values of Q3- and tourmaline-precipitating fluids show a transition from magmatic δ 18O values of ˜ 8 ‰ to ˜ -5 ‰. The outermost quartz-chlorite-muscovite zone was precipitated from a fluid with a significant meteoric water component reflected by very light δ 18O values of about -15 ‰ which is consistent with values found by previous studies (Sun and Eadington, 1987) using conventional O-isotope analysis of veins in the distal halo of the granite intrusion. Intense incursion of meteoric water during Q3 precipitation (light δ 18O values) agrees with the main ore formation event, though the first occurrence of cassiterite is linked to Q2 precipitating fluid with magmatic-like isotope signature. This

  6. Colloidal Synthesis of Gold Semishells

    PubMed Central

    Rodríguez-Fernández, Denis; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel; Liz-Marzán, Luis M

    2012-01-01

    This work describes a novel and scalable colloid chemistry strategy to fabricate gold semishells based on the selective growth of gold on Janus silica particles (500 nm in diameter) partly functionalized with amino groups. The modulation of the geometry of the Janus silica particles allows us to tune the final morphology of the gold semishells. This method also provides a route to fabricating hollow gold semishells through etching of the silica cores with hydrofluoric acid. The optical properties were characterized by visible near-infrared (vis-NIR) spectroscopy and compared with simulations performed using the boundary element method (BEM). These revealed that the main optical features are located beyond the NIR region because of the large core size. PMID:24551496

  7. Gold, currencies and market efficiency

    NASA Astrophysics Data System (ADS)

    Kristoufek, Ladislav; Vosvrda, Miloslav

    2016-05-01

    Gold and currency markets form a unique pair with specific interactions and dynamics. We focus on the efficiency ranking of gold markets with respect to the currency of purchase. By utilizing the Efficiency Index (EI) based on fractal dimension, approximate entropy and long-term memory on a wide portfolio of 142 gold price series for different currencies, we construct the efficiency ranking based on the extended EI methodology we provide. Rather unexpected results are uncovered as the gold prices in major currencies lay among the least efficient ones whereas very minor currencies are among the most efficient ones. We argue that such counterintuitive results can be partly attributed to a unique period of examination (2011-2014) characteristic by quantitative easing and rather unorthodox monetary policies together with the investigated illegal collusion of major foreign exchange market participants, as well as some other factors discussed in some detail.

  8. GOLD: The Genomes Online Database

    DOE Data Explorer

    Kyrpides, Nikos; Liolios, Dinos; Chen, Amy; Tavernarakis, Nektarios; Hugenholtz, Philip; Markowitz, Victor; Bernal, Alex

    Since its inception in 1997, GOLD has continuously monitored genome sequencing projects worldwide and has provided the community with a unique centralized resource that integrates diverse information related to Archaea, Bacteria, Eukaryotic and more recently Metagenomic sequencing projects. As of September 2007, GOLD recorded 639 completed genome projects. These projects have their complete sequence deposited into the public archival sequence databases such as GenBank EMBL,and DDBJ. From the total of 639 complete and published genome projects as of 9/2007, 527 were bacterial, 47 were archaeal and 65 were eukaryotic. In addition to the complete projects, there were 2158 ongoing sequencing projects. 1328 of those were bacterial, 59 archaeal and 771 eukaryotic projects. Two types of metadata are provided by GOLD: (i) project metadata and (ii) organism/environment metadata. GOLD CARD pages for every project are available from the link of every GOLD_STAMP ID. The information in every one of these pages is organized into three tables: (a) Organism information, (b) Genome project information and (c) External links. [The Genomes On Line Database (GOLD) in 2007: Status of genomic and metagenomic projects and their associated metadata, Konstantinos Liolios, Konstantinos Mavromatis, Nektarios Tavernarakis and Nikos C. Kyrpides, Nucleic Acids Research Advance Access published online on November 2, 2007, Nucleic Acids Research, doi:10.1093/nar/gkm884]

    The basic tables in the GOLD database that can be browsed or searched include the following information:

    • Gold Stamp ID
    • Organism name
    • Domain
    • Links to information sources
    • Size and link to a map, when available
    • Chromosome number, Plas number, and GC content
    • A link for downloading the actual genome data
    • Institution that did the sequencing
    • Funding source
    • Database where information resides
    • Publication status and information

    • Gold, coal and oil.

      PubMed

      Dani, Sergio U

      2010-03-01

      Jared Diamond has hypothesized that guns, germs and steel account for the fate of human societies. Here I propose an extension of Diamond's hypothesis and put it in other terms and dimensions: gold, coal and oil account not only for the fate of human societies but also for the fate of mankind through the bodily accumulation of anthropogenic arsenic, an invisible weapon of mass extinction and evolutionary change. The background is clear; arsenic species fulfill seven criteria for a weapon of mass extinction and evolutionary change: (i) bioavailability to all living organisms; (ii) imperceptibility; (iii) acute toxicity; (iv) bioaccumulation and chronic toxicity; (v) adverse impact on reproductive fitness and reproductive outcomes and early-age development and growth in a wide range of microbial, plant and animal species including man; (vi) widespread geographical distribution, mobility and ecological persistence on a centennial to millennial basis and (vii) availability in necessary and sufficient amounts to exert evolutionarily meaningful effects. The proof is becoming increasingly feasible as human exploitation of gold, coal and oil deposits cause sustainable rises of arsenic concentrations in the biosphere. Paradoxically, humans are among the least arsenic-resistant organisms because humans are long-lived, encephalized and complex social metazoans. An arsenic accumulation model is presented here to describe how arsenic accumulates in the human body with increasing age and at different provisionally safe exposure levels. Arsenic accumulates in the human body even at daily exposure levels which are within the lowest possible WHO provisional tolerance limits, yielding bodily arsenic concentrations which are above WHO provisional limits. Ongoing consequences of global scale arsenic poisoning of mankind include age-specific rises in morbidity and mortality followed by adaptive changes. The potential rise of successful forms of inborn resistance to arsenic in humans

    • The mother lode of natural gas

      SciTech Connect

      Monastersky, R.

      1996-11-09

      Late last year a team of oceanographers conducted the most in-depth investigation of methane hydrates to date by drilling into an extensive accumulation beneath the seabed off the coast of the SE USA. The results of this research seem to bolster extremely sketchy estimates made years ago about the vastness of the hydrate resource. At the same time scientist wonder whether this resource also has a dark side. Some think that extremely rapid changes in climate in the past were caused by methane released from methane hydrates. This article discusses the research leading to the discoveries, chemistry of methane hydrates and prospects for their future as an energy source.

    • Gold nanoparticle (AuNPs) and gold nanopore (AuNPore) catalysts in organic synthesis.

      PubMed

      Takale, Balaram S; Bao, Ming; Yamamoto, Yoshinori

      2014-04-07

      Organic synthesis using gold has gained tremendous attention in last few years, especially heterogeneous gold catalysis based on gold nanoparticles has made its place in almost all organic reactions, because of the robust and green nature of gold catalysts. In this context, gold nanopore (AuNPore) with a 3D metal framework is giving a new dimension to heterogeneous gold catalysts. Interestingly, AuNPore chemistry is proving better than gold nanoparticles based chemistry. In this review, along with recent advances, major discoveries in heterogeneous gold catalysis are discussed.

    • Modeling of gold production in Malaysia

      NASA Astrophysics Data System (ADS)

      Muda, Nora; Ainuddeen, Nasihah Rasyiqah; Ismail, Hamizun; Umor, Mohd Rozi

      2013-04-01

      This study was conducted to identify the main factors that contribute to the gold production and hence determine the factors that affect to the development of the mining industry in Malaysia. An econometric approach was used by performing the cointegration analysis among the factors to determine the existence of long term relationship between the gold prices, the number of gold mines, the number of workers in gold mines and the gold production. The study continued with the Granger analysis to determine the relationship between factors and gold production. Results have found that there are long term relationship between price, gold production and number of employees. Granger causality analysis shows that there is only one way relationship between the number of employees with gold production in Malaysia and the number of gold mines in Malaysia.

    • Monoclonal antibody "gold rush".

      PubMed

      Maggon, Krishan

      2007-01-01

      The market, sales and regulatory approval of new human medicines, during the past few years, indicates increasing number and share of new biologics and emergence of new multibillion dollar molecules. The global sale of monoclonal antibodies in 2006 were $20.6 billion. Remicade had annual sales gain of $1 billion during the past 3 years and five brands had similar increase in 2006. Rituxan with 2006 sales of $4.7 billion was the best selling monoclonal antibody and biological product and the 6th among the top selling medicinal brand. It may be the first biologic and monoclonal antibody to reach $10 billion annual sales in the near future. The strong demand from cancer and arthritis patients has surpassed almost all commercial market research reports and sales forecast. Seven monoclonal antibody brands in 2006 had sales exceeding $1 billion. Humanized or fully human monoclonal antibodies with low immunogenicity, enhanced antigen binding and reduced cellular toxicity provide better clinical efficacy. The higher technical and clinical success rate, overcoming of technical hurdles in large scale manufacturing, low cost of market entry and IND filing, use of fully human and humanized monoclonal antibodies has attracted funds and resources towards R&D. Review of industry research pipeline and sales data during the past 3 years indicate a real paradigm shift in industrial R&D from pharmaceutical to biologics and monoclonal antibodies. The antibody bandwagon has been joined by 200 companies with hundreds of new projects and targets and has attracted billions of dollars in R&D investment, acquisitions and licensing deals leading to the current Monoclonal Antibody Gold Rush.

    • Goldschlager allergy in a gold allergic patient.

      PubMed

      Guenthner, T; Stork, C M; Cantor, R M

      1999-08-01

      We describe the case of gold allergy after ingestion of GOLDSCHLAGER, a gold-containing liquor, in a patient with a previous allergy to gold jewelry. The patient was not aware that genuine gold particles were contained in the schnapps liquor and that ingestion could result in a reaction similar to that experienced by individuals sensitive to gold jewelry. Clinicians should be familiar with the presence of gold particles in GOLDSCHLAGER liquor and the potential for allergic reactions to occur in those so predisposed.

    • Phage based green chemistry for gold ion reduction and gold retrieval.

      PubMed

      Setyawati, Magdiel I; Xie, Jianping; Leong, David T

      2014-01-22

      The gold mining industry has taken its toll on the environment, triggering the development of more environmentally benign processes to alleviate the waste load release. Here, we demonstrate the use of bacteriophages (phages) for biosorption and bioreduction of gold ions from aqueous solution, which potentially can be applied to remediate gold ions from gold mining waste effluent. Phage has shown a remarkably efficient sorption of gold ions with a maximum gold adsorption capacity of 571 mg gold/g dry weight phage. The product of this phage mediated process is gold nanocrystals with the size of 30-630 nm. Biosorption and bioreduction processes are mediated by the ionic and covalent interaction between gold ions and the reducing groups on the phage protein coat. The strategy offers a simple, ecofriendly and feasible option to recover of gold ions to form readily recoverable products of gold nanoparticles within 24 h.

    • Gold nanoparticles for photoacoustic imaging

      PubMed Central

      Li, Wanwan; Chen, Xiaoyuan

      2015-01-01

      Photoacoustic (PA) imaging is a biomedical imaging modality that provides functional information regarding the cellular and molecular signatures of tissue by using endogenous and exogenous contrast agents. There has been tremendous effort devoted to the development of PA imaging agents, and gold nanoparticles as exogenous contrast agents have great potential for PA imaging due to their inherent and geometrically induced optical properties. The gold-based nanoparticles that are most commonly employed for PA imaging include spheres, rods, shells, prisms, cages, stars and vesicles. This article provides an overview of the current state of research in utilizing these gold nanomaterials for PA imaging of cancer, atherosclerotic plaques, brain function and image-guided therapy. PMID:25600972

    • Economic geology: Gold buried by oxygen

      NASA Astrophysics Data System (ADS)

      Gaillard, Fabrice; Copard, Yoann

      2015-03-01

      The Witwatersrand Basin in South Africa contains extraordinary amounts of gold. Thermodynamic calculations suggest that the gold may have accumulated there in response to a perfect storm of conditions available only during the Archaean.

    • Recent Developments in Australian Gold Extraction.

      ERIC Educational Resources Information Center

      Thiele, Rodney B.

      1995-01-01

      Describes new technologies that have greatly improved the extraction efficiency of gold ore, including: altering plant layout to promote efficiency, engaging Filiblast forced oxidation and bioxidation systems, and updating the electrowinning procedure at the gold recovery stage. (JRH)

    • Formation, structure, and orientation of gold silicide on gold surfaces

      NASA Technical Reports Server (NTRS)

      Green, A. K.; Bauer, E.

      1976-01-01

      The formation of gold silicide on Au films evaporated onto Si(111) surfaces is studied by Auger electron spectroscopy (AES) and low-energy electron diffraction (LEED). Surface condition, film thickness, deposition temperature, annealing temperature, and heating rate during annealing are varied. Several oriented crystalline silicide layers are observed.

    • Application of U-Th-Pb phosphate geochronology to young orogenic gold deposits: New age constraints on the formation of the Grass Valley gold district, Sierra Foothills province, California

      USGS Publications Warehouse

      Taylor, Ryan D.; Goldfarb, Richard J.; Monecke, Thomas; Fletcher, Ian R.; Cosca, Michael A.; Kelly, Nigel M.

      2015-01-01

      The Grass Valley orogenic gold district in the Sierra Nevada foothills province, central California, the largest historic gold producer of the North American Cordillera, comprises both steeply dipping east-west (E-W) veins located along lithologic contacts in accreted ca. 300 and 200 Ma oceanic rocks and shallowly dipping north-south (N-S) veins hosted by the Grass Valley granodiorite; the latter have yielded about 70 percent of the 13 million ounces of historic lode gold production in the district. The oceanic host rocks were accreted to the western margin of North America between 200 and 170 Ma, metamorphosed to greenschist and amphibolite facies, and uplifted between 175 and 160 Ma. Large-scale magmatism in the Sierra Nevada occurred between 170-140 Ma and 120-80 Ma, with the Grass Valley granodiorite being emplaced during the older episode of magmatism. Uranium-lead isotopic dating of hydrothermal xenotime yielded the first absolute age of 162±5 Ma for the economically more significant N-S veins. The vein-hosted xenotime, as well as associated monazite, are unequivocally of hydrothermal origin as indicated by textural and chemical characteristics, including grain shape, lack of truncated growth banding, lack of a Eu anomaly, and low U and Th concentrations. Furthermore, the crack-seal texture of the veins, with abundant wallrock slivers, suggests their formation as a result of episodic fluid flow possibly related to reoccurring seismic events, rather than a period of fluid exsolution from an evolving magma. The N-S veins are temporally distinct from a younger 153-151 Ma gold event that was previously reported for the E-W veins. Overlapping U-Pb zircon (159.9±2.2 Ma) and 40Ar/39Ar biotite and hornblende (159.7±0.6 to 161.9±1.4 Ma) ages and geothermobarometric calculations indicate that the Grass Valley granodiorite was emplaced at ca. 160 Ma at elevated temperatures (~800°C) within approximately 3 km of the paleosurface and rapidly cooled to the ambient

  1. Single-crystalline gold nanoplates from a commercial gold plating solution.

    PubMed

    Li, Zhonghao; Lapeyre, Véronique; Ravaine, Valérie; Ravaine, Serge; Kuhn, Alexander

    2009-03-01

    A novel route was proposed to synthesize gold nanoplates using a commercial gold plating solution as the reactant. Single-crystalline gold nanoplates can be successfully synthesized by reacting gold plating solution with HCl. The as-prepared nanoplates are from several micrometers to tens of micrometers in size. The effects of reactant concentration and temperature on the morphology of the gold products were investigated. The size of the gold nanoplate increases with the decrease of the amount of gold plating solution, while irregular gold nanoparticles are formed as the HCl concentration becomes low. When the reaction temperature is as low as room temperature, nanoplates with a concavity form. Specifically, it is found that the Cl- plays an important role for the formation of these gold nanoplates. The formation mechanism of the gold nanoplates is studied in detail.

  2. Surface-water, ground-water, and sediment geochemistry of epizonal and shear-hosted mineral deposits in the Tintina Gold Province--arsenic and antimony distribution and mobility: Chapter G in Recent U.S. Geological Survey studies in the Tintina Gold Province, Alaska, United States, and Yukon, Canada--results of a 5-year project

    USGS Publications Warehouse

    Mueller, Seth H.; Goldfarb, Richard J.; Verplanck, Philip L.; Trainor, Thomas P.; Sanzolone, Richard F.; Adams, Monique; Gough, Larry P.; Day, Warren C.

    2007-01-01

    Epigenetic mineral deposits in the Tintina Gold Province are generally characterized by high concentrations of arsenic and antimony in their mineral assemblage. A total of 347 samples (ground water, surface water, and stream sediment) were collected to investigate the distribution and mobility of arsenic and antimony in the environment near known mineral deposits. Samples were collected from east to west at Keno Hill and Brewery Creek, Yukon, Canada; and Cleary Hill, True North, Scrafford Mine, Fairbanks, Ryan Lode, Stampede Creek, Slate Creek, and Donlin Creek, all in Alaska. Surface- and ground-water samples are all slightly acidic to near-neutral in pH (5-8), have a wide range in specific conductance (surface water 17-2,980 microsiemens per centimeter and ground water 170-2,940 microsiemens per centimeter), and show elevated dissolved arsenic and antimony concentrations (arsenic in surface water is less than 1 to 380 micrograms per liter and in ground water is less than 1 micrograms per liter to 1.5 milligrams per liter; antimony in surface water is less than 2 to 660 micrograms per liter and in ground water is less than 2 to 60 micrograms per liter). Stream sediments downstream from these deposits have high concentrations of arsenic and antimony (arsenic median is 1,670 parts per million, maximum is 10,000 parts per million; antimony median is 192 parts per million, maximum is 7,200 parts per million). The mobility of arsenic and antimony is controlled by the local redox environment, with arsenic being less mobile in oxidized surface waters relative to antimony, and arsenic more mobile in reduced ground water. These factors suggest that both antimony and arsenic may be useful pathfinder elements in water and sediment for targeting similar style deposits elsewhere in the Tintina Gold Province.

  3. Structural change from doping the gold cluster.

    PubMed

    Tang, Yiji; Wang, Shu-Guang; Li, Jia

    2011-05-01

    Doping gold clusters with a transition metal (M@Au(n)) causes structural change. To determine the mechanism by which these changes occur, the central gold atom of Au(5) was doped with its same row transition metals Pt, Ir, Os, Re, and W. Based on theoretical calculations, a similar trend was found in other gold clusters.

  4. Highly active thermally stable nanoporous gold catalyst

    SciTech Connect

    Biener, Juergen; Wittstock, Arne; Biener, Monika M.; Bagge-Hansen, Michael; Baeumer, Marcus; Wichmann, Andre; Neuman, Bjoern

    2016-12-20

    In one embodiment, a system includes a nanoporous gold structure and a plurality of oxide particles deposited on the nanoporous gold structure; the oxide particles are characterized by a crystalline phase. In another embodiment, a method includes depositing oxide nanoparticles on a nanoporous gold support to form an active structure and functionalizing the deposited oxide nanoparticles.

  5. The geology of the Morro Velho gold deposit in the Archean Rio das Velhas greenstone belt, Quadrilátero Ferrífero, Brazil

    USGS Publications Warehouse

    Vial, Diogenes Scipioni; DeWitt, Ed; Lobato, Lydia Maria; Thorman, Charles H.

    2007-01-01

    The Morro Velho gold deposit, Quadrilátero Ferrífero region, Minas Gerais, Brazil, is hosted by rocks at the base of the Archean Rio das Velhas greenstone belt. The deposit occurs within a thick carbonaceous phyllite package, containing intercalations of felsic and intermediate volcaniclastic rocks and dolomites. Considering the temporal and spatial association of the deposit with the Rio das Velhas orogeny, and location in close proximity to a major NNW-trending fault zone, it can be classified as an orogenic gold deposit. Hydrothermal activity was characterized by intense enrichment in alteration zones of carbonates, sulfides, chlorite, white mica±biotite, albite and quartz, as described in other Archean lode-type gold ores. Two types of ore occur in the deposit: dark gray quartz veins and sulfide-rich gold orebodies. The sulfide-rich orebodies range from disseminated concentrations of sulfide minerals to massive sulfide bodies. The sulfide assemblage comprises (by volume), on average, 74% pyrrhotite, 17% arsenopyrite, 8% pyrite and 1% chalcopyrite. The orebodies have a long axis parallel to the local stretching lineation, with continuity down the plunge of fold axis for at least 4.8 km. The group of rocks hosting the Morro Velho gold mineralization is locally referred to as lapa seca. These were isoclinally folded and metamorphosed prior to gold mineralization. The lapa seca and the orebodies it hosts are distributed in five main tight folds related to F1 (the best examples are the X, Main and South orebodies, in level 25), which are disrupted by NE- to E-striking shear zones. Textural features indicate that the sulfide mineralization postdated regional peak metamorphism, and that the massive sulfide ore has subsequently been neither metamorphosed nor deformed. Lead isotope ratios indicate a model age of 2.82 ± 0.05 Ga for both sulfide and gold mineralization. The lapa seca are interpreted as the results of a pre-gold alteration process and may be

  6. Gold, Silver and Bronze Citations.

    ERIC Educational Resources Information Center

    American School & University, 2003

    2003-01-01

    Presents the gold, silver, and bronze winners of a competition, which judged the most outstanding learning environments at educational institutions nationwide. Jurors spent two days reviewing projects, focusing on concepts and ideas that made them exceptional. For each citation, the article offers information on the firm, client, total area, total…

  7. Bimodal porous gold opals for molecular sensing

    NASA Astrophysics Data System (ADS)

    Chae, Weon-Sik; Yu, Hyunung; Ham, Sung-Kyoung; Lee, Myung-Jin; Jung, Jin-Seung; Robinson, David B.

    2013-11-01

    We have fabricated bimodal porous gold skeletons by double-templating routes using poly(styrene) colloidal opals as templates. The fabricated gold skeletons show a bimodal pore-size distribution, with small pores within spheres and large pores between spheres. The templated bimodal porous gold skeletons were applied in Raman scattering experiments to study sensing efficiency for probe molecules. We found that the bimodal porous gold skeletons showed obvious enhancement of Raman scattering signals versus that of the unimodal porous gold which only has interstitial pores of several hundred nanometers.

  8. Gold nephropathy in juvenile rheumatoid arthritis.

    PubMed

    Husserl, F E; Shuler, S E

    1979-01-01

    A 2-year-old girl was treated with gold salts for juvenile rheumatoid arthritis. Treatment had to be discontinued when persistent proteinuria was detected. As this case report indicates, close monitoring of the urine is mandatory during treatment with gold salts to detect early signs of toxicity: hematuria followed by casts and then proteinuria as therapy is continued. Histologic examination with electron microscopy will help to differentiate the different forms of gold toxicity. When the findings are consistent with gold-induced renal involvement, therapy should be discontinued. The gold nephropathy usually resolves in time, with no permanent renal damage.

  9. Gold recycling; a materials flow study

    USGS Publications Warehouse

    Amey, Earle B.

    2000-01-01

    This materials flow study includes a description of trends in consumption, loss, and recycling of gold-containing materials in the United States in 1998 in order to illustrate the extent to which gold is presently being recycled and to identify recycling trends. The quantity of gold recycled, as a percent of the apparent supply of gold, was estimated to be about 30 percent. Of the approximately 446 metric tons of gold refined in the United States in 1998, the fabricating and industrial use losses were 3 percent.

  10. Dating native gold by noble gas analyses

    NASA Technical Reports Server (NTRS)

    Niedermann, S.; Eugster, O.; Hofmann, B.; Thalmann, CH.; Reimold, W. U.

    1993-01-01

    Our recent work on He, Ne, and Ar in Alpine gold samples has demonstrated that gold is extremely retentive for He and could thus, in principle, be used for U/Th-He-4 dating. For vein-type gold from Brusson, Northern Italy, we derived a U/Th-He-4 age of 36 Ma, in agreement with the K-Ar formation age of associated muscovites and biotites. However, in placer gold from the Napf area, Central Switzerland, we observed large excesses of both He-4 and radiogenic Ar-40 (Ar-40 sub rad, defined as Ar-40-295.5-Ar-.36). The gas release systematics indicate two distinct noble gas components, one of which is released below about 800 C and the other one at the melting point of gold (1064 C). We now present results of He and Xe measurements in a 1 g placer gold sample from the river Kruempelgraben, as well as He and Ar data for Brusson vein-type gold and for gold from the Lily Gold Mine, South Africa. We calculate reasonable U/Th-He-4 as well as U-Xe ages based on those gases which are released at approximately 800 C. Probably the low-temperature components represent in-situ-produced radiogenic He and fission Xe, whereas the gases evolving when gold melts have been trapped during gold formation. Therefore, only the low-temperature components are relevant for dating purposes.

  11. Mammalian sensitivity to elemental gold (Au?)

    USGS Publications Warehouse

    Eisler, R.

    2004-01-01

    There is increasing documentation of allergic contact dermatitis and other effects from gold jewelry, gold dental restorations, and gold implants. These effects were especially pronounced among females wearing body-piercing gold objects. One estimate of the prevalence of gold allergy worldwide is 13%, as judged by patch tests with monovalent organogold salts. Eczema of the head and neck was the most common response of individuals hypersensitive to gold, and sensitivity can last for at least several years. Ingestion of beverages containing flake gold can result in allergic-type reactions similar to those seen in gold-allergic individuals exposed to gold through dermal contact and other routes. Studies with small laboratory mammals and injected doses of colloidal gold showed increased body temperatures, accumulations in reticular cells, and dose enhancement in tumor therapy; gold implants were associated with tissue injuries. It is proposed that Au? toxicity to mammals is associated, in part, with formation of the more reactive Au+ and Au3+ species.

  12. Copper-gold endoskarns and high-Mg monzodiorite-tonalite intrusions at Mt. Shea, Kalgoorlie, Australia: implications for the origin of gold-pyrite-tennantite mineralization in the Golden Mile

    NASA Astrophysics Data System (ADS)

    Mueller, Andreas G.

    2007-10-01

    .02-0.31). Chromium (62-345 ppm), Ni (23-158), Sr (311-1361 ppm), and Ba (250-2,581 ppm) contents are high, Sr/Y ratios are high (24-278, mostly >50), and the rare earth element patterns are fractionated {( {{{{Ce}}N } {{{Yb}}N = 17 - 41}} right)} . These features and a negative niobium anomaly relative to the normal mid-ocean ridge basalt indicate that the suite formed by hornblende fractionation from a subduction-related monzodiorite magma sourced from metasomatized peridotite in the upper mantle. The magnesian composition of many intrusions was enhanced due to hornblende crystallization under oxidizing hydrous conditions and during the subsequent destruction of igneous magnetite by subsolidus actinolite-albite alteration. At the Shea prospect, main-stage Cu-Au epidote skarn is cut by biotite-albite-dolomite schist and by red biotite-albite replacement bands. Post-skarn alteration includes 20-m-thick zones of sericite-chlorite-ankerite schist confined to two D3 reverse faults. The schists are mineralized with magnetite + pyrite + chalcopyrite (up to 0.62% Cu, 1.6 g/t Au) and are linked to skarn formation by shared Ca-Fe-CO2 metasomatism. Red sericitic alteration, marked by magnetite + hematite + pyrite, occurs in fractured porphyry. The biotite/sericite alteration and oxidized ore assemblages at the Shea prospect are mineralogically identical to magnetite-hematite-bearing gold lodes at Kambalda and in the Golden Mile. Published fluid inclusion data suggest that a “high-pressure”, oxidized magmatic fluid (2-9 wt% NaCl equivalent, X_{{{{CO}}2 }} = 0.1 - 0.2 , 200-400 MPa) was responsible for gold mineralization in structural sites of the Boulder Lefroy and Golden Mile faults. The sericite-alkerite lodes in the Golden Mile share the assemblages pyrite + tennantite + chalcopyrite and bornite + pyrite, and accessory high-sulfidation enargite with late-stage sericitic alteration zones developed above porphyry copper deposits.

  13. Bending Gold Nanorods with Light.

    PubMed

    Babynina, Anastasia; Fedoruk, Michael; Kühler, Paul; Meledin, Alexander; Döblinger, Markus; Lohmüller, Theobald

    2016-10-12

    V-shaped gold nanoantennas are the functional components of plasmonic metasurfaces, which are capable of manipulating light in unprecedented ways. Designing a metasurface requires the custom arrangement of individual antennas with controlled shape and orientation. Here, we show how highly crystalline gold nanorods in solution can be bent, one-by-one, into a V-shaped geometry and printed to the surface of a solid support through a combination of plasmonic heating and optical force. Significantly, we demonstrate that both the bending angle and the orientation of each rod-antenna can be adjusted independent from each other by tuning the laser intensity and polarization. This approach is applicable for the patterning of V-shaped plasmonic antennas on almost any substrate, which holds great potential for the fabrication of ultrathin optical components and devices.

  14. Biomolecular Assembly of Gold Nanocrystals

    SciTech Connect

    Micheel, Christine Marya

    2005-05-20

    Over the past ten years, methods have been developed to construct discrete nanostructures using nanocrystals and biomolecules. While these frequently consist of gold nanocrystals and DNA, semiconductor nanocrystals as well as antibodies and enzymes have also been used. One example of discrete nanostructures is dimers of gold nanocrystals linked together with complementary DNA. This type of nanostructure is also known as a nanocrystal molecule. Discrete nanostructures of this kind have a number of potential applications, from highly parallel self-assembly of electronics components and rapid read-out of DNA computations to biological imaging and a variety of bioassays. My research focused in three main areas. The first area, the refinement of electrophoresis as a purification and characterization method, included application of agarose gel electrophoresis to the purification of discrete gold nanocrystal/DNA conjugates and nanocrystal molecules, as well as development of a more detailed understanding of the hydrodynamic behavior of these materials in gels. The second area, the development of methods for quantitative analysis of transmission electron microscope data, used computer programs written to find pair correlations as well as higher order correlations. With these programs, it is possible to reliably locate and measure nanocrystal molecules in TEM images. The final area of research explored the use of DNA ligase in the formation of nanocrystal molecules. Synthesis of dimers of gold particles linked with a single strand of DNA possible through the use of DNA ligase opens the possibility for amplification of nanostructures in a manner similar to polymerase chain reaction. These three areas are discussed in the context of the work in the Alivisatos group, as well as the field as a whole.

  15. DNA-templated gold nanowires

    NASA Astrophysics Data System (ADS)

    Mohammadzadegan, Reza; Mohabatkar, Hassan; Sheikhi, Mohammad Hossein; Safavi, Afsaneh; Khajouee, Mahmood Barati

    2008-10-01

    We have developed simple methods of reproducibly creating deoxyribonucleic acid (DNA)-templated gold nanowires on silicon. First DNA nanowires were aligned on silicon surfaces. Briefly, modified silicon wafer was soaked in the DNA solution, and then the solution was removed using micropipettes; the surface tension at the moving air-solution interface is sufficient to align the DNA nanowires on the silicon wafer. In another attempt, an aqueous dispersion of sodium azide-stabilized gold nanoparticles was prepared. The nanoparticles aligned double-stranded λ-DNA to form a linear nanoparticle array. Continuous gold nanowires were obtained. The above nanowires were structurally characterized using scanning electron microscopy. The results of the characterizations show the wires to be 57-323 nm wide, to be continuous with a length of 2.8-9.5 μm. The use of DNA as a template for the self-assembly of conducting nanowires represents a potentially important approach in the fabrication of nanoscale interconnects.

  16. Distinguishing Between Legally and Illegally Produced Gold in South Africa.

    PubMed

    Roberts, Richard J; Dixon, Roger D; Merkle, Roland K W

    2016-01-01

    The identification of gold-bearing material is essential for combating the theft of gold in South Africa. Material seized in police operations is generally a mixture of gold from different mines, and as such cannot be traced back to a single location. ICP-OES analysis of material dissolved by acid dissolution provided a database of gold compositions comprising gold from South African mines, illegal gold stolen from the mines, and commercial gold alloys and jewelery. Discrimination between legal and illegal gold was possible due to the presence of Pb, As, Sb, Sn, Se, and Te in the stolen material, elements which are not present in legally produced gold. The presence of these elements is a quick and simple way to distinguish between gold alloys based on refined gold, such as in commercially manufactured jewelery, and gold alloys containing a proportion of unrefined and therefore illegally obtained gold.

  17. Physiological investigation of gold nanorods toward watermelon.

    PubMed

    Wan, Yujie; Li, Junli; Ren, Hongxuan; Huang, Jin; Yuan, Hong

    2014-08-01

    The objective of the present study was to evaluate the phytotoxicity and oxidant stress of the gold nanorods toward watermelon, and hence give a quantitative risk assessment of both seeds and plants phase. The seed germination, the activity of antioxidant enzymes, and the contents of soluble protein and malondialdehyde (MDA) have been measured while the plant roots were observed by transmission electron microscopy (TEM). It was found that the gold nanorods significantly promoted the root elongation. Furthermore, the results on the enzymes activities of plant indicated that oxidative stress happened in the plant treated with gold nanorods. However, the gold nanorods resulted in the phytotoxicity toward plant especially at high concentration. The TEM images of the plant roots with and without the treatment of gold nanorods showed the significant different size of starch granules. In conclusion, significant physiological changes of plant occurred after treatment with the gold nanorods.

  18. Template based synthesis of gold nanotubes using biologically synthesized gold nanoparticles.

    PubMed

    Ballabh, R; Nara, S

    2015-12-01

    Reliable experimental protocols using green technologies to synthesize metallic nanostructures widen their applications, both biological as well as biomedical. Here, we describe a method for synthesizing gold nanotubes using biologically synthesized gold nanoparticles in a template based approach. E. coli DH5α was used as bionanofactory to synthesize gold nanoparticles. These nanoparticles were then deposited on sodium sulfate (Na2SO4) nanowires which were employed as sacrificial template for gold nanotube (Au-NT) formation. The gold nanoparticles, sodium sulphate nanowires and gold nanotubes were appropriately characterized using transmission electron microscopy. The TEM results showed that the average diameter of gold nanotubes was 72 nm and length up to 4-7 μm. The method discussed herein is better than other reported conventional chemical synthesis approaches as it uses biologically synthesized gold nanoparticles, and does not employ any harsh conditions/solvents for template removal which makes it a clean and ecofriendly method.

  19. Electrochemical Assay of Gold-Plating Solutions

    NASA Technical Reports Server (NTRS)

    Chiodo, R.

    1982-01-01

    Gold content of plating solution is assayed by simple method that required only ordinary electrochemical laboratory equipment and materials. Technique involves electrodeposition of gold from solution onto electrode, the weight gain of which is measured. Suitable fast assay methods are economically and practically necessary in electronics and decorative-plating industries. If gold content in plating bath is too low, poor plating may result, with consequent economic loss to user.

