Terminal Restriction Fragment Length Polymorphism Analysis Program, a Web-Based Research Tool for Microbial Community Analysis

PubMed Central

Marsh, Terence L.; Saxman, Paul; Cole, James; Tiedje, James

2000-01-01

Rapid analysis of microbial communities has proven to be a difficult task. This is due, in part, to both the tremendous diversity of the microbial world and the high complexity of many microbial communities. Several techniques for community analysis have emerged over the past decade, and most take advantage of the molecular phylogeny derived from 16S rRNA comparative sequence analysis. We describe a web-based research tool located at the Ribosomal Database Project web site (http://www.cme.msu.edu/RDP/html/analyses.html) that facilitates microbial community analysis using terminal restriction fragment length polymorphism of 16S ribosomal DNA. The analysis function (designated TAP T-RFLP) permits the user to perform in silico restriction digestions of the entire 16S sequence database and derive terminal restriction fragment sizes, measured in base pairs, from the 5′ terminus of the user-specified primer to the 3′ terminus of the restriction endonuclease target site. The output can be sorted and viewed either phylogenetically or by size. It is anticipated that the site will guide experimental design as well as provide insight into interpreting results of community analysis with terminal restriction fragment length polymorphisms. PMID:10919828

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

PubMed Central

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Molecular typing and phylogenetic analysis of some species belonging to phlebotomus (larroussius) and phlebotomus (adlerius) subgenera (Diptera: psychodidae) from two locations in iran.

PubMed

Parvizi, P; Naddaf, S R; Alaeenovin, E

2010-01-01

Haematophagous females of some phlebotomine sandflies are the only natural vectors of Leishmania species, the causative agents of leishmaniasis in many parts of the tropics and subtropics, including Iran. We report the presence of Phlebotomus (Larroussius) major and Phlebotomus (Adlerius) halepensis in Tonekabon (Mazanderan Province) and Phlebotomus (Larroussius) tobbi in Pakdasht (Tehran Province). It is the first report of these species, known as potential vectors of zoonotic visceral leishmaniasis in Iran, are identified in these areas. In 2006-2007 individual wild-caught sandflies were characterized by both morphological features and sequence analysis of their mitochondrial genes (Cytochrome b). The analyses were based on a fragment of 494 bp at the 3' end of the Cyt b gene (Cyt b 3' fragment) and a fragment of 382 bp CB3 at the 5' end of the Cyt b gene (Cyt b 5' fragment). We also analysed the Cyt b Long fragment, which is located on the last 717 bp of the Cyt b gene, followed by 20 bp of intergenic spacer and the transfer RNA ser(TCN) gene. Twenty-seven P. halepensis and four P. major from Dohezar, Tonekabon, Mazanderan province and 8 P. tobbi from Packdasht, Tehran Province were identified by morphological and molecular characters. Cyt b 5' and Cyt b 3' fragment sequences were obtained from 15 and 9 flies, respectively. Cyt b long fragment sequences were obtained from 8 out of 27 P. halepensis. Parsimony analyses (using heuristic searches) of the DNA sequences of Cyt b always showed monophyletic clades of subgenera and each species did form a monophyletic group.

Evidence for the proteolytic processing of dentin matrix protein 1. Identification and characterization of processed fragments and cleavage sites.

PubMed

Qin, Chunlin; Brunn, Jan C; Cook, Richard G; Orkiszewski, Ralph S; Malone, James P; Veis, Arthur; Butler, William T

2003-09-05

Full-length cDNA coding for dentin matrix protein 1 (DMP1) has been cloned and sequenced, but the corresponding complete protein has not been isolated. In searching for naturally occurring DMP1, we recently discovered that the extracellular matrix of bone contains fragments originating from DMP1. Shortened forms of DMP1, termed 37K and 57K fragments, were treated with alkaline phosphatase and then digested with trypsin. The resultant peptides were purified by a two-dimensional method: size exclusion followed by reversed-phase high performance liquid chromatography. Purified peptides were sequenced by Edman degradation and mass spectrometry, and the sequences compared with the DMP1 sequence predicted from cDNA. Extensive sequencing of tryptic peptides revealed that the 37K fragments originated from the NH2-terminal region, and the 57K fragments were from the COOH-terminal part of DMP1. Phosphate analysis indicated that the 37K fragments contained 12 phosphates, and the 57K fragments had 41. From 37K fragments, two peptides lacked a COOH-terminal lysine or arginine; instead they ended at Phe173 and Ser180 and were thus COOH termini of 37K fragments. Two peptides were from the NH2 termini of 57K fragments, starting at Asp218 and Asp222. These findings indicated that DMP1 is proteolytically cleaved at four bonds, Phe173-Asp174, Ser180-Asp181, Ser217-Asp218, and Gln221-Asp222, forming eight fragments. The uniformity of cleavages at the NH2-terminal peptide bonds of aspartyl residues suggests that a single proteinase is involved. Based on its reported specificity, we hypothesize that these scissions are catalyzed by PHEX protein. We envision that the proteolytic processing of DMP1 plays a crucial role during osteogenesis and dentinogenesis.

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

Application of Tandem Two-Dimensional Mass Spectrometry for Top-Down Deep Sequencing of Calmodulin.

PubMed

Floris, Federico; Chiron, Lionel; Lynch, Alice M; Barrow, Mark P; Delsuc, Marc-André; O'Connor, Peter B

2018-06-04

Two-dimensional mass spectrometry (2DMS) involves simultaneous acquisition of the fragmentation patterns of all the analytes in a mixture by correlating their precursor and fragment ions by modulating precursor ions systematically through a fragmentation zone. Tandem two-dimensional mass spectrometry (MS/2DMS) unites the ultra-high accuracy of Fourier transform ion cyclotron resonance (FT-ICR) MS/MS and the simultaneous data-independent fragmentation of 2DMS to achieve extensive inter-residue fragmentation of entire proteins. 2DMS was recently developed for top-down proteomics (TDP), and applied to the analysis of calmodulin (CaM), reporting a cleavage coverage of about ~23% using infrared multiphoton dissociation (IRMPD) as fragmentation technique. The goal of this work is to expand the utility of top-down protein analysis using MS/2DMS in order to extend the cleavage coverage in top-down proteomics further into the interior regions of the protein. In this case, using MS/2DMS, the cleavage coverage of CaM increased from ~23% to ~42%. Graphical Abstract Two-dimensional mass spectrometry, when applied to primary fragment ions from the source, allows deep-sequencing of the protein calmodulin.

Construction of Red Fox Chromosomal Fragments from the Short-Read Genome Assembly.

PubMed

Rando, Halie M; Farré, Marta; Robson, Michael P; Won, Naomi B; Johnson, Jennifer L; Buch, Ronak; Bastounes, Estelle R; Xiang, Xueyan; Feng, Shaohong; Liu, Shiping; Xiong, Zijun; Kim, Jaebum; Zhang, Guojie; Trut, Lyudmila N; Larkin, Denis M; Kukekova, Anna V

2018-06-20

The genome of a red fox ( Vulpes vulpes ) was recently sequenced and assembled using next-generation sequencing (NGS). The assembly is of high quality, with 94X coverage and a scaffold N50 of 11.8 Mbp, but is split into 676,878 scaffolds, some of which are likely to contain assembly errors. Fragmentation and misassembly hinder accurate gene prediction and downstream analysis such as the identification of loci under selection. Therefore, assembly of the genome into chromosome-scale fragments was an important step towards developing this genomic model. Scaffolds from the assembly were aligned to the dog reference genome and compared to the alignment of an outgroup genome (cat) against the dog to identify syntenic sequences among species. The program Reference-Assisted Chromosome Assembly (RACA) then integrated the comparative alignment with the mapping of the raw sequencing reads generated during assembly against the fox scaffolds. The 128 sequence fragments RACA assembled were compared to the fox meiotic linkage map to guide the construction of 40 chromosomal fragments. This computational approach to assembly was facilitated by prior research in comparative mammalian genomics, and the continued improvement of the red fox genome can in turn offer insight into canid and carnivore chromosome evolution. This assembly is also necessary for advancing genetic research in foxes and other canids.

Sequencing of Oligourea Foldamers by Tandem Mass Spectrometry

NASA Astrophysics Data System (ADS)

Bathany, Katell; Owens, Neil W.; Guichard, Gilles; Schmitter, Jean-Marie

2013-03-01

This study is focused on sequence analysis of peptidomimetic helical oligoureas by means of tandem mass spectrometry, to build a basis for de novo sequencing for future high-throughput combinatorial library screening of oligourea foldamers. After the evaluation of MS/MS spectra obtained for model compounds with either MALDI or ESI sources, we found that the MALDI-TOF-TOF instrument gave more satisfactory results. MS/MS spectra of oligoureas generated by decay of singly charged precursor ions show major ion series corresponding to fragmentation across both CO-NH and N'H-CO urea bonds. Oligourea backbones fragment to produce a pattern of a, x, b, and y type fragment ions. De novo decoding of spectral information is facilitated by the occurrence of low mass reporter ions, representative of constitutive monomers, in an analogous manner to the use of immonium ions for peptide sequencing.

Sequence analysis of the pyruvylated galactan sulfate-derived oligosaccharides by negative-ion electrospray tandem mass spectrometry.

PubMed

Li, Na; Mao, Wenjun; Liu, Xue; Wang, Shuyao; Xia, Zheng; Cao, Sujian; Li, Lin; Zhang, Qi; Liu, Shan

2016-10-04

Five sulfated oligosaccharide fragments, F1-F5, were prepared from a pyruvylated galactan sulfate from the green alga Codium divaricatum, by partial depolymerization using mild acid hydrolysis and purification with gel-permeation chromatography. Negative-ion electrospray tandem mass spectrometry with collision-induced dissociation (ES-CID-MS/MS) is attempted for sequence determination of the sulfated oligosaccharides. The sequence of F1 with homogeneous disaccharide composition was first characterized to be Galp-(4SO4)-(1 → 3)-Galp by detailed nuclear magnetic resonance spectroscopic analyses. The fragmentation pattern of F1 in the product ion spectra was established on the basis of negative-ion ES-CID MS/MS, which was then applied to sequence analysis of other sulfated oligosaccharides. The sequences of F2 and F3 were deduced to be Galp-(4SO4)-(1 → 3)-Galp-(1 → 3)-Galp-(1 → 3)-Galp and 3,4-O-(1-carboxyethylidene)-Galp-(6SO4)-(1 → 3)-Galp, respectively. The sequences of major fragments in F4 and F5 were also deduced. The investigation demonstrated that negative-ion ES-CID-MS/MS was an efficient method for the sequence analysis of the pyruvylated galactan sulfate-derived oligosaccharides which revealed the patterns of substitution and glycosidic linkages. The pyruvylated galactan sulfate-derived oligosaccharides were novel sulfated oligosaccharides different from other algal polysaccharide-derived oligosaccharides. Copyright © 2016 Elsevier Ltd. All rights reserved.

Bacterial discrimination by means of a universal array approach mediated by LDR (ligase detection reaction)

PubMed Central

Busti, Elena; Bordoni, Roberta; Castiglioni, Bianca; Monciardini, Paolo; Sosio, Margherita; Donadio, Stefano; Consolandi, Clarissa; Rossi Bernardi, Luigi; Battaglia, Cristina; De Bellis, Gianluca

2002-01-01

Background PCR amplification of bacterial 16S rRNA genes provides the most comprehensive and flexible means of sampling bacterial communities. Sequence analysis of these cloned fragments can provide a qualitative and quantitative insight of the microbial population under scrutiny although this approach is not suited to large-scale screenings. Other methods, such as denaturing gradient gel electrophoresis, heteroduplex or terminal restriction fragment analysis are rapid and therefore amenable to field-scale experiments. A very recent addition to these analytical tools is represented by microarray technology. Results Here we present our results using a Universal DNA Microarray approach as an analytical tool for bacterial discrimination. The proposed procedure is based on the properties of the DNA ligation reaction and requires the design of two probes specific for each target sequence. One oligo carries a fluorescent label and the other a unique sequence (cZipCode or complementary ZipCode) which identifies a ligation product. Ligated fragments, obtained in presence of a proper template (a PCR amplified fragment of the 16s rRNA gene) contain either the fluorescent label or the unique sequence and therefore are addressed to the location on the microarray where the ZipCode sequence has been spotted. Such an array is therefore "Universal" being unrelated to a specific molecular analysis. Here we present the design of probes specific for some groups of bacteria and their application to bacterial diagnostics. Conclusions The combined use of selective probes, ligation reaction and the Universal Array approach yielded an analytical procedure with a good power of discrimination among bacteria. PMID:12243651

MULTIPLE ENZYME RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS FOR HIGH RESOLUTION DISTINCTION OF PSEUDOMONAS (SENSU STRICTO) 16S RRNA GENES

EPA Science Inventory

Pseudomonas specific 16S rDNA PCR amplification and multiple enzyme restriction fragment length polymorphism (MERFLP) analysis using a single digestion mixture of Alu I, Hinf I, Rsa I, and Tru 9I distinguished 150 published sequences and reference strains of authentic Pseudomonas...

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Fragmented esophageal smooth muscle contraction segments on high resolution manometry: a marker of esophageal hypomotility.

PubMed

Porter, R F; Kumar, N; Drapekin, J E; Gyawali, C P

2012-08-01

Esophageal peristalsis consists of a chain of contracting striated and smooth muscle segments on high resolution manometry (HRM). We compared smooth muscle contraction segments in symptomatic subjects with reflux disease to healthy controls. High resolution manometry Clouse plots were analyzed in 110 subjects with reflux disease (50 ± 1.4 years, 51.5% women) and 15 controls (27 ± 2.1 years, 60.0% women). Using the 30 mmHg isobaric contour tool, sequences were designated fragmented if either smooth muscle contraction segment was absent or if the two smooth muscle segments were separated by a pressure trough, and failed if both smooth muscle contraction segments were absent. The discriminative value of contraction segment analysis was assessed. A total of 1115 swallows were analyzed (reflux group: 965, controls: 150). Reflux subjects had lower peak and averaged contraction amplitudes compared with controls (P < 0.0001 for all comparisons). Fragmented sequences followed 18.4% wet swallows in the reflux group, compared with 7.5% in controls (P < 0.0001), and were seen more frequently than failed sequences (7.9% and 2.5%, respectively). Using a threshold of 30% in individual subjects, a composite of failed and/or fragmented sequences was effective in segregating reflux subjects from control subjects (P = 0.04). Evaluation of smooth muscle contraction segments adds value to HRM analysis. Specifically, fragmented smooth muscle contraction segments may be a marker of esophageal hypomotility. © 2012 Blackwell Publishing Ltd.

Top-down analysis of protein samples by de novo sequencing techniques.

PubMed

Vyatkina, Kira; Wu, Si; Dekker, Lennard J M; VanDuijn, Martijn M; Liu, Xiaowen; Tolić, Nikola; Luider, Theo M; Paša-Tolić, Ljiljana; Pevzner, Pavel A

2016-09-15

Recent technological advances have made high-resolution mass spectrometers affordable to many laboratories, thus boosting rapid development of top-down mass spectrometry, and implying a need in efficient methods for analyzing this kind of data. We describe a method for analysis of protein samples from top-down tandem mass spectrometry data, which capitalizes on de novo sequencing of fragments of the proteins present in the sample. Our algorithm takes as input a set of de novo amino acid strings derived from the given mass spectra using the recently proposed Twister approach, and combines them into aggregated strings endowed with offsets. The former typically constitute accurate sequence fragments of sufficiently well-represented proteins from the sample being analyzed, while the latter indicate their location in the protein sequence, and also bear information on post-translational modifications and fragmentation patterns. Freely available on the web at http://bioinf.spbau.ru/en/twister vyatkina@spbau.ru or ppevzner@ucsd.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

ERIC Educational Resources Information Center

Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

2012-01-01

We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Complete amino acid sequence of the myoglobin from the Pacific sei whale, Balaenoptera borealis.

PubMed

Jones, B N; Rothgeb, T M; England, R D; Gurd, F R

1979-04-25

The complete amino acid sequence of the major component myoglobin from Pacific sei whale, Balaenoptera borealis, was determined by specific cleavage of the protein to obtain large peptides which are readily degraded by the automatic sequencer. The acetimidated apomyoglobin was selectively cleaved at its two methionyl residues with cyanogen bromide and at its three arginyl residues by trypsin. From the sequence analysis of four of these peptides and the apomyoglobin, over 75% of the covalent structure of the protein was obtained. The remainder of the primary structure was determined by the sequence analysis of peptides that resulted from further digestion of the amino-terminal and central cyanogen bromide fragments. The amino-terminal fragment was specifically cleaved at its two tryptophanyl residues with N-chlorosuccinimide and the central cyanogen bromide fragment was cleaved at its glutamyl residues with staphylococcal protease and at its single tyrosyl residue with N-bromosuccinimide. The primary structure of this myoglobin proved identical with that from the gray whale but differs from that of the finback whale at four positions, from that of the minke whale at three positions and from the myoglobin of the humpback whale at one position. The above sequence identities and differences reflect the close taxonomic relationship of these five species of Cetacea.

Variation in ribosomal and mitochondrial DNA sequences demonstrates the existence of intraspecific groups in Paramecium multimicronucleatum (Ciliophora, Oligohymenophorea).

PubMed

Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa

2012-05-01

This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

Metavir 2: new tools for viral metagenome comparison and assembled virome analysis

PubMed Central

2014-01-01

Background Metagenomics, based on culture-independent sequencing, is a well-fitted approach to provide insights into the composition, structure and dynamics of environmental viral communities. Following recent advances in sequencing technologies, new challenges arise for existing bioinformatic tools dedicated to viral metagenome (i.e. virome) analysis as (i) the number of viromes is rapidly growing and (ii) large genomic fragments can now be obtained by assembling the huge amount of sequence data generated for each metagenome. Results To face these challenges, a new version of Metavir was developed. First, all Metavir tools have been adapted to support comparative analysis of viromes in order to improve the analysis of multiple datasets. In addition to the sequence comparison previously provided, viromes can now be compared through their k-mer frequencies, their taxonomic compositions, recruitment plots and phylogenetic trees containing sequences from different datasets. Second, a new section has been specifically designed to handle assembled viromes made of thousands of large genomic fragments (i.e. contigs). This section includes an annotation pipeline for uploaded viral contigs (gene prediction, similarity search against reference viral genomes and protein domains) and an extensive comparison between contigs and reference genomes. Contigs and their annotations can be explored on the website through specifically developed dynamic genomic maps and interactive networks. Conclusions The new features of Metavir 2 allow users to explore and analyze viromes composed of raw reads or assembled fragments through a set of adapted tools and a user-friendly interface. PMID:24646187

'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

PubMed

Eichmann, Cordula; Parson, Walther

2008-09-01

The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Scar-less multi-part DNA assembly design automation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan J.

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

An accurate algorithm for the detection of DNA fragments from dilution pool sequencing experiments.

PubMed

Bansal, Vikas

2018-01-01

The short read lengths of current high-throughput sequencing technologies limit the ability to recover long-range haplotype information. Dilution pool methods for preparing DNA sequencing libraries from high molecular weight DNA fragments enable the recovery of long DNA fragments from short sequence reads. These approaches require computational methods for identifying the DNA fragments using aligned sequence reads and assembling the fragments into long haplotypes. Although a number of computational methods have been developed for haplotype assembly, the problem of identifying DNA fragments from dilution pool sequence data has not received much attention. We formulate the problem of detecting DNA fragments from dilution pool sequencing experiments as a genome segmentation problem and develop an algorithm that uses dynamic programming to optimize a likelihood function derived from a generative model for the sequence reads. This algorithm uses an iterative approach to automatically infer the mean background read depth and the number of fragments in each pool. Using simulated data, we demonstrate that our method, FragmentCut, has 25-30% greater sensitivity compared with an HMM based method for fragment detection and can also detect overlapping fragments. On a whole-genome human fosmid pool dataset, the haplotypes assembled using the fragments identified by FragmentCut had greater N50 length, 16.2% lower switch error rate and 35.8% lower mismatch error rate compared with two existing methods. We further demonstrate the greater accuracy of our method using two additional dilution pool datasets. FragmentCut is available from https://bansal-lab.github.io/software/FragmentCut. vibansal@ucsd.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Nucleic acid indexing

DOEpatents

Guilfoyle, Richard A.; Guo, Zhen

2001-01-01

A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

Nucleic acid indexing

DOEpatents

Guilfoyle, Richard A.; Guo, Zhen

1999-01-01

A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

[Association of phytoplasma with Bermuda grass white-leaf disease].

PubMed

Tan, Weijun; Chen, Yong; Zhang, Wu; Han, Chengchou; Tan, Zhiyuan; Zhang, Juming

2008-10-01

Bermuda grass white leaf is an important disease on Bermuda grass all over the world. The aim of this research is to identify the pathogen which leads to Bermuda grass white leaf occurring on the Chinese mainland. PCR amplification technique, sequence analysis and Southern hybridization were used. A 1.3 kb fragment was amplified by PCR phytoplasma universal primers and total DNA sample extracted from ill Bermuda grass as the amplified template. Sequence analysis of the amplified fragment indicated it clustered into Candidatus Phytoplasm Cynodontis. Southern hybridization analysis showed differential cingulums. The pathogen of Bermuda grass white leaf on the Chinese mainland contains phytoplasma, which provides a scientific basis for further identification, prevention and control of the disease.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

PubMed Central

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

Opposite Electron-Transfer Dissociation and Higher-Energy Collisional Dissociation Fragmentation Characteristics of Proteolytic K/R(X)n and (X)nK/R Peptides Provide Benefits for Peptide Sequencing in Proteomics and Phosphoproteomics.

PubMed

Tsiatsiani, Liana; Giansanti, Piero; Scheltema, Richard A; van den Toorn, Henk; Overall, Christopher M; Altelaar, A F Maarten; Heck, Albert J R

2017-02-03

A key step in shotgun proteomics is the digestion of proteins into peptides amenable for mass spectrometry. Tryptic peptides can be readily sequenced and identified by collision-induced dissociation (CID) or higher-energy collisional dissociation (HCD) because the fragmentation rules are well-understood. Here, we investigate LysargiNase, a perfect trypsin mirror protease, because it cleaves equally specific at arginine and lysine residues, albeit at the N-terminal end. LysargiNase peptides are therefore practically tryptic-like in length and sequence except that following ESI, the two protons are now both positioned at the N-terminus. Here, we compare side-by-side the chromatographic separation properties, gas-phase fragmentation characteristics, and (phospho)proteome sequence coverage of tryptic (i.e., (X) n K/R) and LysargiNase (i.e., K/R(X) n ) peptides using primarily electron-transfer dissociation (ETD) and, for comparison, HCD. We find that tryptic and LysargiNase peptides fragment nearly as mirror images. For LysargiNase predominantly N-terminal peptide ions (c-ions (ETD) and b-ions (HCD)) are formed, whereas for trypsin, C-terminal fragment ions dominate (z-ions (ETD) and y-ions (HCD)) in a homologous mixture of complementary ions. Especially during ETD, LysargiNase peptides fragment into low-complexity but information-rich sequence ladders. Trypsin and LysargiNase chart distinct parts of the proteome, and therefore, the combined use of these enzymes will benefit a more in-depth and reliable analysis of (phospho)proteomes.

IG and TR single chain fragment variable (scFv) sequence analysis: a new advanced functionality of IMGT/V-QUEST and IMGT/HighV-QUEST.

PubMed

Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule

2017-06-26

IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino changes). The functionality is generic and can analyse any IG or TR single chain nucleotide sequence containing two V domains, provided that the corresponding species IMGT reference directory is available. The "Analysis of single chain Fragment variable (scFv)" implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST provides the identification and full characterization of the two V domains of full-length scFv (~850 bp) nucleotide sequences from combinatorial libraries. The analysis can also be performed on concatenated paired chains of expressed antigen receptor IG or TR repertoires.

High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.

PubMed

Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie

2015-06-17

High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This sequence structure can be harnessed to improve bioinformatics algorithms, in particular for CNV and structural variant detection. Descriptive measures for cell-free DNA features developed here could also be used in biomarker analysis to monitor the changes that occur during different pathological conditions.

Preparation of Meloidogyne javanica near-isogenic lines virulent and avirulent against the tomato resistance gene Mi and preliminary analyses of the genetic variation between the two lines.

PubMed

Xu, Jian-Hua; Narabu, Takashi; Li, Hong-Mei; Fu, Peng

2002-01-01

Meloidogyne javanica, reproducing by mitotic parthenogenesis, is an economically important pathogen of a wide range of crops. A pair of near-isogenic lines virulent and avirulent toward the tomato resistance gene Mi were prepared for M. javanica by continuously selecting an avirulent population on the resistant tomato cultivar Momotaro over 19 generations. Random amplified polymorphic DNA (RAPD) analysis with 102 primers revealed that RAPD patterns were highly conserved between the virulent and avirulent lines, confirming that the two lines were genomically very similar. Nevertheless, with one of the primers a distinct polymorphic fragment, specific for the avirulent lines, was amplified. Southern hybridization results indicated that the polymorphic fragment and its homologs were deleted from the genome of the virulent line during the process of virulence acquisition. Sequence analysis and homology searches of public data bases, however, revealed no published sequences significantly similar to the sequence of the fragment, precluding a prediction of the potential function of the sequence. The successful preparation of the near-isogenic Mi-virulent and avirulent lines laid a firm foundation for the further identification and isolation of virulence-related genes in M. javanica.

Accurate, Rapid Taxonomic Classification of Fungal Large-Subunit rRNA Genes

PubMed Central

Liu, Kuan-Liang; Porras-Alfaro, Andrea; Eichorst, Stephanie A.

2012-01-01

Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project (http://rdp.cme.msu.edu/classifier/classifier.jsp). PMID:22194300

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

PubMed

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-10-21

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Distribution of a Nocardia brasiliensis catalase gene fragment in members of the genera Nocardia, Gordona, and Rhodococcus.

PubMed

Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C

1999-06-01

An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.

Analysis of In-Flight Collision Process During V-Type Firing Pattern in Surface Blasting Using Simple Physics

NASA Astrophysics Data System (ADS)

Chouhan, Lalit Singh; Raina, Avtar K.

2015-10-01

Blasting is a unit operation in Mine-Mill Fragmentation System (MMFS) and plays a vital role in mining cost. One of the goals of MMFS is to achieve optimum fragment size at minimal cost. Blast fragmentation optimization is known to result in better explosive energy utilization. Fragmentation depends on the rock, explosive and blast design variables. If burden, spacing and type of explosive used in a mine are kept constant, the firing sequence of blast-holes plays a vital role in rock fragmentation. To obtain smaller fragmentation size, mining professionals and relevant publications recommend V- or extended V-pattern of firing sequence. In doing so, it is assumed that the in-flight air collision breaks larger rock fragments into smaller ones, thus aiding further fragmentation. There is very little support to the phenomenon of breakage during in-flight collision of fragments during blasting in published literature. In order to assess the breakage of in-flight fragments due to collision, a mathematical simulation was carried over using basic principles of physics. The calculations revealed that the collision breakage is dependent on velocity of fragments, mass of fragments, the strength of the rock and the area of fragments over which collision takes place. For higher strength rocks, the in-flight collision breakage is very difficult to achieve. This leads to the conclusion that the concept demands an in-depth investigation and validation.

TACOA – Taxonomic classification of environmental genomic fragments using a kernelized nearest neighbor approach

PubMed Central

Diaz, Naryttza N; Krause, Lutz; Goesmann, Alexander; Niehaus, Karsten; Nattkemper, Tim W

2009-01-01

Background Metagenomics, or the sequencing and analysis of collective genomes (metagenomes) of microorganisms isolated from an environment, promises direct access to the "unculturable majority". This emerging field offers the potential to lay solid basis on our understanding of the entire living world. However, the taxonomic classification is an essential task in the analysis of metagenomics data sets that it is still far from being solved. We present a novel strategy to predict the taxonomic origin of environmental genomic fragments. The proposed classifier combines the idea of the k-nearest neighbor with strategies from kernel-based learning. Results Our novel strategy was extensively evaluated using the leave-one-out cross validation strategy on fragments of variable length (800 bp – 50 Kbp) from 373 completely sequenced genomes. TACOA is able to classify genomic fragments of length 800 bp and 1 Kbp with high accuracy until rank class. For longer fragments ≥ 3 Kbp accurate predictions are made at even deeper taxonomic ranks (order and genus). Remarkably, TACOA also produces reliable results when the taxonomic origin of a fragment is not represented in the reference set, thus classifying such fragments to its known broader taxonomic class or simply as "unknown". We compared the classification accuracy of TACOA with the latest intrinsic classifier PhyloPythia using 63 recently published complete genomes. For fragments of length 800 bp and 1 Kbp the overall accuracy of TACOA is higher than that obtained by PhyloPythia at all taxonomic ranks. For all fragment lengths, both methods achieved comparable high specificity results up to rank class and low false negative rates are also obtained. Conclusion An accurate multi-class taxonomic classifier was developed for environmental genomic fragments. TACOA can predict with high reliability the taxonomic origin of genomic fragments as short as 800 bp. The proposed method is transparent, fast, accurate and the reference set can be easily updated as newly sequenced genomes become available. Moreover, the method demonstrated to be competitive when compared to the most current classifier PhyloPythia and has the advantage that it can be locally installed and the reference set can be kept up-to-date. PMID:19210774

Accurate phylogenetic classification of DNA fragments based onsequence composition

DOE Office of Scientific and Technical Information (OSTI.GOV)

McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis

2006-05-01

Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequencemore » characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.« less

Identification of novel protein domains required for the expression of an active dehydratase fragment from a polyunsaturated fatty acid synthase.

PubMed

Oyola-Robles, Delise; Gay, Darren C; Trujillo, Uldaeliz; Sánchez-Parés, John M; Bermúdez, Mei-Ling; Rivera-Díaz, Mónica; Carballeira, Néstor M; Baerga-Ortiz, Abel

2013-07-01

Polyunsaturated fatty acids (PUFAs) are made in some strains of deep-sea bacteria by multidomain proteins that catalyze condensation, ketoreduction, dehydration, and enoyl-reduction. In this work, we have used the Udwary-Merski Algorithm sequence analysis tool to define the boundaries that enclose the dehydratase (DH) domains in a PUFA multienzyme. Sequence analysis revealed the presence of four areas of high structure in a region that was previously thought to contain only two DH domains as defined by FabA-homology. The expression of the protein fragment containing all four protein domains resulted in an active enzyme, while shorter protein fragments were not soluble. The tetradomain fragment was capable of catalyzing the conversion of crotonyl-CoA to β-hydroxybutyryl-CoA efficiently, as shown by UV absorbance change as well as by chromatographic retention of reaction products. Sequence alignments showed that the two novel domains contain as much sequence conservation as the FabA-homology domains, suggesting that they too may play a functional role in the overall reaction. Structure predictions revealed that all domains belong to the hotdog protein family: two of them contain the active site His70 residue present in FabA-like DHs, while the remaining two do not. Replacing the active site His residues in both FabA domains for Ala abolished the activity of the tetradomain fragment, indicating that the DH activity is contained within the FabA-homology regions. Taken together, these results provide a first glimpse into a rare arrangement of DH domains which constitute a defining feature of the PUFA synthases. Copyright © 2013 The Protein Society.

Identification of novel protein domains required for the expression of an active dehydratase fragment from a polyunsaturated fatty acid synthase

PubMed Central

Oyola-Robles, Delise; Gay, Darren C; Trujillo, Uldaeliz; Sánchez-Parés, John M; Bermúdez, Mei-Ling; Rivera-Díaz, Mónica; Carballeira, Néstor M; Baerga-Ortiz, Abel

2013-01-01

Polyunsaturated fatty acids (PUFAs) are made in some strains of deep-sea bacteria by multidomain proteins that catalyze condensation, ketoreduction, dehydration, and enoyl-reduction. In this work, we have used the Udwary-Merski Algorithm sequence analysis tool to define the boundaries that enclose the dehydratase (DH) domains in a PUFA multienzyme. Sequence analysis revealed the presence of four areas of high structure in a region that was previously thought to contain only two DH domains as defined by FabA-homology. The expression of the protein fragment containing all four protein domains resulted in an active enzyme, while shorter protein fragments were not soluble. The tetradomain fragment was capable of catalyzing the conversion of crotonyl-CoA to β-hydroxybutyryl-CoA efficiently, as shown by UV absorbance change as well as by chromatographic retention of reaction products. Sequence alignments showed that the two novel domains contain as much sequence conservation as the FabA-homology domains, suggesting that they too may play a functional role in the overall reaction. Structure predictions revealed that all domains belong to the hotdog protein family: two of them contain the active site His70 residue present in FabA-like DHs, while the remaining two do not. Replacing the active site His residues in both FabA domains for Ala abolished the activity of the tetradomain fragment, indicating that the DH activity is contained within the FabA-homology regions. Taken together, these results provide a first glimpse into a rare arrangement of DH domains which constitute a defining feature of the PUFA synthases. PMID:23696301

T-cell receptor genes in tassel-eared squirrels (Sciurus aberti). I. Genetic polymorphism and divergence in the Abert and Kaibab subspecies.

PubMed

Wettstein, P J; Chakraborty, R; States, J; Ferrari, G

1990-01-01

The role of environmental factors in the evolution and maintenance of diversity of antigen receptor gene families which participate in the immune response in mammals is inadequately understood. In order to elucidate the impact of these factors, we have undertaken the analysis of these gene families in the tassel-eared squirrel (Sciurus aberti) which has been separated into discrete subspecies by geographic barriers and whose food resources can be quantitated for estimating environmental quality. In this communication we describe the initial analysis of the complexity and polymorphism of sequences related to T-cell receptor (Tcr) alpha and beta chain genes in two subspecies, Sciurus aberti aberti (Abert) and Sciurus aberti kaibabensis (Kaibab) which have identical habitats and are separated by the Grand Canyon in Arizona, USA. Genomic blot analysis of 60 Abert and 62 Kaibab individuals collected over a 3-year period was performed with mouse Tcrb and Tcra cDNA probes. Sequences homologous to Tcrb-C, Tcrb-J1, and Tcrb-J2 genes were observed in all individuals from both subspecies; although Tcrb-J1 fragments were monomorphic. Tcrb-C and Tcrb-J2 fragments were polymorphic with both species- and subspecies-specific sequences. A single, monomorphic Tcra-C fragment was observed in addition to multiple Tcra-V fragments homologous to the mouse Tcra-V1 subfamily. Abert samples exhibited greater numbers of Tcra-V1 fragments as well as greater polymorphism than Kaibab samples. Heterozygosity estimates of Tcrb-C and Tcra-V1 sequences were determined for annually collected samples and compared with the yearly estimates of availability of hypogeous fungi, one of the major diet items of tassel-eared squirrels. In the Kaibab annual collections, Tcra-V1 heterozygosity declined with the decline in food resource, whereas heterozygosity of Tcrb-C sequences was inversely related to food resource. Similarly, a reduction in food resource for Abert squirrels in 1985 coincided with an increase in Tcrb-C heterozygosity in the same year. These results suggest that the diversity of gene families which participate in the immune response in mammals may be affected by environmental factors.

[Detection of UGT1A1*28 Polymorphism Using Fragment Analysis].

PubMed

Huang, Ying; Su, Jian; Huang, Xiaosui; Lu, Danxia; Xie, Zhi; Yang, Suqing; Guo, Weibang; Lv, Zhiyi; Wu, Hongsui; Zhang, Xuchao

2017-12-20

Uridine-diphosphoglucuronosyl transferase 1A1 (UGT1A1), UGT1A1*28 polymorphism can reduce UGT1A1 enzymatic activity, which may lead to severe toxicities in patients who receive irinotecan. This study tries to build a fragment analysis method to detect UGT1A1*28 polymorphism. A total of 286 blood specimens from the lung cancer patients who were hospitalized in Guangdong General Hospital between April 2014 to May 2015 were detected UGT1A1*28 polymorphism by fragment analysis method. Comparing with Sanger sequencing, precision and accuracy of the fragment analysis method were 100%. Of the 286 patients, 236 (82.5% harbored TA6/6 genotype, 48 (16.8%) TA 6/7 genotype and 2 (0.7%) TA7/7 genotype. Our data suggest hat the fragment analysis method is robust for detecting UGT1A1*28 polymorphism in clinical practice. It's simple, time-saving, and easy-to-carry.

An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

PubMed

Prakash, Celine; Haeseler, Arndt Von

2017-03-01

RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile

PubMed Central

Haeseler, Arndt Von

2017-01-01

Abstract RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment. PMID:27661099

Minim typing--a rapid and low cost MLST based typing tool for Klebsiella pneumoniae.

PubMed

Andersson, Patiyan; Tong, Steven Y C; Bell, Jan M; Turnidge, John D; Giffard, Philip M

2012-01-01

Here we report a single nucleotide polymorphism (SNP) based genotyping method for Klebsiella pneumoniae utilising high-resolution melting (HRM) analysis of fragments within the multilocus sequence typing (MLST) loci. The approach is termed mini-MLST or Minim typing and it has previously been applied to Streptococcus pyogenes, Staphylococcus aureus and Enterococcus faecium. Six SNPs were derived from concatenated MLST sequences on the basis of maximisation of the Simpsons Index of Diversity (D). DNA fragments incorporating these SNPs and predicted to be suitable for HRM analysis were designed. Using the assumption that HRM alleles are defined by G+C content, Minim typing using six fragments was predicted to provide a D = 0.979 against known STs. The method was tested against 202 K. pneumoniae using a blinded approach in which the MLST analyses were performed after the HRM analyses. The HRM-based alleles were indeed in accordance with G+C content, and the Minim typing identified known STs and flagged new STs. The tonB MLST locus was determined to be very diverse, and the two Minim fragments located herein contribute greatly to the resolving power. However these fragments are refractory to amplification in a minority of isolates. Therefore, we assessed the performance of two additional formats: one using only the four fragments located outside the tonB gene (D = 0.929), and the other using HRM data from these four fragments in conjunction with sequencing of the tonB MLST fragment (D = 0.995). The HRM assays were developed on the Rotorgene 6000, and the method was shown to also be robust on the LightCycler 480, allowing a 384-well high through-put format. The assay provides rapid, robust and low-cost typing with fully portable results that can directly be related to current MLST data. Minim typing in combination with molecular screening for antibiotic resistance markers can be a powerful surveillance tool kit.

Minim Typing – A Rapid and Low Cost MLST Based Typing Tool for Klebsiella pneumoniae

PubMed Central

Andersson, Patiyan; Tong, Steven Y. C.; Bell, Jan M.; Turnidge, John D.; Giffard, Philip M.

2012-01-01

Here we report a single nucleotide polymorphism (SNP) based genotyping method for Klebsiella pneumoniae utilising high-resolution melting (HRM) analysis of fragments within the multilocus sequence typing (MLST) loci. The approach is termed mini-MLST or Minim typing and it has previously been applied to Streptococcus pyogenes, Staphylococcus aureus and Enterococcus faecium. Six SNPs were derived from concatenated MLST sequences on the basis of maximisation of the Simpsons Index of Diversity (D). DNA fragments incorporating these SNPs and predicted to be suitable for HRM analysis were designed. Using the assumption that HRM alleles are defined by G+C content, Minim typing using six fragments was predicted to provide a D = 0.979 against known STs. The method was tested against 202 K. pneumoniae using a blinded approach in which the MLST analyses were performed after the HRM analyses. The HRM-based alleles were indeed in accordance with G+C content, and the Minim typing identified known STs and flagged new STs. The tonB MLST locus was determined to be very diverse, and the two Minim fragments located herein contribute greatly to the resolving power. However these fragments are refractory to amplification in a minority of isolates. Therefore, we assessed the performance of two additional formats: one using only the four fragments located outside the tonB gene (D = 0.929), and the other using HRM data from these four fragments in conjunction with sequencing of the tonB MLST fragment (D = 0.995). The HRM assays were developed on the Rotorgene 6000, and the method was shown to also be robust on the LightCycler 480, allowing a 384-well high through-put format. The assay provides rapid, robust and low-cost typing with fully portable results that can directly be related to current MLST data. Minim typing in combination with molecular screening for antibiotic resistance markers can be a powerful surveillance tool kit. PMID:22428067

Determining Phylogenetic Relationships Among Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) and Inter-Simple Sequence Repeat (ISSR) Markers.

PubMed

Haider, Nadia

2017-01-01

Investigation of genetic variation and phylogenetic relationships among date palm (Phoenix dactylifera L.) cultivars is useful for their conservation and genetic improvement. Various molecular markers such as restriction fragment length polymorphisms (RFLPs), simple sequence repeat (SSR), representational difference analysis (RDA), and amplified fragment length polymorphism (AFLP) have been developed to molecularly characterize date palm cultivars. PCR-based markers random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) are powerful tools to determine the relatedness of date palm cultivars that are difficult to distinguish morphologically. In this chapter, the principles, materials, and methods of RAPD and ISSR techniques are presented. Analysis of data generated from these two techniques and the use of these data to reveal phylogenetic relationships among date palm cultivars are also discussed.

PWHATSHAP: efficient haplotyping for future generation sequencing.

PubMed

Bracciali, Andrea; Aldinucci, Marco; Patterson, Murray; Marschall, Tobias; Pisanti, Nadia; Merelli, Ivan; Torquati, Massimo

2016-09-22

Haplotype phasing is an important problem in the analysis of genomics information. Given a set of DNA fragments of an individual, it consists of determining which one of the possible alleles (alternative forms of a gene) each fragment comes from. Haplotype information is relevant to gene regulation, epigenetics, genome-wide association studies, evolutionary and population studies, and the study of mutations. Haplotyping is currently addressed as an optimisation problem aiming at solutions that minimise, for instance, error correction costs, where costs are a measure of the confidence in the accuracy of the information acquired from DNA sequencing. Solutions have typically an exponential computational complexity. WHATSHAP is a recent optimal approach which moves computational complexity from DNA fragment length to fragment overlap, i.e., coverage, and is hence of particular interest when considering sequencing technology's current trends that are producing longer fragments. Given the potential relevance of efficient haplotyping in several analysis pipelines, we have designed and engineered PWHATSHAP, a parallel, high-performance version of WHATSHAP. PWHATSHAP is embedded in a toolkit developed in Python and supports genomics datasets in standard file formats. Building on WHATSHAP, PWHATSHAP exhibits the same complexity exploring a number of possible solutions which is exponential in the coverage of the dataset. The parallel implementation on multi-core architectures allows for a relevant reduction of the execution time for haplotyping, while the provided results enjoy the same high accuracy as that provided by WHATSHAP, which increases with coverage. Due to its structure and management of the large datasets, the parallelisation of WHATSHAP posed demanding technical challenges, which have been addressed exploiting a high-level parallel programming framework. The result, PWHATSHAP, is a freely available toolkit that improves the efficiency of the analysis of genomics information.

Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

PubMed

Hu, B; Li, J; Yu, W; Fang, J

1993-01-01

Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

Technical Report on Modeling for Quasispecies Abundance Inference with Confidence Intervals from Metagenomic Sequence Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

McLoughlin, K.

2016-01-11

The overall aim of this project is to develop a software package, called MetaQuant, that can determine the constituents of a complex microbial sample and estimate their relative abundances by analysis of metagenomic sequencing data. The goal for Task 1 is to create a generative model describing the stochastic process underlying the creation of sequence read pairs in the data set. The stages in this generative process include the selection of a source genome sequence for each read pair, with probability dependent on its abundance in the sample. The other stages describe the evolution of the source genome from itsmore » nearest common ancestor with a reference genome, breakage of the source DNA into short fragments, and the errors in sequencing the ends of the fragments to produce read pairs.« less

Scanning the human genome at kilobase resolution.

PubMed

Chen, Jun; Kim, Yeong C; Jung, Yong-Chul; Xuan, Zhenyu; Dworkin, Geoff; Zhang, Yanming; Zhang, Michael Q; Wang, San Ming

2008-05-01

Normal genome variation and pathogenic genome alteration frequently affect small regions in the genome. Identifying those genomic changes remains a technical challenge. We report here the development of the DGS (Ditag Genome Scanning) technique for high-resolution analysis of genome structure. The basic features of DGS include (1) use of high-frequent restriction enzymes to fractionate the genome into small fragments; (2) collection of two tags from two ends of a given DNA fragment to form a ditag to represent the fragment; (3) application of the 454 sequencing system to reach a comprehensive ditag sequence collection; (4) determination of the genome origin of ditags by mapping to reference ditags from known genome sequences; (5) use of ditag sequences directly as the sense and antisense PCR primers to amplify the original DNA fragment. To study the relationship between ditags and genome structure, we performed a computational study by using the human genome reference sequences as a model, and analyzed the ditags experimentally collected from the well-characterized normal human DNA GM15510 and the leukemic human DNA of Kasumi-1 cells. Our studies show that DGS provides a kilobase resolution for studying genome structure with high specificity and high genome coverage. DGS can be applied to validate genome assembly, to compare genome similarity and variation in normal populations, and to identify genomic abnormality including insertion, inversion, deletion, translocation, and amplification in pathological genomes such as cancer genomes.

Identifying sites of replication initiation in yeast chromosomes: looking for origins in all the right places.

PubMed

van Brabant, A J; Hunt, S Y; Fangman, W L; Brewer, B J

1998-06-01

DNA fragments that contain an active origin of replication generate bubble-shaped replication intermediates with diverging forks. We describe two methods that use two-dimensional (2-D) agarose gel electrophoresis along with DNA sequence information to identify replication origins in natural and artificial Saccharomyces cerevisiae chromosomes. The first method uses 2-D gels of overlapping DNA fragments to locate an active chromosomal replication origin within a region known to confer autonomous replication on a plasmid. A variant form of 2-D gels can be used to determine the direction of fork movement, and the second method uses this technique to find restriction fragments that are replicated by diverging forks, indicating that a bidirectional replication origin is located between the two fragments. Either of these two methods can be applied to the analysis of any genomic region for which there is DNA sequence information or an adequate restriction map.

On-Line Electrochemical Reduction of Disulfide Bonds: Improved FTICR-CID and -ETD Coverage of Oxytocin and Hepcidin

NASA Astrophysics Data System (ADS)

Nicolardi, Simone; Giera, Martin; Kooijman, Pieter; Kraj, Agnieszka; Chervet, Jean-Pierre; Deelder, André M.; van der Burgt, Yuri E. M.

2013-12-01

Particularly in the field of middle- and top-down peptide and protein analysis, disulfide bridges can severely hinder fragmentation and thus impede sequence analysis (coverage). Here we present an on-line/electrochemistry/ESI-FTICR-MS approach, which was applied to the analysis of the primary structure of oxytocin, containing one disulfide bridge, and of hepcidin, containing four disulfide bridges. The presented workflow provided up to 80 % (on-line) conversion of disulfide bonds in both peptides. With minimal sample preparation, such reduction resulted in a higher number of peptide backbone cleavages upon CID or ETD fragmentation, and thus yielded improved sequence coverage. The cycle times, including electrode recovery, were rapid and, therefore, might very well be coupled with liquid chromatography for protein or peptide separation, which has great potential for high-throughput analysis.

Isolation and bioinformatics analysis of differentially methylated genomic fragments in human gastric cancer

PubMed Central

Liao, Ai-Jun; Su, Qi; Wang, Xun; Zeng, Bin; Shi, Wei

2008-01-01

AIM: To isolate and analyze the DNA sequences which are methylated differentially between gastric cancer and normal gastric mucosa. METHODS: The differentially methylated DNA sequences between gastric cancer and normal gastric mucosa were isolated by methylation-sensitive representational difference analysis (MS-RDA). Similarities between the separated fragments and the human genomic DNA were analyzed with Basic Local Alignment Search Tool (BLAST). RESULTS: Three differentially methylated DNA sequences were obtained, two of which have been accepted by GenBank. The accession numbers are AY887106 and AY887107. AY887107 was highly similar to the 11th exon of LOC440683 (98%), 3’ end of LOC440887 (99%), and promoter and exon regions of DRD5 (94%). AY887106 was consistent (98%) with a CpG island in ribosomal RNA isolated from colorectal cancer by Minoru Toyota in 1999. CONCLUSION: The methylation degree is different between gastric cancer and normal gastric mucosa. The differentially methylated DNA sequences can be isolated effectively by MS-RDA. PMID:18322944

A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

PubMed Central

Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

2010-01-01

Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

Short-Read Sequencing for Genomic Analysis of the Brown Rot Fungus Fibroporia radiculosa

Treesearch

J. D. Tang; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; S. C. Burgess; S. V. Diehl

2012-01-01

The feasibility of short-read sequencing for genomic analysis was demonstrated for Fibroporia radiculosa, a copper-tolerant fungus that causes brown rot decay of wood. The effect of read quality on genomic assembly was assessed by filtering Illumina GAIIx reads from a single run of a paired-end library (75-nucleotide read length and 300-bp fragment...

Application of the MIDAS approach for analysis of lysine acetylation sites.

PubMed

Evans, Caroline A; Griffiths, John R; Unwin, Richard D; Whetton, Anthony D; Corfe, Bernard M

2013-01-01

Multiple Reaction Monitoring Initiated Detection and Sequencing (MIDAS™) is a mass spectrometry-based technique for the detection and characterization of specific post-translational modifications (Unwin et al. 4:1134-1144, 2005), for example acetylated lysine residues (Griffiths et al. 18:1423-1428, 2007). The MIDAS™ technique has application for discovery and analysis of acetylation sites. It is a hypothesis-driven approach that requires a priori knowledge of the primary sequence of the target protein and a proteolytic digest of this protein. MIDAS essentially performs a targeted search for the presence of modified, for example acetylated, peptides. The detection is based on the combination of the predicted molecular weight (measured as mass-charge ratio) of the acetylated proteolytic peptide and a diagnostic fragment (product ion of m/z 126.1), which is generated by specific fragmentation of acetylated peptides during collision induced dissociation performed in tandem mass spectrometry (MS) analysis. Sequence information is subsequently obtained which enables acetylation site assignment. The technique of MIDAS was later trademarked by ABSciex for targeted protein analysis where an MRM scan is combined with full MS/MS product ion scan to enable sequence confirmation.

The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

NASA Astrophysics Data System (ADS)

Nallaseth, Ferez Soli

The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1) sequence content of deletion products confirmed the previously unidentified loss of genetic control of mammalian chromosome biology and hybrid dysgenesis.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

PubMed

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

PubMed Central

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Analysis of complex repeat sequences within the spinal muscular atrophy (SMA) candidate region in 5q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, K.E.; Morrison, K.E.; Daniels, R.I.

1994-09-01

We previously reported that the 400 kb interval flanked the polymorphic loci D5S435 and D5S557 contains blocks of a chromosome 5 specific repeat. This interval also defines the SMA candidate region by genetic analysis of recombinant families. A YAC contig of 2-3 Mb encompassing this area has been constructed and a 5.5 kb conserved fragment, isolated from a YAC end clone within the above interval, was used to obtain cDNAs from both fetal and adult brain libraries. We describe the identification of cDNAs with stretches of high DNA sequence homology to exons of {beta} glucuronidase on human chromosome 7. Themore » cDNAs map both to the candidate region and to an area of 5p using FISH and deletion hybrid analysis. Hybridization to bacteriophage and cosmid clones from the YACs localizes the {beta} glucuronidase related sequences within the 400 kb region of the YAC contig. The cDNAs show a polymorphic pattern on hybridization to genomic BamH1 fragments in the size range of 10-250 kb. Further analysis using YAC fragmentation vectors is being used to determine how these {beta} glucuronidase related cDNAs are distributed within 5q13. Dinucleotide repeats within the region are being investigated to determine linkage disequilibrium with the disease locus.« less

Genetic Analysis of 430 Chinese Cynodon dactylon Accessions Using Sequence-Related Amplified Polymorphism Markers

PubMed Central

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-01-01

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260–1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53–0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars. PMID:25338051

The Neandertal type site revisited: Interdisciplinary investigations of skeletal remains from the Neander Valley, Germany

PubMed Central

Schmitz, Ralf W.; Serre, David; Bonani, Georges; Feine, Susanne; Hillgruber, Felix; Krainitzki, Heike; Pääbo, Svante; Smith, Fred H.

