Sample records for frederickson type iv

  1. A Novel Ras Effector Pathway Found to Play Significant Role in Tumor Suppression | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer; photo by Richard Frederickson, Staff Photographer Normal cells have mechanisms to prevent the development of cancer. Among these is a type of tumor suppressor mechanism known as oncogene-induced senescence, or OIS, which halts the uncontrolled growth of cells caused by mutations in oncogenes. The oncogene Ras plays a crucial role in inducing OIS

  2. [Cholestatic icterus due to oral contraceptives].

    PubMed

    Pestel, M; Lambert, C; Jeanmougin, M

    1973-03-01

    A case report of cholestatic jaundice in a 25 year old woman, who had had jaundice at age 4 years, and had taken Stediril (a combined oral contraceptive) for 1 month, implicates either the pill or a possibly hereditary hyperlipidemia. The jaundice developed in 2 weeks with vomiting, epigastric pain, anorexia, then discolored urine and feces, and intense pruritus. On hospitalization the patient had moderate bilirubinemia (56 mg/1), low alkaline phosphatase (13 U.K.) and slightly high serum glutamate pyruvate transaminase (270 U.W.). There were elevated serum cholesterol (3 gm/1), triglycerides (2.05 gm/1), total lipids (10.6 gm/1), and a definitely increased pre-beta lipoprotein, suggesting hyperlipidemia type IV (Frederickson classification). Liver biopsy showed fibrosis of the portal spaces lymphocytic infiltration, canalicular and intrahepatocytic thrombi. On laparoscopy the liver had a regular lower border, normal volume color and surface. Albumin, prothrombin and flocculation tests were normal. The patient's jaundice lasted about 1 month, then liver function slowly improved, although pruritus remained intense. Probably this jaundice was due to oral contraceptives, in a patient predisposed either by jaundice in childhood or endogenous hyperlipidemia.

  3. A Novel Ras Effector Pathway Found to Play Significant Role in Tumor Suppression | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer; photo by Richard Frederickson, Staff Photographer Normal cells have mechanisms to prevent the development of cancer. Among these is a type of tumor suppressor mechanism known as oncogene-induced senescence, or OIS, which halts the uncontrolled growth of cells caused by mutations in oncogenes. The oncogene Ras plays a crucial role in inducing OIS through a specific cascade of proteins, as reported in a recent article in Molecular and Cellular Biology by Jacqueline Salotti, Ph.D., and colleagues in the Eukaryotic Transcriptional Regulation Section of the Mouse Cancer Genetics Program, Center for Cancer Research (CCR).

  4. Students and Educators Learn about NICBR Science, Careers | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer; photos by Richard Frederickson, Staff Photographer Approximately 50 college students, professors, and high school teachers from Frederick County Public Schools gathered at Hood College for the second annual National Interagency Confederation for Biological Research (NICBR) Exploring Careers in a Scientific Environment Symposium (NECSES). The

  5. Scientists Discover New Possibilities at Scientific Investigators Retreat | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer; photos by Richard Frederickson, Staff Photographer Scientists who attended the 2015 NCI Intramural Scientific Investigators Retreat on Jan. 13 had a chance to discuss research results with other investigators from across the National Cancer Institute. And this year, they could also explore new possibilities for the future of their research.

  6. Using Globus to Transfer and Share Big Data | Poster

    Cancer.gov

    By Ashley DeVine, Staff Writer, and Mark Wance, Guest Writer; photo by Richard Frederickson, Staff Photographer Editor's note: This article was updated April 30, 2018. Transferring big data, such as the genomics data delivered to customers from the Center for Cancer Research Sequencing Facility (CCR SF), has been difficult in the past because the transfer systems have not kept

  7. (Updated) NCI Fiscal 2016 Bypass Budget Proposes $25 Million for Frederick National Lab | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer; image by Richard Frederickson, Staff Photographer The additional funding requested for Frederick National Laboratory for Cancer Research (FNLCR) in the Fiscal 2016 Bypass Budget was $25 million, or approximately 3.5 percent of the total additional funding request of $715 million. Officially called the Professional Judgment Budget, the Bypass

  8. Behind the Scenes, Animal Caretakers and Technical Staff Contribute to High-Quality Research | Poster

    Cancer.gov

    By Frank Blanchard, Staff Writer; photos by Frank Blanchard and Richard Frederickson, Staff Photographer Each day at 6 a.m. the lights pop on inside 18 buildings on the NCI at Frederick campus, illuminating the residential quarters for thousands of research mice. For the mice, it’s the end of their nocturnal day.  For their caretakers, however, the day has just begun.

  9. Students and Educators Learn about NICBR Science, Careers | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer; photos by Richard Frederickson, Staff Photographer Approximately 50 college students, professors, and high school teachers from Frederick County Public Schools gathered at Hood College for the second annual National Interagency Confederation for Biological Research (NICBR) Exploring Careers in a Scientific Environment Symposium (NECSES). The Feb. 13 event highlighted the wide range of scientific research as well as the educational and career opportunities available through NICBR partner organizations.

  10. PSD Applicability for Frederickson Power L.P.

    EPA Pesticide Factsheets

    This document may be of assistance in applying the New Source Review (NSR) air permitting regulations including the Prevention of Significant Deterioration (PSD) requirements. This document is part of the NSR Policy and Guidance Database. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  11. Using Globus to Transfer and Share Big Data | Poster

    Cancer.gov

    By Ashley DeVine, Staff Writer, and Mark Wance, Guest Writer; photo by Richard Frederickson, Staff Photographer Editor's note: This article was updated April 30, 2018. Transferring big data, such as the genomics data delivered to customers from the Center for Cancer Research Sequencing Facility (CCR SF), has been difficult in the past because the transfer systems have not kept pace with the size of the data. However, the situation is changing as a result of the Globus project.

  12. Studying the Role of Eukaryotic Translation Initiation Factor 4E (eIF4E) Phosphorylation by MNK1/2 Kinases in Prostate Cancer Development and Progression

    DTIC Science & Technology

    2012-06-01

    preclinical mouse model. J Clin Invest 118: 3051–3064. 49. Le Bacquer O, et al. (2007) Elevated sensitivity to diet-induced obesity and insulin resistance in...Elevated sensitivity to diet-induced obesity and insulin resistance in mice lacking 4E-BP1 and 4E-BP2. J Clin Invest 117:387–396. 7. Frederickson RM...that knock-in mice expressing a nonphosphorylatable form of eIF4E are resistant to tumorigenesis in a prostate cancer model. By using a genome-wide

  13. (Updated) NCI Fiscal 2016 Bypass Budget Proposes $25 Million for Frederick National Lab | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer; image by Richard Frederickson, Staff Photographer The additional funding requested for Frederick National Laboratory for Cancer Research (FNLCR) in the Fiscal 2016 Bypass Budget was $25 million, or approximately 3.5 percent of the total additional funding request of $715 million. Officially called the Professional Judgment Budget, the Bypass Budget is a result of the National Cancer Act of 1971, which authorizes NCI to submit a budget directly to the president, to send to Congress. With a focus on NCI’s research priorities and areas of cancer research with potential for investment, the Bypass Budget specifies additional funding, over and above the current budget, that is needed to advance

  14. Charging/discharge events in coated spacecraft polymers during electron beam irradiation in a scanning electron microscope

    NASA Astrophysics Data System (ADS)

    Czeremuszkin, G.; Latrèche, M.; Wertheimer, M. R.

    2001-12-01

    Spacecraft, such as those operating in geosynchronous orbit (GEO), can be subjected to intense irradiation by charged particles, for example high-energy (e.g. 20 keV) electrons. The surfaces of dielectric materials (for example, polymers used as "thermal blankets") can therefore become potential sites for damaging electrostatic discharge (ESD) pulse events. We simulate these conditions by examining small specimens of three relevant polymers (polyimide, polyester and fluoropolymer), both bare and coated, in a scanning electron microscope (SEM). The coatings examined include commercial indium-tin oxide (ITO), and thin films of SiO 2 and a-Si:H deposited by plasma-enhanced chemical vapor deposition (PECVD). All coatings are found to greatly modify the observed ESD behavior, compared with that of the bare polymer counterparts. These observations are explained in terms of the model for ESD pulses proposed by Frederickson.

  15. Extension of the classical classification of β-turns

    PubMed Central

    de Brevern, Alexandre G.

    2016-01-01

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

  16. Extension of the classical classification of β-turns.

    PubMed

    de Brevern, Alexandre G

    2016-09-15

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

  17. Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

    PubMed

    Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

    2017-01-01

    The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  18. AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

    PubMed

    Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

    2007-08-01

    Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

  19. [Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

    PubMed

    Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

    1985-04-01

    Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

  20. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

    PubMed

    Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

    2014-04-01

    The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

  1. Genetics Home Reference: familial porencephaly

    MedlinePlus

    ... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  2. A type IV burst associated with a coronal streamer disruption event

    NASA Technical Reports Server (NTRS)

    Kundu, M. R.

    1987-01-01

    A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

  3. Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

    MedlinePlus

    ... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

  4. viking: identification and characterization of a second type IV collagen in Drosophila.

    PubMed

    Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

    1997-10-01

    We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

  5. Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

    PubMed Central

    Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

    1994-01-01

    Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

  6. Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

    MedlinePlus

    ... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  7. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  8. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  9. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

    PubMed Central

    Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

    2014-01-01

    Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

  10. Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

    PubMed Central

    Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

    2011-01-01

    Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

  11. Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

    PubMed

    Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

    2015-09-01

    To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  13. Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

    PubMed

    Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

    2013-03-01

    The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

  14. The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

    2010-04-20

    Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

  15. A model of axonal transport drug delivery

    NASA Astrophysics Data System (ADS)

    Kuznetsov, Andrey V.

    2012-04-01

    In this paper a model of targeted drug delivery by means of active (motor-driven) axonal transport is developed. The model is motivated by recent experimental research by Filler et al. (A.G. Filler, G.T. Whiteside, M. Bacon, M. Frederickson, F.A. Howe, M.D. Rabinowitz, A.J. Sokoloff, T.W. Deacon, C. Abell, R. Munglani, J.R. Griffiths, B.A. Bell, A.M.L. Lever, Tri-partite complex for axonal transport drug delivery achieves pharmacological effect, Bmc Neuroscience 11 (2010) 8) that reported synthesis and pharmacological efficiency tests of a tri-partite complex designed for axonal transport drug delivery. The developed model accounts for two populations of pharmaceutical agent complexes (PACs): PACs that are transported retrogradely by dynein motors and PACs that are accumulated in the axon at the Nodes of Ranvier. The transitions between these two populations of PACs are described by first-order reactions. An analytical solution of the coupled system of transient equations describing conservations of these two populations of PACs is obtained by using Laplace transform. Numerical results for various combinations of parameter values are presented and their physical significance is discussed.

  16. Essential core of the Hawking–Ellis types

    NASA Astrophysics Data System (ADS)

    Martín-Moruno, Prado; Visser, Matt

    2018-06-01

    The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

  17. Observational properties of decameter type IV bursts

    NASA Astrophysics Data System (ADS)

    Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

    2013-04-01

    Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

  18. Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

    PubMed

    Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

    2007-01-01

    Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

  19. Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

    PubMed

    Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

    2014-01-01

    Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

    PubMed

    Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

    2017-08-01

    SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

  1. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  2. Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

    PubMed Central

    Megli, Christina J.

    2013-01-01

    Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

  3. Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

    PubMed

    Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

    2015-06-16

    Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

  4. Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

    USGS Publications Warehouse

    Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

    2005-01-01

    Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

  5. Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

    PubMed

    Zachariae, R; Bjerring, P; Arendt-Nielsen, L

    1989-11-01

    Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

  6. Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

    PubMed

    Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

    2018-05-30

    The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  8. Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

    PubMed

    Wang, Chao; Zhai, Wanying; Shan, Baoqing

    2016-05-01

    Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

  9. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

    PubMed Central

    Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

    2014-01-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

  10. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

    PubMed

    Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

    2014-02-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

  11. A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

    PubMed

    Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

    2008-01-01

    To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

  12. Ultraviolet properties of IRAS-selected Be stars

    NASA Technical Reports Server (NTRS)

    Bjorkman, Karen S.; Snow, Theodore P.