  20. Formation of Gold(III) Alkyls from Gold Alkoxide Complexes

    PubMed Central

    2017-01-01

    The gold(III) methoxide complex (C∧N∧C)AuOMe (1) reacts with tris(p-tolyl)phosphine in benzene at room temperature under O abstraction to give the methylgold product (C∧N∧C)AuMe (2) together with O=P(p-tol)3 ((C∧N∧C) = [2,6-(C6H3tBu-4)2pyridine]2–). Calculations show that this reaction is energetically favorable (ΔG = −32.3 kcal mol–1). The side products in this reaction, the Au(II) complex [Au(C∧N∧C)]2 (3) and the phosphorane (p-tol)3P(OMe)2, suggest that at least two reaction pathways may operate, including one involving (C∧N∧C)Au• radicals. Attempts to model the reaction by DFT methods showed that PPh3 can approach 1 to give a near-linear Au–O–P arrangement, without phosphine coordination to gold. The analogous reaction of (C∧N∧C)AuOEt, on the other hand, gives exclusively a mixture of 3 and (p-tol)3P(OEt)2. Whereas the reaction of (C∧N∧C)AuOR (R = But, p-C6H4F) with P(p-tol)3 proceeds over a period of hours, compounds with R = CH2CF3, CH(CF3)2 react almost instantaneously, to give 3 and O=P(p-tol)3. In chlorinated solvents, treatment of the alkoxides (C∧N∧C)AuOR with phosphines generates [(C∧N∧C)Au(PR3)]Cl, via Cl abstraction from the solvent. Attempts to extend the synthesis of gold(III) alkoxides to allyl alcohols were unsuccessful; the reaction of (C∧N∧C)AuOH with an excess of CH2=CHCH2OH in toluene led instead to allyl alcohol isomerization to give a mixture of gold alkyls, (C∧N∧C)AuR′ (R′ = −CH2CH2CHO (10), −CH2CH(CH2OH)OCH2CH=CH2 (11)), while 2-methallyl alcohol affords R′ = CH2CH(Me)CHO (12). The crystal structure of 11 was determined. The formation of Au–C instead of the expected Au–O products is in line with the trend in metal–ligand bond dissociation energies for Au(III): M–H > M–C > M–O.

  1. Native gold in Hawaiian alkalic magma

    USGS Publications Warehouse

    Sisson, T.W.

    2003-01-01

    Native gold found in fresh basanite glass from the early submarine phase of Kilauea volcano, Hawaii, may be the first documented case of the transport of gold as a distinct precious metal phase in a mantle-derived magma. The gold-bearing glass is a grain in bedded volcanic glass sandstone (Japan Marine Science and Technology Center (JAMSTEC) sample S508-R3) collected by the submersible Shinkai 6500 at 3879 m depth off Kilauea's south flank. Extensive outcrops there expose debris-flow breccias and sandstones containing submarine-erupted alkalic rock fragments and glasses from early Kilauea. Precipitation of an immiscible gold liquid resulted from resorption of magmatic sulfides during crystallization-differentiation, with consequent liberation of sulfide-hosted gold. Elevated whole-rock gold concentrations (to 36 ppb) for fresh lavas and clasts from early Kilauea further show that some magmas erupted at the beginning stages of Hawaiian shield volcanoes were distinctly gold rich, most likely owing to limited residual sulfide in their mantle source. Alkalic magmas at other ocean islands may also be gold rich, and oceanic hot-spot provinces may contain underappreciated gold resources.

  2. Gold ink coating of thermocouple sheaths

    DOEpatents

    Ruhl, H. Kenneth

    1992-01-01

    A method is provided for applying a gold ink coating to a thermocouple sheath which includes the steps of electropolishing and oxidizing the surface of the thermocouple sheath, then dipping the sheath into liquid gold ink, and finally heat curing the coating. The gold coating applied in this manner is highly reflective and does not degrade when used for an extended period of time in an environment having a temperature over 1000.degree. F. Depending on the application, a portion of the gold coating covering the tip of the thermocouple sheath is removed by abrasion.

  3. Zonation of primary haloes of Atud auriferous quartz vein deposit, Central Eastern Desert of Egypt: A potential exploration model targeting for hidden mesothermal gold deposits

    NASA Astrophysics Data System (ADS)

    Harraz, Hassan Z.; Hamdy, Mohamed M.

    2015-01-01

    The Atud gold mine located in the Neoproterozoic diorite and metagabbro of the Central Eastern Desert of Egypt has been initially excavated during Pharaonic times. Between 1953 and 1969, the Egyptian Geological Survey and Mining Authority performed underground prospection in the auriferous quartz vein and metasomatic alteration zones in the main Atud area, estimating a principal gold lode of 19,000 tones (16.28 g/ton), and 1600 tons of damp (1.24 g/ton). Yet the potentiality of the deposit has not been exhausted. However, for exploration of hidden ore, quantitative characterization using trace elements zoning of mineralization haloes with 280 samples from surface and three underground mining levels is applied. This was through multivariate statistical analysis (Factor analysis) of 11 selected trace elements. Axial (vertical) extents of primary haloes above and beneath gently dipping orebody are also visualized to interpret the level of erosion, determine the direction of mineralizing solutions as well as to examine whether the hidden orebody is promising at the Atud mine. Axial zones of primary dispersion aureoles of trace elements are: Ag, As, S and U around the auriferous quartz veins; Cu, and Pb in the surface horizons; and Zn, Ni, Co, and U along the lower margin of mineralization zone. Gold contents in bedrock and quartz vein samples from level-42M are the highest (5.7 and 40.3 ppm, respectively). In the transverse (lateral) direction, the maximum relative accumulation of Au and Zn occurs at the Northern Shaft; Pb, Cu, As, and U at the Main Shaft; and Ag, S, Co, and Ni at the Southern Shaft. The estimated axial zonation sequence of indicator elements using the variability index is Pb → Cu → Ag → Au → As → S → Ni → Co → U → Zn. According to this zonation, an index such as (Pb × Cu)D/(U × Zn)D can be a significant for predicting the Au potentiality at a particular depth. In addition, the Pb/U zonality index is an appropriate indicator for the

  4. Gold Fever! Seattle Outfits the Klondike Gold Rush. Teaching with Historic Places.

    ERIC Educational Resources Information Center

    Blackburn, Marc K.

    This lesson is based on the National Register of Historic Places registration file, "Pioneer Square Historic District," and other sources about Seattle (Washington) and the Klondike Gold Rush. The lesson helps students understand how Seattle exemplified the prosperity of the Klondike Gold Rush after 1897 when news of a gold strike in…

  5. Gold nanorod plasmonic upconversion microlaser.

    PubMed

    Shi, Ce; Soltani, Soheil; Armani, Andrea M

    2013-01-01

    Plasmonic-photonic interactions have stimulated significant interdisciplinary interest, leading to rapid innovations in solar design and biosensors. However, the development of an optically pumped plasmonic laser has failed to keep pace due to the difficulty of integrating a plasmonic gain material with a suitable pump source. In the present work, we develop a method for coating high quality factor toroidal optical cavities with gold nanorods, forming a photonic-plasmonic laser. By leveraging the two-photon upconversion capability of the nanorods, lasing at 581 nm with a 20 μW threshold is demonstrated.

  6. Precision gold conductors for HMCs

    NASA Astrophysics Data System (ADS)

    Widmer, M. R.

    1994-08-01

    Ti/Pd/Au multiple code coded switch (MCCS) networks were built and compared to Cr/Au MCCS networks. The data showed no measurable difference between the two systems. Interface resistance of both types of networks was measured as a diagnostic aid to determine if hydrogen was affecting the Ti/Pd/Au MCCS networks. The data showed that although hydrogen does affect Ti/Pd/Au, the changes are not significant with respect to MCCS environments. An evaluation of several proprietary gold electroplating solutions for use in the production of Ti/Pd/Au conductors was performed. All the testing results were comparable to the current product requirements.

  7. 25 CFR 214.8 - Acreage limitation.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... excess of the following areas: (a) For deposits of the nature of lodes, or veins containing ores of gold, silver, copper, or other useful metals, 640 acres. (b) For beds of placer gold, gypsum,...

  8. 25 CFR 214.8 - Acreage limitation.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... excess of the following areas: (a) For deposits of the nature of lodes, or veins containing ores of gold, silver, copper, or other useful metals, 640 acres. (b) For beds of placer gold, gypsum,...

  9. 25 CFR 214.8 - Acreage limitation.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... excess of the following areas: (a) For deposits of the nature of lodes, or veins containing ores of gold, silver, copper, or other useful metals, 640 acres. (b) For beds of placer gold, gypsum,...

  10. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry..., Silver, and Platinum Industry Products (a) Exemptions recognized in the industry and not to be considered... in any assay for quality of a silver industry product include screws, rivets, springs, spring...

  11. 16 CFR Appendix to Part 23 - Exemptions Recognized in the Assay for Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Quality of Gold Alloy, Gold Filled, Gold Overlay, Rolled Gold Plate, Silver, and Platinum Industry..., Silver, and Platinum Industry Products (a) Exemptions recognized in the industry and not to be considered... in any assay for quality of a silver industry product include screws, rivets, springs, spring...

  12. A Placer-Gold Evaluation Exercise.

    ERIC Educational Resources Information Center

    Tunley, A. Tom

    1984-01-01

    A laboratory exercise allowing students to use drillhole data to simulate the process of locating a placer gold paystreak is presented. As part of the activity students arithmetically compute the value of their gold, mining costs, and personal profits or losses, and decide on development plans for the claim. (BC)

  13. RF Sputtering of Gold Contacts On Niobium

    NASA Technical Reports Server (NTRS)

    Barr, D. W.

    1983-01-01

    Reliable gold contacts are deposited on niobium by combination of RF sputtering and photolithography. Process results in structures having gold only where desired for electrical contact. Contacts are stable under repeated cycling from room temperature to 4.2 K and show room-temperature contact resistance as much as 40 percent below indium contacts made by thermalcompression bonding.

  14. Sesquicentennial: Gold Rush to Golden Statehood.

    ERIC Educational Resources Information Center

    Sabato, George

    1998-01-01

    Provides an annotated bibliography of educational resources that can be used to support instructional units on the Gold Rush or the sesquicentennial of California's statehood. The materials include workbooks, videos, teacher's guides, monographs, and magazines. Offers a brief history of the Gold Rush and a set of relevant discussion questions.…

  15. Gold-nickel-titanium brazing alloy

    DOEpatents

    Mizuhara, Howard

    1990-07-03

    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99% gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  16. The Gold Mining Camp: A Simulation Game.

    ERIC Educational Resources Information Center

    Stoltman, Joseph P.; Keach, Everett T., Jr.

    This economics simulation game complements the third grade Gold Mining Unit developed by Project Social Studies at the University of Minnesota. The simulation is designed for three purposes: 1) to reinforce the prior learning which occurs in the gold mining camp unit; 2) to involve eight-year-olds in the process of solving simulated economic…

  17. Gold-nickel-titanium brazing alloy

    DOEpatents

    Mizuhara, Howard

    1995-01-03

    A brazing alloy in accordance with this invention has the following composition, by weight: 91 to 99 gold, 0.5 to 7% nickel; 0.10 to 2% titanium. Alternatively, with palladium present, the composition is as follows, by weight: 83 to 96% gold; 3 to 10% palladium; 0.5 to 5% nickel; 0.10 to 2% titanium.

  18. Gold-Collar Workers. ERIC Digest.

    ERIC Educational Resources Information Center

    Wonacott, Michael E.

    The gold-collar worker has problem-solving abilities, creativity, talent, and intelligence; performs non-repetitive and complex work difficult to evaluate; and prefers self management. Gold-collar information technology workers learn continually from experience; recognize the synergy of teams; can demonstrate leadership; and are strategic thinkers…

  19. Gold of the Pharaohs 6000 years of gold mining in Egypt and Nubia

    NASA Astrophysics Data System (ADS)

    Klemm, Dietrich; Klemm, Rosemarie; Murr, Andreas

    2001-08-01

    The legendary wealth in gold of ancient Egypt seems to correspond with an unexpected high number of gold production sites in the Eastern Desert of Egypt and Nubia. This contribution introduces briefly the general geology of these vast regions and discusses the geology of the different varieties of the primary gold occurrences (always related to auriferous quartz mineralization in veins or shear zones) as well as the variable physico-chemical genesis of the gold concentrations. The development of gold mining over time, from Predynastic (ca. 3000 BC) until the end of Arab gold production times (about 1350 AD), including the spectacular Pharaonic periods is outlined, with examples of its remaining artefacts, settlements and mining sites in remote regions of the Eastern Desert of Egypt and Nubia. Finally, some estimates on the scale of gold production are presented.

  20. Preparation of conductive gold nanowires in confined environment of gold-filled polymer nanotubes.

    PubMed

    Mitschang, Fabian; Langner, Markus; Vieker, Henning; Beyer, André; Greiner, Andreas

    2015-02-01

    Continuous conductive gold nanofibers are prepared via the "tubes by fiber templates" process. First, poly(l-lactide) (PLLA)-stabilized gold nanoparticles (AuNP) with over 60 wt% gold are synthesized and characterized, including gel permeation chromatography coupled with a diode array detector. Subsequent electrospinning of these AuNP with template PLLA results in composite nanofibers featuring a high gold content of 57 wt%. Highly homogeneous gold nanowires are obtained after chemical vapor deposition of 345 nm of poly(p-xylylene) (PPX) onto the composite fibers followed by pyrolysis of the polymers at 1050 °C. The corresponding heat-induced transition from continuous gold-loaded polymer tubes to smooth gold nanofibers is studied by transmission electron microscopy and helium ion microscopy using both secondary electrons and Rutherford backscattered ions.

  1. Gold emissivities for hydrocode applications

    NASA Astrophysics Data System (ADS)

    Bowen, C.; Wagon, F.; Galmiche, D.; Loiseau, P.; Dattolo, E.; Babonneau, D.

    2004-10-01

    The Radiom model [M. Busquet, Phys Fluids B 5, 4191 (1993)] is designed to provide a radiative-hydrodynamic code with non-local thermodynamic equilibrium (non-LTE) data efficiently by using LTE tables. Comparison with benchmark data [M. Klapisch and A. Bar-Shalom, J. Quant. Spectrosc. Radiat. Transf. 58, 687 (1997)] has shown Radiom to be inaccurate far from LTE and for heavy ions. In particular, the emissivity was found to be strongly underestimated. A recent algorithm, Gondor [C. Bowen and P. Kaiser, J. Quant. Spectrosc. Radiat. Transf. 81, 85 (2003)], was introduced to improve the gold non-LTE ionization and corresponding opacity. It relies on fitting the collisional ionization rate to reproduce benchmark data given by the Averroès superconfiguration code [O. Peyrusse, J. Phys. B 33, 4303 (2000)]. Gondor is extended here to gold emissivity calculations, with two simple modifications of the two-level atom line source function used by Radiom: (a) a larger collisional excitation rate and (b) the addition of a Planckian source term, fitted to spectrally integrated Averroès emissivity data. This approach improves the agreement between experiments and hydrodynamic simulations.

  2. Switchable imbibition in nanoporous gold

    PubMed Central

    Xue, Yahui; Markmann, Jürgen; Duan, Huiling; Weissmüller, Jörg; Huber, Patrick

    2014-01-01

    Spontaneous imbibition enables the elegant propelling of nano-flows because of the dominance of capillarity at small length scales. The imbibition kinetics are, however, solely determined by the static host geometry, the capillarity, and the fluidity of the imbibed liquid. This makes active control particularly challenging. Here we show for aqueous electrolyte imbibition in nanoporous gold that the fluid flow can be reversibly switched on and off through electric potential control of the solid–liquid interfacial tension, that is, we can accelerate the imbibition front, stop it, and have it proceed at will. Simultaneous measurements of the mass flux and the electrical current allow us to document simple scaling laws for the imbibition kinetics, and to explore the charge transport in the metallic nanopores. Our findings demonstrate that the high electric conductivity along with the pathways for fluid/ionic transport render nanoporous gold a versatile, accurately controllable electrocapillary pump and flow sensor for minute amounts of liquids with exceptionally low operating voltages. PMID:24980062

  3. The interaction of gold with gallium arsenide

    NASA Technical Reports Server (NTRS)

    Weizer, Victor G.; Fatemi, Navid S.

    1988-01-01

    Gold and gold-based alloys, commonly used as solar-cell contact materials, are known to react readily with gallium arsenide. Experiments designed to identify the mechanisms involved in these GaAs-metal interactions have yielded several interesting results. It is shown that the reaction of GaAs with gold takes place via a dissociative diffusion process. It is shown further that the GaAs-metal reaction rate is controlled to a very great extent by the condition of the free surface of the contact metal, an interesting example of which is the previously unexplained increase in the reaction rate that has been observed for samples annealed in a vacuum environment as compared to those annealed in a gaseous ambient. A number of other hard-to-explain observations, such as the low-temperature formation of voids in the gold lattice and crystallite growth on the gold surface, are also explained by invoking this mechanism.

  4. Synthesis of camptothecin-loaded gold nanomaterials

    NASA Astrophysics Data System (ADS)

    Xing, Zhimin; Liu, Zhiguo; Zu, Yuangang; Fu, Yujie; Zhao, Chunjian; Zhao, Xiuhua; Meng, Ronghua; Tan, Shengnan

    2010-04-01

    Camptothecin-loaded gold nanomaterials have been synthesized by the sodium borohydride reduction method under a strong basic condition. The obtained gold nanomaterials have been characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM) and UV-vis absorption spectroscopy. The camptothecin-loaded gold colloidal solution was very stable and can be stored for more than two months at room temperature without obvious changes. The color of the colloidal solution can change from wine red to purple and blue during the acidifying process. It was revealed that the release of camptothecin and the aggregation of gold nanoparticles can be controlled by tuning the solution pH. The present study implied that the gold nanomaterials can be used as the potential carrier for CPT delivery.

  5. Ordering Gold Nanoparticles with DNA Origami Nanoflowers.

    PubMed

    Schreiber, Robert; Santiago, Ibon; Ardavan, Arzhang; Turberfield, Andrew J

    2016-08-23

    Nanostructured materials, including plasmonic metamaterials made from gold and silver nanoparticles, provide access to new materials properties. The assembly of nanoparticles into extended arrays can be controlled through surface functionalization and the use of increasingly sophisticated linkers. We present a versatile way to control the bonding symmetry of gold nanoparticles by wrapping them in flower-shaped DNA origami structures. These "nanoflowers" assemble into two-dimensonal gold nanoparticle lattices with symmetries that can be controlled through auxiliary DNA linker strands. Nanoflower lattices are true composites: interactions between the gold nanoparticles are mediated entirely by DNA, and the DNA origami will fold into its designed form only in the presence of the gold nanoparticles.

  6. Tailored nanoporous gold for ultrahigh fluorescence enhancement.

    PubMed

    Lang, X Y; Guan, P F; Fujita, T; Chen, M W

    2011-03-07

    We report molecular fluorescence enhancement of free-standing nanoporous gold in which the nanoporosity can be arbitrarily tailored by the combination of dealloying and electroless gold plating. The nanoporous gold fabricated by this facile method possesses unique porous structures with large gold ligaments and very small pores, and exhibits significant improvements in surface enhanced fluorescence as well as structure rigidity. It demonstrates that the confluence effect of improved quantum yield and excitation of fluorophores is responsible for the large fluorescence enhancement due to the near-field enhancement of nanoporous gold, which arises from the strong electromagnetic coupling between neighboring ligaments and the weakening of plasmon damping of the large ligaments because of the small pore size and large ligament size, respectively.

  7. Magnetically mediated vortexlike assembly of gold nanoshells.

    PubMed

    Sun, Jianfei; Dong, Jian; Sun, Dongke; Guo, Zhirui; Gu, Ning

    2012-04-24

    Gold nanoshells currently attract increasing research interests due to the important role in many subjects. For practical applications, random arrangement of the nanoparticles is often unfavored so that the assembly of gold nanoshells is becoming a central issue. We here proposed to utilize time-variant magnetic field to direct the assembly of gold nanoshells. It was discovered that the alternating magnetic field can mediate the vortex-like assembly of gold nanoshells. The mechanism was explored and thought to be relative with the electric field of induction which caused the thermal gradient on the substrate and the electric force. The vortexlike structure as well as the assembly mechanism will play an important role in research and application of gold nanomaterials.

  8. Molecular Beam Optical Study of Gold Sulfide and Gold Oxide

    NASA Astrophysics Data System (ADS)

    Zhang, Ruohan; Yu, Yuanqin; Steimle, Timothy

    2016-06-01

    Gold-sulfur and gold-oxygen bonds are key components to numerous established and emerging technologies that have applications as far ranging as medical imaging, catalysis, electronics, and material science. A major theoretical challenge for describing this bonding is correctly accounting for the large relativistic and electron correlation effects. Such effects are best studied in diatomic, AuX, molecules. Recently, the observed AuS electronic state energy ordering was measured and compared to a simple molecular orbital diagram prediction. Here we more thoroughly investigate the nature of the electronic states of both AuS and AuO from the analysis of high-resolution (FWHM\\cong35MHz) optical Zeeman spectroscopy of the (0,0){B}2Σ--{X}2Π3/2 bands. The determined fine and hyperfine parameters for the {B}2Σ- state of AuO differ from those extracted from the analysis of a hot, Doppler-limited, spectrum. It is demonstrated that the nature of the {B}2Σ- states of AuO and AuS are radically different. The magnetic tuning of AuO and AuS indicates that the {B}2Σ- states are heavily contaminated. Supported by the National Science Foundation under Grant No.1265885. D. L. Kokkin, R. Zhang, T. C. Steimle, I. A. Wyse, B. W. Pearlman and T. D. Varberg, J. Phys. Chem. A., 119(48), 4412, 2015. L. C. O'Brien, B. A. Borchert, A. Farquhar, S. Shaji, J. J. O'Brien and R. W. Field, J. Mol. Spectrosc., 252(2), 136, 2008

  9. Gold's future role in fuel cell systems

    NASA Astrophysics Data System (ADS)

    Cameron, Don; Holliday, Richard; Thompson, David

    Innovative recent research has suggested that gold-based catalysts are potentially capable of being effectively employed in fuel cells and related hydrogen fuel processing. The justification for developing the gold catalyst technologies described, is not only based on their promising technical performance, but also the relatively low stable price and greater availability of gold compared with the platinum group metals. The employment of gold catalysts could therefore produce a welcome reduction in the capital cost of fuel cell installations. The most likely first use for gold catalysts is for the removal of carbon monoxide impurities from the hydrogen feedstock streams used for fuel cells. Such hydrogen is usually obtained from reforming reactions (from hydrocarbons or methanol) either from free-standing plant or from an on-board reformer in a vehicle in the case of transport applications. Absence of carbon monoxide would enable fuel cells to run at lower temperatures and with improved efficiency. Effectiveness of gold catalysts in this application has already been demonstrated. Preferential oxidation (PROX) of carbon monoxide in hydrogen-rich reformer gas is best effected by a gold catalyst (Au/α-Fe 2O 3) which is significantly more active at lower temperatures than the commercial PROX catalyst, i.e. Pt/γ-Al 2O 3 currently used for this purpose. Supported gold catalysts are also very active in the water gas shift reaction used for producing hydrogen from carbon monoxide and water. Research has shown that gold supported on iron oxide (Au/α-Fe 2O 3) catalyst is more active at lower temperatures than both the α-Fe 2O 3 support and the mixed copper/zinc oxide (CuO/ZnO) catalyst currently used commercially. Preparation of gold on iron oxide and gold on titania (Au/Fe 2O 3 and Au/TiO 2) by deposition-precipitation produces more active catalysts than by conventional co-precipitation. Other applications for gold in fuel cells are described and include its use as a

  10. Coal-gold agglomeration: an alternative separation process in gold recovery

    SciTech Connect

    Akcil, A.; Wu, X.Q.; Aksay, E.K.

    2009-07-01

    Considering the increasing environmental concerns and the potential for small gold deposits to be exploited in the future, the uses of environmentally friendly processes are essential. Recent developments point to the potential for greatly increased plant performance through a separation process that combines the cyanide and flotation processes. In addition, this kind of alternative treatment processes to the traditional gold recovery processes may reduce the environmental risks of present small-scale gold mining. Gold recovery processes that applied to different types of gold bearing ore deposits show that the type of deposits plays an important role for the selection of mineral processing technologies in the production of gold and other precious metals. In the last 25 years, different alternative processes have been investigated on gold deposits located in areas where environmental issues are a great concern. In 1988, gold particles were first recovered by successful pilot trial of coal-gold agglomeration (CGA) process in Australia. The current paper reviews the importance of CGA in the production of gold ore and identifies areas for further development work.

  11. Exposure to metallic gold in patients with contact allergy to gold sodium thiosulfate.

    PubMed

    Ahnlide, I; Björkner, B; Bruze, M; Möller, H

    2000-12-01

    Gold allergy is common, with approximately 10% of patients patch tested because of eczematous disease being positive to gold sodium thiosulfate (GSTS). However, clinical relevance seems to be rare. The aim of this prospective double-blind study was to demonstrate the effects of exposure to metallic gold, in this case earrings, in gold-positive patients. 60 female patients with pierced earlobes test-positive to GSTS were included in the study. The patients were randomized into 2 groups, 30 patients receiving earrings with a surface layer consisting of 24-carat gold and 30 patients earrings with a surface layer of titanium nitride, virtually indistinguishable from gold. The patients wore the earrings for 8 weeks. During the study, any dermatitis on the earlobes, as well as on other body sites, was registered. The skin reactions observed were weak but, in total, 17 of the 60 patients had a skin reaction (local or remote) during the study, 12 of whom had received gold earrings and 5 titanium (p<0.05). 11 patients had a reaction on the earlobes, 7 of whom had received gold earrings and 4 titanium (NS). With these facts it is hard to exclude that exposure to gold jewelry can be clinically relevant in persons hypersensitive to gold.

  12. Gold-catalyzed naphthalene functionalization

    PubMed Central

    Rivilla, Iván

    2011-01-01

    Summary The complexes IPrMCl (IPr = 1,3-bis(diisopropylphenyl)imidazol-2-ylidene, M = Cu, 1a; M = Au, 1b), in the presence of one equiv of NaBAr'4 (Ar' = 3,5-bis(trifluoromethyl)phenyl), catalyze the transfer of carbene groups: C(R)CO2Et (R = H, Me) from N2C(R)CO2Et to afford products that depend on the nature of the metal center. The copper-based catalyst yields exclusively a cycloheptatriene derivative from the Buchner reaction, whereas the gold analog affords a mixture of products derived either from the formal insertion of the carbene unit into the aromatic C–H bond or from its addition to a double bond. In addition, no byproducts derived from carbene coupling were observed. PMID:21647320

  13. Gold nanoparticles in cardiovascular imaging.

    PubMed

    Varna, Mariana; Xuan, Hoa V; Fort, Emmanuel

    2017-04-06

    Although originally applied in the field of oncology, recent results have illustrated the considerable potential of gold nanoparticles (GNPs) in the imaging of cardiovascular diseases (CVDs). CVDs represent the leading cause of mortality and disability in the world. The principal cause underpinning CVDs is atherosclerosis, which develops into mid and large blood vessels, often leading to severe complications. Thanks to their unique physicochemical properties, GNPs have drawn much attention from the research community in cardiovascular imaging. Thus, the optical properties of GNPs have led to their utilization as contrast agents for optical or X-ray imaging modalities allowing the detection of atherosclerotic plaques, intravascular thrombus, or fibrotic tissue. In this study, we detail the most promising preclinical scientific progresses based on the use of GNPs for imaging in cardiovascular field and their improvements for a potential clinical application. For further resources related to this article, please visit the WIREs website.

  14. Cancer theranostics with gold nanoshells.

    PubMed

    Zhao, Jun; Wallace, Michael; Melancon, Marites P

    2014-09-01

    Gold nanoshells (AuNSs) present a vivid example of integrating nanoscience in order to solve a biomedical problem. AuNSs exhibit tunable surface plasmon resonance, which can be tuned to the near-infrared region in order to realize optimal tissue penetration. The highly efficient light-to-heat transformation by AuNSs during laser irradiation causes thermal damage to the tumor without damaging healthy organs. Transient nanobubbles can form around AuNSs during laser treatment and induce mechanical stress specifically in tumor cells. AuNSs also serve as a versatile platform for the delivery of various diagnostic and therapeutic agents. In this article, we describe the physicochemical properties of AuNSs in the context of their design, preparation and application in cancer theranostics. Ultimately, we look beyond the current research on AuNSs and discussed future challenges to their successful translation into clinical use.

  15. Annealing of gold nanostructures sputtered on polytetrafluoroethylene

    PubMed Central

    2011-01-01

    Gold nanolayers sputtered on polytetrafluoroethylene (PTFE) surface and their changes induced by post-deposition annealing at 100°C to 300°C are studied. Changes in surface morphology and roughness are examined by atomic force microscopy, electrical sheet resistance by two point technique, zeta potential by electrokinetic analysis and chemical composition by X-ray photoelectron spectroscopy (XPS) in dependence on the gold layer thickness. Transition from discontinuous to continuous gold coverage takes place at the layer thicknesses 10 to 15 nm and this threshold remains practically unchanged after the annealing at the temperatures below 200°C. The annealing at 300°C, however, leads to significant rearrangement of the gold layer and the transition threshold increases to 70 nm. Significant carbon contamination and the presence of oxidized structures on gold-coated samples are observed in XPS spectra. Gold coating leads to a decrease in the sample surface roughness. Annealing at 300°C of pristine PTFE and gold-coated PTFE results in significant increase of the sample surface roughness. PMID:22078024

  16. Functionalization of gold nanoparticles as antidiabetic nanomaterial

    NASA Astrophysics Data System (ADS)

    Venkatachalam, M.; Govindaraju, K.; Mohamed Sadiq, A.; Tamilselvan, S.; Ganesh Kumar, V.; Singaravelu, G.

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS, FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0 mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p < 0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5 mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  17. Gold nano-particles fixed on glass

    NASA Astrophysics Data System (ADS)

    Worsch, Christian; Wisniewski, Wolfgang; Kracker, Michael; Rüssel, Christian

    2012-09-01

    A simple process for producing wear resistant gold nano-particle coatings on transparent substrates is proposed. Soda-lime-silica glasses were sputtered with gold and subsequently coated with SiO2 using a combustion chemical vapor deposition technique. Some samples were first coated with silica, sputtered with gold and then coated with a second layer of silica. The samples were annealed for 20 min at either 550 or 600 °C. This resulted in the formation of round, well separated gold nano-particles with sizes from 15 to 200 nm. The color of the coated glass was equivalent to that of gold-ruby glasses. Silica/gold/silica coatings annealed at 600 °C for 20 min were strongly adherent and scratch resistant. X-ray diffraction and electron backscatter diffraction (EBSD) were used to describe the crystal orientations of the embedded particles. The gold particles are preferably oriented with their (1 1 1) planes perpendicular to the surface.

  18. Gold metal liquid-like droplets.

    PubMed

    Smirnov, Evgeny; Scanlon, Micheál D; Momotenko, Dmitry; Vrubel, Heron; Méndez, Manuel A; Brevet, Pierre-Francois; Girault, Hubert H

    2014-09-23

    Simple methods to self-assemble coatings and films encompassing nanoparticles are highly desirable in many practical scenarios, yet scarcely any examples of simple, robust approaches to coat macroscopic droplets with continuous, thick (multilayer), reflective and stable liquid nanoparticle films exist. Here, we introduce a facile and rapid one-step route to form films of reflective liquid-like gold that encase macroscopic droplets, and we denote these as gold metal liquid-like droplets (MeLLDs). The present approach takes advantage of the inherent self-assembly of gold nanoparticles at liquid-liquid interfaces and the increase in rates of nanoparticle aggregate trapping at the interface during emulsification. The ease of displacement of the stabilizing citrate ligands by appropriate redox active molecules that act as a lubricating molecular glue is key. Specifically, the heterogeneous interaction of citrate stabilized aqueous gold nanoparticles with the lipophilic electron donor tetrathiafulvalene under emulsified conditions produces gold MeLLDs. This methodology relies exclusively on electrochemical reactions, i.e., the oxidation of tetrathiafulvalene to its radical cation by the gold nanoparticle, and electrostatic interactions between the radical cation and nanoparticles. The gold MeLLDs are reversibly deformable upon compression and decompression and kinetically stable for extended periods of time in excess of a year.

  19. Gold nanoparticles produced in a microalga

    NASA Astrophysics Data System (ADS)

    Luangpipat, Tiyaporn; Beattie, Isabel R.; Chisti, Yusuf; Haverkamp, Richard G.

    2011-12-01

    An efficient biological route to production of gold nanoparticles which allows the nanoparticles to be easily recovered remains elusive. Live cells of the green microalga Chlorella vulgaris were incubated with a solution of gold chloride and harvested by centrifugation. Nanoparticles inside intact cells were identified by transmission electron microscopy and confirmed to be metallic gold by synchrotron based X-ray powder diffraction and X-ray absorption spectroscopy. These intracellular gold nanoparticles were 40-60 nm in diameter. At a concentration of 1.4% Au in the alga, a better than 97% recovery of the gold from solution was achieved. A maximum of 4.2% Au in the alga was obtained. Exposure of C. vulgaris to solutions containing dissolved salts of palladium, ruthenium, and rhodium also resulted in the production of the corresponding nanoparticles within the cells. These were surmised to be also metallic, but were produced at a much lower intracellular concentration than achieved with gold. Iridium was apparently toxic to the alga. No nanoparticles were observed using platinum solutions. C. vulgaris provides a possible route to large scale production of gold nanoparticles.

  20. Functionalization of gold nanoparticles as antidiabetic nanomaterial.

    PubMed

    Venkatachalam, M; Govindaraju, K; Mohamed Sadiq, A; Tamilselvan, S; Ganesh Kumar, V; Singaravelu, G

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS,FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p<0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  1. Nature vs. nurture: gold perpetuates "stemness".

    PubMed

    Paul, Willi; Sharma, Chandra P; Deb, Kaushik Dilip

    2011-01-01

    Adult tissues contain quiescent reservoirs of multipotent somatic stem cells and pluripotent embryonic-like stem cells (ELSCs). Credited with regenerative properties gold is used across both -contemporary and -ancient medicines. Here, we show that gold exerted these effects by enhancing the pool of pluripotent ELSC while improving their stemness. We used hESCs as an in-vitro model to understand if gold could enhance self-renewal and pluripotency. Swarna-bhasma (SB), an ancient Indian gold microparticulate (41.1 nm), preparation, reduced spontaneous-differentiation, improved self-renewal, pluripotency and proliferation of hESCs. Colloidal gold-nanoparticles (GNP) (15.59 nm) were tested to confirm that the observations were attributable to nanoparticulate-gold. SB and GNP exposure: maintained -stemness, -karyotypic stability, enhanced pluripotency till day-12, increased average colony-sizes, and reduced the number of autonomously-derived differentiated FGFR1 positive fibroblast-niche-cells/colony. Particulate-gold induced upregulation of FGFR1 and IGF2 expression, and decrease in IGF1 secretion indicates IGF1/2 mediated support for enhanced pluripotency and self-renewal in hESCs.

  2. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE PAGES

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  3. Alkanetelluroxide-protected gold nanoparticles.