2002-01-01

The 1856 discovery of the Neandertal type specimen (Neandertal 1) in western Germany marked the beginning of human paleontology and initiated the longest-standing debate in the discipline: the role of Neandertals in human evolutionary history. We report excavations of cave sediments that were removed from the Feldhofer caves in 1856. These deposits have yielded over 60 human skeletal fragments, along with a large series of Paleolithic artifacts and faunal material. Our analysis of this material represents the first interdisciplinary analysis of Neandertal remains incorporating genetic, direct dating, and morphological dimensions simultaneously. Three of these skeletal fragments fit directly on Neandertal 1, whereas several others have distinctively Neandertal features. At least three individuals are represented in the skeletal sample. Radiocarbon dates for Neandertal 1, from which a mtDNA sequence was determined in 1997, and a second individual indicate an age of ≈40,000 yr for both. mtDNA analysis on the same second individual yields a sequence that clusters with other published Neandertal sequences. PMID:12232049

Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

PubMed

Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

2010-01-01

Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

Application and expression of HSV gG1 protein from a recombinant strain.

PubMed

Yan, Hua; Yan, Huishen; Huang, Tao; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

2010-11-01

According to the homologous sequence of glycoprotein G1 (gG1) genes from different strains of herpes simplex virus type 1 (HSV-1), a pair of primers was designed to amplify the gG1 gene fragment by PCR. Both the PCR product and the pGEX-4T-1 vector were digested with EcoR I and Sal I. The gG1 gene fragment was subcloned into the digested pGEX-4T-1 vector to construct a recombinant plasmid (pGEX-4T-1-gG1). The resultant plasmid was identified by dual-enzyme digestion and sequence analysis, and then transformed into Escherichia coli BL21 for expression under the induction of isopropyl β-D-1-thiogalactoside (IPTG). The expressed GST-gG1 fragment was detected by SDS-PAGE and purified by affinity chromatography. The properties of GST-gG1 fragment were evaluated by immunoblot analysis. Enzyme-linked immunosorbent assays (ELISAs) based on the GST-gG1 fragment were used for determining IgG or IgM to HSV-1. The GST-gG1 fragment-specific ELISA was also compared with ELISA with whole-HSV-1 antigen and commercial ELISA kits. The gG1-specific IgG and IFN-γ producing CD8+ T cells were induced in mice immunized with the GST-gG1 fragment. These results indicated that the GST-gG1 fragment could be used for replacing whole-virus antigen to detect IgM and IgG to HSV-1 in human sera, which provided a strategy for developing vaccines to protect HSV-1 infection using gG1 fragment. Copyright © 2010 Elsevier B.V. All rights reserved.

Sequence analysis of a few species of termites (Order: Isoptera) on the basis of partial characterization of COII gene.

PubMed

Sobti, Ranbir Chander; Kumari, Mamtesh; Sharma, Vijay Lakshmi; Sodhi, Monika; Mukesh, Manishi; Shouche, Yogesh

2009-11-01

The present study was aimed to get the nucleotide sequences of a part of COII mitochondrial gene amplified from individuals of five species of Termites (Isoptera: Termitidae: Macrotermitinae). Four of them belonged to the genus Odontotermes (O. obesus, O. horni, O. bhagwatii and Odontotermes sp.) and one to Microtermes (M. obesi). Partial COII gene fragments were amplified by using specific primers. The sequences so obtained were characterized to calculate the frequencies of each nucleotide bases and a high A + T content was observed. The interspecific pairwise sequence divergence in Odontotermes species ranged from 6.5% to 17.1% across COII fragment. M. obesi sequence diversity ranged from 2.5 with Odontotermes sp. to 19.0% with O. bhagwatii. Phylogenetic trees drawn on the basis of distance neighbour-joining method revealed three main clades clustering all the individuals according to their genera and families.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

PubMed Central

2012-01-01

Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

PubMed

Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

2012-08-10

Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

A ZFY-like sequence in fish, with comments on the evolution of the ZFY family of genes in vertebrates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zimmerer, E.J.; Threlkeld, L.

1995-08-01

ZFY-like genes have been observed in a variety of vertebrate species. Although originally implicated as the primary testis-determining gene in humans and other placental mammals, more recent evidence indicates a role(s) outside that of testis determination. In this study, DNA from five species of fish, Carasius auratus, Rivulus marmoratus, Xiphophorus maculatus, X. milleri, and X. nigrensis was subjected to Southern blot analysis using a PCR-amplified fragment of mouse ZFY-like sequence as a probe. Restriction fragment patterns were not polymorphic between sexes in any one species but showed a different pattern for each species. With one exception, Rivulus, a 3.1-kb bandmore » from the EcoRI digestion was common to all. Sequence and open reading frame analysis of this fragment showed a strong homology to other known vertebrate ZFY-like genes. Of particular interest in this gene is a novel third finger domain similar to one human and one alligator ZFY-like gene. Our studies and others provide evidence for a family of vertebrate ZFY genes, with those having this novel third finger being representative of the ancestral condition. 30 refs., 3 figs., 3 tabs.« less

Two-color, 30 second microwave-accelerated Metal-Enhanced Fluorescence DNA assays: a new Rapid Catch and Signal (RCS) technology.

PubMed

Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D

2011-03-07

For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.

A chondroitin sulfate chain attached to the bone dentin matrix protein 1 NH2-terminal fragment.

PubMed

Qin, Chunlin; Huang, Bingzhen; Wygant, James N; McIntyre, Bradley W; McDonald, Charles H; Cook, Richard G; Butler, William T

2006-03-24

Dentin matrix protein 1 (DMP1) is an acidic noncollagenous protein shown by gene ablations to be critical for the proper mineralization of bone and dentin. In the extracellular matrix of these tissues DMP1 is present as fragments representing the NH2-terminal (37 kDa) and COOH-terminal (57 kDa) portions of the cDNA-deduced amino acid sequence. During our separation of bone noncollagenous proteins, we observed a high molecular weight, DMP1-related component (designated DMP1-PG). We purified DMP1-PG with a monoclonal anti-DMP1 antibody affinity column. Amino acid analysis and Edman degradation of tryptic peptides proved that the core protein for DMP1-PG is the 37-kDa fragment of DMP1. Chondroitinase treatments demonstrated that the slower migration rate of DMP1-PG is due to the presence of glycosaminoglycan. Quantitative disaccharide analysis indicated that the glycosaminoglycan is made predominantly of chondroitin 4-sulfate. Further analysis on tryptic peptides led us to conclude that a single glycosaminoglycan chain is linked to the core protein via Ser74, located in the Ser74-Gly75 dipeptide, an amino acid sequence specific for the attachment of glycosaminoglycans. Our findings show that in addition to its existence as a phosphoprotein, the NH2-terminal fragment from DMP1 occurs as a proteoglycan. Amino acid sequence alignment analysis showed that the Ser74-Gly75 dipeptide and its flanking regions are highly conserved among a wide range of species from caiman to the Homo sapiens, indicating that this glycosaminoglycan attachment domain has survived an extremely long period of evolution pressure, suggesting that the glycosaminoglycan may be critical for the basic biological functions of DMP1.

Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps).

PubMed

Schmidt, Volker; Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

2017-03-01

Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons ( Pogona vitticeps ), six veiled chameleons ( Chamaeleo calyptratus ), and six panther chameleons ( Furcifer pardalis ) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity. Copyright © 2017 American Society for Microbiology.

Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps)

PubMed Central

Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

2016-01-01

ABSTRACT Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons (Pogona vitticeps), six veiled chameleons (Chamaeleo calyptratus), and six panther chameleons (Furcifer pardalis) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride. According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity. PMID:28003420

Analysis of DNA Cytosine Methylation Patterns Using Methylation-Sensitive Amplification Polymorphism (MSAP).

PubMed

Guevara, María Ángeles; de María, Nuria; Sáez-Laguna, Enrique; Vélez, María Dolores; Cervera, María Teresa; Cabezas, José Antonio

2017-01-01

Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is the methylation-sensitive amplified polymorphism technique (MSAP) which is a modification of amplified fragment length polymorphism (AFLP). It has been used to study methylation of anonymous CCGG sequences in different fungi, plants, and animal species. The main variation of this technique resides on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent-cutter restriction enzyme. For each sample, MSAP analysis is performed using both EcoRI/HpaII- and EcoRI/MspI-digested samples. A comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) methylation-insensitive polymorphisms that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples and (2) methylation-sensitive polymorphisms which are associated with the amplified fragments that differ in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses the modifications that can be applied to adjust the technology to different species of interest.

A diverse family of serine proteinase genes expressed in cotton boll weevil (Anthonomus grandis): implications for the design of pest-resistant transgenic cotton plants.

PubMed

Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Fragoso, Rodrigo R; Silva, Rodrigo O; Gomes, Eliane A; Franco, Octávio L; Dias, Simoni C; Cordeiro, Célia M T; Monnerat, Rose G; Grossi-De-Sá, Maria F

2004-09-01

Fourteen different cDNA fragments encoding serine proteinases were isolated by reverse transcription-PCR from cotton boll weevil (Anthonomus grandis) larvae. A large diversity between the sequences was observed, with a mean pairwise identity of 22% in the amino acid sequence. The cDNAs encompassed 11 trypsin-like sequences classifiable into three families and three chymotrypsin-like sequences belonging to a single family. Using a combination of 5' and 3' RACE, the full-length sequence was obtained for five of the cDNAs, named Agser2, Agser5, Agser6, Agser10 and Agser21. The encoded proteins included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Southern blotting analysis suggested that one or two copies of these serine proteinase genes exist in the A. grandis genome. Northern blotting analysis of Agser2 and Agser5 showed that for both genes, expression is induced upon feeding and is concentrated in the gut of larvae and adult insects. Reverse northern analysis of the 14 cDNA fragments showed that only two trypsin-like and two chymotrypsin-like were expressed at detectable levels. Under the effect of the serine proteinase inhibitors soybean Kunitz trypsin inhibitor and black-eyed pea trypsin/chymotrypsin inhibitor, expression of one of the trypsin-like sequences was upregulated while expression of the two chymotrypsin-like sequences was downregulated. Copyright 2004 Elsevier Ltd.

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Resistance gene homologues in Theobroma cacao as useful genetic markers.

PubMed

Kuhn, D N; Heath, M; Wisser, R J; Meerow, A; Brown, J S; Lopes, U; Schnell, R J

2003-07-01

Resistance gene homologue (RGH) sequences have been developed into useful genetic markers for marker-assisted selection (MAS) of disease resistant Theobroma cacao. A plasmid library of amplified fragments was created from seven different cultivars of cacao. Over 600 cloned recombinant amplicons were evaluated. From these, 74 unique RGHs were identified that could be placed into 11 categories based on sequence analysis. Primers specific to each category were designed. The primers specific for a single RGH category amplified fragments of equal length from the seven different cultivars used to create the library. However, these fragments exhibited single-strand conformational polymorphism (SSCP), which allowed us to map six of the RGH categories in an F(2) population of T. cacao. RGHs 1, 4 and 5 were in the same linkage group, with RGH 4 and 5 separated by less than 4 cM. As SSCP can be efficiently performed on our automated sequencer, we have developed a convenient and rapid high throughput assay for RGH alleles.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ryan, Q.C.

There are two nonallelic human {gamma} globin genes located on the short arm of chromosome No. 11 in the order 5{prime}-{sup G}{sub {gamma}}-{sup A}{sub {gamma}}-3{prime}. Various modifications of the two {gamma} genes have been reported and include: deletions, triplications, quadruplications and recently a quintuplication. These are generally created by one or more unequal crossovers in the {gamma} globin gene regions on adjacent chromosomes. During the course of looking for a {gamma}{sup {degree}} thalassemia, which might be due to a crossover of looking for a {gamma} genes, two cases were found in the family W. Bgl II mapping studies showed amore » 5 kb deletion at the {gamma} gene loci in these individuals. The Bgl II fragment from the {gamma} gene loci of R.W. was cloned into the phage vector QR1. Phage mapping showed that two out of the three Pst I sites within the Bgl II fragment were missing which suggested that the crossover might have occurred within the {gamma} gene, possibly within the {gamma}IVS II region. Sequence analysis of the cloned fragment revealed an unusual sequence which had no sequence homology with the {gamma} gene region except for a small 264 bp region near the 3{prime} end. The orientation of the 264 bp fragment is inverted relative to homologous sequences in the {sup G}{sub {gamma}} and {sup A}{sub {gamma}} IVS II. The unusual sequence was computer analyzed for homology with every DNA sequence file in the EMBL database and GenBank and did not show any significant homologies to all the available DNA sequences except for the 264 bp {gamma}IVS II homology.« less

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

PubMed

Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

1996-01-01

The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

Palaeoproteomics for human evolution studies

NASA Astrophysics Data System (ADS)

Welker, Frido

2018-06-01

The commonplace sequencing of Neanderthal, Denisovan and ancient modern human DNA continues to revolutionize our understanding of hominin phylogeny and interaction(s). The challenge with older fossils is that the progressive fragmentation of DNA even under optimal conditions, a function of time and temperature, results in ever shorter fragments of DNA. This process continues until no DNA can be sequenced or reliably aligned. Ancient proteins ultimately suffer a similar fate, but are a potential alternative source of biomolecular sequence data to investigate hominin phylogeny given their slower rate of fragmentation. In addition, ancient proteins have been proposed to potentially provide insights into in vivo biological processes and can be used to provide additional ecological information through large scale ZooMS (Zooarchaeology by Mass Spectrometry) screening of unidentifiable bone fragments. However, as initially with ancient DNA, most ancient protein research has focused on Late Pleistocene or Holocene samples from Europe. In addition, only a limited number of studies on hominin remains have been published. Here, an updated review on ancient protein analysis in human evolutionary contexts is given, including the identification of specific knowledge gaps and existing analytical limits, as well as potential avenues to overcome these.

Genome of Horsepox Virus

PubMed Central

Tulman, E. R.; Delhon, G.; Afonso, C. L.; Lu, Z.; Zsak, L.; Sandybaev, N. T.; Kerembekova, U. Z.; Zaitsev, V. L.; Kutish, G. F.; Rock, D. L.

2006-01-01

Here we present the genomic sequence of horsepox virus (HSPV) isolate MNR-76, an orthopoxvirus (OPV) isolated in 1976 from diseased Mongolian horses. The 212-kbp genome contained 7.5-kbp inverted terminal repeats and lacked extensive terminal tandem repetition. HSPV contained 236 open reading frames (ORFs) with similarity to those in other OPVs, with those in the central 100-kbp region most conserved relative to other OPVs. Phylogenetic analysis of the conserved region indicated that HSPV is closely related to sequenced isolates of vaccinia virus (VACV) and rabbitpox virus, clearly grouping together these VACV-like viruses. Fifty-four HSPV ORFs likely represented fragments of 25 orthologous OPV genes, including in the central region the only known fragmented form of an OPV ribonucleotide reductase large subunit gene. In terminal genomic regions, HSPV lacked full-length homologues of genes variably fragmented in other VACV-like viruses but was unique in fragmentation of the homologue of VACV strain Copenhagen B6R, a gene intact in other known VACV-like viruses. Notably, HSPV contained in terminal genomic regions 17 kbp of OPV-like sequence absent in known VACV-like viruses, including fragments of genes intact in other OPVs and approximately 1.4 kb of sequence present only in cowpox virus (CPXV). HSPV also contained seven full-length genes fragmented or missing in other VACV-like viruses, including intact homologues of the CPXV strain GRI-90 D2L/I4R CrmB and D13L CD30-like tumor necrosis factor receptors, D3L/I3R and C1L ankyrin repeat proteins, B19R kelch-like protein, D7L BTB/POZ domain protein, and B22R variola virus B22R-like protein. These results indicated that HSPV contains unique genomic features likely contributing to a unique virulence/host range phenotype. They also indicated that while closely related to known VACV-like viruses, HSPV contains additional, potentially ancestral sequences absent in other VACV-like viruses. PMID:16940536

A transmission imaging spectrograph and microfabricated channel system for DNA analysis.

PubMed

Simpson, J W; Ruiz-Martinez, M C; Mulhern, G T; Berka, J; Latimer, D R; Ball, J A; Rothberg, J M; Went, G T

2000-01-01

In this paper we present the development of a DNA analysis system using a microfabricated channel device and a novel transmission imaging spectrograph which can be efficiently incorporated into a high throughput genomics facility for both sizing and sequencing of DNA fragments. The device contains 48 channels etched on a glass substrate. The channels are sealed with a flat glass plate which also provides a series of apertures for sample loading and contact with buffer reservoirs. Samples can be easily loaded in volumes up to 640 nL without band broadening because of an efficient electrokinetic stacking at the electrophoresis channel entrance. The system uses a dual laser excitation source and a highly sensitive charge-coupled device (CCD) detector allowing for simultaneous detection of many fluorescent dyes. The sieving matrices for the separation of single-stranded DNA fragments are polymerized in situ in denaturing buffer systems. Examples of separation of single-stranded DNA fragments up to 500 bases in length are shown, including accurate sizing of GeneCalling fragments, and sequencing samples prepared with a reduced amount of dye terminators. An increase in sample throughput has been achieved by color multiplexing.

Comparison of the nucleotide and amino acid sequences of the RsrI and EcoRI restriction endonucleases.

PubMed

Stephenson, F H; Ballard, B T; Boyer, H W; Rosenberg, J M; Greene, P J

1989-12-21

The RsrI endonuclease, a type-II restriction endonuclease (ENase) found in Rhodobacter sphaeroides, is an isoschizomer of the EcoRI ENase. A clone containing an 11-kb BamHI fragment was isolated from an R. sphaeroides genomic DNA library by hybridization with synthetic oligodeoxyribonucleotide probes based on the N-terminal amino acid (aa) sequence of RsrI. Extracts of E. coli containing a subclone of the 11-kb fragment display RsrI activity. Nucleotide sequence analysis reveals an 831-bp open reading frame encoding a polypeptide of 277 aa. A 50% identity exists within a 266-aa overlap between the deduced aa sequences of RsrI and EcoRI. Regions of 75-100% aa sequence identity correspond to key structural and functional regions of EcoRI. The type-II ENases have many common properties, and a common origin might have been expected. Nevertheless, this is the first demonstration of aa sequence similarity between ENases produced by different organisms.

Novel antigenic shift in HA sequences of H1N1 viruses detected by big data analysis.

PubMed

Zhang, Ruiying; Xu, Chongfeng; Duan, Ziyuan

2017-07-01

The influenza virus H1N1 has been prevalent all over the world for nearly a century. Many studies on its evolutionary history, substitution rate and antigenicity-associated sites have been done with small datasets. To have a complete view, we analysed 3171 full-length HA sequences from human H1N1 viruses sampled from 1918 to 2016, and discovered a new clade has formed with sequences isolated in Iran. Based on genetic distance calculations, we revealed an uneven evolutionary rate among sequences isolated in different years. We also found that the HA1 fragment of the new clade is like that of viruses that existed in the 1930s, while the HA2 fragment is closely associated with strains isolated after the 2009 pandemic. This new, "mixed" HA sequence indicates a cryptic antigenic shift event occurred, and it should draw more attention to the new clade identified from sequences from Iran. Copyright © 2017. Published by Elsevier B.V.

Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

PubMed Central

Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

1994-01-01

A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

Whole Genome Sequence Analysis of Mutations Accumulated in rad27Δ Yeast Strains with Defects in the Processing of Okazaki Fragments Indicates Template-Switching Events

PubMed Central

Omer, Sumita; Lavi, Bar; Mieczkowski, Piotr A.; Covo, Shay; Hazkani-Covo, Einat

2017-01-01

Okazaki fragments that are formed during lagging strand DNA synthesis include an initiating primer consisting of both RNA and DNA. The RNA fragment must be removed before the fragments are joined. In Saccharomyces cerevisiae, a key player in this process is the structure-specific flap endonuclease, Rad27p (human homolog FEN1). To obtain a genomic view of the mutational consequence of loss of RAD27, a S. cerevisiae rad27Δ strain was subcultured for 25 generations and sequenced using Illumina paired-end sequencing. Out of the 455 changes observed in 10 colonies isolated the two most common types of events were insertions or deletions (INDELs) in simple sequence repeats (SSRs) and INDELs mediated by short direct repeats. Surprisingly, we also detected a previously neglected class of 21 template-switching events. These events were presumably generated by quasi-palindrome to palindrome correction, as well as palindrome elongation. The formation of these events is best explained by folding back of the stalled nascent strand and resumption of DNA synthesis using the same nascent strand as a template. Evidence of quasi-palindrome to palindrome correction that could be generated by template switching appears also in yeast genome evolution. Out of the 455 events, 55 events appeared in multiple isolates; further analysis indicates that these loci are mutational hotspots. Since Rad27 acts on the lagging strand when the leading strand should not contain any gaps, we propose a mechanism favoring intramolecular strand switching over an intermolecular mechanism. We note that our results open new ways of understanding template switching that occurs during genome instability and evolution. PMID:28974572

Top-down proteomic identification of Shiga toxin 2 subtypes from Shiga toxin-producing Escherichia coli by matrix-assisted laser desorption ionization-tandem time of flight mass spectrometry.

PubMed

Fagerquist, Clifton K; Zaragoza, William J; Sultan, Omar; Woo, Nathan; Quiñones, Beatriz; Cooley, Michael B; Mandrell, Robert E

2014-05-01

We have analyzed 26 Shiga toxin-producing Escherichia coli (STEC) strains for Shiga toxin 2 (Stx2) production using matrix-assisted laser desorption ionization (MALDI)-tandem time of flight (TOF-TOF) tandem mass spectrometry (MS/MS) and top-down proteomic analysis. STEC strains were induced to overexpress Stx2 by overnight culturing on solid agar supplemented with either ciprofloxacin or mitomycin C. Harvested cells were lysed by bead beating, and unfractionated bacterial cell lysates were ionized by MALDI. The A2 fragment of the A subunit and the mature B subunit of Stx2 were analyzed by MS/MS. Sequence-specific fragment ions were used to identify amino acid subtypes of Stx2 using top-down proteomic analysis using software developed in-house at the U.S. Department of Agriculture (USDA). Stx2 subtypes (a, c, d, f, and g) were identified on the basis of the mass of the A2 fragment and the B subunit as well as from their sequence-specific fragment ions by MS/MS (postsource decay). Top-down proteomic identification was in agreement with DNA sequencing of the full Stx2 operon (stx2) for all strains. Top-down results were also compared to a bioassay using a Vero-d2EGFP cell line. Our results suggest that top-down proteomic identification is a rapid, highly specific technique for distinguishing Stx2 subtypes.

Top-Down Proteomic Identification of Shiga Toxin 2 Subtypes from Shiga Toxin-Producing Escherichia coli by Matrix-Assisted Laser Desorption Ionization–Tandem Time of Flight Mass Spectrometry

PubMed Central

Zaragoza, William J.; Sultan, Omar; Woo, Nathan; Quiñones, Beatriz; Cooley, Michael B.; Mandrell, Robert E.

2014-01-01

We have analyzed 26 Shiga toxin-producing Escherichia coli (STEC) strains for Shiga toxin 2 (Stx2) production using matrix-assisted laser desorption ionization (MALDI)–tandem time of flight (TOF-TOF) tandem mass spectrometry (MS/MS) and top-down proteomic analysis. STEC strains were induced to overexpress Stx2 by overnight culturing on solid agar supplemented with either ciprofloxacin or mitomycin C. Harvested cells were lysed by bead beating, and unfractionated bacterial cell lysates were ionized by MALDI. The A2 fragment of the A subunit and the mature B subunit of Stx2 were analyzed by MS/MS. Sequence-specific fragment ions were used to identify amino acid subtypes of Stx2 using top-down proteomic analysis using software developed in-house at the U.S. Department of Agriculture (USDA). Stx2 subtypes (a, c, d, f, and g) were identified on the basis of the mass of the A2 fragment and the B subunit as well as from their sequence-specific fragment ions by MS/MS (postsource decay). Top-down proteomic identification was in agreement with DNA sequencing of the full Stx2 operon (stx2) for all strains. Top-down results were also compared to a bioassay using a Vero-d2EGFP cell line. Our results suggest that top-down proteomic identification is a rapid, highly specific technique for distinguishing Stx2 subtypes. PMID:24584253

Application of Tandem Two-Dimensional Mass Spectrometry for Top-Down Deep Sequencing of Calmodulin

NASA Astrophysics Data System (ADS)

Floris, Federico; Chiron, Lionel; Lynch, Alice M.; Barrow, Mark P.; Delsuc, Marc-André; O'Connor, Peter B.

2018-06-01

Two-dimensional mass spectrometry (2DMS) involves simultaneous acquisition of the fragmentation patterns of all the analytes in a mixture by correlating their precursor and fragment ions by modulating precursor ions systematically through a fragmentation zone. Tandem two-dimensional mass spectrometry (MS/2DMS) unites the ultra-high accuracy of Fourier transform ion cyclotron resonance (FT-ICR) MS/MS and the simultaneous data-independent fragmentation of 2DMS to achieve extensive inter-residue fragmentation of entire proteins. 2DMS was recently developed for top-down proteomics (TDP), and applied to the analysis of calmodulin (CaM), reporting a cleavage coverage of about 23% using infrared multiphoton dissociation (IRMPD) as fragmentation technique. The goal of this work is to expand the utility of top-down protein analysis using MS/2DMS in order to extend the cleavage coverage in top-down proteomics further into the interior regions of the protein. In this case, using MS/2DMS, the cleavage coverage of CaM increased from 23% to 42%.

Phylogenetic analysis of Rutaceous plants based on single nucleotide polymorphism in chloroplast and nuclear gene sequences

USDA-ARS?s Scientific Manuscript database

The family Rutaceae encompasses several genera including the economically important genus Citrus. In this study, we selected 22 citrus relatives belonging to the various sub groups of Rutaceae and compared the sequences of three gene fragments. The accessions selected belong to the subfamily Rutoide...

Distribution, genetic diversity and recombination analysis of Citrus tristeza virus of India

USDA-ARS?s Scientific Manuscript database

Citrus tristeza virus (CTV) isolates representing all the citrus growing geographical zones of India were analyzed for sequence of the 5'ORF1a fragments of the partial LProI domain and for the coat protein (CP) gene. The sequences were compared with previously reported Indian and CTV genotypes from...

Genome sequence analysis of dengue virus 1 isolated in Key West, Florida.

PubMed

Shin, Dongyoung; Richards, Stephanie L; Alto, Barry W; Bettinardi, David J; Smartt, Chelsea T

2013-01-01

Dengue virus (DENV) is transmitted to humans through the bite of mosquitoes. In November 2010, a dengue outbreak was reported in Monroe County in southern Florida (FL), including greater than 20 confirmed human cases. The virus collected from the human cases was verified as DENV serotype 1 (DENV-1) and one isolate was provided for sequence analysis. RNA was extracted from the DENV-1 isolate and was used in reverse transcription polymerase chain reaction (RT-PCR) to amplify PCR fragments to sequence. Nucleic acid primers were designed to generate overlapping PCR fragments that covered the entire genome. The DENV-1 isolate found in Key West (KW), FL was sequenced for whole genome characterization. Sequence assembly, Genbank searches, and recombination analyses were performed to verify the identity of the genome sequences and to determine percent similarity to known DENV-1 sequences. We show that the KW DENV-1 strain is 99% identical to Nicaraguan and Mexican DENV-1 strains. Phylogenetic and recombination analyses suggest that the DENV-1 isolated in KW originated from Nicaragua (NI) and the KW strain may circulate in KW. Also, recombination analysis results detected recombination events in the KW strain compared to DENV-1 strains from Puerto Rico. We evaluate the relative growth of KW strain of DENV-1 compared to other dengue viruses to determine whether the underlying genetics of the strain is associated with a replicative advantage, an important consideration since local transmission of DENV may result because domestic tourism can spread DENVs.

Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

PubMed Central

Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

2006-01-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

PubMed

Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

2006-12-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

PubMed

Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

1996-03-01

Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

Structural comparisons of two allelic variants of human placental alkaline phosphatase.

PubMed

Millán, J L; Stigbrand, T; Jörnvall, H

1985-01-01

A simple immunosorbent purification scheme based on monoclonal antibodies has been devised for human placental alkaline phosphatase. The two most common allelic variants, S and F, have similar amino acid compositions with identical N-terminal amino acid sequences through the first 13 residues. Both variants have identical lectin binding properties towards concanavalin A, lentil-lectin, wheat germ agglutinin, phytohemagglutinin and soybean agglutinin, and identical carbohydrate contents as revealed by methylation analysis. CNBr fragments of the variants demonstrate identical high performance liquid chromatography patterns. The carbohydrate containing fragment is different from the 32P-labeled active site fragment and the N-terminal fragment.

Whole genome sequence analysis of BT-474 using complete Genomics' standard and long fragment read technologies.

PubMed

Ciotlos, Serban; Mao, Qing; Zhang, Rebecca Yu; Li, Zhenyu; Chin, Robert; Gulbahce, Natali; Liu, Sophie Jia; Drmanac, Radoje; Peters, Brock A

2016-01-01

The cell line BT-474 is a popular cell line for studying the biology of cancer and developing novel drugs. However, there is no complete, published genome sequence for this highly utilized scientific resource. In this study we sought to provide a comprehensive and useful data set for the scientific community by generating a whole genome sequence for BT-474. Five μg of genomic DNA, isolated from an early passage of the BT-474 cell line, was used to generate a whole genome sequence (114X coverage) using Complete Genomics' standard sequencing process. To provide additional variant phasing and structural variation data we also processed and analyzed two separate libraries of 5 and 6 individual cells to depths of 99X and 87X, respectively, using Complete Genomics' Long Fragment Read (LFR) technology. BT-474 is a highly aneuploid cell line with an extremely complex genome sequence. This ~300X total coverage genome sequence provides a more complete understanding of this highly utilized cell line at the genomic level.

Generation of “LYmph Node Derived Antibody Libraries” (LYNDAL) for selecting fully human antibody fragments with therapeutic potential

PubMed Central

Diebolder, Philipp; Keller, Armin; Haase, Stephanie; Schlegelmilch, Anne; Kiefer, Jonathan D; Karimi, Tamana; Weber, Tobias; Moldenhauer, Gerhard; Kehm, Roland; Eis-Hübinger, Anna M; Jäger, Dirk; Federspil, Philippe A; Herold-Mende, Christel; Dyckhoff, Gerhard; Kontermann, Roland E; Arndt, Michaela AE; Krauss, Jürgen

2014-01-01

The development of efficient strategies for generating fully human monoclonal antibodies with unique functional properties that are exploitable for tailored therapeutic interventions remains a major challenge in the antibody technology field. Here, we present a methodology for recovering such antibodies from antigen-encountered human B cell repertoires. As the source for variable antibody genes, we cloned immunoglobulin G (IgG)-derived B cell repertoires from lymph nodes of 20 individuals undergoing surgery for head and neck cancer. Sequence analysis of unselected “LYmph Node Derived Antibody Libraries” (LYNDAL) revealed a naturally occurring distribution pattern of rearranged antibody sequences, representing all known variable gene families and most functional germline sequences. To demonstrate the feasibility for selecting antibodies with therapeutic potential from these repertoires, seven LYNDAL from donors with high serum titers against herpes simplex virus (HSV) were panned on recombinant glycoprotein B of HSV-1. Screening for specific binders delivered 34 single-chain variable fragments (scFvs) with unique sequences. Sequence analysis revealed extensive somatic hypermutation of enriched clones as a result of affinity maturation. Binding of scFvs to common glycoprotein B variants from HSV-1 and HSV-2 strains was highly specific, and the majority of analyzed antibody fragments bound to the target antigen with nanomolar affinity. From eight scFvs with HSV-neutralizing capacity in vitro, the most potent antibody neutralized 50% HSV-2 at 4.5 nM as a dimeric (scFv)2. We anticipate our approach to be useful for recovering fully human antibodies with therapeutic potential. PMID:24256717

Generation of “LYmph Node Derived Antibody Libraries” (LYNDAL) for selecting fully human antibody fragments with therapeutic potential.

PubMed

Diebolder, Philipp; Keller, Armin; Haase, Stephanie; Schlegelmilch, Anne; Kiefer, Jonathan D; Karimi, Tamana; Weber, Tobias; Moldenhauer, Gerhard; Kehm, Roland; Eis-Hübinger, Anna M; Jäger, Dirk; Federspil, Philippe A; Herold-Mende, Christel; Dyckhoff, Gerhard; Kontermann, Roland E; Arndt, Michaela A E; Krauss, Jürgen

2014-01-01

The development of efficient strategies for generating fully human monoclonal antibodies with unique functional properties that are exploitable for tailored therapeutic interventions remains a major challenge in the antibody technology field. Here, we present a methodology for recovering such antibodies from antigen-encountered human B cell repertoires. As the source for variable antibody genes, we cloned immunoglobulin G (IgG)-derived B cell repertoires from lymph nodes of 20 individuals undergoing surgery for head and neck cancer. Sequence analysis of unselected “LYmph Node Derived Antibody Libraries” (LYNDAL) revealed a naturally occurring distribution pattern of rearranged antibody sequences, representing all known variable gene families and most functional germline sequences. To demonstrate the feasibility for selecting antibodies with therapeutic potential from these repertoires, seven LYNDAL from donors with high serum titers against herpes simplex virus (HSV) were panned on recombinant glycoprotein B of HSV-1. Screening for specific binders delivered 34 single-chain variable fragments (scFvs) with unique sequences. Sequence analysis revealed extensive somatic hypermutation of enriched clones as a result of affinity maturation. Binding of scFvs to common glycoprotein B variants from HSV-1 and HSV-2 strains was highly specific, and the majority of analyzed antibody fragments bound to the target antigen with nanomolar affinity. From eight scFvs with HSV-neutralizing capacity in vitro,the most potent antibody neutralized 50% HSV-2 at 4.5 nM as a dimeric (scFv)2. We anticipate our approach to be useful for recovering fully human antibodies with therapeutic potential.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

[Completed sequences analysis on the Chinese attenuated yellow fever 17D vaccine strain and the WHO standard yellow fever 17D vaccine strain].

PubMed

Li, Jing; Yu, Yong-Xin; Dong, Guan-Mu

2009-04-01

To compare the molecular characteristics of the Chinese attenuated yellow fever 17D vaccine strain and the WHO reference yellow fever 17D vaccine strain. The primers were designed according to the published nucleotide sequences of YFV 17D strains in GenBank. Total RNA of was extracted by the Trizol and reverse transcripted. The each fragments of the YFV genome were amplified by PCR and sequenced subsequently. The fragments of the 5' and 3' end of the two strains were cloned into the pGEM T-easy vector and then sequenced. The nucleotide acid and amino acid sequences of the homology to both strains were 99% with each other. No obvious nulceotide changes were found in the sequences of the entire genome of each 17D strains. Moreover, there was no obvious changes in the E protein genes. But the E173 of YF17D Tiantan, associted with the virulence, had mutantions. And the two live attenuated yellow fever 17D vaccine strains fell to the same lineage by the phylogenetic analysis. The results indicated that the two attenuated yellow fever 17D vaccine viruses accumulates mutations at a very low frequency and the genomes were relative stable.

Extending the spectrum of DNA sequences retrieved from ancient bones and teeth

PubMed Central

Glocke, Isabelle; Meyer, Matthias

2017-01-01

The number of DNA fragments surviving in ancient bones and teeth is known to decrease with fragment length. Recent genetic analyses of Middle Pleistocene remains have shown that the recovery of extremely short fragments can prove critical for successful retrieval of sequence information from particularly degraded ancient biological material. Current sample preparation techniques, however, are not optimized to recover DNA sequences from fragments shorter than ∼35 base pairs (bp). Here, we show that much shorter DNA fragments are present in ancient skeletal remains but lost during DNA extraction. We present a refined silica-based DNA extraction method that not only enables efficient recovery of molecules as short as 25 bp but also doubles the yield of sequences from longer fragments due to improved recovery of molecules with single-strand breaks. Furthermore, we present strategies for monitoring inefficiencies in library preparation that may result from co-extraction of inhibitory substances during DNA extraction. The combination of DNA extraction and library preparation techniques described here substantially increases the yield of DNA sequences from ancient remains and provides access to a yet unexploited source of highly degraded DNA fragments. Our work may thus open the door for genetic analyses on even older material. PMID:28408382

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

PubMed

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Lactobacillus Strain Diversity Based on Partial hsp60 Gene Sequences and Design of PCR-Restriction Fragment Length Polymorphism Assays for Species Identification and Differentiation▿ †

PubMed Central

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages. PMID:17993558

Ancient DNA Reveals Late Pleistocene Existence of Ostriches in Indian Sub-Continent.

PubMed

Jain, Sonal; Rai, Niraj; Kumar, Giriraj; Pruthi, Parul Aggarwal; Thangaraj, Kumarasamy; Bajpai, Sunil; Pruthi, Vikas

2017-01-01

Ancient DNA (aDNA) analysis of extinct ratite species is of considerable interest as it provides important insights into their origin, evolution, paleogeographical distribution and vicariant speciation in congruence with continental drift theory. In this study, DNA hotspots were detected in fossilized eggshell fragments of ratites (dated ≥25000 years B.P. by radiocarbon dating) using confocal laser scanning microscopy (CLSM). DNA was isolated from five eggshell fragments and a 43 base pair (bp) sequence of a 16S rRNA mitochondrial-conserved region was successfully amplified and sequenced from one of the samples. Phylogenetic analysis of the DNA sequence revealed a 92% identity of the fossil eggshells to Struthio camelus and their position basal to other palaeognaths, consistent with the vicariant speciation model. Our study provides the first molecular evidence for the presence of ostriches in India, complementing the continental drift theory of biogeographical movement of ostriches in India, and opening up a new window into the evolutionary history of ratites.

Synchronous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment based on a zwitterionic copper (II) metal-organic framework.

PubMed

Qiu, Gui-Hua; Weng, Zi-Hua; Hu, Pei-Pei; Duan, Wen-Jun; Xie, Bao-Ping; Sun, Bin; Tang, Xiao-Yan; Chen, Jin-Xiang

2018-04-01

From a three-dimensional (3D) metal-organic framework (MOF) of {[Cu(Cmdcp)(phen)(H 2 O)] 2 ·9H 2 O} n (1, H 3 CmdcpBr = N-carboxymethyl-(3,5-dicarboxyl)pyridinium bromide, phen = phenanthroline), a sensitive and selective fluorescence sensor has been developed for the simultaneous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded microRNA-like (miRNA-like) fragment. The results from molecular dynamics simulation confirmed that MOF 1 absorbs carboxyfluorescein (FAM)-tagged and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probe ss-DNA (probe DNA, P-DNA) by π … π stacking and hydrogen bonding, as well as additional electrostatic interactions to form a sensing platform of P-DNAs@1 with quenched FAM and ROX fluorescence. In the presence of targeted ebolavirus conserved RNA sequences or ebolavirus-encoded miRNA-like fragment, the fluorophore-labeled P-DNA hybridizes with the analyte to give a P-DNA@RNA duplex and released from MOF 1, triggering a fluorescence recovery. Simultaneous detection of two target RNAs has also been realized by single and synchronous fluorescence analysis. The formed sensing platform shows high sensitivity for ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment with detection limits at the picomolar level and high selectivity without cross-reaction between the two probes. MOF 1 thus shows the potential as an effective fluorescent sensing platform for the synchronous detection of two ebolavirus-related sequences, and offer improved diagnostic accuracy of Ebola virus disease. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

Molecular epidemiology of pathogenic Leptospira spp. in the straw-colored fruit bat (Eidolon helvum) migrating to Zambia from the Democratic Republic of Congo.

PubMed

Ogawa, Hirohito; Koizumi, Nobuo; Ohnuma, Aiko; Mutemwa, Alisheke; Hang'ombe, Bernard M; Mweene, Aaron S; Takada, Ayato; Sugimoto, Chihiro; Suzuki, Yasuhiko; Kida, Hiroshi; Sawa, Hirofumi

2015-06-01

The role played by bats as a potential source of transmission of Leptospira spp. to humans is poorly understood, despite various pathogenic Leptospira spp. being identified in these mammals. Here, we investigated the prevalence and diversity of pathogenic Leptospira spp. that infect the straw-colored fruit bat (Eidolon helvum). We captured this bat species, which is widely distributed in Africa, in Zambia during 2008-2013. We detected the flagellin B gene (flaB) from pathogenic Leptospira spp. in kidney samples from 79 of 529 E. helvum (14.9%) bats. Phylogenetic analysis of 70 flaB fragments amplified from E. helvum samples and previously reported sequences, revealed that 12 of the fragments grouped with Leptospira borgpetersenii and Leptospira kirschneri; however, the remaining 58 flaB fragments appeared not to be associated with any reported species. Additionally, the 16S ribosomal RNA gene (rrs) amplified from 27 randomly chosen flaB-positive samples was compared with previously reported sequences, including bat-derived Leptospira spp. All 27 rrs fragments clustered into a pathogenic group. Eight fragments were located in unique branches, the other 19 fragments were closely related to Leptospira spp. detected in bats. These results show that rrs sequences in bats are genetically related to each other without regional variation, suggesting that Leptospira are evolutionarily well-adapted to bats and have uniquely evolved in the bat population. Our study indicates that pathogenic Leptospira spp. in E. helvum in Zambia have unique genotypes. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Extracting Both Peptide Sequence and Glycan Structural Information by 157 nm Photodissociation of N-Linked Glycopeptides

PubMed Central

Zhang, Liangyi; Reilly, James P.

2009-01-01

157 nm photodissociation of N-linked glycopeptides was investigated in MALDI tandem time-of-flight (TOF) and linear ion trap mass spectrometers. Singly-charged glycopeptides yielded abundant peptide and glycan fragments. The peptide fragments included a series of x-, y-, v- and w- ions with the glycan remaining intact. These provide information about the peptide sequence and the glycosylation site. In addition to glycosidic fragments, abundant cross-ring glycan fragments that are not observed in low-energy CID were detected. These fragments provide insight into the glycan sequence and linkages. Doubly-charged glycopeptides generated by nanospray in the linear ion trap mass spectrometer also yielded peptide and glycan fragments. However, the former were dominated by low-energy fragments such as b- and y- type ions while glycan was primarily cleaved at glycosidic bonds. PMID:19113943

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Digital Biological Converter

DTIC Science & Technology

2013-06-28

of cuts that each fragment should be cut into so the fragments are no greater than a specific length threshold. Additionally, vector sequences and...restriction sites are attached to each fragment while ensuring the restriction sites are unique to each sequence. The vector sequences serve as hooks...for assembly into vector for cloning purposes, and also as primer binding domains for PCR ampl ification. The restriction sites are added to

The evolution and population structure of Lactobacillus fermentum from different naturally fermented products as determined by multilocus sequence typing (MLST).

PubMed

Dan, Tong; Liu, Wenjun; Song, Yuqin; Xu, Haiyan; Menghe, Bilige; Zhang, Heping; Sun, Zhihong

2015-05-20

Lactobacillus fermentum is economically important in the production and preservation of fermented foods. A repeatable and discriminative typing method was devised to characterize L. fermentum at the molecular level. The multilocus sequence typing (MLST) scheme developed was based on analysis of the internal sequence of 11 housekeeping gene fragments (clpX, dnaA, dnaK, groEL, murC, murE, pepX, pyrG, recA, rpoB, and uvrC). MLST analysis of 203 isolates of L. fermentum from Mongolia and seven provinces/ autonomous regions in China identified 57 sequence types (ST), 27 of which were represented by only a single isolate, indicating high genetic diversity. Phylogenetic analyses based on the sequence of the 11 housekeeping gene fragments indicated that the L. fermentum isolates analyzed belonged to two major groups. A standardized index of association (I A (S)) indicated a weak clonal population structure in L. fermentum. Split decomposition analysis indicated that recombination played an important role in generating the genetic diversity observed in L. fermentum. The results from the minimum spanning tree strongly suggested that evolution of L. fermentum STs was not correlated with geography or food-type. The MLST scheme developed will be valuable for further studies on the evolution and population structure of L. fermentum isolates used in food products.

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans

PubMed Central

Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

2015-01-01

Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191

Front-End Electron Transfer Dissociation Coupled to a 21 Tesla FT-ICR Mass Spectrometer for Intact Protein Sequence Analysis

NASA Astrophysics Data System (ADS)

Weisbrod, Chad R.; Kaiser, Nathan K.; Syka, John E. P.; Early, Lee; Mullen, Christopher; Dunyach, Jean-Jacques; English, A. Michelle; Anderson, Lissa C.; Blakney, Greg T.; Shabanowitz, Jeffrey; Hendrickson, Christopher L.; Marshall, Alan G.; Hunt, Donald F.

2017-09-01

High resolution mass spectrometry is a key technology for in-depth protein characterization. High-field Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) enables high-level interrogation of intact proteins in the most detail to date. However, an appropriate complement of fragmentation technologies must be paired with FTMS to provide comprehensive sequence coverage, as well as characterization of sequence variants, and post-translational modifications. Here we describe the integration of front-end electron transfer dissociation (FETD) with a custom-built 21 tesla FT-ICR mass spectrometer, which yields unprecedented sequence coverage for proteins ranging from 2.8 to 29 kDa, without the need for extensive spectral averaging (e.g., 60% sequence coverage for apo-myoglobin with four averaged acquisitions). The system is equipped with a multipole storage device separate from the ETD reaction device, which allows accumulation of multiple ETD fragment ion fills. Consequently, an optimally large product ion population is accumulated prior to transfer to the ICR cell for mass analysis, which improves mass spectral signal-to-noise ratio, dynamic range, and scan rate. We find a linear relationship between protein molecular weight and minimum number of ETD reaction fills to achieve optimum sequence coverage, thereby enabling more efficient use of instrument data acquisition time. Finally, real-time scaling of the number of ETD reactions fills during method-based acquisition is shown, and the implications for LC-MS/MS top-down analysis are discussed. [Figure not available: see fulltext.

Identification and phylogenetic analysis of novel cytochrome P450 1A genes from ungulate species.

PubMed

Darwish, Wageh Sobhy; Kawai, Yusuke; Ikenaka, Yoshinori; Yamamoto, Hideaki; Muroya, Tarou; Ishizuka, Mayumi

2010-09-01

As part of an ongoing effort to understand the biological response of wild and domestic ungulates to different environmental pollutants such as dioxin-like compounds, cDNAs encoding for CYP1A1 and CYP1A2 were cloned and characterized. Four novel CYP1A cDNA fragments from the livers of four wild ungulates (elephant, hippopotamus, tapir and deer) were identified. Three fragments from hippopotamus, tapir and deer were classified as CYP1A2, and the other fragment from elephant was designated as CYP1A1/2. The deduced amino acid sequences of these fragment CYP1As showed identities ranging from 76 to 97% with other animal CYP1As. The phylogenetic analysis of these fragments showed that both elephant and hippopotamus CYP1As made separate branches, while tapir and deer CYP1As were located beside that of horse and cattle respectively in the phylogenetic tree. Analysis of dN/dS ratio among the identified CYP1As indicated that odd toed ungulate CYP1A2s were exposed to different selection pressure.

Cloning and sequence analysis of the meso-diaminopimelate decarboxylase gene from Bacillus methanolicus MGA3 and comparison to other decarboxylase genes.

PubMed Central

Mills, D A; Flickinger, M C

1993-01-01

The lysA gene of Bacillus methanolicus MGA3 was cloned by complementation of an auxotrophic Escherichia coli lysA22 mutant with a genomic library of B. methanolicus MGA3 chromosomal DNA. Subcloning localized the B. methanolicus MGA3 lysA gene into a 2.3-kb SmaI-SstI fragment. Sequence analysis of the 2.3-kb fragment indicated an open reading frame encoding a protein of 48,223 Da, which was similar to the meso-diaminopimelate (DAP) decarboxylase amino acid sequences of Bacillus subtilis (62%) and Corynebacterium glutamicum (40%). Amino acid sequence analysis indicated several regions of conservation among bacterial DAP decarboxylases, eukaryotic ornithine decarboxylases, and arginine decarboxylases, suggesting a common structural arrangement for positioning of substrate and the cofactor pyridoxal 5'-phosphate. The B. methanolicus MGA3 DAP decarboxylase was shown to be a dimer (M(r) 86,000) with a subunit molecular mass of approximately 50,000 Da. This decarboxylase is inhibited by lysine (Ki = 0.93 mM) with a Km of 0.8 mM for DAP. The inhibition pattern suggests that the activity of this enzyme in lysine-overproducing strains of B. methanolicus MGA3 may limit lysine synthesis. Images PMID:8215365

Cloning and sequence analysis of the meso-diaminopimelate decarboxylase gene from Bacillus methanolicus MGA3 and comparison to other decarboxylase genes.

PubMed

Mills, D A; Flickinger, M C

1993-09-01

The lysA gene of Bacillus methanolicus MGA3 was cloned by complementation of an auxotrophic Escherichia coli lysA22 mutant with a genomic library of B. methanolicus MGA3 chromosomal DNA. Subcloning localized the B. methanolicus MGA3 lysA gene into a 2.3-kb SmaI-SstI fragment. Sequence analysis of the 2.3-kb fragment indicated an open reading frame encoding a protein of 48,223 Da, which was similar to the meso-diaminopimelate (DAP) decarboxylase amino acid sequences of Bacillus subtilis (62%) and Corynebacterium glutamicum (40%). Amino acid sequence analysis indicated several regions of conservation among bacterial DAP decarboxylases, eukaryotic ornithine decarboxylases, and arginine decarboxylases, suggesting a common structural arrangement for positioning of substrate and the cofactor pyridoxal 5'-phosphate. The B. methanolicus MGA3 DAP decarboxylase was shown to be a dimer (M(r) 86,000) with a subunit molecular mass of approximately 50,000 Da. This decarboxylase is inhibited by lysine (Ki = 0.93 mM) with a Km of 0.8 mM for DAP. The inhibition pattern suggests that the activity of this enzyme in lysine-overproducing strains of B. methanolicus MGA3 may limit lysine synthesis.

Comprehensive proteomic analysis of Penicillium verrucosum.

PubMed

Nöbauer, Katharina; Hummel, Karin; Mayrhofer, Corina; Ahrens, Maike; Setyabudi, Francis M C; Schmidt-Heydt, Markus; Eisenacher, Martin; Razzazi-Fazeli, Ebrahim

2017-05-01

Mass spectrometric identification of proteins in species lacking validated sequence information is a major problem in veterinary science. In the present study, we used ochratoxin A producing Penicillium verrucosum to identify and quantitatively analyze proteins of an organism with yet no protein information available. The work presented here aimed to provide a comprehensive protein identification of P. verrucosum using shotgun proteomics. We were able to identify 3631 proteins in an "ab initio" translated database from DNA sequences of P. verrucosum. Additionally, a sequential window acquisition of all theoretical fragment-ion spectra analysis was done to find differentially regulated proteins at two different time points of the growth curve. We compared the proteins at the beginning (day 3) and at the end of the log phase (day 12). © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Method for rapid base sequencing in DNA and RNA

DOEpatents

Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

1987-10-07

A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

Method for rapid base sequencing in DNA and RNA

DOEpatents

Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

1990-10-09

A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

Method for rapid base sequencing in DNA and RNA

DOEpatents

Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.

1990-01-01

A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.

An optimized protocol for generation and analysis of Ion Proton sequencing reads for RNA-Seq.

PubMed

Yuan, Yongxian; Xu, Huaiqian; Leung, Ross Ka-Kit

2016-05-26

Previous studies compared running cost, time and other performance measures of popular sequencing platforms. However, comprehensive assessment of library construction and analysis protocols for Proton sequencing platform remains unexplored. Unlike Illumina sequencing platforms, Proton reads are heterogeneous in length and quality. When sequencing data from different platforms are combined, this can result in reads with various read length. Whether the performance of the commonly used software for handling such kind of data is satisfactory is unknown. By using universal human reference RNA as the initial material, RNaseIII and chemical fragmentation methods in library construction showed similar result in gene and junction discovery number and expression level estimated accuracy. In contrast, sequencing quality, read length and the choice of software affected mapping rate to a much larger extent. Unspliced aligner TMAP attained the highest mapping rate (97.27 % to genome, 86.46 % to transcriptome), though 47.83 % of mapped reads were clipped. Long reads could paradoxically reduce mapping in junctions. With reference annotation guide, the mapping rate of TopHat2 significantly increased from 75.79 to 92.09 %, especially for long (>150 bp) reads. Sailfish, a k-mer based gene expression quantifier attained highly consistent results with that of TaqMan array and highest sensitivity. We provided for the first time, the reference statistics of library preparation methods, gene detection and quantification and junction discovery for RNA-Seq by the Ion Proton platform. Chemical fragmentation performed equally well with the enzyme-based one. The optimal Ion Proton sequencing options and analysis software have been evaluated.