    1988-01-01

    New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

  13. Genetics Home Reference: congenital insensitivity to pain with anhidrosis

    MedlinePlus

    ... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

  14. Collagen type IV at the fetal-maternal interface.

    PubMed

    Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

    2015-01-01

    Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  16. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  17. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  18. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

    Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

  20. On the Directivity of Low-Frequency Type IV Radio Bursts

    NASA Technical Reports Server (NTRS)

    Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

    2016-01-01

    An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

  1. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    PubMed

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

    PubMed

    Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

    2007-01-01

    Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

  3. Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

    PubMed

    Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

    2015-04-02

    Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

  4. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

    PubMed

    Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

    2005-04-01

    The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

  5. The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

    DTIC Science & Technology

    1999-05-01

    Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

  6. Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

    PubMed

    Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

    2018-06-01

    The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  7. Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

    2008-01-15

    We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

  8. Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

    PubMed

    de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

    2007-10-01

    The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

  9. Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

    PubMed

    Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

    2016-07-01

    To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

  10. Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

    PubMed

    Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

    2013-10-01

    To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  11. 46 CFR 164.019-3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

  12. Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

    2011-04-15

    Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

  13. Interstellar C IV and Si IV column densities toward early-type stars

    NASA Technical Reports Server (NTRS)

    Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

    1980-01-01

    Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

  14. Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

    PubMed

    Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

    2013-04-01

    Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

  15. Dynamic heterogeneity in crossover spin facilitated model of supercooled liquid and fractional Stokes-Einstein relation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Seo-Woo; Kim, Soree; Jung, YounJoon, E-mail: yjjung@snu.ac.kr

    Kinetically constrained models have gained much interest as models that assign the origins of interesting dynamic properties of supercooled liquids to dynamical facilitation mechanisms that have been revealed in many experiments and numerical simulations. In this work, we investigate the dynamic heterogeneity in the fragile-to-strong liquid via Monte Carlo method using the model that linearly interpolates between the strong liquid-like behavior and the fragile liquid-like behavior by an asymmetry parameter b. When the asymmetry parameter is sufficiently small, smooth fragile-to-strong transition is observed both in the relaxation time and the diffusion constant. Using these physical quantities, we investigate fractional Stokes-Einsteinmore » relations observed in this model. When b is fixed, the system shows constant power law exponent under the temperature change, and the exponent has the value between that of the Frederickson-Andersen model and the East model. Furthermore, we investigate the dynamic length scale of our systems and also find the crossover relation between the relaxation time. We ascribe the competition between energetically favored symmetric relaxation mechanism and entropically favored asymmetric relaxation mechanism to the fragile-to-strong crossover behavior.« less

  16. The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

    DOT National Transportation Integrated Search

    1989-11-01

    The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

  17. An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

    DTIC Science & Technology

    1994-09-01

    wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

  18. Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

    PubMed Central

    Cosgrove, Dominic; Liu, Shiguang

    2016-01-01

    Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

  19. Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

    PubMed

    Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

    2015-06-01

    The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

  20. Genetics Home Reference: glycogen storage disease type IV

    MedlinePlus

    ... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

  1. Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

    PubMed

    Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

    2017-07-01

    The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. 10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

  3. Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

    PubMed

    Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

    1970-12-01

    Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

  4. Alport Syndrome Diagnosis

    MedlinePlus

    ... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

  5. Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

    PubMed

    Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

    2010-08-01

    Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  6. Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

    PubMed

    Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

    2006-11-01

    Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

  7. A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

    PubMed

    Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

    2018-05-17

    Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

    PubMed

    Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

    2012-01-01

    Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

  9. Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

    PubMed Central

    Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

    2015-01-01

    Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

  10. Root canal morphology of South Asian Indian maxillary molar teeth

    PubMed Central

    Singh, Shishir; Pawar, Mansing

    2015-01-01

    Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

  11. Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

    PubMed

    Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

    2014-08-12

    Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

  12. Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

    PubMed

    Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

    2009-06-01

    Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

  13. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

    PubMed Central

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-01-01

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

  14. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-10-23

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

    2012-08-15

    Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

  16. Neurons of human nucleus accumbens.

    PubMed

    Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

    2011-08-01

    Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

  17. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  18. Proposal for a histopathological consensus classification of the periprosthetic interface membrane

    PubMed Central

    Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-01-01

    Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

  19. Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

    PubMed

    Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-06-01

    The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

  20. Environmentally Safe and Effective Processes for Paint Removal

    DTIC Science & Technology

    1995-04-01

    Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

  1. Ehlers-Danlos syndrome type IV

    PubMed Central

    Germain, Dominique P

    2007-01-01

    Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

  2. Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

    PubMed

    Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2016-01-01

    Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

  3. Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

    PubMed

    Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

    2016-05-01

    To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  4. [Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

    PubMed

    Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

    2012-01-01

    Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

  5. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed Central

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

  6. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

  7. Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

    PubMed

    Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

    2007-01-01

    Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

  8. Mechanisms of chiral discrimination by topoisomerase IV

    PubMed Central

    Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

    2009-01-01

    Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

  9. Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

    PubMed

    Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

    2016-11-01

    To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

  10. Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

    PubMed Central

    Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

    2011-01-01

    Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

  11. Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

    PubMed

    Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

    2016-02-28

    Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

  12. Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

    PubMed

    Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

    2013-12-01

    Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

  13. Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

    PubMed

    Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

    2017-05-04

    Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

  14. [Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

    PubMed

    Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

    2014-10-01

    To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

  15. Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

    PubMed Central

    Roos, David S.; Pohlschröder, Mechthild

    2011-01-01

    Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

  16. Accentuated hyperparathyroidism in type II Bartter syndrome.

    PubMed

    Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

    2016-07-01

    Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

  17. Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, K. R.

    1994-01-01

    Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

  18. Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

    PubMed

    Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

    2009-06-01

    Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

  19. Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

    NASA Astrophysics Data System (ADS)

    Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

    1996-08-01

    Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

  20. Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

    PubMed Central

    Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

    2005-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

  1. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, D.; Wang, L.; Beconi, M.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  2. Genetics Home Reference: mucolipidosis type IV

    MedlinePlus

    ... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

  3. Mass loss in the interacting semi-detached binary delta librae

    NASA Technical Reports Server (NTRS)

    Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

    1995-01-01

    The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

  4. Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

    PubMed

    Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

    2007-09-01

    Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

  5. [Mucolipidoses type IV in a patient with mapuche ancestry].

    PubMed

    Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

    2008-07-01

    We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

  6. Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

    PubMed

    Mak, Ki M; Mei, Rena

    2017-08-01

    Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. Odorant transfer characteristics of white bread during baking.

    PubMed

    Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

    2011-01-01

    The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

  8. Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

    PubMed

    Busek, P; Stremenová, J; Krepela, E; Sedo, A

    2008-01-01

    Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

  9. Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

    PubMed

    Pakravan, Nafiseh; Hassan, Zuhair Mohammad

    2018-03-01

    Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

  10. THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

    PubMed Central

    Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

    1932-01-01

    The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

  11. Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

    PubMed

    Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

    2004-06-01

    We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

  12. Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

    PubMed

    Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

    2011-01-01

    Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

  13. Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

    2018-03-01

    We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

  14. Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

    NASA Technical Reports Server (NTRS)

    Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

    2001-01-01

    Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

  15. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

    PubMed

    Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

    2017-04-15

    Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

  16. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

    PubMed Central

    Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

    2017-01-01

    ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

  17. Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

    PubMed

    Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

    2013-11-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  18. Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

    USDA-ARS?s Scientific Manuscript database

    The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

  19. A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

    PubMed

    Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

    2018-03-09

    Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

  20. Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

    PubMed

    Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

    2014-09-01

    Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

  1. Exploring new classification criteria for the earliest type stars: the 3400 Aregion

    NASA Astrophysics Data System (ADS)

    Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

    2002-02-01

    We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

  2. A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

    2018-04-01

    A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

  3. Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

    PubMed

    Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

    2014-04-01

    There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

  4. A study of lip print pattern in Goan dental students - A digital approach.

    PubMed

    Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

    2012-10-01

    To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

  5. Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

    PubMed

    Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

    2006-12-01

    Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

  6. Anomalous ionization seen in the spectra of B supergiants

    NASA Technical Reports Server (NTRS)

    Cassinelli, J. P.; Abbott, D. C.

    1981-01-01

    An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

  7. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  8. Singular cosmological evolution using canonical and ghost scalar fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

    2015-09-01

    We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

  9. Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

    PubMed

    Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

    2018-02-06

    Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

  10. Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

    PubMed

    Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

    2002-09-01

    With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

  11. Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

    PubMed

    Ghoshal, Uday C

    2017-07-30

    A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

  12. Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

    PubMed

    Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

    2017-10-17

    Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  13. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  14. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  15. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Astrophysics Data System (ADS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-08-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  16. Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

    PubMed

    Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

    2003-03-01

    Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

  17. Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

    PubMed

    Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

    2013-04-01

    Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

  18. A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

    PubMed

    Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

    2017-12-01

    The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  19. Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

    PubMed

    Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

    2017-08-01

    We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

    DOE PAGES

    Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

    2015-03-01

    Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

  1. Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

    PubMed

    Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

    2015-10-01

    Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  2. Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

    ClinicalTrials.gov

    2014-02-14

    Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  3. Specific Phobia among U.S. Adolescents: Phenomenology and Typology

    PubMed Central

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2014-01-01

    Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

  4. Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

    PubMed

    Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

    2002-12-06

    Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

  5. Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

    1994-01-01

    High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

  6. Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

    PubMed

    Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

    2006-04-01

    A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

  7. Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

    PubMed

    Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

    2013-11-22

    Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

    PubMed

    Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

    2016-10-01

    The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

  9. The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

    PubMed

    Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

    2012-06-01

    The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

  10. Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

    PubMed Central

    Watanabe, Ikuya; Wallace, Cameron

    2008-01-01

    The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

  11. Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

    PubMed Central

    Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

    2007-01-01

    Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

  12. Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

    PubMed Central

    Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

    2014-01-01

    Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

  13. Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

    PubMed

    Breadon, Jonith Y; Barnes, Chad A

    2007-01-01

    Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

  14. Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

    PubMed

    Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

    2017-09-01

    Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

    ERIC Educational Resources Information Center

    Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

    2015-01-01

    In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

  16. Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

    PubMed

    Lees, George E

    2013-01-01

    To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

  17. Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

    PubMed

    Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

    2014-05-01

    Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

    PubMed

    Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

    2010-08-01

    A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

  19. Level III and IV Ecoregions by State

    EPA Pesticide Factsheets

    Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  20. Level III and IV Ecoregions by EPA Region

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  1. Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

    PubMed

    Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

    2010-11-01

    Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  2. Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

    PubMed Central

    Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

    2013-01-01

    Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

  3. A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

    PubMed

    Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

    2005-03-01

    To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

  4. A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

    PubMed

    Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

    2016-03-01

    The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  5. QTL analysis of ergot resistance in sorghum.

    PubMed

    Parh, D K; Jordan, D R; Aitken, E A B; Mace, E S; Jun-ai, P; McIntyre, C L; Godwin, I D

    2008-08-01

    Sorghum ergot, caused predominantly by Claviceps africana Frederickson, Mantle, de Milliano, is a significant threat to the sorghum industry worldwide. The objectives of this study were firstly, to identify molecular markers linked to ergot resistance and to two pollen traits, pollen quantity (PQ) and pollen viability (PV), and secondly, to assess the relationship between the two pollen traits and ergot resistance in sorghum. A genetic linkage map of sorghum RIL population R931945-2-2 x IS 8525 (resistance source) was constructed using 303 markers including 36 SSR, 117 AFLP , 148 DArT and two morphological trait loci. Composite interval mapping identified nine, five, and four QTL linked to molecular markers for percentage ergot infection (PCERGOT), PQ and PV, respectively, at a LOD >2.0. Co-location/linkage of QTL were identified on four chromosomes while other QTL for the three traits mapped independently, indicating that both pollen and non pollen-based mechanisms of ergot resistance were operating in this sorghum population. Of the nine QTL identified for PCERGOT, five were identified using the overall data set while four were specific to the group data sets defined by temperature and humidity. QTL identified on SBI-02 and SBI-06 were further validated in additional populations. This is the first report of QTL associated with ergot resistance in sorghum. The markers reported herein could be used for marker-assisted selection for this important disease of sorghum.

  6. Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

    NASA Astrophysics Data System (ADS)

    Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

    2018-04-01

    We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

  7. Acute pancreatitis complicating choledochal cysts in children.

    PubMed

    Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

    2017-03-01

    To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  8. Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

    PubMed

    Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

    2012-07-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

  9. The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

    PubMed

    Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

    2016-04-01

    Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

  10. [Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

    PubMed

    Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

    2003-01-01

    The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

  11. Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

    PubMed

    Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

    2017-12-28

    The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

  12. Specific phobia among U.S. adolescents: phenomenology and typology.

    PubMed

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2012-12-01

    Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  13. Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

    Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

  14. Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

    PubMed Central

    Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

    1996-01-01

    We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

  15. Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

    PubMed

    Hidaka, Yoshie; Suzuki, Masakazu

    2004-06-01

    Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

  16. Level III and IV Ecoregions of the Continental United States

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  17. Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

    PubMed Central

    Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

    2014-01-01

    Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

  18. The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

    PubMed

    Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

    2007-06-01

    Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

  19. Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

    2006-10-15

    Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

  20. Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

    PubMed

    Dickens, J C; Prestwich, G D

    1989-02-01

    For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

  1. Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

    PubMed

    Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

    2017-03-01

    We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

  2. Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

    PubMed

    Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

    2015-10-01

    To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  3. Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

    2006-12-15

    We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

  4. Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

    PubMed Central

    Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

    2014-01-01

    Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

  5. Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

    PubMed

    Hardy, Christine D; Cozzarelli, Nicholas R

    2003-03-01

    DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

  6. First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

    PubMed Central

    Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

    2016-01-01

    Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

  7. Lesch typology and temperament in opioid dependence: a cross-sectional study.

    PubMed

    Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

    2014-08-01

    The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

    PubMed

    Luvan, M; Kanthan, S R; Roshan, G; Saw, A

    2015-11-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

  9. A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

    PubMed

    Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

    2009-05-01

    Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

  10. [Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

    PubMed

    Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

    2010-01-01

    Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

  11. Adult presentation of Bartter syndrome type IV with erythrocytosis.

    PubMed

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

  12. Audiological findings in children with mucopolysaccharidoses type i-iv.

    PubMed

    Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

    The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

  13. The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

    PubMed

    Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

    2002-04-02

    The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

  14. Risk evaluation for in-vehicle sign information.

    DOT National Transportation Integrated Search

    2016-05-01

    The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

  15. Nonstatic radiating spheres in general relativity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krori, K.D.; Borgohain, P.; Sarma, R.