    PubMed

    Li, Ying; Silverton, Latoya C; Haasch, Richard; Tong, Yu Ye

    2008-07-15

    The synthesis and characterization of the first air-stable tellurium-containing ligand-protected gold nanoparticles (NPs) are reported. Although the synthesis largely followed the well-known Brust two-phase approach, the starting ligand was dioctyl ditelluride rather than alkanetellurol, which is an analogue of the widely used alkanethiol. Dioctyl ditelluride was used because alkanetellurol is unstable. The 1H and 13C NMR spectra, as well as infrared spectra (IR) of the formed Au NPs, indicated that the Te-Te bond in the starting ligand was broken but the octyl group was intact. This was further corroborated by the solid-state 125Te NMR spectrum that displayed a very broad and significantly downfield-shifted peak, indicating that tellurium was directly bound to the Au core. Furthermore, the O 1s and Te 3d XPS spectra of the Au NPs indicated that the capping ligands were octanetelluroxide. An average particle size of 2.7 nm diameter as measured by transmission electron microscopy (TEM) corresponded to an Au607 core. A two-step weight loss of approximately 22.2% in total was observed in the thermogravimetric analysis, which indicated about 53% ligand monolayer coverage (i.e., Au607(Te(=O)C8H17)133). Additionally, dioctyl ditelluride demonstrated an intriguing reductive power that led to a more sophisticated chemistry of forming the air-stable octanetelluroxide-protected gold NPs. It has been found that (1) when the ratio of Au to Te was about 1.5 a colorless intermediate state similar to Au(I)-SR (the intermediate state widely accepted in the synthesis of thiolate-protected Au NPs) could be obtained and (2) this kind of intermediate state played a key role in the formation of stable Au NPs.

  4. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  5. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  6. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  7. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  8. 33 CFR 13.01-10 - Gold and silver bars.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Gold and silver bars. 13.01-10... DECORATIONS, MEDALS, RIBBONS AND SIMILAR DEVICES Gold and Silver Lifesaving Medals, Bars, and Miniatures § 13.01-10 Gold and silver bars. No person shall receive more than one Gold Lifesaving Medal and...

  9. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  10. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  11. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  12. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  13. 16 CFR 23.4 - Misrepresentation as to gold content.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Misrepresentation as to gold content. 23.4... JEWELRY, PRECIOUS METALS, AND PEWTER INDUSTRIES § 23.4 Misrepresentation as to gold content. (a) It is unfair or deceptive to misrepresent the presence of gold or gold alloy in an industry product, or...

  14. Colloidal-gold electrosensor measuring device

    DOEpatents

    Wegner, S.; Harpold, M.A.; McCaffrey, T.M.; Morris, S.E.; Wojciechowski, M.; Zhao, J.; Henkens, R.W.; Naser, N.; O`Daly, J.P.

    1995-11-21

    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 {micro}g/dL in blood samples as small as 10 {micro}L. 9 figs.

  15. Colloidal-gold electrosensor measuring device

    DOEpatents

    Wegner, Steven; Harpold, Michael A.; McCaffrey, Terence M.; Morris, Susan E.; Wojciechowski, Marek; Zhao, Junguo; Henkens, Robert W.; Naser, Najih; O'Daly, John P.

    1995-01-01

    The present invention provides a new device for use in measuring lead levels in biological and environmental samples. Using square wave coulometry and colloidal gold particles impregnated on carbon electrodes, the present invention provides a rapid, reliable, portable and inexpensive means of detecting low lead levels. The colloidal gold modified electrodes have microelectrode array characteristics and produce significantly higher stripping detection signals for lead than are produced at bulk gold electrode surfaces. The method is effective in determining levels of lead down to at least 5 .mu.g/dL in blood samples as small as 10 .mu.L.

  16. Designing hollow nano gold golf balls.

    PubMed

    Landon, Preston B; Mo, Alexander H; Zhang, Chen; Emerson, Chris D; Printz, Adam D; Gomez, Alan F; DeLaTorre, Christopher J; Colburn, David A M; Anzenberg, Paula; Eliceiri, Matthew; O'Connell, Connor; Lal, Ratnesh

    2014-07-09

    Hollow/porous nanoparticles, including nanocarriers, nanoshells, and mesoporous materials have applications in catalysis, photonics, biosensing, and delivery of theranostic agents. Using a hierarchical template synthesis scheme, we have synthesized a nanocarrier mimicking a golf ball, consisting of (i) solid silica core with a pitted gold surface and (ii) a hollow/porous gold shell without silica. The template consisted of 100 nm polystyrene beads attached to a larger silica core. Selective gold plating of the core followed by removal of the polystyrene beads produced a golf ball-like nanostructure with 100 nm pits. Dissolution of the silica core produced a hollow/porous golf ball-like nanostructure.

  17. Gold nanoparticles extraction from dielectric scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin

    2014-11-01

    The unique advantages such as brightness, non-photobleaching, good bio-compatibility make gold nanoparticles desirable labels and play important roles in biotech and related research and applications. Distinguishing gold nanoparticles from other dielectric scattering particles is of more importance, especially in bio-tracing and imaging. The enhancement image results from the localized surface plasmon resonance associated with gold nanopartilces makes themselves distinguishable from other dielectric particles, based on which, we propose a dual-wavelength detection method by employing a high sensitive cross-polarization microscopy.

  18. Electrochemical control of creep in nanoporous gold

    SciTech Connect

    Ye, Xing-Long; Jin, Hai-Jun

    2013-11-11

    We have investigated the mechanical stability of nanoporous gold (npg) in an electrochemical environment, using in situ dilatometry and compression experiments. It is demonstrated that the gold nano-ligaments creep under the action of surface stress which leads to spontaneous volume contractions in macroscopic npg samples. The creep of npg, under or without external forces, can be controlled electrochemically. The creep rate increases with increasing potential in double-layer potential region, and deceases to almost zero when the gold surface is adsorbed with oxygen. Surprisingly, we also noticed a correlation between creep and surface diffusivity, which links the deformation of nanocrystals to mobility of surface atoms.

  19. Electrically Conductive Polyimide Films Containing Gold Surface

    NASA Technical Reports Server (NTRS)

    Caplan, Maggie L.; Stoakley, Diane M.; St. Clair, Anne K.

    1994-01-01

    Polyimide films exhibiting high thermo-oxidative stability and including electrically conductive surface layers containing gold made by casting process. Many variations of basic process conditions, ingredients, and sequence of operations possible, and not all resulting versions of process yield electrically conductive films. Gold-containing layer formed on film surface during cure. These metallic gold-containing polyimides used in film and coating applications requiring electrical conductivity, high reflectivity, exceptional thermal stability, and/or mechanical integrity. They also find commercial potential in areas ranging from thin films for satellite antennas to decorative coatings and packaging.

  20. Gold deposit styles and placer gold characterisation in northern and east-central Madagascar

    USGS Publications Warehouse

    Pitfield, Peter E. J; Styles, Michael T.; Taylor, Cliff D.; Key, Roger M.; Bauer,; Ralison, A

    2009-01-01

    Microchemical characterisation of bedrock and placer gold grains from six gold districts within the Archaean domains and intervening Neoproterozoic Anaboriana-Manampotsy belt of northern and east-central Madagascar show few opaque inclusions (e.g pyrrhotite, Bi tellurides) but wide range of Ag contents (40wt%). Some districts exhibit multiple source populations of grains. The ‘greenstone belt’ terranes have an orogenic gold signature locally with an intrusion-related to epithermal overprint. Proterozoic metasediments with felsic to ultramafic bodies yield dominantly intrusion-related gold. A high proportion of secondary gold (<0.5wt% Ag) is related to recycling of paleoplacers and erosion of post-Gondwana planation surfaces and indicates that some mesothermal gold systems were already partially to wholly removed by erosion by the PermoTriassic.

  1. Gold nanodumbbell-seeded growth of silver nanobars and nanobipyramids

    NASA Astrophysics Data System (ADS)

    Deng, Jin-Pei; Chen, Chih-Wei; Hsieh, Wei-Chi; Wang, Chao-Hsien; Hsu, Cheng-Yung; Lin, Jyun-Hao

    2014-03-01

    Gold nanodumbbells (NDs) are prepared by the reduction of gold ions in the presence of gold nanorods. Gold NDs are then employed for the synthesis of gold-silver core-shell nanoparticles (Au@Ag NPs). The quasi-ellipsoidal NPs could be found at room temperature, but Au@Ag bar and triangular bipyramid (TBP) NPs were obtained at 75 °C. Our results show that the long ends of gold NDs are in the position of the bar center and closely paralleled the shorter edge of TBP. Mechanisms in the growth of silver on gold NDs are proposed for the formations of these Au@Ag NPs.

  2. Gold and gold-iron oxide magnetic glyconanoparticles: synthesis, characterization and magnetic properties.

    PubMed

    de la Fuente, Jesús M; Alcántara, David; Eaton, Peter; Crespo, Patricia; Rojas, Teresa C; Fernandez, Asunción; Hernando, Antonio; Penadés, Soledad

    2006-07-06

    The preparation, characterization and the magnetic properties of gold and gold-iron oxide glyconanoparticles (GNPs) are described. Glyconanoparticles were prepared in a single step procedure in the presence of aqueous solution of thiol functionalized neoglycoconjugates and either gold salts or both gold and iron salts. Neoglycoconjugates of lactose and maltose disaccharides with different linkers were used. Iron-free gold or gold-iron oxide GNPs with controlled gold-iron ratios were obtained. The average core-size diameters are in the range of 1.5-2.5 nm. The GNPs are fully characterized by (1)H NMR spectrometry, transmission electron microscopy (TEM), and UV-vis and X-ray absorption (XAS) spectroscopies. Inductive plasma-atomic emission spectrometry (ICP) and elemental analysis gave the average number of neoglycoconjugates per cluster. The magnetic properties were measured in a SQUID magnetometer. The most remarkable results was the observation of a permanent magnetism up to room temperature in the iron-free gold GNPs, that was not present in the corresponding gold-iron oxide GNPs.

  3. Structural controls on Carlin-type gold mineralization in the gold bar district, Eureka County, Nevada

    USGS Publications Warehouse

    Yigit, O.; Nelson, E.P.; Hitzman, M.W.; Hofstra, A.H.

    2003-01-01

    The Gold Bar district in the southern Roberts Mountains, 48 km northwest of Eureka, Nevada, contains one main deposit (Gold Bar), five satellite deposits, and other resources. Approximately 0.5 Moz of gold have been recovered from a resource of 1,639,000 oz of gold in Carlin-type gold deposits in lower plate, miogeoclinal carbonate rocks below the Roberts Mountains thrust. Host rocks are unit 2 of the Upper Member of the Devonian Denay Formation and the Bartine Member of the McColley Canyon Formation. Spatial and temporal relations between structures and gold mineralization indicate that both pre-Tertiary and Tertiary structures were important controls on gold mineralization. Gold mineralization occurs primarily along high-angle Tertiary normal faults, some of which are reactivated reverse faults of Paleozoic or Mesozoic age. Most deposits are localized at the intersection of northwest- and northeast-striking faults. Alteration includes decalcification, and to a lesser extent, silicification along high-angle faults. Jasperoid (pervasive silicification), which formed along most faults and in some strata-bound zones, accounts for a small portion of the ore in every deposit. In the Gold Canyon deposit, a high-grade jasperoid pipe formed along a Tertiary normal fault which was localized along a zone of overturned fault-propagation folds and thrust faults of Paleozoic or Mesozoic age.

  4. Emergency Response to Gold King Mine Release

    EPA Pesticide Factsheets

    Description of August 5, 2015 release of contaminated waters from the Gold King Mine into Cement Creek and the Animas River, and the resulting emergency response remediation efforts, including monitoring of affected waterways.

  5. Novel Catalysis by Gold: A Modern Alchemy

    NASA Astrophysics Data System (ADS)

    Haruta, Masatake

    Gold has long been neglected as a catalyst because of its chemical inertness. However, when gold is deposited as nanoparticles on carbon and polymer materials as well as on base metal oxides and hydroxides, it exhibits unique catalytic properties for many reactions such as CO oxidation at a temperature as low as 200 K, gas phase direct epoxidation of propylene, and aerobic oxidation of glucose to gluconic acid. The structure-catalytic activity correlations are discussed with emphasis on the contact structure, support selection, and the size control of gold particles. Gold clusters with diameters smaller than 2 nm are expected to exhibit novel properties in catalysis, optics, and electronics depending on the size (number of atoms), shape, and the electronic and chemical interaction with the support materials. The above achievements and attempts can be regarded as a modern alchemy that creates valuables by means of the noblest element with little practical use.

  6. Anatomy of gold catalysts: facts and myths

    PubMed Central

    Ranieri, Beatrice; Escofet, Imma

    2015-01-01

    This review article covers the main types of gold(i) complexes used as precatalysts under homogeneous conditions in organic synthesis and discusses the different ways of catalyst activation as well as ligand, silver, and anion effects. PMID:26055272

  7. Aqueous Black Colloids of Reticular Nanostructured Gold

    NASA Astrophysics Data System (ADS)

    Stanca, S. E.; Fritzsche, W.; Dellith, J.; Froehlich, F.; Undisz, A.; Deckert, V.; Krafft, C.; Popp, J.

    2015-01-01

    Since ancient times, noble gold has continuously contributed to several aspects of life from medicine to electronics. It perpetually reveals its new features. We report the finding of a unique form of gold, reticular nanostructured gold (RNG), as an aqueous black colloid, for which we present a one-step synthesis. The reticules consist of gold crystals that interconnect to form compact strands. RNG exhibits high conductivity and low reflection, and these features, coupled with the high specific surface area of the material, could prove valuable for applications in electronics and catalysis. Due to high absorption throughout the visible and infrared domain, RNG has the potential to be applied in the construction of sensitive solar cells or as a substrate for Raman spectroscopy.

  8. Radiochemical separation of gold by amalgam exchange

    USGS Publications Warehouse

    Ruch, R.R.

    1970-01-01

    A rapid and simple method for the radiochemical separation of gold after neutron activation. The technique is based on treatment with a dilute indium-gold amalgam, both chemical reduction and isotopic exchange being involved. The counting efficiency for 198Au in small volumes of the amalgam is good. Few interferences occur and the method is applicable to clays, rocks, salts and metals. The possibility of determining silver, platinum and palladium by a similar method is mentioned. ?? 1970.

  9. Silver and gold-catalyzed multicomponent reactions

    PubMed Central

    Abbiati, Giorgio

    2014-01-01

    Summary Silver and gold salts and complexes mainly act as soft and carbophilic Lewis acids even if their use as σ-activators has been rarely reported. Recently, transformations involving Au(I)/Au(III)-redox catalytic systems have been reported in the literature. In this review we highlight all these aspects of silver and gold-mediated processes and their application in multicomponent reactions. PMID:24605168

  10. U. S. GEOLOGICAL SURVEY ALASKAN GOLD PROJECT.

    USGS Publications Warehouse

    Antweiler, John C.; Cathrall, John; Tripp, Richard

    1984-01-01

    The United States Geological Survey has begun a state-wide study of Alaskan gold deposits. The immediate goals are to determine the relationship of gold in placer deposits to possible primary sources, to determine how nuggets form, to contribute to existing knowledge of principles for prospecting for placer deposits, and determine if minerals associated with placer deposits might suggest important deposits of other metals. The project started in 1982 with a study of placer mines in the Brooks Range.

  11. Orientations of polyoxometalate anions on gold nanoparticles.

    PubMed

    Sharet, Shelly; Sandars, Ella; Wang, Yifeng; Zeiri, Offer; Neyman, Alevtina; Meshi, Louisa; Weinstock, Ira A

    2012-09-07

    Cryogenic transmission electron microscopy of polyoxometalate-protected gold nanoparticles reveals that the Preyssler ion, [NaP(5)W(30)O(110)](14-), lies "face down" with its C(5) axis perpendicular to the gold surface, while the Finke-Droege ion, [P(4)W(30)Zn(4)(H(2)O)(2)O(112)](16-), is "tilted", with its long axis close to 60° from the normal to the surface.

  12. Effective PEGylation of gold nanorods

    NASA Astrophysics Data System (ADS)

    Schulz, F.; Friedrich, W.; Hoppe, K.; Vossmeyer, T.; Weller, H.; Lange, H.

    2016-03-01

    Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to dramatically improve the ligand exchange and to synthesize PEGylated AuNR with high chemical and colloidal stability and high PEG grafting densities. Such AuNR are especially interesting for applications in nanomedicine.Standard procedures to coat gold nanorods (AuNR) with poly(ethylene glycol) (PEG)-based ligands are not reliable and high PEG-grafting densities are not achieved. In this work, the ligand exchange of AuNR with PEGMUA, a tailored PEG-ligand bearing a C10 alkylene spacer, is studied. PEGMUA provides AuNR with very high stability against oxidative etching with cyanide. This etching reaction is utilized to study the ligand exchange in detail. Ligand exchange is faster, less ligand consuming and more reproducible with assisting chloroform extraction. Compared to PEG ligands commonly used, PEGMUA provides much higher colloidal and chemical stability. Further analyses based on NMR-, IR- and UV/Vis-spectroscopy reveal that significantly higher PEG-grafting densities, up to ~3 nm-2, are obtained with PEGMUA. This demonstrates how the molecular structure of the PEG ligand can be used to

  13. The gold rush 1925-35.

    PubMed

    Keers, R Y

    1980-12-01

    Although from the time of Koch onwards there had been desultory experiments with a variety of gold preparations in the management of pulmonary tuberculosis, gold as a recognised and accepted treatment did not emerge until 1925. In that year Holger Mollgaard of Copenhagen introduced sanocrysin, a double thiosulphate of gold and sodium, with which he had conducted an extensive series of animal experiments. The results of these were considered to justify its use in clinical practice and two physicians, Secher and Faber, undeterred by its toxicity, reported enthusiastically in its favour. Other Danish physicians followed but, alarmed by violent reactions, modified the dosage, an example followed by British workers. Encouraging results continued to be reported although each series contained a significant proportion of failures, and toxicity remained high. The first properly planned and fully controlled clinical trial took place in the United States and produced a report which was wholly adverse and which sounded the death knell of gold therapy throughout America. Until 1934-35 gold was used extensively in Europe but thereafter there was a sudden and largely universal cessation of interest and within a few years gold, introduced with such éclat and carrying so many high hopes, had vanished from the therapy of tuberculosis even though, at that point, no better alternative was available.

  14. Acoustic vibrations of single suspended gold nanostructures

    NASA Astrophysics Data System (ADS)

    Major, Todd A.

    The acoustic vibrations for single gold nanowires and gold plates were studied using time-resolved ultrafast transient absorption. The objective of this work was to remove the contribution of the supporting substrate from the damping of the acoustic vibrations of the metal nano-objects. This was achieved by suspending the nano-objects across trenches created by photolithography and reactive ion etching. Transient absorption measurements for single suspended gold nanowires were initially completed in air and water environments. The acoustic vibrations for gold nanowires over the trench in air last typically for several nanoseconds, whereas gold nanowires in water are damped more quickly. Continuum mechanics models suggest that the acoustic impedance mismatch between air and water dominates the damping rate. Later transient absorption studies on single suspended gold nanowires were completed in glycerol and ethylene glycol environments. However, our continuum mechanical model suggests nearly complete damping in glycerol due to its high viscosity, but similar damping rates are seen between the two liquids. The continuum mechanics model thus incorrectly addresses high viscosity effects on the lifetimes of the acoustic vibrations, and more complicated viscoelastic interactions occur for the higher viscosity liquids. (Abstract shortened by UMI.).

  15. Gold mobility during Palaeoarchaean submarine alteration

    NASA Astrophysics Data System (ADS)

    Hofmann, Axel; Pitcairn, Iain; Wilson, Allan

    2017-03-01

    Seafloor alteration provides large amounts of solutes to the hydrosphere. In order to investigate gold mobility during water-rock interaction prior to 3-billion-years ago, low detection limit analysis of Au concentrations was carried out on rocks from marine alteration zones. Stratiform zones recording low-temperature (≤150 °C) seafloor alteration are a characteristic feature of greenstone belts older than 3.0 Ga. Hydrothermal processes were operating on, and immediately below, the seafloor, giving rise to extensive silicification of sub-seafloor volcanic rocks and silicification of seafloor sediments. In order to investigate gold mobility during silicification, unaltered and variably silicified volcanic rocks and associated cherts from Palaeoarchaean greenstone successions (c. 3.4 Ga) of South Africa were analyzed. Results show mobility of gold during silicification of mafic/ultramafic rocks and transfer to the Archaean ocean. Some gold was incorporated into carbonaceous marine sediments overlying the alteration zones. A combination of pervasive silicification, rarity of black shales, and low gold content in komatiites can explain the low mineralization potential of Palaeoarchaean greenstone belts for orogenic gold deposits.

  16. [Sunrise gold foil jacket crown].

    PubMed

    Lecardonnel, A

    1989-09-01

    This technique permits the preparation of ceramic jacket crowns made on Sunrise laminated precious metal alloy. The Sunrise foil is gold-colored, made of 99% of precious metals and is 50 microns thick. The die is prepared in order to display a moderate and regular undercut beyond the cervical limit. The margin will be underlined with a red pencil. The Sunrise foil is cut according to predetermined templates. Then the foil is applied without burnishing, according to the technique of jacket crowns on platinum foil only by finger pressure. The double folding on closure is preferably done distally or mesially. Then, the metal base is disinserted, sandblasted with 100 microns aluminum oxide, replaced on its die, and placed in a rubber casing before being placed in the isostatic press, to be subjected to a pressure of 2,000 TSI (14 kg par cm2). Sunrise's orange color reinforces rather subtetly the overall color, making these reconstructions particularly esthetic. The color of the Sunrise metal does not require, therefore a too thick opaque. Any ceramic intended to be fired on a metal base, may be used in respecting its firing protocol. Sunrise, as any other technique of this type, require a careful preparation with a shoulder that has a rounded gingivoaxial line angle. Bridges may be built on the "thimbles" crowns, fitted on Sunrise cores, the pontics being made as a ceramo-metal framework.

  17. Gold Nanoparticle Mediated Cancer Immunotherapy

    PubMed Central

    Almeida, Joao Paulo Mattos; Figueroa, Elizabeth Raquel; Drezek, Rebekah Anna

    2013-01-01

    Significant progress has been made in the field of cancer immunotherapy, where the goal is to activate or modulate the body’s immune response against cancer. However, current immunotherapy approaches exhibit limitations of safety and efficacy due to systemic delivery. In this context, the use of nanotechnology for the delivery of cancer vaccines and immune adjuvants presents a number of advantages such as targeted delivery to immune cells, enhanced therapeutic effect, and reduced adverse outcomes. Recently, gold nanoparticles (AuNP) have been explored as immunotherapy carriers, creating new AuNP applications that merit a critical overview. This review highlights recent advances in the development of AuNP mediated immunotherapies that harness AuNP biodistribution, optical properties and their ability to deliver macromolecules such as peptides and oligonucleotides. It has been demonstrated that the use of AuNP carriers can improve the delivery and safety of immunotherapy agents, and that AuNP immunotherapies are well suited for synergistic combination therapy with existing cancer therapies like photothermal ablation. PMID:24103304

  18. Curcumin: the Indian solid gold.

    PubMed

    Aggarwal, Bharat B; Sundaram, Chitra; Malani, Nikita; Ichikawa, Haruyo

    2007-01-01

    Turmeric, derived from the plant Curcuma longa, is a gold-colored spice commonly used in the Indian subcontinent, not only for health care but also for the preservation of food and as a yellow dye for textiles. Curcumin, which gives the yellow color to turmeric, was first isolated almost two centuries ago, and its structure as diferuloylmethane was determined in 1910. Since the time of Ayurveda (1900 Bc) numerous therapeutic activities have been assigned to turmeric for a wide variety of diseases and conditions, including those of the skin, pulmonary, and gastrointestinal systems, aches, pains, wounds, sprains, and liver disorders. Extensive research within the last half century has proven that most of these activities, once associated with turmeric, are due to curcumin. Curcumin has been shown to exhibit antioxidant, anti-inflammatory, antiviral, antibacterial, antifungal, and anticancer activities and thus has a potential against various malignant diseases, diabetes, allergies, arthritis, Alzheimer's disease, and other chronic illnesses. These effects are mediated through the regulation of various transcription factors, growth factors, inflammatory cytokines, protein kinases, and other enzymes. Curcumin exhibits activities similar to recently discovered tumor necrosis factor blockers (e.g., HUMIRA, REMICADE, and ENBREL), a vascular endothelial cell growth factor blocker (e.g., AVASTIN), human epidermal growth factor receptor blockers (e.g., ERBITUX, ERLOTINIB, and GEFTINIB), and a HER2 blocker (e.g., HERCEPTIN). Considering the recent scientific bandwagon that multitargeted therapy is better than monotargeted therapy for most diseases, curcumin can be considered an ideal "Spice for Life".

  19. Metamorphic origin of ore-forming fluids for orogenic gold-bearing quartz vein systems in the North American Cordillera: constraints from a reconnaissance study of δ15N, δD, and δ18O

    USGS Publications Warehouse

    Jia, Y.; Kerrich, R.; Goldfarb, R.

    2003-01-01

    The western North American Cordillera hosts a large number of gold-bearing quartz vein systems from the Mother Lode of southern California, through counterparts in British Columbia and southeastern Alaska, to the Klondike district in central Yukon. These vein systems are structurally controlled by major fault zones, which are often reactivated terrane-bounding sutures that formed in orogens built during accretion and subduction of terranes along the continental margin of North America. Mineralization ages span mid-Jurassic to early Tertiary and encompass much of the evolution ofthe Cordilleran orogen. Nitrogen contents and δ15N values of hydrothermal micas from veins are between 130 and 3,500 ppm and 1.7 to 5.5 per mil, respectively. These values are consistent with fluids derived from metamorphic dehydration reactions within the Phanerozoic accretion-subduction complexes, which have δ15N values of 1 to 6 per mil. The δ18O values of gold-bearing vein quartz from different locations in the Cordillera are between 14.6 and 22.2 per mil but are uniform for individual vein systems. The δD values of hydrothermal micas are between -110 and -60 per mil. Ore fluids have calculated δ18O values of 8 to 16 per mil and δD values of -65 to -10 per mil at an estimated temperature of 300δC; δD values of ore fluids do not show any latitudinal control. These results indicate a deep crustal source for the ore-forming fluids, most likely of metamorphic origin. Low δDH2O values of -120 to -130 per mil for a hydrous muscovite from the Sheba vein in the Klondike district reflect secondary exchange between recrystallizing mica and meteoric waters. Collectively, the N, H, and O isotope compositions of ore-related hydrothermal minerals indicate that the formation of these gold-bearing veins involved dilute, aqueous carbonic, and nitrogen-bearing fluids that were generated from metamorphic dehydration reactions at deep crustal levels. These data are not consistent with either mantle

  20. Tectonic setting of Late Cenozoic gold mineralization in the gold belt of Costa Rica

    SciTech Connect

    Deruyter, V.D.

    1985-01-01

    The Gold Belt of Costa Rica is a northwest-elongated zone 15 km wide by 120 km long containing numerous auriferous quartz veins and pyritic silicified patterns upon which abundant small mines are developed. Gold veins are related principally to northeast-southwest and north-south striking, steeply dipping faults. Higher grade ore and thicker veins invariably occur at intersections of these fracture orientations, indicating simultaneous opening at the time of gold introduction. Restriction of gold veins to the northwest-trending arc of Miocene Aguacate Group andesite volcanic rocks, a product of Cocos Plate subduction, suggested approximately coeval formation, but recognition by the writer of the important role played by 2-5 m.y. old altered, gold mineralized rhyolite dikes intruded along north-south gold vein structures and intimately involved with high grade ores at the Esperanza Mine and Rio Chiquito prospect, for example, suggest a much younger period of fracturing and gold introduction. The rhyolite intrusions are more brittle and stockwork mineralized than andesite host rocks and form bulk tonnage gold targets. Initiation of right-lateral movement along the north-south Panama Fracture Zone at 5 m.y.a. within the pattern of northeastward Cocos Plate subduction may have tapped rhyolites from subvolcanic magma chambers into new faults.

  1. Gold(I) Carbenoids: On-Demand Access to Gold(I) Carbenes in Solution.

    PubMed

    Sarria Toro, Juan M; García-Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S; Echavarren, Antonio M

    2017-02-06

    Chloromethylgold(I) complexes of phosphine, phosphite, and N-heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene.

  2. Gold(I) Carbenoids: On‐Demand Access to Gold(I) Carbenes in Solution

    PubMed Central

    Sarria Toro, Juan M.; García‐Morales, Cristina; Raducan, Mihai; Smirnova, Ekaterina S.

    2017-01-01

    Abstract Chloromethylgold(I) complexes of phosphine, phosphite, and N‐heterocyclic carbene ligands are easily synthesized by reaction of trimethylsilyldiazomethane with the corresponding gold chloride precursors. Activation of these gold(I) carbenoids with a variety of chloride scavengers promotes reactivity typical of metallocarbenes in solution, namely homocoupling to ethylene, olefin cyclopropanation, and Buchner ring expansion of benzene. PMID:28090747

  3. Silver, gold, and alloyed silver-gold nanoparticles: characterization and comparative cell-biologic action

    NASA Astrophysics Data System (ADS)

    Mahl, Dirk; Diendorf, Jörg; Ristig, Simon; Greulich, Christina; Li, Zi-An; Farle, Michael; Köller, Manfred; Epple, Matthias

    2012-10-01

    Silver, gold, and silver-gold-alloy nanoparticles were prepared by citrate reduction modified by the addition of tannin during the synthesis, leading to a reduction in particle size by a factor of three. Nanoparticles can be prepared by this easy water-based synthesis and subsequently functionalized by the addition of either tris(3-sulfonatophenyl)phosphine or poly( N-vinylpyrrolidone). The resulting nanoparticles of silver (diameter 15-25 nm), gold (5-6 nm), and silver-gold (50:50; 10-12 nm) were easily dispersable in water and also in cell culture media (RPMI + 10 % fetal calf serum), as shown by nanoparticle tracking analysis and differential centrifugal sedimentation. High-resolution transmission electron microscopy showed a polycrystalline nature of all nanoparticles. EDX on single silver-gold nanoparticles indicated that the concentration of gold is higher inside a nanoparticle. The biologic action of the nanoparticles toward human mesenchymal stem cells (hMSC) was different: Silver nanoparticles showed a significant concentration-dependent influence on the viability of hMSC. Gold nanoparticles showed only a small effect on the viability of hMSC after 7 days. Surprisingly, silver-gold nanoparticles had no significant influence on the viability of hMSC despite the silver content. Silver nanoparticles and silver-gold nanoparticles in the concentration range of 5-20 μg mL-1 induced the activation of hMSC as indicated by the release of IL-8. In contrast, gold nanoparticles led to a reduction of the release of IL-6 and IL-8.

  4. Oxidation state of gold and arsenic in gold-bearing arsenian pyrite

    SciTech Connect

    Simon, G.; Huang, H.; Penner-Hahn, J.E.; Kesler, S.E.; Kao, L.S.

    1999-07-01

    XANES measurements on gold-bearing arsenian pyrite from the Twin Creeks Carlin-type gold deposits show that gold is present as both Au{sup 0} and Au{sup 1+} and arsenic is present as As{sup 1{minus}}. Au{sup 0} is attributed to sub-micrometer size inclusions of free gold, whereas Au{sup 1+} is attributed to gold in the lattice of the arsenian pyrite. STEM observations suggest that As{sup 1{minus}} is probably concentrated in angstrom-scale, randomly distributed layers with a marcasite or arsenopyrite structure. Ionic gold (Au{sup 1+}) could be concentrated in these layers as well, and is present in both twofold- and fourfold-coordinated forms, with fourfold-coordinated Au{sup 1+} more abundant. Twofold-coordinated Au{sup 1+} is similar to gold in Au{sub 2}S in which it is linearly coordinated to two sulfur atoms. The nature of fourfold-coordinated Au{sup 1+} is not well understood, although it might be present as an Au-As-S compound where gold is bonded in fourfold coordination to sulfur and arsenic atoms, or in vacancy positions on a cation site in the arsenian pyrite. Au{sup 1+} was probably incorporated into arsenian pyrite by adsorption onto pyrite surfaces during crystal growth. The most likely compound in the case of twofold-coordinated Au{sup 1+} was probably a tri-atomic surface complex such as S{sub pyrite}-Au{sup 1+}-S{sub bi-sulfide}H or Au{sup 1+}-S-Au{sup 1+}. The correlation between gold and arsenic might be related to the role of arsenic in enhancing the adsorption of gold complexes of this type on pyrite surfaces, possibly through semiconductor effects.

  5. Precipitation of lamellar gold nanocrystals in molten polymers

    NASA Astrophysics Data System (ADS)

    Palomba, M.; Carotenuto, G.

    2016-05-01

    Non-aggregated lamellar gold crystals with regular shape (triangles, squares, pentagons, etc.) have been produced by thermal decomposition of gold chloride (AuCl) molecules in molten amorphous polymers (polystyrene and poly(methyl methacrylate)). Such covalent inorganic gold salt is high soluble into non-polar polymers and it thermally decomposes at temperatures compatible with the polymer thermal stability, producing gold atoms and chlorine radicals. At the end of the gold precipitation process, the polymer matrix resulted chemically modified because of the partial cross-linking process due to the gold atom formation reaction.

  6. Engineered Gold Nanoparticles and Plant Adaptation Potential

    NASA Astrophysics Data System (ADS)

    Siddiqi, Khwaja Salahuddin; Husen, Azamal

    2016-09-01

    Use of metal nanoparticles in biological system has recently been recognised although little is known about their possible effects on plant growth and development. Nanoparticles accumulation, translocation, growth response and stress modulation in plant system is not well understood. Plants exposed to gold and gold nanoparticles have been demonstrated to exhibit both positive and negative effects. Their growth and yield vary from species to species. Cytoxicity of engineered gold nanoparticles depends on the concentration, particle size and shape. They exhibit increase in vegetative growth and yield of fruit/seed at lower concentration and decrease them at higher concentration. Studies have shown that the gold nanoparticles exposure has improved free radical scavenging potential and antioxidant enzymatic activities and alter micro RNAs expression that regulate different morphological, physiological and metabolic processes in plants. These modulations lead to improved plant growth and yields. Prior to the use of gold nanoparticles, it has been suggested that its cost may be calculated to see if it is economically feasible.

  7. Radiofrequency Heating Pathways for Gold Nanoparticles

    PubMed Central

    Collins, C. B.; McCoy, R. S.; Ackerson, B. J.; Collins, G. J.