A simple method for semi-random DNA amplicon fragmentation using the methylation-dependent restriction enzyme MspJI.

PubMed

Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W

2015-04-11

Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

First ancient DNA sequences from the Late Pleistocene red deer (Cervus elaphus) in the Crimea, Ukraine

NASA Astrophysics Data System (ADS)

Stanković, Ana; Nadachowski, Adam; Doan, Karolina; Stefaniak, Krzysztof; Baca, Mateusz; Socha, Paweł; Wegleński, Piotr; Ridush, Bogdan

2010-05-01

The Late Pleistocene has been a period of significant population and species turnover and extinctions among the large mammal fauna. Massive climatic and environmental changes during Pleistocene significantly influenced the distribution and also genetic diversity of plants and animals. The model of glacial refugia and habitat contraction to southern peninsulas in Europe as areas for the survival of temperate animal species during unfavourable Pleistocene glaciations is at present widely accepted. However, both molecular data and the fossil record indicate the presence of northern and perhaps north-eastern refugia in Europe. In recent years, much new palaeontological data have been obtained in the Crimean Peninsula, Ukraine, following extensive investigations. The red deer (Cervus elaphus) samples for aDNA studies were collected in Emine-Bair-Khosar Cave, situated on the north edge of Lower Plateau of the Chatyrdag Massif (Crimean Mountains). The cave is a vertical shaft, which functioned as a huge mega-trap over a long period of time (probably most of the Pleistocene). The bone assemblages provided about 5000 bones belonging to more than 40 species. The C. elaphus bones were collected from three different stratigraphical levels, radiocarbon dated by accelerator mass spectrometry (AMS) method. The bone fragments of four specimens of red deer were used for the DNA isolation and analysis. The mtDNA (Cytochome b) was successfully isolated from three bone fragments and the cytochrome b sequences were amplified by multiplex PCR. The sequences obtained so far allowed for the reconstruction of only preliminary phylogenetic trees. A fragment of metatarsus from level dated to ca. 48,500±2,000 years BP, yielded a sequence of 513 bp, allowing to locate the specimen on the phylogenetic tree within modern C. elaphus specimens from southern and middle Europe. The second bone fragment, a fragment of mandible, collected from level dated approximately to ca. 33,500±400 years BP, yielded a sequence (696 bp) locating this specimen much closer to the modern C. elaphus specimens from China and Far East. From the third bone fragment (metatarsus), dated between ca. 12,000 years BP and 30,000 years BP, the sequence of only 346 bp has been obtained. It locates this specimen between European and Asiatic haplogroups. The preliminary results of analysis of the DNA from Crimean C. elaphus fossils reveal the great genetic heterogeneity and a complex phylogeographical pattern of the material studied. The obtained results support the opinion that Crimean Peninsula was the most north-eastern refugium in Europe during Late Pleistocene playing a major role in recolonization and dispersal processes of temperate species during and after the Late Pleistocene in this part of the Euro-Asian continent.

Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

PubMed Central

Grindley, N D; Joyce, C M

1980-01-01

The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

PubMed

Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

2014-01-01

DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic DNA digestion.

Clonal structure in Ichthyobacterium seriolicida, the causative agent of bacterial haemolytic jaundice in yellowtail, Seriola quinqueradiata, inferred from molecular epidemiological analysis.

PubMed

Matsuyama, T; Fukuda, Y; Sakai, T; Tanimoto, N; Nakanishi, M; Nakamura, Y; Takano, T; Nakayasu, C

2017-08-01

Bacterial haemolytic jaundice caused by Ichthyobacterium seriolicida has been responsible for mortality in farmed yellowtail, Seriola quinqueradiata, in western Japan since the 1980s. In this study, polymorphic analysis of I. seriolicida was performed using three molecular methods: amplified fragment length polymorphism (AFLP) analysis, multilocus sequence typing (MLST) and multiple-locus variable-number tandem repeat analysis (MLVA). Twenty-eight isolates were analysed using AFLP, while 31 isolates were examined by MLST and MLVA. No polymorphisms were identified by AFLP analysis using EcoRI and MseI, or by MLST of internal fragments of eight housekeeping genes. However, MLVA revealed variation in repeat numbers of three elements, allowing separation of the isolates into 16 sequence types. The unweighted pair group method using arithmetic averages cluster analysis of the MLVA data identified four major clusters, and all isolates belonged to clonal complexes. It is likely that I. seriolicida populations share a common ancestor, which may be a recently introduced strain. © 2016 John Wiley & Sons Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagrimini, L.M.

Since this manuscript was submitted we have conducted a more thorough physiological analysis of water relations in wild-type and peroxidase overproducing plants. These experiments include pressure bomb, plasmolysis, and membrane integrity analysis. We are also in the process of analyzing other phenotypes in peroxidase overproducer plants such as excessive browning of tissue, the rapid death of tissue in culture, and poor germination of seed. Transformed plants of Nicotiana tabacum and Nicotiana sylvestris were obtained which have peroxidase activity 3--7 fold lower than wild-type plants. This was done by introducing a chimeric gene composed of the CaMV 35S promoter and themore » 5' half of the tobacco anionic peroxidase cDNA in the antisense RNA configuration. A manuscript which describes this work is being written, and will be submitted for publication in January 1990. The anionic peroxidase gene has been cloned by hybridization to the cloned cDNA. The entire gene is contained on an 8.7kb fragment within a lambda phage clone. Several smaller DNA fragments have been subcloned, and some have been sequenced. One exon within the coding sequence has been sequenced, along with the partial sequence of two introns. Further sequencing is being carried-out to identify the promoter, which will be later joined to a reporter gene. 6 figs.« less

Preparation of next-generation sequencing libraries using Nextera™ technology: simultaneous DNA fragmentation and adaptor tagging by in vitro transposition.

PubMed

Caruccio, Nicholas

2011-01-01

DNA library preparation is a common entry point and bottleneck for next-generation sequencing. Current methods generally consist of distinct steps that often involve significant sample loss and hands-on time: DNA fragmentation, end-polishing, and adaptor-ligation. In vitro transposition with Nextera™ Transposomes simultaneously fragments and covalently tags the target DNA, thereby combining these three distinct steps into a single reaction. Platform-specific sequencing adaptors can be added, and the sample can be enriched and bar-coded using limited-cycle PCR to prepare di-tagged DNA fragment libraries. Nextera technology offers a streamlined, efficient, and high-throughput method for generating bar-coded libraries compatible with multiple next-generation sequencing platforms.

Method and apparatus for biological sequence comparison

DOEpatents

Marr, T.G.; Chang, W.I.

1997-12-23

A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.

Method and apparatus for biological sequence comparison

DOEpatents

Marr, Thomas G.; Chang, William I-Wei

1997-01-01

A method and apparatus for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence.

Exploring representations of protein structure for automated remote homology detection and mapping of protein structure space

PubMed Central

2014-01-01

Background Due to rapid sequencing of genomes, there are now millions of deposited protein sequences with no known function. Fast sequence-based comparisons allow detecting close homologs for a protein of interest to transfer functional information from the homologs to the given protein. Sequence-based comparison cannot detect remote homologs, in which evolution has adjusted the sequence while largely preserving structure. Structure-based comparisons can detect remote homologs but most methods for doing so are too expensive to apply at a large scale over structural databases of proteins. Recently, fragment-based structural representations have been proposed that allow fast detection of remote homologs with reasonable accuracy. These representations have also been used to obtain linearly-reducible maps of protein structure space. It has been shown, as additionally supported from analysis in this paper that such maps preserve functional co-localization of the protein structure space. Methods Inspired by a recent application of the Latent Dirichlet Allocation (LDA) model for conducting structural comparisons of proteins, we propose higher-order LDA-obtained topic-based representations of protein structures to provide an alternative route for remote homology detection and organization of the protein structure space in few dimensions. Various techniques based on natural language processing are proposed and employed to aid the analysis of topics in the protein structure domain. Results We show that a topic-based representation is just as effective as a fragment-based one at automated detection of remote homologs and organization of protein structure space. We conduct a detailed analysis of the information content in the topic-based representation, showing that topics have semantic meaning. The fragment-based and topic-based representations are also shown to allow prediction of superfamily membership. Conclusions This work opens exciting venues in designing novel representations to extract information about protein structures, as well as organizing and mining protein structure space with mature text mining tools. PMID:25080993

Sequence and molecular characterization of a DNA region encoding the dibenzothiophene desulfurization operon of Rhodococcus sp. strain IGTS8.

PubMed Central

Piddington, C S; Kovacevich, B R; Rambosek, J

1995-01-01

Dibenzothiophene (DBT), a model compound for sulfur-containing organic molecules found in fossil fuels, can be desulfurized to 2-hydroxybiphenyl (2-HBP) by Rhodococcus sp. strain IGTS8. Complementation of a desulfurization (dsz) mutant provided the genes from Rhodococcus sp. strain IGTS8 responsible for desulfurization. A 6.7-kb TaqI fragment cloned in Escherichia coli-Rhodococcus shuttle vector pRR-6 was found to both complement this mutation and confer desulfurization to Rhodococcus fascians, which normally is not able to desulfurize DBT. Expression of this fragment in E. coli also conferred the ability to desulfurize DBT. A molecular analysis of the cloned fragment revealed a single operon containing three open reading frames involved in the conversion of DBT to 2-HBP. The three genes were designated dszA, dszB, and dszC. Neither the nucleotide sequences nor the deduced amino acid sequences of the enzymes exhibited significant similarity to sequences obtained from the GenBank, EMBL, and Swiss-Prot databases, indicating that these enzymes are novel enzymes. Subclone analyses revealed that the gene product of dszC converts DBT directly to DBT-sulfone and that the gene products of dszA and dszB act in concert to convert DBT-sulfone to 2-HBP. PMID:7574582

Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

PubMed

Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

2017-08-15

Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1991-01-21

bisphosphate carboxylase ( RubisCO ) from symbiotic bacteria of various origins, b) To continue methods development for 16S rRNA sequencing from symbionts in...frozen and badly preserved specimens, and c) To use these new techniques to sequence 16s DNA from a variety of symbionts a) RubisCO We have cloned the...gene coding for RubisCO from the sulfur oxidixing symbiont of the gastropod Alvinochoncha hessleri. Nucleotide sequence analysis of the cloned fragment

Fragmentation of whole-transcriptome RNA using E. coli RNase III.

PubMed

Ares, Manuel

2013-05-01

High-throughput sequencing (HTS) methods can provide short sequence reads for many millions of individual molecules in a sample, allowing the use of sequencing to measure the abundance of RNA molecules. To quantify the amount of a particular sequence in a sample of large RNAs (e.g., mRNAs), it is important to fragment the RNA into short pieces that can be ligated to oligonucleotides that allow polymerase chain reaction (PCR) amplification and sequencing. The most desired end structure of RNA for such ligation steps is a 5' phosphate and a 3' OH. Thus, enzymes that leave these groups after cleavage are of particular utility, avoiding the need to dephosphorylate the 3' end with phosphatases or phosphorylate the 5' end with kinase before proceeding. One such enzyme, RNase III, is widely available. Although it primarily cuts duplex RNA, this specificity is salt- and concentration-dependent, and many RNAs that lack strong extended duplexes are nonetheless susceptible to cleavage at many spots. RNA fragmentation by RNase III does not seem to grossly affect the distribution of RNA sequencing reads. Thus, it has become a standard method for creating nominally representative pools of transcriptome sequences with 5' phosphates and 3' OH for library construction. Three steps in preparing fragmented transcriptome RNA for sequencing library construction are described here: (1) fragmenting the RNA with RNase III to the extent that ~60-100-nucleotide fragments are created, (2) purifying the RNA from the RNase III reaction, and (3) analyzing the digestion products for their suitability in library production.

Mini-midi-mito: adapting the amplification and sequencing strategy of mtDNA to the degradation state of crime scene samples.

PubMed

Berger, Cordula; Parson, Walther

2009-06-01

The degradation state of some biological traces recovered from the crime scene requires the amplification of very short fragments to attain a useful mitochondrial (mt)DNA sequence. We have previously introduced two mini-multiplex assays that amplify 10 overlapping control region (CR) fragments in two separate multiplex PCRs, which brought successful CR consensus sequences from even highly degraded DNA extracts. This procedure requires a total of 20 sequencing reactions per sample, which is laborious and cost intensive. For only moderately degraded samples that we encounter more frequently with typical mtDNA casework material, we developed two new multiplex assays that use a subset of the mini-amplicon primers but embrace larger fragments (midis) and require only 10 sequencing reactions to build a double-stranded CR consensus sequence. We used a preceding mtDNA quantitation step by real-time PCR with two different target fragments (143 and 283 bp) that roughly correspond to the average fragment sizes of the different multiplex approaches to estimate size-dependent mtDNA quantities and to aid the choice of the appropriate PCR multiplexes with respect to quality of the results and required costs.

[Isolation of ABA-regulated genes in Oryza sativa through fluorescent differential display PCR (FDD-PCR)].

PubMed

Xu, Shou Ling; Shen, Si Shi; Xu, Zhi Hong; Xue, Hong Wei

2002-12-01

Abscisic acid (ABA) was critical in plant seed development and response to environmental factors such as stress situations. To study the possible ABA related signaling transduction pathways, we tried to isolate the ABA-regulated genes through fluorescent differential display PCR (FDD-PCR) technology using rice seedling as materials (treated with ABA for 2, 4, 8 and 12h). In the 17 fragments isolated, 14 and 3 clones were up-and down-regulated respectively. Sequence analyses revealed that the encoded proteins were involved in photosynthesis (7 fragments), signal transduction (1 fragments), transcription (2 fragments), metabolism and resistance (6 fragments), and unknown protein (1 fragments). 3 clones, encoding putative alpha/beta hydrolase fold, putative vacuolar H+ -ATPase B subunit, putative tyrosine phosphatase, were confirmed to be regulated under ABA treatment by RT-PCR and northern blot analysis. FDD-PCR and possible functional mechanisms of ABA were discussed.

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Development of a monoclonal anitbody to immuno-cytochemical analysis of the cellular localization of the peripheral benzodiazepine receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dussossoy, D.; Carayon, P.; Feraut, D.

1996-05-01

Based on the amino acid sequence deduced from the cloned human peripheral benzodiazepine receptor (PBR) gene, monoclonal antibody (Mab 8D7) was produced against the C-terminal fragment of the receptor. Immunoblot experiments, performed against purified PBR, indicated that the antipeptide antibody recognized, under denaturing conditions, the corresponding amino acid sequence of the PBR. When mitochondrial membranes form PBR transfected yeast or from THP1 and U937 cells were used on immunoblot analysis, a high level of immunoreactivity was observed at 18 kDa, the PBR molecular mass deduced from cDNA, establishing the specificity of the antibody for the receptor. Moreover, binding experiments realizedmore » with intact mitochondria demonstrated that the immunogenic sequence was accessible to the antibody indicating that the C-terminal fragment of the PBR faces the cytosol. Using this Mab we developed a technique which allowed precise quantification of PBR density per cell. Furthermore, cellular localization studies by flow cytometric analysis and confocal microscopy on cell lines displaying different levels of PBR showed that Mab 8D7 was entirely colocalized with an antimitochondria Mab. 34 refs., 7 figs.« less

Separating endogenous ancient DNA from modern day contamination in a Siberian Neandertal

PubMed Central

Skoglund, Pontus; Northoff, Bernd H.; Shunkov, Michael V.; Derevianko, Anatoli P.; Pääbo, Svante; Krause, Johannes; Jakobsson, Mattias

2014-01-01

One of the main impediments for obtaining DNA sequences from ancient human skeletons is the presence of contaminating modern human DNA molecules in many fossil samples and laboratory reagents. However, DNA fragments isolated from ancient specimens show a characteristic DNA damage pattern caused by miscoding lesions that differs from present day DNA sequences. Here, we develop a framework for evaluating the likelihood of a sequence originating from a model with postmortem degradation—summarized in a postmortem degradation score—which allows the identification of DNA fragments that are unlikely to originate from present day sources. We apply this approach to a contaminated Neandertal specimen from Okladnikov Cave in Siberia to isolate its endogenous DNA from modern human contaminants and show that the reconstructed mitochondrial genome sequence is more closely related to the variation of Western Neandertals than what was discernible from previous analyses. Our method opens up the potential for genomic analysis of contaminated fossil material. PMID:24469802

Species identification in mixed tuna samples with next-generation sequencing targeting two short cytochrome b gene fragments.

PubMed

Kappel, Kristina; Haase, Ilka; Käppel, Christine; Sotelo, Carmen G; Schröder, Ute

2017-11-01

Conventional Sanger sequencing of PCR products is the gold standard for species authentication of seafood products. However, this method is inappropriate for the analysis of products that might contain mixtures of species, such as tinned tuna. The purpose of this study was to test whether next-generation sequencing (NGS) can be a solution for the authentication of mixed products. Nine tuna samples containing mixtures of up to four species were prepared and subjected to an NGS approach targeting two short cytochrome b gene (cytb) fragments on the Illumina MiSeq platform. Sequence recovery was precise and admixtures of as low as 1% could be identified, depending on the species composition of the mixtures. Duplicate samples as well as two individual NGS runs produced very similar results. A first test of three commercial tinned tuna samples indicated the presence of different species in the same tin, although this is forbidden by EU law. Copyright © 2017 Elsevier Ltd. All rights reserved.

Human adenovirus serotype 12 virion precursors pMu and pVI are cleaved at amino-terminal and carboxy-terminal sites that conform to the adenovirus 2 endoproteinase cleavage consensus sequence.

PubMed

Freimuth, P; Anderson, C W

1993-03-01

The sequence of a 1158-base pair fragment of the human adenovirus serotype 12 (Ad12) genome was determined. This segment encodes the precursors for virion components Mu and VI. Both Ad12 precursors contain two sequences that conform to a consensus sequence motif for cleavage by the endoproteinase of adenovirus 2 (Ad2). Analysis of the amino terminus of VI and of the peptide fragments found in Ad12 virions demonstrated that these sites are cleaved during Ad12 maturation. This observation suggests that the recognition motif for adenovirus endoproteinases is highly conserved among human serotypes. The adenovirus 2 endoproteinase polypeptide requires additional co-factors for activity (C. W. Anderson, Protein Expression Purif., 1993, 4, 8-15). Synthetic Ad12 or Ad2 pVI carboxy-terminal peptides each permitted efficient cleavage of an artificial endoproteinase substrate by recombinant Ad2 endoproteinase polypeptide.

Multiplex screening for RB1 germline mutations in 106 patients with hereditary retinoblastoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lohmann, D.R.; Brandt, B.; Passarge, E.

1994-09-01

The identification of germline mutations in the retinoblastoma susceptibility gene (RB1) is important for genetic counseling in hereditary retinoblastoma. Due to the complex genomic organization of this gene and the heterogeneity of mutations, efficient screening procedures are important for rapid mutation detection. We have developed methods based on simultaneous analysis of multiple regions of this gene in an ABI automated DNA fragment analyzer to examine 106 patients with hereditary retinoblastoma in which no alteration was identified by Southern blot hybridization. Primers for the amplification of all 27 exons of the RB1 gene as well as the promoter and poly(A) signalmore » sequences were labelled with distinct fluorescent dyes (FAM, HEX, TAMRA) to enable simultaneous electrophoretic analysis of PCR products with similar mobility. PCR fragments distinguishable by size or color were co-amplified by multiplex PCR and analyzed for length by GENESCAN analysis. Using this approach, small deletions ranging from 1 bp to 22 bp were identified in 24 patients (23%). Short sequence repeats or polypyrimidine runs were present in the vicinity of most of these deletions. In 4 patients (4%), insertions from 1 bp to 4 bp were found. The majority of length mutations resulted in a truncated gene product due to frameshift and premature termination. No mutation was identified in exons 25 to 27 possibly indicating that the encoded protein domains have minor functional importance. In order to screen for base substitutions that are not detectable by fragment length analysis, we adapted heteroduplex analysis for the use in the DNA fragment analyzer. During the optimization of this method we detected 10 single base substitutions most of which generated stop codons. Intriguingly, two identical missense mutations were identified in two unrelated families with a low-penetrance phenotype.« less

Peptides derivatized with bicyclic quaternary ammonium ionization tags. Sequencing via tandem mass spectrometry.

PubMed

Setner, Bartosz; Rudowska, Magdalena; Klem, Ewelina; Cebrat, Marek; Szewczuk, Zbigniew

2014-10-01

Improving the sensitivity of detection and fragmentation of peptides to provide reliable sequencing of peptides is an important goal of mass spectrometric analysis. Peptides derivatized by bicyclic quaternary ammonium ionization tags: 1-azabicyclo[2.2.2]octane (ABCO) or 1,4-diazabicyclo[2.2.2]octane (DABCO), are characterized by an increased detection sensitivity in electrospray ionization mass spectrometry (ESI-MS) and longer retention times on the reverse-phase (RP) chromatography columns. The improvement of the detection limit was observed even for peptides dissolved in 10 mM NaCl. Collision-induced dissociation tandem mass spectrometry of quaternary ammonium salts derivatives of peptides showed dominant a- and b-type ions, allowing facile sequencing of peptides. The bicyclic ionization tags are stable in collision-induced dissociation experiments, and the resulted fragmentation pattern is not significantly influenced by either acidic or basic amino acid residues in the peptide sequence. Obtained results indicate the general usefulness of the bicyclic quaternary ammonium ionization tags for ESI-MS/MS sequencing of peptides. Copyright © 2014 John Wiley & Sons, Ltd.

Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

PubMed

Al-Khalifah, Nasser S; Shanavaskhan, A E

2017-01-01

Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): taxonomic implications for the Great Lakes species flock.

PubMed

Reed, K M; Dorschner, M O; Todd, T N; Phillips, R B

1998-09-01

Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens of C. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

Cloning and expression of Bartonella henselae sucB gene encoding an immunogenic dihydrolipoamide succinyltransferase homologous protein.

PubMed

Kabeya, Hidenori; Maruyama, Soichi; Hirano, Kouji; Mikami, Takeshi

2003-01-01

Immunoscreening of a ZAP genomic library of Bartonella henselae strain Houston-1 expressed in Escherichia coli resulted in the isolation of a clone containing 3.5 kb BamHI genomic DNA fragment. This 3.5 kb DNA fragment was found to contain a sequence of a gene encoding a protein with significant homology to the dihydrolipoamide succinyltransferase of Brucella melitensis (sucB). Subsequent cloning and DNA sequence analysis revealed that the deduced amino acid sequence from the cloned gene showed 66.5% identity to SucB protein of B. melitensis, and 43.4 and 47.2% identities to those of Coxiella burnetii and E. coli, respectively. The gene was expressed as a His-Nus A-tagged fusion protein. The recombinant SucB protein (rSucB) was shown to be an immunoreactive protein of about 115 kDa by Western blot analysis with sera from B. henselae-immunized mice. Therefore the rSucB may be a candidate antigen for a specific serological diagnosis of B. henselae infection.

Analysis of DNA methylation in Arabidopsis thaliana based on methylation-sensitive AFLP markers.

PubMed

Cervera, M T; Ruiz-García, L; Martínez-Zapater, J M

2002-12-01

AFLP analysis using restriction enzyme isoschizomers that differ in their sensitivity to methylation of their recognition sites has been used to analyse the methylation state of anonymous CCGG sequences in Arabidopsis thaliana. The technique was modified to improve the quality of fingerprints and to visualise larger numbers of scorable fragments. Sequencing of amplified fragments indicated that detection was generally associated with non-methylation of the cytosine to which the isoschizomer is sensitive. Comparison of EcoRI/ HpaII and EcoRI/ MspI patterns in different ecotypes revealed that 35-43% of CCGG sites were differentially digested by the isoschizomers. Interestingly, the pattern of digestion among different plants belonging to the same ecotype is highly conserved, with the rate of intra-ecotype methylation-sensitive polymorphisms being less than 1%. However, pairwise comparisons of methylation patterns between samples belonging to different ecotypes revealed differences in up to 34% of the methylation-sensitive polymorphisms. The lack of correlation between inter-ecotype similarity matrices based on methylation-insensitive or methylation-sensitive polymorphisms suggests that whatever the mechanisms regulating methylation may be, they are not related to nucleotide sequence variation.

Interaction of the p85 subunit of PI 3-kinase and its N-terminal SH2 domain with a PDGF receptor phosphorylation site: structural features and analysis of conformational changes.

PubMed Central

Panayotou, G; Bax, B; Gout, I; Federwisch, M; Wroblowski, B; Dhand, R; Fry, M J; Blundell, T L; Wollmer, A; Waterfield, M D

1992-01-01

Circular dichroism and fluorescence spectroscopy were used to investigate the structure of the p85 alpha subunit of the PI 3-kinase, a closely related p85 beta protein, and a recombinant SH2 domain-containing fragment of p85 alpha. Significant spectral changes, indicative of a conformational change, were observed on formation of a complex with a 17 residue peptide containing a phosphorylated tyrosine residue. The sequence of this peptide is identical to the sequence surrounding Tyr751 in the kinase-insert region of the platelet-derived growth factor beta-receptor (beta PDGFR). The rotational correlation times measured by fluorescence anisotropy decay indicated that phosphopeptide binding changed the shape of the SH2 domain-containing fragment. The CD and fluorescence spectroscopy data support the secondary structure prediction based on sequence analysis and provide evidence for flexible linker regions between the various domains of the p85 proteins. The significance of these results for SH2 domain-containing proteins is discussed. Images PMID:1330535

The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans.

PubMed

Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

2015-07-20

Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Structure and inhibition analysis of the mouse SAD-B C-terminal fragment.

PubMed

Ma, Hui; Wu, Jing-Xiang; Wang, Jue; Wang, Zhi-Xin; Wu, Jia-Wei

2016-10-01

The SAD (synapses of amphids defective) kinases, including SAD-A and SAD-B, play important roles in the regulation of neuronal development, cell cycle, and energy metabolism. Our recent study of mouse SAD-A identified a unique autoinhibitory sequence (AIS), which binds at the junction of the kinase domain (KD) and the ubiquitin-associated (UBA) domain and exerts autoregulation in cooperation with UBA. Here, we report the crystal structure of the mouse SAD-B C-terminal fragment including the AIS and the kinase-associated domain 1 (KA1) at 2.8 Å resolution. The KA1 domain is structurally conserved, while the isolated AIS sequence is highly flexible and solvent-accessible. Our biochemical studies indicated that the SAD-B AIS exerts the same autoinhibitory role as that in SAD-A. We believe that the flexible isolated AIS sequence is readily available for interaction with KD-UBA and thus inhibits SAD-B activity.

Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing.

PubMed

Kanda, Kojun; Pflug, James M; Sproul, John S; Dasenko, Mark A; Maddison, David R

2015-01-01

In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced.

Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing

PubMed Central

Dasenko, Mark A.

2015-01-01

In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced. PMID:26716693

Binning of shallowly sampled metagenomic sequence fragments reveals that low abundance bacteria play important roles in sulfur cycling and degradation of complex organic polymers in an acid mine drainage community

NASA Astrophysics Data System (ADS)

Dick, G. J.; Andersson, A.; Banfield, J. F.

2007-12-01

Our understanding of environmental microbiology has been greatly enhanced by community genome sequencing of DNA recovered directly the environment. Community genomics provides insights into the diversity, community structure, metabolic function, and evolution of natural populations of uncultivated microbes, thereby revealing dynamics of how microorganisms interact with each other and their environment. Recent studies have demonstrated the potential for reconstructing near-complete genomes from natural environments while highlighting the challenges of analyzing community genomic sequence, especially from diverse environments. A major challenge of shotgun community genome sequencing is identification of DNA fragments from minor community members for which only low coverage of genomic sequence is present. We analyzed community genome sequence retrieved from biofilms in an acid mine drainage (AMD) system in the Richmond Mine at Iron Mountain, CA, with an emphasis on identification and assembly of DNA fragments from low-abundance community members. The Richmond mine hosts an extensive, relatively low diversity subterranean chemolithoautotrophic community that is sustained entirely by oxidative dissolution of pyrite. The activity of these microorganisms greatly accelerates the generation of AMD. Previous and ongoing work in our laboratory has focused on reconstrucing genomes of dominant community members, including several bacteria and archaea. We binned contigs from several samples (including one new sample and two that had been previously analyzed) by tetranucleotide frequency with clustering by Self-Organizing Maps (SOM). The binning, evaluated by comparison with information from the manually curated assembly of the dominant organisms, was found to be very effective: fragments were correctly assigned with 95% accuracy. Improperly assigned fragments often contained sequences that are either evolutionarily constrained (e.g. 16S rRNA genes) or mobile elements that are not expected to reflect the tetranucleotide frequency signature of the host genome. Four unknown tetranucleotide frequency clusters with significant sequence (6 Mb total) were noted and analyzed further. Based on phylogenetic markers and BLAST results, these clusters represent low abundance bacteria including Acintobacteria, Firmicutes, and Proteobacteria. Functional analysis of these clusters revealved that the low- abundance bacteria harbor genes that could potentially encode important ecosystem functions such as sulfur utilization (e.g. polysulfide reductase) and polymer degradation (e.g. chitinase and glycoside hydrolase). We conclude that ESOM clustering of tetranucleotide frequency patterns is an effective method for rapidly binning shotgun community genomic sequences and a valuable tool for analyzing minor community members, which despite their low abundance may play crucial ecological roles.

Structure and regulation of an archaebacterial promoter: An in vivo study. Progress report, August 1, 1991--March 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daniels, C.J.

1993-06-01

We have established that a 100 bp DNA fragment from the Haloferax volcanii tRNALys gene directs transcription in vivo. This element served as the starting point for a detailed analysis of the requirements for in vivo transcription. Among several gene tentatively identified as reporter elements, we selected a eukaryotic intron-containing tRNAPro gene for when it is driven by the H. volcanii tRNALys promoter fragment, produces a single small transcript. Transcript analysis, by Sl mapping and primer extension, showed that this RNA initiated at the expected tRNALys BoxB sequence and terminated in the tRNAPro RNA Pol III termination element present onmore » the DNA fragment. In initial studies we determined that the 3 inches proximal region of this tRNALys promoter element was sufficient for transcription initiation in vivo. This 40 bp region contains only the BoxA and BoxB regions and short purine rich regions 5 inches to the BoxA and BoxB sequence. Using the tRNAPro gene as the reporter and this minimal promoter, we performed a comprehensive analysis of the BoxA region. Each position of the BoxA region was converted to an four possible nucleotides and the transcription of 36 mutants was quantitated. Among the sites analyzed, only five of the positions showed high levels of discrimination; the preferred BoxA element was 5 inches-TT({sub T}/A)({sup A}/T) ANNNN-3 inches. Mutational analysis demonstrated that a transition from T-rich to A-rich sequences in the BoxA element is essential and that there is some flexibility in the location of the ``TA`` sequence. Additionally the TA sequence appears to determine the location of the transcription start site. The BoxA element defined in this study is similar to those observed for Sulfolobus and the methanogen promoters, and supports the hypothesis that a similar core promoter element is used by all archaeal RNA polymerases.« less

Systematic analysis of protein identity between Zika virus and other arthropod-borne viruses.

PubMed

Chang, Hsiao-Han; Huber, Roland G; Bond, Peter J; Grad, Yonatan H; Camerini, David; Maurer-Stroh, Sebastian; Lipsitch, Marc

2017-07-01

To analyse the proportions of protein identity between Zika virus and dengue, Japanese encephalitis, yellow fever, West Nile and chikungunya viruses as well as polymorphism between different Zika virus strains. We used published protein sequences for the Zika virus and obtained protein sequences for the other viruses from the National Center for Biotechnology Information (NCBI) protein database or the NCBI virus variation resource. We used BLASTP to find regions of identity between viruses. We quantified the identity between the Zika virus and each of the other viruses, as well as within-Zika virus polymorphism for all amino acid k -mers across the proteome, with k ranging from 6 to 100. We assessed accessibility of protein fragments by calculating the solvent accessible surface area for the envelope and nonstructural-1 (NS1) proteins. In total, we identified 294 Zika virus protein fragments with both low proportion of identity with other viruses and low levels of polymorphisms among Zika virus strains. The list includes protein fragments from all Zika virus proteins, except NS3. NS4A has the highest number (190 k -mers) of protein fragments on the list. We provide a candidate list of protein fragments that could be used when developing a sensitive and specific serological test to detect previous Zika virus infections.

Nitrous Oxide Reductase (nosZ) Gene Fragments Differ between Native and Cultivated Michigan Soils

PubMed Central

Stres, Blaž; Mahne, Ivan; Avguštin, Gorazd; Tiedje, James M.

2004-01-01

The effect of standard agricultural management on the genetic heterogeneity of nitrous oxide reductase (nosZ) fragments from denitrifying prokaryotes in native and cultivated soil was explored. Thirty-six soil cores were composited from each of the two soil management conditions. nosZ gene fragments were amplified from triplicate samples, and PCR products were cloned and screened by restriction fragment length polymorphism (RFLP). The total nosZ RFLP profiles increased in similarity with soil sample size until triplicate 3-g samples produced visually identical RFLP profiles for each treatment. Large differences in total nosZ profiles were observed between the native and cultivated soils. The fragments representing major groups of clones encountered at least twice and four randomly selected clones with unique RFLP patterns were sequenced to verify nosZ identity. The sequence diversity of nosZ clones from the cultivated field was higher, and only eight patterns were found in clone libraries from both soils among the 182 distinct nosZ RFLP patterns identified from the two soils. A group of clones that comprised 32% of all clones dominated the gene library of native soil, whereas many minor groups were observed in the gene library of cultivated soil. The 95% confidence intervals of the Chao1 nonparametric richness estimator for nosZ RFLP data did not overlap, indicating that the levels of species richness are significantly different in the two soils, the cultivated soil having higher diversity. Phylogenetic analysis of deduced amino acid sequences grouped the majority of nosZ clones into an interleaved Michigan soil cluster whose cultured members are α-Proteobacteria. Only four nosZ sequences from cultivated soil and one from the native soil were related to sequences found in γ-Proteobacteria. Sequences from the native field formed a distinct, closely related cluster (Dmean = 0.16) containing 91.6% of the native clones. Clones from the cultivated field were more distantly related to each other (Dmean = 0.26), and 65% were found outside of the cluster from the native soil, further indicating a difference in the two communities. Overall, there appears to be a relationship between use and richness, diversity, and the phylogenetic position of nosZ sequences, indicating that agricultural use of soil caused a shift to a more diverse denitrifying community. PMID:14711656

Multiple tag labeling method for DNA sequencing

DOEpatents

Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.

1995-01-01

A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

High-Resolution Genotyping of Streptococcus pyogenes Serotype M1 Isolates by Fluorescent Amplified-Fragment Length Polymorphism Analysis

PubMed Central

Desai, Meeta; Efstratiou, Androulla; George, Robert; Stanley, John

1999-01-01

We have used fluorescent amplified-fragment length polymorphism (FAFLP) analysis to subtype clinical isolates of Streptococcus pyogenes serotype M1. Established typing methods define most M1 isolates as members of a clone that has a worldwide distribution and that is strongly associated with invasive diseases. FAFLP analysis simultaneously sampled 90 to 120 loci throughout the M1 genome. Its discriminatory power, precision, and reproducibility were compared with those of other molecular typing methods. Irrespective of disease symptomatology or geographic origin, the majority of the clinical M1 isolates shared a single ribotype, pulsed-field gel electrophoresis macrorestriction profile, and emm1 gene sequence. Nonetheless, among these isolates, FAFLP analysis could differentiate 17 distinct profiles, including seven multi-isolate groups. The FAFLP profiles of M1 isolates reproducibly exhibited between 1 and more than 20 amplified fragment differences. The high discriminatory power of genotyping by FAFLP analysis revealed genetic microheterogeneity and differentiated otherwise “identical” M1 isolates as members of a clone complex. PMID:10325352

Fixing Formalin: A Method to Recover Genomic-Scale DNA Sequence Data from Formalin-Fixed Museum Specimens Using High-Throughput Sequencing

PubMed Central

Hykin, Sarah M.; Bi, Ke; McGuire, Jimmy A.

2015-01-01

For 150 years or more, specimens were routinely collected and deposited in natural history collections without preserving fresh tissue samples for genetic analysis. In the case of most herpetological specimens (i.e. amphibians and reptiles), attempts to extract and sequence DNA from formalin-fixed, ethanol-preserved specimens—particularly for use in phylogenetic analyses—has been laborious and largely ineffective due to the highly fragmented nature of the DNA. As a result, tens of thousands of specimens in herpetological collections have not been available for sequence-based phylogenetic studies. Massively parallel High-Throughput Sequencing methods and the associated bioinformatics, however, are particularly suited to recovering meaningful genetic markers from severely degraded/fragmented DNA sequences such as DNA damaged by formalin-fixation. In this study, we compared previously published DNA extraction methods on three tissue types subsampled from formalin-fixed specimens of Anolis carolinensis, followed by sequencing. Sufficient quality DNA was recovered from liver tissue, making this technique minimally destructive to museum specimens. Sequencing was only successful for the more recently collected specimen (collected ~30 ybp). We suspect this could be due either to the conditions of preservation and/or the amount of tissue used for extraction purposes. For the successfully sequenced sample, we found a high rate of base misincorporation. After rigorous trimming, we successfully mapped 27.93% of the cleaned reads to the reference genome, were able to reconstruct the complete mitochondrial genome, and recovered an accurate phylogenetic placement for our specimen. We conclude that the amount of DNA available, which can vary depending on specimen age and preservation conditions, will determine if sequencing will be successful. The technique described here will greatly improve the value of museum collections by making many formalin-fixed specimens available for genetic analysis. PMID:26505622

Fixing Formalin: A Method to Recover Genomic-Scale DNA Sequence Data from Formalin-Fixed Museum Specimens Using High-Throughput Sequencing.

PubMed

Hykin, Sarah M; Bi, Ke; McGuire, Jimmy A

2015-01-01

For 150 years or more, specimens were routinely collected and deposited in natural history collections without preserving fresh tissue samples for genetic analysis. In the case of most herpetological specimens (i.e. amphibians and reptiles), attempts to extract and sequence DNA from formalin-fixed, ethanol-preserved specimens-particularly for use in phylogenetic analyses-has been laborious and largely ineffective due to the highly fragmented nature of the DNA. As a result, tens of thousands of specimens in herpetological collections have not been available for sequence-based phylogenetic studies. Massively parallel High-Throughput Sequencing methods and the associated bioinformatics, however, are particularly suited to recovering meaningful genetic markers from severely degraded/fragmented DNA sequences such as DNA damaged by formalin-fixation. In this study, we compared previously published DNA extraction methods on three tissue types subsampled from formalin-fixed specimens of Anolis carolinensis, followed by sequencing. Sufficient quality DNA was recovered from liver tissue, making this technique minimally destructive to museum specimens. Sequencing was only successful for the more recently collected specimen (collected ~30 ybp). We suspect this could be due either to the conditions of preservation and/or the amount of tissue used for extraction purposes. For the successfully sequenced sample, we found a high rate of base misincorporation. After rigorous trimming, we successfully mapped 27.93% of the cleaned reads to the reference genome, were able to reconstruct the complete mitochondrial genome, and recovered an accurate phylogenetic placement for our specimen. We conclude that the amount of DNA available, which can vary depending on specimen age and preservation conditions, will determine if sequencing will be successful. The technique described here will greatly improve the value of museum collections by making many formalin-fixed specimens available for genetic analysis.

Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

PubMed Central

Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

2008-01-01

Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

Barcodes for genomes and applications

PubMed Central

Zhou, Fengfeng; Olman, Victor; Xu, Ying

2008-01-01

Background Each genome has a stable distribution of the combined frequency for each k-mer and its reverse complement measured in sequence fragments as short as 1000 bps across the whole genome, for 1

Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene.

PubMed

Wang, Wenbing; Zhu, Shanying; Wang, Liqun; Yu, Feng; Shen, Weide

2005-12-01

Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1,530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, W.M.; Sylvester, J.E.

1994-09-01

In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less

Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

PubMed Central

Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

2000-01-01

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

PubMed

Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

2012-04-01

Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

Dissociation Behavior of a TEMPO-Active Ester Cross-Linker for Peptide Structure Analysis by Free Radical Initiated Peptide Sequencing (FRIPS) in Negative ESI-MS.

PubMed

Hage, Christoph; Ihling, Christian H; Götze, Michael; Schäfer, Mathias; Sinz, Andrea

2017-01-01

We have synthesized a homobifunctional amine-reactive cross-linking reagent, containing a TEMPO (2,2,6,6-tetramethylpiperidine-1-oxy) and a benzyl group (Bz), termed TEMPO-Bz-linker, to derive three-dimensional structural information of proteins. The aim for designing this novel cross-linker was to facilitate the mass spectrometric analysis of cross-linked products by free radical initiated peptide sequencing (FRIPS). In an initial study, we had investigated the fragmentation behavior of TEMPO-Bz-derivatized peptides upon collision activation in (+)-electrospray ionization collision-induced dissociation tandem mass spectrometry (ESI-CID-MS/MS) experiments. In addition to the homolytic NO-C bond cleavage FRIPS pathway delivering the desired odd-electron product ions, an alternative heterolytic NO-C bond cleavage, resulting in even-electron product ions mechanism was found to be relevant. The latter fragmentation route clearly depends on the protonation of the TEMPO-Bz-moiety itself, which motivated us to conduct (-)-ESI-MS, CID-MS/MS, and MS 3 experiments of TEMPO-Bz-cross-linked peptides to further clarify the fragmentation behavior of TEMPO-Bz-peptide molecular ions. We show that the TEMPO-Bz-linker is highly beneficial for conducting FRIPS in negative ionization mode as the desired homolytic cleavage of the NO-C bond is the major fragmentation pathway. Based on characteristic fragments, the isomeric amino acids leucine and isoleucine could be discriminated. Interestingly, we observed pronounced amino acid side chain losses in cross-linked peptides if the cross-linked peptides contain a high number of acidic amino acids. Graphical Abstract ᅟ.

Multiple tag labeling method for DNA sequencing

DOEpatents

Mathies, R.A.; Huang, X.C.; Quesada, M.A.

1995-07-25

A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

Common Amino Acid Subsequences in a Universal Proteome—Relevance for Food Science

PubMed Central

Minkiewicz, Piotr; Darewicz, Małgorzata; Iwaniak, Anna; Sokołowska, Jolanta; Starowicz, Piotr; Bucholska, Justyna; Hrynkiewicz, Monika

2015-01-01

A common subsequence is a fragment of the amino acid chain that occurs in more than one protein. Common subsequences may be an object of interest for food scientists as biologically active peptides, epitopes, and/or protein markers that are used in comparative proteomics. An individual bioactive fragment, in particular the shortest fragment containing two or three amino acid residues, may occur in many protein sequences. An individual linear epitope may also be present in multiple sequences of precursor proteins. Although recent recommendations for prediction of allergenicity and cross-reactivity include not only sequence identity, but also similarities in secondary and tertiary structures surrounding the common fragment, local sequence identity may be used to screen protein sequence databases for potential allergens in silico. The main weakness of the screening process is that it overlooks allergens and cross-reactivity cases without identical fragments corresponding to linear epitopes. A single peptide may also serve as a marker of a group of allergens that belong to the same family and, possibly, reveal cross-reactivity. This review article discusses the benefits for food scientists that follow from the common subsequences concept. PMID:26340620

Re-sequencing regions of the ovine Y chromosome in domestic and wild sheep reveals novel paternal haplotypes.

PubMed

Meadows, J R S; Kijas, J W

2009-02-01

The male-specific region of the ovine Y chromosome (MSY) remains poorly characterized, yet sequence variants from this region have the potential to reveal the wild progenitor of domestic sheep or examples of domestic and wild paternal introgression. The 5' promoter region of the sex-determining gene SRY was re-sequenced using a subset of wild sheep including bighorn (Ovis canadensis), thinhorn (Ovis dalli spp.), urial (Ovis vignei), argali (Ovis ammon), mouflon (Ovis musimon) and domestic sheep (Ovis aries). Seven novel SNPs (oY2-oY8) were revealed; these were polymorphic between but not within species. Re-sequencing and fragment analysis was applied to the MSY microsatellite SRYM18. It contains a complex compound repeat structure and sequencing of three novel size fragments revealed that a pentanucleotide element remained fixed, whilst a dinucleotide element displayed variability within species. Comparison of the sequence between species revealed that urial and argali sheep grouped more closely to the mouflon and domestic breeds than the pachyceriforms (bighorn and thinhorn). SNP and microsatellite data were combined to define six previously undetected haplotypes. Analysis revealed the mouflon as the only species to share a haplotype with domestic sheep, consistent with its status as a feral domesticate that has undergone male-mediated exchange with domestic animals. A comparison of the remaining wild species and domestic sheep revealed that O. aries is free from signatures of wild sheep introgression.

Cingulin Contains Globular and Coiled-Coil Domains and Interacts with Zo-1, Zo-2, Zo-3, and Myosin

PubMed Central

Cordenonsi, Michelangelo; D'Atri, Fabio; Hammar, Eva; Parry, David A.D.; Kendrick-Jones, John; Shore, David; Citi, Sandra

1999-01-01

We characterized the sequence and protein interactions of cingulin, an M r 140–160-kD phosphoprotein localized on the cytoplasmic surface of epithelial tight junctions (TJ). The derived amino acid sequence of a full-length Xenopus laevis cingulin cDNA shows globular head (residues 1–439) and tail (1,326–1,368) domains and a central α-helical rod domain (440–1,325). Sequence analysis, electron microscopy, and pull-down assays indicate that the cingulin rod is responsible for the formation of coiled-coil parallel dimers, which can further aggregate through intermolecular interactions. Pull-down assays from epithelial, insect cell, and reticulocyte lysates show that an NH2-terminal fragment of cingulin (1–378) interacts in vitro with ZO-1 (K d ∼5 nM), ZO-2, ZO-3, myosin, and AF-6, but not with symplekin, and a COOH-terminal fragment (377–1,368) interacts with myosin and ZO-3. ZO-1 and ZO-2 immunoprecipitates contain cingulin, suggesting in vivo interactions. Full-length cingulin, but not NH2-terminal and COOH-terminal fragments, colocalizes with endogenous cingulin in transfected MDCK cells, indicating that sequences within both head and rod domains are required for TJ localization. We propose that cingulin is a functionally important component of TJ, linking the submembrane plaque domain of TJ to the actomyosin cytoskeleton. PMID:10613913

Sequencing the cap-snatching repertoire of H1N1 influenza provides insight into the mechanism of viral transcription initiation

PubMed Central

Koppstein, David; Ashour, Joseph; Bartel, David P.

2015-01-01

The influenza polymerase cleaves host RNAs ∼10–13 nucleotides downstream of their 5′ ends and uses this capped fragment to prime viral mRNA synthesis. To better understand this process of cap snatching, we used high-throughput sequencing to determine the 5′ ends of A/WSN/33 (H1N1) influenza mRNAs. The sequences provided clear evidence for nascent-chain realignment during transcription initiation and revealed a strong influence of the viral template on the frequency of realignment. After accounting for the extra nucleotides inserted through realignment, analysis of the capped fragments indicated that the different viral mRNAs were each prepended with a common set of sequences and that the polymerase often cleaved host RNAs after a purine and often primed transcription on a single base pair to either the terminal or penultimate residue of the viral template. We also developed a bioinformatic approach to identify the targeted host transcripts despite limited information content within snatched fragments and found that small nuclear RNAs and small nucleolar RNAs contributed the most abundant capped leaders. These results provide insight into the mechanism of viral transcription initiation and reveal the diversity of the cap-snatched repertoire, showing that noncoding transcripts as well as mRNAs are used to make influenza mRNAs. PMID:25901029

Mitochondrial DNA diagnosis for taeniasis and cysticercosis.

PubMed

Yamasaki, Hiroshi; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Sato, Marcello Otake; Ito, Akira

2006-01-01

Molecular diagnosis for taeniasis and cysticercosis in humans on the basis of mitochondrial DNA analysis was reviewed. Development and application of three different methods, including restriction fragment length polymorphism analysis, base excision sequence scanning thymine-base analysis and multiplex PCR, were described. Moreover, molecular diagnosis of cysticerci found in specimens submitted for histopathology and the molecular detection of taeniasis using copro-DNA were discussed.

Total Extracellular Small RNA Profiles from Plasma, Saliva, and Urine of Healthy Subjects

PubMed Central

Yeri, Ashish; Courtright, Amanda; Reiman, Rebecca; Carlson, Elizabeth; Beecroft, Taylor; Janss, Alex; Siniard, Ashley; Richholt, Ryan; Balak, Chris; Rozowsky, Joel; Kitchen, Robert; Hutchins, Elizabeth; Winarta, Joseph; McCoy, Roger; Anastasi, Matthew; Kim, Seungchan; Huentelman, Matthew; Van Keuren-Jensen, Kendall

2017-01-01

Interest in circulating RNAs for monitoring and diagnosing human health has grown significantly. There are few datasets describing baseline expression levels for total cell-free circulating RNA from healthy control subjects. In this study, total extracellular RNA (exRNA) was isolated and sequenced from 183 plasma samples, 204 urine samples and 46 saliva samples from 55 male college athletes ages 18–25 years. Many participants provided more than one sample, allowing us to investigate variability in an individual’s exRNA expression levels over time. Here we provide a systematic analysis of small exRNAs present in each biofluid, as well as an analysis of exogenous RNAs. The small RNA profile of each biofluid is distinct. We find that a large number of RNA fragments in plasma (63%) and urine (54%) have sequences that are assigned to YRNA and tRNA fragments respectively. Surprisingly, while many miRNAs can be detected, there are few miRNAs that are consistently detected in all samples from a single biofluid, and profiles of miRNA are different for each biofluid. Not unexpectedly, saliva samples have high levels of exogenous sequence that can be traced to bacteria. These data significantly contribute to the current number of sequenced exRNA samples from normal healthy individuals. PMID:28303895

LESSONS IN DE NOVO PEPTIDE SEQUENCING BY TANDEM MASS SPECTROMETRY

PubMed Central

Medzihradszky, Katalin F.; Chalkley, Robert J.

2015-01-01

Mass spectrometry has become the method of choice for the qualitative and quantitative characterization of protein mixtures isolated from all kinds of living organisms. The raw data in these studies are MS/MS spectra, usually of peptides produced by proteolytic digestion of a protein. These spectra are “translated” into peptide sequences, normally with the help of various search engines. Data acquisition and interpretation have both been automated, and most researchers look only at the summary of the identifications without ever viewing the underlying raw data used for assignments. Automated analysis of data is essential due to the volume produced. However, being familiar with the finer intricacies of peptide fragmentation processes, and experiencing the difficulties of manual data interpretation allow a researcher to be able to more critically evaluate key results, particularly because there are many known rules of peptide fragmentation that are not incorporated into search engine scoring. Since the most commonly used MS/MS activation method is collision-induced dissociation (CID), in this article we present a brief review of the history of peptide CID analysis. Next, we provide a detailed tutorial on how to determine peptide sequences from CID data. Although the focus of the tutorial is de novo sequencing, the lessons learned and resources supplied are useful for data interpretation in general. PMID:25667941

Ammonium sulfate and MALDI in-source decay: a winning combination for sequencing peptides

PubMed Central

Delvolve, Alice; Woods, Amina S.

2009-01-01

In previous papers we highlighted the role of ammonium sulfate in increasing peptide fragmentation by in source decay (ISD). The current work systematically investigated effects of MALDI extraction delay, peptide amino acid composition, matrix and ammonium sulfate concentration on peptides ISD fragmentation. The data confirmed that ammonium sulfate increased peptides signal to noise ratio as well as their in source fragmentation resulting in complete sequence coverage regardless of the amino acid composition. This method is easy, inexpensive and generates the peptides sequence instantly. PMID:19877641

Human scFv antibody fragments specific for hepatocellular carcinoma selected from a phage display library.