    1985-02-15

    The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

  16. Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

    DTIC Science & Technology

    2010-05-01

    Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

  17. Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

    NASA Astrophysics Data System (ADS)

    Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

    2013-09-01

    Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

  18. Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

    PubMed

    Satya, Ramadass; Vijayakumar, Vani

    2006-10-01

    A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

  19. Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

    PubMed

    Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

    2014-06-01

    The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

  20. Biomarker for Glycogen Storage Diseases

    ClinicalTrials.gov

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  1. Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

    PubMed Central

    Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

    2014-01-01

    Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

  2. Self aligned hysteresis free carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

    2016-04-01

    Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

  3. The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

    PubMed

    Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

    2018-05-01

    Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

  4. Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

    PubMed

    Boos, A

    2000-01-01

    Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

  5. Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

    PubMed Central

    Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

    2017-01-01

    The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

  6. Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

    PubMed

    Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

    2016-01-01

    Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

  7. Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

    PubMed Central

    Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

    2016-01-01

    Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

  8. Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

    PubMed Central

    Harastani, Houda H.; Tokajian, Sima T.

    2014-01-01

    Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

  9. Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

    DTIC Science & Technology

    1983-12-01

    2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

  10. Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

    PubMed

    Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

    2017-01-01

    Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

  11. AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasanth, V.; Chen, Yao; Feng, Shiwei

    2016-10-10

    Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

  12. Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

    PubMed

    Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

    2015-07-01

    In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

  13. [Alcohol-related cognitive impairment and the DSM-5].

    PubMed

    Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

    2016-01-01

    It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

  14. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

    PubMed Central

    Luvan, M; Roshan, G; Saw, A

    2015-01-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

  15. The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

    PubMed Central

    Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

    2012-01-01

    In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

  16. Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

    PubMed

    Madabhushi, Ram; Marians, Kenneth J

    2009-01-30

    In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

  17. Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

    PubMed

    Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

    2015-01-01

    A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

  18. Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

    PubMed

    Hardie, Andrew D; Kereshi, Borko

    2014-06-01

    Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

  19. Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

    DTIC Science & Technology

    2017-05-17

    490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

  20. Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

    PubMed

    Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

    2017-01-01

    The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

  1. Adult presentation of Bartter syndrome type IV with erythrocytosis

    PubMed Central

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

  2. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

    PubMed Central

    MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

    2012-01-01

    SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

  3. Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

    PubMed

    Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

    2018-01-09

    Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

  4. The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

    PubMed Central

    Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

    2017-01-01

    Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

  5. Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

    PubMed Central

    Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

    2004-01-01

    NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

  6. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

    PubMed Central

    Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

    2015-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

  7. Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

    PubMed Central

    Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

    2013-01-01

    DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

  8. Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

    PubMed

    Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

    2013-11-01

    The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

  9. Influence of hospital type on survival in stage IV colorectal cancer.

    PubMed

    Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

    2016-08-01

    Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

  10. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  11. Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

    PubMed Central

    Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

    2018-01-01

    Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

  12. Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

    PubMed Central

    SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

    1998-01-01

    Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

  13. Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

    PubMed

    Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

    2005-01-01

    The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

  14. Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

    PubMed

    Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

    2015-08-01

    Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

  15. Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

    PubMed Central

    Charvin, G.; Bensimon, D.; Croquette, V.

    2003-01-01

    Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

  16. L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

    PubMed Central

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

    2012-01-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

  17. L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

    PubMed

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

    2012-10-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

  18. [Joint endoprosthesis pathology. Histopathological diagnostics and classification].

    PubMed

    Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

    2011-05-01

    Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

  19. NATIONAL COASTAL CONDITION REPORT IV | Science ...

    EPA Pesticide Factsheets

    The National Coastal Condition Report IV (NCCR IV) is the fourth in a series of environmental assessments of U.S. coastal waters and the Great Lakes. The report includes assessments of all the nation’s estuaries in the contiguous 48 states and Puerto Rico, south-eastern Alaska, Hawaii, the U.S. Virgin Islands, Guam, and American Samoa. The NCCR IV presents four main types of data: (1) coastal monitoring data, (2) coastal ocean/ offshore monitoring data, (3) offshore fisheries data, and (4) assessment and advisory data (new to NCCR IV). The NCCR IV relies heavily on coastal monitoring data from EPA’s National Coastal Assessment (NCA) to assess coastal condition by evaluating five indicators of condition—water quality, sediment quality, benthic community condition, coastal habitat loss, and fish tissue contaminants. To assess and report on the condition of the nation's coastal resources

  20. 2- and 3-substituted imidazo[1,2-a]pyrazines as inhibitors of bacterial type IV secretion

    PubMed Central

    Sayer, James R.; Walldén, Karin; Pesnot, Thomas; Campbell, Frederick; Gane, Paul J.; Simone, Michela; Koss, Hans; Buelens, Floris; Boyle, Timothy P.; Selwood, David L.; Waksman, Gabriel; Tabor, Alethea B.

    2014-01-01

    A novel series of 8-amino imidazo[1,2-a]pyrazine derivatives has been developed as inhibitors of the VirB11 ATPase HP0525, a key component of the bacterial type IV secretion system. A flexible synthetic route to both 2- and 3-aryl substituted regioisomers has been developed. The resulting series of imidazo[1,2-a]pyrazines has been used to probe the structure–activity relationships of these inhibitors, which show potential as antibacterial agents. PMID:25438770

  1. Sfg

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

  2. Vet

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume F 'Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes STO to ZON' of Volume 14 'Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV 'Physical Chemistry'.

  3. Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

    PubMed

    Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

    2008-12-01

    Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

  4. Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue

    PubMed Central

    Chamot-Rooke, Julia; Rousseau, Benoit; Lanternier, Fanny; Mikaty, Guillain; Mairey, Emilie; Malosse, Christian; Bouchoux, Guy; Pelicic, Vladimir; Camoin, Luc; Nassif, Xavier; Duménil, Guillaume

    2007-01-01

    The importance of protein glycosylation in the interaction of pathogenic bacteria with their host is becoming increasingly clear. Neisseria meningitidis, the etiological agent of cerebrospinal meningitis, crosses cellular barriers after adhering to host cells through type IV pili. Pilin glycosylation genes (pgl) are responsible for the glycosylation of PilE, the major subunit of type IV pili, with the 2,4-diacetamido-2,4,6-trideoxyhexose residue. Nearly half of the clinical isolates, however, display an insertion in the pglBCD operon, which is anticipated to lead to a different, unidentified glycosylation. Here the structure of pilin glycosylation was determined in such a strain by “top-down” MS approaches. MALDI-TOF, nanoelectrospray ionization Fourier transform ion cyclotron resonance, and nanoelectrospray ionization quadrupole TOF MS analysis of purified pili preparations originating from N. meningitidis strains, either wild type or deficient for pilin glycosylation, revealed a glycan mass inconsistent with 2,4-diacetamido-2,4,6-trideoxyhexose or any sugar in the databases. This unusual modification was determined by in-source dissociation of the sugar from the protein followed by tandem MS analysis with collision-induced fragmentation to be a hexose modified with a glyceramido and an acetamido group. We further show genetically that the nature of the sugar present on the pilin is determined by the carboxyl-terminal region of the pglB gene modified by the insertion in the pglBCD locus. We thus report a previously undiscovered monosaccharide involved in posttranslational modification of type IV pilin subunits by a MS-based approach and determine the molecular basis of its biosynthesis. PMID:17804791

  5. Failure mechanisms and closed reduction of a constrained tripolar acetabular liner.

    PubMed

    Robertson, William J; Mattern, Christopher J; Hur, John; Su, Edwin P; Pellicci, Paul M

    2009-02-01

    Unlike traditional bipolar constrained liners, the Osteonics Omnifit constrained acetabular insert is a tripolar device, consisting of an inner bipolar bearing articulating within an outer, true liner. Every reported failure of the Omnifit tripolar implant has been by failure at the shell-bone interface (Type I failure), failure at the shell-liner interface (Type II failure), or failure of the locking mechanism resulting in dislocation of the bipolar-liner interface (Type III failure). In this report we present two cases of failure of the Omnifit tripolar at the bipolar-femoral head interface. To our knowledge, these are the first reported cases of failure at the bipolar-femoral head interface (Type IV failure). In addition, we described the first successful closed reduction of a Type IV failure.

  6. Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

    PubMed Central

    Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

    2014-01-01

    We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

  7. Two-View Gravity Stress Imaging Protocol for Nondisplaced Type II Supination External Rotation Ankle Fractures: Introducing the Gravity Stress Cross-Table Lateral View.

    PubMed

    Boffeli, Troy J; Collier, Rachel C; Gervais, Samuel J

    Assessing ankle stability in nondisplaced Lauge-Hansen supination external rotation type II injuries requires stress imaging. Gravity stress mortise imaging is routinely used as an alternative to manual stress imaging to assess deltoid integrity with the goal of differentiating type II from type IV injuries in cases without a posterior or medial fracture. A type II injury with a nondisplaced fibula fracture is typically treated with cast immobilization, and a type IV injury is considered unstable and often requires operative repair. The present case series (two patients) highlights a standardized 2-view gravity stress imaging protocol and introduces the gravity stress cross-table lateral view. The gravity stress cross-table lateral view provides a more thorough evaluation of the posterior malleolus owing to the slight external rotation and posteriorly directed stress. External rotation also creates less bony overlap between the tibia and fibula, allowing for better visualization of the fibula fracture. Gravity stress imaging confirmed medial-sided injury in both cases, confirming the presence of supination external rotation type IV or bimalleolar equivalent fractures. Open reduction and internal fixation was performed, and both patients achieved radiographic union. No further treatment was required at 21 and 33 months postoperatively. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  8. Fine typing of methicillin-resistant Staphylococcus aureus isolates using direct repeat unit and staphylococcal interspersed repeat unit typing methods.

    PubMed

    Ho, Cheng-Mao; Ho, Mao-Wang; Li, Chi-Yuan; Lu, Jang-Jih

    2015-08-01

    Methicillin-resistant Staphylococcus aureus (MRSA) typing is an important epidemiologic tool for monitoring trends and preventing outbreaks. However, the efficiency of various MRSA typing methods for each SCCmec MRSA isolate is rarely evaluated. A total of 157 MRSA isolates from four different regions in Taiwan were typed with five different molecular methods, including SCCmec typing, multilocus sequence typing (MLST), spa typing, mec-associated direct repeat unit (dru) copy number determination, and staphylococcal interspersed repeat unit (SIRU) profiling. There were four SCCmec types, eight MLST types, 15 spa types, 11 dru types, and 31 SIRU profiles. The most common type determined by each molecular typing method was SCCmec III (115 isolates, 73.2%), ST239 (99 isolates, 63.1%), t037 (107 isolates, 68.2%), 14 dru copies (76 isolates, 48.4%), and SIRU profile 3013722 (102 isolates, 65%), respectively. When using the combination of MLST, spa typing, and dru copy number, ST5-t002-4 (n = 8), ST239-t037-14 (n = 68), ST59-t437-9 (n = 9), and ST59-t437-11 (n = 6) were found to be the most common types of SCCmec types II (n = 9), III (n = 115), IV (n = 21), and VT (n = 11) isolates, respectively. SCCmec type III isolates were further classified into 11 dru types. Of the 21 SCCmec type IV isolates, 14 SIRU profiles were found. Seven SIRU patterns were observed in the 11 SCCmec type VT isolates. Different typing methods showed a similar Hunter-Gaston discrimination index among the 157 MRSA isolates. However, dru and SIRU typing methods had a better discriminatory power for SCCmec type III and SCCmec types IV and VT isolates, respectively, suggesting that dru and SIRU can be used to further type these isolates. Copyright © 2013. Published by Elsevier B.V.