    2015-01-01

    This feature article reviews the thermal dissipation of nanoscopic gold under radiofrequency (RF) irradiation. It also presents previously unpublished data addressing obscure aspects of this phenomenon. While applications in biology motivated initial investigation of RF heating of gold nanoparticles, recent controversy concerning whether thermal effects can be attributed to nanoscopic gold highlight the need to understand the involved mechanism or mechanisms of heating. Both the nature of the particle and the nature of the RF field influence heating. Aspects of nanoparticle chemistry and physics, including the hydrodynamic diameter of the particle, the oxidation state and related magnetism of the core, and the chemical nature of the ligand shell may all strongly influence to what extent a nanoparticle heats in an RF field. Aspects of RF include: power, frequency and antenna designs that emphasize relative strength of magnetic or electric fields, and also influence the extent to which a gold nanoparticle heats in RF. These nanoparticle and RF properties are analysed in the context of three heating mechanisms proposed to explain gold nanoparticle heating in an RF field. This article also makes a critical analysis of the existing literature in the context of the nanoparticle preparations, RF structure, and suggested mechanisms in previously reported experiments. PMID:24962620

  8. Therapeutic gold, silver, and platinum nanoparticles.

    PubMed

    Yamada, Miko; Foote, Matthew; Prow, Tarl W

    2015-01-01

    There are an abundance of nanoparticle technologies being developed for use as part of therapeutic strategies. This review focuses on a narrow class of metal nanoparticles that have therapeutic potential that is a consequence of elemental composition and size. The most widely known of these are gold nanoshells that have been developed over the last two decades for photothermal ablation in superficial cancers. The therapeutic effect is the outcome of the thickness and diameter of the gold shell that enables fine tuning of the plasmon resonance. When these metal nanoparticles are exposed to the relevant wavelength of light, their temperature rapidly increases. This in turn induces a localized photothermal ablation that kills the surrounding tumor tissue. Similarly, gold nanoparticles have been developed to enhance radiotherapy. The high-Z nature of gold dramatically increases the photoelectric cross-section. Thus, the photoelectric effects are significantly increased. The outcome of these interactions is enhanced tumor killing with lower doses of radiation, all while sparing tissue without gold nanoparticles. Silver nanoparticles have been used for their wound healing properties in addition to enhancing the tumor-killing effects of anticancer drugs. Finally, platinum nanoparticles are thought to serve as a reservoir for platinum ions that can induce DNA damage in cancer cells. The future is bright with the path to clinical trials is largely cleared for some of the less complex therapeutic metal nanoparticle systems.

  9. Amplitude enhancement by a gold dimer

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Wang, Jingxin; Jin, Zheng

    2016-10-01

    The unique optical properties such as brightness, non-bleaching, good bio-compatibility make gold particles ideal label candidates for molecular probes. Due to the strongly enhanced field, aggregation of gold nanoparticles finds themselves plenty of applications in bio-imaging. But limited by its small cross-section associated with nanometer sized particle, it is a big challenge to employ it in a single molecular detection. The field enhancement results from the effect of plasmonic coupling between two closely attached gold nanoparticle under the right excitation condition. With the aim to apply the gold dimer probe to find the molecules in our recently established optical detection method, we compared of the amplitude enhancement by the dimer relative to a single particle. The amplitude distribution under a highly focused illumination objective was calculated, whose results suggest that at the optimized excitation condition, the local field can be enhanced 190 fold. In consequence, experimental detection was carried out. Gold dimers were linked together by the hybridization of two single chain DNAs. Dimer and single particle probes were mixed together in one detection. Overwhelming contrast between these two kinds of probes were clearly exhibited in the experimental detection image. This method can provide a way to a high specific detection in early diagnosis.

  10. Controlling Gold Nanoclusters by Diphospine Ligands

    SciTech Connect

    Chen, Jing; Zhang, Qianfan; Bonaccorso, Timary A.; Williard, Paul G.; Wang, Lai S.

    2014-01-08

    We report the synthesis and structure determination of a new Au22 nanocluster coordinated by six bidentate diphosphine ligands: 1,8-bis(diphenylphosphino) octane (L8 for short). Single crystal x-ray crystallography and electrospray ionization mass spectrometry show that the cluster assembly is neutral and can be formulated as Au22(L8)6. The Au22 core consists of two Au11 units clipped together by four L8 ligands, while the additional two ligands coordinate to each Au11 unit in a bidentate fashion. Eight gold atoms at the interface of the two Au11 units are not coordinated by any ligands. Four short gold-gold distances (2.64?2.65 Å) are observed at the interface of the two Au11 clusters as a result of the clamping force of the four clipping ligands and strong electronic interactions. The eight uncoordinated surface gold atoms in the Au22(L8)6 nanocluster are unprecedented in atom-precise gold nanoparticles and can be considered as potential in-situ active sites for catalysis.

  11. Gold Nanoparticle Labels Amplify Ellipsometric Signals

    NASA Technical Reports Server (NTRS)

    Venkatasubbarao, Srivatsa

    2008-01-01

    The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.

  12. Miocene and early Pliocene epithermal gold-silver deposits in the northern Great Basin, western United States: Characteristics, distribution, and relationship to Magmatism

    USGS Publications Warehouse

    John, D.A.

    2001-01-01

    -sulfidation gold-silver and porphyry copper-gold deposits are affiliated with the western andesite assemblage and include the Comstock Lode, Tonopah, Goldfield, Aurora, Bodie, Paradise Peak, and Rawhide deposits. Low-sulfidation Au-Ag deposits in the bimodal assemblage formed under relatively low oxygen and sulfur fugacities and have generally low total base metal (Cu + Pb + Zn) contents, low Ag/Au ratios, and notably high selenide mineral contents compared to temporally equivalent low-sulfidation deposits in the western andesite assemblage. Petrologic studies suggest that these differences may reflect variations in the magmatic-tectonic settings of the associated magmatic assemblages-deposits in the western andesite assemblage formed from oxidized, water-rich, subduction-related calc-alkaline magmas, whereas deposits in the bimodal assemblage were associated with reduced, water-poor tholeiitic magmas derived from the lithospheric mantle during continental extension. The contrasting types and characteristics of epithermal deposits and their affinities with associated igneous rocks suggest that a genetic relationship is present between these Au-Ag deposits and their temporally associated magmatism, although available data do not prove this relationship for most low-sulfidation deposits.

  13. Gold nanocrystals with DNA-directed morphologies

    NASA Astrophysics Data System (ADS)

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-09-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology.

  14. Gold nanocrystals with DNA-directed morphologies

    PubMed Central

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-01-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology. PMID:27633935

  15. Galvanic gold plating for fixed dental prosthesis.

    PubMed

    Ozcelik, Tuncer Burak; Yilmaz, Burak

    2013-07-01

    Metal ceramic partial fixed dental prostheses have been commonly used for the replacement of missing teeth for many years. Because of an increase in the price of gold, base metal alloys have been the choice of alloy for the fabrication of metal ceramic restorations in many dental clinics. Some major disadvantages of base metals are their corrosion and the dark coloration they may cause at the crown margins. This article describes a galvanic gold-plating technique, which is used to minimize corrosion and improve the esthetics of metal ceramic restorations fabricated with Cr-Co base metal alloys. This technique involves the deposition of a 6 μm to 8 μm 24 K gold layer directly onto the Cr-Co cast prosthesis framework. The technique improves metal surface properties, making them more biocompatible and usable, however, requires additional equipment and experienced laboratory technicians. Clinical studies should be performed to corroborate the long term success of this technique.

  16. Catalysis by unsupported skeletal gold catalysts.

    PubMed

    Wittstock, Arne; Bäumer, Marcus

    2014-03-18

    Catalysis is one of the key technologies for the 21st century for achieving the required sustainability of chemical processes. Critical improvements are based on the development of new catalysts and catalytic concepts. In this context, gold holds great promise because it is more active and selective than other precious metal catalysts at low temperatures. However, gold becomes only chemically and catalytically active when it is nanostructured. Since the 1970s and 1980s, the first type of gold catalysts that chemists studied were small nanoparticles on oxidic supports. With the later onset of nanotechnology, a variety of nanostructured materials not requiring a support or organic stabilizers became available within about the last 10 years. Among these are gold nanofoams generated by combustion of gold compounds, nanotube membranes prepared by electroless deposition of gold inside a template, and corrosion-derived nanoporous gold. Even though these materials are macroscopic in their geometric dimensions (e.g., disks, cubes, and membranes with dimensions of millimeters), they are comprised of gold nanostructures, for example, in the form of ligaments as small as 15 nm in diameter (nanoporous gold, npAu). The nanostructure brings about a high surface to volume ratio and a large fraction of low coordinated surface atoms. In this Account, we discuss how unsupported materials are active catalysts for aerobic oxidation reaction in gas phase (oxidation of CO and primary alcohols), as well as liquid phase oxidation and reduction reactions. It turns out that the bonding and activation of molecular oxygen for gas phase oxidations strongly profits from trace amounts of an ad-metal residue such as silver. It is noteworthy that these catalysts still exhibit the special gold type chemistry, characterized by activity at very low temperatures and high selectivity for partial oxidations. For example, we can oxidize CO over these unsupported catalysts (npAu, nanotubes, and powder) at

  17. Ultrasonic-aided fabrication of gold nanofluids.

    PubMed

    Chen, Hui-Jiuan; Wen, Dongsheng

    2011-03-07

    A novel ultrasonic-aided one-step method for the fabrication of gold nanofluids is proposed in this study. Both spherical- and plate-shaped gold nanoparticles (GNPs) in the size range of 10-300 nm are synthesized. Subsequent purification produces well-controlled nanofluids with known solid and liquid contents. The morphology and properties of the nanoparticle and nanofluids are characterized by transmission electron microscopy, scanning electron microscope, energy dispersive X-ray spectroscope, X-ray diffraction spectroscopy, and dynamic light scattering, as well as effective thermal conductivities. The ultrasonication technique is found to be a very powerful tool in engineering the size and shape of GNPs. Subsequent property measurement shows that both particle size and particle shape play significant roles in determining the effective thermal conductivity. A large increase in effective thermal conductivity can be achieved (approximately 65%) for gold nanofluids using plate-shaped particles under low particle concentrations (i.e.764 μM/L).

  18. Gold(III) complexes in medicinal chemistry.

    PubMed

    Maia, Pedro Ivo da Silva; Deflon, Victor M; Abram, Ulrich

    2014-09-01

    A number of gold(III) compounds has been designed with the objective of overcoming the disadvantages associated with the platinum-based drugs for cancer treatment. Compounds of a remarkable structural manifold show significant antiproliferative effects in vitro against a number of cancer cells, including cisplatin resistant ones. The target of most of them is, unlike that of cisplatin, not the DNA. Although the mechanisms of action displayed by the gold compounds in biological media are still under investigation, many studies show evidence that the cellular targets are mitochondria-based. Recent advances in gold(III) medicinal chemistry also recommend such compounds for other pharmacological applications such as the treatment of viral or parasitic diseases. The radioactive isotopes (198)Au and (199)Au present potential in radiotherapy.

  19. Layering-induced Superlubricity: Gold on Graphite

    NASA Astrophysics Data System (ADS)

    Vanossi, Andrea; Guerra, Roberto; Tosatti, Erio; Nanofriction Group Sissa Team

    2015-03-01

    By means of realistic MD simulations, we explore the static friction trend as a function of the true contact area and the model dimensionality for 2D gold nanoislands and 3D gold nanoclusters deposited on graphite, interesting tribological systems whose slow and fast dynamics have been previously investigated. For increasing island size, because of the relative gold-graphite lattice mismatch, the interface stress energy has the chance to pile up by forming frustrated unmatched (i.e., incommensurate) regions and to develop a continuous solitonic pathway, foreshadowing a possible condition for the occurrence of ultra-low friction regimes. The significant reduction of the depinning threshold, towards superlubricity, with the system dimensionality can be ascribed to a layering-induced effective stiffness of the interface contact, favoring the natural Au-C lattice incommensurability. Partly sponsored under SNSF Sinergia Grant CRSII2 136287/1, EU ERC Grant No. 320796 MODPHYSFRICT, EU COST Action MP1303.

  20. OCT imaging enhancement of ovarian cancer using gold and gold/silver nanorods

    NASA Astrophysics Data System (ADS)

    Shi, Yiwen; Fan, Shanhui; Chen, Shuohui; Jiang, Xia; Zhao, Qingliang; Ren, Qiushi; Cui, Daxiang; Zhou, Chuanqing

    2014-11-01

    For OCT imaging, enhancing contrast efficiency will lead to significant improvements in the detection limits in cancer. Recently, noble metal nanoparticles are considered to be better contrast agents than traditional ones, especially for gold and silver. Silver nanoparticles have more attractive optical properties than gold nanoparticles. But they are employed far less because of its poor chemical stability. In this paper, we introduced our recent progress on a new application of using gold/silver alloy nanoparticles as OCT contrast agents in the detection of ovarian cancer. The scattering properties and sensitivity of silver were investigated. By means of tuning LSPR wavelengths of the nanoparticles, they were able to match the central wavelength of light used in OCT. Before carrying out animal experiments, we evaluated the different performances of alloy nanoparticles and gold nanorods in vitro. It has been sufficiently demonstrated that the alloy nanoparticles revealed stronger OCT signals than gold nanorods because of the better scattering properties. Then in vivo study, we compared the contrast enhancement of gold/silver alloy nanoparticles and gold nanorods on the ovarian cancer model mice. This study contributes a new kind of contrast agent in OCT imaging, which has a profound effect on drug delivery and further therapeutic action.

  1. Luminescent gold nanoparticles for bioimaging

    NASA Astrophysics Data System (ADS)

    Zhou, Chen

    Inorganic nanoparticles (NPs) with tunable and diverse material properties hold great potential as contrast agents for better disease management. Over the past decades, luminescent gold nanoparticles (AuNPs) with intrinsic emissions ranging from the visible to the near infrared have been synthesized and emerge as a new class of fluorophores for bioimaging. This dissertation aims to fundamentally understand the structure-property relationships in luminescent AuNPs and apply them as contrast agents to address some critical challenges in bioimaging at both the in vitro and in vivo level. In Chapter 2, we described the synthesized ~20 nm polycrystalline AuNPs (pAuNPs), which successfully integrated and enhanced plasmonic and fluorescence properties into a single AuNP through the grain size effect. The combination of these properties in one NP enabled AuNPs to serve as a multimodal contrast agent for in vitro optical microscopic imaging, making it possible to develop correlative microscopic imaging techniques. In Chapters 3-5, we proposed a feasible approach to optimize the in vivo kinetics and clearance profile of nanoprobes for multimodality in vivo bioimaging applications by using straightforward surface chemistry with luminescent AuNPs as a model. Luminescent glutathione-coated AuNPs of ~2 nm were synthesized. Investigation of the biodistribution showed that these glutathione-coated AuNPs (GS-AuNPs) exhibit stealthiness to the reticuloendothelial system (RES) organs and efficient renal clearance, with only 3.7+/-1.9% and 0.3+/-0.1% accumulating in the liver and spleen, and over 65% of the injection dose cleared out via the urine within the first 72 hours. In addition, ~2.5 nm NIR-emitting radioactive glutathione-coated [198Au]AuNPs (GS-[198Au]AuNPs) were synthesized for further evaluation of the pharmacokinetic profile of GS-AuNPs and potential multimodal imaging. The results showed that the GS-[198Au]AuNPs behave like small-molecule contrast agents in

  2. Major brazilian gold deposits - 1982 to 1999

    USGS Publications Warehouse

    Thorman, C.H.; Dewitt, E.; Maron, M.A.; Ladeira, E.A.

    2001-01-01

    Brazil has been a major but intermittent producer of gold since its discovery in 1500. Brazil led the world in gold production during the 18th and early 19th centuries. From the late 19th century to the late 20th century, total mining company and garimpeiro production was small and relatively constant at about 5 to 8 t/year. The discovery of alluvial deposits in the Amazon by garimpeiros in the 1970s and the opening of eight mines by mining companies from 1983 to 1990 fueled a major boom in Brazil's gold production, exceeding 100 t/year in 1988 and 1989. However, garimpeiro alluvial production decreased 'rapidly in the 1990s, to about 10 t/year by 1999. Company production increased about tenfold from about 4 t/year in 1982 to 40 t in 1992. Production from 1992 to the present remained relatively stable, even though several mines were closed or were in the process of closing and no new major mines were put into production during that period. Based on their production history from 1982-1999, 17 gold mines are ranked as major (> 20 t) and minor (3-8 t) mines. From 1982-1999, deposits hosted in Archean rocks produced 66% of the gold in Brazil, whereas deposits in Paleoproterozoic and Neoproterozoic rocks accounted for 19% and 15%, respectively. Deposits in metamorphosed sedimentary rocks, especially carbonate-rich rocks and carbonate iron-formation, yielded the great bulk of the gold. Deposits in igneous rocks were of much less importance. The Archean and Paleoproterozoic terranes of Brazil largely lack base-metal-rich volcanogenic massive sulfide deposits, porphyry deposits, and polymetallic veins and sedimentary exhalative deposits. An exception to this is in the Caraja??s Mineral Province.

  3. Rheumatoid arthritis, gold therapy, contact allergy and blood cytokines

    PubMed Central

    Svensson, Åke; Möller, Halvor; Björkner, Bert; Bruze, Magnus; Leden, Ido; Theander, Jan; Ohlsson, Kjell; Linder, Carina

    2002-01-01

    Objective To study the clinical and biochemical effects of a low starting dose for gold therapy in rheumatoid arthritis patients with a contact allergy to gold. Methods Serum cytokines were assayed before and 24 h after the first injection of gold sodium thiomalate (GSTM). Results Contact allergy to gold was found in 4 of 19 patients. Compared to gold-negative patients (starting dose: 10 mg GSTM), there was a larger increase in serum TNFalpha (p < 0.05), sTNF-R1 (NS), and IL-1 ra (p < 0.05) in gold-allergic patients. Conclusions Cytokines are released in blood by GSTM in RA patients with gold allergy. To minimize the risk of acute adverse reactions the starting dose of GSTM should be lowered to 5 mg. Alternatively, patients should be patch-tested before gold therapy; in test-positive cases, 5 mg is recommended as the first dose. PMID:11860615

  4. 14. BALD MOUNTAIN MILL, INTERIOR SHOWING GOLD TANKS FROM WEST, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. BALD MOUNTAIN MILL, INTERIOR SHOWING GOLD TANKS FROM WEST, c. 1937. DATE BASED ON USE IN PUBLICATION. CREDIT WR. - Bald Mountain Gold Mill, Nevada Gulch at head of False Bottom Creek, Lead, Lawrence County, SD

  5. OVERVIEW OF GOLD HILL MILL, ROAD, AND WARM SPRINGS CAMP ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    OVERVIEW OF GOLD HILL MILL, ROAD, AND WARM SPRINGS CAMP BUILDINGS, LOOKING SOUTH SOUTHEAST. THE FUNCTION OF THE FLAT AREA AT CENTER RIGHT IS UNKNOWN. - Gold Hill Mill, Warm Spring Canyon Road, Death Valley Junction, Inyo County, CA

  6. Nanosecond laser ablation of gold nanoparticle films

    SciTech Connect

    Ko, Seung H.; Choi, Yeonho; Hwang, David J.; Grigoropoulos, Costas P.; Chung, Jaewon; Poulikakos, Dimos

    2006-10-02

    Ablation of self-assembled monolayer protected gold nanoparticle films on polyimide was explored using a nanosecond laser. When the nanoparticle film was ablated and subsequently thermally sintered to a continuous film, the elevated rim structure by the expulsion of molten pool could be avoided and the ablation threshold fluence was reduced to a value at least ten times lower than the reported threshold for the gold film. This could be explained by the unusual properties of nanoparticle film such as low melting temperature, weak bonding between nanoparticles, efficient laser energy deposition, and reduced heat loss. Finally, submicron lines were demonstrated.

  7. Plasmonics of Gold Nanorods. Considerations for Biosensing

    NASA Astrophysics Data System (ADS)

    Liz-Marzán, Luis M.; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel

    In this chapter, we explore the sensitivity of gold nanorods toward changes in the dielectric constant of the surrounding medium. Experimental data for pure and silica-coated nanorods with varying shell thickness are compared to calculations based on the boundary element method (BEM). They indicate that anisotropy and sharp tips make nanoparticles more environmentally sensitive. We also find that sensitivity decreases as silica shell thickness increases, as expected from a dielectric screening effect. Even when coated with thin shells, gold nanorods are found to be excellent candidates for biosensing applications.

  8. Current methods for synthesis of gold nanoparticles.

    PubMed

    Herizchi, Roya; Abbasi, Elham; Milani, Morteza; Akbarzadeh, Abolfazl

    2016-01-01

    Metal nanoparticles, such as nanoparticles synthesized using gold, have numerous uncommon chemical and physical properties due to the effects of their quantum size and their large surface area, in comparison with other metal atoms or bulk metal. Gold nanoparticles (GNPs), in particular, are very attractive because of their size and shape-dependent properties. Metal nanoparticles have gathered extensive attention due to their uncommon properties and promising applications in photonics, electronics, biochemical sensing, and imaging. This review covers recent advances in the synthesis of GNPs.

  9. Functionalized Gold Nanoparticles and Their Biomedical Applications

    PubMed Central

    Tiwari, Pooja M.; Vig, Komal; Dennis, Vida A.; Singh, Shree R.

    2011-01-01

    Metal nanoparticles are being extensively used in various biomedical applications due to their small size to volume ratio and extensive thermal stability. Gold nanoparticles (GNPs) are an obvious choice due to their amenability of synthesis and functionalization, less toxicity and ease of detection. The present review focuses on various methods of functionalization of GNPs and their applications in biomedical research. Functionalization facilitates targeted delivery of these nanoparticles to various cell types, bioimaging, gene delivery, drug delivery and other therapeutic and diagnostic applications. This review is an amalgamation of recent advances in the field of functionalization of gold nanoparticles and their potential applications in the field of medicine and biology.

  10. Crack injection in silver gold alloys

    NASA Astrophysics Data System (ADS)

    Chen, Xiying

    Stress corrosion cracking (SCC) is a materials degradation phenomena resulting from a combination of stress and a corrosive environment. Among the alphabet soup of proposed mechanism of SCC the most important are film-rupture, film-induced cleavage and hydrogen embrittlement. This work examines various aspects of film-induced cleavage in gold alloys for which the operation of hydrogen embrittlement processes can be strictly ruled out on thermodynamic grounds. This is so because in such alloys SCC occurs under electrochemical conditions within which water is stable to hydrogen gas evolution. The alloy system examined in this work is AgAu since the corrosion processes in this system occur by a dealloying mechanism that results in the formation of nanoporous gold. The physics behind the dealloying process as well as the resulting formation of nanoporous gold is today well understood. Two important aspects of the film-induced cleavage mechanism are examined in this work: dynamic fracture in monolithic nanoporous gold and crack injection. In crack injection there is a finite thickness dealloyed layer formed on a AgAu alloy sample and the question of whether or not a crack that nucleates within this layer can travel for some finite distance into the un-corroded parent phase alloy is addressed. Dynamic fracture tests were performed on single edge-notched monolithic nanoporous gold samples as well as "infinite strip" sample configurations for which the stress intensity remains constant over a significant portion of the crack length. High-speed photography was used to measure the crack velocity. In the dynamic fracture experiments cracks were observed to travel at speeds as large as 270 m/s corresponding to about 68% of the Raleigh wave velocity. Crack injection experiments were performed on single crystal Ag77Au23, polycrystalline Ag72Au28 and pure gold, all of which had thin nanoporous gold layers on the surface of samples. Through-thickness fracture was seen in both the

  11. Shape-controlled Synthesis of Gold Nanoparticles from Gold(III)-chelates of β-diketones

    NASA Astrophysics Data System (ADS)

    Kundu, Subrata; Pal, Anjali; Ghosh, Sujit Kumar; Nath, Sudip; Panigrahi, Sudipa; Praharaj, Snigdhamayee; Basu, Soumen; Pal, Tarasankar

    2005-12-01

    Chelating ligands with β-diketone skeleton have been employed for the first time as reductant to produce ligand stabilized gold nanoparticles of different shapes out of aqueous HAuCl4 solutions. Evolution of stable gold nanoparticles happens to be first order with respect to gold particles having rate constants ˜ ˜10-2 min-1 and subsequent chlorine insertion in the β-diketone skeleton is reported as a general feature. Spherical or triangular or hexagonal particle evolution goes selectively under the influence of different β-diketones in terms of capping and reducing capabilities of the reductants.

  12. Self-assembly of 4-ferrocene thiophenol capped electroactive gold nanoparticles onto gold electrode

    NASA Astrophysics Data System (ADS)

    Li, Di; Li, Jinghong

    2003-01-01

    Gold nanoparticles capped by 4-ferrocene thiophenol with an average core size of 2.5 nm and surface plasmon absorbance at 522 nm were place-exchanged with 1,8-octanedithiol, and then self-assembled onto the gold electrode via tail SH group. The self-assembly was characterized by X-ray photoelectron spectroscopy. Cyclic voltammograms examined the coverage fraction of the self-assembled monolayers of the electroactive gold nanoparticles and the formal potential of the indicated SAMs. Further experiments exhibited that the electrode process was controlled by surface confined faradic reactions.

  13. Fractionation of gold in a differentiated tholeiitic dolerite

    USGS Publications Warehouse

    Rowe, J.J.

    1969-01-01

    Gold content was determined, by neutron-activation analysis, in samples from a drill core through the Great Lake sheet, Tasmania, a differentiated tholeiitic dolerite. The gold content of parts of the core seems to be related to the mafic index. The variation of gold content with depth and mafic index is similar to that of copper, indicating that gold and copper may have been concomitantly crystallized from the magma. ?? 1969.

  14. Early Yellowstone hotspot magmatism and gold metallogeny

    NASA Astrophysics Data System (ADS)

    Hames, Willis; Unger, Derick; Saunders, James; Kamenov, George

    2009-11-01

    High-grade epithermal gold deposits in the Northern Great Basin have long been associated with regional Miocene basaltic to rhyolitic volcanism. Previous models for the low-sulfidation epithermal gold ores in this region have generally portrayed the bimodal magmas as a source of heat to drive large-scale convection of meteoritic water that leached gold from crustal sources and deposited it in hydrothermal vein systems, or required that the gold evolve from fractionated silicic magmas. New data of the present study indicate a more direct genetic link to the plume-related basaltic magmas of the region. Laser 40Ar/ 39Ar incremental heating plateau ages for single crystals of adularia from several of these low-sulfidation epithermal gold deposits range from 16.6 Ma to 15.5 Ma. Adularia from the Jumbo deposit yields three concordant plateau ages with a combined statistical result of 16.54 ± 0.04 Ma (95% confidence level, MSWD = 0.23). Plateau ages for adularia from other deposits in the region, and from gold-bearing veins in the Owyhee Mountains of southwestern Idaho, yield similar ages up to ~16.5 Ma, however some veins are as young as ca. 15.5 Ma and the grain-to-grain ages for a given sample can vary by up to ca. 0.5 Ma. Observed variations in age among the adularia crystals of a given rock sample indicate varying amounts of extraneous argon, and also loss of radiogenic 40Ar, among the population of grains for a particular sample. The single-crystal results are interpreted to indicate a 16.5-15.5 Ma interval for formation of gold-bearing adularia veins in the region. The initiation and duration of this gold-forming event appears contemporaneous (within uncertainties) with the basaltic volcanism at the Steens Mountain section and an ensuing one-million-year episode of basaltic volcanism from multiple centers in the region ( Brueseke et al., 2007). Trace amounts of lead are alloyed with gold in the deposits studied. The isotopic compositions of this lead are not

  15. Gold-coated nanoparticles for use in biotechnology applications

    DOEpatents

    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.

    2007-06-05

    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  16. Gold-coated nanoparticles for use in biotechnology applications

    DOEpatents

    Berning, Douglas E.; Kraus, Jr., Robert H.; Atcher, Robert W.; Schmidt, Jurgen G.

    2009-07-07

    A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.

  17. Gold nanoparticles: preparation, functionalisation and applications in biochemistry and immunochemistry

    NASA Astrophysics Data System (ADS)

    Dykman, Lev A.; Bogatyrev, Vladimir A.

    2007-02-01

    The review summarises data on the synthesis and functionalisation of gold nanoparticles and their applications in biological investigations. Particular attention is given to applications of colloidal gold in solid-phase assays, immunoassay and studies of biologically active compounds by vibrational spectroscopy. A special section deals with the use of gold nanoparticles as antigen carriers in immunisation.

  18. 77 FR 60279 - Gold Star Mother's and Family's Day, 2012

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-03

    ... Documents#0;#0; ] Proclamation 8872 of September 28, 2012 Gold Star Mother's and Family's Day, 2012 By the... upholding the sacred trust we share with our Gold Star families and the heroes we have laid to rest. Let us... designated the last Sunday in September as ``Gold Star Mother's Day.'' NOW, THEREFORE, I, BARACK...

  19. 76 FR 60355 - Gold Star Mother's and Family's Day, 2011

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-28

    ... Documents#0;#0; ] Proclamation 8722 of September 23, 2011 Gold Star Mother's and Family's Day, 2011 By the... never fully repay, and the enormity of the grief their families carry we can never fully know. Gold Star... heartbreaking loss, our Gold Star families continue to support one another, serve their communities, and...

  20. 75 FR 60283 - Gold Star Mother's and Families' Day, 2010

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-29

    ... Documents#0;#0; ] Proclamation 8569 of September 24, 2010 Gold Star Mother's and Families' Day, 2010 By the... those who share in that ultimate sacrifice: America's Gold Star Mothers and Families. For those in our... exceptional spirit of service dwells in the pride of Gold Star parents, who instilled the values that...

  1. 78 FR 60179 - Gold Star Mother's and Family's Day, 2013

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ... Documents#0;#0; ] Proclamation 9025 of September 26, 2013 Gold Star Mother's and Family's Day, 2013 By the... their example. On this day, we remember our commitment to the Gold Star mothers and families who carry... is over, we will continue to give our military and Gold Star families the care and support...

  2. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  3. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  4. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  5. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  6. 21 CFR 872.3350 - Gold or stainless steel cusp.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Gold or stainless steel cusp. 872.3350 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3350 Gold or stainless steel cusp. (a) Identification. A gold or stainless steel cusp is a prefabricated device made of austenitic alloys or...

  7. Gold in meteorites and in the earth's crust

    USGS Publications Warehouse

    Jones, Robert Sprague

    1968-01-01

    The reported gold contents of meteorites range from 0.0003 to 8.74 parts per million. Gold is siderophilic, and the greatest amounts in meteorites are in the iron phases. Estimates ,of the gold content of the earth's crust are in the range of 0.001 to 0.006 parts per million.

  8. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  9. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  10. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  11. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  12. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  13. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  14. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  15. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  16. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  17. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  18. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  19. 50 CFR 665.169 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.169 Section 665.169 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.169 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  20. 50 CFR 665.270 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.270 Section 665.270 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Fisheries § 665.270 Gold coral harvest moratorium. Fishing for, taking, or retaining any gold coral in...

  1. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  2. 21 CFR 872.3580 - Preformed gold denture tooth.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Preformed gold denture tooth. 872.3580 Section 872...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3580 Preformed gold denture tooth. (a) Identification. A preformed gold denture tooth is a device composed of austenitic alloys or alloys containing...

  3. Demonstration of enhancement of x-ray flux with foam gold compared to solid gold

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Ding, Yongkun; Lin, Zhiwei; Li, Hang; Jing, Longfei; Yuan, Zheng; Yang, Zhiwen; Tan, Xiulan; Kuang, Longyu; Zhang, Wenhai; Li, Liling; Li, Ping; Yuan, Guanghui; Jiang, Shaoen; Zhang, Baohan

    2016-03-01

    Experiments have been conducted to compare the re-emission from foam gold with a 0.3 g cc-1 density and solid gold in a SGIII prototype laser facility. Measurements of the re-emission x-ray flux demonstrate that emission is enhanced by the low density foam gold compared to the solid gold under the same conditions. The emission fraction increases with time and is concentrated on soft x-ray flux between 0.1-1 keV. The simulation results with Multi 1D agree with the experimental results. There are potential advantages to using foam walls for improving the emission and soft x-ray flux in hohlraums.

  4. Near Infrared Resonant Gold / Gold Sulfide Nanoparticles as a Photothermal Cancer Therapeutic Agent

    PubMed Central

    Gobin, André M.; Watkins, Emily M.; Quevedo, Elizabeth; Colvin, Vicki L.; West, Jennifer L.

    2010-01-01

    The development and optimization of near-infrared (nIR) absorbing nanoparticles for use as photothermal cancer therapeutic agents has been ongoing. We have previously reported on larger layered gold / silica nanoshells (~140 nm) for combined therapy and imaging applications. This work exploits the properties of smaller gold / gold sulfide (GGS) nIR absorbing nanoparticles (~35–55 nm) that provide higher absorption (98% absorption & 2% scattering for GGS versus 70% absorption & 30% scattering for gold/silica nanoshells) as well as potentially better tumor penetration. In this work we demonstrate ability to ablate tumor cells in vitro, and efficacy for photothermal cancer therapy, where in an in vivo model we show significantly increased long-term, tumor-free survival. Further, enhanced circulation and bio-distribution is observed in vivo. This class of nIR absorbing nanoparticles has potential to improve upon photothermal tumor ablation for cancer therapy. PMID:20183810

  5. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates.

    PubMed

    Dorel, Ruth; Echavarren, Antonio M

    2015-08-07

    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes.

  6. Gold-Catalyzed Reactions via Cyclopropyl Gold Carbene-like Intermediates

    PubMed Central

    2015-01-01

    Cycloisomerizations of 1,n-enynes catalyzed by gold(I) proceed via electrophilic species with a highly distorted cyclopropyl gold(I) carbene-like structure, which can react with different nucleophiles to form a wide variety of products by attack at the cyclopropane or the carbene carbons. Particularly important are reactions in which the gold(I) carbene reacts with alkenes to form cyclopropanes either intra- or intermolecularly. In the absence of nucleophiles, 1,n-enynes lead to a variety of cycloisomerized products including those resulting from skeletal rearrangements. Reactions proceeding through cyclopropyl gold(I) carbene-like intermediates are ideally suited for the bioinspired synthesis of terpenoid natural products by the selective activation of the alkyne in highly functionalized enynes or polyenynes. PMID:26061916

  7. Gold Nanoparticle Hyperthermia Reduces Radiotherapy Dose

    PubMed Central

    Lin, Lynn; Slatkin, Daniel N.; Dilmanian, F. Avraham; Vadas, Timothy M.; Smilowitz, Henry M.