PubMed

Yu, Bing; Ni, Ming; Li, Wen-Han; Lei, Ping; Xing, Wei; Xiao, Dai-Wen; Huang, Yu; Tang, Zhen-Jie; Zhu, Hui-Fen; Shen, Guan-Xin

2005-07-14

To identify the scFv antibody fragments specific for hepatocellular carcinoma by biopanning from a large human naive scFv phage display library. A large human naive scFv phage library was used to search for the specific targets by biopanning with the hepatocellular carcinoma cell line HepG2 for the positive-selecting and the normal liver cell line L02 for the counter-selecting. After three rounds of biopanning, individual scFv phages binding selectively to HepG2 cells were picked out. PCR was carried out for identification of the clones containing scFv gene sequence. The specific scFv phages were selected by ELISA and flow cytometry. DNA sequences of positive clones were analyzed by using Applied Biosystem Automated DNA sequencers 3 730. The expression proteins of the specific scFv antibody fragments in E.coli HB2151 were purified by the affinity chromatography and detected by SDS-PAGE, Western blot and ELISA. The biological effect of the soluble antibody fragments on the HepG2 cells was investigated by observing the cell proliferation. Two different positive clones were obtained and the functional variable sequences were identified. Their DNA sequences of the scFv antibody fragments were submitted to GenBank (accession nos: AY686498 and AY686499). The soluble scFv antibody fragments were successfully expressed in E.coli HB2151. The relative molecular mass of the expression products was about 36 ku, according to its predicted M(r) value. The two soluble scFv antibody fragments also had specific binding activity and obvious growth inhibition properties to HepG2 cells. The phage library biopanning permits identification of specific antibody fragments for hepatocellular carcinoma and affords experiment evidence for its immunotherapy study.

Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): Taxonomic implications for the Great Lakes species flock

USGS Publications Warehouse

Reed, Kent M.; Dorschner, Michael O.; Todd, Thomas N.; Phillips, Ruth B.

1998-01-01

Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens ofC. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

Cloning, Sequencing, and Characterization of the cgmB Gene of Sinorhizobium meliloti Involved in Cyclic β-Glucan Biosynthesis

PubMed Central

Wang, Ping; Ingram-Smith, Cheryl; Hadley, Jill A.; Miller, Karen J.

1999-01-01

Periplasmic cyclic β-glucans of Rhizobium species provide important functions during plant infection and hypo-osmotic adaptation. In Sinorhizobium meliloti (also known as Rhizobium meliloti), these molecules are highly modified with phosphoglycerol and succinyl substituents. We have previously identified an S. meliloti Tn5 insertion mutant, S9, which is specifically impaired in its ability to transfer phosphoglycerol substituents to the cyclic β-glucan backbone (M. W. Breedveld, J. A. Hadley, and K. J. Miller, J. Bacteriol. 177:6346–6351, 1995). In the present study, we have cloned, sequenced, and characterized this mutation at the molecular level. By using the Tn5 flanking sequences (amplified by inverse PCR) as a probe, an S. meliloti genomic library was screened, and two overlapping cosmid clones which functionally complement S9 were isolated. A 3.1-kb HindIII-EcoRI fragment found in both cosmids was shown to fully complement mutant S9. Furthermore, when a plasmid containing this 3.1-kb fragment was used to transform Rhizobium leguminosarum bv. trifolii TA-1JH, a strain which normally synthesizes only neutral cyclic β-glucans, anionic glucans containing phosphoglycerol substituents were produced, consistent with the functional expression of an S. meliloti phosphoglycerol transferase gene. Sequence analysis revealed the presence of two major, overlapping open reading frames within the 3.1-kb fragment. Primer extension analysis revealed that one of these open reading frames, ORF1, was transcribed and its transcription was osmotically regulated. This novel locus of S. meliloti is designated the cgm (cyclic glucan modification) locus, and the product encoded by ORF1 is referred to as CgmB. PMID:10419956

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

PubMed

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

PubMed

Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

2008-10-13

cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

Partial De Novo Sequencing and Unusual CID Fragmentation of a 7 kDa, Disulfide-Bridged Toxin

NASA Astrophysics Data System (ADS)

Medzihradszky, Katalin F.; Bohlen, Christopher J.

2012-05-01

A 7 kDa toxin isolated from the venom of the Texas coral snake ( Micrurus tener tener) was subjected to collision-induced dissociation (CID) and electron-transfer dissociation (ETD) analyses both before and after reduction at low pH. Manual and automated approaches to de novo sequencing are compared in detail. Manual de novo sequencing utilizing the combination of high accuracy CID and ETD data and an acid-related cleavage yielded the N-terminal half of the sequence from the reduced species. The intact polypeptide, containing 3 disulfide bridges produced a series of unusual fragments in ion trap CID experiments: abundant internal amino acid losses were detected, and also one of the disulfide-linkage positions could be determined from fragments formed by the cleavage of two bonds. In addition, internal and c-type fragments were also observed.

Use of CID/ETD Mass Spectrometry to Analyze Glycopeptides

PubMed Central

Mechref, Yehia

2013-01-01

Collision-induced dissociation (CID) tandem mass spectrometry (MS) does not allow the characterization of glycopeptides because of the fragmentation of their glycan structures and limited fragmentation of peptide backbones. Electron-transfer dissociation (ETD) tandem MS, on the other hand, offers an alternative approach allowing the fragmentation of only peptide backbones of glycopeptides. Characterization of glycopeptides using both CID and ETD is summarized in this unit. While CID provide information related to the composition of glycan moiety attached to a peptide backbone, ETD permits de novo sequencing of peptides, since it prompts only peptide backbone fragmentation while keeping posttranslational modifications intact. Radical anions transfer of electrons to peptide backbone which induces cleavage of the N-Cα bond is observed in ETD. The glycan moiety is retained on the peptide backbone, largely unaffected by the ETD process. Accordingly, ETD allows not only the identification of the amino acid sequence of a glycopeptide, but also the unambiguous assignment of its glycosylation site. When data acquired from both fragmentation techniques are combined, it is possible to characterize comprehensively the entire glycopeptide. This is achieved using an instrument capable of alternating between CID and ETD experiments during an LC-MS/MS analysis. This unit discusses the different fragmentation of glycopeptides observed in CID and ETD. Tables of residue masses associated with oxonium ions observed in CID are provided to help in the interpretation of CID mass spectra. The utility of both CID and ETD for better characterization of glycopeptides are demonstrated for a model glycoprotein. PMID:22470127

A computational method for estimating the PCR duplication rate in DNA and RNA-seq experiments.

PubMed

Bansal, Vikas

2017-03-14

PCR amplification is an important step in the preparation of DNA sequencing libraries prior to high-throughput sequencing. PCR amplification introduces redundant reads in the sequence data and estimating the PCR duplication rate is important to assess the frequency of such reads. Existing computational methods do not distinguish PCR duplicates from "natural" read duplicates that represent independent DNA fragments and therefore, over-estimate the PCR duplication rate for DNA-seq and RNA-seq experiments. In this paper, we present a computational method to estimate the average PCR duplication rate of high-throughput sequence datasets that accounts for natural read duplicates by leveraging heterozygous variants in an individual genome. Analysis of simulated data and exome sequence data from the 1000 Genomes project demonstrated that our method can accurately estimate the PCR duplication rate on paired-end as well as single-end read datasets which contain a high proportion of natural read duplicates. Further, analysis of exome datasets prepared using the Nextera library preparation method indicated that 45-50% of read duplicates correspond to natural read duplicates likely due to fragmentation bias. Finally, analysis of RNA-seq datasets from individuals in the 1000 Genomes project demonstrated that 70-95% of read duplicates observed in such datasets correspond to natural duplicates sampled from genes with high expression and identified outlier samples with a 2-fold greater PCR duplication rate than other samples. The method described here is a useful tool for estimating the PCR duplication rate of high-throughput sequence datasets and for assessing the fraction of read duplicates that correspond to natural read duplicates. An implementation of the method is available at https://github.com/vibansal/PCRduplicates .

Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

PubMed Central

Eriani, G; Dirheimer, G; Gangloff, J

1989-01-01

The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

Pyrin gene and mutants thereof, which cause familial Mediterranean fever

DOEpatents

Kastner, Daniel L [Bethesda, MD; Aksentijevichh, Ivona [Bethesda, MD; Centola, Michael [Tacoma Park, MD; Deng, Zuoming [Gaithersburg, MD; Sood, Ramen [Rockville, MD; Collins, Francis S [Rockville, MD; Blake, Trevor [Laytonsville, MD; Liu, P Paul [Ellicott City, MD; Fischel-Ghodsian, Nathan [Los Angeles, CA; Gumucio, Deborah L [Ann Arbor, MI; Richards, Robert I [North Adelaide, AU; Ricke, Darrell O [San Diego, CA; Doggett, Norman A [Santa Cruz, NM; Pras, Mordechai [Tel-Hashomer, IL

2003-09-30

The invention provides the nucleic acid sequence encoding the protein associated with familial Mediterranean fever (FMF). The cDNA sequence is designated as MEFV. The invention is also directed towards fragments of the DNA sequence, as well as the corresponding sequence for the RNA transcript and fragments thereof. Another aspect of the invention provides the amino acid sequence for a protein (pyrin) associated with FMF. The invention is directed towards both the full length amino acid sequence, fusion proteins containing the amino acid sequence and fragments thereof. The invention is also directed towards mutants of the nucleic acid and amino acid sequences associated with FMF. In particular, the invention discloses three missense mutations, clustered in within about 40 to 50 amino acids, in the highly conserved rfp (B30.2) domain at the C-terminal of the protein. These mutants include M6801, M694V, K695R, and V726A. Additionally, the invention includes methods for diagnosing a patient at risk for having FMF and kits therefor.

MHC class II B diversity in blue tits: a preliminary study.

PubMed

Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

2013-07-01

In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4-7 fragments, indicating a minimum number of 2-4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date.

MHC class II B diversity in blue tits: a preliminary study

PubMed Central

Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

2013-01-01

In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4–7 fragments, indicating a minimum number of 2–4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date. PMID:23919136

Annotation of differentially expressed genes in the somatic embryogenesis of musa and their location in the banana genome.

PubMed

Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-Graciamedrano, Rosa Maria

2013-01-01

Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100-4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Identifying different transcribed proteins in the newly described Theraphosidae Pamphobeteus verdolaga.

PubMed

Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos

2017-04-01

Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Web-Based Phylogenetic Assignment Tool for Analysis of Terminal Restriction Fragment Length Polymorphism Profiles of Microbial Communities

PubMed Central

Kent, Angela D.; Smith, Dan J.; Benson, Barbara J.; Triplett, Eric W.

2003-01-01

Culture-independent DNA fingerprints are commonly used to assess the diversity of a microbial community. However, relating species composition to community profiles produced by community fingerprint methods is not straightforward. Terminal restriction fragment length polymorphism (T-RFLP) is a community fingerprint method in which phylogenetic assignments may be inferred from the terminal restriction fragment (T-RF) sizes through the use of web-based resources that predict T-RF sizes for known bacteria. The process quickly becomes computationally intensive due to the need to analyze profiles produced by multiple restriction digests and the complexity of profiles generated by natural microbial communities. A web-based tool is described here that rapidly generates phylogenetic assignments from submitted community T-RFLP profiles based on a database of fragments produced by known 16S rRNA gene sequences. Users have the option of submitting a customized database generated from unpublished sequences or from a gene other than the 16S rRNA gene. This phylogenetic assignment tool allows users to employ T-RFLP to simultaneously analyze microbial community diversity and species composition. An analysis of the variability of bacterial species composition throughout the water column in a humic lake was carried out to demonstrate the functionality of the phylogenetic assignment tool. This method was validated by comparing the results generated by this program with results from a 16S rRNA gene clone library. PMID:14602639

Diversity and abundance of nitrate assimilation genes in the northern South china sea.

PubMed

Cai, Haiyuan; Jiao, Nianzhi

2008-11-01

Marine heterotrophic microorganisms that assimilate nitrate play an important role in nitrogen and carbon cycling in the water column. The nasA gene, encoding the nitrate assimilation enzyme, was selected as a functional marker to examine the nitrate assimilation community in the South China Sea (SCS). PCR amplification, restriction fragment length polymorphism (RFLP) screening, and phylogenetic analysis of nasA gene sequences were performed to characterize in situ nitrate assimilatory bacteria. Furthermore, the effects of nutrients and other environmental factors on the genetic heterogeneity of nasA fragments from the SCS were evaluated at the surface in three stations, and at two other depths in one of these stations. The diversity indices and rarefaction curves indicated that the nasA gene was more diverse in offshore waters than in the Pearl River estuary. The phylotype rank abundance curve showed an abundant and unique RFLP pattern in all five libraries, indicating that a high diversity but low abundance of nasA existed in the study areas. Phylogenetic analysis of environmental nasA gene sequences further revealed that the nasA gene fragments came from several common aquatic microbial groups, including the Proteobacteria, Cytophaga-Flavobacteria (CF), and Cyanobacteria. In addition to the direct PCR/sequence analysis of environmental samples, we also cultured a number of nitrate assimilatory bacteria isolated from the field. Comparison of nasA genes from these isolates and from the field samples indicated the existence of horizontal nasA gene transfer. Application of real-time quantitative PCR to these nasA genes revealed a great variation in their abundance at different investigation sites and water depths.

Human jagged polypeptide, encoding nucleic acids and methods of use

DOEpatents

Li, Linheng; Hood, Leroy

2000-01-01

The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

Methods of diagnosing alagille syndrome

DOEpatents

Li, Linheng; Hood, Leroy; Krantz, Ian D.; Spinner, Nancy B.

2004-03-09

The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, O.; Masters, C.; Lewis, M.B.

1994-09-01

In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila

PubMed Central

Saveliev, Sergei V.; Cox, Michael M.

2001-01-01

DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15–16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form. PMID:11406601

Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila.

PubMed

Saveliev, S V; Cox, M M

2001-06-15

DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15-16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form.

Detection and Analysis of Six Lizard Adenoviruses by Consensus Primer PCR Provides Further Evidence of a Reptilian Origin for the Atadenoviruses

PubMed Central

Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.

2004-01-01

A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689

Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses.

PubMed

Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R

2004-12-01

A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

Homology-based Modeling of Rhodopsin-like Family Members in the Inactive State: Structural Analysis and Deduction of Tips for Modeling and Optimization.

PubMed

Pappalardo, Matteo; Rayan, Mahmoud; Abu-Lafi, Saleh; Leonardi, Martha E; Milardi, Danilo; Guccione, Salvatore; Rayan, Anwar

2017-08-01

Modeling G-Protein Coupled Receptors (GPCRs) is an emergent field of research, since utility of high-quality models in receptor structure-based strategies might facilitate the discovery of interesting drug candidates. The findings from a quantitative analysis of eighteen resolved structures of rhodopsin family "A" receptors crystallized with antagonists and 153 pairs of structures are described. A strategy termed endeca-amino acids fragmentation was used to analyze the structures models aiming to detect the relationship between sequence identity and Root Mean Square Deviation (RMSD) at each trans-membrane-domain. Moreover, we have applied the leave-one-out strategy to study the shiftiness likelihood of the helices. The type of correlation between sequence identity and RMSD was studied using the aforementioned set receptors as representatives of membrane proteins and 98 serine proteases with 4753 pairs of structures as representatives of globular proteins. Data analysis using fragmentation strategy revealed that there is some extent of correlation between sequence identity and global RMSD of 11AA width windows. However, spatial conservation is not always close to the endoplasmic side as was reported before. A comparative study with globular proteins shows that GPCRs have higher standard deviation and higher slope in the graph with correlation between sequence identity and RMSD. The extracted information disclosed in this paper could be incorporated in the modeling protocols while using technique for model optimization and refinement. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fragment-based prediction of skin sensitization using recursive partitioning

NASA Astrophysics Data System (ADS)

Lu, Jing; Zheng, Mingyue; Wang, Yong; Shen, Qiancheng; Luo, Xiaomin; Jiang, Hualiang; Chen, Kaixian

2011-09-01

Skin sensitization is an important toxic endpoint in the risk assessment of chemicals. In this paper, structure-activity relationships analysis was performed on the skin sensitization potential of 357 compounds with local lymph node assay data. Structural fragments were extracted by GASTON (GrAph/Sequence/Tree extractiON) from the training set. Eight fragments with accuracy significantly higher than 0.73 ( p < 0.1) were retained to make up an indicator descriptor fragment. The fragment descriptor and eight other physicochemical descriptors closely related to the endpoint were calculated to construct the recursive partitioning tree (RP tree) for classification. The balanced accuracy of the training set, test set I, and test set II in the leave-one-out model were 0.846, 0.800, and 0.809, respectively. The results highlight that fragment-based RP tree is a preferable method for identifying skin sensitizers. Moreover, the selected fragments provide useful structural information for exploring sensitization mechanisms, and RP tree creates a graphic tree to identify the most important properties associated with skin sensitization. They can provide some guidance for designing of drugs with lower sensitization level.

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

1992-01-01

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

1992-05-12

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

Genetic characterization of Pompeii and Herculaneum Equidae buried by Vesuvius in 79 AD.

PubMed

Di Bernardo, G; Galderisi, U; Del Gaudio, S; D'Aniello, A; Lanave, C; De Robertis, M T; Cascino, Antonino; Cipollaro, M

2004-05-01

DNA extracted from the skeletons of five equids discovered in a Pompeii stable and of a horse found in Herculaneum was investigated. Amino acid racemization level was consistent with the presence of DNA. Post-mortem base modifications were excluded by sequencing a 146 bp fragment of the 16S rRNA mitochondrial gene. Sequencing of a 370 bp fragment of mitochondrial (mt)DNA control region allowed the construction of a phylogenetic tree that, along with sequencing of nuclear genes (epsilon globin, gamma interferon, and p53) fragments, gave us the possibility to address some questions puzzling archaeologists. What animals-donkeys, horses, or crossbreeds-were they? And, given they had been evidently assigned to one specific job, were they all akin or were they animals with different mitochondrial haplotypes? The conclusions provided by molecular analysis show that the Pompeii remains are those of horses and mules. Furthermore one of the equids (CAV5) seems to belong to a haplotype, which is either not yet documented in the GenBank or has since disappeared. As its characteristics closely recall those of donkeys, which is the out group chosen to construct the tree, that appears to have evolved within the Equidae family much earlier than horses, this assumption seems to be nearer the truth.

Identification of the regulatory autophosphorylation site of autophosphorylation-dependent protein kinase (auto-kinase). Evidence that auto-kinase belongs to a member of the p21-activated kinase family.

PubMed

Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D

1998-08-15

Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2.

Identification of the regulatory autophosphorylation site of autophosphorylation-dependent protein kinase (auto-kinase). Evidence that auto-kinase belongs to a member of the p21-activated kinase family.

PubMed Central

Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D

1998-01-01

Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2. PMID:9693111

Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

PubMed

Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

2017-01-01

Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

Spatial analysis of extension fracture systems: A process modeling approach

USGS Publications Warehouse

Ferguson, C.C.

1985-01-01

Little consensus exists on how best to analyze natural fracture spacings and their sequences. Field measurements and analyses published in geotechnical literature imply fracture processes radically different from those assumed by theoretical structural geologists. The approach adopted in this paper recognizes that disruption of rock layers by layer-parallel extension results in two spacing distributions, one representing layer-fragment lengths and another separation distances between fragments. These two distributions and their sequences reflect mechanics and history of fracture and separation. Such distributions and sequences, represented by a 2 ?? n matrix of lengthsL, can be analyzed using a method that is history sensitive and which yields also a scalar estimate of bulk extension, e (L). The method is illustrated by a series of Monte Carlo experiments representing a variety of fracture-and-separation processes, each with distinct implications for extension history. Resulting distributions of e (L)are process-specific, suggesting that the inverse problem of deducing fracture-and-separation history from final structure may be tractable. ?? 1985 Plenum Publishing Corporation.

Cloning and expression analysis of a new anther-specific gene CaMF4 in Capsicum annuum.

PubMed

Hao, Xuefeng; Chen, Changming; Chen, Guoju; Cao, Bihao; Lei, Jianjun

2017-03-01

Our previous study on the genic male sterile-fertile line 114AB of Capsicum annuum indicated a diversity of differentially expressed cDNA fragments in fertile and sterile lines. In this study, a transcript-derived fragment (TDF), male fertile 4 (CaMF4) was chosen for further investigation to observe that this specific fragment accumulates in the flower buds of the fertile line. The full genomic DNA sequence of CaMF4 was 894 bp in length, containing two exons and one intron, and the complete coding sequence encoded a putative 11.53 kDa protein of 109 amino acids. The derived protein of CaMF4 shared similarity with the members of PGPS/D3 protein family. The expression of CaMF4 was detected in both the flower buds at stage 8 and open flowers of the male fertile line. In contrast to this observation, expression of CaMF4 was not detected in any organs of the male sterile line. Further analysis revealed that CaMF4 was expressed particularly in anthers of the fertile line. Our results suggest that CaMF4 is an anther-specific gene and might be indispensable for anther or pollen development in C. annuum.

Chromosomal localization and sequence analysis of a human episomal sequence with in vitro differentiating activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boccaccio, C.; Deshatrette, J.; Meunier-Rotival, M.

1994-05-01

The genomic fragment carrying the human activator of liver function, previously described as an episome capable of inducing differentiation upon transfection into a dedifferentiated rat hepatoma cell line, was mapped on human chromosome 12q24.2-12q24.3. This chromosomal location was indistinguishable by in situ hybridization from that of the gene coding for the hepatic transcription factor HNF1. The sequence of the integrated form of the episome as well as its flanking sequences show that it is rich in retroposons. It contains a human ribosomal protein L21 processed pseudogene, one truncated L1Hs sequence, and 10 Alu repeats, which belong to different subfamilies.

Open reading frames in a 4556 nucleotide sequence within MDV-1 BamHI-D DNA fragment: evidence for splicing of mRNA from a new viral glycoprotein gene.

PubMed

Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M

1994-01-01

A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.

Integrated Bottom-Up and Top-Down Liquid Chromatography-Mass Spectrometry for Characterization of Recombinant Human Growth Hormone Degradation Products.

PubMed

Wang, Yu Annie; Wu, Di; Auclair, Jared R; Salisbury, Joseph P; Sarin, Richa; Tang, Yang; Mozdzierz, Nicholas J; Shah, Kartik; Zhang, Anna Fan; Wu, Shiaw-Lin; Agar, Jeffery N; Love, J Christopher; Love, Kerry R; Hancock, William S

2017-12-05

With the advent of biosimilars to the U.S. market, it is important to have better analytical tools to ensure product quality from batch to batch. In addition, the recent popularity of using a continuous process for production of biopharmaceuticals, the traditional bottom-up method, alone for product characterization and quality analysis is no longer sufficient. Bottom-up method requires large amounts of material for analysis and is labor-intensive and time-consuming. Additionally, in this analysis, digestion of the protein with enzymes such as trypsin could induce artifacts and modifications which would increase the complexity of the analysis. On the other hand, a top-down method requires a minimum amount of sample and allows for analysis of the intact protein mass and sequence generated from fragmentation within the instrument. However, fragmentation usually occurs at the N-terminal and C-terminal ends of the protein with less internal fragmentation. Herein, we combine the use of the complementary techniques, a top-down and bottom-up method, for the characterization of human growth hormone degradation products. Notably, our approach required small amounts of sample, which is a requirement due to the sample constraints of small scale manufacturing. Using this approach, we were able to characterize various protein variants, including post-translational modifications such as oxidation and deamidation, residual leader sequence, and proteolytic cleavage. Thus, we were able to highlight the complementarity of top-down and bottom-up approaches, which achieved the characterization of a wide range of product variants in samples of human growth hormone secreted from Pichia pastoris.

Bioinformatic mapping and production of recombinant N-terminal domains of human cardiac ryanodine receptor 2

PubMed Central

Bauerová-Hlinková, Vladena; Hostinová, Eva; Gašperík, Juraj; Beck, Konrad; Borko, Ľubomír; Lai, F. Anthony; Zahradníková, Alexandra; Ševčík, Jozef

2010-01-01

We report the domain analysis of the N-terminal region (residues 1–759) of the human cardiac ryanodine receptor (RyR2) that encompasses one of the discrete RyR2 mutation clusters associated with catecholaminergic polymorphic ventricular tachycardia (CPVT1) and arrhythmogenic right ventricular dysplasia (ARVD2). Our strategy utilizes a bioinformatics approach complemented by protein expression, solubility analysis and limited proteolytic digestion. Based on the bioinformatics analysis, we designed a series of specific RyR2 N-terminal fragments for cloning and overexpression in Escherichia coli. High yields of soluble proteins were achieved for fragments RyR21–606·His6, RyR2391–606·His6, RyR2409–606·His6, Trx·RyR2384–606·His6, Trx·RyR2391-606·His6 and Trx·RyR2409–606·His6. The folding of RyR21–606·His6 was analyzed by circular dichroism spectroscopy resulting in α-helix and β-sheet content of ∼23% and ∼29%, respectively, at temperatures up to 35 °C, which is in agreement with sequence based secondary structure predictions. Tryptic digestion of the largest recombinant protein, RyR21–606·His6, resulted in the appearance of two specific subfragments of ∼40 and 25 kDa. The 25 kDa fragment exhibited greater stability. Hybridization with anti-His6·Tag antibody indicated that RyR21–606·His6 is cleaved from the N-terminus and amino acid sequencing of the proteolytic fragments revealed that digestion occurred after residues 259 and 384, respectively. PMID:20045464

Validation and application of quantitative PCR assays using host-specific Bacteroidales genetic markers for swine fecal pollution tracking.

PubMed

Fan, Lihua; Shuai, Jiangbing; Zeng, Ruoxue; Mo, Hongfei; Wang, Suhua; Zhang, Xiaofeng; He, Yongqiang

2017-12-01

Genome fragment enrichment (GFE) method was applied to identify host-specific bacterial genetic markers that differ among different fecal metagenomes. To enrich for swine-specific DNA fragments, swine fecal DNA composite (n = 34) was challenged against a DNA composite consisting of cow, human, goat, sheep, chicken, duck and goose fecal DNA extracts (n = 83). Bioinformatic analyses of 384 non-redundant swine enriched metagenomic sequences indicated a preponderance of Bacteroidales-like regions predicted to encode metabolism-associated, cellular processes and information storage and processing. After challenged against fecal DNA extracted from different animal sources, four sequences from the clone libraries targeting two Bacteroidales- (genes 1-38 and 3-53), a Clostridia- (gene 2-109) as well as a Bacilli-like sequence (gene 2-95), respectively, showed high specificity to swine feces based on PCR analysis. Host-specificity and host-sensitivity analysis confirmed that oligonucleotide primers and probes capable of annealing to select Bacteroidales-like sequences (1-38 and 3-53) exhibited high specificity (>90%) in quantitative PCR assays with 71 fecal DNAs from non-target animal sources. The two assays also demonstrated broad distributions of corresponding genetic markers (>94% positive) among 72 swine feces. After evaluation with environmental water samples from different areas, swine-targeted assays based on two Bacteroidales-like GFE sequences appear to be suitable quantitative tracing tools for swine fecal pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

PubMed

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica.

PubMed

Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M

2015-12-01

Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

Construction of an agglutination tool: recombinant Fab fragments biotinylated in vitro.

PubMed

Czerwinski, Marcin; Krop-Watorek, Anna; Wasniowska, Kazimiera; Smolarek, Dorota; Spitalnik, Steven L

2009-11-30

The pComb3H vector system is used for constructing and panning recombinant antibody libraries. It allows for expression of monovalent Fab fragments, either on the surface of M13 phage, or in the form of soluble proteins secreted into the periplasmic space of bacteria. We constructed a modified pComb3H vector containing cDNA encoding for a 23-amino acid fragment of the Escherichia coli biotin carboxy carrier protein (BCCP), which is an acceptor sequence for biotinylation. The vector was used to express the Fab fragment recognizing human glycophorin A. The purified Fab fragment containing this biotin acceptor sequence was effectively biotinylated in vitro using biotin ligase (BirA). The specificity and avidity of the biotinylated Fab fragments were similar to the previously produced, unmodified Fab fragments. An avidin-alkaline phosphatase conjugate was used to detect the recombinant Fab fragments, instead of secondary antibody. In addition, when biotinylated Fab fragments were mixed with avidin, red blood cells were directly agglutinated.

Fragmentation of contaminant and endogenous DNA in ancient samples determined by shotgun sequencing; prospects for human palaeogenomics.

PubMed

García-Garcerà, Marc; Gigli, Elena; Sanchez-Quinto, Federico; Ramirez, Oscar; Calafell, Francesc; Civit, Sergi; Lalueza-Fox, Carles

2011-01-01

Despite the successful retrieval of genomes from past remains, the prospects for human palaeogenomics remain unclear because of the difficulty of distinguishing contaminant from endogenous DNA sequences. Previous sequence data generated on high-throughput sequencing platforms indicate that fragmentation of ancient DNA sequences is a characteristic trait primarily arising due to depurination processes that create abasic sites leading to DNA breaks. METHODOLOGY/PRINCIPALS FINDINGS: To investigate whether this pattern is present in ancient remains from a temperate environment, we have 454-FLX pyrosequenced different samples dated between 5,500 and 49,000 years ago: a bone from an extinct goat (Myotragus balearicus) that was treated with a depurinating agent (bleach), an Iberian lynx bone not subjected to any treatment, a human Neolithic sample from Barcelona (Spain), and a Neandertal sample from the El Sidrón site (Asturias, Spain). The efficiency of retrieval of endogenous sequences is below 1% in all cases. We have used the non-human samples to identify human sequences (0.35 and 1.4%, respectively), that we positively know are contaminants. We observed that bleach treatment appears to create a depurination-associated fragmentation pattern in resulting contaminant sequences that is indistinguishable from previously described endogenous sequences. Furthermore, the nucleotide composition pattern observed in 5' and 3' ends of contaminant sequences is much more complex than the flat pattern previously described in some Neandertal contaminants. Although much research on samples with known contaminant histories is needed, our results suggest that endogenous and contaminant sequences cannot be distinguished by the fragmentation pattern alone.

Next generation haplotyping to decipher nuclear genomic interspecific admixture in Citrus species: analysis of chromosome 2.

PubMed

Curk, Franck; Ancillo, Gema; Garcia-Lor, Andres; Luro, François; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Navarro, Luis; Ollitrault, Patrick

2014-12-29

The most economically important Citrus species originated by natural interspecific hybridization between four ancestral taxa (Citrus reticulata, Citrus maxima, Citrus medica, and Citrus micrantha) and from limited subsequent interspecific recombination as a result of apomixis and vegetative propagation. Such reticulate evolution coupled with vegetative propagation results in mosaic genomes with large chromosome fragments from the basic taxa in frequent interspecific heterozygosity. Modern breeding of these species is hampered by their complex heterozygous genomic structures that determine species phenotype and are broken by sexual hybridisation. Nevertheless, a large amount of diversity is present in the citrus gene pool, and breeding to allow inclusion of desirable traits is of paramount importance. However, the efficient mobilization of citrus biodiversity in innovative breeding schemes requires previous understanding of Citrus origins and genomic structures. Haplotyping of multiple gene fragments along the whole genome is a powerful approach to reveal the admixture genomic structure of current species and to resolve the evolutionary history of the gene pools. In this study, the efficiency of parallel sequencing with 454 methodology to decipher the hybrid structure of modern citrus species was assessed by analysis of 16 gene fragments on chromosome 2. 454 amplicon libraries were established using the Fluidigm array system for 48 genotypes and 16 gene fragments from chromosome 2. Haplotypes were established from the reads of each accession and phylogenetic analyses were performed using the haplotypic data for each gene fragment. The length of 454 reads and the level of differentiation between the ancestral taxa of modern citrus allowed efficient haplotype phylogenetic assignations for 12 of the 16 gene fragments. The analysis of the mixed genomic structure of modern species and cultivars (i) revealed C. maxima introgressions in modern mandarins, (ii) was consistent with previous hypotheses regarding the origin of secondary species, and (iii) provided a new picture of the evolution of chromosome 2. 454 sequencing was an efficient strategy to establish haplotypes with significant phylogenetic assignations in Citrus, providing a new picture of the mixed structure on chromosome 2 in 48 citrus genotypes.

Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

NASA Astrophysics Data System (ADS)

McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

2016-05-01

Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides.

PubMed

McMillen, Chelsea L; Wright, Patience M; Cassady, Carolyn J

2016-05-01

Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

Using RSAT oligo-analysis and dyad-analysis tools to discover regulatory signals in nucleic sequences.

PubMed

Defrance, Matthieu; Janky, Rekin's; Sand, Olivier; van Helden, Jacques

2008-01-01

This protocol explains how to discover functional signals in genomic sequences by detecting over- or under-represented oligonucleotides (words) or spaced pairs thereof (dyads) with the Regulatory Sequence Analysis Tools (http://rsat.ulb.ac.be/rsat/). Two typical applications are presented: (i) predicting transcription factor-binding motifs in promoters of coregulated genes and (ii) discovering phylogenetic footprints in promoters of orthologous genes. The steps of this protocol include purging genomic sequences to discard redundant fragments, discovering over-represented patterns and assembling them to obtain degenerate motifs, scanning sequences and drawing feature maps. The main strength of the method is its statistical ground: the binomial significance provides an efficient control on the rate of false positives. In contrast with optimization-based pattern discovery algorithms, the method supports the detection of under- as well as over-represented motifs. Computation times vary from seconds (gene clusters) to minutes (whole genomes). The execution of the whole protocol should take approximately 1 h.

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

DNA methylation profiling using HpaII tiny fragment enrichment by ligation-mediated PCR (HELP)

PubMed Central

Suzuki, Masako; Greally, John M.

2010-01-01

The HELP assay is a technique that allows genome-wide analysis of cytosine methylation. Here we describe the assay, its relative strengths and weaknesses, and the transition of the assay from a microarray to massively-parallel sequencing-based foundation. PMID:20434563

Global sequence variation in the histidine-rich proteins 2 and 3 of Plasmodium falciparum: implications for the performance of malaria rapid diagnostic tests

PubMed Central

2010-01-01

Background Accurate diagnosis is essential for prompt and appropriate treatment of malaria. While rapid diagnostic tests (RDTs) offer great potential to improve malaria diagnosis, the sensitivity of RDTs has been reported to be highly variable. One possible factor contributing to variable test performance is the diversity of parasite antigens. This is of particular concern for Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-detecting RDTs since PfHRP2 has been reported to be highly variable in isolates of the Asia-Pacific region. Methods The pfhrp2 exon 2 fragment from 458 isolates of P. falciparum collected from 38 countries was amplified and sequenced. For a subset of 80 isolates, the exon 2 fragment of histidine-rich protein 3 (pfhrp3) was also amplified and sequenced. DNA sequence and statistical analysis of the variation observed in these genes was conducted. The potential impact of the pfhrp2 variation on RDT detection rates was examined by analysing the relationship between sequence characteristics of this gene and the results of the WHO product testing of malaria RDTs: Round 1 (2008), for 34 PfHRP2-detecting RDTs. Results Sequence analysis revealed extensive variations in the number and arrangement of various repeats encoded by the genes in parasite populations world-wide. However, no statistically robust correlation between gene structure and RDT detection rate for P. falciparum parasites at 200 parasites per microlitre was identified. Conclusions The results suggest that despite extreme sequence variation, diversity of PfHRP2 does not appear to be a major cause of RDT sensitivity variation. PMID:20470441

Multilocus sequence typing of Pseudomonas syringae sensu lato confirms previously described genomospecies and permits rapid identification of P. syringae pv. coriandricola and P. syringae pv. apii causing bacterial leaf spot on parsley.

PubMed

Bull, Carolee T; Clarke, Christopher R; Cai, Rongman; Vinatzer, Boris A; Jardini, Teresa M; Koike, Steven T

2011-07-01

Since 2002, severe leaf spotting on parsley (Petroselinum crispum) has occurred in Monterey County, CA. Either of two different pathovars of Pseudomonas syringae sensu lato were isolated from diseased leaves from eight distinct outbreaks and once from the same outbreak. Fragment analysis of DNA amplified between repetitive sequence polymerase chain reaction; 16S rDNA sequence analysis; and biochemical, physiological, and host range tests identified the pathogens as Pseudomonas syringae pv. apii and P. syringae pv. coriandricola. Koch's postulates were completed for the isolates from parsley, and host range tests with parsley isolates and pathotype strains demonstrated that P. syringae pv. apii and P. syringae pv. coriandricola cause leaf spot diseases on parsley, celery, and coriander or cilantro. In a multilocus sequence typing (MLST) approach, four housekeeping gene fragments were sequenced from 10 strains isolated from parsley and 56 pathotype strains of P. syringae. Allele sequences were uploaded to the Plant-Associated Microbes Database and a phylogenetic tree was built based on concatenated sequences. Tree topology directly corresponded to P. syringae genomospecies and P. syringae pv. apii was allocated appropriately to genomospecies 3. This is the first demonstration that MLST can accurately allocate new pathogens directly to P. syringae sensu lato genomospecies. According to MLST, P. syringae pv. coriandricola is a member of genomospecies 9, P. cannabina. In a blind test, both P. syringae pv. coriandricola and P. syringae pv. apii isolates from parsley were correctly identified to pathovar. In both cases, MLST described diversity within each pathovar that was previously unknown.

Structural and genetic analysis of a mutant of Rhodobacter sphaeroides WS8 deficient in hook length control.

PubMed Central

González-Pedrajo, B; Ballado, T; Campos, A; Sockett, R E; Camarena, L; Dreyfus, G

1997-01-01

Motility in the photosynthetic bacterium Rhodobacter sphaeroides is achieved by the unidirectional rotation of a single subpolar flagellum. In this study, transposon mutagenesis was used to obtain nonmotile flagellar mutants from this bacterium. We report here the isolation and characterization of a mutant that shows a polyhook phenotype. Morphological characterization of the mutant was done by electron microscopy. Polyhooks were obtained by shearing and were used to purify the hook protein monomer (FlgE). The apparent molecular mass of the hook protein was 50 kDa. N-terminal amino acid sequencing and comparisons with the hook proteins of other flagellated bacteria indicated that the Rhodobacter hook protein has consensus sequences common to axial flagellar components. A 25-kb fragment from an R. sphaeroides WS8 cosmid library restored wild-type flagellation and motility to the mutant. Using DNA adjacent to the inserted transposon as a probe, we identified a 4.6-kb SalI restriction fragment that contained the gene responsible for the polyhook phenotype. Nucleotide sequence analysis of this region revealed an open reading frame with a deduced amino acid sequence that was 23.4% identical to that of FliK of Salmonella typhimurium, the polypeptide responsible for hook length control in that enteric bacterium. The relevance of a gene homologous to fliK in the uniflagellated bacterium R. sphaeroides is discussed. PMID:9352903

Assessment of replicate bias in 454 pyrosequencing and a multi-purpose read-filtering tool.

PubMed

Jérôme, Mariette; Noirot, Céline; Klopp, Christophe

2011-05-26

Roche 454 pyrosequencing platform is often considered the most versatile of the Next Generation Sequencing technology platforms, permitting the sequencing of large genomes, the analysis of variations or the study of transcriptomes. A recent reported bias leads to the production of multiple reads for a unique DNA fragment in a random manner within a run. This bias has a direct impact on the quality of the measurement of the representation of the fragments using the reads. Other cleaning steps are usually performed on the reads before assembly or alignment. PyroCleaner is a software module intended to clean 454 pyrosequencing reads in order to ease the assembly process. This program is a free software and is distributed under the terms of the GNU General Public License as published by the Free Software Foundation. It implements several filters using criteria such as read duplication, length, complexity, base-pair quality and number of undetermined bases. It also permits to clean flowgram files (.sff) of paired-end sequences generating on one hand validated paired-ends file and the other hand single read file. Read cleaning has always been an important step in sequence analysis. The pyrocleaner python module is a Swiss knife dedicated to 454 reads cleaning. It includes commonly used filters as well as specialised ones such as duplicated read removal and paired-end read verification.

Bromine isotopic signature facilitates de novo sequencing of peptides in free-radical-initiated peptide sequencing (FRIPS) mass spectrometry.

PubMed

Nam, Jungjoo; Kwon, Hyuksu; Jang, Inae; Jeon, Aeran; Moon, Jingyu; Lee, Sun Young; Kang, Dukjin; Han, Sang Yun; Moon, Bongjin; Oh, Han Bin

2015-02-01

We recently showed that free-radical-initiated peptide sequencing mass spectrometry (FRIPS MS) assisted by the remarkable thermochemical stability of (2,2,6,6-tetramethyl-piperidin-1-yl)oxyl (TEMPO) is another attractive radical-driven peptide fragmentation MS tool. Facile homolytic cleavage of the bond between the benzylic carbon and the oxygen of the TEMPO moiety in o-TEMPO-Bz-C(O)-peptide and the high reactivity of the benzylic radical species generated in •Bz-C(O)-peptide are key elements leading to extensive radical-driven peptide backbone fragmentation. In the present study, we demonstrate that the incorporation of bromine into the benzene ring, i.e. o-TEMPO-Bz(Br)-C(O)-peptide, allows unambiguous distinction of the N-terminal peptide fragments from the C-terminal fragments through the unique bromine doublet isotopic signature. Furthermore, bromine substitution does not alter the overall radical-driven peptide backbone dissociation pathways of o-TEMPO-Bz-C(O)-peptide. From a practical perspective, the presence of the bromine isotopic signature in the N-terminal peptide fragments in TEMPO-assisted FRIPS MS represents a useful and cost-effective opportunity for de novo peptide sequencing. Copyright © 2015 John Wiley & Sons, Ltd.

Method for identifying mutagenic agents which induce large, multilocus deletions in DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bradley, W.E.C.; Belouchi, A.; Dewyse, P.

1993-07-13

A method of identifying a mutagenic agent is described which includes a large, multilocus deletions in DNA in mammalian cells comprising: (i) exposing a class III heterozygous CHO cell line to a potential mutagenic agent under investigation, and allowing any mutation of the cell line to proceed, said cell line being characterized in that a restriction fragment length variation exists in on mutation it becomes resistant to 2,6-diaminopurine and in that the DNA sequence adjacent to the two alleles of the APRT gene such that the DNA sequence adjacent to one of the two alleles can be digested with themore » enzyme BclI but the DNA sequence variation adjacent to the other of the two alleles cannot be digested with BclI, (ii) isolating induced mutations of the cell line deficient in APRT function, (iii) isolating DNA from the induced mutants, (iv) digesting the isolated DNA with BclI enzyme to produce digested fragments including a 19 kb fragment and any 2 kb fragment, which fragments hybridize with the labeled probe derived from DNA fragment PDI, (v) separating any digested fragments, (vi) transferring the separated fragments of (v) to a solid support, (vii) hybridizing the supported separated fragments with a labeled probe derived from the clone DNA fragment PD 1, (viii) determining fragments having undergone loss of the 2 kb band identified by the probe, as an identification of parent mutants in which the loss occurred, and (ix) evaluating the mutating ability of the potential mutagenic agent.« less

Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

PubMed

Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

1985-10-30

A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

Beet western yellows virus infects the carnivorous plant Nepenthes mirabilis.

PubMed

Miguel, Sissi; Biteau, Flore; Mignard, Benoit; Marais, Armelle; Candresse, Thierry; Theil, Sébastien; Bourgaud, Frédéric; Hehn, Alain

2016-08-01

Although poleroviruses are known to infect a broad range of higher plants, carnivorous plants have not yet been reported as hosts. Here, we describe the first polerovirus naturally infecting the pitcher plant Nepenthes mirabilis. The virus was identified through bioinformatic analysis of NGS transcriptome data. The complete viral genome sequence was assembled from overlapping PCR fragments and shown to share 91.1 % nucleotide sequence identity with the US isolate of beet western yellows virus (BWYV). Further analysis of other N. mirabilis plants revealed the presence of additional BWYV isolates differing by several insertion/deletion mutations in ORF5.

Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

PubMed

Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

2005-12-01

Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

Genotyping of bacteria belonging to the former Erwinia genus by PCR-RFLP analysis of a recA gene fragment.

PubMed

Waleron, Małgorzata; Waleron, Krzysztof; Podhajska, Anna J; Lojkowska, Ewa

2002-02-01

Genotypic characterization, based on the analysis of restriction fragment length polymorphism of the recA gene fragment PCR product (recA PCR-RFLP), was performed on members of the former Erwinia genus. PCR primers deduced from published recA gene sequences of Erwinia carotovora allowed the amplification of an approximately 730 bp DNA fragment from each of the 19 Erwinia species tested. Amplified recA fragments were compared using RFLP analysis with four endonucleases (AluI, HinfI, TasI and Tru1I), allowing the detection of characteristic patterns of RFLP products for most of the Erwinia species. Between one and three specific RFLP groups were identified among most of the species tested (Erwinia amylovora, Erwinia ananas, Erwinia cacticida, Erwinia cypripedii, Erwinia herbicola, Erwinia mallotivora, Erwinia milletiae, Erwinia nigrifluens, Erwinia persicina, Erwinia psidii, Erwinia quercina, Erwinia rhapontici, Erwinia rubrifaciens, Erwinia salicis, Erwinia stewartii, Erwinia tracheiphila, Erwinia uredovora, Erwinia carotovora subsp. atroseptica, Erwinia carotovora subsp. betavasculorum, Erwinia carotovora subsp. odorifera and Erwinia carotovora subsp. wasabiae). However, in two cases, Erwinia chrysanthemi and Erwinia carotovora subsp. carotovora, 15 and 18 specific RFLP groups were detected, respectively. The variability of genetic patterns within these bacteria could be explained in terms of their geographic origin and/or wide host-range. The results indicated that PCR-RFLP analysis of the recA gene fragment is a useful tool for identification of species and subspecies belonging to the former Erwinia genus, as well as for differentiation of strains within E. carotovora subsp. carotovora and E. chrysanthemi.

A binary search approach to whole-genome data analysis.

PubMed

Brodsky, Leonid; Kogan, Simon; Benjacob, Eshel; Nevo, Eviatar

2010-09-28

A sequence analysis-oriented binary search-like algorithm was transformed to a sensitive and accurate analysis tool for processing whole-genome data. The advantage of the algorithm over previous methods is its ability to detect the margins of both short and long genome fragments, enriched by up-regulated signals, at equal accuracy. The score of an enriched genome fragment reflects the difference between the actual concentration of up-regulated signals in the fragment and the chromosome signal baseline. The "divide-and-conquer"-type algorithm detects a series of nonintersecting fragments of various lengths with locally optimal scores. The procedure is applied to detected fragments in a nested manner by recalculating the lower-than-baseline signals in the chromosome. The algorithm was applied to simulated whole-genome data, and its sensitivity/specificity were compared with those of several alternative algorithms. The algorithm was also tested with four biological tiling array datasets comprising Arabidopsis (i) expression and (ii) histone 3 lysine 27 trimethylation CHIP-on-chip datasets; Saccharomyces cerevisiae (iii) spliced intron data and (iv) chromatin remodeling factor binding sites. The analyses' results demonstrate the power of the algorithm in identifying both the short up-regulated fragments (such as exons and transcription factor binding sites) and the long--even moderately up-regulated zones--at their precise genome margins. The algorithm generates an accurate whole-genome landscape that could be used for cross-comparison of signals across the same genome in evolutionary and general genomic studies.

Molecular Detection, Isolation, and Physiological Characterization of Functionally Dominant Phenol-Degrading Bacteria in Activated Sludge

PubMed Central

Watanabe, Kazuya; Teramoto, Maki; Futamata, Hiroyuki; Harayama, Shigeaki

1998-01-01

DNA was isolated from phenol-digesting activated sludge, and partial fragments of the 16S ribosomal DNA (rDNA) and the gene encoding the largest subunit of multicomponent phenol hydroxylase (LmPH) were amplified by PCR. An analysis of the amplified fragments by temperature gradient gel electrophoresis (TGGE) demonstrated that two major 16S rDNA bands (bands R2 and R3) and two major LmPH gene bands (bands P2 and P3) appeared after the activated sludge became acclimated to phenol. The nucleotide sequences of these major bands were determined. In parallel, bacteria were isolated from the activated sludge by direct plating or by plating after enrichment either in batch cultures or in a chemostat culture. The bacteria isolated were classified into 27 distinct groups by a repetitive extragenic palindromic sequence PCR analysis. The partial nucleotide sequences of 16S rDNAs and LmPH genes of members of these 27 groups were then determined. A comparison of these nucleotide sequences with the sequences of the major TGGE bands indicated that the major bacterial populations, R2 and R3, possessed major LmPH genes P2 and P3, respectively. The dominant populations could be isolated either by direct plating or by chemostat culture enrichment but not by batch culture enrichment. One of the dominant strains (R3) which contained a novel type of LmPH (P3), was closely related to Valivorax paradoxus, and the result of a kinetic analysis of its phenol-oxygenating activity suggested that this strain was the principal phenol digester in the activated sludge. PMID:9797297

Characterization of circulating transfer RNA-Derived RNA fragments in cattle

USDA-ARS?s Scientific Manuscript database

The objective was to characterize naturally occurring circulating transfer RNA-derived RNA Fragments (tRFs) in cattle. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences a...

Essentials of Conservation Biotechnology: A mini review

NASA Astrophysics Data System (ADS)

Merlyn Keziah, S.; Subathra Devi, C.

2017-11-01

Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

Molecular Cloning and Sequence Analysis of the Sta58 Major Antigen Gene of Rickettsia tsutsugamushi: Sequence homology and Antigenic Comparison of Sta58 to the 60-Kilodalton Family of Stress Proteins

DTIC Science & Technology

1990-05-01

Sta58 antigen and the Sta56 strain- GroES, C. burnetii HtpA, Mycobacterium tuberculosis 12- specific major antigen of R. tsutsugamushi (strain Karp...kb HindlIl fragment carrying the gene for the Sta58 tuberculosis, and Mycobacterium smegmatis (65-kDa anti- protein was subjected to DNA sequence...the Hsp6O and HsplO proteins. R. tsu., R. isutsugamushi; M. lep., Mvtcobacteriutn leprae : C. bur., C. burneiii; Synech.. Synechococcus strain 6301; T

Analyzing Internal Fragmentation of Electrosprayed Ubiquitin Ions During Beam-Type Collisional Dissociation

NASA Astrophysics Data System (ADS)

Durbin, Kenneth R.; Skinner, Owen S.; Fellers, Ryan T.; Kelleher, Neil L.

2015-05-01

Gaseous fragmentation of intact proteins is multifaceted and can be unpredictable by current theories in the field. Contributing to the complexity is the multitude of precursor ion states and fragmentation channels. Terminal fragment ions can be re-fragmented, yielding product ions containing neither terminus, termed internal fragment ions. In an effort to better understand and capitalize upon this fragmentation process, we collisionally dissociated the high (13+), middle (10+), and low (7+) charge states of electrosprayed ubiquitin ions. Both terminal and internal fragmentation processes were quantified through step-wise increases of voltage potential in the collision cell. An isotope fitting algorithm matched observed product ions to theoretical terminal and internal fragment ions. At optimal energies for internal fragmentation of the 10+, nearly 200 internal fragments were observed; on average each of the 76 residues in ubiquitin was covered by 24.1 internal fragments. A pertinent finding was that formation of internal ions occurs at similar energy thresholds as terminal b- and y-ion types in beam-type activation. This large amount of internal fragmentation is frequently overlooked during top-down mass spectrometry. As such, we present several new approaches to visualize internal fragments through modified graphical fragment maps. With the presented advances of internal fragment ion accounting and visualization, the total percentage of matched fragment ions increased from approximately 40% to over 75% in a typical beam-type MS/MS spectrum. These sequence coverage improvements offer greater characterization potential for whole proteins with no needed experimental changes and could be of large benefit for future high-throughput intact protein analysis.

Mermithid parasitism of Hawaiian Tetragnatha spiders in a fragmented landscape

USGS Publications Warehouse

Vandergast, Amy; Roderick, George K.