  9. Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

    PubMed

    Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

    2012-11-01

    It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

  10. Genetics of Lesch's typology of alcoholism.

    PubMed

    Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

    2008-02-15

    It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.

  11. Mechanisms and implications of a type IV functional response for short-term intake rate of dry matter in large mammalian herbivores.

    PubMed

    Mezzalira, Jean C; Bonnet, Olivier J F; Carvalho, Paulo C de F; Fonseca, Lidiane; Bremm, Carolina; Mezzalira, Carlos C; Laca, Emilio A

    2017-09-01

    The functional response (i.e. the relationship between consumers' intake rate and resource density) is central in plant-herbivore interactions. Its shape and the biological processes leading to it have significant implications for both foraging theory and ecology of grazing systems. A type IV functional response (i.e. dome-shaped relationship) of short-term intake rate of dry matter (intake while grazing) has rarely been reported for large herbivores and the conditions that can lead to it are poorly understood. We report a type IV functional response observed in heifers grazing monocultures of Cynodon sp. and Avena strigosa. The mechanisms and consequences of this type of functional response for grazed system dynamics are discussed. Intake rate was higher at intermediate than at short or tall sward heights in both grass species. The type IV functional response resulted from changes in bite mass instead of a longer time needed to encounter and process bites. Thus, the decrease of intake rate of dry matter in tall swards is not explained by a shift from process 3 (potential bites are concentrated and apparent) to process 2 (potential bites are apparent but dispersed, Spalinger & Hobbs 1992). Bite mass was smaller in tall than in intermediate swards due to a reduction of bite volume possibly caused by the greater proportion of stem and sheath acting as a physical barrier to bite formation. It is generally accepted that potential bites are abundant and apparent in most grassland and meadow systems, as they were in the present experiments. Therefore, a type IV response of intake rate not directly related to digestive constraints may determine the dynamics of intake and defoliation under a much larger set of conditions than previously thought. These results have implications for foraging theory and stability of grazing systems. For example, if animals prefer patches of intermediate stature that yield the highest intake rate, grazing should lead to the widely observed bimodal distribution of plant mass per unit area, even when tall patches are not of significantly lower digestive quality than the pasture average. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

  12. Slope Stability of Geosynthetic Clay Liner Test Plots

    EPA Science Inventory

    Fourteen full-scale field test plots containing five types of geosynthetic clay liners (GCLs) were constructed on 2H:IV and 3H:IV slopes for the purpose of assessing slope stability. The test plots were designed to simulate typical final cover systems for landfill. Slides occurr...

  13. A novel GBE1 gene variant in a child with glycogen storage disease type IV.

    PubMed

    Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

    2016-08-01

    Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

    PubMed

    Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

    2002-06-01

    Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

  15. Diagnostic efficiency of amylase and type IV collagen in predicting chronic pancreatitis.

    PubMed

    Das, Subir Kumar; Varadhan, Sowmya; Dhanya, L; Mukherjee, Sukhes; Mohana, S; Balakrishnan, V; Vasudevan, D M

    2009-01-01

    Chronic pancreatitis, an irreversible inflammatory disease of the pancreas, is associated with the replacement of the destroyed parenchyma by extended development of fibrosis. Despite marked progress in diagnostic tools, no consensus has been reached in diagnosis of chronic pancreatitis. In this study we examined the hematological and biochemical parameters among 40 chronic pancreatitis patients within 18 to 67 yrs. ESR level and ALP activity was elevated in 40% cases. Serum amylase activity increased in 32 patients and it showed significant correlation with ALP (r=0.458, p=0.003), CA-19.9 (r=0.556, p<0.001), and calcium level (r=-0.472, p=0.002). Type IV collagen level in chronic pancreatitis also elevated (164.4 ± 55.5 ng/ml) and showed negative significant correlation with calcium level (r= -0.505, p=0.001). However, no significant correlation was observed between amylase activity and type IV collagen (r=0.289, p= 0.07).

  16. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    PubMed Central

    2011-01-01

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

  17. Effect of microwave disinfection on compressive and tensile strengths of dental stones.

    PubMed

    Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

    2013-01-01

    Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

  18. Identification of another module involved in the horizontal transfer of the Haemophilus genomic island ICEHin1056.

    PubMed

    Juhas, Mario; Dimopoulou, Ioanna; Robinson, Esther; Elamin, Abdel; Harding, Rosalind; Hood, Derek; Crook, Derrick

    2013-09-01

    A significant part of horizontal gene transfer is facilitated by genomic islands. Haemophilus influenzae genomic island ICEHin1056 is an archetype of a genomic island that accounts for pandemic spread of antibiotics resistance. ICEHin1056 has modular structure and harbors modules involved in type IV secretion and integration. Previous studies have shown that ICEHin1056 encodes a functional type IV secretion system; however, other modules have not been characterized yet. Here we show that the module on the 5' extremity of ICEHin1056 consists of 15 genes that are well conserved in a number of related genomic islands. Furthermore by disrupting six genes of the investigated module of ICEHin1056 by site-specific mutagenesis we demonstrate that in addition to type IV secretion system module, the investigated module is also important for the successful conjugal transfer of ICEHin1056 from donor to recipient cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Exome sequencing establishes a gelsolin mutation as the cause of inherited bulbar-onset neuropathy.

    PubMed

    Caress, James B; Johnson, Janel O; Abramzon, Yevgeniya A; Hawkins, Gregory A; Gibbs, J Raphael; Sullivan, Elizabeth A; Chahal, Chamanpreet S; Traynor, Bryan J

    2017-11-01

    Progressive bulbar motor neuropathy is primarily caused by bulbar-onset ALS. Hereditary amyloidosis type IV also presents with a bulbar neuropathy that mimics motor neuron disease. The disease is prevalent in Finland only and is not commonly included in the differential diagnosis of ALS. We studied 18 members of a family in which some had bulbar motor neuropathy, and we performed exome sequencing. Five affected family members were found to have a D187Y substitution in the GSN gene known to cause hereditary amyloidosis type IV. This American family presented with progressive bulbar neuropathy due to a gelsolin mutation not found in Finland. Hereditary amyloidosis type IV presents with bulbar motor neuropathy and not with peripheral neuropathy as occurs with common forms of amyloidosis. This report demonstrates the power of exome sequencing to determine the cause of rare hereditary diseases with incomplete or atypical phenotypes. Muscle Nerve 56: 1001-1005, 2017. © 2016 Wiley Periodicals, Inc.

  20. Gluteo-vaginal sinus formation complicating posterior intravaginal slingplasty followed by successful IVS removal. A case report and review of the literature.

    PubMed

    Mikos, Themistoklis; Tsalikis, Tryfon; Papanikolaou, Alexios; Pournaropoulos, Fotios; Bontis, John N

    2008-03-01

    Posterior intravaginal slingplasty (IVS) is a technique used for the treatment of apical prolapse. Type III meshes have been mostly used with this technique. In this article, a case of bilateral gluteo-vaginal sinus tract formation that complicated a posterior vaginal slingplasty with a type III mesh is presented. At 3 months follow-up, the patient complained for bulking through the vagina, continuous offensive vaginal discharge, and constant pain at the buttocks. She had prolapse recurrence, and there was defective healing at the gluteal entry points of the posterior IVS. Ten months after the initial surgery, she underwent a laparotomic subtotal hysterectomy and sacrocervicopexy with prolene type I mesh. At the same time, the posterior mesh was removed allowing the surgeon to discover communication of the canal of the mesh extending from gluteal incisions to the vagina epithelium. The sinus tract was managed surgically with excision of the surrounding tissues. There was no recurrence or other complications at 2 months follow-up.

  1. In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

    PubMed Central

    Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

    2009-01-01

    Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

  2. Transarterial treatment with Onyx of Cognard type IV anterior cranial fossa dural arteriovenous fistulas.

    PubMed

    Li, Chuanhui; Wu, Zhongxue; Yang, Xinjian; Li, Youxiang; Jiang, Chuhan; He, Hongwei

    2014-03-01

    Cognard type IV anterior cranial fossa dural arteriovenous fistulas (DAVFs) are rare lesions with a high risk of intracranial hemorrhage. We present our experience with the use of Onyx via the arterial route in these aggressive lesions. Between October 2009 and October 2011, six consecutive patients diagnosed with Cognard type IV anterior cranial fossa DAVFs were treated transarterially with Onyx in our department. All patients were male; mean age was 55 years (range 38-68). Four patients presented with intracranial hemorrhage as the initial manifestation; one patient presented with seizures at the time of diagnosis and experienced intracranial hemorrhage during the antiepileptic therapy; and the other patient was asymptomatic. In five patients, complete obliteration was achieved with transarterial Onyx injection in a single treatment session; in the remaining patient, subtotal occlusion was achieved and gamma knife treatment was followed. The average time of injection was 19 min (range 5-28) for every pedicle catheterized and the average amount of Onyx was 3.2 ml (range 0.4-6.3) for each lesion. All patients recovered uneventfully after embolization. No mortality or permanent morbidity was observed in this series. Follow-up digital subtraction or MR angiography confirmed durable obliteration of the fistulas in five cured cases. No patients suffered intracranial hemorrhage during the follow-up period. In this small series, our experience with the use of Onyx for arterial embolization of Cognard type IV DAVFs is encouraging, with durable complete cure in most lesions without severe complications.

  3. CT-based radiomics signature for differentiating Borrmann type IV gastric cancer from primary gastric lymphoma.

    PubMed

    Ma, Zelan; Fang, Mengjie; Huang, Yanqi; He, Lan; Chen, Xin; Liang, Cuishan; Huang, Xiaomei; Cheng, Zixuan; Dong, Di; Liang, Changhong; Xie, Jiajun; Tian, Jie; Liu, Zaiyi

    2017-06-01

    To evaluate the value of CT-based radiomics signature for differentiating Borrmann type IV gastric cancer (GC) from primary gastric lymphoma (PGL). 40 patients with Borrmann type IV GC and 30 patients with PGL were retrospectively recruited. 485 radiomics features were extracted and selected from the portal venous CT images to build a radiomics signature. Subjective CT findings, including gastric wall peristalsis, perigastric fat infiltration, lymphadenopathy below the renal hila and enhancement pattern, were assessed to construct a subjective findings model. The radiomics signature, subjective CT findings, age and gender were integrated into a combined model by multivariate analysis. The diagnostic performance of these three models was assessed with receiver operating characteristics curves (ROC) and were compared using DeLong test. The subjective findings model, the radiomics signature and the combined model showed a diagnostic accuracy of 81.43% (AUC [area under the curve], 0.806; 95% CI [confidence interval]: 0.696-0.917; sensitivity, 63.33%; specificity, 95.00%), 84.29% (AUC, 0.886 [95% CI: 0.809-0.963]; sensitivity, 86.67%; specificity, 82.50%), 87.14% (AUC, 0.903 [95%CI: 0.831-0.975]; sensitivity, 70.00%; specificity, 100%), respectively. There were no significant differences in AUC among these three models (P=0.051-0.422). Radiomics analysis has the potential to accurately differentiate Borrmann type IV GC from PGL. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  5. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  6. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  7. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  8. Standard-Cell, Open-Architecture Power Conversion Systems

    DTIC Science & Technology

    2005-10-01

    TLmax Maximum junction temperature 423 OK Table 5. 9. PEBB average model description in VTB. Terminal Type Name - 4 -, A Power DC Bus + B Power AC Pole...5 A. Switching models ........................................................................................ 5 B. Average ...11-6 IV. Average Modeling of PEBB-Based Converters...................................................... 11-10 0 IV. 1.Voltage

  9. Vorinostat and Azacitidine in Treating Patients With Locally Recurrent or Metastatic Nasopharyngeal Cancer or Nasal Natural Killer T-Cell Lymphoma

    ClinicalTrials.gov

    2018-04-20

    Adult Nasal Type Extranodal NK/T-Cell Lymphoma; Recurrent Nasopharyngeal Keratinizing Squamous Cell Carcinoma; Recurrent Nasopharyngeal Undifferentiated Carcinoma; Stage IV Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7; Stage IV Nasopharyngeal Undifferentiated Carcinoma AJCC v7

  10. Effects of intravenous delivery systems on infused red blood cells.

    PubMed

    Gibson, J S; Leff, R D; Roberts, R J

    1984-03-01

    The effects of various intravenous delivery systems on the integrity of infused red blood cells (RBCs) were studied. Using a factorial design, whole blood and packed RBCs were infused through i.v. delivery systems employing various combinations of i.v. tubing diameter and length, needle gauge, infusion rate (5 and 50 ml/hr), type of infusion pump (piston, diaphragm, or peristaltic operation), and type of blood product. The age and temperature of the blood filter used were held constant. A 5-ml sample of the blood product obtained during each experimental run was analyzed for plasma free-hemoglobin to assess the degree of hemolysis. Osmotic fragility of the RBCs was evaluated by measuring the percentage of hemolysis in the blood products in various concentrations of sodium chloride solution. Type of blood product and i.v. pump were the only variables significantly influencing RBC hemolysis. In both blood products, a greater degree of hemolysis occurred with the peristaltic-type pump than with the other types of pumps. In packed RBCs, the diaphragm-type pump produced greater hemolysis than the piston-type pump, but hemolysis was similar in whole-blood samples. Regardless of the type of pump, more hemolysis occurred in whole blood at the 5-ml/hr infusion rate than at the 50-ml/hr rate, but the converse was true in packed RBCs. Samples of both blood products were less osmotically fragile than their respective controls at sodium chloride concentrations ranging from 0.30 to 0.50%.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Renal tubular acidosis type IV in hyperkalaemic patients--a fairy tale or reality?