    2014-01-01

    Gold nanoparticles can absorb near infrared light, resulting in heating and ablation of tumors. Gold nanoparticles have also been used for enhancing the dose of X-rays in tumors during radiotherapy. The combination of hyperthermia and radiotherapy is synergistic, importantly allowing a reduction in X-ray dose with improved therapeutic results. Here we intratumorally infused small 15 nm gold nanoparticles engineered to be transformed from infrared-transparent to infrared-absorptive by the tumor, which were then heated by infrared followed by X-ray treatment. Synergy was studied using a very radioresistant subcutaneous squamous cell carcinoma (SCCVII) in mice. It was found that the dose required to control 50% of the tumors, normally 55 Gy, could be reduced to <15 Gy (a factor of >3.7). Gold nanoparticles therefore provide a method to combine hyperthermia and radiotherapy to drastically reduce the X-ray radiation needed, thus sparing normal tissue, reducing the side effects, and making radiotherapy more effective. PMID:24990355

  8. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-01-01

    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24198458

  9. Applications of gold nanoparticles in cancer nanotechnology

    PubMed Central

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2013-01-01

    It has been almost 4 decades since the “war on cancer” was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a “magic gold bullet” against cancer. PMID:24163578

  10. Gold Creek: Preserving an Environmental Studies Center.

    ERIC Educational Resources Information Center

    Brooks, Suzanne

    In response to a Board of Trustees request for information and recommendations concerning the future use of the Gold Creek property owned by the Los Angeles Community College District, this report emphasizes that the use of this site for instructional field experiences enhances the quality of environmental education for the district's diverse…

  11. Crystalline and amorphous gold in chrysiasis.

    PubMed

    Benn, H P; von Gaudecker, B; Czank, M; Loeffler, H

    1990-01-01

    Skin biopsy specimens from five patients (three females and two males) treated parenterally with gold were investigated using transmission electron microscopy. X-ray microanalysis and electron diffraction were used to determine the dermal heavy metal content. Additional sections were stained for light microscopic examination. The amount of elemental gold administered to the patients over a period of years to alleviate rheumatoid arthritis lay between a minimum of 4.0 g and a maximum of 10.0 g. In one and the same patient dermal histiocytic gold aggregations in sun-exposed areas of skin displayed a different pattern and divergent physiochemical states from the gold deposits in non-UV-exposed skin, where aurosome-like amorphous formations are found in the cells of the upper dermis. Additional spherical particles are associated predominantly with phagolysosomes in melanophages beneath solar-irradiated epidermis. Convergent beam electron diffraction proves the crystalline nature of the spherical auriferous deposits. The occurrence of skin rash was not related to different physicochemical states of the precious metal.

  12. Applications of gold nanoparticles in cancer nanotechnology.

    PubMed

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-09-19

    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  13. Applications of gold nanoparticles in cancer nanotechnology.

    PubMed

    Cai, Weibo; Gao, Ting; Hong, Hao; Sun, Jiangtao

    2008-09-01

    It has been almost 4 decades since the "war on cancer" was declared. It is now generally believed that personalized medicine is the future for cancer patient management. Possessing unprecedented potential for early detection, accurate diagnosis, and personalized treatment of cancer, nanoparticles have been extensively studied over the last decade. In this review, we will summarize the current state-of-the-art of gold nanoparticles in biomedical applications targeting cancer. Gold nanospheres, nanorods, nanoshells, nanocages, and surface enhanced Raman scattering nanoparticles will be discussed in detail regarding their uses in in vitro assays, ex vivo and in vivo imaging, cancer therapy, and drug delivery. Multifunctionality is the key feature of nanoparticle-based agents. Targeting ligands, imaging labels, therapeutic drugs, and other functionalities can all be integrated to allow for targeted molecular imaging and molecular therapy of cancer. Big strides have been made and many proof-of-principle studies have been successfully performed. The future looks brighter than ever yet many hurdles remain to be conquered. A multifunctional platform based on gold nanoparticles, with multiple receptor targeting, multimodality imaging, and multiple therapeutic entities, holds the promise for a "magic gold bullet" against cancer.

  14. Functionalized gold nanorods for molecular optoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Eghtedari, Mohammad; Oraevsky, Alexander; Conjusteau, Andre; Copland, John A.; Kotov, Nicholas A.; Motamedi, Massoud

    2007-02-01

    The development of gold nanoparticles for molecular optoacoustic imaging is a very promising area of research and development. Enhancement of optoacoustic imaging for molecular detection of tumors requires the engineering of nanoparticles with geometrical and molecular features that can enhance selective targeting of malignant cells while optimizing the sensitivity of optoacoustic detection. In this article, cylindrical gold nanoparticles (i.e. gold nanorods) were fabricated with a plasmon resonance frequency in the near infra-red region of the spectrum, where deep irradiation of tissue is possible using an Alexandrite laser. Gold nanorods (Au-NRs) were functionalized by covalent attachment of Poly(ethylene glycol) to enhance their biocompatibility. These particles were further functionalized with the aim of targeting breast cancer cells using monoclonal antibodies that binds to Her2/neu receptors, which are over expressed on the surface of breast cancer cells. A custom Laser Optoacoustic Imaging System (LOIS) was designed and employed to image nanoparticle-targeted cancer cells in a phantom and PEGylated Au-NRs that were injected subcutaneously into a nude mouse. The results of our experiments show that functionalized Au-NRs with a plasmon resonance frequency at near infra-red region of the spectrum can be detected and imaged in vivo using laser optoacoustic imaging system.

  15. The golden age: gold nanoparticles for biomedicine.

    PubMed

    Dreaden, Erik C; Alkilany, Alaaldin M; Huang, Xiaohua; Murphy, Catherine J; El-Sayed, Mostafa A

    2012-04-07

    Gold nanoparticles have been used in biomedical applications since their first colloidal syntheses more than three centuries ago. However, over the past two decades, their beautiful colors and unique electronic properties have also attracted tremendous attention due to their historical applications in art and ancient medicine and current applications in enhanced optoelectronics and photovoltaics. In spite of their modest alchemical beginnings, gold nanoparticles exhibit physical properties that are truly different from both small molecules and bulk materials, as well as from other nanoscale particles. Their unique combination of properties is just beginning to be fully realized in range of medical diagnostic and therapeutic applications. This critical review will provide insights into the design, synthesis, functionalization, and applications of these artificial molecules in biomedicine and discuss their tailored interactions with biological systems to achieve improved patient health. Further, we provide a survey of the rapidly expanding body of literature on this topic and argue that gold nanotechnology-enabled biomedicine is not simply an act of 'gilding the (nanomedicinal) lily', but that a new 'Golden Age' of biomedical nanotechnology is truly upon us. Moving forward, the most challenging nanoscience ahead of us will be to find new chemical and physical methods of functionalizing gold nanoparticles with compounds that can promote efficient binding, clearance, and biocompatibility and to assess their safety to other biological systems and their long-term term effects on human health and reproduction (472 references).

  16. Gold Creek: An Environmental Studies Center.

    ERIC Educational Resources Information Center

    Woodley, Laurel

    A description is provided of the Gold Creek Ecological Reserve, 240 acres of undisturbed land in Northeast Los Angeles County, which serves the Los Angeles Community College District (LACCD) as an outdoor laboratory for students and faculty in numerous disciplines. Section I provides introductory information on the reserve and its features, which…

  17. Gold(III)-Catalyzed Hydration of Phenylacetylene

    ERIC Educational Resources Information Center

    Leslie, J. Michelle; Tzeel, Benjamin A.

    2016-01-01

    A guided inquiry-based experiment exploring the regioselectivity of the hydration of phenylacetylene is described. The experiment uses an acidic gold(III) catalyst in a benign methanol/water solvent system to introduce students to alkyne chemistry and key principles of green chemistry. The experiment can be easily completed in approximately 2 h,…

  18. Hydroquinone Based Synthesis of Gold Nanorods.

    PubMed

    Picciolini, Silvia; Mehn, Dora; Ojea-Jiménez, Isaac; Gramatica, Furio; Morasso, Carlo

    2016-08-10

    Gold nanorods are an important kind of nanoparticles characterized by peculiar plasmonic properties. Despite their widespread use in nanotechnology, the synthetic methods for the preparation of gold nanorods are still not fully optimized. In this paper we describe a new, highly efficient, two-step protocol based on the use of hydroquinone as a mild reducing agent. Our approach allows the preparation of nanorods with a good control of size and aspect ratio (AR) simply by varying the amount of hexadecyl trimethylammonium bromide (CTAB) and silver ions (Ag(+)) present in the "growth solution". By using this method, it is possible to markedly reduce the amount of CTAB, an expensive and cytotoxic reagent, necessary to obtain the elongated shape. Gold nanorods with an aspect ratio of about 3 can be obtained in the presence of just 50 mM of CTAB (versus 100 mM used in the standard protocol based on the use of ascorbic acid), while shorter gold nanorods are obtained using a concentration as low as 10 mM.

  19. Shape-Controlled Gold Nanoparticle Synthesis

    DTIC Science & Technology

    2013-09-01

    shaped nanoparticles were produced. Liu and Guyot -Sionnest (9) showed through high-resolution transmission electron microscopy (TEM) that citrate-capped...14317. 9. Liu, M.; Guyot -Sionnest, P. Mechanism of Silver (I)-Assisted Growth of Gold Nanorods and Bipyramids. The Journal of Physical Chemistry B

  20. WILLIAM GOLDING'S NOVEL--THE BACKWARD LOOK.

    ERIC Educational Resources Information Center

    PECK, CAROL FAULKNER

    THE "SURPRISE ENDINGS" IN EACH OF WILLIAM GOLDING'S FIRST FOUR NOVELS OCCUR WHEN THE POINT OF VIEW SHIFTS FROM THE LIMITED WORLD OF THE NOVEL TO THE UNLIMITED WORLD OF REALITY. THE BOYS' RESCUE BY THE UNCOMPREHENDING OFFICER IN "LORD OF THE FLIES," REFOCUSES AND REINFORCES ALL THAT PRECEDES IT, AND THE FABLE, SUPERIMPOSED UPON REAL LIFE, BECOMES…

  1. Understanding gold nanoisland formation using transport measurement

    NASA Astrophysics Data System (ADS)

    Joshi, Toyanath

    Novel metal nano-clusters are always being an interest of scientists and researchers because of their unique optical and chemical properties. This thesis studies the formation mechanism of gold nanoisland film by studying transport properties. We used layer-by-layer self-assembled multilayer gold samples and annealed them at the temperature ranging from room temperature to 625°C. Transport properties, particularly the resistance and capacitance, were measured in situ during annealing and compared with the surface morphology and UV-vis studies. Five films of the 8-layer gold and one film of the 5-layer silver and 5-layer gold nanoparticle sequentially self-assembled samples were measured. Temperature dependent resistance curves were plotted and analyzed. From the resistance curves, we were able to identify the actual temperature for polymer evaporation and nanoisland formation. These data were re-verified by comparing them with the temperature dependent studies of surface morphology and UV-vis spectroscopy. The effect of measuring condition, like heating rate and pre-annealing time factor, was also analyzed. Particularly, the slow heating and long pre-annealing time effected nanoisland growth mechanism.

  2. Atmospheric Turbulence Statistics from GOLD Experiments

    NASA Technical Reports Server (NTRS)

    Jeganathan, Muthu; Wilson, Keith; Lesh, Jim

    1996-01-01

    Ground-Orbiter Lasercomm Demonstration (GOLD) includes the following: (1) Optical communication experiments between Table Mountain Observatory (TMF) and Japanese Engineering Test Satellite (ETS-VI); (2) International cooperative effort between NASA, NASDA, CRL and JPL; and (3) Phase 1 transmissions from October 1995 to January 1996 and Phase 2 transmissions from March 1996 to May 1996.

  3. X-ray laser driven gold targets

    SciTech Connect

    Petrova, Tz. B. Whitney, K. G.; Davis, J.

    2014-03-15

    The femtosecond population dynamics of gold irradiated by a coherent high-intensity (>10{sup 17} W/cm{sup 2}) x-ray laser pulse is investigated theoretically. There are two aspects to the assembled model. One is the construction of a detailed model of platinum-like gold inclusive of all inner-shell states that are created by photoionization of atomic gold and decay either by radiative or Auger processes. Second is the computation of the population dynamics that ensues when an x-ray pulse is absorbed in gold. The hole state generation depends on the intensity and wavelength of the driving x-ray pulse. The excited state populations reached during a few femtosecond timescales are high enough to generate population inversions, whose gain coefficients are calculated. These amplified lines in the emitted x-ray spectrum provide important diagnostics of the radiation dynamics and also suggest a nonlinear way to increase the frequency of the coherent output x-ray pulses relative to the frequency of the driver input x-ray pulse.

  4. Catalysis of Gold and Gold-Silver Alloy Nanoparticles Supported on Mesoporous Silica

    DTIC Science & Technology

    2009-11-26

    catalysts greatly and an acidic silica support may solve this problem. Our purpose here is to develop stable gold-based nanocatalysts for the...Discussion: (1) Au system: We first demonstrate the use of pure gold nanocatalyst in catalysis of CO oxidation. While there are a large number of recent...studies of Au nanocatalysts supported on metal oxides, low-temperature CO oxidation under an acidic environment has not yet been accomplished. Over

  5. Analysis of gold(I/III)-complexes by HPLC-ICP-MS demonstrates gold(III) stability in surface waters.

    PubMed

    Ta, Christine; Reith, Frank; Brugger, Joël; Pring, Allan; Lenehan, Claire E

    2014-05-20

    Understanding the form in which gold is transported in surface- and groundwaters underpins our understanding of gold dispersion and (bio)geochemical cycling. Yet, to date, there are no direct techniques capable of identifying the oxidation state and complexation of gold in natural waters. We present a reversed phase ion-pairing HPLC-ICP-MS method for the separation and determination of aqueous gold(III)-chloro-hydroxyl, gold(III)-bromo-hydroxyl, gold(I)-thiosulfate, and gold(I)-cyanide complexes. Detection limits for the gold species range from 0.05 to 0.30 μg L(-1). The [Au(CN)2](-) gold cyanide complex was detected in five of six waters from tailings and adjacent monitoring bores of working gold mines. Contrary to thermodynamic predictions, evidence was obtained for the existence of Au(III)-complexes in circumneutral, hypersaline waters of a natural lake overlying a gold deposit in Western Australia. This first direct evidence for the existence and stability of Au(III)-complexes in natural surface waters suggests that Au(III)-complexes may be important for the transport and biogeochemical cycling of gold in surface environments. Overall, these results show that near-μg L(-1) enrichments of Au in environmental waters result from metastable ligands (e.g., CN(-)) as well as kinetically controlled redox processes leading to the stability of highly soluble Au(III)-complexes.

  6. Bioaccumulation of gold by sulfate-reducing bacteria cultured in the presence of gold(I)-thiosulfate complex

    NASA Astrophysics Data System (ADS)

    Lengke, Maggy; Southam, Gordon

    2006-07-01

    A sulfate-reducing bacterial (SRB) enrichment, from the Driefontein Consolidated Gold Mine, Witwatersrand Basin, Republic of South Africa, was able to destabilize gold(I)-thiosulfate complex (Au(SO)23-) and precipitate elemental gold. The precipitation of gold was observed in the presence of active (live) SRB due to the formation and release of hydrogen sulfide as an end-product of metabolism, and occurred by three possible mechanisms involving iron sulfide, localized reducing conditions, and metabolism. The presence of biogenic iron sulfide caused significant removal of gold from solutions by adsorption and reduction processes on the iron sulfide surfaces. The presence of gold nanoparticles within and immediately surrounding the bacterial cell envelope highlights the presence of localized reducing conditions produced by the bacterial electron transport chain via energy generating reactions within the cell. Specifically, the decrease in redox conditions caused by the release of hydrogen sulfide from the bacterial cells destabilized the Au(SO)23- solutions. The presence of gold as nanoparticles (<10 nm) inside a sub-population of SRB suggests that the reduction of gold was a part of metabolic process. In late stationary phase or death phase, gold nanoparticles that were initially precipitated inside the bacterial cells, were released from the cells and deposited in the bulk solution as addition of gold nanoparticles that already precipitated in the solution. Ultimately, the formation of micrometer-scale sub-octahedral and octahedral gold and spherical aggregates containing octahedral gold was observed.

  7. Gold-Catalyzed Rearrangements and Beyond

    PubMed Central

    2013-01-01

    Cycloisomerizations of enynes are probably the most representative carbon–carbon bond forming reactions catalyzed by electrophilic metal complexes. These transformations are synthetically useful because chemists can use them to build complex architectures under mild conditions from readily assembled starting materials. However, these transformations can have complex mechanisms. In general, gold(I) activates alkynes in the presence of any other unsaturated functional group by forming an (η2-alkyne)–gold complex. This species reacts readily with nucleophiles, including electron-rich alkenes. In this case, the reaction forms cyclopropyl gold(I) carbene-like intermediates. These can come from different pathways depending on the substitution pattern of the alkyne and the alkene. In the absence of external nucleophiles, 1,n-enynes can form products of skeletal rearrangement in fully intramolecular reactions, which are mechanistically very different from metathesis reactions initiated by the [2 + 2] cycloaddition of a Grubbs-type carbene or other related metal carbenes. In this Account, we discuss how cycloisomerization and addition reactions of substituted enynes, as well as intermolecular reactions between alkynes and alkenes, are best interpreted as proceeding through discrete cationic intermediates in which gold(I) plays a significant role in the stabilization of the positive charge. The most important intermediates are highly delocalized cationic species that some chemists describe as cyclopropyl gold(I) carbenes or gold(I)-stabilized cyclopropylmethyl/cyclobutyl/homoallyl carbocations. However, we prefer the cyclopropyl gold(I) carbene formulation for its simplicity and mnemonic value, highlighting the tendency of these intermediates to undergo cyclopropanation reactions with alkenes. We can add a variety of hetero- and carbonucleophiles to the enynes in the presence of gold(I) in intra- or intermolecular reactions, leading to the corresponding adducts with

  8. Gold surface with gold nitride-a surface enhanced Raman scattering active substrate

    NASA Astrophysics Data System (ADS)

    Brieva, A. C.; Alves, L.; Krishnamurthy, S.; Šiller, L.

    2009-03-01

    The nitration of gold surfaces is a nonpolluting method, which can lead to large scale production of substrates with remarkable properties and applications. We present a topographical study of the nanoscale structure of the gold nitride surfaces produced by radio frequency (rf) nitrogen plasma etching of thin gold films. Atomic force microscopy images taken after rf etching reveal the striking appearance of the cluster assembly with large clusters surrounded by small clusters (7.9±1.4 and 2.3±0.9 nm, respectively) appearing to exhibit an attractive interaction. We discuss the possible mechanism for this attraction based on a colloid model by Messina et al. [Phys. Rev. Lett. 85, 872 (2000)]. This surface exhibits a notable surface enhanced Raman scattering effect demonstrated with L-alanine and rhodamine-6G. The significance of this work is that we found that this SERS active gold nitride surface can be prepared in just one step: by nitrogen plasma etching a thin gold film. Until now most SERS active gold cluster covered surfaces have been prepared in several steps very often requiring complex lithography.

  9. A halogen-free synthesis of gold nanoparticles using gold(III) oxide

    NASA Astrophysics Data System (ADS)

    Sashuk, Volodymyr; Rogaczewski, Konrad

    2016-09-01

    Gold nanoparticles are one of the most used nanomaterials. They are usually synthesized by the reduction of gold(III) chloride. However, the presence of halide ions in the reaction mixture is not always welcome. In some cases, these ions have detrimental influence on the morphology and structure of resulting nanoparticles. Here, we present a simple and halogen-free procedure to prepare gold nanoparticles by reduction of gold(III) oxide in neat oleylamine. The method provides the particles with an average size below 10 nm and dispersity of tens of percent. The process of nanoparticle formation was monitored using UV-Vis spectroscopy. The structure and chemical composition of the nanoparticles was determined by SEM, XPS and EDX. We also proposed the mechanism of reduction of gold(III) oxide based on MS, IR and NMR data. Importantly, the synthetic protocol is general and applicable for the preparation of other coinage metal nanoparticles from the corresponding metal oxides. For instance, we demonstrated that the absence of halogen enables efficient alloying of metals when preparing gold-silver bimetallic nanoparticles.

  10. Magnetic resonance investigation of gold-doped and gold-hydrogen-doped silicon

    NASA Astrophysics Data System (ADS)

    Huy, P. T.; Ammerlaan, C. A.

    2002-10-01

    Three paramagnetic centers related to gold have been observed in gold-doped and gold-doped hydrogenated silicon by magnetic resonance. One spectrum, labeled Si-NL62, corresponding to a center with monoclinic-I symmetry, presents fourfold splitting due to the hyperfine interaction with one gold atom and further hyperfine interaction with two silicon nearest-neighbor atoms. After being diffused with hydrogen in a wet atmosphere of water vapor at 1300 °C for about 30 min, a second electron paramagnetic resonance spectrum, labeled Si-NL63, is detected, also of the monoclinic-I symmetry. The spectrum of the center is characterized by a complex hyperfine structure, in which, depending on magnetic field orientation, a sevenfold splitting with the intensities 1:2:3:4:3:2:1, a fourfold splitting 4:4:4:4, and other more arbitrary structures are observed. Extra small splitting is observed in the sample diffused with deuterium, indicating hydrogen involvement in the microscopic structure of the Si-NL63 center. Under band gap illumination the third center of a one-gold-two-hydrogen complex is observed. The center, labeled Si-NL64, has low triclinic symmetry and features the hyperfine interactions with one gold and two nearly equivalent hydrogen atoms. This results in a (1:2:1):(1:2:1):(1:2:1):(1:2:1) structure of each group of spectral lines. Spin-Hamiltonian parameters for the three spectra are determined and microscopic models are discussed.

  11. Detailed energy distributions in laser-produced plasmas of solid gold and foam gold planar targets

    SciTech Connect

    Dong, Yunsong; Zhang, Lu; Yang, Jiamin; Shang, Wanli

    2013-12-15

    Foam gold was proposed to increase the laser to x-ray conversion efficiency due to its important applications. To understand the mechanism of x-ray enhancement, the detailed energy distributions and plasma profiles for laser-irradiated solid gold and foam gold targets were studied comparatively by hydrodynamic simulations using the code Multi-1D. It is confirmed that the radiation heat wave is subsonic for the normal solid gold target, while supersonic for the foam gold target. The shock wave, which is behind the supersonic radiation heat wave for the foam gold target, generates a plasma temperature gradient with high temperature near the shock wave front to produce an additional net outward radiation for enhancement of the x-ray emission. Much larger inward plasma velocity is also driven by the shock wave as an initial plasma velocity for the laser deposition and electron thermal conduct zone, which decreases the expanding plasma kinetic energy loss and helps to increase the x-ray radiation.

  12. Polymer decorated gold nanoparticles in nanomedicine conjugates.

    PubMed

    Capek, Ignác

    2017-02-15

    Noble metal, especially gold nanoparticles and their conjugates with biopolymers have immense potential for disease diagnosis and therapy on account of their surface plasmon resonance (SPR) enhanced light scattering and absorption. Conjugation of noble metal nanoparticles to ligands specifically targeted to biomarkers on diseased cells allows molecular-specific imaging and detection of disease. The development of smart gold nanoparticles (AuNPs) that can deliver therapeutics at a sustained rate directly to cancer cells may provide better efficacy and lower toxicity for treating cancer tumors. We highlight some of the promising classes of targeting systems that are under development for the delivery of gold nanoparticles. Nanoparticles designed for biomedical applications are often coated with polymers containing reactive functional groups to conjugate targeting ligands, cell receptors or drugs. Using targeted nanoparticles to deliver chemotherapeutic agents in cancer therapy offers many advantages to improve drug/gene delivery and to overcome many problems associated with conventional radiotherapy and chemotherapy. The targeted nanoparticles were found to be effective in killing cancer cells which were studied using various anticancer assays. Cell morphological analysis shows the changes occurred in cancer cells during the treatment with AuNPs. The results determine the influence of particle size and concentration of AuNPs on their absorption, accumulation, and cytotoxicity in model normal and cancer cells. As the mean particle diameter of the AuNPs decreased, their rate of absorption by the intestinal epithelium cells increased. These results provide important insights into the relationship between the dimensions of AuNPs and their gastrointestinal uptake and potential cytotoxicity. Furthermore gold nanoparticles efficiently convert the absorbed light into localized heat, which can be exploited for the selective laser photothermal therapy of cancer. We also review

  13. RAPID COMMUNICATION: Surface vertical deposition for gold nanoparticle film

    NASA Astrophysics Data System (ADS)

    Diao, J. J.; Qiu, F. S.; Chen, G. D.; Reeves, M. E.

    2003-02-01

    In this rapid communication, we present the surface vertical deposition (SVD) method to synthesize the gold nanoparticle films. Under conditions where the surface of the gold nanoparticle suspension descends slowly by evaporation, the gold nanoparticles in the solid-liquid-gas junction of the suspension aggregate together on the substrate by the force of solid and liquid interface. When the surface properties of the substrate and colloidal nanoparticle suspension define for the SVD, the density of gold nanoparticles in the thin film made by SVD only depends on the descending velocity of the suspension surface and on the concentration of the gold nanoparticle suspension.

  14. Synchrotron X-Ray Synthesized Gold Nanoparticles for Tumor Therapy

    SciTech Connect

    Chien, C. C.; Wang, C. H.; Tseng, P. Y.; Yang, T. Y.; Hua, T. E.; Hwu, Y.; Chen, Y. J.; Chung, K. H.; Je, J. H.; Margaritondo, G.

    2007-01-19

    Highly concentrated gold nanoparticles (20 {+-} 5 nm) were produced by an x-ray irradiation method. The particles were then examined for the interactions between gold and tumor cells under x-ray radiation conditions. The biological effects of gold nanoparticles were investigated in terms of the internalization, cytotoxicity and capability to enhance x-ray radiotherapy. The results of this investigation indicated that x-ray derived gold nanoparticles were nontoxic to CT-26 cell line and immobilized within cytoplasm. The irradiation experiments provided further evidence that gold nanoparticles were capable of enhancing the efficiency of radiotherapy.

  15. Radicals Are Required for Thiol Etching of Gold Particles.

    PubMed

    Dreier, Timothy A; Ackerson, Christopher J

    2015-08-03

    Etching of gold with an excess of thiol ligand is used in both synthesis and analysis of gold particles. Mechanistically, the process of etching gold with excess thiol is unclear. Previous studies have obliquely considered the role of oxygen in thiolate etching of gold. Herein, we show that oxygen or a radical initiator is a necessary component for efficient etching of gold by thiolates. Attenuation of the etching process by radical scavengers in the presence of oxygen, and the restoration of activity by radical initiators under inert atmosphere, strongly implicate the oxygen radical. These data led us to propose an atomistic mechanism in which the oxygen radical initiates the etching process.

  16. The gold-sulfur interface at the nanoscale.

    PubMed

    Häkkinen, Hannu

    2012-05-22

    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  17. In vitro cytotoxicity of gold nanorods in A549 cells.

    PubMed

    Tang, Ying; Shen, Yafeng; Huang, Libin; Lv, Gaojian; Lei, Changhai; Fan, Xiaoyan; Lin, Fangxing; Zhang, Yuxia; Wu, Lihui; Yang, Yongji

    2015-03-01

    Gold nanoparticles, which have unique physicochemical characteristics, are being used for an increasingly wide range of applications in biomedical research. In this study, gold nanorods (width of 25 nm, length of 52 nm) were found to be internalized by A549 cells and were primarily localized in the lysosomes and membranous vesicles. The integrity of the membranes of A549 cells exposed to gold nanorods for 4h was damaged, as indicated by laser scanning confocal microscopy (LSCM). Increased lactate dehydrogenase (LDH) leakage and decreased cell viability further indicated the concentration-dependent cytotoxicity of the gold nanorods to the A549 cells. Reactive oxygen species (ROS) production was induced in the A549 cells by the gold nanorods, and this effect was positively correlated with the concentration of the gold nanorods. The results of this study indicated that exposure to gold nanorods caused dose-dependent cytotoxicity in A549 cells and that oxidative stress may be the main factor causing cytotoxicity.

  18. Preparation and characterization of gold-decorated graphite nanosheet composites.

    PubMed

    Kim, Jungsoo; Nam, Dae Geun; Oh, Weon Tae

    2013-05-01

    Some composites of gold nanoparticles and graphite nanosheets were prepared by electrostatic interaction, and structurally and electrochemically characterized using X-ray diffraction, X-ray photoelectron spectroscopy, UVNis spectroscopy, transmission electron microscopy, and cyclic-voltammetry. Pristine graphite was chemically treated using aqueous acid solution, and dispersed inpoly(diallyldimethylammonium) chloride aqueous solution to prepare positively charged graphite nanosheets. The gold nanoparticles (GNPs) in this work were stabilized by sodium dodecyl sulfate, poly(sodium 4-styrene sulfonate), or poly(vinylpyrrolidone). Gold nanoparticles and graphite nanosheet composites with gold nanoparticles showed the characteristic surface plasmon band at -530 nm. The electrochemical properties of the graphite nanosheet composites with gold nanoparticles were studied by cyclic voltammetry, in which reduction potential and reduction current of gold nanoparticles were strongly dependent on the gold-wrapped stabilizer in the composites.

  19. The gold-sulfur interface at the nanoscale

    NASA Astrophysics Data System (ADS)

    Häkkinen, Hannu

    2012-06-01

    Thiolate-protected gold surfaces and interfaces, relevant for self-assembled monolayers of organic molecules on gold, for passivated gold nanoclusters and for molecule-gold junctions, are archetypal systems in various fields of current nanoscience research, materials science, inorganic chemistry and surface science. Understanding this interface at the nanometre scale is essential for a wide range of potential applications for site-specific bioconjugate labelling and sensing, drug delivery and medical therapy, functionalization of gold surfaces for sensing, molecular recognition and molecular electronics, and gold nanoparticle catalysis. During the past five years, considerable experimental and theoretical advances have furthered our understanding of the molecular structure of the gold-sulfur interface in these systems. This Review discusses the recent progress from the viewpoint of theory and computations, with connections to relevant experiments.

  20. Multiple origins of Canadian Cordilleran gold deposits: geochemical characteristics

    SciTech Connect

    Murowchick, J.B.; Nesbitt, B.E.; Muehlenbachs, K.

    1985-01-01

    Two types of lode Au mineralization (Mother Lode and Epithermal) can be recognized in the Canadian Cordillera by geochemical characteristics. The Coquihalla Au belt, a typical ML district, has steeply-dipping Q-cc-ab-Au veins. Host rocks are greywackes, slates and greenstones in fault contact with a serpentinite body. Isotopic analyses: Q-cc and antigorite-mt paris gives temperatures around 250/sup 0/C. delta/sup 18/O/sub SMOW/ are exceptionally high: vein Q = 16 to 18 per thousand, antigorite = 7.4 to 9.5 per thousand, and cc = 14 to 18 per thousand with delta/sup 13/C/sub PDB/ =-2.9 to -6.9 per thousand. deltaD are low: -111 to -142 for the serpentines and -84 to -100 for fluid inclusion waters extracted by crushing vein Q. These fluids have low salinity and contain CO/sub 2/. The delta/sup 18/O for the ore fluid is about 8 per thousand and was also the serpentinizing fluid. The deltaD suggest that the fluid was dominantly meteoric, but evolved by reaction with the metasediments during deep circulation. The typical ML assemblage is Q-cc-ab with aspy, py, po, Au, +/-AU tellurides +/- scheelite; Au/Ag = 4 to 7 in this belt. Other ML deposits in BC show similar isotopic and mineralogic traits. Epithermal deposits in the Canadian Cordillera are comparable to well-studied US examples: their fluids were shallow-circulated meteoric waters (delta/sup 18/O=-14 to -7), delta/sup 18/O=-5 to +2, T=200-300/sup 0/C, Au/Ag<1, and have Q, chalcedony, cc, hematite, adularia, barite, py, cpy, Ag/sub 2/S, Au, electrum and anomalous Hg, As, and Tl contents. The association of Hg and Sb occurrences near many B.C. ML deposits suggests that these may be the epithermal expression of deeper ML mineralization.

  1. Chirality in thiolate-protected gold clusters.

    PubMed

    Knoppe, Stefan; Bürgi, Thomas

    2014-04-15

    Over recent years, research on thiolate-protected gold clusters Au(m)(SR)n has gained significant interest. Milestones were the successful determination of a series of crystal structures (Au102(SR)44, Au25(SR)18, Au38(SR)24, Au36(SR)24, and Au28(SR)20). For Au102(SR)44, Au38(SR)24, and Au28(SR)20, intrinsic chirality was found. Strong Cotton effects (circular dichroism, CD) of gold clusters protected by chiral ligands have been reported a long time ago, indicating the transfer of chiral information from the ligand into the cluster core. Our lab has done extensive studies on chiral thiolate-protected gold clusters, including those protected with chiral ligands. We demonstrated that vibrational circular dichroism can serve as a useful tool for the determination of conformation of the ligand on the surface of the cluster. The first reports on crystal structures of Au102(SR)44 and Au38(SR)24 revealed the intrinsic chirality of these clusters. Their chirality mainly arises from the arrangement of the ligands on the surface of the cluster cores. As achiral ligands are used to stabilize the clusters, racemic mixtures are obtained. However, the separation of the enantiomers by HPLC was demonstrated which enabled the measurement of their CD spectra. Thermally induced inversion allows determination of the activation parameters for their racemization. The inversion demonstrates that the gold-thiolate interface is anything but fixed; in contrast, it is rather flexible. This result is of fundamental interest and needs to be considered in future applications. A second line of our research is the selective introduction of chiral, bidentate ligands into the ligand layer of intrinsically chiral gold clusters. The ligand exchange reaction is highly diastereoselective. The bidentate ligand connects two of the protecting units on the cluster surface and thus effectively stabilizes the cluster against thermally induced inversion. A minor (but significant) influence of chiral ligands to

  2. Antifungal activity of gold nanoparticles prepared by solvothermal method

    SciTech Connect

    Ahmad, Tokeer; Wani, Irshad A.; Lone, Irfan H.; Ganguly, Aparna; Manzoor, Nikhat; Ahmad, Aijaz; Ahmed, Jahangeer; Al-Shihri, Ayed S.

    2013-01-15

    Graphical abstract: Gold nanoparticles (7 and 15 nm) of very high surface area (329 and 269 m{sup 2}/g) have been successfully synthesized through solvothermal method by using tin chloride and sodium borohydride as reducing agents. As-prepared gold nanoparticles shows very excellent antifungal activity against Candida isolates and activity increases with decrease in the particle size. Display Omitted Highlights: ► Effect of reducing agents on the morphology of gold nanoparticles. ► Highly uniform and monodisperse gold nanoparticles (7 nm). ► Highest surface area of gold nanoparticles (329 m{sup 2/}g). ► Excellent antifungal activity of gold nanoparticles against Candida strains. -- Abstract: Gold nanoparticles have been successfully synthesized by solvothermal method using SnCl{sub 2} and NaBH{sub 4} as reducing agents. X-ray diffraction studies show highly crystalline and monophasic nature of the gold nanoparticles with face centred cubic structure. The transmission electron microscopic studies show the formation of nearly spherical gold nanoparticles of average size of 15 nm using SnCl{sub 2}, however, NaBH{sub 4} produced highly uniform, monodispersed and spherical gold nanoparticles of average grain size of 7 nm. A high surface area of 329 m{sup 2}/g for 7 nm and 269 m{sup 2}/g for 15 nm gold nanoparticles was observed. UV–vis studies assert the excitations over the visible region due to transverse and longitudinal surface plasmon modes. The gold nanoparticles exhibit excellent size dependant antifungal activity and greater biocidal action against Candida isolates for 7 nm sized gold nanoparticles restricting the transmembrane H{sup +} efflux of the Candida species than 15 nm sized gold nanoparticles.

  3. Tectonic history of the northern Nabitah fault zone, Arabian Shield, Kingdom of Saudi Arabia

    USGS Publications Warehouse

    Quick, J.E.; Bosch, Paul S.

    1990-01-01

    Based on the presence of similar lithologies, similar structure, and analogous tectonic setting, the Mother Lode District in California is reviewed as a model for gold occurrences near the Nabitah fault zone in this report.