2003-01-01

Hawaiian Tetragnatha spiders inhabiting small forest fragments on the Big Island of Hawaii are parasitized by mermithid nematodes. This is the first report of mermithid nematodes infecting spiders in Hawaii, and an initial attempt to characterize this host–parasite interaction. Because immature mermithids were not morphologically identifiable, a molecular identification was performed. A phylogenetic analysis based on 18S small ribosomal subunit nuclear gene sequences suggested that Hawaiian spider mermithids are more closely related to a mainland presumptive Aranimemis species that infects spiders, than to an insect-infecting mermithid collected on Oahu, HI, or to Mermis nigrescens, also a parasite of insects. Measured infection prevalence was low (ranging from 0 to 4%) but differed significantly among forest fragments. Infection prevalence was associated significantly with fragment area, but not with spider density nor spider species richness. Results suggest that mermithid populations are sensitive to habitat fragmentation, but that changes in infection prevalence do not appear to affect spider community structure.

Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2010-09-01

Two lactic acid bacteria, strains 257(T) and 252, were isolated from traditional heap fermentations of Ghanaian cocoa beans. 16S rRNA gene sequence analysis of these strains allocated them to the genus Weissella, showing 99.5 % 16S rRNA gene sequence similarity towards Weissella ghanensis LMG 24286(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and biochemical tests confirmed their unique taxonomic position. DNA-DNA hybridization experiments towards their nearest phylogenetic neighbour demonstrated that the two strains represent a novel species, for which we propose the name Weissella fabaria sp. nov., with strain 257(T) (=LMG 24289(T) =DSM 21416(T)) as the type strain. Additional sequence analysis using pheS gene sequences proved useful for identification of all Weissella-Leuconostoc-Oenococcus species and for the recognition of the novel species.

Distinctive and Complementary MS2 Fragmentation Characteristics for Identification of Sulfated Sialylated N-Glycopeptides by nanoLC-MS/MS Workflow

NASA Astrophysics Data System (ADS)

Kuo, Chu-Wei; Guu, Shih-Yun; Khoo, Kay-Hooi

2018-04-01

High sensitivity identification of sulfated glycans carried on specific sites of glycoproteins is an important requisite for investigation of molecular recognition events involved in diverse biological processes. However, aiming for resolving site-specific glycosylation of sulfated glycopeptides by direct LC-MS2 sequencing is technically most challenging. Other than the usual limiting factors such as lower abundance and ionization efficiency compared to analysis of non-glycosylated peptides, confident identification of sulfated glycopeptides among the more abundant non-sulfated glycopeptides requires additional considerations in the selective enrichment and detection strategies. Metal oxide has been applied to enrich phosphopeptides and sialylated glycopeptides, but its use to capture sulfated glycopeptides has not been investigated. Likewise, various complementary MS2 fragmentation modes have yet to be tested against sialylated and non-sialylated sulfoglycopeptides due to limited appropriate sample availability. In this study, we have investigated the feasibility of sequencing tryptic sulfated N-glycopeptide and its MS2 fragmentation characteristics by first optimizing the enrichment methods to allow efficient LC-MS detection and MS2 analysis by a combination of CID, HCD, ETD, and EThcD on hybrid and tribrid Orbitrap instruments. Characteristic sulfated glyco-oxonium ions and direct loss of sulfite from precursors were detected as evidences of sulfate modification. It is anticipated that the technical advances demonstrated in this study would allow a feasible extension of our sulfoglycomic analysis to sulfoglycoproteomics. [Figure not available: see fulltext.

Efficient and Accurate Algorithm for Cleaved Fragments Prediction (CFPA) in Protein Sequences Dataset Based on Consensus and Its Variants: A Novel Degradomics Prediction Application.

PubMed

El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges; Hajj, Hazem; Kobeissy, Firas H

2017-01-01

Degradomics is a novel discipline that involves determination of the proteases/substrate fragmentation profile, called the substrate degradome, and has been recently applied in different disciplines. A major application of degradomics is its utility in the field of biomarkers where the breakdown products (BDPs) of different protease have been investigated. Among the major proteases assessed, calpain and caspase proteases have been associated with the execution phases of the pro-apoptotic and pro-necrotic cell death, generating caspase/calpain-specific cleaved fragments. The distinction between calpain and caspase protein fragments has been applied to distinguish injury mechanisms. Advanced proteomics technology has been used to identify these BDPs experimentally. However, it has been a challenge to identify these BDPs with high precision and efficiency, especially if we are targeting a number of proteins at one time. In this chapter, we present a novel bioinfromatic detection method that identifies BDPs accurately and efficiently with validation against experimental data. This method aims at predicting the consensus sequence occurrences and their variants in a large set of experimentally detected protein sequences based on state-of-the-art sequence matching and alignment algorithms. After detection, the method generates all the potential cleaved fragments by a specific protease. This space and time-efficient algorithm is flexible to handle the different orientations that the consensus sequence and the protein sequence can take before cleaving. It is O(mn) in space complexity and O(Nmn) in time complexity, with N number of protein sequences, m length of the consensus sequence, and n length of each protein sequence. Ultimately, this knowledge will subsequently feed into the development of a novel tool for researchers to detect diverse types of selected BDPs as putative disease markers, contributing to the diagnosis and treatment of related disorders.

Genetic diversity of HIV-1 non-B strains in Sicily: evidence of intersubtype recombinants by sequence analysis of gag, pol, and env genes.

PubMed

Tramuto, Fabio; Bonura, Filippa; Perna, Anna Maria; Mancuso, Salvatrice; Firenze, Alberto; Romano, Nino; Vitale, Francesco

2007-09-01

The molecular epidemiology of HIV-1 strains in Sicily (Italy) was phylogenetically investigated by the analysis of HIV-1 gag, pol, and env gene sequences from 11 HIV-1 non-B strains from 408 HIV-1-seropositive patients observed from September 2001 to August 2006. Sequences suggestive of recombination were further investigated by bootscanning analysis of various fragments. Overall, we identified several second-generation recombinant (SGRs) strains, which contained genetic material of CRF02_AG in at least one gene. Notably, three individuals were found to be infected with subsubtype A3, and one of them showed genetic recombination with subsubtype A4. The current study emphasizes the genetic analysis of gag, pol, and env genes as a powerful tool to trace the spread of complex HIV-1 recombinant forms, and highlight the genetic diversity of HIV-1 non-B strains in Italy.

Annotation of Differentially Expressed Genes in the Somatic Embryogenesis of Musa and Their Location in the Banana Genome

PubMed Central

Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-GraciaMedrano, Rosa Maria

2013-01-01

Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100–4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa. PMID:24027442

Isolation and characterization of Y chromosome sequences from the African malaria mosquito Anopheles gambiae.

PubMed Central

Krzywinski, Jaroslaw; Nusskern, Deborah R; Kern, Marcia K; Besansky, Nora J

2004-01-01

The karyotype of the African malaria mosquito Anopheles gambiae contains two pairs of autosomes and a pair of sex chromosomes. The Y chromosome, constituting approximately 10% of the genome, remains virtually unexplored, despite the recent completion of the A. gambiae genome project. Here we report the identification and characterization of Y chromosome sequences of total length approaching 150 kb. We developed 11 Y-specific PCR markers that consistently yielded male-specific products in specimens from both laboratory colony and natural populations. The markers are characterized by low sequence polymorphism in samples collected across Africa and by presence in more than one copy on the Y. Screening of the A. gambiae BAC library using these markers allowed detection of 90 Y-linked BAC clones. Analysis of the BAC sequences and other Y-derived fragments showed massive accumulation of a few transposable elements. Nevertheless, more complex sequences are apparently present on the Y; these include portions of an approximately 48-kb-long unmapped AAAB01008227 scaffold from the whole genome shotgun assembly. Anopheles Y appears not to harbor any of the genes identified in Drosophila Y. However, experiments suggest that one of the ORFs from the AAAB01008227 scaffold represents a fragment of a gene with male-specific expression. PMID:15082548

Discovery and molecular characterization of a new cryptovirus dsRNA genome from Japanese persimmon through conventional cloning and high-throughput sequencing.

PubMed

Morelli, M; Chiumenti, M; De Stradis, A; La Notte, P; Minafra, A

2015-02-01

Through the application of next generation sequencing, in synergy with conventional cloning of DOP-PCR fragments, two double-stranded RNA (dsRNA) molecules of about 1.5 kbp in size were isolated from leaf tissue of a Japanese persimmon (accession SSPI) from Apulia (southern Italy) showing veinlets necrosis. High-throughput sequencing allowed whole genome sequence assembly, yielding a 1,577 and a 1,491 bp contigs identified as dsRNA-1 and dsRNA-2 of a previously undescribed virus, provisionally named as Persimmon cryptic virus (PeCV). In silico analysis showed that both dsRNA fragments were monocistronic and comprised the RNA-dependent RNA polymerase (RdRp) and the capsid protein (CP) genes, respectively. Phylogenetic reconstruction revealed a close relationship of these dsRNAs with those of cryptoviruses described in woody and herbaceous hosts, recently gathered in genus Deltapartitivirus. Virus-specific primers for RT-PCR, designed in the CP cistron, detected viral RNAs also in symptomless persimmon trees sampled from the same geographical area of SSPI, thus proving that PeCV infection may be fairly common and presumably latent.

FragIdent--automatic identification and characterisation of cDNA-fragments.

PubMed

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

DTIC Science & Technology

1988-02-02

the bands excised, and the DNA extracted with phenol for cloning in M13 . 6 Nuclotida sequence analysis. The two fragments were each cloned into phages ...DNA; and strain JM103 (29) was used to propagate M13 ph&ge derivatives. -1 Subcloning and detection of PA-producing rsccmbinants. The isolation of...method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132. 19. Lauben, J. 0., and J. 2. K. Nielsen. 1982. Penicillinase and

Molecular detection of kobuviruses in European roe deer (Capreolus capreolus) in Italy.

PubMed

Di Martino, Barbara; Di Profio, Federica; Melegari, Irene; Di Felice, Elisabetta; Robetto, Serena; Guidetti, Cristina; Orusa, Riccardo; Martella, Vito; Marsilio, Fulvio

2015-08-01

Kobuvirus RNA was found in 6.6 % (13/198) of stool specimens from roe deer (Capreolus capreolus) captured during the regular hunting season. Upon sequence analysis of a fragment of the 3D gene, nine strains displayed the highest nucleotide sequence identity (91.2-97.4 %) to bovine kobuviruses previously detected in either diarrhoeic or asymptomatic calves. Interestingly, four strains were genetically related to the newly discovered caprine kobuviruses (84.2-87.6 % nucleotide identity) identified in black goats in Korea.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

PubMed

Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

2018-03-15

The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan at molecular level. The detection of FPV could be a case of real co-infection or a case of dual presence, due to ingestion of contaminated food.

Molecular identification and partial sequence analysis of an aryl hydrocarbon receptor from beluga (Delphinapterus leucas)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, B.A.; Hahn, M.E.

1995-12-31

The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

Analysis of myosin heavy chain mRNA expression by RT-PCR

NASA Technical Reports Server (NTRS)

Wright, C.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

1997-01-01

An assay was developed for rapid and sensitive analysis of myosin heavy chain (MHC) mRNA expression in rodent skeletal muscle. Only 2 microg of total RNA were necessary for the simultaneous analysis of relative mRNA expression of six different MHC genes. We designed synthetic DNA fragments as internal standards, which contained the relevant primer sequences for the adult MHC mRNAs type I, IIa, IIx, IIb as well as the embryonic and neonatal MHC mRNAs. A known amount of the synthetic fragment was added to each polymerase chain reaction (PCR) and yielded a product of different size than the amplified MHC mRNA fragment. The ratio of amplified MHC fragment to synthetic fragment allowed us to calculate percentages of the gene expression of the different MHC genes in a given muscle sample. Comparison with the traditional Northern blot analysis demonstrated that our reverse transcriptase-PCR-based assay was reliable, fast, and quantitative over a wide range of relative MHC mRNA expression in a spectrum of adult and neonatal rat skeletal muscles. Furthermore, the high sensitivity of the assay made it very useful when only small quantities of tissue were available. Statistical analysis of the signals for each MHC isoform across the analyzed samples showed a highly significant correlation between the PCR and the Northern signals as Pearson correlation coefficients ranged between 0.77 and 0.96 (P < 0.005). This assay has potential use in analyzing small muscle samples such as biopsies and samples from pre- and/or neonatal stages of development.

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

[Species identification in 5 imported cases previously diagnosed as Vivax malaria by parasitological and nested PCR techniques].

PubMed

Yao, Li-Nong; Zhang, Ling-Ling; Ruan, Wei; Chen, Hua-Liang; Lu, Qiao-Yi; Yang, Ting-Ting

2013-06-01

To identify the species of malaria parasites in 5 imported cases previously diagnosed as vivax malaria. Epidemiological information and blood samples were collected from five patients who returned from Africa and were diagnosed as vivax malaria. The detection was conducted by microscopy, right VIEW rapid malaria test (RDTs) and nested PCR with Plasmodium genus-specific and species-specific primers. The amplified products were sequenced and Blast analysis was performed. Three of the 5 cases had a history of malaria attack. Microscopically, 4 cases were confirmed as Plasmodium ovale infection, 1 (case 1) was co-infected with P. vivax and P. ovale. All 5 cases showed negative RDT results. Nested PCR detection revealed that the 5 cases had a P. ovale-specific fragment (800 bp), while case 1 had a P. vivax-specific fragment (120 bp) concurrently. Blast analysis showed that the amplified sequence of the 5 cases had a high sequence homology (99%) with P. ovale gene for small subunit ribosomal RNA from GenBank, and that of case 1 also shared 99% homology with P. vivax isolate SV5 18S ribosomal RNA gene (GenBank accession number: JQ627157.1). Among the five cases, four were infected by Plasmodium ovale, and one was co-infected with both P. vivax and P. ovale.

Isolation of a promoter region in mouse cytochrome P450 3A (Cyp3A16) gene and its transcriptional control.

PubMed

Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T

1997-02-07

An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

PubMed Central

Haggarty, N W; Dunbar, B; Fothergill, L A

1983-01-01

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important for the activity of the glycolytic mutase are conserved in the erythrocyte diphosphoglycerate mutase. PMID:6313356

Dna Sequencing

DOEpatents

Tabor, Stanley; Richardson, Charles C.

1995-04-25

A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

The short interspersed repetitive element of Trypanosoma cruzi, SIRE, is part of VIPER, an unusual retroelement related to long terminal repeat retrotransposons

PubMed Central

Vázquez, Martín; Ben-Dov, Claudia; Lorenzi, Hernan; Moore, Troy; Schijman, Alejandro; Levin, Mariano J.

2000-01-01

The short interspersed repetitive element (SIRE) of Trypanosoma cruzi was first detected when comparing the sequences of loci that encode the TcP2β genes. It is present in about 1,500–3,000 copies per genome, depending on the strain, and it is distributed in all chromosomes. An initial analysis of SIRE sequences from 21 genomic fragments allowed us to derive a consensus nucleotide sequence and structure for the element, consisting of three regions (I, II, and III) each harboring distinctive features. Analysis of 158 transcribed SIREs demonstrates that the consensus is highly conserved. The sequences of 51 cDNAs show that SIRE is included in the 3′ end of several mRNAs, always transcribed from the sense strand, contributing the polyadenylation site in 63% of the cases. This study led to the characterization of VIPER (vestigial interposed retroelement), a 2,326-bp-long unusual retroelement. VIPER's 5′ end is formed by the first 182 bp of SIRE, whereas its 3′ end is formed by the last 220 bp of the element. Both SIRE moieties are connected by a 1,924-bp-long fragment that carries a unique ORF encoding a complete reverse transcriptase-RNase H gene whose 15 C-terminal amino acids derive from codons specified by SIRE's region II. The amino acid sequence of VIPER's reverse transcriptase-RNase H shares significant homology to that of long terminal repeat retrotransposons. The fact that SIRE and VIPER sequences are found only in the T. cruzi genome may be of relevance for studies concerning the evolution and the genome flexibility of this protozoan parasite. PMID:10688909

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

PubMed Central

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Detection, differentiation, and VP1 sequencing of duck hepatitis A virus type 1 and type 3 by a 1-step duplex reverse-transcription PCR assay.

PubMed

Wen, X J; Cheng, A C; Wang, M S; Jia, R Y; Zhu, D K; Chen, S; Liu, M F; Liu, F; Chen, X Y

2014-09-01

Duck hepatitis A virus (DHAV) is an infectious pathogen causing fatal duck viral hepatitis in ducklings. Although both the inactivated vaccines and live attenuated vaccines have been used to protect ducklings, DHAV-1 and DHAV-3 still cause significant serious damage to the duck industry in China and South Korea. For rapid detection, differentiation, and epidemic investigation of DHAV in China, a genotype-specific 1-step duplex reverse-transcription (RT) PCR assay was established in this study. The sensitivity and specificity of the developed RT-PCR assay was evaluated with nucleic acids extracted from 2 DHAV reference strains, and 9 other infectious viruses and bacteria. The genotype-specific primers amplified different size DNA fragments encompassing the complete VP1 gene of the DHAV-1 or DHAV-3. The assay detected the liver samples collected from experimentally infected ducklings and dead ducklings collected from different regions of China. Sequence analysis of these DNA fragments indicated that VP1 sequences of DHAV-1 can be used to distinguish wild type and vaccine strains. The phylogenetic analysis of VP1 sequences indicated that the developed RT-PCR assay can be used for epidemic investigation of DHAV-1 and DHAV-3. The developed RT-PCR assay can be used as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV. © 2014 Poultry Science Association Inc.

Raman-based system for DNA sequencing-mapping and other separations

DOEpatents

Vo-Dinh, Tuan

1994-01-01

DNA sequencing and mapping are performed by using a Raman spectrometer with a surface enhanced Raman scattering (SERS) substrate to enhance the Raman signal. A SERS label is attached to a DNA fragment and then analyzed with the Raman spectrometer to identify the DNA fragment according to characteristics of the Raman spectrum generated.

RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

NASA Astrophysics Data System (ADS)

Wang, Tiegu; Huang, Qunce; Feng, Weisen

2007-10-01

Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

Cell transformation mediated by chromosomal deoxyribonucleic acid of polyoma virus-transformed cells.

PubMed Central

Della Valle, G; Fenton, R G; Basilico, C

1981-01-01

To study the mechanism of deoxyribonucleic acid (DNA)-mediated gene transfer, normal rat cells were transfected with total cellular DNA extracted from polyoma virus-transformed cells. This resulted in the appearance of the transformed phenotype in 1 X 10(-6) to 3 X 10(-6) of the transfected cells. Transformation was invariably associated with the acquisition of integrated viral DNA sequences characteristic of the donor DNA. This was caused not by the integration of free DNA molecules, but by the transfer of large DNA fragments (10 to 20 kilobases) containing linked cellular and viral sequences. Although Southern blot analysis showed that integration did not appear to occur in a homologous region of the recipient chromosome, the frequency of transformation was rather high when compared with that of purified polyoma DNA, perhaps due to "position" effects or to the high efficiency of recombination of large DNA fragments. Images PMID:6100965

BlockLogo: visualization of peptide and sequence motif conservation

PubMed Central

Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian; Sun, Jing; Schönbach, Christian; Reinherz, Ellis L.; Zhang, Guang Lan; Brusic, Vladimir

2013-01-01

BlockLogo is a web-server application for visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes and B-cell epitopes (both continuous and discontinuous). Our additional example shows a visualization and analysis of structural motifs that determine specificity of peptide binding to HLA-DR molecules. The BlockLogo server also employs selected experimentally validated prediction algorithms to enable on-the-fly prediction of MHC binding affinity to 15 common HLA class I and class II alleles as well as visual analysis of discontinuous epitopes from multiple sequence alignments. It enables the visualization and analysis of structural and functional motifs that are usually described as regular expressions. It provides a compact view of discontinuous motifs composed of distant positions within biological sequences. BlockLogo is available at: http://research4.dfci.harvard.edu/cvc/blocklogo/ and http://methilab.bu.edu/blocklogo/ PMID:24001880

A streamlined method for analysing genome-wide DNA methylation patterns from low amounts of FFPE DNA.

PubMed

Ludgate, Jackie L; Wright, James; Stockwell, Peter A; Morison, Ian M; Eccles, Michael R; Chatterjee, Aniruddha

2017-08-31

Formalin fixed paraffin embedded (FFPE) tumor samples are a major source of DNA from patients in cancer research. However, FFPE is a challenging material to work with due to macromolecular fragmentation and nucleic acid crosslinking. FFPE tissue particularly possesses challenges for methylation analysis and for preparing sequencing-based libraries relying on bisulfite conversion. Successful bisulfite conversion is a key requirement for sequencing-based methylation analysis. Here we describe a complete and streamlined workflow for preparing next generation sequencing libraries for methylation analysis from FFPE tissues. This includes, counting cells from FFPE blocks and extracting DNA from FFPE slides, testing bisulfite conversion efficiency with a polymerase chain reaction (PCR) based test, preparing reduced representation bisulfite sequencing libraries and massively parallel sequencing. The main features and advantages of this protocol are: An optimized method for extracting good quality DNA from FFPE tissues. An efficient bisulfite conversion and next generation sequencing library preparation protocol that uses 50 ng DNA from FFPE tissue. Incorporation of a PCR-based test to assess bisulfite conversion efficiency prior to sequencing. We provide a complete workflow and an integrated protocol for performing DNA methylation analysis at the genome-scale and we believe this will facilitate clinical epigenetic research that involves the use of FFPE tissue.

N-Terminal Amino Acid Sequence Determination of Proteins by N-Terminal Dimethyl Labeling: Pitfalls and Advantages When Compared with Edman Degradation Sequence Analysis.

PubMed

Chang, Elizabeth; Pourmal, Sergei; Zhou, Chun; Kumar, Rupesh; Teplova, Marianna; Pavletich, Nikola P; Marians, Kenneth J; Erdjument-Bromage, Hediye

2016-07-01

In recent history, alternative approaches to Edman sequencing have been investigated, and to this end, the Association of Biomolecular Resource Facilities (ABRF) Protein Sequencing Research Group (PSRG) initiated studies in 2014 and 2015, looking into bottom-up and top-down N-terminal (Nt) dimethyl derivatization of standard quantities of intact proteins with the aim to determine Nt sequence information. We have expanded this initiative and used low picomole amounts of myoglobin to determine the efficiency of Nt-dimethylation. Application of this approach on protein domains, generated by limited proteolysis of overexpressed proteins, confirms that it is a universal labeling technique and is very sensitive when compared with Edman sequencing. Finally, we compared Edman sequencing and Nt-dimethylation of the same polypeptide fragments; results confirm that there is agreement in the identity of the Nt amino acid sequence between these 2 methods.

Solid phase sequencing of biopolymers

DOEpatents

Cantor, Charles; Koster, Hubert

2010-09-28

This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.

RNAfbinv: an interactive Java application for fragment-based design of RNA sequences.

PubMed

Weinbrand, Lina; Avihoo, Assaf; Barash, Danny

2013-11-15

In RNA design problems, it is plausible to assume that the user would be interested in preserving a particular RNA secondary structure motif, or fragment, for biological reasons. The preservation could be in structure or sequence, or both. Thus, the inverse RNA folding problem could benefit from considering fragment constraints. We have developed a new interactive Java application called RNA fragment-based inverse that allows users to insert an RNA secondary structure in dot-bracket notation. It then performs sequence design that conforms to the shape of the input secondary structure, the specified thermodynamic stability, the specified mutational robustness and the user-selected fragment after shape decomposition. In this shape-based design approach, specific RNA structural motifs with known biological functions are strictly enforced, while others can possess more flexibility in their structure in favor of preserving physical attributes and additional constraints. RNAfbinv is freely available for download on the web at http://www.cs.bgu.ac.il/~RNAexinv/RNAfbinv. The site contains a help file with an explanation regarding the exact use.

C-TERMINAL FRAGMENT OF TRANSFORMING GROWTH FACTOR BETA-INDUCED PROTEIN (TGFBIp) IS REQUIRED FOR APOPTOSIS IN HUMAN OSTEOSARCOMA CELLS

PubMed Central

Zamilpa, Rogelio; Rupaimoole, Rajesha; Phelix, Clyde F.; Somaraki-Cormier, Maria; Haskins, William; Asmis, Reto; LeBaron, Richard G.

2009-01-01

Transforming growth factor beta induced protein (TGFBIp), is secreted into the extracellular space. When fragmentation of C-terminal portions is blocked, apoptosis is low, even when the protein is overexpressed. If fragmentation occurs, apoptosis is observed. Whether full-length TGFBIp or integrin-binding fragments released from its C-terminus is necessary for apoptosis remains equivocal. More importantly, the exact portion of the C-terminus that conveys the pro-apoptotic property of TGFBIp is uncertain. It is reportedly within the final 166 amino acids. We sought to determine if this property is dependent upon the final 69 amino acids containing the integrin-binding, EPDIM and RGD, sequences. With MG-63 osteosarcoma cells, transforming growth factor (TGF)-β1 treatment increased expression of TGFBIp over 72 hours (p<0.001). At this time point, apoptosis was significantly increased (p<0.001) and was prevented by an anti-TGFBIp, polyclonal antibody (p<0.05). Overexpression of TGFBIp by transient transfection produced a 2-fold increase in apoptosis (p<0.01). Exogenous purified TGFBIp at concentrations of 37 to 150 nM produced a dose dependent increase in apoptosis (p<0.001). Mass spectrometry analysis of TGFBIp isolated from conditioned medium of cells treated with TGF-β1 revealed truncated forms of TGFBIp that lacked integrin-binding sequences in the C-terminus. Recombinant TGFBIp truncated, similarly, at amino acid 614 failed to induce apoptosis. A recombinant fragment encoding the final 69 amino acids of the TGFBIp C-terminus produced significant apoptosis. This apoptosis level was comparable to that induced by TGF-β1 upregulation of endogenous TGFBIp. Mutation of the integrin-binding sequence EPDIM, but not RGD, blocked apoptosis (p<0.001). These pro-apoptotic actions are dependent on the C-terminus most likely to interact with integrins. PMID:19505574

Molecular identification and phylogenetic study of Demodex caprae.

PubMed

Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

2014-10-01

The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

Characterization of Novel Fusaricidins Produced by Paenibacillus polymyxa-M1 Using MALDI-TOF Mass Spectrometry

NASA Astrophysics Data System (ADS)

Vater, Joachim; Niu, Ben; Dietel, Kristin; Borriss, Rainer

2015-09-01

Paenibacillus polymyxa-M1 is a potent producer of bioactive compounds, such as lipopeptides, polyketides, and lantibiotics of biotechnological and medical interest. Genome sequencing revealed nine gene clusters for nonribosomal biosynthesis of such agents. Here we report on the investigation of the fusaricidins, a complex of cyclic lipopeptides containing 15-guanidino-3-hydroxypentadecanoic acid (GHPD) as fatty acid component by matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). More than 20 variants of these compounds were detected and characterized in detail. Mass spectrometric sequence analysis was performed by MALDI-LIFT-TOF/TOF fragment analysis. The obtained product ion spectra show a specific processing in the fatty acid part. GHPD is cleaved between the α- and ß-position yielding two fragments a and b, one bearing the end-standing guanidine group and another one comprising the residual two C-atoms of GHPD with the attached peptide moiety. The complete sequence of all fusaricidins was derived from sets of bn- and yn-ions. The fusaricidin complex can be divided into four lipopeptide families, three of them showing variations of the amino acid in position 3, Val or Ile for the first and Tyr or Phe for families 2 and 3, respectively. A collection of novel fusaricidins was detected differing from those of families 1-3 by an additional residue of 71 Da (family 4). LIFT-TOF/TOF fragment spectra of these species imply that in their peptide moiety, an Ala-residue is attached by an ester bond to the free hydroxyl group of Thr4. More than 10 novel fusaricidins were characterized mass spectrometrically.

Mycobacterium marinum infections in fish and humans in Israel.

PubMed

Ucko, M; Colorni, A

2005-02-01

Israeli Mycobacterium marinum isolates from humans and fish were compared by direct sequencing of the 16S rRNA and hsp65 genes, restriction mapping, and amplified fragment length polymorphism analysis. Significant molecular differences separated all clinical isolates from the piscine isolates, ruling out the local aquaculture industry as the source of human infections.

Optimization and comparative analysis of plant organellar DNA enrichment methods suitable for next generation sequencing

USDA-ARS?s Scientific Manuscript database

Plant organellar genomes contain large repetitive elements that may undergo pairing or recombination to form complex structures and/or sub-genomic fragments. Organellar genomes also exist in admixtures within a given cell or tissue type (heteroplasmy) and abundance of sub-types may change through de...

RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF PCR-AMPLIFIED NIFH SEQUENCES FROM WETLAND PLANT RHIZOSPHERE COMMUNITIES

EPA Science Inventory

We describe a method to assess the community structure of N2-fixing bacteria in the rhizosphere. Total DNA was extracted from Spartina alterniflora and Sesbania macrocarpa root zones by bead-beating and purified by CsCl-EtBr gradient centrifugation. The average DNA yield was 5.5 ...

Molecular Typing of Australian Scedosporium Isolates Showing Genetic Variability and Numerous S. aurantiacum

PubMed Central

Delhaes, Laurence; Harun, Azian; Chen, Sharon C.A.; Nguyen, Quoc; Slavin, Monica; Heath, Christopher H.; Maszewska, Krystyna; Halliday, Catriona; Robert, Vincent; Sorrell, Tania C.

2008-01-01

One hundred clinical isolates from a prospective nationwide study of scedosporiosis in Australia (2003–2005) and 46 additional isolates were genotyped by internal transcribed spacer–restriction fragment length polymorphism (ITS-RFLP) analysis, ITS sequencing, and M13 PCR fingerprinting. ITS-RFLP and PCR fingerprinting identified 3 distinct genetic groups. The first group corresponded to Scedosporium prolificans (n = 83), and the other 2 comprised isolates previously identified as S. apiospermum: one of these corresponded to S. apiospermum (n = 33) and the other to the newly described species S. aurantiacum (n = 30). Intraspecies variation was highest for S. apiospermum (58%), followed by S. prolificans (45%) and S. aurantiacum (28%) as determined by PCR fingerprinting. ITS sequence variation of 2.2% was observed among S. apiospermum isolates. No correlation was found between genotype of strains and their geographic origin, body site from which they were cultured, or colonization versus invasive disease. Twelve S. prolificans isolates from 2 suspected case clusters were examined by amplified fragment length polymorphism analysis. No specific clusters were confirmed. PMID:18258122

First molecular investigation of Cryptosporidium spp. in young calves in Algeria.

PubMed

Benhouda, Djahida; Hakem, Ahcène; Sannella, Anna Rosa; Benhouda, Afaf; Cacciò, Simone M

2017-01-01

To date, no information is available on the prevalence and genetic identity of Cryptosporidium spp. in cattle in Algeria. In this study, 17 dairy farms in the province of Batna, located in the northeast of the country, were visited to collect 132 fecal samples from young calves (< 8 weeks old). Samples were examined microscopically using the modified Ziehl-Neelsen acid-fast staining method, and at least one sample per farm was submitted for molecular analysis. Amplification of a fragment of the small subunit ribosomal RNA gene was positive for 24 of the 61 samples (40%), and sequence analysis identified three species, namely Cryptosporidium bovis (n = 14), C. ryanae (n = 6), and C. parvum (n = 4). The C. parvum IIaA13G2R1 subtype, an uncommon zoonotic subtype, was identified in two isolates from a single farm by sequencing a fragment of the GP60 gene. This is the first report about genotyping and subtyping of Cryptosporidium in calves in Algeria. © D. Benhouda et al., published by EDP Sciences, 2017.

First molecular investigation of Cryptosporidium spp. in young calves in Algeria

PubMed Central

Benhouda, Djahida; Hakem, Ahcène; Sannella, Anna Rosa; Benhouda, Afaf; Cacciò, Simone M.

2017-01-01

To date, no information is available on the prevalence and genetic identity of Cryptosporidium spp. in cattle in Algeria. In this study, 17 dairy farms in the province of Batna, located in the northeast of the country, were visited to collect 132 fecal samples from young calves (< 8 weeks old). Samples were examined microscopically using the modified Ziehl-Neelsen acid-fast staining method, and at least one sample per farm was submitted for molecular analysis. Amplification of a fragment of the small subunit ribosomal RNA gene was positive for 24 of the 61 samples (40%), and sequence analysis identified three species, namely Cryptosporidium bovis (n = 14), C. ryanae (n = 6), and C. parvum (n = 4). The C. parvum IIaA13G2R1 subtype, an uncommon zoonotic subtype, was identified in two isolates from a single farm by sequencing a fragment of the GP60 gene. This is the first report about genotyping and subtyping of Cryptosporidium in calves in Algeria. PMID:28497744

Demonstration of retrotransposition of the Tf1 element in fission yeast.

PubMed

Levin, H L; Boeke, J D

1992-03-01

Tf1, a retrotransposon from fission yeast, has LTRs and coding sequences resembling the protease, reverse transcriptase and integrase domains of retroviral pol genes. A unique aspect of Tf1 is that it contains a single open reading frame whereas other retroviruses and retrotransposons usually possess two or more open reading frames. To determine whether Tf1 can transpose, we overproduced Tf1 transcripts encoded by a plasmid copy of the element marked with a neo gene. Approximately 0.1-4.0% of the cell population acquired chromosomally inherited resistance to G418. DNA blot analysis demonstrated that such strains had acquired both Tf1 and neo specific sequences within a restriction fragment of the same size; the size of this restriction fragment varied between different isolates. Structural analysis of the cloned DNA flanking the Tf1-neo element of two transposition candidates with the same regions in the parent strain showed that the ability to grow on G418 was due to transposition of Tf1-neo and not other types of recombination events.

Tentacle: distributed quantification of genes in metagenomes.

PubMed

Boulund, Fredrik; Sjögren, Anders; Kristiansson, Erik

2015-01-01

In metagenomics, microbial communities are sequenced at increasingly high resolution, generating datasets with billions of DNA fragments. Novel methods that can efficiently process the growing volumes of sequence data are necessary for the accurate analysis and interpretation of existing and upcoming metagenomes. Here we present Tentacle, which is a novel framework that uses distributed computational resources for gene quantification in metagenomes. Tentacle is implemented using a dynamic master-worker approach in which DNA fragments are streamed via a network and processed in parallel on worker nodes. Tentacle is modular, extensible, and comes with support for six commonly used sequence aligners. It is easy to adapt Tentacle to different applications in metagenomics and easy to integrate into existing workflows. Evaluations show that Tentacle scales very well with increasing computing resources. We illustrate the versatility of Tentacle on three different use cases. Tentacle is written for Linux in Python 2.7 and is published as open source under the GNU General Public License (v3). Documentation, tutorials, installation instructions, and the source code are freely available online at: http://bioinformatics.math.chalmers.se/tentacle.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The VP35 and VP40 proteins of filoviruses. Homology between Marburg and Ebola viruses.

PubMed

Bukreyev, A A; Volchkov, V E; Blinov, V M; Netesov, S V

1993-05-03

The fragments of genomic RNA sequences of Marburg (MBG) and Ebola (EBO) viruses are reported. These fragments were found to encode the VP35 and VP40 proteins. The canonic sequences were revealed before and after each open reading frame. It is suggested that these sequences are mRNA extremities and at the same time the regulatory elements for mRNA transcription. Homology between the MBG and EBO proteins was discovered.

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Identification of a 'Candidatus Phytoplasma hispanicum'-related strain, associated with yellows-type diseases, in smoke-tree sharpshooter (Homalodisca liturata Ball).

PubMed

Servín-Villegas, Rosalía; Caamal-Chan, Maria Goretty; Chavez-Medina, Alicia; Loera-Muro, Abraham; Barraza, Aarón; Medina-Hernández, Diana; Holguín-Peña, Ramón Jaime

2018-04-11

The 16SrXIII group from phytoplasma bacteria were identified in salivary glands from Homalodisca liturata, which were collected in El Comitán on the Baja California peninsula in Mexico. We were able to positively identify 15 16S rRNA gene sequences with the corresponding signature sequence of 'CandidatusPhytoplasma' (CAAGAYBATKATGTKTAGCYGGDCT) and in silico restriction fragment length polymorphism (RFLP) profiles (F value estimations) coupled with a phylogenetic analysis to confirm their relatedness to 'CandidatusPhytoplasma hispanicum', which in turn belongs to the 16SrXIII group. A restriction analysis was carried out with AluI and EcoRI to confirm that the five sequences belongs to subgroup D. The rest of the sequences did not exhibit any known RFLP profile related to a subgroup reported in the 16SrXIII group.

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

PubMed

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-09-24

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments

PubMed Central

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-01-01

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp. PMID:24019490

Construction of new EST-SSRs for Fusarium resistant wheat breeding.

PubMed

Yumurtaci, Aysen; Sipahi, Hulya; Al-Abdallat, Ayed; Jighly, Abdulqader; Baum, Michael

2017-06-01

Surveying Fusarium resistance in wheat with easy applicable molecular markers such as simple sequence repeats (SSRs) is a prerequest for molecular breeding. Expressed sequence tags (ESTs) are one of the main sources for development of new SSR candidates. Therefore, 18.292 publicly available wheat ESTs were mined and genotyping of newly developed 55 EST-SSR derived primer pairs produced clear fragments in ten wheat cultivars carrying different levels of Fusarium resistance. Among the proved markers, 23 polymorphic EST-SSRs were obtained and related alleles were mostly found on B and D genome. Based on the fragment profiling and similarity analysis, a 327bp amplicon, which was a product of contig 1207 (chromosome 5BL), was detected only in Fusarium head blight (FHB) resistant cultivars (CM82036 and Sumai) and the amino acid sequences showed a similarity to pathogen related proteins. Another FHB resistance related EST-SSR, Contig 556 (chromosome 1BL) produced a 151bp fragment in Sumai and was associated to wax2-like protein. A polymorphic 204bp fragment, derived from Contig 578 (chromosome 1DL), was generated from root rot (FRR) resistant cultivars (2-49; Altay2000 and Sunco). A total of 98 alleles were displayed with an average of 1.8 alleles per locus and the polymorphic information content (PIC) ranged from 0.11 to 0.78. Dendrogram tree with two main and five sub-groups were displayed the highest genetic relationship between FRR resistant cultivars (2-49 and Altay2000), FRR sensitive cultivars (Seri82 and Scout66) and FHB resistant cultivars (CM82036 and Sumai). Thus, exploitation of these candidate EST-SSRs may help to genotype other wheat sources for Fusarium resistance. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of expressed genes in cDNA library of hemocytes from the RLO-challenged oyster, Crassostrea ariakensis Gould with special functional implication of three complement-related fragments (CaC1q1, CaC1q2 and CaC3).

PubMed

Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong

2012-06-01

A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

PubMed

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

Identification of a novel astrovirus in domestic sheep in Hungary.

PubMed

Reuter, Gábor; Pankovics, Péter; Delwart, Eric; Boros, Ákos

2012-02-01

The family Astroviridae consists of two genera, Avastrovirus and Mamastrovirus, whose members are associated with gastroenteritis in avian and mammalian hosts, respectively. We serendipitously identified a novel ovine astrovirus in a fecal specimen from a domestic sheep (Ovis aries) in Hungary by viral metagenomic analysis. Sequencing of the fragment indicated that it was an ORF1b/ORF2/3'UTR sequence, and it has been submitted to the GenBank database as ovine astrovirus type 2 (OAstV-2/Hungary/2009) with accession number JN592482. The unique sequence characteristics and the phylogenetic position of OAstV-2 suggest that genetically divergent lineages of astroviruses exist in sheep.

Raman-based system for DNA sequencing-mapping and other separations

DOEpatents

Vo-Dinh, T.

1994-04-26

DNA sequencing and mapping are performed by using a Raman spectrometer with a surface enhanced Raman scattering (SERS) substrate to enhance the Raman signal. A SERS label is attached to a DNA fragment and then analyzed with the Raman spectrometer to identify the DNA fragment according to characteristics of the Raman spectrum generated. 11 figures.

Identification of genes associated with low furanocoumarin content in grapefruit.

PubMed

Chen, Chunxian; Yu, Qibin; Wei, Xu; Cancalon, Paul F; Gmitter, Fred G

2014-10-01

Some furanocoumarins in grapefruit (Citrus paradisi) are associated with the so-called grapefruit juice effect. Previous phytochemical quantification and genetic analysis suggested that the synthesis of these furanocoumarins may be controlled by a single gene in the pathway. In this study, cDNA-amplified fragment length polymorphism (cDNA-AFLP) analysis of fruit tissues was performed to identify the candidate gene(s) likely associated with low furanocoumarin content in grapefruit. Fifteen tentative differentially expressed fragments were cloned through the cDNA-AFLP analysis of the grapefruit variety Foster and its spontaneous low-furanocoumarin mutant Low Acid Foster. Sequence analysis revealed a cDNA-AFLP fragment, Contig 6, was homologous to a substrate-proved psoralen synthase gene, CYP71A22, and was part of citrus unigenes Cit.3003 and Csi.1332, and predicted genes Ciclev10004717m in mandarin and orange1.1g041507m in sweet orange. The two predicted genes contained the highly conserved motifs at one of the substrate recognition sites of CYP71A22. Digital gene expression profile showed the unigenes were expressed only in fruit and seed. Quantitative real-time PCR also proved Contig 6 was down-regulated in Low Acid Foster. These results showed the differentially expressed Contig 6 was related to the reduced furanocoumarin levels in the mutant. The identified fragment, homologs, unigenes, and genes may facilitate further furanocoumarin genetic study and grapefruit variety improvement.

K-sam, an amplified gene in stomach cancer, is a member of the heparin-binding growth factor receptor genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hattori, Yutaka; Odagiri, Hiroki; Nakatani, Hiroshi

1990-08-01

DNA fragments amplified in a stomach cancer-derived cell line, KATO-III, were previously identified by the in-gel DNA renaturation method, and a 0.2-kilobase-pair fragment of the amplified sequence was subsequently cloned. By genomic walking, a portion of the exon of the gene flanking this 0.2-kilobase-pair fragment was cloned, and the gene was designated as K-sam ({und K}ATO-III cell-derived {und s}tomach cancer {und am}plified gene). The K-sam cDNAs, corresponding to the 3.5-kilobase K-sam mRNA, were cloned from the KATO-III cells. Sequence analysis revealed that this gene coded for 682 amino acid residues that satisfied the characteristics of the receptor tyrosine kinase. Themore » K-sam gene had significant homologies with bek, FLG, and chicken basic fibroblast growth factor receptor gene. The K-sam gene was amplified in KATO-III cells with the major transcript of 3.5-kilobases in size. This gene was also expressed in some other stomach cancer cells, a small cell lung cancer, and germ cell tumors.« less

Method of inactivation of an end product of energy metabolism in Zymomonas mobilis

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Lakewood, CO

2008-05-20

The present invention briefly provides a method of site-specific insertion in Zymomonas, comprising, providing a Zymomonas gene fragment, interrupting a DNA sequence the fragment, and transforming the Zymomonas through homologous recombination with the interrupted fragment.

On-line LC-MS approach combining collision-induced dissociation (CID), electron-transfer dissociation (ETD), and CID of an isolated charge-reduced species for the trace-level characterization of proteins with post-translational modifications.

PubMed

Wu, Shiaw-Lin; Hühmer, Andreas F R; Hao, Zhiqi; Karger, Barry L

2007-11-01

We have expanded our recent on-line LC-MS platform for large peptide analysis to combine collision-induced dissociation (CID), electron-transfer dissociation (ETD), and CID of an isolated charge-reduced (CRCID) species derived from ETD to determine sites of phosphorylation and glycosylation modifications, as well as the sequence of large peptide fragments (i.e., 2000-10,000 Da) from complex proteins, such as beta-casein, epidermal growth factor receptor (EGFR), and tissue plasminogen activator (t-PA) at the low femtomol level. The incorporation of an additional CID activation step for a charge-reduced species, isolated from ETD fragment ions, improved ETD fragmentation when precursor ions with high m/z (approximately >1000) were automatically selected for fragmentation. Specifically, the identification of the exact phosphorylation sites was strengthened by the extensive coverage of the peptide sequence with a near-continuous product ion series. The identification of N-linked glycosylation sites in EGFR and an O-linked glycosylation site in t-PA were also improved through the enhanced identification of the peptide backbone sequence of the glycosylated precursors. The new strategy is a good starting survey scan to characterize enzymatic peptide mixtures over a broad range of masses using LC-MS with data-dependent acquisition, as the three activation steps can provide complementary information to each other. In general, large peptides can be extensively characterized by the ETD and CRCID steps, including sites of modification from the generated, near-continuous product ion series, supplemented by the CID-MS2 step. At the same time, small peptides (e.g.,

reSpect: Software for Identification of High and Low Abundance Ion Species in Chimeric Tandem Mass Spectra

PubMed Central

Shteynberg, David; Mendoza, Luis; Hoopmann, Michael R.; Sun, Zhi; Schmidt, Frank; Deutsch, Eric W.; Moritz, Robert L.

2016-01-01

Most shotgun proteomics data analysis workflows are based on the assumption that each fragment ion spectrum is explained by a single species of peptide ion isolated by the mass spectrometer; however, in reality mass spectrometers often isolate more than one peptide ion within the window of isolation that contributes to additional peptide fragment peaks in many spectra. We present a new tool called reSpect, implemented in the Trans-Proteomic Pipeline (TPP), that enables an iterative workflow whereby fragment ion peaks explained by a peptide ion identified in one round of sequence searching or spectral library search are attenuated based on the confidence of the identification, and then the altered spectrum is subjected to further rounds of searching. The reSpect tool is not implemented as a search engine, but rather as a post search engine processing step where only fragment ion intensities are altered. This enables the application of any search engine combination in the following iterations. Thus, reSpect is compatible with all other protein sequence database search engines as well as peptide spectral library search engines that are supported by the TPP. We show that while some datasets are highly amenable to chimeric spectrum identification and lead to additional peptide identification boosts of over 30% with as many as four different peptide ions identified per spectrum, datasets with narrow precursor ion selection only benefit from such processing at the level of a few percent. We demonstrate a technique that facilitates the determination of the degree to which a dataset would benefit from chimeric spectrum analysis. The reSpect tool is free and open source, provided within the TPP and available at the TPP website. PMID:26419769

Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism.

PubMed

Tan, Ming-pu

2010-01-01

Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.

reSpect: software for identification of high and low abundance ion species in chimeric tandem mass spectra.

PubMed

Shteynberg, David; Mendoza, Luis; Hoopmann, Michael R; Sun, Zhi; Schmidt, Frank; Deutsch, Eric W; Moritz, Robert L

2015-11-01

Most shotgun proteomics data analysis workflows are based on the assumption that each fragment ion spectrum is explained by a single species of peptide ion isolated by the mass spectrometer; however, in reality mass spectrometers often isolate more than one peptide ion within the window of isolation that contribute to additional peptide fragment peaks in many spectra. We present a new tool called reSpect, implemented in the Trans-Proteomic Pipeline (TPP), which enables an iterative workflow whereby fragment ion peaks explained by a peptide ion identified in one round of sequence searching or spectral library search are attenuated based on the confidence of the identification, and then the altered spectrum is subjected to further rounds of searching. The reSpect tool is not implemented as a search engine, but rather as a post-search engine processing step where only fragment ion intensities are altered. This enables the application of any search engine combination in the iterations that follow. Thus, reSpect is compatible with all other protein sequence database search engines as well as peptide spectral library search engines that are supported by the TPP. We show that while some datasets are highly amenable to chimeric spectrum identification and lead to additional peptide identification boosts of over 30% with as many as four different peptide ions identified per spectrum, datasets with narrow precursor ion selection only benefit from such processing at the level of a few percent. We demonstrate a technique that facilitates the determination of the degree to which a dataset would benefit from chimeric spectrum analysis. The reSpect tool is free and open source, provided within the TPP and available at the TPP website. Graphical Abstract ᅟ.

reSpect: Software for Identification of High and Low Abundance Ion Species in Chimeric Tandem Mass Spectra

NASA Astrophysics Data System (ADS)

Shteynberg, David; Mendoza, Luis; Hoopmann, Michael R.; Sun, Zhi; Schmidt, Frank; Deutsch, Eric W.; Moritz, Robert L.

2015-11-01

Most shotgun proteomics data analysis workflows are based on the assumption that each fragment ion spectrum is explained by a single species of peptide ion isolated by the mass spectrometer; however, in reality mass spectrometers often isolate more than one peptide ion within the window of isolation that contribute to additional peptide fragment peaks in many spectra. We present a new tool called reSpect, implemented in the Trans-Proteomic Pipeline (TPP), which enables an iterative workflow whereby fragment ion peaks explained by a peptide ion identified in one round of sequence searching or spectral library search are attenuated based on the confidence of the identification, and then the altered spectrum is subjected to further rounds of searching. The reSpect tool is not implemented as a search engine, but rather as a post-search engine processing step where only fragment ion intensities are altered. This enables the application of any search engine combination in the iterations that follow. Thus, reSpect is compatible with all other protein sequence database search engines as well as peptide spectral library search engines that are supported by the TPP. We show that while some datasets are highly amenable to chimeric spectrum identification and lead to additional peptide identification boosts of over 30% with as many as four different peptide ions identified per spectrum, datasets with narrow precursor ion selection only benefit from such processing at the level of a few percent. We demonstrate a technique that facilitates the determination of the degree to which a dataset would benefit from chimeric spectrum analysis. The reSpect tool is free and open source, provided within the TPP and available at the TPP website.

Library Design-Facilitated High-Throughput Sequencing of Synthetic Peptide Libraries.

PubMed

Vinogradov, Alexander A; Gates, Zachary P; Zhang, Chi; Quartararo, Anthony J; Halloran, Kathryn H; Pentelute, Bradley L

2017-11-13

A methodology to achieve high-throughput de novo sequencing of synthetic peptide mixtures is reported. The approach leverages shotgun nanoliquid chromatography coupled with tandem mass spectrometry-based de novo sequencing of library mixtures (up to 2000 peptides) as well as automated data analysis protocols to filter away incorrect assignments, noise, and synthetic side-products. For increasing the confidence in the sequencing results, mass spectrometry-friendly library designs were developed that enabled unambiguous decoding of up to 600 peptide sequences per hour while maintaining greater than 85% sequence identification rates in most cases. The reliability of the reported decoding strategy was additionally confirmed by matching fragmentation spectra for select authentic peptides identified from library sequencing samples. The methods reported here are directly applicable to screening techniques that yield mixtures of active compounds, including particle sorting of one-bead one-compound libraries and affinity enrichment of synthetic library mixtures performed in solution.

Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

PubMed

Saito, T; Ochiai, H

1999-10-01

cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

Genetic diversity analysis of Leuconostoc mesenteroides from Korean vegetables and food products by multilocus sequence typing.

PubMed

Sharma, Anshul; Kaur, Jasmine; Lee, Sulhee; Park, Young-Seo

2018-06-01

In the present study, 35 Leuconostoc mesenteroides strains isolated from vegetables and food products from South Korea were studied by multilocus sequence typing (MLST) of seven housekeeping genes (atpA, groEL, gyrB, pheS, pyrG, rpoA, and uvrC). The fragment sizes of the seven amplified housekeeping genes ranged in length from 366 to 1414 bp. Sequence analysis indicated 27 different sequence types (STs) with 25 of them being represented by a single strain indicating high genetic diversity, whereas the remaining 2 were characterized by five strains each. In total, 220 polymorphic nucleotide sites were detected among seven housekeeping genes. The phylogenetic analysis based on the STs of the seven loci indicated that the 35 strains belonged to two major groups, A (28 strains) and B (7 strains). Split decomposition analysis showed that intraspecies recombination played a role in generating diversity among strains. The minimum spanning tree showed that the evolution of the STs was not correlated with food source. This study signifies that the multilocus sequence typing is a valuable tool to access the genetic diversity among L. mesenteroides strains from South Korea and can be used further to monitor the evolutionary changes.

Study of infectious diseases in archaeological bone material - A dataset.