    PubMed

    Haas, Christian S; Pohlenz, Inga; Lindner, Ulrich; Muck, Philip M; Arand, Jovana; Suefke, Sven; Lehnert, Hendrik

    2013-05-01

    Hyperkalaemia is a common feature in hospitalized patients and often attributed to drugs antagonizing the renin-angiotensin-aldosterone system (RAAS) and/or acute kidney injury (AKI), despite significantly preserved glomerular filtration rate (GFR). The objective of this study was to determine the prevalence and role of renal tubular acidosis type IV (RTA IV) in the development of significant hyperkalaemia. A single-centre retrospective study. Patients admitted to a University Hospital over 12 months. Patients with a potassium value > 6·0 mm were identified. Clinical and laboratory data were revisited, and patients with a normal anion gap metabolic acidosis were evaluated for the existence of RTA IV. A total of 57 patients having significant hyperkalaemia (>6·0 mm) were identified. Twelve patients had end-stage renal disease, while 21 patients had solely AKI or progressive chronic renal failure. RTA IV was present in 24 patients (42%), of whom 71% had pre-existing renal insufficiency because of diabetic nephropathy or tubulointerstitial nephritis. All hyperkalaemic patients with urinary/serum electrolytes suggestive of RTA IV had evidence of AKI, but creatinine levels were significantly lower (P < 0·05), while the number of drugs antagonizing the RAAS was comparable. We demonstrated that RTA IV (i) is very common in patients with hyperkalaemia; (ii) should always be suspected in hyperkalaemic patients with only moderately impaired GFR; and (iii) may result in significant hyperkalaemia in the presence of both AKI and drugs antagonizing the RAAS. © 2012 Blackwell Publishing Ltd.

  12. A Comprehensive Functional Analysis of NTRK1 Missense Mutations Causing Hereditary Sensory and Autonomic Neuropathy Type IV (HSAN IV).

    PubMed

    Shaikh, Samiha S; Chen, Ya-Chun; Halsall, Sally-Anne; Nahorski, Michael S; Omoto, Kiyoyuki; Young, Gareth T; Phelan, Anne; Woods, Christopher Geoffrey

    2017-01-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV) is an autosomal recessive disorder characterized by a complete lack of pain perception and anhidrosis. Here, we studied a cohort of seven patients with HSAN IV and describe a comprehensive functional analysis of seven novel NTRK1 missense mutations, c.1550G >A, c.1565G >A, c.1970T >C, c.2096T >C, c.2254T >A, c.2288G >C, and c.2311C >T, corresponding to p.G517E, p.G522E, p.L657P, p.I699T, p.C752S, p.C763S, and p.R771C, all of which were predicted pathogenic by in silico analysis. The results allowed us to assess the pathogenicity of each mutation and to gain novel insights into tropomyosin receptor kinase A (TRKA) downstream signaling. Each mutation was systematically analyzed for TRKA glycosylation states, intracellular and cell membrane expression patterns, nerve growth factor stimulated TRKA autophosphorylation, TRKA-Y496 phosphorylation, PLCγ activity, and neurite outgrowth. We showed a diverse range of functional effects: one mutation appeared fully functional, another had partial activity in all assays, one mutation affected only the PLCγ pathway and four mutations were proved null in all assays. Thus, we conclude that complete abolition of TRKA kinase activity is not the only pathogenic mechanism underlying HSAN IV. By corollary, the assessment of the clinical pathogenicity of HSAN IV mutations is more complex than initially predicted and requires a multifaceted approach. © 2016 WILEY PERIODICALS, INC.

  13. Predicting DPP-IV inhibitors with machine learning approaches

    NASA Astrophysics Data System (ADS)

    Cai, Jie; Li, Chanjuan; Liu, Zhihong; Du, Jiewen; Ye, Jiming; Gu, Qiong; Xu, Jun

    2017-04-01

    Dipeptidyl peptidase IV (DPP-IV) is a promising Type 2 diabetes mellitus (T2DM) drug target. DPP-IV inhibitors prolong the action of glucagon-like peptide-1 (GLP-1) and gastric inhibitory peptide (GIP), improve glucose homeostasis without weight gain, edema, and hypoglycemia. However, the marketed DPP-IV inhibitors have adverse effects such as nasopharyngitis, headache, nausea, hypersensitivity, skin reactions and pancreatitis. Therefore, it is still expected for novel DPP-IV inhibitors with minimal adverse effects. The scaffolds of existing DPP-IV inhibitors are structurally diversified. This makes it difficult to build virtual screening models based upon the known DPP-IV inhibitor libraries using conventional QSAR approaches. In this paper, we report a new strategy to predict DPP-IV inhibitors with machine learning approaches involving naïve Bayesian (NB) and recursive partitioning (RP) methods. We built 247 machine learning models based on 1307 known DPP-IV inhibitors with optimized molecular properties and topological fingerprints as descriptors. The overall predictive accuracies of the optimized models were greater than 80%. An external test set, composed of 65 recently reported compounds, was employed to validate the optimized models. The results demonstrated that both NB and RP models have a good predictive ability based on different combinations of descriptors. Twenty "good" and twenty "bad" structural fragments for DPP-IV inhibitors can also be derived from these models for inspiring the new DPP-IV inhibitor scaffold design.

  14. Alport syndrome and thin glomerular basement membrane nephropathy: a practical approach to diagnosis.

    PubMed

    Haas, Mark

    2009-02-01

    Alport syndrome and thin glomerular basement membrane nephropathy (TBMN) are genetically heterogeneous conditions characterized by structural abnormalities in the glomerular basement membrane and an initial presentation that usually involves hematuria. Approximately 40% of patients with TBMN are heterozygous carriers for autosomal recessive Alport syndrome, with mutations at the genetic locus encoding type IV collagen alpha(3) [alpha(3)(IV)] and alpha(4) chains. However, although the clinical course of TBMN is usually benign, Alport syndrome, particularly the X-linked form with mutations in the locus encoding the alpha(5) chain of type IV collagen [alpha(5)(IV)], typically results in end-stage renal disease. Electron microscopy is essential to diagnosis of TBMN and Alport syndrome on renal biopsy, although electron microscopy alone is of limited value in distinguishing between TBMN, the heterozygous carrier state of X-linked Alport syndrome, autosomal recessive Alport syndrome, and even early stages of X-linked Alport syndrome. To review diagnostic pathologic features of each of the above conditions, emphasizing the need for immunohistology for alpha(3)(IV) and alpha(5)(IV) in addition to electron microscopy to resolve this differential diagnosis on a renal biopsy. The diagnostic value of immunofluorescence studies for alpha(5)(IV) on a skin biopsy in family members of patients with Alport syndrome also is reviewed. Original and comprehensive review articles on the diagnosis of Alport syndrome and TBMN from the past 35 years, primarily the past 2 decades, and experience in our own renal pathology laboratory. Although Alport syndrome variants and TBMN do not show characteristic light microscopic findings and can be difficult to differentiate from each other even by electron microscopy, using a combination of electron microscopy and immunohistology for alpha(3)(IV) and alpha(5)(IV) enables pathologists to definitively diagnose these disorders on renal biopsy in most cases.

  15. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy.

    PubMed

    Rossi, Valentina; Nolè, Franco; Redana, Stefania; Adamoli, Laura; Martinello, Rossella; Aurilio, Gaetano; Verri, Elena; Sapino, Anna; Viale, Giuseppe; Aglietta, Massimo; Montemurro, Filippo

    2014-02-01

    Five to 10% of women with newly diagnosed breast cancer have synchronous metastases (de novo stage IV). A further 20% will develop metastases during follow-up (recurring stage IV). We compared the clinical outcomes of women with HER2-positive metastatic breast cancer (MBC) receiving first-line trastuzumab-based therapy according to type of metastatic presentation. Retrospective analysis of 331 MBC patients receiving first-line trastuzumab-based treatment. Response rates (RR) were compared by the chi-square test. Time-to progression (TTP) and overall survival (OS) curves were compared by the log-rank test. Cox-proportional hazards models were used to study predictors of PFS and OS, including the type of metastatic presentation. Seventy-seven patients (23%) had de novo stage IV disease. Forty-six of these patients underwent surgery of the primary ("de novo/surgery"). Response rates to first-line trastuzumab-based therapy and median progression-free survival did not differ in patients with "recurring", "de novo/surgery" and "de novo" without surgery ("de novo/no surgery) stage IV breast cancer. However, women with "de novo/surgery" stage IV breast cancer had the longest median OS (60 months), and those with "de novo/no surgery" stage IV breast cancer the shortest (26 months). For women with recurring metastatic breast cancer median OS was 40 months (overall log-rank test, p < 0.01). Multivariate analysis confirmed these findings. Our analysis shows that response rates and PFS to first-line trastuzumab-based therapy do not differ significantly between de novo and recurring stage IV, HER2 positive breast cancer. The observed difference in OS favoring women with de novo stage IV disease submitted to surgery of the primary tumor could be the result of a selection bias. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Genome-Enabled Studies of Anaerobic, Nitrate-Dependent Iron Oxidation in the Chemolithoautotrophic Bacterium Thiobacillus denitrificans

    NASA Astrophysics Data System (ADS)

    Beller, H. R.; Zhou, P.; Legler, T. C.; Chakicherla, A.; O'Day, P. A.

    2013-12-01

    Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. Of the transposon mutants defective in Fe(II) oxidation, one mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process.

  17. Genome-enabled studies of anaerobic, nitrate-dependent iron oxidation in the chemolithoautotrophic bacterium Thiobacillus denitrificans

    PubMed Central

    Beller, Harry R.; Zhou, Peng; Legler, Tina C.; Chakicherla, Anu; Kane, Staci; Letain, Tracy E.; A. O’Day, Peggy

    2013-01-01

    Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. A transposon mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process. PMID:24065960

  18. Rib Cage Deformities Alter Respiratory Muscle Action and Chest Wall Function in Patients with Severe Osteogenesis Imperfecta

    PubMed Central

    LoMauro, Antonella; Pochintesta, Simona; Romei, Marianna; D'Angelo, Maria Grazia; Pedotti, Antonio; Turconi, Anna Carla; Aliverti, Andrea

    2012-01-01

    Background Osteogenesis imperfecta (OI) is an inherited connective tissue disorder characterized by bone fragility, multiple fractures and significant chest wall deformities. Cardiopulmonary insufficiency is the leading cause of death in these patients. Methods Seven patients with severe OI type III, 15 with moderate OI type IV and 26 healthy subjects were studied. In addition to standard spirometry, rib cage geometry, breathing pattern and regional chest wall volume changes at rest in seated and supine position were assessed by opto-electronic plethysmography to investigate if structural modifications of the rib cage in OI have consequences on ventilatory pattern. One-way or two-way analysis of variance was performed to compare the results between the three groups and the two postures. Results Both OI type III and IV patients showed reduced FVC and FEV1 compared to predicted values, on condition that updated reference equations are considered. In both positions, ventilation was lower in OI patients than control because of lower tidal volume (p<0.01). In contrast to OI type IV patients, whose chest wall geometry and function was normal, OI type III patients were characterized by reduced (p<0.01) angle at the sternum (pectus carinatum), paradoxical inspiratory inward motion of the pulmonary rib cage, significant thoraco-abdominal asynchronies and rib cage distortions in supine position (p<0.001). Conclusions In conclusion, the restrictive respiratory pattern of Osteogenesis Imperfecta is closely related to the severity of the disease and to the sternal deformities. Pectus carinatum characterizes OI type III patients and alters respiratory muscles coordination, leading to chest wall and rib cage distortions and an inefficient ventilator pattern. OI type IV is characterized by lower alterations in the respiratory function. These findings suggest that functional assessment and treatment of OI should be differentiated in these two forms of the disease. PMID:22558284