  4. Ultraviolet imaging detectors for the GOLD mission

    NASA Astrophysics Data System (ADS)

    Siegmund, O. H. W.; McPhate, J.; Curtis, T.; Jelinsky, S.; Vallerga, J. V.; Hull, J.; Tedesco, J.

    2016-07-01

    The GOLD mission is a NASA Explorer class ultraviolet Earth observing spectroscopy instrument that will be flown on a telecommunications satellite in geostationary orbit in 2018. Microchannel plate detectors operating in the 132 nm to 162 nm FUV bandpass with 2D imaging cross delay line readouts and electronics have been built for each of the two spectrometer channels for GOLD. The detectors are "open face" with CsI photocathodes, providing 30% efficiency at 130.4 nm and 15% efficiency at 160.8 nm. These detectors with their position encoding electronics provide 600 x 500 FWHM resolution elements and are photon counting, with event handling rates of > 200 KHz. The operational details of the detectors and their performance are discussed.

  5. Tamper indicating gold nanocup plasmonic films

    NASA Astrophysics Data System (ADS)

    DeVetter, Brent M.; Bernacki, Bruce E.; Bennett, Wendy D.; Schemer-Kohrn, Alan; Alvine, Kyle J.

    2017-02-01

    The spectral signatures of nanoplasmonic films are both robust and tailorable with optical responses ranging from the visible to the near-infrared. We present the development of flexible, elastomeric nanoplasmonic films consisting of periodic arrays of gold nanocups as tamper indicating films. Gold nanocups have polarization-sensitive optical properties that may be manufactured into films that offer unique advantages for tamper indication. These flexible films can be made quickly and at low-cost using the commercially available monodisperse polystyrene nanospheres through self-assembly followed by plasma etching, metal deposition, and lift-off from a sacrificial substrate. The polarization- and angle-dependent optical spectroscopic measurements were performed to characterize the fabricated films. Using polarization-sensitive hyperspectral imaging, we demonstrate how these films can be applied to tamper indication and counterfeit resistance applications.

  6. Synthesis and spectroscopic characterization of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Philip, Daizy

    2008-11-01

    Photoluminescent nanoparticles of gold with size 3, 4, 6, and 9 nm are prepared by borohydride/citrate reduction in presence of polyethylene glycol (PEG)/tannic acid. The prepared nanomaterials are characterized by UV-vis spectroscopy and dynamic light scattering (DLS) technique. Intense photoluminescence (PL) is observed in nanoparticles prepared by fast reduction with borohydride in presence of PEG. A red shift of PL emission from 408 to 456 nm is observed for the change of size from 4 to 6 nm. Increase in PL intensity is observed for all the nanoparticles on the addition of KCl. Citrate reduced gold colloid which consists of large particles of size ˜35 nm with anisotropic shapes showing two plasmon peaks is also prepared. The anisotropy is confirmed by TEM measurement. SERS activity of this colloid is tested using glutamic acid as an adsorbate probe. Assignment of the observed bands is given.

  7. Gold nanodisk array surface plasmon resonance sensor

    NASA Astrophysics Data System (ADS)

    Tian, Xueli

    Surface plasmon resonances in periodic metal nanostructures have been investigated for sensing applications over the last decade. The resonance wavelengths of the nanostructures are usually measured in the transmission or reflection spectrum for chemical and biological sensing. In this thesis, I introduce a nanoscale gap mediated surface plasmon resonance nanodisk array for displacement sensing and a super-period gold nanodisk grating enabled surface plasmon resonance spectrometer sensor. The super-period gold nanodisk grating has a small subwavelength period and a large diffraction grating period. Surface plasmon resonance spectra are measured in the first order diffraction spatial profiles captured by a charge-coupled device (CCD). A surface plasmon resonance sensor for the bovine serum albumin (BSA) protein nanolayer bonding is demonstrated by measuring the surface plasmon resonance shift in the first order diffraction spatial intensity profiles captured by the CCD.

  8. Interconnecting Gold Islands with DNA Origami Nanotubes

    PubMed Central

    Ding, Baoquan; Wu, Hao; Xu, Wei; Zhao, Zhao; Liu, Yan; Yu, Hongbin; Yan, Hao

    2012-01-01

    Scaffolded DNA origami has recently emerged as a versatile, programmable method to fold DNA into arbitrarily shaped nanostructures that are spatially addressable, with sub-10 nm resolution. Toward functional DNA nanotechnology, one of the key challenges is to integrate the bottom up self-assembly of DNA origami with the top-down lithographic methods used to generate surface patterning. In this report we demonstrate that fixed length DNA origami nanotubes, modified with multiple thiol groups near both ends, can be used to connect surface patterned gold islands (tens of nanometers in diameter) fabricated by electron beam lithography (EBL). Atomic force microscopic imaging verified that the DNA origami nanotubes can be efficiently aligned between gold islands with various inter-island distances and relative locations. This development represents progress toward the goal of bridging bottom up and top down assembly approaches. PMID:21070012

  9. Gold resource modeling using pod indicator kriging

    NASA Astrophysics Data System (ADS)

    Bargawa, Waterman Sulistyana; Rauf, Abdul; Amri, Nur Ali

    2016-02-01

    This paper describes an implementation of the pod indicator kriging method used to gold resource modeling. Method such as ordinary kriging estimate the mean grade of a block that is fairly large. The usual outcome is that large blocks rarely turn out to be all ore or all waste, thus making reserve estimates an incorrect estimate of what will be mined. Pod indicator kriging offers a solution to this problem by estimating the distribution of grade values within a large block, rather than just estimating the mean grade of the block. Knowing the distribution of grade value within the block, it is then easy to calculate the proportion of the block that is above cutoff grade and the grade of the ore above cutoff grade. This research shows that the pod indicator kriging model is quite applicable and reliable in gold resourcemodeling.

  10. Topological states on the gold surface.

    PubMed

    Yan, Binghai; Stadtmüller, Benjamin; Haag, Norman; Jakobs, Sebastian; Seidel, Johannes; Jungkenn, Dominik; Mathias, Stefan; Cinchetti, Mirko; Aeschlimann, Martin; Felser, Claudia

    2015-12-14

    Gold surfaces host special electronic states that have been understood as a prototype of Shockley surface states. These surface states are commonly employed to benchmark the capability of angle-resolved photoemission spectroscopy (ARPES) and scanning tunnelling spectroscopy. Here we show that these Shockley surface states can be reinterpreted as topologically derived surface states (TDSSs) of a topological insulator (TI), a recently discovered quantum state. Based on band structure calculations, the Z2-type invariants of gold can be well-defined to characterize a TI. Further, our ARPES measurement validates TDSSs by detecting the dispersion of unoccupied surface states. The same TDSSs are also recognized on surfaces of other well-known noble metals (for example, silver, copper, platinum and palladium), which shines a new light on these long-known surface states.

  11. Gold Nanoparticles for Neural Prosthetics Devices

    PubMed Central

    Zhang, Huanan; Shih, Jimmy; Zhu, Jian; Kotov, Nicholas A.

    2012-01-01

    Treatments of neurological diseases and the realization of brain-computer interfaces require ultrasmall electrodes which are “invisible” to resident immune cells. Functional electrodes smaller than 50μm are impossible to produce with traditional materials due to high interfacial impedance at the characteristic frequency of neural activity and insufficient charge storage capacity. The problem can be resolved by using gold nanoparticle nanocomposites. Careful comparison indicates that layer-by-layer assembled films from Au NPs provide more than threefold improvement in interfacial impedance and one order of magnitude increase in charge storage capacity. Prototypes of microelectrodes could be made using traditional photolithography. Integration of unique nanocomposite materials with microfabrication techniques opens the door for practical realization of the ultrasmall implantable electrodes. Further improvement of electrical properties is expected when using special shapes of gold nanoparticles. PMID:22734673

  12. Biological synthesis of triangular gold nanoprisms

    NASA Astrophysics Data System (ADS)

    Shankar, S. Shiv; Rai, Akhilesh; Ankamwar, Balaprasad; Singh, Amit; Ahmad, Absar; Sastry, Murali

    2004-07-01

    The optoelectronic and physicochemical properties of nanoscale matter are a strong function of particle size. Nanoparticle shape also contributes significantly to modulating their electronic properties. Several shapes ranging from rods to wires to plates to teardrop structures may be obtained by chemical methods; triangular nanoparticles have been synthesized by using a seeded growth process. Here, we report the discovery that the extract from the lemongrass plant, when reacted with aqueous chloroaurate ions, yields a high percentage of thin, flat, single-crystalline gold nanotriangles. The nanotriangles seem to grow by a process involving rapid reduction, assembly and room-temperature sintering of 'liquid-like' spherical gold nanoparticles. The anisotropy in nanoparticle shape results in large near-infrared absorption by the particles, and highly anisotropic electron transport in films of the nanotriangles.

  13. Prospecting for gold in the United States

    USGS Publications Warehouse

    ,

    1967-01-01

    Prospecting for gold is something that probably everyone dreams of trying at least once. To the person who is mainly concerned with this activity as a vacation diversion, prospecting offers a special excitement. There is a constant hope that the next pan of sediment may be "pay dirt," and no other thrill can compare with that experienced when one sees even a few tiny flecks of gold glittering in the black sand at the bottom of his pan. The search itself is its own reward for the efforts expended by the vacation prospector. The would-be prospector hoping for financial gain, however, should carefully consider all the facts of the situation before deciding to set out on a prospecting expedition.

  14. Superlubricity of graphene nanoribbons on gold surfaces.

    PubMed

    Kawai, Shigeki; Benassi, Andrea; Gnecco, Enrico; Söde, Hajo; Pawlak, Rémy; Feng, Xinliang; Müllen, Klaus; Passerone, Daniele; Pignedoli, Carlo A; Ruffieux, Pascal; Fasel, Roman; Meyer, Ernst

    2016-02-26

    The state of vanishing friction known as superlubricity has important applications for energy saving and increasing the lifetime of devices. Superlubricity, as detected with atomic force microscopy, appears when sliding large graphite flakes or gold nanoclusters across surfaces, for example. However, the origin of the behavior is poorly understood because of the lack of a controllable nanocontact. We demonstrated the superlubricity of graphene nanoribbons when sliding on gold with a joint experimental and computational approach. The atomically well-defined contact allows us to trace the origin of superlubricity, unraveling the role played by ribbon size and elasticity, as well as by surface reconstruction. Our results pave the way to the scale-up of superlubricity and thus to the realization of frictionless coatings.

  15. Atomic Diffusion within Individual Gold Nanocrystal

    PubMed Central

    Xiong, Gang; Clark, Jesse N.; Nicklin, Chris; Rawle, Jonathan; Robinson, Ian K.

    2014-01-01

    Due to their excess surface free energy and structural instabilities, nanoparticles exhibit interesting physical and chemical properties. There has been an ever-growing interest in investigating these properties, driven by the desire to further miniaturize electronic devices, develop new functional materials and catalysts. Here, the intriguing question of how diffusion evolves in a single nanoparticle is investigated by measuring the spatial and temporal variations of the diffracted coherent X-ray intensity during copper diffusion into a gold nanocrystal. Dislocation loops formed from the insertion of single layer of extra atoms between neighbouring gold host lattice planes are detected. Au-Cu alloy channels are found to penetrate the nanocrystal due to the differential diffusion rate along different directions. With the advent of higher brilliance sources and free-electron-lasers, Bragg Coherent X-ray Diffraction Imaging can play an important role in unveiling atomic behaviours in three dimensions for nanomaterials during various fundamental processes. PMID:25341377

  16. A 'Pot of Gold' Rich with Nuggets

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This close-up image taken by the Mars Exploration Rover Spirit highlights the nodular nuggets that cover the rock dubbed 'Pot of Gold.' These nuggets appear to stand on the end of stalk-like features. The surface of the rock is dotted with fine-scale pits. Data from the rover's scientific instruments have shown that Pot of Gold contains the mineral hematite, which can be formed with or without water.

    Scientists are planning further observations of this rock, which they hope will yield more insight into the hematite's origins as well as how the enigmatic nuggets formed.

    This image was taken by Spirit's microscopic imager on sol 162 (June 17, 2004). The observed area is 3 centimeters by 3 centimeters (1.2 inches by 1.2 inches)

  17. Chandra Locates Mother Lode of Planetary Ore in Colliding Galaxies

    NASA Astrophysics Data System (ADS)

    2004-01-01

    NASA's Chandra X-ray Observatory has discovered rich deposits of neon, magnesium, and silicon in a pair of colliding galaxies known as The Antennae. When the clouds in which these elements are present cool, an exceptionally high number of stars with planets should form. These results may foreshadow the fate of the Milky Way and its future collision with the Andromeda Galaxy. "The amount of enrichment of elements in The Antennae is phenomenal," said Giuseppina Fabbiano of the Harvard-Smithsonian Center for Astrophysics (CfA) in Cambridge, Mass. at a press conference at a meeting of the American Astronomical Society in Atlanta, Ga. "This must be due to a very high rate of supernova explosions in these colliding galaxies." Fabbiano is lead author of a paper on this discovery by a team of U.S. and U.K. scientists that will appear in an upcoming issue of The Astrophysical Journal Letters. When galaxies collide, direct hits between stars are extremely rare, but collisions between huge gas clouds in the galaxies can trigger a stellar baby boom. The most massive of these stars race through their evolution in a few million years and explode as supernovas. Heavy elements manufactured inside these stars are blown away by the explosions and enrich the surrounding gas for thousands of light years. "The amount of heavy elements supports earlier studies that indicate there was a very high rate of relatively recent supernovas, 30 times that of the Milky Way," according to collaborator Andreas Zezas of the CfA. Animation of Colliding Galaxies Animation of Colliding Galaxies The supernova violence also heats the gas to millions of degrees Celsius. This makes much of the matter in the clouds invisible to optical telescopes, but it can be observed by an X-ray telescope. Chandra data revealed for the first time regions of varying enrichment in the galaxies – in one cloud magnesium and silicon are 16 and 24 times as abundant as in the Sun. "These are the kinds of elements that form the ultimate building blocks for habitable planets," said Andrew King of the University of Leicester, U.K. and a coauthor of the study. "This process occurs in all galaxies, but it is greatly enhanced by the collision. Usually we only see the new elements in diluted form as they are mixed up with the rest of the interstellar gas." CfA coauthor Alessandro Baldi commented that, "This is spectacular confirmation of the idea that the basis of chemistry, of planets, and ultimately of life is assembled inside stars and spread through galaxies by supernova explosions," As the enriched gas cools, a new generation of stars will form, and with them new planets. A number of studies indicate that clouds enriched in heavy elements are more likely to form stars with planetary systems, so in the future an unusually high number of planets may form in The Antennae. "If life arises on a significant fraction of these planets, then in the future the Antennae will be teeming with life," speculated Francois Schweizer, another coauthor who is from the Carnegie Observatories in Pasadena, Calif. "A vast number of Sun like stars and planetary systems will age in unison for billions of years." At a distance of about 60 million light years, The Antennae system is the nearest example of a collision between two large galaxies. The collision, which began a couple of hundred million years ago, has been so violent that gas and stars from the galaxies have been ejected into the two long arcs that give the system its name. The Chandra image shows spectacular loops of 3-million-degree gas spreading out south of the antennae. "These loops may be carrying out some of the elements dispersed by supernovas into intergalactic space," said Trevor Ponman of Birmingham University, U.K. The Antennae give a closeup view of the type of collisions that were common in the early universe and likely led to the formation of most of the stars that exist in the universe today. They may also provide a glimpse of the future of our Milky Way Galaxy, which is on a collision course with the Andromeda Galaxy. At the present rate, a crash such as the one now occurring in the Antennae could happen in about 3 billion years. Tremendous gravitational forces will disrupt both galaxies and reform them, probably as a giant elliptical galaxy with hundreds of millions of young Sun like stars, and possibly planetary systems. NASA's Marshall Space Flight Center, Huntsville, Ala., manages the Chandra program for the Office of Space Science, NASA Headquarters, Washington. Northrop Grumman of Redondo Beach, Calif., formerly TRW, Inc., was the prime development contractor for the observatory. The Smithsonian Astrophysical Observatory controls science and flight operations from the Chandra X-ray Center in Cambridge, Mass. Additional information and images are available at: http://chandra.harvard.edu and http://chandra.nasa.gov

  18. Mother Lode: The Untapped Rare Earth Mineral Resources of Vietnam

    DTIC Science & Technology

    2013-11-01

    magnets made from neodymium are a key component in both flash-drive and electric vehicle technologies. 10 There are also critical applications...advanced radar and sonar systems (yttrium, lanthanum, neodymium , europium, lutetium); missile guidance and...systems (praseodymium, samarium, terbium, dysprosium); as well as electric motors and jet engines ( neodymium , praseodymium, samarium, terbium, dysprosium

  19. A Mother Lode of Images for Teaching History.

    ERIC Educational Resources Information Center

    Lefever, Margaret

    1987-01-01

    Reviews two 35mm slide collections recently published by Instructional Resources Corporation. Each collection contains 2100 slides, captioned and categorized to allow easy use. The United States history collection and the Western Civilization collection include many different topics. (JDH)

  20. Local density variation of gold nanoparticles in aquatic environments

    NASA Astrophysics Data System (ADS)

    Hosseinzadeh, F.; Shirazian, F.; Shahsavari, R.; Khoei, A. R.

    2016-10-01

    Gold (Au) nanoparticles are widely used in diagnosing cancer, imaging, and identification of therapeutic methods due to their particular quantum characteristics. This research presents different types of aqueous models and potentials used in TIP3P, to study the effect of the particle size and density of Au clusters in aquatic environments; so it can be useful to facilitate future investigation of the interaction of proteins with Au nanoparticles. The EAM potential is used to model the structure of gold clusters. It is observed that in the systems with identical gold/water density and different cluster radii, gold particles are distributed in aqueous environment almost identically. Thus, Au particles have identical local densities, and the root mean square displacement (RMSD) increases with a constant slope. However in systems with constant cluster radii and different gold/water densities, Au particle dispersion increases with density; as a result, the local density decreases and the RMSD increases with a larger slope. In such systems, the larger densities result in more blunted second peaks in gold-gold radial distribution functions, owing to more intermixing of the clusters and less FCC crystalline features at longer range, a mechanism that is mediated by the competing effects of gold-water and gold-gold interactions.

  1. Irradiation stability and cytotoxicity of gold nanoparticles for radiotherapy

    PubMed Central

    Zhang, Xiao-Dong; Guo, Mei-Li; Wu, Hong-Ying; Sun, Yuan-Ming; Ding, Yan-Qiu; Feng, Xin; Zhang, Liang-An

    2009-01-01

    Gold nanoparticles are promising as a kind of novel radiosensitizer in radiotherapy. If gold nanoparticles are shown to have good irradiation stability and biocompatibility, they would play an important role in radiotherapy. In this work, we investigated irradiation effects of gold nanoparticles under 2–10 kR gamma irradiation and cytotoxicity of gold nanoparticles with human K562 cells by using Cell Titre-Glo™ luminescent cell viability assay. The results revealed that gamma irradiation had not induced any obvious instability and size variations in gold nanoparticles. We found that gold nanoparticles showed excellent radiation hardness with an absorbed dose conversation factor of 9.491 rad/R. Meanwhile, the surface plasmon resonance of gold nanoparticles was enhanced obviously after 2–10 kR gamma irradiation. Subsequently, cytotoxicity tests indicated that the extremely high concentration of gold nanoparticles could cause a sharp decrease in K562 cell viability, while the low concentration of gold nanoparticles had no obvious influence on the cell viability. Our results revealed that gold nanoparticles were stable under high-energy ray irradiation and showed concentration-dependent cytotoxicity. PMID:19774115

  2. Role of CO2 in the formation of gold deposits.

    PubMed

    Phillips, G N; Evans, K A

    2004-06-24

    Much of global gold production has come from deposits with uneconomic concentrations of base metals, such as copper, lead and zinc. These 'gold-only' deposits are thought to have formed from hot, aqueous fluids rich in carbon dioxide, but only minor significance has been attached to the role of the CO2 in the process of gold transport. This is because chemical bonding between gold ions and CO2 species is not strong, and so it is unlikely that CO2 has a direct role in gold transport. An alternative indirect role for CO2 as a weak acid that buffers pH has also appeared unlikely, because previously inferred pH values for such gold-bearing fluids are variable. Here we show that such calculated pH values are unlikely to record conditions of gold transport, and propose that CO2 may play a critical role during gold transport by buffering the fluid in a pH range where elevated gold concentration can be maintained by complexation with reduced sulphur. Our conclusions, which are supported by geochemical modelling, may provide a platform for new gold exploration methods.

  3. Gold fingerprinting by laser ablation inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Watling, R. John; Herbert, Hugh K.; Delev, Dianne; Abell, Ian D.

    1994-02-01

    Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) has been applied to the characterization of the trace element composition "fingerprint" of selected gold samples from Western Australia and South Africa. By comparison of the elemental associations it is possible to relate gold to a specific mineralizing event, mine or bullion sample. This methodology facilitates identification of the provenance of stolen gold or gold used in salting activities. In this latter case, it is common for gold from a number of sources to be used in the salting process. Consequently, gold in the prospect being salted will not come from a single source and identification of multiple sources for this gold will establish that salting has occurred. Preliminary results also indicate that specific elemental associations could be used to identify the country of origin of gold. The technique has already been applied in 17 cases involving gold theft in Western Australia, where it is estimated that up to 2% of gold production is "relocated" each year as a result of criminal activities.

  4. Assembly of functional gold nanoparticle on silica microsphere.

    PubMed

    Wang, Hsuan-Lan; Lee, Fu-Cheng; Tang, Tse-Yu; Zhou, Chenguang; Tsai, De-Hao

    2016-05-01

    We demonstrate a controlled synthesis of silica microsphere with the surface-decorated functional gold nanoparticles. Surface of silica microsphere was modified by 3-aminopropypltriethoxysilane and 3-aminopropyldimethylethoxysilane to generate a positive electric field, by which the gold nanoparticles with the negative charges (unconjugated, thiolated polyethylene glycol functionalized with the traceable packing density and conformation) were able to be attracted to the silica microsphere. Results show that both the molecular conjugation on gold nanoparticle and the uniformity in the amino-silanization of silica microsphere influenced the loading and the homogeneity of gold nanoparticles on silica microsphere. The 3-aminopropyldimethylethoxysilane-functionalized silica microsphere provided an uniform field to attract gold nanoparticles. Increasing the ethanol content in aminosilane solution significantly improved the homogeneity and the loading of gold nanoparticles on the surface of silica microsphere. For the gold nanoparticle, increasing the molecular mass of polyethylene glycol yielded a greater homogeneity but a lower loading on silica microsphere. Bovine serum albumin induced the desorption of gold nanoparticles from silica microsphere, where the extent of desorption was suppressed by the presence of high-molecular mass polyethylene glycol on gold nanoparticles. This work provides the fundamental understanding for the synthesis of gold nanoparticle-silica microsphere constructs useful to the applications in chemo-radioactive therapeutics.

  5. A novel 'Gold on Gold' biosensing scheme for an on-fiber immunoassay

    NASA Astrophysics Data System (ADS)

    Punjabi, N.; Satija, J.; Mukherji, S.

    2015-05-01

    In this paper, we propose a novel „gold on gold‟ biosensing scheme for absorbance based fiber-optic biosensor. First, a self-assembled monolayer of gold nanoparticles is formed at the sensing region of the fiber-optic probe by incubating an amino-silanized probe in a colloidal gold solution. Thereafter, the receptor moieties, i.e. Human immunoglobulin G (HIgG) were immobilized by using standard alkanethiol and classic carbodiimide coupling chemistry. Finally, biosensing experiments were performed with different concentrations of gold nanoparticle-tagged analyte, i.e. Goat anti- Human immunoglobulin G (Nanogold-GaHIgG). The sensor response was observed to be more than five-fold compared to the control bioassay, in which the sensor matrix was devoid of gold nanoparticle film. Also, the response was found to be ~10 times higher compared to the FITC-tagged scheme and ~14.5 times better compared to untagged scheme. This novel scheme also demonstrated the potential in improving the limit of detection for the fiber-optic biosensors.

  6. Differential interferences with clinical chemistry assays by gold nanorods, and gold and silica nanospheres.

    PubMed

    Hinkley, Georgia K; Carpinone, Paul L; Munson, John W; Powers, Kevin W; Roberts, Stephen M

    2015-02-01

    Nanomaterials are known to cause interference with several standard toxicological assays. As part of an in vivo study of PEG-coated gold nanorods in mice, nanorods were added to reference serum, and results for standard clinical chemistry parameters were compared with serum analyzed without nanorods. PEG-coated gold nanorods produced several concentration-dependent interferences. Comparisons were then made with PEG-coated gold and silica nanospheres. Interferences were observed for both materials that differed from gold nanorods. Removal of the particles from serum by centrifugation prior to analysis resolved most, but not all of the interferences. Additional clinical chemistry analyzers were used to further investigate trends in assay interference. We conclude that PEG-coated gold and silica nanoparticles can interfere with standard clinical chemistry tests in ways that vary depending upon material, shape, and specific assay methodology employed. Assay interferences by nanomaterials cannot always be predicted, underscoring the need to verify that nanomaterials under study do not interfere with methods used to evaluate potential biological effects.

  7. Silver- and gold-mediated nucleobase bonding.

    PubMed

    Acioli, Paulo H; Srinivas, Sudha

    2014-08-01

    We report the results of a density functional theory investigation of the bonding of nucleobases mediated by silver and gold atoms in the gas phase. Our calculations use the Becke exchange and Perdew-Wang correlation functional (BPW91) combined with the Stuttgart effective core potentials to represent the valence electrons of gold, silver, and platinum, and the all-electron DGTZVP basis set for C, H, N, and O. This combination was chosen based on tests on the metal atoms and tautomers of adenine, cytosine, and guanine. To establish a benchmark to understand the metal-mediated bonding, we calculated the binding energy of each of the base pairs in their canonical forms. Our calculations show rather strong bonds between the Watson-Crick base pairs when compared with typical values for N-H-N and N-H-O hydrogen bonds. The neutral metal atoms tend to bond near the nitrogen atoms. The effect of the metal atoms on the bonding of nucleobases differs depending on whether or not the metal atoms bond to one of the hydrogen-bonding sites. When the silver or gold atoms bond to a non-hydrogen-bonding site, the effect is a slight enhancement of the cytosine-guanine bonding, but there is almost no effect on the adenine-thymine pairing. The metal atoms can block one of the hydrogen-bonding sites, thus preventing the normal cytosine-guanine and adenine-thymine pairings. We also find that both silver and gold can bond to consecutive guanines in a similar fashion to platinum, albeit with a significantly lower binding energy.

  8. Optical Limiting Materials Based on Gold Nanoparticles

    DTIC Science & Technology

    2014-04-30

    AFRL-OSR-VA-TR-2014-0104 OPTICAL LIMITING MATERIALS BASED ON GOLD NANOPARTICLES John Dawson SOUTH CAROLINA RESEARCH FOUNDATION Final Report 04/30...2009; therefore, the award was modified so that her former department chair, John Dawson, became the PI of the award, with Murphy as a subcontract at...Mediated Synthesis to Nanoscale Sculpting,” Curr. Opin. Colloid. Interfac. Sci. 2011, 16, 128-134. • Sivapalan, S. T.; Vella, J. H.; Yang, T. K.; Dalton

  9. 'Pot of Gold' Close-up

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This false-color image taken by the panoramic camera on the Mars Exploration Rover Spirit shows a close-up of the rock dubbed 'Pot of Gold' (left), which is located near the base of the 'Columbia Hills' in Gusev Crater. Scientists are intrigued by this unusual-looking, nodule-covered rock and plan to investigate its detailed chemistry in coming sols. This picture was taken on sol 159 (June 14, 2004).

  10. Backhoe 3D "gold standard" image

    NASA Astrophysics Data System (ADS)

    Gorham, LeRoy; Naidu, Kiranmai D.; Majumder, Uttam; Minardi, Michael A.

    2005-05-01

    ViSUAl-D (VIsual Sar Using ALl Dimensions), a 2004 DARPA/IXO seedling effort, is developing a capability for reliable high confidence ID from standoff ranges. Recent conflicts have demonstrated that the warfighter would greatly benefit from the ability to ID targets beyond visual and electro-optical ranges[1]. Forming optical-quality SAR images while exploiting full polarization, wide angles, and large bandwidth would be key evidence such a capability is achievable. Using data generated by the Xpatch EM scattering code, ViSUAl-D investigates all degrees of freedom available to the radar designer, including 6 GHz bandwidth, full polarization and angle sampling over 2π steradians (upper hemisphere), in order to produce a "literal" image or representation of the target. This effort includes the generation of a "Gold Standard" image that can be produced at X-band utilizing all available target data. This "Gold Standard" image of the backhoe will serve as a test bed for future more relevant military targets and their image development. The seedling team produced a public release data which was released at the 2004 SPIE conference, as well as a 3D "Gold Standard" backhoe image using a 3D image formation algorithm. This paper describes the full backhoe data set, the image formation algorithm, the visualization process and the resulting image.

  11. Identification of Paracoccidioides brasiliensis by gold nanoprobes

    NASA Astrophysics Data System (ADS)

    Martins, Jaciara F. S.; Castilho, Maiara L.; Cardoso, Maria A. G.; Carreiro, Andrea P.; Martin, Airton A.; Raniero, Leandro

    2012-01-01

    Paracoccidioides brasiliensis (P. brasiliensis) is a thermal dimorphic fungus and causal agent of paracoccidioidomycosis. Epidemiological data shows that it is mainly concentrated in Central and South America countries, with most registered cases in Colombia, Brazil, and Venezuela. The histopathological similarity with others fungal infection makes the diagnosis of P. brasiliensis more complicated. Therefore, the aim of this work was to find a positive and negative test for P. brasiliensis using gold nanoprobes as a new tool for P. brasiliensis detection. Gold nanoparticles were synthesized by reduction of gold chloride with sodium citrate. The results of this procedure is a wine-red solution with a maximum absorption in the range of ~520-530nm. A specific P. brasiliensis sequence of oligonucleotide was bonded to the nanoparticles, which maintained the wine-red color. The color changes from red to blue for negative diagnostic and is unchanged for a positive test. The H-bond interaction of DNA with the complementary DNA keeps strands together and forms double helical structure, maintaining the colloid stability. However, for non-complimentary DNA sequence the nanoprobes merge into a cluster, changing the light absorption.

  12. Ion beam analysis of gold jewelry

    NASA Astrophysics Data System (ADS)

    Demortier, Guy

    1992-02-01

    PIXE milliprobe in a nonvacuum assembly has been proven to be a very rapid and accurate method for the elemental analysis of gold jewelry artefacts. Using protons whose energy is lower than 3 MeV, it is possible to obtain, in a few minutes, the actual composition (copper, iron, gold, silver, etc.) of narrow parts of artefacts, without any sampling, even at microscopic level. Most of the studies of our group in this field concern solders on these jewelry items. Narrow regions of gold artefacts have also been studied with a PIXE microprobe. They were then irradiated in vacuum. Nuclear reaction analyses induced by 2 MeV deuterons are also performed to identify the presence of light elements and, particularly O, N and S. Traces of these elements are of primary importance to characterize the origin of the ores used in various workmanships. Interferences of X-ray lines of Au with those of traces of Cu and Zn are solved using a method of selective excitation of X-rays of these elements. Analytical results have been interpreted in order to understand the workmanship of goldsmiths from the Antiquity. Fakes and repairs (or ornaments added to original artefacts) may also be identified. The ancient recipes are improved to give new soldering procedures at low temperature.

  13. Photoswitchable NIR-Emitting Gold Nanoparticles.

    PubMed

    Bonacchi, Sara; Cantelli, Andrea; Battistelli, Giulia; Guidetti, Gloria; Calvaresi, Matteo; Manzi, Jeannette; Gabrielli, Luca; Ramadori, Federico; Gambarin, Alessandro; Mancin, Fabrizio; Montalti, Marco

    2016-09-05

    Photo-switching of the NIR emission of gold nanoparticles (GNP) upon photo-isomerization of azobenzene ligands, bound to the surface, is demonstrated. Photophysical results confirm the occurrence of an excitation energy transfer process from the ligands to the GNP that produces sensitized NIR emission. Because of this process, the excitation efficiency of the gold core, upon excitation of the ligands, is much higher for the trans form than for the cis one, and t→c photo-isomerization causes a relevant decrease of the GNP NIR emission. As a consequence, photo-isomerization can be monitored by ratiometric detection of the NIR emission upon dual excitation. The photo-isomerization process was followed in real-time through the simultaneous detection of absorbance and luminescence changes using a dedicated setup. Surprisingly, the photo-isomerization rate of the ligands, bound to the GNP surface, was the same as measured for the chromophores in solution. This outcome demonstrated that excitation energy transfer to gold assists photo-isomerization, rather than competing with it. These results pave the road to the development of new, NIR-emitting, stimuli-responsive nanomaterials for theranostics.

  14. Biosynthesis of gold nanoparticles: A green approach.

    PubMed

    Ahmed, Shakeel; Annu; Ikram, Saiqa; Yudha S, Salprima

    2016-08-01

    Nanotechnology is an immensely developing field due to its extensive range of applications in different areas of technology and science. Different types of methods are employed for synthesis of nanoparticles due to their wide applications. The conventional chemical methods have certain limitations with them either in the form of chemical contaminations during their syntheses procedures or in later applications and use of higher energy. During the last decade research have been focussed on developing simple, clean, non-toxic, cost effective and eco-friendly protocols for synthesis of nanoparticles. In order to get this objective, biosynthesis methods have been developed in order to fill this gap. The biosynthesis of nanoparticles is simple, single step, eco-friendly and a green approach. The biochemical processes in biological agents reduce the dissolved metal ions into nano metals. The various biological agents like plant tissues, fungi, bacteria, etc. are used for biosynthesis for metal nanoparticles. In this review article, we summarised recent literature on biosynthesis of gold nanoparticles which have revolutionised technique of synthesis for their applications in different fields. Due to biocompatibility of gold nanoparticles, it has find its applications in biomedical applications. The protocol and mechanism of biosynthesis of gold nanoparticles along with various applications have also been discussed.

  15. Titration of gold nanoparticles in phase extraction.

    PubMed

    Cheng, Han-Wen; Schadt, Mark J; Zhong, Chuan-Jian

    2015-12-07

    In the organic-aqueous phase transfer process of gold nanoparticles, there are two types of distinctive interfaces involving hydrophilic and hydrophobic ligands, the understanding of which is important for the design of functional nanomaterials for analytical/bioanalytical applications and the control over the nanoparticles' nanoactivity and nanotoxicity in different phases. This report describes new findings of an investigation of the quantitative aspect of ligand ion pairing at the capping monolayer structure that drives the phase extraction of gold nanoparticles. Alkanethiolate-capped gold nanoparticles of 8 nm diameter with high size monodispersity (RSD ∼ 5%) were first derivatized by a ligand place exchange reaction with 11-mercaptoundecanoic acid to form a mixed monolayer shell consisting of both hydrophobic (-CH3) and hydrophilic (-COOH) groups. It was followed by quantitative titration of the resulting nanoparticles with a cationic species (-NR4(+)) in a toluene phase, yielding ion pairing of -NR4(+) and -COO(-) on part of the capping monolayer. Analysis of the phase extraction allowed a quantitative determination of the percentage of ion pairing and structural changes in the capping monolayer on the nanoparticles. The results, along with morphological characterization, are discussed in terms of the interfacial structural changes and their implications on the rational design of surface-functionalized nanoparticles and fine tuning of the interfacial reactivity.