PubMed

Pucu, Elisa; Cascardo, Paula; Chame, Marcia; Felice, Gisele; Guidon, Niéde; Cleonice Vergne, Maria; Campos, Guadalupe; Roberto Machado-Silva, José; Leles, Daniela

2017-08-01

Bones of human and ground sloth remains were analyzed for presence of Trypanosoma cruzi by conventional PCR using primers TC, TC1 and TC2. Sequence results amplified a fragment with the same product size as the primers (300 and 350pb). Amplified PCR product was sequenced and analyzed on GenBank, using Blast. Although these sequences did not match with these parasites they showed high amplification with species of bacteria. This article presents the methodology used and the alignment of the sequences. The display of this dataset will allow further analysis of our results and discussion presented in the manuscript "Finding the unexpected: a critical view on molecular diagnosis of infectious diseases in archaeological samples" (Pucu et al. 2017) [1].

Lactobacillus fabifermentans sp. nov. and Lactobacillus cacaonum sp. nov., isolated from Ghanaian cocoa fermentations.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2009-01-01

Two Gram-positive bacterial strains, LMG 24284T and LMG 24285T, were isolated from different spontaneous cocoa bean heap fermentations in Ghana. Analysis of their 16S rRNA gene sequences indicated that they were members of the Lactobacillus plantarum and Lactobacillus salivarius species groups, respectively. DNA-DNA hybridization experiments with their nearest phylogenetic neighbours demonstrated that both strains represented novel species that could be differentiated from their nearest neighbours by pheS sequence analysis, whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism analysis and biochemical characterization. Therefore, two novel Lactobacillus species are proposed, Lactobacillus fabifermentans sp. nov. (type strain LMG 24284T =DSM 21115T) and Lactobacillus cacaonum sp. nov. (type strain LMG 24285T =DSM 21116T).

Applicability of SCAR markers to food genomics: olive oil traceability.

PubMed

Pafundo, Simona; Agrimonti, Caterina; Maestri, Elena; Marmiroli, Nelson

2007-07-25

DNA analysis with molecular markers has opened a shortcut toward a genomic comprehension of complex organisms. The availability of micro-DNA extraction methods, coupled with selective amplification of the smallest extracted fragments with molecular markers, could equally bring a breakthrough in food genomics: the identification of original components in food. Amplified fragment length polymorphisms (AFLPs) have been instrumental in plant genomics because they may allow rapid and reliable analysis of multiple and potentially polymorphic sites. Nevertheless, their direct application to the analysis of DNA extracted from food matrixes is complicated by the low quality of DNA extracted: its high degradation and the presence of inhibitors of enzymatic reactions. The conversion of an AFLP fragment to a robust and specific single-locus PCR-based marker, therefore, could extend the use of molecular markers to large-scale analysis of complex agro-food matrixes. In the present study is reported the development of sequence characterized amplified regions (SCARs) starting from AFLP profiles of monovarietal olive oils analyzed on agarose gel; one of these was used to identify differences among 56 olive cultivars. All the developed markers were purposefully amplified in olive oils to apply them to olive oil traceability.

Structural alphabets derived from attractors in conformational space

PubMed Central

2010-01-01

Background The hierarchical and partially redundant nature of protein structures justifies the definition of frequently occurring conformations of short fragments as 'states'. Collections of selected representatives for these states define Structural Alphabets, describing the most typical local conformations within protein structures. These alphabets form a bridge between the string-oriented methods of sequence analysis and the coordinate-oriented methods of protein structure analysis. Results A Structural Alphabet has been derived by clustering all four-residue fragments of a high-resolution subset of the protein data bank and extracting the high-density states as representative conformational states. Each fragment is uniquely defined by a set of three independent angles corresponding to its degrees of freedom, capturing in simple and intuitive terms the properties of the conformational space. The fragments of the Structural Alphabet are equivalent to the conformational attractors and therefore yield a most informative encoding of proteins. Proteins can be reconstructed within the experimental uncertainty in structure determination and ensembles of structures can be encoded with accuracy and robustness. Conclusions The density-based Structural Alphabet provides a novel tool to describe local conformations and it is specifically suitable for application in studies of protein dynamics. PMID:20170534

Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

PubMed Central

Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

2011-01-01

Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

Modularity of Protein Folds as a Tool for Template-Free Modeling of Structures.

PubMed

Vallat, Brinda; Madrid-Aliste, Carlos; Fiser, Andras

2015-08-01

Predicting the three-dimensional structure of proteins from their amino acid sequences remains a challenging problem in molecular biology. While the current structural coverage of proteins is almost exclusively provided by template-based techniques, the modeling of the rest of the protein sequences increasingly require template-free methods. However, template-free modeling methods are much less reliable and are usually applicable for smaller proteins, leaving much space for improvement. We present here a novel computational method that uses a library of supersecondary structure fragments, known as Smotifs, to model protein structures. The library of Smotifs has saturated over time, providing a theoretical foundation for efficient modeling. The method relies on weak sequence signals from remotely related protein structures to create a library of Smotif fragments specific to the target protein sequence. This Smotif library is exploited in a fragment assembly protocol to sample decoys, which are assessed by a composite scoring function. Since the Smotif fragments are larger in size compared to the ones used in other fragment-based methods, the proposed modeling algorithm, SmotifTF, can employ an exhaustive sampling during decoy assembly. SmotifTF successfully predicts the overall fold of the target proteins in about 50% of the test cases and performs competitively when compared to other state of the art prediction methods, especially when sequence signal to remote homologs is diminishing. Smotif-based modeling is complementary to current prediction methods and provides a promising direction in addressing the structure prediction problem, especially when targeting larger proteins for modeling.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

The histidine permease gene (HIP1) of Saccharomyces cerevisiae.

PubMed

Tanaka, J; Fink, G R

1985-01-01

The histidine-specific permease gene (HIP1) of Saccharomyces cerevisiae has been mapped, cloned, and sequenced. The HIP1 gene maps to the right arm of chromosome VII, approx. 11 cM distal to the ADE3 gene. The gene was isolated as an 8.6-kb BamHI-Sau3A fragment by complementation of the histidine-specific permease deficiency in recipient yeast cells. We sequenced a 2.4-kb subfragment of this BamHI-Sau3A fragment containing the HIP1 gene and identified a 1596-bp open reading frame (ORF). We confirmed the assignment of the 1596-bp ORF as the HIP1 coding sequence by sequencing a hip1 nonsense mutation. Analysis of the amino acid (aa) sequence of the HIP1 gene reveals several hydrophobic stretches, but shows no obvious N-terminal signal peptide. We have constructed a deletion of the HIP1 gene in vitro and replaced the wild-type copy of the gene with this deletion. The hip1 deletion mutant can grow when it is supplemented with 30 mM histidine, 50 times the amount required for the growth of HIP1 cells. Revertants of this deletion mutant able to grow on a normal level of histidine arise by mutation in unlinked genes. Both these observations suggest that there are additional, low-affinity pathways for histidine uptake.

Effectiveness of CID, HCD, and ETD with FT MS/MS for degradomic-peptidomic analysis: comparison of peptide identification methods

PubMed Central

Shen, Yufeng; Tolić, Nikola; Xie, Fang; Zhao, Rui; Purvine, Samuel O.; Schepmoes, Athena A.; Ronald, J. Moore; Anderson, Gordon A.; Smith, Richard D.

2011-01-01

We report on the effectiveness of CID, HCD, and ETD for LC-FT MS/MS analysis of peptides using a tandem linear ion trap-Orbitrap mass spectrometer. A range of software tools and analysis parameters were employed to explore the use of CID, HCD, and ETD to identify peptides isolated from human blood plasma without the use of specific “enzyme rules”. In the evaluation of an FDR-controlled SEQUEST scoring method, the use of accurate masses for fragments increased the numbers of identified peptides (by ~50%) compared to the use of conventional low accuracy fragment mass information, and CID provided the largest contribution to the identified peptide datasets compared to HCD and ETD. The FDR-controlled Mascot scoring method provided significantly fewer peptide identifications than with SEQUEST (by 1.3–2.3 fold) at the same confidence levels, and CID, HCD, and ETD provided similar contributions to identified peptides. Evaluation of de novo sequencing and the UStags method for more intense fragment ions revealed that HCD afforded more sequence consecutive residues (e.g., ≥7 amino acids) than either CID or ETD. Both the FDR-controlled SEQUEST and Mascot scoring methods provided peptide datasets that were affected by the decoy database and mass tolerances applied (e.g., the identical peptides between the datasets could be limited to ~70%), while the UStags method provided the most consistent peptide datasets (>90% overlap) with extremely low (near zero) numbers of false positive identifications. The m/z ranges in which CID, HCD, and ETD contributed the largest number of peptide identifications were substantially overlapping. This work suggests that the three peptide ion fragmentation methods are complementary, and that maximizing the number of peptide identifications benefits significantly from a careful match with the informatics tools and methods applied. These results also suggest that the decoy strategy may inaccurately estimate identification FDRs. PMID:21678914

Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

PubMed

Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

2002-12-01

The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes.

PubMed

Milbury, Coren A; Lee, Jung C; Cannone, Jamie J; Gaffney, Patrick M; Gutell, Robin R

2010-09-02

Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA) genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers.

PubMed

Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E M

2016-10-08

The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequencing, different barcodes can be inserted at each fragment end to either increase the number of multiplexed samples in the library or to use one of the barcodes as UMI. Alternatively, UMIs can be combined with the sample barcodes into composite barcodes, or with standard Illumina® indexing. Subsequent analysis must take read duplicates and sample identity into account, by identifying UMIs. Existing tools do not support these complex barcoding configurations and custom code development is frequently required. Here, we present Je, a suite of tools that accommodates complex barcoding strategies, extracts UMIs and filters read duplicates taking UMIs into account. Using Je on publicly available scRNA-seq and iCLIP data containing UMIs, the number of unique reads increased by up to 36 %, compared to when UMIs are ignored. Je is implemented in JAVA and uses the Picard API. Code, executables and documentation are freely available at http://gbcs.embl.de/Je . Je can also be easily installed in Galaxy through the Galaxy toolshed.

i-rDNA: alignment-free algorithm for rapid in silico detection of ribosomal gene fragments from metagenomic sequence data sets.

PubMed

Mohammed, Monzoorul Haque; Ghosh, Tarini Shankar; Chadaram, Sudha; Mande, Sharmila S

2011-11-30

Obtaining accurate estimates of microbial diversity using rDNA profiling is the first step in most metagenomics projects. Consequently, most metagenomic projects spend considerable amounts of time, money and manpower for experimentally cloning, amplifying and sequencing the rDNA content in a metagenomic sample. In the second step, the entire genomic content of the metagenome is extracted, sequenced and analyzed. Since DNA sequences obtained in this second step also contain rDNA fragments, rapid in silico identification of these rDNA fragments would drastically reduce the cost, time and effort of current metagenomic projects by entirely bypassing the experimental steps of primer based rDNA amplification, cloning and sequencing. In this study, we present an algorithm called i-rDNA that can facilitate the rapid detection of 16S rDNA fragments from amongst millions of sequences in metagenomic data sets with high detection sensitivity. Performance evaluation with data sets/database variants simulating typical metagenomic scenarios indicates the significantly high detection sensitivity of i-rDNA. Moreover, i-rDNA can process a million sequences in less than an hour on a simple desktop with modest hardware specifications. In addition to the speed of execution, high sensitivity and low false positive rate, the utility of the algorithmic approach discussed in this paper is immense given that it would help in bypassing the entire experimental step of primer-based rDNA amplification, cloning and sequencing. Application of this algorithmic approach would thus drastically reduce the cost, time and human efforts invested in all metagenomic projects. A web-server for the i-rDNA algorithm is available at http://metagenomics.atc.tcs.com/i-rDNA/

Topological Structure of the Space of Phenotypes: The Case of RNA Neutral Networks

PubMed Central

Aguirre, Jacobo; Buldú, Javier M.; Stich, Michael; Manrubia, Susanna C.

2011-01-01

The evolution and adaptation of molecular populations is constrained by the diversity accessible through mutational processes. RNA is a paradigmatic example of biopolymer where genotype (sequence) and phenotype (approximated by the secondary structure fold) are identified in a single molecule. The extreme redundancy of the genotype-phenotype map leads to large ensembles of RNA sequences that fold into the same secondary structure and can be connected through single-point mutations. These ensembles define neutral networks of phenotypes in sequence space. Here we analyze the topological properties of neutral networks formed by 12-nucleotides RNA sequences, obtained through the exhaustive folding of sequence space. A total of 412 sequences fragments into 645 subnetworks that correspond to 57 different secondary structures. The topological analysis reveals that each subnetwork is far from being random: it has a degree distribution with a well-defined average and a small dispersion, a high clustering coefficient, and an average shortest path between nodes close to its minimum possible value, i.e. the Hamming distance between sequences. RNA neutral networks are assortative due to the correlation in the composition of neighboring sequences, a feature that together with the symmetries inherent to the folding process explains the existence of communities. Several topological relationships can be analytically derived attending to structural restrictions and generic properties of the folding process. The average degree of these phenotypic networks grows logarithmically with their size, such that abundant phenotypes have the additional advantage of being more robust to mutations. This property prevents fragmentation of neutral networks and thus enhances the navigability of sequence space. In summary, RNA neutral networks show unique topological properties, unknown to other networks previously described. PMID:22028856

Mycobacterium marinum Infections in Fish and Humans in Israel

PubMed Central

Ucko, M.; Colorni, A.

2005-01-01

Israeli Mycobacterium marinum isolates from humans and fish were compared by direct sequencing of the 16S rRNA and hsp65 genes, restriction mapping, and amplified fragment length polymorphism analysis. Significant molecular differences separated all clinical isolates from the piscine isolates, ruling out the local aquaculture industry as the source of human infections. PMID:15695698

Protein sequence analysis, cloning, and expression of flammutoxin, a pore-forming cytolysin from Flammulina velutipes. Maturation of dimeric precursor to monomeric active form by carboxyl-terminal truncation.

PubMed

Tomita, Toshio; Mizumachi, Yoshihiro; Chong, Kang; Ogawa, Kanako; Konishi, Norihide; Sugawara-Tomita, Noriko; Dohmae, Naoshi; Hashimoto, Yohichi; Takio, Koji

2004-12-24

Flammutoxin (FTX), a 31-kDa pore-forming cytolysin from Flammulina velutipes, is specifically expressed during the fruiting body formation. We cloned and expressed the cDNA encoding a 272-residue protein with an identical N-terminal sequence with that of FTX but failed to obtain hemolytically active protein. This, together with the presence of multiple FTX family proteins in the mushroom, prompted us to determine the complete primary structure of FTX by protein sequence analysis. The N-terminal 72 and C-terminal 107 residues were sequenced by Edman degradation of the fragments generated from the alkylated FTX by enzymatic digestions with Achromobacter protease I or Staphylococcus aureus V8 protease and by chemical cleavages with CNBr, hydroxylamine, or 1% formic acid. The central part of FTX was sequenced with a surface-adhesive 7-kDa fragment, which was generated by a tryptic digestion of FTX and recovered by rinsing the wall of a test tube with 6 M guanidine HCl. The 7-kDa peptide was cleaved with 12 M HCl, thermolysin, or S. aureus V8 protease to produce smaller peptides for sequence analysis. As a result, FTX consisted of 251 residues, and protein and nucleotide sequences were in accord except for the lack of the initial Met and the C-terminal 20 residues in protein. Recombinant FTX (rFTX) with or without the C-terminal 20 residues (rFTX271 or rFTX251, respectively) was prepared to study the maturation process of FTX. Like natural FTX, rFTX251 existed as a monomer in solution and assembled into an SDS-stable, ring-shaped pore complex on human erythrocytes, causing hemolysis. In contrast, rFTX271, existing as a dimer in solution, bound to the cells but failed to form pore complex. The dimeric rFTX271 was converted to hemolytically active monomers upon the cleavage between Lys(251) and Met(252) by trypsin.

Molecular phylogeny for marine turtles based on sequences of the ND4-leucine tRNA and control regions of mitochondrial DNA.

PubMed

Dutton, P H; Davis, S K; Guerra, T; Owens, D

1996-06-01

Marine turtles are divided into two families, the Dermochelyidae and the Cheloniidae. The majority of species are currently placed within the two tribes of the Cheloniidae, the Chelonini and the Carettini, but debate continues over generic and tribal affinities as well as species boundaries. We used nucleotide sequences (907 bp) from the ND4-LEU tRNA region and the control region (526 bp) of mitochondrial DNA to resolve areas of uncertainty in marine turtle (Chelonioidae) systematics. The ND4-LEU tRNA fragment was more conserved than the fragment from the control region, with sequence divergences ranging from 0.026 to 0.148 and 0.067 to 0.267, respectively. Parsimony analysis based only on the ND4-LEU tRNA data suggests that the hawksbill, Eretmochelys imbricata, lies within the tribe Carettni and is closely related to the genus Caretta, but could not resolve the position of the flatback, Natator depressus. A similar analysis based only on the control region sequence data suggested that N. depressus is affiliated with the Chelonini, but failed to resolve the position of E. imbricata and the loggerhead, Caretta caretta. In contrast to these results, the combination of both data sets with published cytochrome b data produced a phylogeny based on 1924 bp of sequence data which resolves the position of E. imbricata relative to Caretta and Lepidochelys and joins N. depressus as sister to the Carettini. Based on the molecular data, the Chelonini contains the Chelonia species, while the Carettini contains the remaining species of Cheloniidae. The control region sequence divergence between Pacific and Atlantic populations of the leatherback, Dermochelys coriacea, was relatively low (0.0081) when compared with the green turtle, Chelonia mydas (0.071-0.074). Atlantic and Pacific populations of Ch. mydas were found to be paraphyletic with respect to the black turtle, Ch. agassizi, suggesting that the current taxonomic designations within the Pacific Chelonia are questionable. This analysis shows the utility of combining sequence data for different regions of mtDNA that by themselves are insufficient to obtain robust phylogenies.

A palindrome-mediated mechanism distinguishes translocations involving LCR-B of chromosome 22q11.2.

PubMed

Gotter, Anthony L; Shaikh, Tamim H; Budarf, Marcia L; Rhodes, C Harker; Emanuel, Beverly S

2004-01-01

Two known recurrent constitutional translocations, t(11;22) and t(17;22), as well as a non-recurrent t(4;22), display derivative chromosomes that have joined to a common site within the low copy repeat B (LCR-B) region of 22q11.2. This breakpoint is located between two AT-rich inverted repeats that form a nearly perfect palindrome. Breakpoints within the 11q23, 17q11 and 4q35 partner chromosomes also fall near the center of palindromic sequences. In the present work the breakpoints of a fourth translocation involving LCR-B, a balanced ependymoma-associated t(1;22), were characterized not only to localize this junction relative to known genes, but also to further understand the mechanism underlying these rearrangements. FISH mapping was used to localize the 22q11.2 breakpoint to LCR-B and the 1p21 breakpoint to single BAC clones. STS mapping narrowed the 1p21.2 breakpoint to a 1990 bp AT-rich region, and junction fragments were amplified by nested PCR. Junction fragment-derived sequence indicates that the 1p21.2 breakpoint splits a 278 nt palindrome capable of forming stem-loop secondary structure. In contrast, the 1p21.2 reference genomic sequence from clones in the database does not exhibit this configuration, suggesting a predisposition for regional genomic instability perhaps etiologic for this rearrangement. Given its similarity to known chromosomal fragile site (FRA) sequences, this polymorphic 1p21.2 sequence may represent one of the FRA1 loci. Comparative analysis of the secondary structure of sequences surrounding translocation breakpoints that involve LCR-B with those not involving this region indicate a unique ability of the former to form stem-loop structures. The relative likelihood of forming these configurations appears to be related to the rate of translocation occurrence. Further analysis suggests that constitutional translocations in general occur between sequences of similar melting temperature and propensity for secondary structure.

Purification and sequence analysis of 4-methyl-5-nitrocatechol oxygenase from Burkholderia sp. strain DNT.

PubMed Central

Haigler, B E; Suen, W C; Spain, J C

1996-01-01

4-Methyl-5-nitrocatechol (MNC) is an intermediate in the degradation of 2,4-dinitrotoluene by Burkholderia sp. strain DNT. In the presence of NADPH and oxygen, MNC monooxygenase catalyzes the removal of the nitro group from MNC to form 2-hydroxy-5-methylquinone. The gene (dntB) encoding MNC monooxygenase has been previously cloned and characterized. In order to examine the properties of MNC monooxygenase and to compare it with other enzymes, we sequenced the gene encoding the MNC monooxygenase and purified the enzyme from strain DNT. dntB was localized within a 2.2-kb ApaI DNA fragment. Sequence analysis of this fragment revealed an open reading frame of 1,644 bp with an N-terminal amino acid sequence identical to that of purified MNC monooxygenase from strain DNT. Comparison of the derived amino acid sequences with those of other genes showed that DntB contains the highly conserved ADP and flavin adenine dinucleotide (FAD) binding motifs characteristic of flavoprotein hydroxylases. MNC monooxygenase was purified to homogeneity from strain DNT by anion exchange and gel filtration chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single protein with a molecular weight of 60,200, which is consistent with the size determined from the gene sequence. The native molecular weight determined by gel filtration was 65,000, which indicates that the native enzyme is a monomer. It used either NADH or NADPH as electron donors, and NADPH was the preferred cofactor. The purified enzyme contained 1 mol of FAD per mol of protein, which is also consistent with the detection of an FAD binding motif in the amino acid sequence of DntB. MNC monooxygenase has a narrow substrate specificity. MNC and 4-nitrocatechol are good substrates whereas 3-methyl-4-nitrophenol, 3-methyl-4-nitrocatechol, 4-nitrophenol, 3-nitrophenol, and 4-chlorocatechol were not. These studies suggest that MNC monooxygenase is a flavoprotein that shares some properties with previously studied nitrophenol oxygenases. PMID:8830701

A palindrome-mediated mechanism distinguishes translocations involving LCR-B of chromosome 22q11.2

PubMed Central

Gotter, Anthony L.; Shaikh, Tamim H.; Budarf, Marcia L.; Rhodes, C. Harker; Emanuel, Beverly S.

2010-01-01

Two known recurrent constitutional translocations, t(11;22) and t(17;22), as well as a non-recurrent t(4;22), display derivative chromosomes that have joined to a common site within the low copy repeat B (LCR-B) region of 22q11.2. This breakpoint is located between two AT-rich inverted repeats that form a nearly perfect palindrome. Breakpoints within the 11q23, 17q11 and 4q35 partner chromosomes also fall near the center of palindromic sequences. In the present work the breakpoints of a fourth translocation involving LCR-B, a balanced ependymoma-associated t(1;22), were characterized not only to localize this junction relative to known genes, but also to further understand the mechanism underlying these rearrangements. FISH mapping was used to localize the 22q11.2 breakpoint to LCR-B and the 1p21 breakpoint to single BAC clones. STS mapping narrowed the 1p21.2 breakpoint to a 1990 bp AT-rich region, and junction fragments were amplified by nested PCR. Junction fragment-derived sequence indicates that the 1p21.2 breakpoint splits a 278 nt palindrome capable of forming stem–loop secondary structure. In contrast, the 1p21.2 reference genomic sequence from clones in the database does not exhibit this configuration, suggesting a predisposition for regional genomic instability perhaps etiologic for this rearrangement. Given its similarity to known chromosomal fragile site (FRA) sequences, this polymorphic 1p21.2 sequence may represent one of the FRA1 loci. Comparative analysis of the secondary structure of sequences surrounding translocation breakpoints that involve LCR-B with those not involving this region indicate a unique ability of the former to form stem–loop structures. The relative likelihood of forming these configurations appears to be related to the rate of translocation occurrence. Further analysis suggests that constitutional translocations in general occur between sequences of similar melting temperature and propensity for secondary structure. PMID:14613967

Phage display selection of fully human antibody fragments to inhibit growth-promoting effects of glycine-extended gastrin 17 on human colorectal cancer cells.

PubMed

Khajeh, Shirin; Tohidkia, Mohammad Reza; Aghanejad, Ayuob; Mehdipour, Tayebeh; Fathi, Farzaneh; Omidi, Yadollah

2018-06-09

Glycine-extended gastrin 17 (G17-Gly), a dominant processing intermediate of gastrin gene, has been implicated in the development or maintenance of colorectal cancers (CRCs). Hence, neutralizing G17-Gly activity by antibody entities can provide a potential therapeutic strategy in the patients with CRCs. To this end, we isolated fully human antibody fragments from a phage antibody library through biopanning against different epitopes of G17-Gly in order to obtain the highest possible antibody diversity. ELISA screening and sequence analysis identified 2 scFvs and 4 V L antibody fragments. Kinetic analysis of the antibody fragments by SPR revealed K D values to be in the nanomolar range (87.9-334 nM). The selected anti-G17-Gly antibody fragments were analyzed for growth inhibition and apoptotic assays in a CRC cell line, HCT-116, which is well-characterized for expressing gastrin intermediate species but not amidated gastrin. The antibody fragments exhibited significant inhibition of HCT-116 cells proliferation ranging from 36.5 to 73% of controls. Further, Annexin V/PI staining indicated that apoptosis rates of scFv H8 and V L G8 treated cells were 45.8 and 63%, respectively. Based on these results, we for the first time, demonstrated the isolation of anti-G17-Gly human scFv and V L antibodies with potential therapeutic applications in G17-Gly-responsive tumors.

[Homology analysis of the extended-V region of the surface proteins in different serotype Streptococcus mutans].

PubMed

He, Kui-Fang; Liu, Jian-Guo; Liu, Tian-Jia; Yang, De-Qin; Zhuang, Heng; Li, Song

2006-08-01

To analysis the homology among the extended-V region of the surface proteins in different serotype Streptococcus mutans (c, f, d, g) and to find out it's significance in anti-caries vaccine. The DNA of the bacteria (standarded serotype c, d, f, g and partial serotype c clinicals) was extracted and the extended-V region (SrV+, 1 384-2 514 bp) was amplified using polymerase chain reaction (PCR). Then the products were assessed using restriction fragment length polymorphism (RFLP) by endonuclease Dde I. The genotypings were sequenced and analysised using the program of BLAST on NCBI Gene Bank database. About 1.13 kb fragments were produced both in serotype c and f, the serotype d and g were failed. The RFLP results showed that five different patterns(A, B, C, D, E) among the 117 PCR products were reveled by Dde I. The ration of the genotypings A and B were the most among the strains, the C was lower, the D and E respectively was 1 and 3 strains per genotype. OMZ175 (serotype f) was belong to B genotype. Selected one of the A, B, C genotypings to sequenced and blasted. Then the results of the blastn showed that the identities of the gene sequence were 92%-98% between the serotype c and serotype f, part sequence of the serotype g was homology with the SrV+ of the serotype c, the protein sequence among serotype c, d, f, g were 77%-82%. It is reasonable to use some putative pipetides to study the anti-caries vaccine among the extended-V regions of the surface proteins in different serotype (c, d, f, g) in S. mutans.

Molecular analysis of the glucocerebrosidase gene locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winfield, S.L.; Martin, B.M.; Fandino, A.

1994-09-01

Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less

Fragmentation of tRNA in Phytophthora infestans asexual life cycle stages and during host plant infection.

PubMed

Åsman, Anna K M; Vetukuri, Ramesh R; Jahan, Sultana N; Fogelqvist, Johan; Corcoran, Pádraic; Avrova, Anna O; Whisson, Stephen C; Dixelius, Christina

2014-12-10

The oomycete Phytophthora infestans possesses active RNA silencing pathways, which presumably enable this plant pathogen to control the large numbers of transposable elements present in its 240 Mb genome. Small RNAs (sRNAs), central molecules in RNA silencing, are known to also play key roles in this organism, notably in regulation of critical effector genes needed for infection of its potato host. To identify additional classes of sRNAs in oomycetes, we mapped deep sequencing reads to transfer RNAs (tRNAs) thereby revealing the presence of 19-40 nt tRNA-derived RNA fragments (tRFs). Northern blot analysis identified abundant tRFs corresponding to half tRNA molecules. Some tRFs accumulated differentially during infection, as seen by examining sRNAs sequenced from P. infestans-potato interaction libraries. The putative connection between tRF biogenesis and the canonical RNA silencing pathways was investigated by employing hairpin RNA-mediated RNAi to silence the genes encoding P. infestans Argonaute (PiAgo) and Dicer (PiDcl) endoribonucleases. By sRNA sequencing we show that tRF accumulation is PiDcl1-independent, while Northern hybridizations detected reduced levels of specific tRNA-derived species in the PiAgo1 knockdown line. Our findings extend the sRNA diversity in oomycetes to include fragments derived from non-protein-coding RNA transcripts and identify tRFs with elevated levels during infection of potato by P. infestans.

Molecular genetic analysis of the V kappa Ser group associated with two mouse light chain genetic markers. Complementary DNA cloning and southern hybridization analysis

PubMed Central

1985-01-01

Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938

Structural determination of intact proteins using mass spectrometry

DOEpatents

Kruppa, Gary [San Francisco, CA; Schoeniger, Joseph S [Oakland, CA; Young, Malin M [Livermore, CA

2008-05-06

The present invention relates to novel methods of determining the sequence and structure of proteins. Specifically, the present invention allows for the analysis of intact proteins within a mass spectrometer. Therefore, preparatory separations need not be performed prior to introducing a protein sample into the mass spectrometer. Also disclosed herein are new instrumental developments for enhancing the signal from the desired modified proteins, methods for producing controlled protein fragments in the mass spectrometer, eliminating complex microseparations, and protein preparatory chemical steps necessary for cross-linking based protein structure determination.Additionally, the preferred method of the present invention involves the determination of protein structures utilizing a top-down analysis of protein structures to search for covalent modifications. In the preferred method, intact proteins are ionized and fragmented within the mass spectrometer.

Corn and culture in central andean prehistory.

PubMed

Johannessen, S; Hastorf, C A

1989-05-12

The prehistoric development and spread of domesticated maize varieties in the highlands of Peru, unlike the drier coastal deserts, is little known because ancient maize remains in this area survive mainly as fragments, kernels, and cob parts. An analysis of fragmented charred maize from prehistoric households (A.D.450 to 1500) in the Mantaro Valley reveals a developmental sequence of maize varieties for Highland Peru. The evidence indicates an adoption of large-kernelled maize varieties beginning in the Late Intermediate (A.D. 1000). This is centuries later than a similar change in maize, associated with the Wari expansion, that occurred in coastal areas, and indicates minimal Wari impact in the Mantaro Valley.

Cloning and Expression of Synthetic Genes Encoding the Broad Antimicrobial Spectrum Bacteriocins SRCAM 602, OR-7, E-760, and L-1077, by Recombinant Pichia pastoris

PubMed Central

Jiménez, Juan J.; Gútiez, Loreto; Cintas, Luis M.; Herranz, Carmen; Hernández, Pablo E.

2015-01-01

We have evaluated the cloning and functional expression of previously described broad antimicrobial spectrum bacteriocins SRCAM 602, OR-7, E-760, and L-1077, by recombinant Pichia pastoris. Synthetic genes, matching the codon usage of P. pastoris, were designed from the known mature amino acid sequence of these bacteriocins and cloned into the protein expression vector pPICZαA. The recombinant derived plasmids were linearized and transformed into competent P. pastoris X-33, and the presence of integrated plasmids into the transformed cells was confirmed by PCR and sequencing of the inserts. The antimicrobial activity, expected in supernatants of the recombinant P. pastoris producers, was purified using a multistep chromatographic procedure including ammonium sulfate precipitation, desalting by gel filtration, cation exchange-, hydrophobic interaction-, and reverse phase-chromatography (RP-FPLC). However, a measurable antimicrobial activity was only detected after the hydrophobic interaction and RP-FPLC steps of the purified supernatants. MALDI-TOF MS analysis of the antimicrobial fractions eluted from RP-FPLC revealed the existence of peptide fragments of lower and higher molecular mass than expected. MALDI-TOF/TOF MS analysis of selected peptides from eluted RP-FPLC samples with antimicrobial activity indicated the presence of peptide fragments not related to the amino acid sequence of the cloned bacteriocins. PMID:25821820

Molecular biological researches of Kuro-Koji molds, their classification and safety.

PubMed

Yamada, Osamu; Takara, Ryo; Hamada, Ryoko; Hayashi, Risa; Tsukahara, Masatoshi; Mikami, Shigeaki

2011-09-01

To assess the position of Kuro-Koji molds in black Aspergillus, we performed sequence analysis of approximately 2500 nucleotides of partial gene fragments, such as histone 3, on a total of 57 Aspergillus strains, including Aspergillus kawachii NBRC 4308, 12 Kuro-Koji molds isolated from awamori breweries in Japan, Aspergillus niger ATCC 1015, and A. tubingensis ATCC10550. Sequence results showed that all black Aspergillus strains could be classified into 3 types, type N which includes A. niger ATCC 1015, type T which includes A. tubingensis ATCC 10550, and type L which includes A. kawachii NBRC 4308. Phylogenetic analysis showed these three types belong to different clusters. All 12 Kuro-Koji molds isolated from awamori breweries were classified as type L, thus we concluded type L represents the industrial Kuro-Koji molds. We found all type L strains lack the An15g07920 gene which is required for ochratoxin A biosynthesis in black Aspergillus. This sequence is present in the genome of A. niger CBS 513.88 and has homology to the polyketide synthase fragment of A. ochraceus which is involved in ochratoxin A biosynthesis. Based on the industrial importance and the safety of Kuro-Koji molds, we propose to classify the type L strains as Aspergillus luchuensis, as initially reported by Dr. Inui. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Antibody engineering of a cytotoxic monoclonal antibody 84 against human embryonic stem cells: Investigating the effects of multivalency on cytotoxicity.

PubMed

Klement, Maximilian; Zheng, Jiyun; Liu, Chengcheng; Tan, Heng-Liang; Wong, Victor Vai Tak; Choo, Andre Boon-Hwa; Lee, Dong-Yup; Ow, Dave Siak-Wei

2017-02-10

Antibody fragments have shown targeted specificity to their antigens, but only modest tissue retention times in vivo and in vitro. Multimerization has been used as a protein engineering tool to increase the number of binding units and thereby enhance the efficacy and retention time of antibody fragments. In this work, we explored the effects of valency using a series of self-assembling polypeptides based on the GCN4 leucine zipper multimerization domain fused to a single-chain variable fragment via an antibody upper hinge sequence. Four engineered antibody fragments with a valency from one to four antigen-binding units of a cytotoxic monoclonal antibody 84 against human embryonic stem cells (hESC) were constructed. We hypothesized that higher cytotoxicity would be observed for fragments with increased valency. Flow cytometry analysis revealed that the trimeric and tetrameric engineered antibody fragments resulted in the highest degree of cytotoxicity to the undifferentiated hESC, while the engineered antibody fragments were observed to have improved tissue penetration into cell clusters. Thus, a trade off was made for the trimeric versus tetrameric fragment due to improved tissue penetration. These results have direct implications for antibody-mediated removal of undifferentiated hESC during regenerative medicine and cell therapy. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

PubMed

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Isolation and determination of the primary structure of a lectin protein from the serum of the American alligator (Alligator mississippiensis).

PubMed

Darville, Lancia N F; Merchant, Mark E; Maccha, Venkata; Siddavarapu, Vivekananda Reddy; Hasan, Azeem; Murray, Kermit K

2012-02-01

Mass spectrometry in conjunction with de novo sequencing was used to determine the amino acid sequence of a 35kDa lectin protein isolated from the serum of the American alligator that exhibits binding to mannose. The protein N-terminal sequence was determined using Edman degradation and enzymatic digestion with different proteases was used to generate peptide fragments for analysis by liquid chromatography tandem mass spectrometry (LC MS/MS). Separate analysis of the protein digests with multiple enzymes enhanced the protein sequence coverage. De novo sequencing was accomplished using MASCOT Distiller and PEAKS software and the sequences were searched against the NCBI database using MASCOT and BLAST to identify homologous peptides. MS analysis of the intact protein indicated that it is present primarily as monomer and dimer in vitro. The isolated 35kDa protein was ~98% sequenced and found to have 313 amino acids and nine cysteine residues and was identified as an alligator lectin. The alligator lectin sequence was aligned with other lectin sequences using DIALIGN and ClustalW software and was found to exhibit 58% and 59% similarity to both human and mouse intelectin-1. The alligator lectin exhibited strong binding affinities toward mannan and mannose as compared to other tested carbohydrates. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification and characterization of Burkholderia multivorans CCA53.

PubMed

Akita, Hironaga; Kimura, Zen-Ichiro; Yusoff, Mohd Zulkhairi Mohd; Nakashima, Nobutaka; Hoshino, Tamotsu

2017-07-06

A lignin-degrading bacterium, Burkholderia sp. CCA53, was previously isolated from leaf soil. The purpose of this study was to determine phenotypic and biochemical features of Burkholderia sp. CCA53. Multilocus sequence typing (MLST) analysis based on fragments of the atpD, gltD, gyrB, lepA, recA and trpB gene sequences was performed to identify Burkholderia sp. CCA53. The MLST analysis revealed that Burkholderia sp. CCA53 was tightly clustered with B. multivorans ATCC BAA-247 T . The quinone and cellular fatty acid profiles, carbon source utilization, growth temperature and pH were consistent with the characteristics of B. multivorans species. Burkholderia sp. CCA53 was therefore identified as B. multivorans CCA53.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Characterization of the 3p12.3-pcen region associated with tumor suppression in a novel ovarian cancer cell line model genetically modified by chromosome 3 fragment transfer.

PubMed

Cody, Neal A L; Shen, Zhen; Ripeau, Jean-Sebastien; Provencher, Diane M; Mes-Masson, Anne-Marie; Chevrette, Mario; Tonin, Patricia N

2009-12-01

The genetic analysis of nontumorigenic radiation hybrids generated by transfer of chromosome 3 fragments into the tumorigenic OV-90 ovarian cancer cell line identified the 3p12.3-pcen region as a candidate tumor suppressor gene (TSG) locus. In the present study, polymorphic microsatellite repeat analysis of the hybrids further defined the 3p12.3-pcen interval to a 16.1 Mb common region containing 12 known or hypothetical genes: 3ptel-ROBO2-ROBO1-GBE1-CADM2-VGLL3-CHMP2B-POU1F1-HTR1F-CGGBP1-ZNF654-C3orf38-EPHA3-3pcen. Seven of these genes, ROBO1, GBE1, VGLL3, CHMP2B, CGGBP1, ZNF654, and C3orf38, exhibited gene expression in the hybrids, placing them as top TSG candidates for further analysis. The expression of all but one (VGLL3) of these genes was also detected in the parental OV-90 cell line. Mutations were not identified in a comparative sequence analysis of the predicted protein coding regions of these candidates in OV-90 and donor normal chromosome 3 contig. However, the nondeleterious sequence variants identified in the transcribed regions distinguished parent of origin alleles for ROBO1, VGLL3, CHMP2B, and CGGBP1 and cDNA sequencing of the hybrids revealed biallelic expression of these genes. Interestingly, underexpression of VGLL3 and ZNF654 were observed in malignant ovarian tumor samples as compared with primary cultures of normal ovarian surface epithelial cells or benign ovarian tumors, and this occurred regardless of allelic content of 3p12.3-pcen. The results taken together suggest that dysregulation of VGLL3 and/or ZNF654 expression may have affected pathways important in ovarian tumorigenesis which was offset by the transfer of chromosome 3 fragments in OV-90, a cell line hemizygous for 3p.

Genetic and Epigenetic Alterations of Brassica nigra Introgression Lines from Somatic Hybridization: A Resource for Cauliflower Improvement.

PubMed

Wang, Gui-Xiang; Lv, Jing; Zhang, Jie; Han, Shuo; Zong, Mei; Guo, Ning; Zeng, Xing-Ying; Zhang, Yue-Yun; Wang, You-Ping; Liu, Fan

2016-01-01

Broad phenotypic variations were obtained previously in derivatives from the asymmetric somatic hybridization of cauliflower "Korso" (Brassica oleracea var. botrytis, 2n = 18, CC genome) and black mustard "G1/1" (Brassica nigra, 2n = 16, BB genome). However, the mechanisms underlying these variations were unknown. In this study, 28 putative introgression lines (ILs) were pre-selected according to a series of morphological (leaf shape and color, plant height and branching, curd features, and flower traits) and physiological (black rot/club root resistance) characters. Multi-color fluorescence in situ hybridization revealed that these plants contained 18 chromosomes derived from "Korso." Molecular marker (65 simple sequence repeats and 77 amplified fragment length polymorphisms) analysis identified the presence of "G1/1" DNA segments (average 7.5%). Additionally, DNA profiling revealed many genetic and epigenetic differences among the ILs, including sequence alterations, deletions, and variation in patterns of cytosine methylation. The frequency of fragments lost (5.1%) was higher than presence of novel bands (1.4%), and the presence of fragments specific to Brassica carinata (BBCC 2n = 34) were common (average 15.5%). Methylation-sensitive amplified polymorphism analysis indicated that methylation changes were common and that hypermethylation (12.4%) was more frequent than hypomethylation (4.8%). Our results suggested that asymmetric somatic hybridization and alien DNA introgression induced genetic and epigenetic alterations. Thus, these ILs represent an important, novel germplasm resource for cauliflower improvement that can be mined for diverse traits of interest to breeders and researchers.

Recombination of polynucleotide sequences using random or defined primers

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

2000-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Recombination of polynucleotide sequences using random or defined primers

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

2001-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Sequence analysis of chloroplast chlB gene of medicinal Ephedra species and its application to authentication of Ephedra Herb.

PubMed

Guo, Yahong; Tsuruga, Ayako; Yamaguchi, Shigeharu; Oba, Koji; Iwai, Kasumi; Sekita, Setsuko; Mizukami, Hajime

2006-06-01

Chloroplast chlB gene encoding subunit B of light-independent protochlorophyllide reductase was amplified from herbarium and crude drug specimens of Ephedra sinica, E. intermedia, E. equisetina, and E. przewalskii. Sequence comparison of the chlB gene indicated that all the E. sinica specimens have the same sequence type (Type S) distinctive from other species, while there are two sequence types (Type E1 and Type E2) in E. equisetina. E. intermedia and E. prezewalskii revealed an identical sequence type (Type IP). E. sinica was also identified by digesting the chlB fragment with Bcl I. A novel method for DNA authentication of Ephedra Herb based on the sequences of the chloroplast chlB gene and internal transcribed spacer of nuclear rRNA genes was developed and successfully applied for identification of the crude drugs obtained in the Chinese market.

Merozoite surface protein-1 genetic diversity in Plasmodium malariae and Plasmodium brasilianum from Brazil.

PubMed

Guimarães, Lilian O; Wunderlich, Gerhard; Alves, João M P; Bueno, Marina G; Röhe, Fabio; Catão-Dias, José L; Neves, Amanda; Malafronte, Rosely S; Curado, Izilda; Domingues, Wilson; Kirchgatter, Karin

2015-11-16

The merozoite surface protein 1 (MSP1) gene encodes the major surface antigen of invasive forms of the Plasmodium erythrocytic stages and is considered a candidate vaccine antigen against malaria. Due to its polymorphisms, MSP1 is also useful for strain discrimination and consists of a good genetic marker. Sequence diversity in MSP1 has been analyzed in field isolates of three human parasites: P. falciparum, P. vivax, and P. ovale. However, the extent of variation in another human parasite, P. malariae, remains unknown. This parasite shows widespread, uneven distribution in tropical and subtropical regions throughout South America, Asia, and Africa. Interestingly, it is genetically indistinguishable from P. brasilianum, a parasite known to infect New World monkeys in Central and South America. Specific fragments (1 to 5) covering 60 % of the MSP1 gene (mainly the putatively polymorphic regions), were amplified by PCR in isolates of P. malariae and P. brasilianum from different geographic origin and hosts. Sequencing of the PCR-amplified products or cloned PCR fragments was performed and the sequences were used to construct a phylogenetic tree by the maximum likelihood method. Data were computed to give insights into the evolutionary and phylogenetic relationships of these parasites. Except for fragment 4, sequences from all other fragments consisted of unpublished sequences. The most polymorphic gene region was fragment 2, and in samples where this region lacks polymorphism, all other regions are also identical. The low variability of the P. malariae msp1 sequences of these isolates and the identification of the same haplotype in those collected many years apart at different locations is compatible with a low transmission rate. We also found greater diversity among P. brasilianum isolates compared with P. malariae ones. Lastly, the sequences were segregated according to their geographic origins and hosts, showing a strong genetic and geographic structure. Our data show that there is a low level of sequence diversity and a possible absence of allelic dimorphism of MSP1 in these parasites as opposed to other Plasmodium species. P. brasilianum strains apparently show greater divergence in comparison to P. malariae, thus P. malariae could derive from P. brasilianum, as it has been proposed.

Sensitive Next-Generation Sequencing Method Reveals Deep Genetic Diversity of HIV-1 in the Democratic Republic of the Congo.

PubMed

Rodgers, Mary A; Wilkinson, Eduan; Vallari, Ana; McArthur, Carole; Sthreshley, Larry; Brennan, Catherine A; Cloherty, Gavin; de Oliveira, Tulio

2017-03-15

As the epidemiological epicenter of the human immunodeficiency virus (HIV) pandemic, the Democratic Republic of the Congo (DRC) is a reservoir of circulating HIV strains exhibiting high levels of diversity and recombination. In this study, we characterized HIV specimens collected in two rural areas of the DRC between 2001 and 2003 to identify rare strains of HIV. The env gp41 region was sequenced and characterized for 172 HIV-positive specimens. The env sequences were predominantly subtype A (43.02%), but 7 other subtypes (33.14%), 20 circulating recombinant forms (CRFs; 11.63%), and 20 unclassified (11.63%) sequences were also found. Of the rare and unclassified subtypes, 18 specimens were selected for next-generation sequencing (NGS) by a modified HIV-switching mechanism at the 5' end of the RNA template (SMART) method to obtain full-genome sequences. NGS produced 14 new complete genomes, which included pure subtype C ( n = 2), D ( n = 1), F1 ( n = 1), H ( n = 3), and J ( n = 1) genomes. The two subtype C genomes and one of the subtype H genomes branched basal to their respective subtype branches but had no evidence of recombination. The remaining 6 genomes were complex recombinants of 2 or more subtypes, including subtypes A1, F, G, H, J, and K and unclassified fragments, including one subtype CRF25 isolate, which branched basal to all CRF25 references. Notably, all recombinant subtype H fragments branched basal to the H clade. Spatial-geographical analysis indicated that the diverse sequences identified here did not expand globally. The full-genome and subgenomic sequences identified in our study population significantly increase the documented diversity of the strains involved in the continually evolving HIV-1 pandemic. IMPORTANCE Very little is known about the ancestral HIV-1 strains that founded the global pandemic, and very few complete genome sequences are available from patients in the Congo Basin, where HIV-1 expanded early in the global pandemic. By sequencing a subgenomic fragment of the HIV-1 envelope from study participants in the DRC, we identified rare variants for complete genome sequencing. The basal branching of some of the complete genome sequences that we recovered suggests that these strains are more closely related to ancestral HIV-1 strains than to previously reported strains and is evidence that the local diversification of HIV in the DRC continues to outpace the diversity of global strains decades after the emergence of the pandemic. Copyright © 2017 Rodgers et al.

Recombination enhances HIV-1 envelope diversity by facilitating the survival of latent genomic fragments in the plasma virus population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Immonen, Taina T.; Conway, Jessica M.; Romero-Severson, Ethan O.

HIV-1 is subject to immune pressure exerted by the host, giving variants that escape the immune response an advantage. Virus released from activated latent cells competes against variants that have continually evolved and adapted to host immune pressure. Nevertheless, there is increasing evidence that virus displaying a signal of latency survives in patient plasma despite having reduced fitness due to long-term immune memory. We investigated the survival of virus with latent envelope genomic fragments by simulating within-host HIV-1 sequence evolution and the cycling of viral lineages in and out of the latent reservoir. Our model incorporates a detailed mutation processmore » including nucleotide substitution, recombination, latent reservoir dynamics, diversifying selection pressure driven by the immune response, and purifying selection pressure asserted by deleterious mutations. We evaluated the ability of our model to capture sequence evolution in vivo by comparing our simulated sequences to HIV-1 envelope sequence data from 16 HIV-infected untreated patients. Empirical sequence divergence and diversity measures were qualitatively and quantitatively similar to those of our simulated HIV-1 populations, suggesting that our model invokes realistic trends of HIV-1 genetic evolution. Moreover, reconstructed phylogenies of simulated and patient HIV-1 populations showed similar topological structures. Our simulation results suggest that recombination is a key mechanism facilitating the persistence of virus with latent envelope genomic fragments in the productively infected cell population. Recombination increased the survival probability of latent virus forms approximately 13-fold. Prevalence of virus with latent fragments in productively infected cells was observed in only 2% of simulations when we ignored recombination, while the proportion increased to 27% of simulations when we allowed recombination. We also found that the selection pressures exerted by different fitness landscapes influenced the shape of phylogenies, diversity trends, and survival of virus with latent genomic fragments. Furthermore, our model predicts that the persistence of latent genomic fragments from multiple different ancestral origins increases sequence diversity in plasma for reasonable fitness landscapes.« less

Recombination enhances HIV-1 envelope diversity by facilitating the survival of latent genomic fragments in the plasma virus population

DOE PAGES

Immonen, Taina T.; Conway, Jessica M.; Romero-Severson, Ethan O.; ...

2015-12-22

HIV-1 is subject to immune pressure exerted by the host, giving variants that escape the immune response an advantage. Virus released from activated latent cells competes against variants that have continually evolved and adapted to host immune pressure. Nevertheless, there is increasing evidence that virus displaying a signal of latency survives in patient plasma despite having reduced fitness due to long-term immune memory. We investigated the survival of virus with latent envelope genomic fragments by simulating within-host HIV-1 sequence evolution and the cycling of viral lineages in and out of the latent reservoir. Our model incorporates a detailed mutation processmore » including nucleotide substitution, recombination, latent reservoir dynamics, diversifying selection pressure driven by the immune response, and purifying selection pressure asserted by deleterious mutations. We evaluated the ability of our model to capture sequence evolution in vivo by comparing our simulated sequences to HIV-1 envelope sequence data from 16 HIV-infected untreated patients. Empirical sequence divergence and diversity measures were qualitatively and quantitatively similar to those of our simulated HIV-1 populations, suggesting that our model invokes realistic trends of HIV-1 genetic evolution. Moreover, reconstructed phylogenies of simulated and patient HIV-1 populations showed similar topological structures. Our simulation results suggest that recombination is a key mechanism facilitating the persistence of virus with latent envelope genomic fragments in the productively infected cell population. Recombination increased the survival probability of latent virus forms approximately 13-fold. Prevalence of virus with latent fragments in productively infected cells was observed in only 2% of simulations when we ignored recombination, while the proportion increased to 27% of simulations when we allowed recombination. We also found that the selection pressures exerted by different fitness landscapes influenced the shape of phylogenies, diversity trends, and survival of virus with latent genomic fragments. Furthermore, our model predicts that the persistence of latent genomic fragments from multiple different ancestral origins increases sequence diversity in plasma for reasonable fitness landscapes.« less

[Cloning and sequence analysis of tomato fruit-specific E8 promoter from Lycopersicon esculentum (Zhongshu No.5)].

PubMed

Zhou, Xiao-hong; Chen, Xiao-guang; Zhang, Xiao-dong; Wang, Ya-nan; Li, Lin; Xi, Jia-fei; Hu, Jian-jun

2003-01-01

To obtain the gene encoding tomato fruit-specific E8 promoter therefore to prepare for exogenous gene transcription and expression in transgenic tomato fruit. The cotyledons of tomato Lycopersicon esculentum (Zhongshu No.5) were collected for extracting the genomic DNA of this plant. The fruit-specific E81.1 and E82.2 promoter DNA were then amplified by PCR, the product of which was subcloned into pGEM-T vector. After identification by restriction enzymes, the recombinant T-vectors were subjected to sequence analysis. The fragments of the promoter as amplified by PCR were of predicted length. Digestion with Xba I and Hind III /BamH I proved correct insertion of the target fragments with expected length into the recombinant T vectors. As indicated by homology analysis, the resultant tomato fruit-specific E8 promoter was highly conservative, and E82.2 promoter of Zhongshu No.5, with GenBank submission number of AF515784, proved to share 99% homology with E82.2 promoter of Zhongshu No.5 Cherry as reported by Deikman J. Tomato fruit-specific E8 promoter of Zhongshu No.5 has been successfully cloned, thus making possible the subsequent research in oral vaccine of transgenic tomato.