  19. Transarterial Onyx embolization of intracranial dural arteriovenous fistulas: a single center experience.

    PubMed

    Luo, Chao-Bao; Chang, Feng-Chi; Mu-Huo Teng, Michael; Lin, Chung-Jung; Wu, Hsiu-Mei; Guo, Wan-Yuo; Chang, Cheng-Yen

    2014-04-01

    Transarterial embolization of intracranial dural arteriovenous fistulas (DAVFs) is usually associated with inadequate embolization. The purpose of this study was to report our experience of transarterial Onyx embolization of intracranial DAVFs with an emphasis on treatment outcome with this new embolic agent in different types of DAVFs. In the past 3 years, a total of 14 intracranial DAVFs have been treated by transarterial Onyx embolization. Among these, there were nine males and five females, aged from 30 years to 82 years (mean = 62 years). We retrospectively analyzed the injection volume and time of Onyx embolization as well as outcomes in different types of DAVFs. The locations of the DAVFs were sigmoid sinus (n = 6), tentorium (n = 3), sinus confluence (n = 2), transverse-sigmoid sinus (n = 1), sigmoid sinus-jugular bulb (n = 1) and the superior petrous sinus (n = 1). The mean volume and time of Onyx injection were 3.4 mL and 28 minutes, respectively (Cognard type I: 4.9 mL, 40 minutes; type II: 4.5 mL, 34 minutes; type III: 2.2 mL, 21 minutes; type IV: 2 mL, 22 minutes). Total fistula occlusion was achieved in six out of seven patients of type III and type IV DAVFs, and in four out of seven patients of type I and type II DAVFs. Nine patients had total resolution of their symptoms, whereas partial regression occurred in five patients. No significant periprocedural complication was found. Mean clinical follow-up period was 16 months. Transarterial Onyx embolization of intracranial DAVFs is safe and effective. This technique is particularly useful in type III and type IV DAVFs with a high cure rate, and lower volume of Onyx as well as a short injection time. Copyright © 2014. Published by Elsevier B.V.

  20. Analysis of Phoenix Anomalies and IV & V Findings Applied to the GRAIL Mission

    NASA Technical Reports Server (NTRS)

    Larson, Steve

    2012-01-01

    NASA IV&V was established in 1993 to improve safety and cost-effectiveness of mission critical software. Since its inception the tools and strategies employed by IV&V have evolved. This paper examines how lessons learned from the Phoenix project were developed and applied to the GRAIL project. Shortly after selection, the GRAIL project initiated a review of the issues documented by IV&V for Phoenix. The motivation was twofold: the learn as much as possible about the types of issues that arose from the flight software product line slated for use on GRAIL, and to identify opportunities for improving the effectiveness of IV&V on GRAIL. The IV&V Facility provided a database dump containing 893 issues. These were categorized into 16 bins, and then analyzed according to whether the project responded by changing the affected artifacts or using as-is. The results of this analysis were compared to a similar assessment of post-launch anomalies documented by the project. Results of the analysis were discussed with the IV&V team assigned to GRAIL. These discussions led to changes in the way both the project and IV&V approached the IV&V task, and improved the efficiency of the activity.

  1. Contribution of alpha3(IV)alpha4(IV)alpha5(IV) Collagen IV to the Mechanical Properties of the Glomerular Basement Membrane

    NASA Astrophysics Data System (ADS)

    Gyoneva, Lazarina

    The glomerular basement membrane (GBM) is a vital part of the blood-urine filtration barrier in the kidneys. In healthy GBMs, the main tension-resisting component is alpha3(IV)alpha4(IV)alpha5(IV) type IV collagen, but in some diseases it is replaced by other collagen IV isoforms. As a result, the GBM becomes leaky and disorganized, ultimately resulting in kidney failure. Our goal is to understanding the biomechanical aspects of the alpha3(IV)alpha4(IV)alpha5(IV) chains and how their absence could be responsible for (1) the initial injury to the GBM and (2) progression to kidney failure. A combination of experiments and computational models were designed for that purpose. A model basement membrane was used to compare experimentally the distensibility of tissues with the alpha3(IV)alpha4(IV)alpha5(IV) chains present and missing. The experiments showed basement membranes containing alpha3(IV)alpha4(IV)alpha5(IV) chains were less distensible. It has been postulated that the higher level of lateral cross-linking (supercoiling) in the alpha3(IV)alpha4(IV)alpha5(IV) networks contributes additional strength/stability to basement membranes. In a computational model of supercoiled networks, we found that supercoiling greatly increased the stiffness of collagen IV networks but only minimally decreased the permeability, which is well suited for the needs of the GBM. It is also known that the alpha3(IV)alpha4(IV)alpha5(IV) networks are more protected from enzymatic degradation, and we explored their significance in GBM remodeling. Our simulations showed that the more protected network was needed to prevent the system from entering a dangerous feedback cycle due to autoregulation mechanisms in the kidneys. Overall, the work adds to the evidence of biomechanical differences between the alpha3(IV)alpha4(IV)alpha5(IV) networks and other collagen IV networks, points to supercoiling as the main source of biomechanical differences, discusses the suitability of alpha3(IV)alpha4(IV)alpha5(IV) networks to meet the mechanics and permeability needs of the GBM, and explores the role of biomechanics and enzymatic digestion in GBM remodeling.

  2. A Morphological Analysis of Gamma-Ray Burst Early-optical Afterglows

    NASA Astrophysics Data System (ADS)

    Gao, He; Wang, Xiang-Gao; Mészáros, Peter; Zhang, Bing

    2015-09-01

    Within the framework of the external shock model of gamma-ray burst (GRB) afterglows, we perform a morphological analysis of the early-optical light curves to directly constrain model parameters. We define four morphological types, i.e., the reverse shock-dominated cases with/without the emergence of the forward shock peak (Type I/Type II), and the forward shock-dominated cases without/with νm crossing the band (Type III/IV). We systematically investigate all of the Swift GRBs that have optical detection earlier than 500 s and find 3/63 Type I bursts (4.8%), 12/63 Type II bursts (19.0%), 30/63 Type III bursts (47.6%), 8/63 Type IV bursts (12.7%), and 10/63 Type III/IV bursts (15.9%). We perform Monte Carlo simulations to constrain model parameters in order to reproduce the observations. We find that the favored value of the magnetic equipartition parameter in the forward shock ({ɛ }B{{f}}) ranges from 10-6 to 10-2, and the reverse-to-forward ratio of ɛB ({{R}}B) is about 100. The preferred electron equipartition parameter {ɛ }{{e}}{{r},{{f}}} value is 0.01, which is smaller than the commonly assumed value, e.g., 0.1. This could mitigate the so-called “efficiency problem” for the internal shock model, if ɛe during the prompt emission phase (in the internal shocks) is large (say, ˜0.1). The preferred {{R}}B value is in agreement with the results in previous works that indicate a moderately magnetized baryonic jet for GRBs.

  3. Comparative c-type cytochrome expression analysis in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C grown with soluble and insoluble oxidised metal electron acceptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna

    2012-01-01

    The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less

  4. The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili.

    PubMed

    Baynham, Patricia J; Ramsey, Deborah M; Gvozdyev, Borys V; Cordonnier, Ellen M; Wozniak, Daniel J

    2006-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that is commonly found in water and soil. In order to colonize surfaces with low water content, P. aeruginosa utilizes a flagellum-independent form of locomotion called twitching motility, which is dependent upon the extension and retraction of type IV pili. This study demonstrates that AlgZ, previously identified as a DNA-binding protein absolutely required for transcription of the alginate biosynthetic operon, is required for twitching motility. AlgZ may be required for the biogenesis or function of type IV pili in twitching motility. Transmission electron microscopy analysis of an algZ deletion in nonmucoid PAO1 failed to detect surface pili. To examine expression and localization of PilA (the major pilin subunit), whole-cell extracts and cell surface pilin preparations were analyzed by Western blotting. While the PilA levels present in whole-cell extracts were similar for wild-type P. aeruginosa and P. aeruginosa with the algZ deletion, the amount of PilA on the surface of the cells was drastically reduced in the algZ mutant. Analysis of algZ and algD mutants indicates that the DNA-binding activity of AlgZ is essential for the regulation of twitching motility and that this is independent of the role of AlgZ in alginate expression. These data show that AlgZ DNA-binding activity is required for twitching motility independently of its role in alginate production and that this involves the surface localization of type IV pili. Given this new role in twitching motility, we propose that algZ (PA3385) be designated amrZ (alginate and motility regulator Z).

  5. Diagnostic accuracy study of anorectal manometry for diagnosis of dyssynergic defaecation

    PubMed Central

    Grossi, Ugo; Carrington, Emma V; Bharucha, Adil E; Horrocks, Emma J; Scott, S Mark; Knowles, Charles H

    2015-01-01

    Objective The diagnostic accuracy of anorectal manometry (AM), which is necessary to diagnose functional defaecatory disorders (FDD), is unknown. Using blinded analysis and standardised reporting of diagnostic accuracy (STARD), we evaluated whether AM could discriminate between asymptomatic controls and patients with functional constipation (FC). Design Derived line-plots of anorectal pressure profiles during simulated defaecation were independently analysed in random order by 3 expert observers blinded to health status in 85 women with FC and 85 age-matched asymptomatic healthy volunteers (HV). Using accepted criteria, these pressure profiles were characterized as normal (i.e. increased rectal pressure coordinated with anal relaxation) or types I-IV dyssynergia. Inter-observer agreement and diagnostic accuracy were determined. Results Blinded consensus-based assessment disclosed a normal pattern in 16/170 (9%) of all participants and only 11/85 (13%) HV. The combined frequency of dyssynergic patterns (I-IV) was very similar in FC (80/85 [94%]) and HV (74/85 [87%]). Type I dyssynergia (‘paradoxical’ contraction) was less prevalent in FC (17/85 [20%] than HV (31/85 [36.5%], p=0.03). After statistical correction, only type IV dyssynergia was moderately useful for discriminating between FC (39/85 [46%] and HV 17/85 [20%], p=0.001, PPV=70.0%, positive LR=2.3). Inter-observer agreement was substantial or moderate for identifying a normal pattern, dyssynergia types I and IV, and FDD, and fair for types II and III. Conclusions While the interpretation of AM patterns is reproducible, nearly 90% of HV have a pattern that is currently regarded as “abnormal” by AM. Hence AM is of limited utility for distinguishing between FC and HV. PMID:25765461

  6. Does microvascularization of the footprint play a role in rotator cuff healing of the shoulder?

    PubMed

    Bonnevialle, Nicolas; Bayle, Xavier; Faruch, Marie; Wargny, Matthieu; Gomez-Brouchet, Anne; Mansat, Pierre

    2015-08-01

    The aim of the study was to evaluate the relationship between bone microvascularization of the footprint and tendon integrity after rotator cuff repair of the shoulder. Forty-eight patients (mean age, 59 years; ±7.9) with a chronic rotator cuff tear underwent a tendon repair with a single-row technique and were studied prospectively. A core obtained from the footprint during the procedure allowed determination of the bone's microvascularization with an immunohistochemistry technique using anti-CD34 antibodies. Clinical evaluation was performed at a minimum of 12-month follow-up, and rotator cuff integrity was assessed with ultrasound according to Sugaya's classification. At a mean follow-up of 13 months, the Constant score improved from 40 to 75 points; American Shoulder and Elbow Surgeons score, from 59 to 89 points; and subjective shoulder value, from 38% to 83% (P < .001). Ultrasound identified 18 patients with Sugaya type I healing, 27 patients with type II, and 3 patients with type IV. No patients showed Sugaya type III or V repairs. The rate of microvascularization of the footprint was 15.6%, 13.9%, and 4.2% for type I, II, and IV tendon integrity, respectively (I vs. II, P = .22; II vs. IV, P = .02; I vs. IV, P = .0022). Patients with a history of corticosteroid injection had a lower rate of microvascularization than the others (10.3% vs. 16.2%; P = .03). Even if overall satisfactory clinical outcomes are achieved after a rotator cuff repair, bone microvascularization of the footprint plays a role in rotator cuff healing. A lower rate of microvessels decreases the tendon integrity and healing potential after repair. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  7. A case of mild phenotype Alport syndrome caused by COL4A3 mutations.