  16. Gold nanorods: contrast agents for photoacoustic imaging?

    NASA Astrophysics Data System (ADS)

    Ungureanu, C.; Gopal, R. Raja; van Leeuwen, T. G.; Manohar, S.

    2007-07-01

    Gold nanorods are seen as possible contrast agents for photoacoustic imaging since they have strong absorption peaks at near-infrared wavelengths. Also they are easy to conjugate with various proteins. If these particles can be conjugated with cancer affinity proteins then these particles can accumulate specifically at a tumor site. By detecting the presence of accumulation of gold nanorods inside the tissue the indirect detection of tumor can be realized. When these particles are irradiated with light pulses of appropriate temporal properties and energy the temperature around these particles can be high enough to induce apoptosis or necrosis in the surrounding cells. In order to use these particles at their full potential we must determine precisely their optical properties. We simulated the optical properties of gold nanorods synthesized by us using the DDSCAT code. The simulated spectra agree qualitatively with the spectra determined using spectrometry and also determined using photoacoustic spectroscopy. Further the values of molar extinction coefficient derived from the simulations were similar to the data measured experimentally by other groups. These results validated qualitatively the model used in the simulations. During simulations we found that the choice of the dielectric function used in simulations plays an important role in the results.

  17. Determination of the concentration and the average number of gold atoms in a gold nanoparticle by osmotic pressure.

    PubMed

    Lu, Yan; Wang, Lixia; Chen, Dejun; Wang, Gongke

    2012-06-26

    For an ideal solution, an analytical expression for the macromolecule concentration, electrolyte concentration, and solution osmotic pressure is obtained on the basis of the van't Hoff equation and the Donnan equilibrium. The expression was further applied to a colloid solution of about 3 nm glutathione-stabilized gold nanoparticles. The concentration of the colloid solution and the average net ion charge number for each gold nanoparticle were determined with the measured osmotic pressure data. Meanwhile, the gold contents of the solutions were analyzed by means of atomic absorption spectrophotometry, and the results were combined with the determined concentration of gold nanoparticle colloids to determine that the average number of gold atoms per 3 nm gold nanoparticle is 479, which is 1/1.7 times the number of atoms in bulk metallic gold of the same size. The same proportion also occurred in the 2 nm 4-mercaptobenzoic acid monolayer-protected gold nanoparticles prepared by Ackerson et al., who utilized the quantitative high-angle annular dark-field scanning transmission electron microscope to determine the average number of gold atoms per nanoparticle (Ackerson, C. J.; Jadzinsky, P. D.; Sexton J. Z.; Bushnell, D. A.; Kornberg, R. D. Synthesis and Bioconjugation of 2 and 3 nm-Diameter Gold Nanoparticles. Bioconjugate Chem. 2010, 21, 214-218).

  18. Manganese oxides supported on gold nanoparticles: new findings and current controversies for the role of gold.

    PubMed

    Najafpour, Mohammad Mahdi; Hosseini, Seyedeh Maedeh; Hołyńska, Małgorzata; Tomo, Tatsuya; Allakhverdiev, Suleyman I

    2015-12-01

    We synthesized manganese oxides supported on gold nanoparticles (diameter <100 nm) by the reaction of KMnO4 with gold nanoparticles under hydrothermal conditions. In this green method Mn oxide is deposited on the gold nanoparticles. The compounds were characterized by scanning electron microscopy, energy-dispersive spectrometry, high-resolution transmission electron microscopy, X-ray diffraction, UV-Vis spectroscopy, Fourier transform infrared spectroscopy, and atomic absorption spectroscopy. In the next step, the water-oxidizing activities of these compounds in the presence of cerium(IV) ammonium nitrate as a non-oxo transfer oxidant were studied. The results show that these compounds are good catalysts toward water oxidation with a turnover frequency of 1.0 ± 0.1 (mmol O2/(mol Mn·s)). A comparison with other previously reported Mn oxides and important factors influencing the water-oxidizing activities of Mn oxides is also discussed.

  19. Plasmonic phototherapy using gold nanospheres and gold nanorods irradiated with light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Poorani, Gananathan; Rao, Aruna Prakasa; Singaravelu, Ganesan; Manickam, Elanchezhiyan

    2016-04-01

    Gold nanoparticles (GNPs) provide different modes of therapeutic responses in cells depending on their size and shape. We have studied two modifications of GNPs exhibiting surface plasmon resonances (SPRs) with phototherapeutic effects in nonmalignant Vero and malignant HeLa cell lines. The cells were treated with 30-nm-size gold nanospheres (GNSs) (having SPR at a wavelength of 530 nm) and with gold nanorods (GNRs) (having SPR at 630 nm). The plasmonic phototherapy effect in cells was provided by irradiating them with green and red light-emitting diodes (LEDs). The cytotoxicities of GNPs were determined by MTT assay. Both the GNSs and GNRs were found to be biocompatible and have efficient phototherapeutic activity with LEDs.

  20. Electron-Impurity Interactions in the Relaxation of Hot Electrons in Gold-Gold Sulfide Nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah; Wolfgang, John; Nordlander, Peter; Halas, Naomi

    2000-10-01

    Hot electron dynamics can be modified in metallic nanostructures compared to bulk metals. In this experiment, ultrafast pump-probe spectroscopy permits observation of the effects of the local environment on hot electron relaxation in gold nanoshell particles. These nanoparticles consist of spherical (40 nm diameter) gold sulfide cores surrounded by ultrathin (5 nm) gold shells and possess a structure-dependent plasmon resonance.^1 Following excitation by a pump pulse at the plasmon resonance, the relaxation of the hot electrons in the nanoparticle's shell layer was observed. When molecules were adsorbed onto the nanoshell surface, increased electronic relaxation rates were observed for those molecular species with the greatest induced dipole moments near the nanoparticle surface. The effect of impurity adsorbates on the nanoparticle's electron dynamics is attributed to a perturbation in the electronic potential in the metal by the presence of the nearby impurities. ^1 R. D. Averitt, D. Sarkar, and N. J. Halas, Phys. Rev. Lett. 78, 4217 (1997).

  1. Lithologically controlled invisible gold, Yukon, Canada

    NASA Astrophysics Data System (ADS)

    MacKenzie, Doug; Craw, Dave; Finnigan, Craig

    2015-02-01

    The newly discovered Cretaceous Coffee orogenic gold deposit (>4 Moz resource) consists of an extensive oxidised zone developed on primary sulphidic rock. The primary mineralised rock is characterised by invisible gold in arsenian pyrite that has replaced biotite in selected host rocks. The deposit has a cryptic surface expression and is an example of an extremely subtle exploration target. Hydrothermal emplacement was controlled by extensional fractures, with breccias, but most mineralisation was focused on biotite-bearing granitic gneiss, metasedimentary gneisses, and younger biotite granite. Fine-grained (<0.1 mm) arsenian pyrite replaced biotite along mineral cleavage planes and followed biotite-rich metamorphic and post-metamorphic structural fabrics. Arsenian pyrite also formed overgrowths on earlier coarse-grained (up to 2 mm) barren hydrothermal pyrite. Arsenian pyrite is concentrically zoned on the 1-10-μm scale with respect to As, Sb, and Au contents and typically contains ˜5 wt% As, ˜500 mg/kg Sb, and ˜500 mg/kg Au, in solid solution. Biotite replacement was accompanied by sericitisation, silicification, and ankerite impregnation. Hydrothermal alteration involved dilution and localised depletion of K, Na, and Al in silicified host rocks, but most Ca, Mg, and Fe concentrations remained broadly constant. Magnesium-rich ultramafic host rocks were only weakly mineralised with auriferous arsenian pyrite and have fuchsite and magnesite alteration. Near-surface oxidation has liberated nanoparticulate and microparticulate supergene gold, which remains essentially invisible. Varying degrees of oxidation extend as deep as 250 m below the present subdued topographic surface, well beyond the present vadose zone, and this deep oxidation may have occurred during post-mineralisation uplift and erosion in the Cretaceous. Oxidation has leached some As from the surficial mineralised rocks, decreasing the geochemical signal, which is also obscured by the localised

  2. Ultrafast electron dynamics in gold nanoshells

    NASA Astrophysics Data System (ADS)

    Westcott, Sarah Linda

    2001-10-01

    In metallic nanostructures, the interaction of excited electrons with the nanostructure surface may result in electron relaxation dynamics that are significantly different than those predicted by electron-lattice coupling. These ultrafast electron dynamics were monitored by pump-probe measurements of the time-resolved change in transmission. Using femtosecond pulses from a cavity-dumped titanium-doped sapphire laser, two types of nanoparticles with a core-shell geometry were studied. Nanoshells are nanoparticles with a dielectric core surrounded by a continuous thin metal shell. For nanoshells, the plasmon resonance wavelength is tunable by changing the core and shell dimensions. For nanoshells with a gold sulfide core and a gold shell, two conditions were observed under which electron relaxation was different than predicted by electron-phonon coupling. First, electron relaxation occurred more rapidly for gold-gold sulfide nanoshells embedded in polymer films than for nanoshells dispersed in water, with lifetimes of 1.6 ps and 3 to 5 ps, respectively. Second, for nanoshells dispersed in water, the electron relaxation lifetime decreased with adsorption of p-aminobenzoic acid (to 1.7 ps) or aniline (to 1.9 ps) on the nanoshells. With adsorbed n-propylamine or p-mercaptobenzoic acid, electron relaxation transpired in 2.8 ps or 2.4 ps, respectively. Density functional theory calculations indicated that the molecules leading to the fastest electron relaxation possessed the largest induced dipole moments near a metal surface. Semicontinuous gold films grown around a silica nanoparticle core exhibited spectral and dynamical optical signatures of the percolation threshold. Compared to continuous shells, the electron dynamics in the semicontinuous shell layer were dramatically different as additional induced bleaching was observed in the first 500 fs. The observed dynamics are consistent with a rate equation model in which the electrons are initially excited in localized

  3. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  4. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Forfeiture of gold valued in excess... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  5. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  6. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  7. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  8. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Forfeiture of gold valued in excess of... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  9. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  10. 31 CFR 406.5 - Forfeiture of gold valued in excess of $2,500.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Forfeiture of gold valued in excess... (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.5 Forfeiture of gold valued in excess of $2,500. When...

  11. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  12. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  13. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  14. 31 CFR 406.3 - Forfeiture of gold valued not in excess of $2,500.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 2 2014-07-01 2014-07-01 false Forfeiture of gold valued not in... Finance (Continued) SECRET SERVICE, DEPARTMENT OF THE TREASURY SEIZURE AND FORFEITURE OF GOLD FOR VIOLATIONS OF GOLD RESERVE ACT OF 1934 AND GOLD REGULATIONS § 406.3 Forfeiture of gold valued not in...

  15. 40 CFR 440.140 - Applicability; description of the gold placer mine subcategory.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Applicability; description of the gold... CATEGORY Gold Placer Mine Subcategory § 440.140 Applicability; description of the gold placer mine... that produce gold or gold bearing ores from placer deposits; and (2) The beneficiation processes...

  16. Stabilization of 4H hexagonal phase in gold nanoribbons

    PubMed Central

    Fan, Zhanxi; Bosman, Michel; Huang, Xiao; Huang, Ding; Yu, Yi; Ong, Khuong P.; Akimov, Yuriy A.; Wu, Lin; Li, Bing; Wu, Jumiati; Huang, Ying; Liu, Qing; Eng Png, Ching; Lip Gan, Chee; Yang, Peidong; Zhang, Hua

    2015-01-01

    Gold, silver, platinum and palladium typically crystallize with the face-centred cubic structure. Here we report the high-yield solution synthesis of gold nanoribbons in the 4H hexagonal polytype, a previously unreported metastable phase of gold. These gold nanoribbons undergo a phase transition from the original 4H hexagonal to face-centred cubic structure on ligand exchange under ambient conditions. Using monochromated electron energy-loss spectroscopy, the strong infrared plasmon absorption of single 4H gold nanoribbons is observed. Furthermore, the 4H hexagonal phases of silver, palladium and platinum can be readily stabilized through direct epitaxial growth of these metals on the 4H gold nanoribbon surface. Our findings may open up new strategies for the crystal phase-controlled synthesis of advanced noble metal nanomaterials. PMID:26216712

  17. Annealing of gold nanostructures sputtered on glass substrate

    NASA Astrophysics Data System (ADS)

    Švorčík, V.; Siegel, J.; Šutta, P.; Mistrík, J.; Janíček, P.; Worsch, P.; Kolská, Z.

    2011-03-01

    The effects of annealing at 300 °C on gold nanostructures sputtered onto glass substrate were studied using XRD, SAXSees, the Van der Pauw method and ellipsometry. As-sputtered and annealed samples exhibit a different dependence of the gold lattice parameter on the sputtering time. With increasing sputtering time the average thickness of the layer and the size of gold crystallites increased. Another rapid enlargement of the crystallites is observed after annealing. The volume resistivity decreases rapidly with the increasing sputtering time for both, as-deposited and annealed structures. With increasing sputtering time initially discontinuous gold coverage changes gradually in a continuous one. Electrically continuous gold coverage on the as-sputtered and annealed samples exhibits the same concentration of free charge carriers and Hall mobility. Optical constants of as-deposited and annealed gold films determined by ellipsometry support resistivity measurements and clearly manifest the presence of plasmons in discontinuous films.

  18. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  19. Microbial synthesis of gold nanoparticles: current status and future prospects.

    PubMed

    Shedbalkar, Utkarsha; Singh, Richa; Wadhwani, Sweety; Gaidhani, Sharvari; Chopade, B A

    2014-07-01

    Gold nanoparticles have been employed in biomedicine since the last decade because of their unique optical, electrical and photothermal properties. Present review discusses the microbial synthesis, properties and biomedical applications of gold nanoparticles. Different microbial synthesis strategies used so far for obtaining better yield and stability have been described. It also includes different methods used for the characterization and analysis of gold nanoparticles, viz. UV-visible spectroscopy, Fourier transform infrared spectroscopy, X ray diffraction spectroscopy, scanning electron microscopy, ransmission electron microscopy, atomic force microscopy, electron dispersive X ray, X ray photoelectron spectroscopy and cyclic voltametry. The different mechanisms involved in microbial synthesis of gold nanoparticles have been discussed. The information related to applications of microbially synthesized gold nanoparticles and patents on microbial synthesis of gold nanoparticles has been summarized.

  20. Establishment of gold-quartz standard GQS-1

    USGS Publications Warehouse

    Millard, Hugh T.; Marinenko, John; McLane, John E.

    1969-01-01

    A homogeneous gold-quartz standard, GQS-1, was prepared from a heterogeneous gold-bearing quartz by chemical treatment. The concentration of gold in GQS-1 was determined by both instrumental neutron activation analysis and radioisotope dilution analysis to be 2.61?0.10 parts per million. Analysis of 10 samples of the standard by both instrumental neutron activation analysis and radioisotope dilution analysis failed to reveal heterogeneity within the standard. The precision of the analytical methods, expressed as standard error, was approximately 0.1 part per million. The analytical data were also used to estimate the average size of gold particles. The chemical treatment apparently reduced the average diameter of the gold particles by at least an order of magnitude and increased the concentration of gold grains by a factor of at least 4,000.

  1. Detection of squamous carcinoma cells using gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Dai, Wei-Yun; Lee, Sze-tsen; Hsu, Yih-Chih

    2015-03-01

    The goal of this study is to use gold nanoparticle as a diagnostic agent to detect human squamous carcinoma cells. Gold nanoparticles were synthesized and the gold nanoparticle size was 34.3 ± 6.2 nm. Based on the over-expression of epidermal growth factor receptor (EGFR) biomarkers in squamous carcinoma cells, we hypothesized that EGFR could be a feasible biomarker with a target moiety for detection. We further modified polyclonal antibodies of EGFR on the surface of gold nanoparticles. We found selected squamous carcinoma cells can be selectively detected using EGFR antibody-modified gold nanoparticles via receptor-mediated endocytosis. Cell death was also examined to determine the survival status of squamous carcinoma cells with respect to gold nanoparticle treatment and EGFR polyclonal antibody modification.

  2. SERS decoding of micro gold shells moving in microfluidic systems.

    PubMed

    Lee, Saram; Joo, Segyeong; Park, Sejin; Kim, Soyoun; Kim, Hee Chan; Chung, Taek Dong

    2010-05-01

    In this study, in situ surface-enhanced Raman scattering (SERS) decoding was demonstrated in microfluidic chips using novel thin micro gold shells modified with Raman tags. The micro gold shells were fabricated using electroless gold plating on PMMA beads with diameter of 15 microm. These shells were sophisticatedly optimized to produce the maximum SERS intensity, which minimized the exposure time for quick and safe decoding. The shell surfaces produced well-defined SERS spectra even at an extremely short exposure time, 1 ms, for a single micro gold shell combined with Raman tags such as 2-naphthalenethiol and benzenethiol. The consecutive SERS spectra from a variety of combinations of Raman tags were successfully acquired from the micro gold shells moving in 25 microm deep and 75 microm wide channels on a glass microfluidic chip. The proposed functionalized micro gold shells exhibited the potential of an on-chip microfluidic SERS decoding strategy for micro suspension array.

  3. Diffuse reflectivity of gold plating with high power laser irradiation

    NASA Astrophysics Data System (ADS)

    Wu, Yong; Zhang, Lei; Yang, Pengling; Wang, Zhenbao; Tao, Mengmeng; Liu, Fuhua; Feng, Guobin

    2015-05-01

    The discoloration and optical characteristics of the gold plating film under long-time high power laser irradiation are investigated. The fabrication process of gold plating on nickel underplate on rough surface of copper and aluminum alloy substrates is introduced. The measurement results of the diffuse reflectivity for the samples with different surface roughness indicate that roughness of the gold layer surface should be 4μm to obtain the maximum value of diffuse reflectivity. The discoloration and variation of diffuse reflectivity are experimentally studied under 2000W irradiation. The research results show that the discoloration and degrading of reflectivity are caused by the diffusion of Ni to the gold plating surface and forming NiO thin film due to the porosity of the gold film and high temperature treatment. A change of diffuse reflectivity related mechanism is described. Several plating solution recipes are used to eliminate the discoloration and mitigate the degrading of the reflectivity on gold surface.

  4. Gold over Branched Palladium Nanostructures for Photothermal Cancer Therapy.

    PubMed

    McGrath, Andrew J; Chien, Yi-Hsin; Cheong, Soshan; Herman, David A J; Watt, John; Henning, Anna M; Gloag, Lucy; Yeh, Chen-Sheng; Tilley, Richard D

    2015-12-22

    Bimetallic nanostructures show exciting potential as materials for effective photothermal hyperthermia therapy. We report the seed-mediated synthesis of palladium-gold (Pd-Au) nanostructures containing multiple gold nanocrystals on highly branched palladium seeds. The nanostructures were synthesized via the addition of a gold precursor to a palladium seed solution in the presence of oleylamine, which acts as both a reducing and a stabilizing agent. The interaction and the electronic coupling between gold nanocrystals and between palladium and gold broadened and red-shifted the localized surface plasmon resonance absorption maximum of the gold nanocrystals into the near-infrared region, to give enhanced suitability for photothermal hyperthermia therapy. Pd-Au heterostructures irradiated with an 808 nm laser light caused destruction of HeLa cancer cells in vitro, as well as complete destruction of tumor xenographs in mouse models in vivo for effective photothermal hyperthermia.

  5. Solution-based metal enhanced fluorescence with gold and gold/silver core-shell nanorods

    NASA Astrophysics Data System (ADS)

    Ren, Zebin; Li, Xiaoyi; Guo, Jingxia; Wang, Ruibo; Wu, Yanni; Zhang, Mingdi; Li, Caixia; Han, Qingyan; Dong, Jun; Zheng, Hairong

    2015-12-01

    Metal enhanced fluorescence of Oxazine720 fluorophore with gold and gold/silver core-shell nanorods is investigated experimentally in aqueous solution system. Metallic nanorods are synthesized for providing proper localized surface plasmon resonance and necessary enhancement to the fluorophore molecule. The experimental observation shows that the fluorescence enhancement increases firstly and then decreases when the concentration of metallic nanorods increases, which is resulted by the competition between enhanced emission and inner-filtering effect. Further investigation with different amounts of metallic nanorods shows that the relationship between metal enhanced fluorescence and spectral correlation strongly depends on the concentration of metallic nanorods.

  6. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    SciTech Connect

    Pattabi, Manjunatha M, Krishnaprabha

    2015-06-24

    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl{sub 4}). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  7. Synthesis of porous gold nanoshells by controlled transmetallation reaction

    NASA Astrophysics Data System (ADS)

    Pattabi, Manjunatha; M, Krishnaprabha

    2015-06-01

    Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl4). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.

  8. Novel Organo-Soluble Optically Tunable Chiral Hybrid Gold Nanorods

    DTIC Science & Technology

    2014-12-04

    AFRL-OSR-VA-TR-2014-0334 NOVEL ORGANO-SOLUBLE OPTICALLY TUNABLE CHIRAL HYBRID GOLD NANORODS Quan Li KENT STATE UNIV OH Final Report 12/04/2014...Prescribed by ANSI Std. Z39.18 1 FINAL REPORT Title: Novel Organo-Soluble Optically Tunable Chiral Hybrid Gold Nanorods AFOSR...Now this project has accomplished all the proposed objectives and beyond. Organo-soluble chiral azo thiol monolayer-protected gold nanorods, the

  9. Gold Ion-Angiotensin Peptide Interaction by Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Lee, Jenny; Jayathilaka, Lasanthi P.; Gupta, Shalini; Huang, Jin-Sheng; Lee, Bao-Shiang

    2012-05-01

    Stimulated by the interest in developing gold compounds for treating cancer, gold ion-angiotensin peptide interactions are investigated by mass spectrometry. Under the experimental conditions used, the majority of gold ion-angiotensin peptide complexes contain gold in the oxidation states I and III. Both ESI-MS and MALDI-TOF MS detect singly/multiply charged ions for mononuclear/multinuclear gold-attached peptides, which are represented as [peptide + a Au(I) + b Au(III) + (e - a -3b) H]e+, where a,b ≥ 0 and e is charge. ESI-MS data shows singly/multiply charged ions of Au(I)-peptide and Au(III)-peptide complexes. This study reveals that MALDI-TOF MS mainly detects singly charged Au(I)-peptide complexes, presumably due to the ionization process. The electrons in the MALDI plume seem to efficiently reduce Au(III) to Au(I). MALDI also tends to enhance the higher polymeric forms of gold-peptide complexes regardless of the laser power used. Collision-induced dissociation experiments of the mononuclear and dinuclear gold-attached peptide ions for angiotensin peptides show that the gold ion (a soft acid) binding sites are in the vicinity of Cys (a soft ligand), His (a major anchor of peptide for metal ion chelation), and the basic residue Arg. Data also suggests that the abundance of gold-attached peptides increases with higher gold concentration until saturation, after which an increase in gold ion concentration leads to the aggregation and/or precipitation of gold-bound peptides.

  10. Multiple gold-dimer detection from large scattering background

    NASA Astrophysics Data System (ADS)

    Hong, Xin; Jin, Zheng

    2016-10-01

    Gold nanoparticles exhibit unique plasmonic optical properties in visible to near infrared band. Especially the coupling effect existing at the gap between a closely linked particle pair can make the local field strongly enhanced. These properties make gold particles more attractive to be employed as molecular probes in biomedical related fundamental and clinical researches. However in the bio-system exist many large molecules or groups, whose optical signals can strongly depress the gold particles without detectable. In this paper, we proposed a method to extract the targets which are labelled by gold dimer pairs from large scattering background.

  11. Preparation and characterization of graphene oxide encapsulated gold nanoparticles.

    PubMed

    Yun, Yong Ju; Song, Ki-Bong

    2013-11-01

    We present a simple approach for the fabrication of graphene oxide-encapsulated gold nanoparticles using graphene oxide sheet-wrapping via electrostatic self-assembly. By mixing bovine serum albumin molecule-functionalized gold nanoparticles with graphene oxide dispersion, positively charged bovine serum albumin/gold nanoparticles easily assembled with negatively charged graphene oxide sheets through electrostatic interaction. Transmittance electron microscopy, scanning electron microscopy, atomic force microscopy, and Raman spectroscopy were used to confirm the encapsulation of graphene oxide on gold nanoparticles. Interestingly, graphene oxide sheets wrapping mainly occurs along the main body of single or a few gold nanoparticles. Additionally, by measuring the ultraviolet-visible spectroscopy spectrum, we found that the surface plasmon resonances band of the graphene oxide-encapsulated gold nanoparticles was found to become red-shifted compared to that of pristine gold nanoparticles, whereas similar to that of bovine serum albumin-coated gold nanoparticles. These results indicating that most of graphene oxide-encapsulated gold nanoparticles have good monodispersity and spherical shape. These resulting materials may potentially serve as a platform for plasmon resonance electron transfer spectroscopy or a probe for low level biosensing.

  12. Accelerated atmospheric corrosion testing of electroplated gold mirror coatings

    NASA Astrophysics Data System (ADS)

    Chu, C.-T.; Alaan, D. R.; Taylor, D. P.

    2010-08-01

    Gold-coated mirrors are widely used in infrared optics for industrial, space, and military applications. These mirrors are often made of aluminum or beryllium substrates with polished nickel plating. Gold is deposited on the nickel layer by either electroplating or vacuum deposition processes. Atmospheric corrosion of gold-coated electrical connectors and contacts was a well-known problem in the electronic industry and studied extensively. However, there is limited literature data that correlates atmospheric corrosion to the optical properties of gold mirror coatings. In this paper, the atmospheric corrosion of different electroplated gold mirror coatings were investigated with an accelerated mixed flowing gas (MFG) test for up to 50 days. The MFG test utilizes a combination of low-level air pollutants, humidity, and temperatures to achieve a simulated indoor environment. Depending on the gold coating thickness, pore corrosion started to appear on samples after about 10 days of the MFG exposure. The corrosion behavior of the gold mirror coatings demonstrated the porous nature of the electroplated gold coatings as well as the variation of porosity to the coating thickness. The changes of optical properties of the gold mirrors were correlated to the morphology of corrosion features on the mirror surface.

  13. The graphene-gold interface and its implications for nanoelectronics.

    PubMed

    Sundaram, Ravi S; Steiner, Mathias; Chiu, Hsin-Ying; Engel, Michael; Bol, Ageeth A; Krupke, Ralph; Burghard, Marko; Kern, Klaus; Avouris, Phaedon

    2011-09-14

    We combine optical microspectroscopy and electronic measurements to study how gold deposition affects the physical properties of graphene. We find that the electronic structure, the electron-phonon coupling, and the doping level in gold-plated graphene are largely preserved. The transfer lengths for electrons and holes at the graphene-gold contact have values as high as 1.6 μm. However, the interfacial coupling of graphene and gold causes local temperature drops of up to 500 K in operating electronic devices.

  14. Methanobactin-mediated one-step synthesis of gold nanoparticles.

    PubMed

    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu

    2013-11-01

    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months.

  15. Methanobactin-Mediated One-Step Synthesis of Gold Nanoparticles

    PubMed Central

    Xin, Jia-ying; Cheng, Dan-dan; Zhang, Lan-xuan; Lin, Kai; Fan, Hong-chen; Wang, Yan; Xia, Chun-gu

    2013-01-01

    Preparation of gold nanoparticles with a narrow size distribution has enormous importance in nanotechnology. Methanobactin (Mb) is a copper-binding small peptide that appears to function as an agent for copper sequestration and uptake in methanotrophs. Mb can also bind and catalytically reduce Au (III) to Au (0). In this study, we demonstrate a facile Mb-mediated one-step synthetic route to prepare monodispersed gold nanoparticles. Continuous reduction of Au (III) by Mb can be achieved by using hydroquinone as the reducing agent. The gold nanoparticles have been characterized by UV-visible spectroscopy. The formation and the surface plasmon resonance properties of the gold nanoparticles are highly dependent on the ratio of Au (III) to Mb in solution. X-ray photoelectron spectroscopy (XPS), fluorescence spectra and Fourier transform-infrared spectroscopy (FT-IR) spectra suggest that Mb molecules catalytically reduce Au (III) to Au (0) with the concomitant production of gold nanoparticles, and then, Mb statically adsorbed onto the surface of gold nanoparticles to form an Mb-gold nanoparticles assembly. This avoids secondary nucleation. The formed gold nanoparticles have been demonstrated to be monodispersed and uniform by transmission electron microscopy (TEM) images. Analysis of these particles shows an average size of 14.9 nm with a standard deviation of 1.1 nm. The gold nanoparticles are extremely stable and can resist aggregation, even after several months. PMID:24189217

  16. Reflectance spectroscopy of gold nanoshells: computational predictions and experimental measurements

    NASA Astrophysics Data System (ADS)

    Lin, Alex W. H.; Lewinski, Nastassja A.; Lee, Min-Ho; Drezek, Rebekah A.

    2006-10-01

    Gold nanoshells are concentric spherical constructs that possess highly desirable optical responses in the near infrared. Gold nanoshells consist of a thin outer gold shell and a silica core and can be used for both diagnostic and therapeutic purposes by tuning the optical response through changing the core-shell ratio as well as the overall size. Although optical properties of gold nanoshells have already been well documented, the reflectance characteristics are not well understood and have not yet been elucidated by experimental measurements. Yet, in order to use gold nanoshells as an optical contrast agent for scattering-based optical methods such as reflectance spectroscopy, it is critical to characterize the reflectance behavior. With this in mind, we used a fiber-optic-based spectrometer to measure diffuse reflectance of gold nanoshell suspensions from 500 nm to 900 nm. Experimental results show that gold nanoshells cause a significant increase in the measured reflectance. Spectral features associated with scattering from large angles ( 180°) were observed at low nanoshell concentrations. Monte Carlo modeling of gold nanoshells reflectance demonstrated the efficacy of using such methods to predict diffuse reflectance. Our studies suggest that gold nanoshells are an excellent candidate as optical contrast agents and that Monte Carlo methods are a useful tool for optimizing nanoshells best suited for scattering-based optical methods.

  17. Gold Carbene or Carbenoid: Is There a Difference?

    PubMed Central

    Wang, Yahui; Muratore, Michael E; Echavarren, Antonio M

    2015-01-01

    By reviewing the recent progress on the elucidation of the structure of gold carbenes and the definitions of metal carbenes and carbenoids, we recommend to use the term gold carbene to describe gold carbene-like intermediates, regardless of whether the carbene or carbocation extreme resonance dominates. Gold carbenes, because of the weak metal-to-carbene π-back-donation and their strongly electrophilic reactivity, could be classified into the broader family of Fischer carbenes, although their behavior and properties are very specific. PMID:25786384

  18. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection

    NASA Astrophysics Data System (ADS)

    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo

    2014-07-01

    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  19. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection.

    PubMed

    Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo

    2014-01-01

    In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage.

  20. Ligand-Assisted Gold-Catalyzed Cross-Coupling with Aryldiazonium Salts: Redox Gold Catalysis without an External Oxidant.

    PubMed

    Cai, Rong; Lu, Mei; Aguilera, Ellen Y; Xi, Yumeng; Akhmedov, Novruz G; Petersen, Jeffrey L; Chen, Hao; Shi, Xiaodong

    2015-07-20

    Gold-catalyzed C(sp)-C(sp(2)) and C(sp(2))-C(sp(2)) cross-coupling reactions are accomplished with aryldiazonium salts as the coupling partner. With the assistance of bpy ligand, gold(I) species were oxidized to gold(III) by diazonium without any external oxidants. Monitoring the reaction with NMR and ESI-MS provided strong evidence for the nitrogen extrusion followed by Au(III) reductive elimination as the key step.

  1. Nanomanufacturing of gold nanoparticle superstructures from the "bottom-up"

    NASA Astrophysics Data System (ADS)

    Rao, Tingling

    Gold nanoparticles that can generate surface plasmons under appropriate conditions have attracted significant interest for their potential in optics, photonics, data storage and biological sensors. Developing high fidelity fabrication methods that yield gold nanoparticles with well-defined size, shape, composition and self-assembly allows manipulation of surface plasmonic properties for novel applications as well as revealing new aspects of the underlying science. This dissertation demonstrates multiple techniques that describe cost-effective bottom-up" fabrication methods that yield gold nano-superstructures. In my initial work, I outline the solution conditions for fabricating Janus nanoparticles composed of one gold nanoparticle per micelle. Poly(ethylene oxide)-b-polystyrene (PEO-b-PS) was synthesized and processed into spherical micelles, which served as the template to induce gold nanoparticles growth within the PEO corona in situ. Organic-inorganic hybrid nanoparticle formation was controlled kinetically by manipulating the concentration of both the micelle and reducing agent (HEPES). We also found that under certain condition, PEO-b-PS yielded micelles with pearl-like morphology, which possessed concentrated PEO domains at the interface between two adjacent PS cores. Careful manipulation of reaction conditions afforded gold nanoparticles that grew from the core-shell interface to form 1-dimensional (1-D) periodical gold nanoparticle chains. Based on similar principles, gold-gold dimers were synthesized by growing a second gold nanoparticle from a gold nanoparticle template surface-functionalized with PEO ligands. Gold dimers fabricated with this method exhibited strong enhancement properties via surface-enhanced Raman scattering (SERS). Instead of kinetic control, the number of newly grown gold nanoparticles on each particle template heavily relied on the PEO density on the nanoparticle template. As the size of the particle template increased from 10 nm to

  2. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.

    2014-04-01

    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  3. Effect of gold ion concentration on size and properties of gold nanoparticles in TritonX-100 based inverse microemulsions

    NASA Astrophysics Data System (ADS)

    Ahmad, Tokeer; Wani, Irshad A.; Ahmed, Jahangeer; Al-Hartomy, Omar A.

    2013-04-01

    Gold nanoparticles have been prepared successfully using TritonX-100 inverse microemulsion at different concentrations of HAuCl4 (0.1, 0.05, 0.04, 0.03, 0.02 and 0.01 M). We have studied the effect of gold ion concentration on the particle size, morphology, surface area and optical properties of the gold nanoparticles. The gold nanoparticles were characterized by X-ray diffraction, transmission electron microscopy, UV-Visible spectroscopy and Brunauer-Emmett-Teller surface area analysis. X-ray diffraction studies show the monophasic nature of the gold nanoparticles. TritonX-100 stabilized gold nanoparticles were appeared to be agglomerated at higher concentrations (0.1 and 0.05 M) of Au3+ with an average grain size of 60 and 50 nm, respectively. Monodisperse and uniform gold nanoparticles with well-defined morphologies of an average grain size of 15 and 25 nm were obtained at lower concentrations (0.01 and 0.02 M). UV-Visible spectroscopy shows the characteristic surface plasmon resonance peak ~540 nm along with the peaks at shorter and longer wavelengths may be due to the higher order plasmon resonance of the gold nanoparticles. The surface areas of the gold nanoparticles were found to be in the range of 5.8-107 m2/g which were well in agreement with the electron microscopic studies.