A highly optimized grid deployment: the metagenomic analysis example.

PubMed

Aparicio, Gabriel; Blanquer, Ignacio; Hernández, Vicente

2008-01-01

Computational resources and computationally expensive processes are two topics that are not growing at the same ratio. The availability of large amounts of computing resources in Grid infrastructures does not mean that efficiency is not an important issue. It is necessary to analyze the whole process to improve partitioning and submission schemas, especially in the most critical experiments. This is the case of metagenomic analysis, and this text shows the work done in order to optimize a Grid deployment, which has led to a reduction of the response time and the failure rates. Metagenomic studies aim at processing samples of multiple specimens to extract the genes and proteins that belong to the different species. In many cases, the sequencing of the DNA of many microorganisms is hindered by the impossibility of growing significant samples of isolated specimens. Many bacteria cannot survive alone, and require the interaction with other organisms. In such cases, the information of the DNA available belongs to different kinds of organisms. One important stage in Metagenomic analysis consists on the extraction of fragments followed by the comparison and analysis of their function stage. By the comparison to existing chains, whose function is well known, fragments can be classified. This process is computationally intensive and requires of several iterations of alignment and phylogeny classification steps. Source samples reach several millions of sequences, which could reach up to thousands of nucleotides each. These sequences are compared to a selected part of the "Non-redundant" database which only implies the information from eukaryotic species. From this first analysis, a refining process is performed and alignment analysis is restarted from the results. This process implies several CPU years. The article describes and analyzes the difficulties to fragment, automate and check the above operations in current Grid production environments. This environment has been tuned-up from an experimental study which has tested the most efficient and reliable resources, the optimal job size, and the data transference and database reindexation overhead. The environment should re-submit faulty jobs, detect endless tasks and ensure that the results are correctly retrieved and workflow synchronised. The paper will give an outline on the structure of the system, and the preparation steps performed to deal with this experiment.

Characterization of a new qQq-FTICR mass spectrometer for post-translational modification analysis and top-down tandem mass spectrometry of whole proteins.

PubMed

Jebanathirajah, Judith A; Pittman, Jason L; Thomson, Bruce A; Budnik, Bogdan A; Kaur, Parminder; Rape, Michael; Kirschner, Marc; Costello, Catherine E; O'Connor, Peter B

2005-12-01

The use of a new electrospray qQq Fourier transform ion cyclotron mass spectrometer (qQq-FTICR MS) instrument for biologic applications is described. This qQq-FTICR mass spectrometer was designed for the study of post-translationally modified proteins and for top-down analysis of biologically relevant protein samples. The utility of the instrument for the analysis of phosphorylation, a common and important post-translational modification, was investigated. Phosphorylation was chosen as an example because it is ubiquitous and challenging to analyze. In addition, the use of the instrument for top-down sequencing of proteins was explored since this instrument offers particular advantages to this approach. Top-down sequencing was performed on different proteins, including commercially available proteins and biologically derived samples such as the human E2 ubiquitin conjugating enzyme, UbCH10. A good sequence tag was obtained for the human UbCH10, allowing the unambiguous identification of the protein. The instrument was built with a commercially produced front end: a focusing rf-only quadrupole (Q0), followed by a resolving quadrupole (Q1), and a LINAC quadrupole collision cell (Q2), in combination with an FTICR mass analyzer. It has utility in the analysis of samples found in substoichiometric concentrations, as ions can be isolated in the mass resolving Q1 and accumulated in Q2 before analysis in the ICR cell. The speed and efficacy of the Q2 cooling and fragmentation was demonstrated on an LCMS-compatible time scale, and detection limits for phosphopeptides in the 10 amol/muL range (pM) were demonstrated. The instrument was designed to make several fragmentation methods available, including nozzle-skimmer fragmentation, Q2 collisionally activated dissociation (Q2 CAD), multipole storage assisted dissociation (MSAD), electron capture dissociation (ECD), infrared multiphoton induced dissociation (IRMPD), and sustained off resonance irradiation (SORI) CAD, thus allowing a variety of MS(n) experiments. A particularly useful aspect of the system was the use of Q1 to isolate ions from complex mixtures with narrow windows of isolation less than 1 m/z. These features enable top-down protein analysis experiments as well structural characterization of minor components of complex mixtures.

Application of denaturing gradient gel electrophoresis (DGGE) to the analysis of microbial communities of subgingival plaque.

PubMed

Fujimoto, C; Maeda, H; Kokeguchi, S; Takashiba, S; Nishimura, F; Arai, H; Fukui, K; Murayama, Y

2003-08-01

Denaturing gradient gel electrophoresis (DGGE) was applied to the microbiologic examination of subgingival plaque. The PCR primers were designed from conserved nucleotide sequences on 16S ribosomal RNA gene (16SrDNA) with GC rich clamp at the 5'-end. Polymerase chain reaction (PCR) was performed using the primers and genomic DNAs of typical periodontal bacteria. The generated 16SrDNA fragments were separated by denaturing gel. Although the sizes of the amplified DNA fragments were almost the same among the species, 16SrDNAs of the periodontal bacteria were distinguished according to their specific sequences. The microflora of clinical plaque samples were profiled by the PCR-DGGE method, and the dominant 16SrDNA bands were cloned and sequenced. Simultaneously, Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis and Prevotella intermedia were detected by an ordinary PCR method. In the deep periodontal pockets, the bacterial community structures were complicated and P. gingivalis was the most dominant species, whereas the DGGE profiles were simple and Streptococcus or Neisseria species were dominant in the shallow pockets. The species-specific PCR method revealed the presence of A. actinomycetemcomitans, P. gingivalis and P. intermedia in the clinical samples. However, corresponding bands were not always observed in the DGGE profiles, indicating a lower sensitivity of the DGGE method. Although the DGGE method may have a lower sensitivity than the ordinary PCR methods, it could visualize the bacterial qualitative compositions and reveal the major species of the plaque. The DGGE analysis and following sequencing may have the potential to be a promising bacterial examination procedure in periodontal diseases.

Shifts in phylogenetic diversity of archaeal communities in mangrove sediments at different sites and depths in southeastern Brazil.

PubMed

Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui

2012-06-01

This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (<18% of sequences shared) than sites (>25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of plant genes regulated in resistant potato Solanum sparsipilum during the early stages of infection by Globodera pallida.

PubMed

Jolivet, Katell; Grenier, Eric; Bouchet, Jean-Paul; Esquibet, Magali; Kerlan, Marie-Claire; Caromel, Bernard; Mugniéry, Didier; Lefebvre, Véronique

2007-04-01

Using a complementary (c)DNA-amplified fragment length polymorphism (AFLP) approach, we investigated differential gene expression linked to resistance mechanisms during the incompatible potato - Globodera pallida interaction. Expression was compared between a resistant and a susceptible potato clone, inoculated or not inoculated with G. pallida. These clones were issued from a cross between the resistant Solanum sparsipilum spl329.18 accession and the susceptible dihaploid S. tuberosum Caspar H3, and carried, respectively, resistant and susceptible alleles at the resistance quantitative trait loci (QTLs). Analysis was done on root fragments picked up at 4 time points, during a period of 6 days after infection, from penetration of the nematode in the root to degradation of the feeding site in resistant plants. A total of 2560 transcript-derived fragments (TDFs) were analyzed, resulting in the detection of 46 TDFs that were up- or downregulated. The number of TDFs that were up- or downregulated increased with time after inoculation. The majority of TDFs were upregulated at only 1 or 2 time points in response to infection. After isolation and sequencing of the TDFs of interest, a subset of 36 sequences were identified, among which 22 matched plant sequences and 2 matched nematode sequences. Some of the TDFs that matched plant genes showed clear homologies to genes involved in cell-cycle regulation, transcription regulation, resistance downstream signalling pathways, and defense mechanisms. Other sequences with homologies to plant genes of unknown function or without any significant similarity to known proteins were also found. Although not exhaustive, these results represent the most extensive list of genes with altered RNA levels after the incompatible G. pallida-potato interaction that has been published to date. The function of these genes could provide insight into resistance or plant defense mechanisms during incompatible potato-cyst nematode interactions.

Specific Detection of Clavibacter michiganensis subsp. sepedonicus by Amplification of Three Unique DNA Sequences Isolated by Subtraction Hybridization.

PubMed

Mills, D; Russell, B W; Hanus, J W

1997-08-01

ABSTRACT Three single-copy, unique DNA fragments, designated Cms50, Cms72, and Cms85, were isolated from strain CS3 of Clavibacter michiganensis subsp. sepedonicus by subtraction hybridization using driver DNA from C. michiganensis subsp. insidiosus, C. michiganensis subsp. michiganensis, and Rhodococcus facians. Radio-labeled probes made of these fragments and used in Southern blot analysis revealed each to be absolutely specific to all North American C. michiganensis subsp. sepedonicus strains tested, including plasmidless and nonmucoid strains. The probes have no homology with genomic DNA from related C. michiganensis subspecies insidiosus, michiganensis, and tessellarius, nor with DNA from 11 additional bacterial species and three unidentified strains, some of which have been previously reported to display cross-reactivity with C. michiganensis subsp. sepedonicus-specific antisera. The three fragments shared no homology, and they appeared to be separated from each other by at least 20 kbp in the CS3 genome. Internal primer sets permitted amplification of each fragment by the polymerase chain reaction (PCR) only from C. michiganensis subsp. sepedonicus DNA. In a PCR-based sensitivity assay using a primer set that amplifies Cms85, the lowest level of detection of C. michiganensis subsp. sepedonicus was 100 CFU per milliliter when cells were added to potato core fluid. Erroneous results that may arise from PCR artifacts and mutational events are, therefore, minimized by the redundancy of the primer sets, and the products should be verifiable with unique capture probes in sequence-based detection systems.

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

PubMed

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

PubMed Central

Martin, William F.

2017-01-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

Evidence for Sequence Scrambling and Divergent H/D Exchange Reactions of Doubly-Charged Isobaric b-Type Fragment Ions

NASA Astrophysics Data System (ADS)

Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H.; Somogyi, Arpad; Solouki, Touradj

2014-02-01

To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10 2+ that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10 2+ and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10 2+, suggesting that b10 2+ may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10 2+; over 30 % of the observed SORI-CID fragment ions from substance P b10 2+ had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10 2+, whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10 2+.

Evidence for sequence scrambling and divergent H/D exchange reactions of doubly-charged isobaric b-type fragment ions.

PubMed

Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H; Somogyi, Arpad; Solouki, Touradj

2014-02-01

To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10(2+) that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10(2+) and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10(2+), suggesting that b10(2+) may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10(2+); over 30% of the observed SORI-CID fragment ions from substance P b10(2+) had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10(2+), whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10(2+).

[Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

PubMed

Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

2015-08-01

In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum

PubMed Central

DANESHPARVAR, Afrooz; MOWLAVI, Gholamreza; MIRJALALI, Hamed; HAJJARAN, Homa; MOBEDI, Iraj; NADDAF, Saeed Reza; SHIDFAR, Mohammadreza; SADAT MAKKI, Mahsa

2017-01-01

Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites. PMID:28761482

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

PubMed

Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

2017-01-01

Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

Highly sensitive luciferase reporter assay using a potent destabilization sequence of calpain 3.

PubMed

Yasunaga, Mayu; Murotomi, Kazutoshi; Abe, Hiroko; Yamazaki, Tomomi; Nishii, Shigeaki; Ohbayashi, Tetsuya; Oshimura, Mitsuo; Noguchi, Takako; Niwa, Kazuki; Ohmiya, Yoshihiro; Nakajima, Yoshihiro

2015-01-20

Reporter assays that use luciferases are widely employed for monitoring cellular events associated with gene expression in vitro and in vivo. To improve the response of the luciferase reporter to acute changes of gene expression, a destabilization sequence is frequently used to reduce the stability of luciferase protein in the cells, which results in an increase of sensitivity of the luciferase reporter assay. In this study, we identified a potent destabilization sequence (referred to as the C9 fragment) consisting of 42 amino acid residues from human calpain 3 (CAPN3). Whereas the half-life of Emerald Luc (ELuc) from the Brazilian click beetle Pyrearinus termitilluminans was reduced by fusing PEST (t1/2=9.8 to 2.8h), the half-life of C9-fused ELuc was significantly shorter (t1/2=1.0h) than that of PEST-fused ELuc when measurements were conducted at 37°C. In addition, firefly luciferase (luc2) was also markedly destabilized by the C9 fragment compared with the humanized PEST sequence. These results indicate that the C9 fragment from CAPN3 is a much more potent destabilization sequence than the PEST sequence. Furthermore, real-time bioluminescence recording of the activation kinetics of nuclear factor-κB after transient treatment with tumor necrosis factor α revealed that the response of C9-fused ELuc is significantly greater than that of PEST-fused ELuc, demonstrating that the use of the C9 fragment realizes a luciferase reporter assay that has faster response speed compared with that provided by the PEST sequence. Copyright © 2014 Elsevier B.V. All rights reserved.

Protection against β-amyloid neurotoxicity by a non-toxic endogenous N-terminal β-amyloid fragment and its active hexapeptide core sequence.

PubMed

Forest, Kelly H; Alfulaij, Naghum; Arora, Komal; Taketa, Ruth; Sherrin, Tessi; Todorovic, Cedomir; Lawrence, James L M; Yoshikawa, Gene T; Ng, Ho-Leung; Hruby, Victor J; Nichols, Robert A

2018-01-01

High levels (μM) of beta amyloid (Aβ) oligomers are known to trigger neurotoxic effects, leading to synaptic impairment, behavioral deficits, and apoptotic cell death. The hydrophobic C-terminal domain of Aβ, together with sequences critical for oligomer formation, is essential for this neurotoxicity. However, Aβ at low levels (pM-nM) has been shown to function as a positive neuromodulator and this activity resides in the hydrophilic N-terminal domain of Aβ. An N-terminal Aβ fragment (1-15/16), found in cerebrospinal fluid, was also shown to be a highly active neuromodulator and to reverse Aβ-induced impairments of long-term potentiation. Here, we show the impact of this N-terminal Aβ fragment and a shorter hexapeptide core sequence in the Aβ fragment (Aβcore: 10-15) to protect or reverse Aβ-induced neuronal toxicity, fear memory deficits and apoptotic death. The neuroprotective effects of the N-terminal Aβ fragment and Aβcore on Aβ-induced changes in mitochondrial function, oxidative stress, and apoptotic neuronal death were demonstrated via mitochondrial membrane potential, live reactive oxygen species, DNA fragmentation and cell survival assays using a model neuroblastoma cell line (differentiated NG108-15) and mouse hippocampal neuron cultures. The protective action of the N-terminal Aβ fragment and Aβcore against spatial memory processing deficits in amyloid precursor protein/PSEN1 (5XFAD) mice was demonstrated in contextual fear conditioning. Stabilized derivatives of the N-terminal Aβcore were also shown to be fully protective against Aβ-triggered oxidative stress. Together, these findings indicate an endogenous neuroprotective role for the N-terminal Aβ fragment, while active stabilized N-terminal Aβcore derivatives offer the potential for therapeutic application. © 2017 International Society for Neurochemistry.

Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic).

PubMed

Kartashov, Mikhail Yu; Glushkova, Ludmila I; Mikryukova, Tamara P; Korabelnikov, Igor V; Egorova, Yulia I; Tupota, Natalia L; Protopopova, Elena V; Konovalova, Svetlana N; Ternovoi, Vladimir A; Loktev, Valery B

2017-06-01

The number of tick-borne infections in the northern European regions of Russia has increased considerably in the last years. In the present study, 676 unfed adult Ixodes persulcatus ticks were collected in the Komi Republic from 2011 to 2013 to study tick-borne rickettsioses. Rickettsia spp. DNA was detected by PCR in 51 (7.6%) ticks. The nucleotide sequence analysis of gltA fragments (765bp) from 51 ticks indicated that 60.8% and 39.2% of the ticks were infected with Rickettsia helvetica and Candidatus R. tarasevichiae, respectively. The gltA fragments showed 100% identity with those of Candidatus R. tarasevichiae previously discovered in Siberia and China, whereas R. helvetica showed 99.9% sequence identity with European isolates. The ompB had 8 nucleotide substitutions, 6 of which resulted in amino acid substitutions. In the sca9 gene, 3 nucleotide substitutions were detected, and only one resulted in amino acid substitution. The smpA, ompW, and β-lactamase genes of R. helvetica also showed a high level of sequence identity. Copyright © 2017 Elsevier GmbH. All rights reserved.

Intrapopulation polymorphism in Anopheles messeae (An. maculipennis complex) inferred by molecular analysis.

PubMed

Di Luca, Marco; Boccolini, Daniela; Marinuccil, Marino; Romi, Roberto

2004-07-01

We evaluated the internal transcribed spacer two (ITS2) sequence to detect intraspecific polymorphism in the Palearctic Anopheles maculipennis complex, analyzing 52 populations from 12 countries and representing six species. For An. messene, two fragments of the cytochrome oxidase I (COI) gene were also evaluated. The results were compared with GenBank sequences and data from the literature. ITS2 analysis revealed evident intraspecific polymorphism for An. messeae and a slightly less evident polymorphism for An. melanoon, whereas for each of the other species, 100% identity was found among populations. ITS2 analysis of An. messeae identified five haplotypes that were consistent with the geographical origin of the populations. ITS2 seems to be a reliable marker of intraspecific polymorphism for this complex, whereas the COI gene is apparently uninformative.

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

PubMed Central

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P < 0.001). Our findings suggest that lysogeny has increased the ability of some S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

PubMed

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

Interspecific and intraspecific gene variability in a 1-Mb region containing the highest density of NBS-LRR genes found in the melon genome.

PubMed

González, Víctor M; Aventín, Núria; Centeno, Emilio; Puigdomènech, Pere

2014-12-17

Plant NBS-LRR -resistance genes tend to be found in clusters, which have been shown to be hot spots of genome variability. In melon, half of the 81 predicted NBS-LRR genes group in nine clusters, and a 1 Mb region on linkage group V contains the highest density of R-genes and presence/absence gene polymorphisms found in the melon genome. This region is known to contain the locus of Vat, an agronomically important gene that confers resistance to aphids. However, the presence of duplications makes the sequencing and annotation of R-gene clusters difficult, usually resulting in multi-gapped sequences with higher than average errors. A 1-Mb sequence that contains the largest NBS-LRR gene cluster found in melon was improved using a strategy that combines Illumina paired-end mapping and PCR-based gap closing. Unknown sequence was decreased by 70% while about 3,000 SNPs and small indels were corrected. As a result, the annotations of 18 of a total of 23 NBS-LRR genes found in this region were modified, including additional coding sequences, amino acid changes, correction of splicing boundaries, or fussion of ORFs in common transcription units. A phylogeny analysis of the R-genes and their comparison with syntenic sequences in other cucurbits point to a pattern of local gene amplifications since the diversification of cucurbits from other families, and through speciation within the family. A candidate Vat gene is proposed based on the sequence similarity between a reported Vat gene from a Korean melon cultivar and a sequence fragment previously absent in the unrefined sequence. A sequence refinement strategy allowed substantial improvement of a 1 Mb fragment of the melon genome and the re-annotation of the largest cluster of NBS-LRR gene homologues found in melon. Analysis of the cluster revealed that resistance genes have been produced by sequence duplication in adjacent genome locations since the divergence of cucurbits from other close families, and through the process of speciation within the family a candidate Vat gene was also identified using sequence previously unavailable, which demonstrates the advantages of genome assembly refinements when analyzing complex regions such as those containing clusters of highly similar genes.

Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

PubMed

Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

1989-05-01

Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

Cloning, sequence analysis, and expression in Escherichia coli of a gene coding for a. beta. -mannanase from the extremely thermophilic bacterium Caldocellum saccharolyticum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luethi, E.; Jasmat, N.B.; Grayling, R.A.

1991-03-01

A {lambda} recombinant phage expressing {beta}-mannanase activity in Escherichia coli has been isolated from a genomic library of the extremely thermophilic anaerobe Caldocellum saccharolyticum. The gene was cloned into pBR322 on a 5-kb BamHI fragment, and its location was obtained by deletion analysis. The sequence of a 2.1-kb fragment containing the mannanase gene has been determined. One open reading frame was found which could code for a protein of M{sub r} 38,904. The mannanase gene (manA) was overexpressed in E. coli by cloning the gene downstream from the lacZ promoter of pUC18. The enzyme was most active at pH 6more » and 80 C and degraded locust bean gum, guar gum, Pinus radiata glucomannan, and konjak glucomannan. The noncoding region downstream from the mannanase gene showed strong homology to celB, a gene coding for a cellulase from the same organism, suggesting that the manA gene might have been inserted into its present position on the C. saccharolyticum genome by homologous recombination.« less

Comparison of seven techniques for typing international epidemic strains of Clostridium difficile: restriction endonuclease analysis, pulsed-field gel electrophoresis, PCR-ribotyping, multilocus sequence typing, multilocus variable-number tandem-repeat analysis, amplified fragment length polymorphism, and surface layer protein A gene sequence typing.

PubMed

Killgore, George; Thompson, Angela; Johnson, Stuart; Brazier, Jon; Kuijper, Ed; Pepin, Jacques; Frost, Eric H; Savelkoul, Paul; Nicholson, Brad; van den Berg, Renate J; Kato, Haru; Sambol, Susan P; Zukowski, Walter; Woods, Christopher; Limbago, Brandi; Gerding, Dale N; McDonald, L Clifford

2008-02-01

Using 42 isolates contributed by laboratories in Canada, The Netherlands, the United Kingdom, and the United States, we compared the results of analyses done with seven Clostridium difficile typing techniques: multilocus variable-number tandem-repeat analysis (MLVA), amplified fragment length polymorphism (AFLP), surface layer protein A gene sequence typing (slpAST), PCR-ribotyping, restriction endonuclease analysis (REA), multilocus sequence typing (MLST), and pulsed-field gel electrophoresis (PFGE). We assessed the discriminating ability and typeability of each technique as well as the agreement among techniques in grouping isolates by allele profile A (AP-A) through AP-F, which are defined by toxinotype, the presence of the binary toxin gene, and deletion in the tcdC gene. We found that all isolates were typeable by all techniques and that discrimination index scores for the techniques tested ranged from 0.964 to 0.631 in the following order: MLVA, REA, PFGE, slpAST, PCR-ribotyping, MLST, and AFLP. All the techniques were able to distinguish the current epidemic strain of C. difficile (BI/027/NAP1) from other strains. All of the techniques showed multiple types for AP-A (toxinotype 0, binary toxin negative, and no tcdC gene deletion). REA, slpAST, MLST, and PCR-ribotyping all included AP-B (toxinotype III, binary toxin positive, and an 18-bp deletion in tcdC) in a single group that excluded other APs. PFGE, AFLP, and MLVA grouped two, one, and two different non-AP-B isolates, respectively, with their AP-B isolates. All techniques appear to be capable of detecting outbreak strains, but only REA and MLVA showed sufficient discrimination to distinguish strains from different outbreaks.

Fluorescent Amplified-Fragment Length Polymorphism Genotyping of Neisseria meningitidis Identifies Clones Associated with Invasive Disease

PubMed Central

Goulding, Jonathan N.; Hookey, John V.; Stanley, John; Olver, Will; Neal, Keith R.; Ala'Aldeen, Dlawer A. A.; Arnold, Catherine

2000-01-01

Fluorescent amplified-fragment length polymorphism (FAFLP), a genotyping technique with phylogenetic significance, was applied to 123 isolates of Neisseria meningitidis. Nine of these were from an outbreak in a British university; 9 were from a recent outbreak in Pontypridd, Glamorgan; 15 were from sporadic cases of meningococcal disease; 26 were from the National Collection of Type Cultures; 58 were carrier isolates from Ironville, Derbyshire; 1 was a disease isolate from Ironville; and five were representatives of invasive clones of N. meningitidis. FAFLP analysis results were compared with previously published multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) results. FAFLP was able to identify hypervirulent, hyperendemic lineages (invasive clones) of N. meningitidis as well as did MLST. PFGE did not discriminate between two strains from the outbreak that were classified as similar but distinct by FAFLP. The results suggest that high resolution of N. meningitidis for outbreak and other epidemiological analyses is more cost efficient by FAFLP than by sequencing procedures. PMID:11101599

High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

PubMed

Sakai, Y; Goh, T K; Tani, Y

1993-06-01

We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.

Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

PubMed Central

Soares, Vítor Yamashiro Rocha; da Silva, Jailthon Carlos; da Silva, Kleverton Ribeiro; Cruz, Maria do Socorro Pires e; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

2014-01-01

An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA. PMID:24821056

Multi-Stage Mass Spectrometry Analysis of Sugar-Conjugated β-Turn Structures to be Used as Probes in Autoimmune Diseases

NASA Astrophysics Data System (ADS)

Giangrande, Chiara; Auberger, Nicolas; Rentier, Cédric; Papini, Anna Maria; Mallet, Jean-Maurice; Lavielle, Solange; Vinh, Joëlle

2016-04-01

Synthetic sugar-modified peptides were identified as antigenic probes in the context of autoimmune diseases. The aim of this work is to provide a mechanistic study on the fragmentation of different glycosylated analogs of a synthetic antigenic probe able to detect antibodies in a subpopulation of multiple sclerosis patients. In particular the N-glucosylated type I' β-turn peptide structure called CSF114(Glc) was used as a model to find signature fragmentations exploring the potential of multi-stage mass spectrometry by MALDI-LTQ Orbitrap. Here we compare the fragmentation of the glucosylated form of the synthetic peptide CSF114(Glc), bearing a glucose moiety on an asparagine residue, with less or non- immunoreactive forms, bearing different sugar-modifications, such as CSF114(GlcNAc), modified with a residue of N-acetylglucosamine, and CSF114[Lys7(1-deoxyfructopyranosyl)], this last one modified with a 1-deoxyfructopyranosyl moiety on a lysine at position 7. The analysis was set up using a synthetic compound specifically deuterated on the C-1 to compare its fragmentation with the fragmentation of the undeuterated form, and thus ascertain with confidence the presence on an Asn(Glc) within a peptide sequence. At the end of the study, our analysis led to the identification of signature neutral losses inside the sugar moieties to characterize the different types of glycosylation/glycation. The interest of this study lies in the possibility of applyimg this approach to the discovery of biomarkers and in the diagnosis of autoimmune diseases.

Multi-Stage Mass Spectrometry Analysis of Sugar-Conjugated β-Turn Structures to be Used as Probes in Autoimmune Diseases.

PubMed

Giangrande, Chiara; Auberger, Nicolas; Rentier, Cédric; Papini, Anna Maria; Mallet, Jean-Maurice; Lavielle, Solange; Vinh, Joëlle

2016-04-01

Synthetic sugar-modified peptides were identified as antigenic probes in the context of autoimmune diseases. The aim of this work is to provide a mechanistic study on the fragmentation of different glycosylated analogs of a synthetic antigenic probe able to detect antibodies in a subpopulation of multiple sclerosis patients. In particular the N-glucosylated type I' β-turn peptide structure called CSF114(Glc) was used as a model to find signature fragmentations exploring the potential of multi-stage mass spectrometry by MALDI-LTQ Orbitrap. Here we compare the fragmentation of the glucosylated form of the synthetic peptide CSF114(Glc), bearing a glucose moiety on an asparagine residue, with less or non- immunoreactive forms, bearing different sugar-modifications, such as CSF114(GlcNAc), modified with a residue of N-acetylglucosamine, and CSF114[Lys(7)(1-deoxyfructopyranosyl)], this last one modified with a 1-deoxyfructopyranosyl moiety on a lysine at position 7. The analysis was set up using a synthetic compound specifically deuterated on the C-1 to compare its fragmentation with the fragmentation of the undeuterated form, and thus ascertain with confidence the presence on an Asn(Glc) within a peptide sequence. At the end of the study, our analysis led to the identification of signature neutral losses inside the sugar moieties to characterize the different types of glycosylation/glycation. The interest of this study lies in the possibility of applyimg this approach to the discovery of biomarkers and in the diagnosis of autoimmune diseases. Graphical Abstract .

Human gut bacterial communities are altered by addition of cruciferous vegetables to a controlled fruit- and vegetable-free diet.

PubMed

Li, Fei; Hullar, Meredith A J; Schwarz, Yvonne; Lampe, Johanna W

2009-09-01

In the human gut, commensal bacteria metabolize food components that typically serve as energy sources. These components have the potential to influence gut bacterial community composition. Cruciferous vegetables, such as broccoli and cabbage, contain distinctive compounds that can be utilized by gut bacteria. For example, glucosinolates can be hydrolyzed by certain bacteria, and dietary fibers can be fermented by a range of species. We hypothesized that cruciferous vegetable consumption would alter growth of certain bacteria, thereby altering bacterial community composition. We tested this hypothesis in a randomized, crossover, controlled feeding study. Fecal samples were collected from 17 participants at the end of 2 14-d intake periods: a low-phytochemical, low-fiber basal diet (i.e. refined grains without fruits or vegetables) and a high ("double") cruciferous vegetable diet [basal diet + 14 g cruciferous vegetables/(kg body weightd)]. Fecal bacterial composition was analyzed by the terminal restriction fragment length polymorphism (tRFLP) method using the bacterial 16S ribosomal RNA gene and nucleotide sequencing. Using blocked multi-response permutation procedures analysis, we found that overall bacterial community composition differed between the 2 consumption periods (delta = 0.603; P = 0.011). The bacterial community response to cruciferous vegetables was individual-specific, as revealed by nonmetric multidimensional scaling ordination analysis. Specific tRFLP fragments that characterized each of the diets were identified using indicator species analysis. Putative species corresponding to these fragments were identified through gene sequencing as Eubacterium hallii, Phascolarctobacterium faecium, Burkholderiales spp., Alistipes putredinis, and Eggerthella spp. In conclusion, human gut bacterial community composition was altered by cruciferous vegetable consumption, which could ultimately influence gut metabolism of bioactive food components and host exposure to these compounds.

Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia.

PubMed

Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D

2011-12-01

Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.

Identification of verotoxin type 2 variant B subunit genes in Escherichia coli by the polymerase chain reaction and restriction fragment length polymorphism analysis.

PubMed Central

Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R

1991-01-01

A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436

Comprehensive Analysis of Protein Modifications by Top-down Mass Spectrometry

PubMed Central

Zhang, Han; Ge, Ying

2012-01-01

Mass spectrometry (MS)-based proteomics is playing an increasingly important role in cardiovascular research. Proteomics includes not only identification and quantification of proteins, but also the characterization of protein modifications such as post-translational modifications and sequence variants. The conventional bottom-up approach, involving proteolytic digestion of proteins into small peptides prior to MS analysis, is routinely used for protein identification and quantification with high throughput and automation. Nevertheless, it has limitations in the analysis of protein modifications mainly due to the partial sequence coverage and loss of connections among modifications on disparate portions of a protein. An alternative approach, top-down MS, has emerged as a powerful tool for the analysis of protein modifications. The top-down approach analyzes whole proteins directly, providing a “bird’s eye” view of all existing modifications. Subsequently, each modified protein form can be isolated and fragmented in the mass spectrometer to locate the modification site. The incorporation of the non-ergodic dissociation methods such as electron capture dissociation (ECD) greatly enhances the top-down capabilities. ECD is especially useful for mapping labile post-translational modifications which are well-preserved during the ECD fragmentation process. Top-down MS with ECD has been successfully applied to cardiovascular research with the unique advantages in unraveling the molecular complexity, quantifying modified protein forms, complete mapping of modifications with full sequence coverage, discovering unexpected modifications, and identifying and quantifying positional isomers and determining the order of multiple modifications. Nevertheless, top-down MS still needs to overcome some technical challenges to realize its full potential. Herein, we reviewed the advantages and challenges of top-down methodology with a focus on its application in cardiovascular research. PMID:22187450

Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

USGS Publications Warehouse

Einer-Jensen, Katja; Winton, James R.; Lorenzen, Niels

2005-01-01

The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt) sequences of the VHSV glycoprotein (G) gene, were used to predict restriction fragment length polymorphism (RFLP) patterns that were subsequently grouped and compared with a phylogenetic analysis of the G-gene sequences of the same set of isolates. Digestion of PCR amplicons from the full-lengthG-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes. Experimental evaluation of the method consisted of three steps: (i) RT-PCR amplification of the G-gene of VHSV isolates using purified viral RNA as template, (ii) digestion of the PCR products with a panel of restriction endonucleases and (iii) interpretation of the resulting RFLP profiles. The RFLP analysis was shown to approximate the level of genetic discrimination obtained by other, more labour-intensive, molecular techniques such as the ribonuclease protection assay or sequence analysis. In addition, 37 previously uncharacterised isolates from diverse sources were assigned to specific genotypes. While the assay was able to distinguish between marine and continental isolates of VHSV, the differences did not correlate with the pathogenicity of the isolates.

DNA fingerprinting and analysis of population structure in the chestnut blight fungus, Cryphonectria parasitica.

PubMed

Milgroom, M G; Lipari, S E; Powell, W A

1992-06-01

We analyzed DNA fingerprints in the chestnut blight fungus, Cryphonectria parasitica, for stability, inheritance, linkage and variability in a natural population. DNA fingerprints resulting from hybridization with a dispersed moderately repetitive DNA sequence of C. parasitica in plasmid pMS5.1 hybridized to 6-17 restriction fragments per individual isolate. In a laboratory cross and from progeny from a single perithecium collected from a field population, the presence/absence of 11 fragments in the laboratory cross and 12 fragments in the field progeny set segregated in 1:1 ratios. Two fragments in each progeny set cosegregated; no other linkage was detected among the segregating fragments. Mutations, identified by missing bands, were detected for only one fragment in which 4 of 43 progeny lacked a band present in both parents; no novel fragments were detected in any progeny. All other fragments appeared to be stably inherited. Hybridization patterns did not change during vegetative growth or sporulation. However, fingerprint patterns of single conidial isolates of strains EP155 and EP67 were found to be heterogenous due to mutations that occurred during culturing in the laboratory since these strains were first isolated in 1976-1977. In a population sample of 39 C. parasitica isolates, we found 33 different fingerprint patterns with pMS5.1. Most isolates differed from all other isolates by the presence or absence of several fragments. Six fingerprint patterns each occurred twice. Isolates with identical fingerprints occurred in cankers on the same chestnut stems three times; isolates within the other three pairs were isolated from cankers more than 5 m apart. The null hypothesis of random mating in this population could not be rejected if the six putative clones were removed from the analysis. Thus, a rough estimate of the clonal fraction of this population is 6 in 39 isolates (15.4%).

Microbial Genomics of a Host-Associated Commensal Bacterium in Fragmented Populations of Endangered Takahe.

PubMed

Grange, Zoë L; Gartrell, Brett D; Biggs, Patrick J; Nelson, Nicola J; Anderson, Marti; French, Nigel P

2016-05-01

Isolation of wildlife into fragmented populations as a consequence of anthropogenic-mediated environmental change may alter host-pathogen relationships. Our understanding of some of the epidemiological features of infectious disease in vulnerable populations can be enhanced by the use of commensal bacteria as a proxy for invasive pathogens in natural ecosystems. The distinctive population structure of a well-described meta-population of a New Zealand endangered flightless bird, the takahe (Porphyrio hochstetteri), provided a unique opportunity to investigate the influence of host isolation on enteric microbial diversity. The genomic epidemiology of a prevalent rail-associated endemic commensal bacterium was explored using core genome and ribosomal multilocus sequence typing (rMLST) of 70 Campylobacter sp. nova 1 isolated from one third of the takahe population resident in multiple locations. While there was evidence of recombination between lineages, bacterial divergence appears to have occurred and multivariate analysis of 52 rMLST genes revealed location-associated differentiation of C. sp. nova 1 sequence types. Our results indicate that fragmentation and anthropogenic manipulation of populations can influence host-microbial relationships, with potential implications for niche adaptation and the evolution of micro-organisms in remote environments. This study provides a novel framework in which to explore the complex genomic epidemiology of micro-organisms in wildlife populations.

Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.

PubMed

Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier

2014-01-01

Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.

Multiprimer PCR system for differential identification of mycobacteria in clinical samples.

PubMed Central

Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M

1996-01-01

A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008

Gene expression analysis by cDNA-AFLP highlights a set of new signaling networks and translational control during seed dormancy breaking in Nicotiana plumbaginifolia.

PubMed

Bove, Jérôme; Lucas, Philippe; Godin, Béatrice; Ogé, Laurent; Jullien, Marc; Grappin, Philippe

2005-03-01

Seed dormancy in Nicotiana plumbaginifolia is characterized by an abscisic acid accumulation linked to a pronounced germination delay. Dormancy can be released by 1 year after-ripening treatment. Using a cDNA-amplified fragment length polymorphism (cDNA-AFLP) approach we compared the gene expression patterns of dormant and after-ripened seeds, air-dry or during one day imbibition and analyzed 15,000 cDNA fragments. Among them 1020 were found to be differentially regulated by dormancy. Of 412 sequenced cDNA fragments, 83 were assigned to a known function by search similarities to public databases. The functional categories of the identified dormancy maintenance and breaking responsive genes, give evidence that after-ripening turns in the air-dry seed to a new developmental program that modulates, at the RNA level, components of translational control, signaling networks, transcriptional control and regulated proteolysis.

Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures

PubMed Central

Pride, David T; Schoenfeld, Thomas

2008-01-01

Background Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC), where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. Results From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of the Octopus and Bear Paw metagenomic contigs are predicted to belong to viruses rather than to any Bacteria or Archaea, consistent with the apparent viral origin of both metagenomes. Conclusion That BLAST searches identify no significant homologs for most metagenome contigs, while GSPC suggests their origin as archaeal viruses or bacteriophages, indicates GSPC provides a complementary approach in viral metagenomic analysis. PMID:18798991

Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures.

PubMed

Pride, David T; Schoenfeld, Thomas

2008-09-17

Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC), where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of the Octopus and Bear Paw metagenomic contigs are predicted to belong to viruses rather than to any Bacteria or Archaea, consistent with the apparent viral origin of both metagenomes. That BLAST searches identify no significant homologs for most metagenome contigs, while GSPC suggests their origin as archaeal viruses or bacteriophages, indicates GSPC provides a complementary approach in viral metagenomic analysis.

A mechanistic insight into the amyloidogenic structure of hIAPP peptide revealed from sequence analysis and molecular dynamics simulation.

PubMed

Chakraborty, Sandipan; Chatterjee, Barnali; Basu, Soumalee

2012-07-01

A collective approach of sequence analysis, phylogenetic tree and in silico prediction of amyloidogenecity using bioinformatics tools have been used to correlate the observed species-specific variations in IAPP sequences with the amyloid forming propensity. Observed substitution patterns indicate that probable changes in local hydrophobicity are instrumental in altering the aggregation propensity of the peptide. In particular, residues at 17th, 22nd and 23rd positions of the IAPP peptide are found to be crucial for amyloid formation. Proline25 primarily dictates the observed non-amyloidogenecity in rodents. Furthermore, extensive molecular dynamics simulation of 0.24 μs have been carried out with human IAPP (hIAPP) fragment 19-27, the portion showing maximum sequence variation across different species, to understand the native folding characteristic of this region. Principal component analysis in combination with free energy landscape analysis illustrates a four residue turn spanning from residue 22 to 25. The results provide a structural insight into the intramolecular β-sheet structure of amylin which probably is the template for nucleation of fibril formation and growth, a pathogenic feature of type II diabetes. Copyright © 2012 Elsevier B.V. All rights reserved.

[Sequence analysis of LEAFY homologous gene from Dendrobium moniliforme and application for identification of medicinal Dendrobium].

PubMed

Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu

2013-04-01

The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.

Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

PubMed

Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

2015-01-01

Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits.

PubMed

Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

2016-01-01

Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35-120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs' analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between the two major groups of strains of this pathogen.

Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits

PubMed Central

Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M.; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

2016-01-01

Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35–120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs’ analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between the two major groups of strains of this pathogen. PMID:27092114

Sequences of two related multiple antibiotic resistance virulence plasmids sharing a unique IS26-related molecular signature isolated from different Escherichia coli pathotypes from different hosts.

PubMed

Venturini, Carola; Hassan, Karl A; Roy Chowdhury, Piklu; Paulsen, Ian T; Walker, Mark J; Djordjevic, Steven P

2013-01-01

Enterohemorrhagic Escherichia coli (EHEC) and atypical enteropathogenic E. coli (aEPEC) are important zoonotic pathogens that increasingly are becoming resistant to multiple antibiotics. Here we describe two plasmids, pO26-CRL125 (125 kb) from a human O26:H- EHEC, and pO111-CRL115 (115kb) from a bovine O111 aEPEC, that impart resistance to ampicillin, kanamycin, neomycin, streptomycin, sulfathiazole, trimethoprim and tetracycline and both contain atypical class 1 integrons with an identical IS26-mediated deletion in their 3´-conserved segment. Complete sequence analysis showed that pO26-CRL125 and pO111-CRL115 are essentially identical except for a 9.7 kb fragment, present in the backbone of pO26-CRL125 but absent in pO111-CRL115, and several indels. The 9.7 kb fragment encodes IncI-associated genes involved in plasmid stability during conjugation, a putative transposase gene and three imperfect repeats. Contiguous sequence identical to regions within these pO26-CRL125 imperfect repeats was identified in pO111-CRL115 precisely where the 9.7 kb fragment is missing, suggesting it may be mobile. Sequences shared between the plasmids include a complete IncZ replicon, a unique toxin/antitoxin system, IncI stability and maintenance genes, a novel putative serine protease autotransporter, and an IncI1 transfer system including a unique shufflon. Both plasmids carry a derivate Tn21 transposon with an atypical class 1 integron comprising a dfrA5 gene cassette encoding resistance to trimethoprim, and 24 bp of the 3´-conserved segment followed by Tn6026, which encodes resistance to ampicillin, kanymycin, neomycin, streptomycin and sulfathiazole. The Tn21-derivative transposon is linked to a truncated Tn1721, encoding resistance to tetracycline, via a region containing the IncP-1α oriV. Absence of the 5 bp direct repeats flanking Tn3-family transposons, indicates that homologous recombination events played a key role in the formation of this complex antibiotic resistance gene locus. Comparative sequence analysis of these closely related plasmids reveals aspects of plasmid evolution in pathogenic E. coli from different hosts.

DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

PubMed

Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

2004-01-01

RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

Purification and characterization of plantaricin Y, a novel bacteriocin produced by Lactobacillus plantarum 510.

PubMed

Chen, Yi-sheng; Wang, Yan-chong; Chow, Yiou-shing; Yanagida, Fujitoshi; Liao, Chen-chung; Chiu, Chi-ming

2014-03-01

Lactobacillus plantarum 510, previously isolated from a koshu vineyard in Japan, was found to produce a bacteriocin-like inhibitory substance which was purified and characterized. Mass spectrometry analysis showed that the mass of this bacteriocin is 4,296.65 Da. A partial sequence, NH2- SSSLLNTAWRKFG, was obtained by N-terminal amino acid sequence analysis. A BLAST search revealed that this is a unique sequence; this peptide is thus a novel bacteriocin produced by Lactobacillus plantarum 510 and was termed plantaricin Y. Plantaricin Y shows strong inhibitory activity against Listeria monocytogenes BCRC 14845, but no activity against other pathogens tested. Bacteriocin activity decreased slightly after autoclaving (121 °C for 15 min), but was completely inactivated by protease K. Furthermore, trypsin-digested bacteriocin product fragments retained activity against L. monocytogenes BCRC 14845 and exhibited a different inhibitory spectrum.

Molecular identification of Giardia and Cryptosporidium from dogs and cats

PubMed Central

Sotiriadou, Isaia; Pantchev, Nikola; Gassmann, Doreen; Karanis, Panagiotis

2013-01-01

The aim of the present study was to diagnose the presence of Giardia cysts and Cryptosporidium oocysts in household animals using nested polymerase chain reaction (PCR) and sequence analysis. One hundred faecal samples obtained from 81 dogs and 19 cats were investigated. The Cryptosporidium genotypes were determined by sequencing a fragment of the small subunit (SSU) rRNA gene, while the Giardia Assemblages were determined through analysis of the glutamate dehydrogenase (GDH) locus. Isolates from five dogs and two cats were positive by PCR for the presence of Giardia, and their sequences matched the zoonotic Assemblage A of Giardia. Cryptosporidium spp. isolated from one dog and one cat were both found to be C. parvum. One dog isolate harboured a mixed infection of C. parvum and Giardia Assemblage A. These findings support the growing evidence that household animals are potential reservoirs of the zoonotic pathogens Giardia spp. and Cryptosporidium spp. for infections in humans. PMID:23477297

Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.

PubMed

Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P

1986-02-01

Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations.

Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.

PubMed Central

Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P

1986-01-01

Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations. Images PMID:3003377

Evaluation of Helicobacter pylori infection and clarithromycin resistance in strains from symptomatic Colombian children.

PubMed

Rosero Lasso, Yuliet Liliana; Arévalo-Jaimes, Betsy Verónica; Delgado, María de Pilar; Vera-Chamorro, José Fernando; García, Daniella; Ramírez, Andrea; Rodríguez-Urrego, Paula A; Álvarez, Johanna; Jaramillo, Carlos Alberto

2018-04-27

To determine the current prevalence of Helicobacter pylori in symptomatic Colombian children and evaluate the presence of mutations associated with clarithromycin resistance. Biopsies from 133 children were analyzed. The gastric fragment was used for urease test and reused for PCR-sequencing of the 23SrDNA gene. Mutations were detected by bioinformatic analysis. PCR-sequencing established that H. pylori infection was present in 47% of patients. Bioinformatics analysis of the 62 positive sequences for 23SrDNA revealed that 92% exhibited a genotype susceptible to clarithromycin, whereas remain strains (8%) showed mutations associated with clarithromycin resistance. The low rate of resistance to clarithromycin (8%) suggests that conventional treatment methods are an appropriate choice for children. Recycling a biopsy that is normally discarded reduces the risks associated with the procedure. The 23SrDNA gene amplification could be used for a dual purpose: detection of H. pylori and determination of susceptibility to clarithromycin.

[Identification of a HPGD mutation in three families affected with primary hypertrophic osteoarthropathy].

PubMed

Zhang, Wanying; Wang, Tao; Huang, Shuaiwu; Zhao, Xiuli

2018-04-10

To detect mutation of HPGD gene among three pedigrees affected with primary hypertrophic osteoarthropathy (PHO) by DNA sequencing and high-resolution melting (HRM) analysis. Genomic DNA was extracted from peripheral blood samples collected from the pedigrees. PCR and direct sequencing were carried out to identify potential mutations of the HPGD gene. Amplicons containing the mutation spot were generated by nested PCR. The products were then subjected to HRM analysis using the HR-1 instrument. Direct sequencing was carried out in family members and healthy individuals to confirm the result of HRM analysis. A homozygous mutation c.310_311delCT was detected in 2 affected probands, while a heterozygous mutation c.310_311delCT was detected in the third proband. HRM analysis of the fragments encompassing HPGD exon 3 showed 3 curve patterns representing three different genotypes, i.e., the wild type, the c.310_311delCT homozygote, and the c.310_311delCT heterozygote. Result of DNA sequencing was consistent with that of the HRM analysis and phenotype of the subjects. The c.310_311delCT mutation may be the most prevalent mutation among Chinese population. HRM analysis has provided an optimized method for genetic testing of HPGD mutation for its simplicity, rapid turnover and high sensitivity.

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

PubMed

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Effects of legacy nuclear waste on the compositional diversity and distributions of sulfate-reducing bacteria in a terrestrial subsurface aquifer.

PubMed

Bagwell, Christopher E; Liu, Xuaduan; Wu, Liyou; Zhou, Jizhong

2006-03-01

The impact of legacy nuclear waste on the compositional diversity and distribution of sulfate-reducing bacteria in a heavily contaminated subsurface aquifer was examined. dsrAB clone libraries were constructed and restriction fragment length polymorphism (RFLP) analysis used to evaluate genetic variation between sampling wells. Principal component analysis identified nickel, nitrate, technetium, and organic carbon as the primary variables contributing to well-to-well geochemical variability, although comparative sequence analysis showed the sulfate-reducing bacteria community structure to be consistent throughout contaminated and uncontaminated regions of the aquifer. Only 3% of recovered dsrAB gene sequences showed apparent membership to the Deltaproteobacteria. The remainder of recovered sequences may represent novel, deep-branching lineages that, to our knowledge, do not presently contain any cultivated members; although corresponding phylotypes have recently been reported from several different marine ecosystems. These findings imply resiliency and adaptability of sulfate-reducing bacteria to extremes in environmental conditions, although the possibility for horizontal transfer of dsrAB is also discussed.

Genomic signal processing methods for computation of alignment-free distances from DNA sequences.

PubMed

Borrayo, Ernesto; Mendizabal-Ruiz, E Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P; Morales, J Alejandro

2014-01-01

Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments.

Genomic Signal Processing Methods for Computation of Alignment-Free Distances from DNA Sequences

PubMed Central

Borrayo, Ernesto; Mendizabal-Ruiz, E. Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P.; Morales, J. Alejandro

2014-01-01

Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments. PMID:25393409

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

A common deletion in two gamma ray induced rat pulmonary tumor cell lines.

PubMed

Van Klaveren, P; De Bruijne, J; Van der Winden, H; Kal, H B; Bentvelzen, P

1994-01-01

Subtraction hybridization was performed on normal WAG/Rij rat DNA with DNA from a syngeneic Ir-192 induced pulmonary tumor cell line L37. The residual DNA was amplified by means of sequence-independent PCR. This procedure yielded a sequence, of which multiple copies are present in normal rat DNA. In the tumor line L37 two restriction fragments hybridizing with this repeat sequence are lacking. In another Ir-192 induced pulmonary tumor line, L33, one of these fragments was also lacking. This indicates a common deletion in the two tumor lines.

Analysis of the DNA sequence of a 15,500 bp fragment near the left telomere of chromosome XV from Saccharomyces cerevisiae reveals a putative sugar transporter, a carboxypeptidase homologue and two new open reading frames.

PubMed

Gamo, F J; Lafuente, M J; Casamayor, A; Ariño, J; Aldea, M; Casas, C; Herrero, E; Gancedo, C

1996-06-15

We report the sequence of a 15.5 kb DNA segment located near the left telomere of chromosome XV of Saccharomyces cerevisiae. The sequence contains nine open reading frames (ORFs) longer than 300 bp. Three of them are internal to other ones. One corresponds to the gene LGT3 that encodes a putative sugar transporter. Three adjacent ORFs were separated by two stop codons in frame. These ORFs presented homology with the gene CPS1 that encodes carboxypeptidase S. The stop codons were not found in the same sequence derived from another yeast strain. Two other ORFs without significant homology in databases were also found. One of them, O0420, is very rich in serine and threonine and presents a series of repeated or similar amino acid stretches along the sequence.

Fact and fictions in FX arbitrage processes

NASA Astrophysics Data System (ADS)

Cross, Rod; Kozyakin, Victor

2015-02-01

The efficient markets hypothesis implies that arbitrage opportunities in markets such as those for foreign exchange (FX) would be, at most, short-lived. The present paper surveys the fragmented nature of FX markets, revealing that information in these markets is also likely to be fragmented. The "quant" workforce in the hedge fund featured in The Fear Index novel by Robert Harris would have little or no reason for their existence in an EMH world. The four currency combinatorial analysis of arbitrage sequences contained in [1] is then considered. Their results suggest that arbitrage processes, rather than being self-extinguishing, tend to be periodic in nature. This helps explain the fact that arbitrage dealing tends to be endemic in FX markets.

Genomic analysis of Oryctes rhinoceros virus reveals genetic relatedness to Heliothis zea virus 1.