    PubMed

    Kamijo, Masafumi; Kitamura, Mineaki; Muta, Kumiko; Uramatsu, Tadashi; Obata, Yoko; Nozu, Kandai; Kaito, Hiroshi; Iijima, Kazumoto; Mukae, Hiroshi; Nishino, Tomoya

    2017-11-01

    In a case of 41-year-old man with mild nephropathy, Alport syndrome (AS) was diagnosed from the renal biopsy. However, the α5 chain of type IV collagen expressed in the glomerular basement membrane, which was the atypical staining pattern of AS. Genetic testing suggested autosomal recessive AS from heterozygous mutations at two positions in the type IV collagen α3 chain. These two gene mutations represented a new pattern of mutation and was suggested the association with an atypical α5 chain expression and mild phenotype.

  8. Bacteria use type IV pili to walk upright and detach from surfaces.

    PubMed

    Gibiansky, Maxsim L; Conrad, Jacinta C; Jin, Fan; Gordon, Vernita D; Motto, Dominick A; Mathewson, Margie A; Stopka, Wiktor G; Zelasko, Daria C; Shrout, Joshua D; Wong, Gerard C L

    2010-10-08

    Bacterial biofilms are structured multicellular communities involved in a broad range of infections. Knowing how free-swimming bacteria adapt their motility mechanisms near surfaces is crucial for understanding the transition between planktonic and biofilm phenotypes. By translating microscopy movies into searchable databases of bacterial behavior, we identified fundamental type IV pili-driven mechanisms for Pseudomonas aeruginosa surface motility involved in distinct foraging strategies. Bacteria stood upright and "walked" with trajectories optimized for two-dimensional surface exploration. Vertical orientation facilitated surface detachment and could influence biofilm morphology.

  9. Catalase-loaded cisplatin-prodrug-constructed liposomes to overcome tumor hypoxia for enhanced chemo-radiotherapy of cancer.

    PubMed

    Zhang, Rui; Song, Xuejiao; Liang, Chao; Yi, Xuan; Song, Guosheng; Chao, Yu; Yang, Yu; Yang, Kai; Feng, Liangzhu; Liu, Zhuang

    2017-09-01

    Aiming at improved therapeutic efficacies, the combination of chemotherapy and radiotherapy (chemo-radiotherapy) has been widely studied and applied in clinic. However, the hostile characteristics of tumor microenvironment such as hypoxia often limit the efficacies in both types of cancer therapies. Herein, catalase (CAT), an antioxidant enzyme, is encapsulated inside liposomes constituted by cisplatin (IV)-prodrug-conjugated phospholipid, forming CAT@Pt (IV)-liposome for enhanced chemo-radiotherapy of cancer. After being loaded inside liposomes, CAT within CAT@Pt (IV)-liposome shows retained and well-protected enzyme activity, and is able to trigger decomposition of H 2 O 2 produced by tumor cells, so as to produce additional oxygen for hypoxia relief. As the result, treatment of CAT@Pt (IV)-liposome induces the highest level of DNA damage in cancer cells after X-ray radiation compared to the control groups. In vivo tumor treatment further demonstrates a remarkably improved therapeutic outcome in chemo-radiotherapy with such CAT@Pt (IV)-liposome nanoparticles. Hence, an exquisite type of liposome-based nanoparticles is developed in this work by integrating cisplatin-based chemotherapy and catalase-induced tumor hypoxia relief together for combined chemo-radiotherapy with great synergistic efficacy, promising for clinical translation in cancer treatment. Copyright © 2017. Published by Elsevier Ltd.

  10. Pelvic Arterial Anatomy Relevant to Prostatic Artery Embolisation and Proposal for Angiographic Classification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Assis, André Moreira de, E-mail: andre.maa@gmail.com; Moreira, Airton Mota, E-mail: motamoreira@gmail.com; Paula Rodrigues, Vanessa Cristina de, E-mail: vanessapaular@yahoo.com.br

    PurposeTo describe and categorize the angiographic findings regarding prostatic vascularization, propose an anatomic classification, and discuss its implications for the PAE procedure.MethodsAngiographic findings from 143 PAE procedures were reviewed retrospectively, and the origin of the inferior vesical artery (IVA) was classified into five subtypes as follows: type I: IVA originating from the anterior division of the internal iliac artery (IIA), from a common trunk with the superior vesical artery (SVA); type II: IVA originating from the anterior division of the IIA, inferior to the SVA origin; type III: IVA originating from the obturator artery; type IV: IVA originating from themore » internal pudendal artery; and type V: less common origins of the IVA. Incidences were calculated by percentage.ResultsTwo hundred eighty-six pelvic sides (n = 286) were analyzed, and 267 (93.3 %) were classified into I–IV types. Among them, the most common origin was type IV (n = 89, 31.1 %), followed by type I (n = 82, 28.7 %), type III (n = 54, 18.9 %), and type II (n = 42, 14.7 %). Type V anatomy was seen in 16 cases (5.6 %). Double vascularization, defined as two independent prostatic branches in one pelvic side, was seen in 23 cases (8.0 %).ConclusionsDespite the large number of possible anatomical variations of male pelvis, four main patterns corresponded to almost 95 % of the cases. Evaluation of anatomy in a systematic fashion, following a standard classification, will make PAE a faster, safer, and more effective procedure.« less

  11. Management of inferior vena cava aneurysm.

    PubMed

    Montero-Baker, M F; Branco, B C; Leon, L L; Labropoulos, N; Echeverria, A; Mills, J L

    2015-10-01

    Inferior vena cava (IVC) aneurysm is an infrequent but potentially lethal abnormality. We have seen one such case in our group practice. We have added this case to a review of 53 previously reported cases in order to develop a management algorithm for this entity. We conducted a MedLine search of all English-language articles from the first reported case in 1950 through August 2013. Patient demographics, clinical data, management and outcomes were extracted. IVC aneurysms were categorized in 4 types as per Gradman and Steinberg classification. The mean patient age was 27.1 years (range 5-89) and 57.4% were male. A total of 11 (20.3%) had associated vascular anomalies and iliocaval thrombosis was found in 10 (18.5%). There were 23 type I aneurysms, 8 type IIs, 21 type IIIs and 2 type IVs. All but 1 type I was successfully managed conservatively without complications. For type IIs, only 3 patients were managed conservatively with 1 death related to stroke from paradoxical embolus. For type IIIs, resection was the most common management option (14 patients). One patient was treated endovascularly with aneurysm embolization. A total of 6 asymptomatic patients were treated conservatively with 1 death due to thromboembolism. For type IVs, all cases underwent expectant management with 1 death due to aneurysm rupture. IVC aneurysms are rare with only 54 cases reported in the literature. Associated vascular anomalies and iliocaval thrombosis should be expected in approximately 20% of cases. Type I aneurysms can be managed expectantly with close surveillance unless symptomatic. For type II-IV, surgical consideration should be given based on high rates of thromboembolic complications and non-negligible risk of rupture.

  12. Decreased fracture rate, pharmacogenetics and BMD response in 79 Swedish children with osteogenesis imperfecta types I, III and IV treated with Pamidronate.

    PubMed

    Lindahl, K; Kindmark, A; Rubin, C-J; Malmgren, B; Grigelioniene, G; Söderhäll, S; Ljunggren, Ö; Åström, E

    2016-06-01

    Osteogenesis imperfecta (OI) is an inherited heterogeneous bone fragility disorder, usually caused by collagen I mutations. It is well established that bisphosphonate treatment increases lumbar spine (LS) bone mineral density (BMD), as well as improves vertebral geometry in severe OI; however, fracture reduction has been difficult to prove, pharmacogenetic studies are scarce, and it is not known at which age, or severity of disease, treatment should be initiated. COL1A1 and COL1A2 were analyzed in 79 children with OI (type I n=33, type III n=25 and type IV n=21) treated with Pamidronate. Data on LS BMD, height, and radiologically confirmed non-vertebral and vertebral fractures were collected prior to, and at several time points during treatment. An increase in LS BMD Z-score was observed for all types of OI, and a negative correlation to Δ LS BMD was observed for both age and LS BMD Z-score at treatment initiation. Supine height Z-scores were not affected by Pamidronate treatment, The fracture rate was reduced for all OI types at all time points during treatment (overall p<0.0003, <0.0001 and 0.0003 for all OI types I, III and IV respectively). The reduced fracture rate was maintained for types I and IV, while an additional decrease was observed over time for type III. The fracture rate was reduced also in individuals with continued low BMD after >4yrs Pamidronate. Twice as many boys as girls with OI type I were treated with Pamidronate, and the fracture rate the year prior treatment was 2.2 times higher for boys (p=0.0236). Greater Δ LS BMD, but smaller Δ fracture numbers were observed on Pamidronate for helical glycine mutations in COL1A1 vs. COL1A2. Vertebral compression fractures did not progress in any individual during treatment; however, they did not improve in 9%, and these individuals were all >11years of age at treatment initiation (p<0.0001). Pamidronate treatment in children with all types of OI increased LS BMD, decreased fracture rate, and improved vertebral compression fractures. Fracture reduction was prompt and maintained during treatment, irrespective of age at treatment initiation and collagen I mutation type. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. The lateral mobility of cell adhesion molecules is highly restricted at septate junctions in Drosophila.

    PubMed

    Laval, Monique; Bel, Christophe; Faivre-Sarrailh, Catherine

    2008-07-18

    A complex of three cell adhesion molecules (CAMs) Neurexin IV(Nrx IV), Contactin (Cont) and Neuroglian (Nrg) is implicated in the formation of septate junctions between epithelial cells in Drosophila. These CAMs are interdependent for their localization at septate junctions and e.g. null mutation of nrx IV or cont induces the mislocalization of Nrg to the baso-lateral membrane. These mutations also result in ultrastructural alteration of the strands of septate junctions and breakdown of the paracellular barrier. Varicose (Vari) and Coracle (Cora), that both interact with the cytoplasmic tail of Nrx IV, are scaffolding molecules required for the formation of septate junctions. We conducted photobleaching experiments on whole living Drosophila embryos to analyze the membrane mobility of CAMs at septate junctions between epithelial cells. We show that GFP-tagged Nrg and Nrx IV molecules exhibit very stable association with septate junctions in wild-type embryos. Nrg-GFP is mislocalized to the baso-lateral membrane in nrx IV or cont null mutant embryos, and displays increased mobile fraction. Similarly, Nrx IV-GFP becomes distributed to the baso-lateral membrane in null mutants of vari and cora, and its mobile fraction is strongly increased. The loss of Vari, a MAGUK protein that interacts with the cytoplasmic tail of Nrx IV, has a stronger effect than the null mutation of nrx IV on the lateral mobility of Nrg-GFP. The strands of septate junctions display a stable behavior in vivo that may be correlated with their role of paracellular barrier. The membrane mobility of CAMs is strongly limited when they take part to the multimolecular complex forming septate junctions. This restricted lateral diffusion of CAMs depends on both adhesive interactions and clustering by scaffolding molecules. The lateral mobility of CAMs is strongly increased in embryos presenting alteration of septate junctions. The stronger effect of vari by comparison with nrx IV null mutation supports the hypothesis that this scaffolding molecule may cross-link different types of CAMs and play a crucial role in stabilizing the strands of septate junctions.

  14. Apolipoprotein A-IV concentrations and clinical outcomes in haemodialysis patients with type 2 diabetes mellitus--a post hoc analysis of the 4D Study.

    PubMed

    Kollerits, B; Krane, V; Drechsler, C; Lamina, C; März, W; Ritz, E; Wanner, C; Kronenberg, F

    2012-12-01

    Apolipoprotein A-IV (apoA-IV) is an anti-atherogenic and anti-oxidative plasma glycoprotein involved in reverse cholesterol transport. The aim of this study was to examine the association between apoA-IV and all-cause mortality, cardiovascular endpoints and parameters of protein-energy wasting and nutrition in haemodialysis patients. This post hoc analysis was performed in the German Diabetes Dialysis Study (4D Study) evaluating atorvastatin in 1255 haemodialysis patients with type 2 diabetes mellitus, followed for a median of 4 years. The association between apoA-IV and relevant outcomes was analysed using Cox proportional hazards regression analyses. Body mass index (BMI) was used as a marker of protein-energy wasting. In addition, a definition of extended wasting was applied, combining median values of BMI, serum albumin, creatinine and sensitive C-reactive protein, to classify patients. Mean (±SD) apoA-IV concentration was 49.8 ± 14.2 mg dL(-1). Age- and gender-adjusted apoA-IV concentrations were strongly associated with the presence of congestive heart failure at baseline [odds ratio = 0.81, 95% confidence interval (CI) 0.74-0.88 per 10 mg dL(-1) increase; P < 0.001). During the prospective follow-up, the strongest association was found for all-cause mortality [hazard ratio (HR) = 0.89, 95% CI 0.85-0.95, P = 0.001), which was mainly because of patients with BMI > 23 kg m(-2) (HR = 0.87, 95% CI 0.82-0.94, P < 0.001) and those in the nonwasting group according to the extended definition (HR = 0.89, 95% CI 0.84-0.96, P = 0.001). This association remained significant after additionally adjusting for parameters associated with apoA-IV at baseline. Further associations were observed for sudden cardiac death. ApoA-IV was less strongly associated with atherogenic events such as myocardial infarction. Low apoA-IV levels seem to be a risk predictor of all-cause mortality and sudden cardiac death. This association might be modified by nutritional status. © 2012 The Association for the Publication of the Journal of Internal Medicine.