  4. Turning Plastic into Gold: An Analogy to Demonstrate The Rutherford Gold Foil Experiment

    ERIC Educational Resources Information Center

    Gregory, Robert B.

    2007-01-01

    The Rutherford-Geiger-Marsden gold foil experiment is demonstrated to give students a useful mental image of the concept or principle of chemistry. The experiment shows students that in a short time one unexpected result can change the way science looks at the world.

  5. Where Are the Facts? "Jason's Gold" Gives Meaning to the Yukon Gold Rush

    ERIC Educational Resources Information Center

    Wasta, Stephanie; Lott, Carolyn

    2006-01-01

    This article discusses how fictional works can give a purposeful context and an appropriate venue for developing essential social studies concepts in middle-school students. The author uses the example of a National Council for the Social Studies (NCSS) notable book, "Jason's Gold" that blends history with story to become historical…

  6. Modulation of Fano resonances in symmetry-broken gold-SiO2-gold nanotube dimers

    NASA Astrophysics Data System (ADS)

    Wu, DaJian; Yu, HaiQun; Jiang, ShuMin; Wu, XueWei; Liu, XiaoJun

    2014-06-01

    Fano resonances in the symmetry-broken gold-SiO2-gold (BGSG) nanotubes and the associated dimers have been investigated based on the finite element method. In the BGSG nanotube, the symmetry breaking induced the interactions of the inner gold core and outer gold nanoshell plasmons of all multipolar orders and hence the red-shifts of the plasmon resonance modes and the enhanced quadrupole mode peaks were observed. The interference of the quadrupole mode peak with the subradiant dipole mode caused a Fano-dip in the scattering spectrum. By increasing the core offset-value in the BGSG nanotube, the Fano dip with low energy showed a red-shift and became deeper. Unexpectedly the plasmon coupling between a GSG nanotube and a BGSG nanotube can lead to two strong Fano dips in the scattering spectra of the dimer. It was further noted that the thin side of the BGSG nanotube located at two sides of the dimer gap can lead to the strong near-field coupling between two BGSG nanotubes and hence a deeper and broader Fano dip.

  7. Electronic transport in arrays of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Parthasarathy, Raghuveer

    We examine electronic transport through two-dimensional arrays of gold nanocrystals. Recently developed techniques of particle synthesis and array self-assembly provide ordered (and disordered) monolayers of six-nanometer diameter gold nanocrystals on substrates with in-plane electrodes. These well-characterized superlattices allow investigation of basic questions about electronic conduction in metal quantum dot assemblies, answers to which have previously remained elusive. We first address the relation between current and voltage. Central to transport is the Coulomb blockade, the energetic cost of adding a single electron to a nanocrystal. Theoretical studies suggest power-law scaling of current beyond a threshold voltage in Coulomb blockade dominated systems. In ordered arrays, our data follow a power-law form, but with a scaling exponent significantly higher than the theoretical prediction. In disordered arrays, power-law scaling is violated; we explain that disorder disturbs the branching of current-carrying paths responsible for power-law conduction. Second, we examine the effect of temperature on transport. We find a large low-temperature regime (up to about 100 K) in which thermal energy acts only to linearly suppress the threshold voltage, leaving the current scale unaffected. We provide a simple, analytic model of thermally assisted tunneling which quantitatively describes the data. Third, we develop a simple and novel technique to tune the interparticle electronic couplings of the arrays---deposition of small amounts of germanium on the monolayers. The germanium dopant lowers the voltage threshold, and also increases conductivity. It also increases the temperature dependence of transport, suggesting the introduction of trapped states between the gold nanocrystal cores.

  8. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  9. Gold in the oceans through time

    NASA Astrophysics Data System (ADS)

    Large, Ross R.; Gregory, Daniel D.; Steadman, Jeffrey A.; Tomkins, Andrew G.; Lounejeva, Elena; Danyushevsky, Leonid V.; Halpin, Jacqueline A.; Maslennikov, Valeriy; Sack, Patrick J.; Mukherjee, Indrani; Berry, Ron; Hickman, Arthur

    2015-10-01

    During sedimentation and diagenesis of carbonaceous shales in marine continental margin settings, Au is adsorbed from seawater and organic matter and becomes incorporated into sedimentary pyrite. LA-ICPMS analysis of over 4000 sedimentary pyrite grains in 308 samples from 33 locations around the world, grouped over 123 determined ages, has enabled us to track, in a first order sense, the Au content of the ocean over the last 3.5 billion years. Gold was enriched in the Meso- and Neoarchean oceans, several times above present values, then dropped by an order of magnitude from the first Great Oxidation Event (GOE1) through the Paleoproterozoic to reach a minimum value around 1600 Ma. Gold content of the oceans then rose, with perturbations, through the Meso- and Neoproterozoic, showing a steady rise at the end of the Proterozoic (800 to 520 Ma), which most likely represents the effects of the second Great Oxidation Event (GOE2). Gold in the oceans was at a maximum at 520 Ma, when oxygen in the oceans rose to match current maximum values. In the Archean and Proterozoic, the Au content of seawater correlates with the time distribution of high-Mg greenstone belts, black shales and banded iron formations, suggesting that increases in atmospheric oxygen and marine bio-productivity, combined with the higher background of Au in komatiitic and Mg-rich basalts were the first order causes of the pattern of Au enrichment in seawater. We suggest the lack of major Au deposits from 1800 to 800 Ma, is explained by the low levels of Au in the oceans during this period.

  10. Fugitive Mercury Emissions From Nevada Gold Mines

    NASA Astrophysics Data System (ADS)

    Miller, M. B.; Eckley, C. S.; Gustin, M.; Marsik, F.

    2008-12-01

    Mercury (Hg) can be released from point sources at gold mines (e.g. stacks associated with ore processing facilities) as well as from diffuse fugitive sources (e.g. waste rock dumps, heap leaches, etc). Fugitive Hg emissions have not been quantified for active gold mines and as such a large knowledge gap exists concerning the magnitude of total emissions from this source type. This study measured fugitive Hg emissions from two active gold mines in Northern Nevada. To contextualize the magnitude of the mine emissions with respect to those associated with natural surfaces, data were collected from undisturbed areas near the mines that are of similar geologic character. The initial results from this project have shown that there is a large range in surface Hg concentrations and associated emissions to the atmosphere from different surface types within a mine as well as between the two mines. At both mines, the lowest surface Hg concentrations and emissions were associated with the alluvium/overburden waste rock dumps. Surface Hg concentrations and emissions at nearby undisturbed sites were of similar magnitude. Surface concentrations and emissions were substantially higher from active heap leaches. In addition to the difference in fluxes for specific materials, measured emissions must be put within the context of material spatial extent and temporal variability. Here we compare Hg emission contributions from mining and undisturbed materials as a function of space and time (diel and seasonal), and illustrate the need for collection of these types of data in order to reduce uncertainties in understanding air-surface Hg exchange.

  11. Solidification of gold nanoparticles in carbon nanotubes.

    PubMed

    Arcidiacono, S; Walther, J H; Poulikakos, D; Passerone, D; Koumoutsakos, P

    2005-03-18

    The structure and the solidification of gold nanoparticles in a carbon nanotube are investigated using molecular dynamics simulations. The simulations indicate that the predicted solidification temperature of the enclosed particle is lower than its bulk counterpart, but higher than that observed for clusters placed in vacuum. A comparison with a phenomenological model indicates that, in the considered range of tube radii (R(CNT)) of 0.5 < R(CNT) < 1.6 nm, the solidification temperature depends mainly on the length of the particle with a minor dependence on R(CNT).

  12. Gold(I) Fluorohalides: Theory and Experiment.

    PubMed

    Baya, Miguel; Pérez-Bitrián, Alberto; Martínez-Salvador, Sonia; Casas, José M; Menjón, Babil; Orduna, Jesús

    2017-01-31

    The anionic trifluoromethylgold(I) derivatives [CF3 AuX](-) , which have been prepared and isolated as their [PPh4 ](+) salts in good yield, undergo thermally induced difluorocarbene extrusion in the gas phase, giving rise to the mixed gold(I) fluorohalide complexes [F-Au-X](-) (X=Cl, Br, I). These triatomic species have been detected by tandem mass spectrometry (MS2) experiments and their properties have been analyzed by DFT methods. The CF2 extrusion mechanism from the Au-CF3 moiety serves as a model for the CF2 insertion into the Au-F bond, since both reactivity channels are connected by the microreversibility principle.

  13. Structural and plasmonic properties of gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Sivapalan, Sean T.

    The design of gold nanoparticles for surface-enhanced Raman scattering (SERS) and plasmonic enhanced fluorescence are more involved than simply maximizing the local field enhancement. The enhancement is a function of the excitation wavelength relative to the plasmon resonance as well as the distance of the reporter molecules from the nanoparticles' surface. For suspension based measurements, additional considerations must also be made regarding absorption and scattering effects as light propagates through the sample. These effects are in addition to the other more commonly observed effects such as nanocrystal shape. With such a wide number of variables in play, a series of studies breaking down each of these components and their contribution to the observed enhancement is warranted. In this thesis, a series of experiments were undertaken using a platform based on polyelectrolyte coating of gold nanoparticles by layer-by-layer deposition. The reporter molecules are bound onto the surface of polyelectrolyte coated nanoparticles before trap coating them with an additional oppositely charged polyelectrolyte layer. By etching away the gold nanoparticle using potassium cyanide, we are then able to quantify the number of reporter molecule per nanoparticle using mass spectrometry. With this quantitative approach, we can the directly compare the effects of the aforementioned enhancement mechanisms on the observed signal intensity. This method overcomes some of the disparities in literature between reported values of enhancement due to assumption in the number of reporter molecules contribution to the signal intensity. Using our group's expertise, we synthesized gold nanoparticle libraries of nanorods, cubes, trisoctahedra and spheres of different sizes. Each geometric configuration was characterized using a recently developed TEM technique---nano-beam coherent area diffraction. The as-synthesized were exposed to a coherent electron beam with probe size similar to that of

  14. Overgrowth of Rhodium on Gold Nanorods

    PubMed Central

    2012-01-01

    This study focuses on the deposition and growth mode of rhodium (Rh) on gold (Au) seed nanorods (NRs). Using a combination of scanning transmission electron microscopy imaging, energy-dispersive X-ray spectroscopy, and UV–visible absorption spectroscopy, we show that Rh deposition results in an uneven overlayer morphology on the Au NR seeds, with a tendency for Rh deposition to occur preferentially on the Au NR ends. The results suggest that complex and kinetically driven metal–metal interactions take place in this system. PMID:22582111

  15. Mortality of white South African gold miners.

    PubMed Central

    Reid, P J; Sluis-Cremer, G K

    1996-01-01

    OBJECTIVES--This two part study aimed to determine whether there was an excess mortality generally or for some diseases among middle aged white South African gold miners on the Witwatersrand and whether the underground dust exposure of these miners contributed to the development of lung cancer, chronic obstructive pulmonary disease (COPD), or ischaemic heart disease (IHD). METHODS--A cohort of 4925 white miners in South Africa, born between 1 January 1916 and 31 December 1930 who were alive and working in the vicinity of Johannesburg on 1 January 1970, then aged between 39 and 54, was followed up for 20 years by which time 2032 had died. Most were gold miners (about 87% had worked 85% or more of their shifts in gold mines). Standardised mortality ratios (SMRs) were calculated as percentages of the number of deaths observed in the cohort for a condition as stated on the death certificate divided by the number expected on the basis of concurrent mortality in the reference population (the total age specific white male population of South Africa). A case-control analysis was performed for three diseases (lung cancer, COPD, and IHD), the results of which are presented for those miners in the cohort who had spent at least 85% of their service on gold mines and had worked at least 15% of their shifts underground. RESULTS--The SMR for all causes of death was 129.6%, raised because of excess mortality due to the following causes: lung cancer (SMR = 139.8%), IHD (124.1%), COPD (189%) and cirrhosis of the liver (155.3%). Smoking was confirmed to be the main risk factor for lung cancer and COPD although cumulative dust exposure was found to increase the risk of COPD in conjunction with smoking. No significant risk of lung cancer resulted from exposure to dust. High blood pressure and smoking were found to increase the risk of IHD, but no association between IHD and the quetelet index (weight/height2) was found. CONCLUSIONS--The most significant and unexpected finding was the

  16. Monolayer coated gold nanoparticles for delivery applications

    PubMed Central

    Rana, Subinoy; Bajaj, Avinash; Mout, Rubul; Rotello, Vincent M.

    2011-01-01

    Gold nanoparticles (AuNPs) provide attractive vehicles for delivery of drugs, genetic materials, proteins, and small molecules. AuNPs feature low core toxicity coupled with the ability to parametrically control particle size and surface properties. In this review, we focus on engineering of the AuNP surface monolayer, highlighting recent advances in tuning monolayer structures for efficient delivery of drugs and biomolecules. This review covers two broad categories of particle functionalization, organic monolayers and biomolecule coatings, and discusses their applications in drug, DNA/RNA, protein and small molecule delivery. PMID:21925556

  17. Method for aqueous gold thiosulfate extraction using copper-cyanide pretreated carbon adsorption

    SciTech Connect

    Young, Courtney; Melashvili, Mariam; Gow, Nicholas V

    2013-08-06

    A gold thiosulfate leaching process uses carbon to remove gold from the leach liquor. The activated carbon is pretreated with copper cyanide. A copper (on the carbon) to gold (in solution) ratio of at least 1.5 optimizes gold recovery from solution. To recover the gold from the carbon, conventional elution technology works but is dependent on the copper to gold ratio on the carbon.

  18. Adsorption of cellulose derivatives on flat gold surfaces and on spherical gold particles.

    PubMed

    Amirkhani, Masoud; Volden, Sondre; Zhu, Kaizheng; Glomm, Wilhelm R; Nyström, Bo

    2008-12-01

    The adsorption of hydroxyethylcellulose (HEC), ethyl(hydroxyethyl)cellulose (EHEC), and their hydrophobically modified counterparts HM-HEC and HM-EHEC has been studied on planar gold and citrate-covered gold surfaces by means of quartz crystal microbalance with dissipation monitoring (QCM-D), and on citrate-covered gold particles with the aid of dynamic light scattering (DLS). The QCM-D results indicate that larger amounts of polymer are adsorbed from aqueous solutions of HM-HEC and HM-EHEC on both substrates than from solutions of their unmodified analogues. The adsorption affinity for all the polymers, except EHEC, is higher on the citrate-covered surfaces than on the bare gold substrate. This indicates that more adsorption sites are activated in the presence of the citrate layer. The experimental adsorption data for all the polymers can be described fairly well by the Langmuir adsorption isotherm. However, at very low polymer concentrations significant deviations from the model are observed. The value of the hydrodynamic thickness of the adsorbed polymer layer (delta h), determined from DLS, rises with increasing polymer concentration for all the cellulose derivatives; a Langmuir type of isotherm can be used to roughly describe the adsorption behavior. Because of good solvent conditions for HEC the chains extend far out in the bulk at higher concentrations and the value of delta h is much higher than that of HM-HEC. The adsorption of EHEC and HM-EHEC onto gold particles discloses that the values of delta h are considerably higher for the hydrophobically modified cellulose derivative, and this finding is compatible with the trend in layer thickness estimated from the QCM-D measurements.

  19. Shape and surface effects on the cytotoxicity of nanoparticles: Gold nanospheres versus gold nanostars.

    PubMed

    Favi, Pelagie Marlene; Gao, Ming; Johana Sepúlveda Arango, Liuda; Ospina, Sandra Patricia; Morales, Mariana; Pavon, Juan Jose; Webster, Thomas Jay

    2015-11-01

    Gold nanoparticles are materials with unique optical properties that have made them very attractive for numerous biomedical applications. With the increasing discovery of techniques to synthesize novel nanoparticles such as star-shaped gold nanoparticles for biomedical applications, the safety and performance of these new nanomaterials must be systematically assessed before use. In this study, gold nanostars (AuNSTs) with multibranched surface structures were synthesized, and their influence on the cytotoxicity of human skin fibroblasts and rat fat pad endothelial cells (RFPECs) were assessed and compared with that of gold nanospheres (AuNSPs) with unbranched surfaces. Results showed that the AuNSPs with diameters of approximately 61.46 nm showed greater toxicity with fibroblast cells and RFPECs compared with the synthesized AuNSTs with diameters of approximately 33.69 nm. The AuNSPs were lethal at concentrations of 40 μg/mL for both cell lines, whereas the AuNSTs were less toxic at higher concentrations (400 μg/mL). The calculated IC50 (50% inhibitory concentration) values of the AuNSPs exposed to fibroblast cells were greater at 1 and 4 days of culture (26.4 and 27.7 μg/mL, respectively) compared with the RFPECs (13.6 and 13.8 μg/mL, respectively), indicating that the AuNSPs have a greater toxicity to endothelial cells. It was proposed that possible factors that could be promoting the reduced toxicity effects of the AuNSTs to fibroblast cells and RFPECs, compared with the AuNSPs may be size, surface chemistry, and shape of the gold nanoparticles. The reduced cell toxicity observed with the AuNSTs suggests that AuNSTs may be a promising material for use in biomedical applications.

  20. Synthesis of Barbaralones and Bullvalenes Made Easy by Gold Catalysis.

    PubMed

    Ferrer, Sofia; Echavarren, Antonio M

    2016-09-05

    The gold(I)-catalyzed oxidative cyclization of 7-ethynyl-1,3,5-cycloheptatrienes gives 1-substituted barbaralones in a general manner, which simplifies the access to other fluxional molecules. As an example, we report the shortest syntheses of bullvalene, phenylbullvalene, and disubstituted bullvalenes, and a readily accessible route to complex cage-type structures by further gold(I)-catalyzed reactions.

  1. Intriguing mechanistic labyrinths in gold(i) catalysis

    PubMed Central

    Obradors, Carla

    2014-01-01

    Many mechanistically intriguing reactions have been developed in the last decade using gold(i) as catalyst. Here we review the main mechanistic proposals in gold-catalysed activation of alkynes and allenes, in which this metal plays a central role by stabilising a variety of complex cationic intermediates. PMID:24176910

  2. Why Gold and Copper Are Colored but Silver Is Not.

    ERIC Educational Resources Information Center

    Guerrero, Ariel H.; Fasoli, Hector J.; Costa, Jose Luis

    1999-01-01

    Explains why silver, which has the same external electronic configuration as copper and gold, does not appear yellow: white light reflects on most metals without color absorption or change to the naked eye; however, copper and gold appear yellow because they absorb "blue" and "red" photons during electron transitions between…

  3. Gold Mining in Papua New Guinea: A Curricular Omission?

    ERIC Educational Resources Information Center

    Palmer, W. P.

    1989-01-01

    What criteria should be used to include or exclude particular topics within a country's science curriculum? It will be argued here that gold/gold mining is a suitable and relevant topic for inclusion in PNG's science curricula and suggestions towards achieving that end will be offered. The teaching of the mining of copper ore and the metal's…

  4. News from El Dorado: Newspapers and the California Gold Rush.

    ERIC Educational Resources Information Center

    Kurutz, Gary F.

    When James Wilson Marshall discovered gold at Sutter's Mill (California) in 1848, he not only touched off the greatest gold rush the world had ever seen, but also ignited one of the great writing frenzies in American history. Guidebooks, diaries, and letters all told of a new El Dorado where unimaginable riches could be found simply by picking…

  5. An electrochemical investigation of gold, tin and titanium compounds

    SciTech Connect

    Sawtelle, S.M.

    1992-01-01

    The determination of the electron transfer properties of gold, tin, and titanium compounds using electrochemical and spectroelectrochemical techniques is the focus of this dissertation. The investigations of the gold compounds include the determination of the properties of Au[PR[sub 3

  6. [Gold amulets of Ra: a step towards immortality].

    PubMed

    Janot, F

    2000-06-01

    In Ancient Egypt, the priest-embalmer laid the gold on the whole of the king's body. For simple citizens, he more modestly applied fine leaves or amulets of golden wax for certain parts. Possessing the same magical powers as gold, they participated in the complete preservation.

  7. The source of Witwatersrand gold: evidence from uraninite chemistry

    USGS Publications Warehouse

    Frimmel, Hartwig E.; Emsbo, Poul; Koenig, Alan E.

    2009-01-01

    An in-situ LA-ICP-MS study of different generations of uraninite from the Mesoarchaean Witwatersrand gold palaeoplacer deposits revealed unusually high Au concentrations in rounded, detrital uraninite grains but no detectable Au in secondary, hydrothermally mobilised uraninite. A Au-enriched uraninite-bearing magmatic host is suggested as a significant source for detrital gold in the Witwatersrand sediments.

  8. Gold-silica quantum rattles for multimodal imaging and therapy.

    PubMed

    Hembury, Mathew; Chiappini, Ciro; Bertazzo, Sergio; Kalber, Tammy L; Drisko, Glenna L; Ogunlade, Olumide; Walker-Samuel, Simon; Krishna, Katla Sai; Jumeaux, Coline; Beard, Paul; Kumar, Challa S S R; Porter, Alexandra E; Lythgoe, Mark F; Boissière, Cédric; Sanchez, Clément; Stevens, Molly M

    2015-02-17

    Gold quantum dots exhibit distinctive optical and magnetic behaviors compared with larger gold nanoparticles. However, their unfavorable interaction with living systems and lack of stability in aqueous solvents has so far prevented their adoption in biology and medicine. Here, a simple synthetic pathway integrates gold quantum dots within a mesoporous silica shell, alongside larger gold nanoparticles within the shell's central cavity. This "quantum rattle" structure is stable in aqueous solutions, does not elicit cell toxicity, preserves the attractive near-infrared photonics and paramagnetism of gold quantum dots, and enhances the drug-carrier performance of the silica shell. In vivo, the quantum rattles reduced tumor burden in a single course of photothermal therapy while coupling three complementary imaging modalities: near-infrared fluorescence, photoacoustic, and magnetic resonance imaging. The incorporation of gold within the quantum rattles significantly enhanced the drug-carrier performance of the silica shell. This innovative material design based on the mutually beneficial interaction of gold and silica introduces the use of gold quantum dots for imaging and therapeutic applications.

  9. Functionalized Gold Nanoparticles: Synthesis, Properties and Applications--A Review.

    PubMed

    Alex, Saji; Tiwari, Ashutosh

    2015-03-01

    The past few decades have witnessed significant advances in the development of functionalized gold nanoparticles for applications in various fields such as chemistry, biology, pharmacy and physics. Although it has been more than 150 years since they were first synthesized, extensive research has recently been undertaken to improve or modify gold nanoparticles, thereby opening up opportunities to enhance and optimize their potential and breadth of their applicability. Recently developed methods have allowed a precise control of gold nanoparticle size and the modification of gold nanoparticles with suitable protecting and functionalizing agents, facilitate their applications in different areas such as chemical and biological sensing, imaging and biomedical applications. This review focuses on the recent developments in various methods for the size and shape controlled synthesis of gold nanoparticles, understanding of different properties of gold nanoparticles and their applications in various fields. Particular attention is given to the chemical and biological sensing applications of gold nanoparticles and on the advances in the controlled ordering of gold nanoparticles for creating nanostructures for diverse applications.

  10. Ion-selective electrodes for gold and silver determination.

    PubMed

    Petrukhin, O M; Avdeeva, E N; Shavnya, Y V; Yankauskas, V P; Kazlauskas, R M; Bychkov, A S; Zolotov, Y A

    1987-01-01

    Some new ion-selective electrodes for silver and gold are described. They are based on the ion-associate species formed by the cyanide, chloride or thiourea complexes of the metals, with hydrophobic anions or cations, as appropriate. The electrodes have been applied to the determination of gold and silver in various technological process solutions in industry.

  11. Colloidal Gold Nanocups with Orientation-Dependent Plasmonic Properties.

    PubMed

    Jiang, Ruibin; Qin, Feng; Liu, Yejing; Ling, Xing Yi; Guo, Jun; Tang, Minghua; Cheng, Si; Wang, Jianfang

    2016-08-01

    Colloidal gold nanocups are synthesized through single-vertex-initiated gold deposition on PbS nanooctahedrons and subsequent selective dissolution of the PbS component. They possess strong magnetic plasmon resonance and exhibit remarkable orientation-dependent plasmonic properties when deposited on flat substrates. They can also effectively couple s-polarized light into the interfacial region between the nanocup and substrate.

  12. Synthesis of gold nanostructures using fruit extract of Garcinia Indica

    NASA Astrophysics Data System (ADS)

    Krishnaprabha, M.; Pattabi, Manjunatha

    2016-05-01

    Gold nanoparticles having different shapes are synthesized using extract of fresh fruit rinds of Garcinia Indica. The onset of growth and formation of gold nanostructures is confirmed from UV-Vis spectroscopy. Morphological studies are done using FESEM. Size dependent catalytic activity is evaluated with the model reduction reaction of 4-nitrophenol to 4-aminophenol.

  13. Polymer and biopolymer mediated self-assembly of gold nanoparticles.

    PubMed

    Ofir, Yuval; Samanta, Bappaditya; Rotello, Vincent M

    2008-09-01

    Gold nanoparticle-polymer composites are versatile and diverse functional materials, with applications in optical, electronic and sensing devices. This tutorial review focuses on the use of polymers to control the assembly of gold nanoparticles. Examples of synthetic polymers and biopolymers are provided, as well as applications of the composite materials in sensing and memory devices.

  14. Undergraduate Laboratory Experiment Modules for Probing Gold Nanoparticle Interfacial Phenomena

    ERIC Educational Resources Information Center

    Karunanayake, Akila G.; Gunatilake, Sameera R.; Ameer, Fathima S.; Gadogbe, Manuel; Smith, Laura; Mlsna, Deb; Zhang, Dongmao

    2015-01-01

    Three gold-nanoparticle (AuNP) undergraduate experiment modules that are focused on nanoparticles interfacial phenomena have been developed. Modules 1 and 2 explore the synthesis and characterization of AuNPs of different sizes but with the same total gold mass. These experiments enable students to determine how particle size affects the AuNP…

  15. The Late Start and Amazing Upswing in Gold Chemistry

    ERIC Educational Resources Information Center

    Raubenheimer, Helgard G.; Schmidbaur, Hubert

    2014-01-01

    Probably owing to the prejudice that gold is a metal too noble to be used much in chemistry, the chemistry of this element has developed much later than that of its congeners and neighbors in the periodic table. In fact, before and after the time of alchemists, and up to the 20th century, all chemistry of gold was mainly performed in attempts to…

  16. 30. HISTORIC PHOTOGRAPH SHOWING WALL STREET GOLD MILL FROM WEST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. HISTORIC PHOTOGRAPH SHOWING WALL STREET GOLD MILL FROM WEST TO EAST, PRIOR TO BEING COVERED WITH SHEET METAL IN 1966. PHOTOCOPY FROM A COLOR PRINT, JOSHUA TREE NATIONAL MONUMENT COLLECTION, "FACT FILE, PHOTOGRAPH FILE." - Wall Street Gold Mill, Twentynine Palms, San Bernardino County, CA

  17. VIEW, LOOKING SOUTHWEST OF GOLD AMALGAMATION ROOM, SHOWING AMALGAMATION BARREL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW, LOOKING SOUTHWEST OF GOLD AMALGAMATION ROOM, SHOWING AMALGAMATION BARREL AT CENTER FOREGROUND, BULLION FURNACE IN LARGE HOOD BEHIND IT, AND GOLD RETORT IN BACKGROUND HOOD. NOTE OVERHEAD MONORAIL FOR MATERIALS HANDLING. - Shenandoah-Dives Mill, 135 County Road 2, Silverton, San Juan County, CO

  18. 1. VIEW, LOOKING FROM THE EAST, OF THE GOLD KNOLL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW, LOOKING FROM THE EAST, OF THE GOLD KNOLL SITE. MILL FOUNDATIONS ARE AT CENTER, WITH REMAINS OF THE TRESTLE ABOVE. WASTE DUMP FROM THE SHAFT IS AT LEFT - Gold Knoll Mill, Southern Edge of Salt Spring Valley, Copperopolis, Calaveras County, CA

  19. OVERVIEW OF GOLD HILL MILL, ROAD, AND WHITE PINE TALC ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    OVERVIEW OF GOLD HILL MILL, ROAD, AND WHITE PINE TALC MINE LOOKING EAST. THE OPENING TO THE TALC MINE IS IN THE DARK AREA AT CENTER LEFT EDGE. WARM SPRINGS CAMP IS OUT OF FRAME TO THE RIGHT. - Gold Hill Mill, Warm Spring Canyon Road, Death Valley Junction, Inyo County, CA

  20. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  1. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  2. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  3. Exhaust system having a gold-platinum group metal catalyst

    DOEpatents

    Ragle, Christie Susan [Havana, IL; Silver, Ronald G [Peoria, IL; Zemskova, Svetlana Mikhailovna [Edelstein, IL; Eckstein, Colleen J [Metamora, IL

    2011-12-06

    A method of providing an exhaust treatment device is disclosed. The method includes applying a catalyst including gold and a platinum group metal to a particulate filter. The concentration of the gold and the platinum group metal is sufficient to enable oxidation of carbon monoxide and nitric oxide.

  4. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  5. Exhaust system having a gold-platinum group metal catalyst

    DOEpatents

    Ragle, Christie Susan; Silver, Ronald G.; Zemskova, Svetlana Mikhailovna; Eckstein, Colleen J.

    2012-08-07

    A method of providing an exhaust treatment device is disclosed. The method includes applying a catalyst including gold and a platinum group metal to a particulate filter. The concentration of the gold and the platinum group metal is sufficient to enable oxidation of carbon monoxide and nitric oxide.

  6. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  7. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  8. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 1 2011-10-01 2011-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  9. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 13 2013-10-01 2013-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  10. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  11. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 13 2014-10-01 2014-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  12. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 1 2014-10-01 2014-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  13. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 1 2012-10-01 2012-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  14. 47 CFR 3.46 - Use of gold francs.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 1 2013-10-01 2013-10-01 false Use of gold francs. 3.46 Section 3.46... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Settlement Operations § 3.46 Use of gold francs. An accounting authority must accept accounts presented to it from foreign administrations in...

  15. 50 CFR 665.469 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.469 Section 665.469 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Archipelago Fisheries § 665.469 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  16. 50 CFR 665.669 - Gold coral harvest moratorium.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 13 2012-10-01 2012-10-01 false Gold coral harvest moratorium. 665.669 Section 665.669 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... Island Area Fisheries § 665.669 Gold coral harvest moratorium. Fishing for, taking, or retaining any...

  17. Advocacy: Making the Gold Standard School a Reality

    ERIC Educational Resources Information Center

    Roberts, Julia Link; Inman, Tracy Ford

    2011-01-01

    In their last column, the authors described a Gold Standard School--a place in which all children thrive including the gifted and talented. The Checklist for a Gold Standard School, which is included in this article, highlights the main characteristics of such a school including a focus on continuous progress, talent development, policies that…

  18. The halogen analogs of thiolated gold nanoclusters

    SciTech Connect

    Jiang, Deen; Walter, Michael

    2012-01-01

    Is it possible to replace all the thiolates in a thiolated gold nanocluster with halogens while still maintaining the geometry and the electronic structure? In this work, we show from density functional theory that such halogen analogs of thiolated gold nanoclusters are highly likely. Using Au{sub 25}X{sub 18}{sup -} as an example, where X = F, Cl, Br, or I replaces -SR, we find that Au{sub 25}Cl{sub 18}{sup -} demonstrates a high similarity to Au{sub 25}(SR){sub 18}{sup -} by showing Au-Cl distances, Cl-Au-Cl angles, band gap, and frontier orbitals similar to those in Au{sub 25}(SR){sub 18}{sup -}. DFT-based global minimization also indicates the energetic preference of staple formation for the Au{sub 25}Cl{sub 18}{sup -} cluster. The similarity between Au{sub m}(SR){sub n} and Au{sub m}X{sub n} could be exploited to make viable Au{sub m}X{sub n} clusters and to predict structures for Au{sub m}(SR){sub n}.

  19. Photoinduced spectral changes of photoluminescent gold nanoclusters.

    PubMed

    Matulionytė, Marija; Marcinonytė, Raminta; Rotomskis, Ričardas

    2015-05-01

    Ultrasmall photoluminescent gold nanoclusters (Au NCs), composed of several atoms with sizes up to a few nanometers, have recently stimulated extensive interest. Unique molecule-like behaviors, low toxicity, and facile synthesis make photoluminescent Au NCs a very promising alternative to organic fluorophores and semiconductor quantum dots (QDs) in broad ranges of biomedical applications. However, using gold nanoparticles (Au NPs) for bioimaging might cause their degradation under continuous excitation with UV light, which might result in toxicity. We report spectral changes of photoluminescent 2-(N-morpholino) ethanesulfonic acid (MES)-coated (Au-MES) NCs under irradiation with UV/blue light. Photoluminescent water soluble Au- MES NCs with a photoluminescence (PL) band maximum at 476 nm (λex = 420 nm) were synthesized. Under irradiation with 402 nm wavelength light the size of photoluminescent Au-MES NCs decreased (λem = 430 nm). Irradiating the sample solution with 330 nm wavelength light, nonluminescent Au NPs were disrupted, and photoluminescent Au NCs (λem = 476 nm) were formed. Irradiation with 330 nm wavelength light did not directly affect photoluminescent Au-MES NCs, however, increase in PL intensity indicated the formation of photoluminescent Au NCs from the disrupted nonluminescent Au NPs. This study gives a good insight into the photostability of MES-coated Au NPs under continuous excitation with UV/blue light.

  20. Photoinduced spectral changes of photoluminescent gold nanoclusters

    NASA Astrophysics Data System (ADS)

    Matulionytė, Marija; Marcinonytė, Raminta; Rotomskis, Ričardas

    2015-05-01

    Ultrasmall photoluminescent gold nanoclusters (Au NCs), composed of several atoms with sizes up to a few nanometers, have recently stimulated extensive interest. Unique molecule-like behaviors, low toxicity, and facile synthesis make photoluminescent Au NCs a very promising alternative to organic fluorophores and semiconductor quantum dots (QDs) in broad ranges of biomedical applications. However, using gold nanoparticles (Au NPs) for bioimaging might cause their degradation under continuous excitation with UV light, which might result in toxicity. We report spectral changes of photoluminescent 2-(N-morpholino) ethanesulfonic acid (MES)-coated (Au-MES) NCs under irradiation with UV/blue light. Photoluminescent water soluble Au-MES NCs with a photoluminescence (PL) band maximum at 476 nm (λex=420 nm) were synthesized. Under irradiation with 402 nm wavelength light the size of photoluminescent Au-MES NCs decreased (λem=430 nm). Irradiating the sample solution with 330 nm wavelength light, nonluminescent Au NPs were disrupted, and photoluminescent Au NCs (λem=476 nm) were formed. Irradiation with 330 nm wavelength light did not directly affect photoluminescent Au-MES NCs, however, increase in PL intensity indicated the formation of photoluminescent Au NCs from the disrupted nonluminescent Au NPs. This study gives a good insight into the photostability of MES-coated Au NPs under continuous excitation with UV/blue light.