PubMed

Wang, Y; van Oers, M M; Crawford, A M; Vlak, J M; Jehle, J A

2007-01-01

Oryctes rhinoceros virus (OrV) is an unassigned invertebrate dsDNA virus with enveloped and rod-shaped virions. Two cloned PstI fragments, C and D, of OrV DNA have been sequenced, consisting of 19,805 and 17,146 bp, respectively, and comprising about 30% of the OrV genome. For each of the two fragments, 20 open reading frames (ORFs) of 150 nucleotides or greater with no or minimal overlap were predicted. Ten of the predicted 40 ORFs revealed significant similarities to Heliothis zea virus 1 (HzV-1) ORFs, of which five, lef-4, lef-5, pif-2, dnapol and ac81, are homologues of conserved core genes in the family Baculoviridae, and one is homologous to baculovirus rr1. A baculovirus odv-e66 homologue is also present in OrV. Five ORFs encode proteins homologous to cellular thymidylate synthase (TS), patatin-like phospholipase, mitochondrial carrier protein, Ser/Thr protein phosphatase, and serine protease, respectively. TS is phylogenetically related to those of eukarya and nucleo-cytoplasmic large dsDNA viruses. However, the remaining 25 ORFs have poor or no sequence matches with the current databases. Both the gene content of the sequenced fragments and the phylogenetic analyses of the viral DNA polymerase suggest that OrV is most closely related to HzV-1. These findings and the re-evaluation of the relationship of HzV-1 to baculoviruses suggest that a new virus genus, Nudivirus, should be established, containing OrV and HzV-1, which are genetically related to members of the family Baculoviridae.

An efficient approach to BAC based assembly of complex genomes.

PubMed

Visendi, Paul; Berkman, Paul J; Hayashi, Satomi; Golicz, Agnieszka A; Bayer, Philipp E; Ruperao, Pradeep; Hurgobin, Bhavna; Montenegro, Juan; Chan, Chon-Kit Kenneth; Staňková, Helena; Batley, Jacqueline; Šimková, Hana; Doležel, Jaroslav; Edwards, David

2016-01-01

There has been an exponential growth in the number of genome sequencing projects since the introduction of next generation DNA sequencing technologies. Genome projects have increasingly involved assembly of whole genome data which produces inferior assemblies compared to traditional Sanger sequencing of genomic fragments cloned into bacterial artificial chromosomes (BACs). While whole genome shotgun sequencing using next generation sequencing (NGS) is relatively fast and inexpensive, this method is extremely challenging for highly complex genomes, where polyploidy or high repeat content confounds accurate assembly, or where a highly accurate 'gold' reference is required. Several attempts have been made to improve genome sequencing approaches by incorporating NGS methods, to variable success. We present the application of a novel BAC sequencing approach which combines indexed pools of BACs, Illumina paired read sequencing, a sequence assembler specifically designed for complex BAC assembly, and a custom bioinformatics pipeline. We demonstrate this method by sequencing and assembling BAC cloned fragments from bread wheat and sugarcane genomes. We demonstrate that our assembly approach is accurate, robust, cost effective and scalable, with applications for complete genome sequencing in large and complex genomes.

A protein block based fold recognition method for the annotation of twilight zone sequences.

PubMed

Suresh, V; Ganesan, K; Parthasarathy, S

2013-03-01

The description of protein backbone was recently improved with a group of structural fragments called Structural Alphabets instead of the regular three states (Helix, Sheet and Coil) secondary structure description. Protein Blocks is one of the Structural Alphabets used to describe each and every region of protein backbone including the coil. According to de Brevern (2000) the Protein Blocks has 16 structural fragments and each one has 5 residues in length. Protein Blocks fragments are highly informative among the available Structural Alphabets and it has been used for many applications. Here, we present a protein fold recognition method based on Protein Blocks for the annotation of twilight zone sequences. In our method, we align the predicted Protein Blocks of a query amino acid sequence with a library of assigned Protein Blocks of 953 known folds using the local pair-wise alignment. The alignment results with z-value ≥ 2.5 and P-value ≤ 0.08 are predicted as possible folds. Our method is able to recognize the possible folds for nearly 35.5% of the twilight zone sequences with their predicted Protein Block sequence obtained by pb_prediction, which is available at Protein Block Export server.

Cloning of an avilamycin biosynthetic gene cluster from Streptomyces viridochromogenes Tü57.

PubMed Central

Gaisser, S; Trefzer, A; Stockert, S; Kirschning, A; Bechthold, A

1997-01-01

A 65-kb region of DNA from Streptomyces viridochromogenes Tü57, containing genes encoding proteins involved in the biosynthesis of avilamycins, was isolated. The DNA sequence of a 6.4-kb fragment from this region revealed four open reading frames (ORF1 to ORF4), three of which are fully contained within the sequenced fragment. The deduced amino acid sequence of AviM, encoded by ORF2, shows 37% identity to a 6-methylsalicylic acid synthase from Penicillium patulum. Cultures of S. lividans TK24 and S. coelicolor CH999 containing plasmids with ORF2 on a 5.5-kb PstI fragment were able to produce orsellinic acid, an unreduced version of 6-methylsalicylic acid. The amino acid sequence encoded by ORF3 (AviD) is 62% identical to that of StrD, a dTDP-glucose synthase from S. griseus. The deduced amino acid sequence of AviE, encoded by ORF4, shows 55% identity to a dTDP-glucose dehydratase (StrE) from S. griseus. Gene insertional inactivation experiments of aviE abolished avilamycin production, indicating the involvement of aviE in the biosynthesis of avilamycins. PMID:9335272

2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Galderisi, Umberto; Cipollaro, Marilena

2004-11-15

Ancient DNA extracted from 2000 year-old equine bones was examined in order to amplify mitochondrial and nuclear DNA fragments. A specific equine satellite-type sequence representing 3.7%-11% of the entire equine genome, proved to be a suitable target to address the question of the presence of aDNA in ancient bones. The PCR strategy designed to investigate this specific target also allowed us to calculate the molecular weight of amplifiable DNA fragments. Sequencing of a 370 bp DNA fragment of mitochondrial control region allowed the comparison of ancient DNA sequences with those of modern horses to assess their genetic relationship. The 16S rRNA mitochondrial gene was also examined to unravel the post-mortem base modification feature and to test the status of Pompeian equids taxon on the basis of a Mae III restriction site polymorphism. Copyright 2004 Wiley-Liss, Inc.

[Diversity of beta-proteobacterial ammonia-oxidizing bacteria and ammonia-oxidizing archaea in shrimp farm sediment].

PubMed

Gao, Lihai; Lin, Weitie

2011-01-01

In order to study the diversity of ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA) in shrimp farm sediment. Total microbial DNA was directly extracted from the shrimp farm sediment. The clone library of amoA genes were constructed with beta-Proteobacterial-AOB and AOA specific primers. The library was screened by PCR-restriction fragment length polymorphism (RFLP) analysis and clones with unique RFLP patterns were sequenced. Phylogenetic analyses of the amoA gene fragments showed that all AOB sequences from shrimp farm sediment were affiliated with Nitrosomonas (61.54%) or Nitrosomonas-like (38. 46%) species and grouped into Nitrosomonas communis cluster, Nitrosomonas sp. Nm148 cluster, Nitrosomonas oligotropha cluster. All AOA sequences belonged to the kingdom Crenarchaeote except that one Operational Taxa Unit (OTU) sequence was Unclassified-Archaea and fell within cluster S (soil origin). AOB and AOA species composition included 13 OTUs and 9 OTUs. The clone coverage of bacterial and archaeal amoA genes was 73.47% and 90.43%. The Shannon-Wiener index, Evenness index, Simpson index and Richness index of AOB were higher than those of AOA. These findings represent the first detailed examination of archaeal amoA diversity in shrimp farm sediment and demonstrate that diverse communities of Crenarchaeote capable of ammonia oxidation are present within shrimp farm sediment, where they may be actively involved in nitrification.

First report on an X-linked hypohidrotic ectodermal dysplasia family with X chromosome inversion: Breakpoint mapping reveals the pathogenic mechanism and preimplantation genetics diagnosis achieves an unaffected birth.

PubMed

Wu, Tonghua; Yin, Biao; Zhu, Yuanchang; Li, Guangui; Ye, Lijun; Liang, Desheng; Zeng, Yong

2017-12-01

To investigate the etiology of X-linked hypohidrotic ectodermal dysplasia (XLHED) in a family with an inversion of the X chromosome [inv(X)(p21q13)] and to achieve a healthy birth following preimplantation genetic diagnosis (PGD). Next generation sequencing (NGS) and Sanger sequencing analysis were carried out to define the inversion breakpoint. Multiple displacement amplification, amplification of breakpoint junction fragments, Sanger sequencing of exon 1 of ED1, haplotyping of informative short tandem repeat markers and gender determination were performed for PGD. NGS data of the proband sample revealed that the size of the possible inverted fragment was over 42Mb, spanning from position 26, 814, 206 to position 69, 231, 915 on the X chromosome. The breakpoints were confirmed by Sanger sequencing. A total of 5 blastocyst embryos underwent trophectoderm biopsy. Two embryos were diagnosed as carriers and three were unaffected. Two unaffected blastocysts were transferred and a singleton pregnancy was achieved. Following confirmation by prenatal diagnosis, a healthy baby was delivered. This is the first report of an XLHED family with inv(X). ED1 is disrupted by the X chromosome inversion in this XLHED family and embryos with the X chromosomal abnormality can be accurately identified by means of PGD. Copyright © 2017. Published by Elsevier B.V.

Comparing K-mer based methods for improved classification of 16S sequences.

PubMed

Vinje, Hilde; Liland, Kristian Hovde; Almøy, Trygve; Snipen, Lars

2015-07-01

The need for precise and stable taxonomic classification is highly relevant in modern microbiology. Parallel to the explosion in the amount of sequence data accessible, there has also been a shift in focus for classification methods. Previously, alignment-based methods were the most applicable tools. Now, methods based on counting K-mers by sliding windows are the most interesting classification approach with respect to both speed and accuracy. Here, we present a systematic comparison on five different K-mer based classification methods for the 16S rRNA gene. The methods differ from each other both in data usage and modelling strategies. We have based our study on the commonly known and well-used naïve Bayes classifier from the RDP project, and four other methods were implemented and tested on two different data sets, on full-length sequences as well as fragments of typical read-length. The difference in classification error obtained by the methods seemed to be small, but they were stable and for both data sets tested. The Preprocessed nearest-neighbour (PLSNN) method performed best for full-length 16S rRNA sequences, significantly better than the naïve Bayes RDP method. On fragmented sequences the naïve Bayes Multinomial method performed best, significantly better than all other methods. For both data sets explored, and on both full-length and fragmented sequences, all the five methods reached an error-plateau. We conclude that no K-mer based method is universally best for classifying both full-length sequences and fragments (reads). All methods approach an error plateau indicating improved training data is needed to improve classification from here. Classification errors occur most frequent for genera with few sequences present. For improving the taxonomy and testing new classification methods, the need for a better and more universal and robust training data set is crucial.

Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA.

PubMed

Dinsmore, P K; Klaenhammer, T R

1997-05-01

A spontaneous mutant of the lactococcal phage phi31 that is insensitive to the phage defense mechanism AbiA was characterized in an effort to identify the phage factor(s) involved in sensitivity of phi31 to AbiA. A point mutation was localized in the genome of the AbiA-insensitive phage (phi31A) by heteroduplex analysis of a 9-kb region. The mutation (G to T) was within a 738-bp open reading frame (ORF245) and resulted in an arginine-to-leucine change in the predicted amino acid sequence of the protein. The mutant phi31A-ORF245 reduced the sensitivity of phi31 to AbiA when present in trans, indicating that the mutation in ORF245 is responsible for the AbiA insensitivity of phi31A. Transcription of ORF245 occurs early in the phage infection cycles of phi31 and phi31A and is unaffected by AbiA. Expansion of the phi31 sequence revealed ORF169 (immediately upstream of ORF245) and ORF71 (which ends 84 bp upstream of ORF169). Two inverted repeats lie within the 84-bp region between ORF71 and ORF169. Sequence analysis of an independently isolated AbiA-insensitive phage, phi31B, identified a mutation (G to A) in one of the inverted repeats. A 118-bp fragment from phi31, encompassing the 84-bp region between ORF71 and ORF169, eliminates AbiA activity against phi31 when present in trans, establishing a relationship between AbiA and this fragment. The study of this region of phage phi31 has identified an open reading frame (ORF245) and a 118-bp DNA fragment that interact with AbiA and are likely to be involved in the sensitivity of this phage to AbiA.

Development of self-compressing BLSOM for comprehensive analysis of big sequence data.

PubMed

Kikuchi, Akihito; Ikemura, Toshimichi; Abe, Takashi

2015-01-01

With the remarkable increase in genomic sequence data from various organisms, novel tools are needed for comprehensive analyses of available big sequence data. We previously developed a Batch-Learning Self-Organizing Map (BLSOM), which can cluster genomic fragment sequences according to phylotype solely dependent on oligonucleotide composition and applied to genome and metagenomic studies. BLSOM is suitable for high-performance parallel-computing and can analyze big data simultaneously, but a large-scale BLSOM needs a large computational resource. We have developed Self-Compressing BLSOM (SC-BLSOM) for reduction of computation time, which allows us to carry out comprehensive analysis of big sequence data without the use of high-performance supercomputers. The strategy of SC-BLSOM is to hierarchically construct BLSOMs according to data class, such as phylotype. The first-layer BLSOM was constructed with each of the divided input data pieces that represents the data subclass, such as phylotype division, resulting in compression of the number of data pieces. The second BLSOM was constructed with a total of weight vectors obtained in the first-layer BLSOMs. We compared SC-BLSOM with the conventional BLSOM by analyzing bacterial genome sequences. SC-BLSOM could be constructed faster than BLSOM and cluster the sequences according to phylotype with high accuracy, showing the method's suitability for efficient knowledge discovery from big sequence data.

FRAGSION: ultra-fast protein fragment library generation by IOHMM sampling.

PubMed

Bhattacharya, Debswapna; Adhikari, Badri; Li, Jilong; Cheng, Jianlin

2016-07-01

Speed, accuracy and robustness of building protein fragment library have important implications in de novo protein structure prediction since fragment-based methods are one of the most successful approaches in template-free modeling (FM). Majority of the existing fragment detection methods rely on database-driven search strategies to identify candidate fragments, which are inherently time-consuming and often hinder the possibility to locate longer fragments due to the limited sizes of databases. Also, it is difficult to alleviate the effect of noisy sequence-based predicted features such as secondary structures on the quality of fragment. Here, we present FRAGSION, a database-free method to efficiently generate protein fragment library by sampling from an Input-Output Hidden Markov Model. FRAGSION offers some unique features compared to existing approaches in that it (i) is lightning-fast, consuming only few seconds of CPU time to generate fragment library for a protein of typical length (300 residues); (ii) can generate dynamic-size fragments of any length (even for the whole protein sequence) and (iii) offers ways to handle noise in predicted secondary structure during fragment sampling. On a FM dataset from the most recent Critical Assessment of Structure Prediction, we demonstrate that FGRAGSION provides advantages over the state-of-the-art fragment picking protocol of ROSETTA suite by speeding up computation by several orders of magnitude while achieving comparable performance in fragment quality. Source code and executable versions of FRAGSION for Linux and MacOS is freely available to non-commercial users at http://sysbio.rnet.missouri.edu/FRAGSION/ It is bundled with a manual and example data. chengji@missouri.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Molecular identification of wild triatomines of the genus Rhodnius in the Bolivian Amazon: Strategy and current difficulties.

PubMed

Brenière, Simone Frédérique; Condori, Edwin Wily; Buitrago, Rosio; Sosa, Luis Fernando; Macedo, Catarina Lopes; Barnabé, Christian

2017-07-01

The Amazon region has recently been considered as endemic in Latin America. In Bolivia, the vast Amazon region is undergoing considerable human migrations and substantial anthropization of the environment, potentially renewing the danger of establishing the transmission of Chagas disease. The cases of human oral contamination occurring in 2010 in the town of Guayaramerín provided reasons to intensify research. As a result, the goal of this study was to characterize the species of sylvatic triatomines circulating in the surroundings of Yucumo (Beni, Bolivia), a small Amazonian city at the foot of the Andes between the capital (La Paz) and Trinidad the largest city of Beni. The triatomine captures were performed with mice-baited adhesive traps mostly settled in palm trees in forest fragments and pastures. Species were identified by morphological observation, dissection of genitalia, and sequencing of three mitochondrial gene fragments and one nuclear fragment. Molecular analysis was based on (i) the identity score of the haplotypes with GenBank sequences through the BLAST algorithm and (ii) construction of phylogenetic trees. Thirty-four triatomines, all belonging to the Rhodnius genus, of which two were adult males, were captured in palm trees in forest fragments and pastures (overall infestation rate, 12.3%). The morphology of the phallic structures in the two males confirmed the R. stali species. For the other specimens, after molecular sequencing, only one specimen was identified with confidence as belonging to Rhodnius robustus, the others belonged to one of the species of the Rhodnius pictipes complex, probably Rhodnius stali. The two species, R. robustus and R. stali, had previously been reported in the Alto Beni region (edge of the Amazon region), but not yet in the Beni department situated in the Amazon region. Furthermore, the difficulties of molecular characterization of closely related species within the three complexes of the genus Rhodnius are highlighted and discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

PubMed

Hazkani-Covo, Einat; Martin, William F

2017-05-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Prevalence and phylogenetic analysis of hepatitis E virus in pigs, wild boars, roe deer, red deer and moose in Lithuania.

PubMed

Spancerniene, Ugne; Grigas, Juozas; Buitkuviene, Jurate; Zymantiene, Judita; Juozaitiene, Vida; Stankeviciute, Milda; Razukevicius, Dainius; Zienius, Dainius; Stankevicius, Arunas

2018-02-23

Hepatitis E virus (HEV) is one of the major causes of acute viral hepatitis worldwide. In Europe, food-borne zoonotic transmission of HEV genotype 3 has been associated with domestic pigs and wild boar. Controversial data are available on the circulation of the virus in animals that are used for human consumption, and to date, no gold standard has yet been defined for the diagnosis of HEV-associated hepatitis. To investigate the current HEV infection status in Lithuanian pigs and wild ungulates, the presence of viral RNA was analyzed by nested reverse transcription polymerase chain reaction (RT-nPCR) in randomly selected samples, and the viral RNA was subsequently genotyped. In total, 32.98 and 22.55% of the domestic pig samples were HEV-positive using RT-nPCR targeting the ORF1 and ORF2 fragments, respectively. Among ungulates, 25.94% of the wild boar samples, 22.58% of the roe deer samples, 6.67% of the red deer samples and 7.69% of the moose samples were positive for HEV RNA using primers targeting the ORF1 fragment. Using primers targeting the ORF2 fragment of the HEV genome, viral RNA was only detected in 17.03% of the wild boar samples and 12.90% of the roe deer samples. Phylogenetic analysis based on a 348-nucleotide-long region of the HEV ORF2 showed that all obtained sequences detected in Lithuanian domestic pigs and wildlife belonged to genotype 3. In this study, the sequences identified from pigs, wild boars and roe deer clustered within the 3i subtype reference sequences from the GenBank database. The sequences obtained from pig farms located in two different counties of Lithuania were of the HEV 3f subtype. The wild boar sequences clustered within subtypes 3i and 3h, clearly indicating that wild boars can harbor additional subtypes of HEV. For the first time, the ORF2 nucleotide sequences obtained from roe deer proved that HEV subtype 3i can be found in a novel host. The results of the viral prevalence and phylogenetic analyses clearly demonstrated viral infection in Lithuanian pigs and wild ungulates, thus highlighting a significant concern for zoonotic virus transmission through both the food chain and direct contact with animals. Unexpected HEV genotype 3 subtype diversity in Lithuania and neighboring countries revealed that further studies are necessary to understand the mode of HEV transmission between animals and humans in the Baltic States region.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Tick-Borne Encephalitis with Hemorrhagic Syndrome, Novosibirsk Region, Russia, 1999

PubMed Central

Ternovoi, Vladimir A.; Kurzhukov, Gennady P.; Sokolov, Yuri V.; Ivanov, Gennady Y.; Ivanisenko, Vladimir A.; Loktev, Alexander V.; Ryder, Robert W.; Netesov, Sergey V.

2003-01-01

Eight fatal cases of tick-borne encephalitis with unusual hemorrhagic syndrome were identified in 1999 in the Novosibirsk Region, Russia. To study these strains, we sequenced cDNA fragments of protein E gene from six archival formalin-fixed brain samples. Phylogenetic analysis showed tick-borne encephalitis variants clustered with a Far Eastern subtype (homology 94.7%) but not with the Siberian subtype (82%). PMID:12781020

Insight into the Structure of Amyloid Fibrils from the Analysis of Globular Proteins

PubMed Central

Trovato, Antonio; Chiti, Fabrizio; Maritan, Amos; Seno, Flavio

2006-01-01

The conversion from soluble states into cross-β fibrillar aggregates is a property shared by many different proteins and peptides and was hence conjectured to be a generic feature of polypeptide chains. Increasing evidence is now accumulating that such fibrillar assemblies are generally characterized by a parallel in-register alignment of β-strands contributed by distinct protein molecules. Here we assume a universal mechanism is responsible for β-structure formation and deduce sequence-specific interaction energies between pairs of protein fragments from a statistical analysis of the native folds of globular proteins. The derived fragment–fragment interaction was implemented within a novel algorithm, prediction of amyloid structure aggregation (PASTA), to investigate the role of sequence heterogeneity in driving specific aggregation into ordered self-propagating cross-β structures. The algorithm predicts that the parallel in-register arrangement of sequence portions that participate in the fibril cross-β core is favoured in most cases. However, the antiparallel arrangement is correctly discriminated when present in fibrils formed by short peptides. The predictions of the most aggregation-prone portions of initially unfolded polypeptide chains are also in excellent agreement with available experimental observations. These results corroborate the recent hypothesis that the amyloid structure is stabilised by the same physicochemical determinants as those operating in folded proteins. They also suggest that side chain–side chain interaction across neighbouring β-strands is a key determinant of amyloid fibril formation and of their self-propagating ability. PMID:17173479

DNA barcoding insect–host plant associations

PubMed Central

Jurado-Rivera, José A.; Vogler, Alfried P.; Reid, Chris A.M.; Petitpierre, Eduard; Gómez-Zurita, Jesús

2008-01-01

Short-sequence fragments (‘DNA barcodes’) used widely for plant identification and inventorying remain to be applied to complex biological problems. Host–herbivore interactions are fundamental to coevolutionary relationships of a large proportion of species on the Earth, but their study is frequently hampered by limited or unreliable host records. Here we demonstrate that DNA barcodes can greatly improve this situation as they (i) provide a secure identification of host plant species and (ii) establish the authenticity of the trophic association. Host plants of leaf beetles (subfamily Chrysomelinae) from Australia were identified using the chloroplast trnL(UAA) intron as barcode amplified from beetle DNA extracts. Sequence similarity and phylogenetic analyses provided precise identifications of each host species at tribal, generic and specific levels, depending on the available database coverage in various plant lineages. The 76 species of Chrysomelinae included—more than 10 per cent of the known Australian fauna—feed on 13 plant families, with preference for Australian radiations of Myrtaceae (eucalypts) and Fabaceae (acacias). Phylogenetic analysis of beetles shows general conservation of host association but with rare host shifts between distant plant lineages, including a few cases where barcodes supported two phylogenetically distant host plants. The study demonstrates that plant barcoding is already feasible with the current publicly available data. By sequencing plant barcodes directly from DNA extractions made from herbivorous beetles, strong physical evidence for the host association is provided. Thus, molecular identification using short DNA fragments brings together the detection of species and the analysis of their interactions. PMID:19004756

Putative cross-kingdom horizontal gene transfer in sponge (Porifera) mitochondria.

PubMed

Rot, Chagai; Goldfarb, Itay; Ilan, Micha; Huchon, Dorothée

2006-09-14

The mitochondrial genome of Metazoa is usually a compact molecule without introns. Exceptions to this rule have been reported only in corals and sea anemones (Cnidaria), in which group I introns have been discovered in the cox1 and nad5 genes. Here we show several lines of evidence demonstrating that introns can also be found in the mitochondria of sponges (Porifera). A 2,349 bp fragment of the mitochondrial cox1 gene was sequenced from the sponge Tetilla sp. (Spirophorida). This fragment suggests the presence of a 1143 bp intron. Similar to all the cnidarian mitochondrial introns, the putative intron has group I intron characteristics. The intron is present in the cox1 gene and encodes a putative homing endonuclease. In order to establish the distribution of this intron in sponges, the cox1 gene was sequenced from several representatives of the demosponge diversity. The intron was found only in the sponge order Spirophorida. A phylogenetic analysis of the COI protein sequence and of the intron open reading frame suggests that the intron may have been transmitted horizontally from a fungus donor. Little is known about sponge-associated fungi, although in the last few years the latter have been frequently isolated from sponges. We suggest that the horizontal gene transfer of a mitochondrial intron was facilitated by a symbiotic relationship between fungus and sponge. Ecological relationships are known to have implications at the genomic level. Here, an ecological relationship between sponge and fungus is suggested based on the genomic analysis.

High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

PubMed

Tong, Steven Y C; Xie, Shirley; Richardson, Leisha J; Ballard, Susan A; Dakh, Farshid; Grabsch, Elizabeth A; Grayson, M Lindsay; Howden, Benjamin P; Johnson, Paul D R; Giffard, Philip M

2011-01-01

We have developed a single nucleotide polymorphism (SNP) nucleated high-resolution melting (HRM) technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST) database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE) and an allele specific real-time PCR (AS kinetic PCR) SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs) in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs) and provides a Simpson's Index of Diversity (D) of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

PubMed

Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

2002-11-01

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

Genetic and Epigenetic Alterations of Brassica nigra Introgression Lines from Somatic Hybridization: A Resource for Cauliflower Improvement

PubMed Central

Wang, Gui-xiang; Lv, Jing; Zhang, Jie; Han, Shuo; Zong, Mei; Guo, Ning; Zeng, Xing-ying; Zhang, Yue-yun; Wang, You-ping; Liu, Fan

2016-01-01

Broad phenotypic variations were obtained previously in derivatives from the asymmetric somatic hybridization of cauliflower “Korso” (Brassica oleracea var. botrytis, 2n = 18, CC genome) and black mustard “G1/1” (Brassica nigra, 2n = 16, BB genome). However, the mechanisms underlying these variations were unknown. In this study, 28 putative introgression lines (ILs) were pre-selected according to a series of morphological (leaf shape and color, plant height and branching, curd features, and flower traits) and physiological (black rot/club root resistance) characters. Multi-color fluorescence in situ hybridization revealed that these plants contained 18 chromosomes derived from “Korso.” Molecular marker (65 simple sequence repeats and 77 amplified fragment length polymorphisms) analysis identified the presence of “G1/1” DNA segments (average 7.5%). Additionally, DNA profiling revealed many genetic and epigenetic differences among the ILs, including sequence alterations, deletions, and variation in patterns of cytosine methylation. The frequency of fragments lost (5.1%) was higher than presence of novel bands (1.4%), and the presence of fragments specific to Brassica carinata (BBCC 2n = 34) were common (average 15.5%). Methylation-sensitive amplified polymorphism analysis indicated that methylation changes were common and that hypermethylation (12.4%) was more frequent than hypomethylation (4.8%). Our results suggested that asymmetric somatic hybridization and alien DNA introgression induced genetic and epigenetic alterations. Thus, these ILs represent an important, novel germplasm resource for cauliflower improvement that can be mined for diverse traits of interest to breeders and researchers. PMID:27625659

RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae).

PubMed

Zhao, Ya-E; Wu, Li-Ping

2012-06-01

For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.

Structure characterization of lipocyclopeptide antibiotics, aspartocins A, B & C, by ESI-MSMS and ESI-nozzle-skimmer-MSMS.

PubMed

Siegel, Marshall M; Kong, Fangming; Feng, Xidong; Carter, Guy T

2009-12-01

Three lipocyclopeptide antibiotics, aspartocins A (1), B (2), and C (3), were obtained from the aspartocin complex by HPLC separation methodology. Their structures were elucidated using previously published chemical degradation results coupled with spectroscopic studies including ESI-MS, ESI-Nozzle Skimmer-MSMS and NMR. All three aspartocin compounds share the same cyclic decapeptide core of cyclo [Dab2 (Asp1-FA)-Pip3-MeAsp4-Asp5-Gly6-Asp7-Gly8-Dab9-Val10-Pro11]. They differ only in the fatty acid side chain moiety (FA) corresponding to (Z)-13-methyltetradec-3-ene-carbonyl, (+,Z)-12-methyltetradec-3-ene-carbonyl and (Z)-12-methyltridec-3-ene-carbonyl for aspartocins A (1), B (2), and C (3), respectively. All of the sequence ions were observed by ESI-MSMS of the doubly charged parent ions. However, a number of the sequence ions observed were of low abundance. To fully sequence the lipocyclopeptide antibiotic structures, these low abundance sequence ions together with complementary sequence ions were confirmed by ESI-Nozzle-Skimmer-MSMS of the singly charged linear peptide parent fragment ions H-Asp5-Gly6-Asp7-Gly8-Dab9-Val10-Pro11-Dab2(1+)-Asp1-FA. Cyclization of the aspartocins was demonstrated to occur via the beta-amino group of Dab2 from ions of moderate intensity in the ESI-MSMS spectra. As the fatty acid moieties do not undergo internal fragmentations under the experimental ESI mass spectral conditions used, the 14 Da mass difference between the fatty acid moieties of aspartocins A (1) and B (2) versus aspartocin C (3) was used as an internal mass tag to differentiate fragment ions containing fatty acid moieties and those not containing the fatty acid moieties. The most numerous and abundant fragment ions observed in the tandem mass spectra are due to the cleavage of the tertiary nitrogen amide of the pipecolic acid residue-3 (16 fragment ions) and the proline residue-11 (7 fragment ions). In addition, the neutral loss of ethanimine from alpha,beta-diaminobutyric acid residue 9 was observed for the parent molecular ion and for 7 fragment ions. Copyright 2009 John Wiley & Sons, Ltd.

Protein Sequencing with Tandem Mass Spectrometry

NASA Astrophysics Data System (ADS)

Ziady, Assem G.; Kinter, Michael

The recent introduction of electrospray ionization techniques that are suitable for peptides and whole proteins has allowed for the design of mass spectrometric protocols that provide accurate sequence information for proteins. The advantages gained by these approaches over traditional Edman Degradation sequencing include faster analysis and femtomole, sometimes attomole, sensitivity. The ability to efficiently identify proteins has allowed investigators to conduct studies on their differential expression or modification in response to various treatments or disease states. In this chapter, we discuss the use of electrospray tandem mass spectrometry, a technique whereby protein-derived peptides are subjected to fragmentation in the gas phase, revealing sequence information for the protein. This powerful technique has been instrumental for the study of proteins and markers associated with various disorders, including heart disease, cancer, and cystic fibrosis. We use the study of protein expression in cystic fibrosis as an example.

Genome Sequencing and Analysis of Yersina pestis KIM D27, an Avirulent Strain Exempt from Select Agent Regulation

PubMed Central

Losada, Liliana; Varga, John J.; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C.

2011-01-01

Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes. PMID:21559501

Genome sequencing and analysis of Yersina pestis KIM D27, an avirulent strain exempt from select agent regulation.

PubMed

Losada, Liliana; Varga, John J; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C

2011-04-29

Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes.

Heart Rate Fragmentation: A Symbolic Dynamical Approach.

PubMed

Costa, Madalena D; Davis, Roger B; Goldberger, Ary L

2017-01-01

Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability. Objective: The objectives of this study were to: (1) introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2) evaluate how the distribution of the different dynamical patterns ("words") varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD); and (3) quantify the differences in the fragmentation patterns between the two sample populations. Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words) with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW). Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed "soft" inflection points). In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to deceleration and vice versa , termed "hard" inflection points). Compared to healthy subjects, patients with CAD had significantly higher percentages of soft and hard inflection points, an increased percentage of words with a high degree of fragmentation and a decreased percentage of words with a lower degree of fragmentation. Conclusion: The symbolic dynamical method employed here was useful to probe the newly recognized property of heart rate fragmentation. The findings from these cross-sectional studies confirm that CAD and older age are associated with higher levels of heart rate fragmentation. Furthermore, fragmentation with healthy aging appears to be phenotypically different from fragmentation in the context of CAD.

In vivo protein stabilization based on fragment complementation and a split GFP system.

PubMed

Lindman, Stina; Hernandez-Garcia, Armando; Szczepankiewicz, Olga; Frohm, Birgitta; Linse, Sara

2010-11-16

Protein stabilization was achieved through in vivo screening based on the thermodynamic linkage between protein folding and fragment complementation. The split GFP system was found suitable to derive protein variants with enhanced stability due to the correlation between effects of mutations on the stability of the intact chain and the effects of the same mutations on the affinity between fragments of the chain. PGB1 mutants with higher affinity between fragments 1 to 40 and 41 to 56 were obtained by in vivo screening of a library of the 1 to 40 fragments against wild-type 41 to 56 fragments. Colonies were ranked based on the intensity of green fluorescence emerging from assembly and folding of the fused GFP fragments. The DNA from the brightest fluorescent colonies was sequenced, and intact mutant PGB1s corresponding to the top three sequences were expressed, purified, and analyzed for stability toward thermal denaturation. The protein sequence derived from the top fluorescent colony was found to yield a 12 °C increase in the thermal denaturation midpoint and a free energy of stabilization of -8.7 kJ/mol at 25 °C. The stability rank order of the three mutant proteins follows the fluorescence rank order in the split GFP system. The variants are stabilized through increased hydrophobic effect, which raises the free energy of the unfolded more than the folded state; as well as substitutions, which lower the free energy of the folded more than the unfolded state; optimized van der Waals interactions; helix stabilization; improved hydrogen bonding network; and reduced electrostatic repulsion in the folded state.

Development of a SCAR marker for male gametophyte of Gracilariopsis lemaneiformis based on AFLP technique

NASA Astrophysics Data System (ADS)

Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo

2014-05-01

The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.

Using specific length amplified fragment sequencing to construct the high-density genetic map for Vitis (Vitis vinifera L. × Vitis amurensis Rupr.).

PubMed

Guo, Yinshan; Shi, Guangli; Liu, Zhendong; Zhao, Yuhui; Yang, Xiaoxu; Zhu, Junchi; Li, Kun; Guo, Xiuwu

2015-01-01

In this study, 149 F1 plants from the interspecific cross between 'Red Globe' (Vitis vinifera L.) and 'Shuangyou' (Vitis amurensis Rupr.) and the parent were used to construct a molecular genetic linkage map by using the specific length amplified fragment sequencing technique. DNA sequencing generated 41.282 Gb data consisting of 206,411,693 paired-end reads. The average sequencing depths were 68.35 for 'Red Globe,' 63.65 for 'Shuangyou,' and 8.01 for each progeny. In all, 115,629 high-quality specific length amplified fragments were detected, of which 42,279 were polymorphic. The genetic map was constructed using 7,199 of these polymorphic markers. These polymorphic markers were assigned to 19 linkage groups; the total length of the map was 1929.13 cm, with an average distance of 0.28 cm between each maker. To our knowledge, the genetic maps constructed in this study contain the largest number of molecular markers. These high-density genetic maps might form the basis for the fine quantitative trait loci mapping and molecular-assisted breeding of grape.

Cloning, sequencing, and expression of the gene coding for bile acid 7 alpha-hydroxysteroid dehydrogenase from Eubacterium sp. strain VPI 12708.

PubMed Central

Baron, S F; Franklund, C V; Hylemon, P B

1991-01-01

Southern blot analysis indicated that the gene encoding the constitutive, NADP-linked bile acid 7 alpha-hydroxysteroid dehydrogenase of Eubacterium sp. strain VPI 12708 was located on a 6.5-kb EcoRI fragment of the chromosomal DNA. This fragment was cloned into bacteriophage lambda gt11, and a 2.9-kb piece of this insert was subcloned into pUC19, yielding the recombinant plasmid pBH51. DNA sequence analysis of the 7 alpha-hydroxysteroid dehydrogenase gene in pBH51 revealed a 798-bp open reading frame, coding for a protein with a calculated molecular weight of 28,500. A putative promoter sequence and ribosome binding site were identified. The 7 alpha-hydroxysteroid dehydrogenase mRNA transcript in Eubacterium sp. strain VPI 12708 was about 0.94 kb in length, suggesting that it is monocistronic. An Escherichia coli DH5 alpha transformant harboring pBH51 had approximately 30-fold greater levels of 7 alpha-hydroxysteroid dehydrogenase mRNA, immunoreactive protein, and specific activity than Eubacterium sp. strain VPI 12708. The 7 alpha-hydroxysteroid dehydrogenase purified from the pBH51 transformant was similar in subunit molecular weight, specific activity, and kinetic properties to that from Eubacterium sp. strain VPI 12708, and it reached with antiserum raised against the authentic enzyme on Western immunoblots. Alignment of the amino acid sequence of the 7 alpha-hydroxysteroid dehydrogenase with those of 10 other pyridine nucleotide-linked alcohol/polyol dehydrogenases revealed six conserved amino acid residues in the N-terminal regions thought to function in coenzyme binding. Images PMID:1856160

Genome variability of foot-and-mouth disease virus during the short period of the 2010 epidemic in Japan.

PubMed

Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto

2017-02-01

Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

The Effects of Trivalent Lanthanide Cationization on the Electron Transfer Dissociation of Acidic Fibrinopeptide B and its Analogs

NASA Astrophysics Data System (ADS)

Commodore, Juliette J.; Cassady, Carolyn J.

2016-09-01

Electrospray ionization (ESI) on mixtures of acidic fibrinopeptide B and two peptide analogs with trivalent lanthanide salts generates [M + Met + H]4+, [M + Met]3+, and [M + Met -H]2+, where M = peptide and Met = metal (except radioactive promethium). These ions undergo extensive and highly efficient electron transfer dissociation (ETD) to form metallated and non-metallated c- and z-ions. All metal adducted product ions contain at least two acidic sites, which suggest attachment of the lanthanide cation at the side chains of one or more acidic residues. The three peptides undergo similar fragmentation. ETD on [M + Met + H]4+ leads to cleavage at every residue; the presence of both a metal ion and an extra proton is very effective in promoting sequence-informative fragmentation. Backbone dissociation of [M + Met]3+ is also extensive, although cleavage does not always occur between adjacent glutamic acid residues. For [M + Met - H ]2+, a more limited range of product ions form. All lanthanide metal peptide complexes display similar fragmentation except for europium (Eu). ETD on [M + Eu - H]2+ and [M + Eu]3+ yields a limited amount of peptide backbone cleavage; however, [M + Eu + H]4+ dissociates extensively with cleavage at every residue. With the exception of the results for Eu(III), metallated peptide ion formation by ESI, ETD fragmentation efficiencies, and product ion formation are unaffected by the identity of the lanthanide cation. Adduction with trivalent lanthanide metal ions is a promising tool for sequence analysis of acidic peptides by ETD.

In Vitro Magnetic Resonance Imaging Evaluation of Fragmented, Open-Coil, Percutaneous Peripheral Nerve Stimulation Leads.

PubMed

Shellock, Frank G; Zare, Armaan; Ilfeld, Brian M; Chae, John; Strother, Robert B

2018-04-01

Percutaneous peripheral nerve stimulation (PNS) is an FDA-cleared pain treatment. Occasionally, fragments of the lead (MicroLead, SPR Therapeutics, LLC, Cleveland, OH, USA) may be retained following lead removal. Since the lead is metallic, there are associated magnetic resonance imaging (MRI) risks. Therefore, the objective of this investigation was to evaluate MRI-related issues (i.e., magnetic field interactions, heating, and artifacts) for various lead fragments. Testing was conducted using standardized techniques on lead fragments of different lengths (i.e., 50, 75, and 100% of maximum possible fragment length of 12.7 cm) to determine MRI-related problems. Magnetic field interactions (i.e., translational attraction and torque) and artifacts were tested for the longest lead fragment at 3 Tesla. MRI-related heating was evaluated at 1.5 Tesla/64 MHz and 3 Tesla/128 MHz with each lead fragment placed in a gelled-saline filled phantom. Temperatures were recorded on the lead fragments while using relatively high RF power levels. Artifacts were evaluated using T1-weighted, spin echo, and gradient echo (GRE) pulse sequences. The longest lead fragment produced only minor magnetic field interactions. For the lead fragments evaluated, physiologically inconsequential MRI-related heating occurred at 1.5 Tesla/64 MHz while under certain 3 Tesla/128 MHz conditions, excessive temperature elevations may occur. Artifacts extended approximately 7 mm from the lead fragment on the GRE pulse sequence, suggesting that anatomy located at a position greater than this distance may be visualized on MRI. MRI may be performed safely in patients with retained lead fragments at 1.5 Tesla using the specific conditions of this study (i.e., MR Conditional). Due to possible excessive temperature rises at 3 Tesla, performing MRI at that field strength is currently inadvisable. © 2017 International Neuromodulation Society.

[Expression, purification and activity analysis of GGDEF and EAL domain-containing proteins from Lactobacillus acidophilus].

PubMed

He, Jia-Hui; Sun, Jie-Li; Yan, Wen-Juan; Wang, Fang

2017-05-20

To identify the functions of the proteins containing the GGDEF or EAL domain in Lactobacillus acidophilus for investigation of the regulatory mechanism of c-di-GMP in this strain. The DNA fragments of NH13_07045-GGDEF, NH13_07050 and NH13_07055 from Lactobacillus acidophilus ATCC4356 were amplified by PCR and cloned into the expression vector pMAL-His-c2. After sequencing, the recombinant plasmids were transformed into competent Escherichia coli cells, which were induced by IPTG to express the recombinant proteins fused with maltose binding protein (MBP). The fusion proteins were purified using amylose resin column for diguanylate cyclase (DGC) or phosphodiesterase (PDE) activity assays in vitro followed by analysis with high-performance liquid chromatography (HPLC). The target DNA fragments were obtained by PCR, and their sequences were all identical to that in GenBank. The purified and concentrated fusion proteins, which were identified by SDS-PAGE and Western blotting, had relative molecular masses of 59 kD, 67 kD and 72 kD. HPLC analysis showed no DGC activity in NH13_07045-GGDEF, while PDE activity was found in NH13_07050 but not in NH13_07055. We obtained the protein encoded by NH13_07050 that possesses PDE activity in vitro. This protein may facilitate the evaluation of the regulatory function of c-di-GMP in Lactobacillus acidophilus.

Identification of two new polymorphisms in the manganese superoxide dismutase gene (Mn-SOD); Part of the etiology of Parkinson`s disease?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eggers, B.; Kurth, J.H.; Kurth, M.C.

1994-09-01

Epidemiological studies suggest that several different environmental agents interact with a number of genetic elements to cause Parkinson`s disease (PD), a common neurodegenerative disease. Abnormalities of oxidative metabolism may be central to this process. Specifically, the production and degradation of dopamine may lead to toxic by-products and increased oxidative stress. Toxic by-products include hydrogen peroxide, superoxide, and hydroxyl radicals, all of which are implicated in the aging process of the central nervous system. Superoxide dismutase (SOD) catalyzes superoxide to hydrogen peroxide. Genetic predisposition to PD may be at least partially a result of certain SOD alleles. Using the cDNA sequencemore » of Mn-SOD gene, oligonucleotide primers were designed which span several presumptive splice junction sites. An approximatley 2.4kb PCR product was amplified from gDNA samples that span one or more intron near the 3{prime} end of the Mn-SOD cDNA sequence. The resultant product was screened with a panel of 4-cutters to identify fragments appropriate for SSCP analysis. Twenty-two gDNA samples were screened for SSCP and size differences of these PCR products. After digestion with AluI, two polymorphisms were observed. Two alleles with a size difference of 2-4 bp were observed by denaturing PAGE in one of the fragments. SSCP analysis revealed a polymorphism with 2 alleles in another fragment. Sequence analysis of these polymorphisms is in progress. DNA from several DEPH families was used to confirm Mendelian inheritance of these polymorphisms. Genomic DNA samples have been collected from 265 PD patients and 169 control individuals; allelic frequencies will be determined for these populations, compared by {chi}{sup 2} analysis, and relative risk calculated. These results may support a contribution of Mn-SOD in the genetic predisposition to PD.« less

Simultaneous mutation detection of three homoeologous genes in wheat by High Resolution Melting analysis and Mutation Surveyor.

PubMed

Dong, Chongmei; Vincent, Kate; Sharp, Peter

2009-12-04

TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful tool for reverse genetics, combining traditional chemical mutagenesis with high-throughput PCR-based mutation detection to discover induced mutations that alter protein function. The most popular mutation detection method for TILLING is a mismatch cleavage assay using the endonuclease CelI. For this method, locus-specific PCR is essential. Most wheat genes are present as three similar sequences with high homology in exons and low homology in introns. Locus-specific primers can usually be designed in introns. However, it is sometimes difficult to design locus-specific PCR primers in a conserved region with high homology among the three homoeologous genes, or in a gene lacking introns, or if information on introns is not available. Here we describe a mutation detection method which combines High Resolution Melting (HRM) analysis of mixed PCR amplicons containing three homoeologous gene fragments and sequence analysis using Mutation Surveyor software, aimed at simultaneous detection of mutations in three homoeologous genes. We demonstrate that High Resolution Melting (HRM) analysis can be used in mutation scans in mixed PCR amplicons containing three homoeologous gene fragments. Combining HRM scanning with sequence analysis using Mutation Surveyor is sensitive enough to detect a single nucleotide mutation in the heterozygous state in a mixed PCR amplicon containing three homoeoloci. The method was tested and validated in an EMS (ethylmethane sulfonate)-treated wheat TILLING population, screening mutations in the carboxyl terminal domain of the Starch Synthase II (SSII) gene. Selected identified mutations of interest can be further analysed by cloning to confirm the mutation and determine the genomic origin of the mutation. Polyploidy is common in plants. Conserved regions of a gene often represent functional domains and have high sequence similarity between homoeologous loci. The method described here is a useful alternative to locus-specific based methods for screening mutations in conserved functional domains of homoeologous genes. This method can also be used for SNP (single nucleotide polymorphism) marker development and eco-TILLING in polyploid species.

Characterization of Dermanyssus gallinae (Acarina: Dermanissydae) by sequence analysis of the ribosomal internal transcribed spacer regions.

PubMed

Potenza, L; Cafiero, M A; Camarda, A; La Salandra, G; Cucchiarini, L; Dachà, M

2009-10-01

In the present work mites previously identified as Dermanyssus gallinae De Geer (Acari, Mesostigmata) using morphological keys were investigated by molecular tools. The complete internal transcribed spacer 1 (ITS1), 5.8S ribosomal DNA, and ITS2 region of the ribosomal DNA from mites were amplified and sequenced to examine the level of sequence variations and to explore the feasibility of using this region in the identification of this mite. Conserved primers located at the 3'end of 18S and at the 5'start of 28S rRNA genes were used first, and amplified fragments were sequenced. Sequence analyses showed no variation in 5.8S and ITS2 region while slight intraspecific variations involving substitutions as well as deletions concentrated in the ITS1 region. Based on the sequence analyses a nested PCR of the ITS2 region followed by RFLP analyses has been set up in the attempt to provide a rapid molecular diagnostic tool of D. gallinae.

Cavitation Enhancing Nanodroplets Mediate Efficient DNA Fragmentation in a Bench Top Ultrasonic Water Bath

PubMed Central

Malc, Ewa P.; Jayakody, Chatura N.; Tsuruta, James K.; Mieczkowski, Piotr A.; Janzen, William P.; Dayton, Paul A.

2015-01-01

A perfluorocarbon nanodroplet formulation is shown to be an effective cavitation enhancement agent, enabling rapid and consistent fragmentation of genomic DNA in a standard ultrasonic water bath. This nanodroplet-enhanced method produces genomic DNA libraries and next-generation sequencing results indistinguishable from DNA samples fragmented in dedicated commercial acoustic sonication equipment, and with higher throughput. This technique thus enables widespread access to fast bench-top genomic DNA fragmentation. PMID:26186461

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Gluten-specific antibodies of celiac disease gut plasma cells recognize long proteolytic fragments that typically harbor T-cell epitopes.

PubMed

Dørum, Siri; Steinsbø, Øyvind; Bergseng, Elin; Arntzen, Magnus Ø; de Souza, Gustavo A; Sollid, Ludvig M

2016-05-05

This study aimed to identify proteolytic fragments of gluten proteins recognized by recombinant IgG1 monoclonal antibodies generated from single IgA plasma cells of celiac disease lesions. Peptides bound by monoclonal antibodies in complex gut-enzyme digests of gluten treated with the deamidating enzyme transglutaminase 2, were identified by mass spectrometry after antibody pull-down with protein G beads. The antibody bound peptides were long deamidated peptide fragments that contained the substrate recognition sequence of transglutaminase 2. Characteristically, the fragments contained epitopes with the sequence QPEQPFP and variants thereof in multiple copies, and they typically also harbored many different gluten T-cell epitopes. In the pull-down setting where antibodies were immobilized on a solid phase, peptide fragments with multivalent display of epitopes were targeted. This scenario resembles the situation of the B-cell receptor on the surface of B cells. Conceivably, B cells of celiac disease patients select gluten epitopes that are repeated multiple times in long peptide fragments generated by gut digestive enzymes. As the fragments also contain many different T-cell epitopes, this will lead to generation of strong antibody responses by effective presentation of several distinct T-cell epitopes and establishment of T-cell help to B cells.

Gluten-specific antibodies of celiac disease gut plasma cells recognize long proteolytic fragments that typically harbor T-cell epitopes

PubMed Central

Dørum, Siri; Steinsbø, Øyvind; Bergseng, Elin; Arntzen, Magnus Ø.; de Souza, Gustavo A.; Sollid, Ludvig M.

2016-01-01

This study aimed to identify proteolytic fragments of gluten proteins recognized by recombinant IgG1 monoclonal antibodies generated from single IgA plasma cells of celiac disease lesions. Peptides bound by monoclonal antibodies in complex gut-enzyme digests of gluten treated with the deamidating enzyme transglutaminase 2, were identified by mass spectrometry after antibody pull-down with protein G beads. The antibody bound peptides were long deamidated peptide fragments that contained the substrate recognition sequence of transglutaminase 2. Characteristically, the fragments contained epitopes with the sequence QPEQPFP and variants thereof in multiple copies, and they typically also harbored many different gluten T-cell epitopes. In the pull-down setting where antibodies were immobilized on a solid phase, peptide fragments with multivalent display of epitopes were targeted. This scenario resembles the situation of the B-cell receptor on the surface of B cells. Conceivably, B cells of celiac disease patients select gluten epitopes that are repeated multiple times in long peptide fragments generated by gut digestive enzymes. As the fragments also contain many different T-cell epitopes, this will lead to generation of strong antibody responses by effective presentation of several distinct T-cell epitopes and establishment of T-cell help to B cells. PMID:27146306

Combinatorial Labeling Method for Improving Peptide Fragmentation in Mass Spectrometry

NASA Astrophysics Data System (ADS)

Kuchibhotla, Bhanuramanand; Kola, Sankara Rao; Medicherla, Jagannadham V.; Cherukuvada, Swamy V.; Dhople, Vishnu M.; Nalam, Madhusudhana Rao

2017-06-01

Annotation of peptide sequence from tandem mass spectra constitutes the central step of mass spectrometry-based proteomics. Peptide mass spectra are obtained upon gas-phase fragmentation. Identification of the protein from a set of experimental peptide spectral matches is usually referred as protein inference. Occurrence and intensity of these fragment ions in the MS/MS spectra are dependent on many factors such as amino acid composition, peptide basicity, activation mode, protease, etc. Particularly, chemical derivatizations of peptides were known to alter their fragmentation. In this study, the influence of acetylation, guanidinylation, and their combination on peptide fragmentation was assessed initially on a lipase (LipA) from Bacillus subtilis followed by a bovine six protein mix digest. The dual modification resulted in improved fragment ion occurrence and intensity changes, and this resulted in the equivalent representation of b- and y-type fragment ions in an ion trap MS/MS spectrum. The improved representation has allowed us to accurately annotate the peptide sequences de novo. Dual labeling has significantly reduced the false positive protein identifications in standard bovine six peptide digest. Our study suggests that the combinatorial labeling of peptides is a useful method to validate protein identifications for high confidence protein inference. [Figure not available: see fulltext.

Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

PubMed Central

Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

2013-01-01

Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

Random-breakage mapping method applied to human DNA sequences

NASA Technical Reports Server (NTRS)

Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

1996-01-01

The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

ECB deacylase mutants

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.

2002-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.