  15. Comparison of efficacies of a dipeptidyl peptidase IV inhibitor and alpha-glucosidase inhibitors in oral carbohydrate and meal tolerance tests and the effects of their combination in mice.

    PubMed

    Yamazaki, Kazuto; Inoue, Takashi; Yasuda, Nobuyuki; Sato, Yoshiaki; Nagakura, Tadashi; Takenaka, Osamu; Clark, Richard; Saeki, Takao; Tanaka, Isao

    2007-05-01

    E3024 (3-but-2-ynyl-5-methyl-2-piperazin-1-yl-3,5-dihydro-4H-imidazo[4,5-d]pyridazin-4-one tosylate) is a dipeptidyl peptidase IV (DPP-IV) inhibitor. Since the target of both DPP-IV inhibitors and alpha-glucosidase inhibitors is the lowering of postprandial hyperglycemia, we compared antihyperglycemic effects for E3024 and alpha-glucosidase inhibitors in various oral carbohydrate and meal tolerance tests using normal mice. In addition, we investigated the combination effects of E3024 and voglibose on blood glucose levels in a meal tolerance test using mice fed a high-fat diet. ER-235516-15 (the trifluoroacetate salt form of E3024, 1 mg/kg) lowered glucose excursions consistently, regardless of the kind of carbohydrate loaded. However, the efficacy of acarbose (10 mg/kg) and of voglibose (0.1 mg/kg) varied with the type of carbohydrate administered. The combination of E3024 (3 mg/kg) and voglibose (0.3 mg/kg) improved glucose tolerance additively, with the highest plasma active glucagon-like peptide-1 levels. This study shows that compared to alpha-glucosidase inhibitors, DPP-IV inhibitors may have more consistent efficacy to reduce postprandial hyperglycemia, independent of the types of carbohydrate contained in a meal, and that the combination of a DPP-IV inhibitor and an alpha-glucosidase inhibitor is expected to be a promising option for lowering postprandial hyperglycemia.

  16. Bowel perforation in type IV vascular Ehlers-Danlos syndrome. A systematic review.

    PubMed

    El Masri, H; Loong, T-H; Meurette, G; Podevin, J; Zinzindohoue, F; Lehur, P-A

    2018-05-01

    Spontaneous gastrointestinal (GI) perforation is a well-known complication occurring in patients suffering from Type IV vascular Ehlers-Danlos syndrome (EDS IV). The aim of the present study was to review the current literature on spontaneous GI perforation in EDS IV and illustrate the surgical management and outcome when possible. A systematic review of all the published data on EDS IV patients with spontaneous GI perforation between January 2000 and December 2015 was conducted using three major databases PUBMED, EMBASE, and Cochrane Central Register of Controlled Trails. References of the selected articles were screened to avoid missing main articles. Twenty-seven published case reports and four retrospective studies, including 31 and 527 cases, respectively, matched the search criteria. A case from our institution was added. Mean age was 26 years (range 6-64 years). The most frequent site of perforation was the colon, particularly the sigmoid, followed by small bowel, upper rectum, and finally stomach. The majority of cases were initially managed with Hartmann's procedure. In recurrent perforations, total colectomy was performed. The reperforation rate was considerably higher in the "partial colectomy with anastomosis" group than in the Hartmann group. Colonic perforation is the most common spontaneous GI perforation in EDS IV patients. An unexpected fragility of the tissues should raise the possibility of a connective tissue disorder and prompt further investigation with eventual management of these high-risk patients with a multidisciplinary team approach in dedicated centres. In the emergency setting, a Hartmann procedure should be performed.

  17. Molecular Characterization of Methicillin-Resistant Staphylococcus aureus Isolates, Isolated from a Burn Hospital in Southwest Iran in 2006 and 2014.

    PubMed

    Ghaznavi-Rad, Ehsanollah; Ekrami, Alireza

    2018-01-01

    Incidence of methicillin-resistant Staphylococcus aureus (MRSA) is increasing every year, especially in burn patients with a high rate of morbidity and mortality. Molecular and epidemiologic studies are useful practices for understanding the relatedness of isolates in a single patient or a hospital. This study aimed at determining molecular characterizations of isolates collected in 2006 and 2014 using S. aureus -specific staphylococcal protein A (Spa) typing and Multilocus Sequence Typing (MLST) methods. Totally, 71 MRSA isolates were collected during the last two studies (2006 and 2014) from burn patients at Taleghani Burn Centre. After confirmation, all isolates were analysed using MLST and Spa typing methods. We reported the emergence of Spa type t021, ST-30-IV MRSA isolates, which were PVL-positive in 14.6% of the cases and t12366, ST-8-IV isolates, which were PVL-negative in 9.8% of the cases. In 2014 study, Spa typing of MRSA isolates revealed five different spa types. Overall, in two studies, t037, ST-239, SCC mec III, and CC8 were predominant clones and they were reported in 63% of the cases. The predominance of ST-239 in this region during the last eight years is a major concern. It also has a disturbing impact on the management of staphylococcal infections. Moreover, the SCC mec type IV strain is able to disseminate rapidly in hospital environments, demanding an improvement in infection-control policy.

  18. Polyglycine hydrolases secreted by Pleosporineae fungi that target the linker region of plant class IV chitinases*

    USDA-ARS?s Scientific Manuscript database

    Chitinase modifying proteins (cmps) are fungal proteases that truncate plant class IV chitinases by cleaving near their amino termini. We previously described Fv-cmp, a fungalysin protease that cleaves a conserved glycine-cysteine bond within the hevein domain. Here we describe a new type of cmp—pol...

  19. Antimicrobial peptide inhibition of fungalysin proteases that target plant type 19 Family IV defense chitinases

    USDA-ARS?s Scientific Manuscript database

    Cereal crops and other plants produce secreted seed chitinases that reduce pathogenic infection, most likely by targeting the fungal chitinous cell wall. We have shown that corn (Zea mays) produces three GH family 19, plant class IV chitinases, that help in protecting the plant against Fusarium and ...

  20. Validity of DSM-IV attention deficit/hyperactivity disorder symptom dimensions and subtypes.

    PubMed

    Willcutt, Erik G; Nigg, Joel T; Pennington, Bruce F; Solanto, Mary V; Rohde, Luis A; Tannock, Rosemary; Loo, Sandra K; Carlson, Caryn L; McBurnett, Keith; Lahey, Benjamin B

    2012-11-01

    Diagnostic and Statistical Manual of Mental Disorders, 4th Edition (DSM-IV) criteria for attention deficit/hyperactivity disorder (ADHD) specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, we conclude that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. (PsycINFO Database Record (c) 2012 APA, all rights reserved).

  1. Molecular and Functional Effects of a Splice Site Mutation in the MYL2 Gene Associated with Cardioskeletal Myopathy and Early Cardiac Death in Infants

    PubMed Central

    Zhou, Zhiqun; Huang, Wenrui; Liang, Jingsheng; Szczesna-Cordary, Danuta

    2016-01-01

    The homozygous appearance of the intronic mutation (IVS6-1) in the MYL2 gene encoding for myosin ventricular/slow-twitch skeletal regulatory light chain (RLC) was recently linked to the development of slow skeletal muscle fiber type I hypotrophy and early cardiac death. The IVS6-1 (c403-1G>C) mutation resulted from a cryptic splice site in MYL2 causing a frameshift and replacement of the last 32 codons by 19 different amino acids in the RLC mutant protein. Infants who were IVS6-1+∕+-positive died between 4 and 6 months of age due to cardiomyopathy and heart failure. In this report we have investigated the molecular mechanism and functional consequences associated with the IVS6-1 mutation using recombinant human cardiac IVS6-1 and wild-type (WT) RLC proteins. Recombinant proteins were reconstituted into RLC-depleted porcine cardiac muscle preparations and subjected to enzymatic and functional assays. IVS6-1-RLC showed decreased binding to the myosin heavy chain (MHC) compared with WT, and IVS6-1-reconstituted myosin displayed reduced binding to actin in rigor. The IVS6-1 myosin demonstrated a significantly lower Vmax of the actin-activated myosin ATPase activity compared with WT. In stopped-flow experiments, IVS6-1 myosin showed slower kinetics of the ATP induced dissociation of the acto-myosin complex and a significantly reduced slope of the kobs-[MgATP] relationship compared to WT. In skinned porcine cardiac muscles, RLC-depleted and IVS6-1 reconstituted muscle strips displayed a significant decrease in maximal contractile force and a significantly increased Ca2+ sensitivity, both hallmarks of hypertrophic cardiomyopathy-associated mutations in MYL2. Our results showed that the amino-acid changes in IVS6-1 were sufficient to impose significant conformational alterations in the RLC protein and trigger a series of abnormal protein-protein interactions in the cardiac muscle sarcomere. Notably, the mutation disrupted the RLC-MHC interaction and the steady-state and kinetics of the acto-myosin interaction. Specifically, slower myosin cross-bridge turnover rates and slower second-order MgATP binding rates of acto-myosin interactions were observed in IVS6-1 vs. WT reconstituted cardiac preparations. Our in vitro results suggest that when placed in vivo, IVS6-1 may lead to cardiomyopathy and early death of homozygous infants by severely compromising the ability of myosin to develop contractile force and maintain normal systolic and diastolic cardiac function. PMID:27378946

  2. Singular F(R) cosmology unifying early- and late-time acceleration with matter and radiation domination era

    NASA Astrophysics Data System (ADS)

    Odintsov, S. D.; Oikonomou, V. K.

    2016-06-01

    We present some cosmological models which unify the late- and early-time acceleration eras with the radiation and the matter domination era, and we realize the cosmological models by using the theoretical framework of F(R) gravity. Particularly, the first model unifies the late- and early-time acceleration with the matter domination era, and the second model unifies all the evolution eras of our Universe. The two models are described in the same way at early and late times, and only the intermediate stages of the evolution have some differences. Each cosmological model contains two Type IV singularities which are chosen to occur one at the end of the inflationary era and one at the end of the matter domination era. The cosmological models at early times are approximately identical to the R 2 inflation model, so these describe a slow-roll inflationary era which ends when the slow-roll parameters become of order one. The inflationary era is followed by the radiation era and after that the matter domination era follows, which lasts until the second Type IV singularity, and then the late-time acceleration era follows. The models have two appealing features: firstly they produce a nearly scale invariant power spectrum of primordial curvature perturbations and a scalar-to-tensor ratio which are compatible with the most recent observational data and secondly, it seems that the deceleration-acceleration transition is crucially affected by the presence of the second Type IV singularity which occurs at the end of the matter domination era. As we demonstrate, the Hubble horizon at early times shrinks, as expected for an initially accelerating Universe, then during the matter domination era, it expands and finally after the Type IV singularity, the Hubble horizon starts to shrink again, during the late-time acceleration era. Intriguingly enough, the deceleration-acceleration transition, occurs after the second Type IV singularity. In addition, we investigate which F(R) gravity can successfully realize each of the four cosmological epochs.

  3. Using type IV Pearson distribution to calculate the probabilities of underrun and overrun of lists of multiple cases.

    PubMed

    Wang, Jihan; Yang, Kai

    2014-07-01

    An efficient operating room needs both little underutilised and overutilised time to achieve optimal cost efficiency. The probabilities of underrun and overrun of lists of cases can be estimated by a well defined duration distribution of the lists. To propose a method of predicting the probabilities of underrun and overrun of lists of cases using Type IV Pearson distribution to support case scheduling. Six years of data were collected. The first 5 years of data were used to fit distributions and estimate parameters. The data from the last year were used as testing data to validate the proposed methods. The percentiles of the duration distribution of lists of cases were calculated by Type IV Pearson distribution and t-distribution. Monte Carlo simulation was conducted to verify the accuracy of percentiles defined by the proposed methods. Operating rooms in John D. Dingell VA Medical Center, United States, from January 2005 to December 2011. Differences between the proportion of lists of cases that were completed within the percentiles of the proposed duration distribution of the lists and the corresponding percentiles. Compared with the t-distribution, the proposed new distribution is 8.31% (0.38) more accurate on average and 14.16% (0.19) more accurate in calculating the probabilities at the 10th and 90th percentiles of the distribution, which is a major concern of operating room schedulers. The absolute deviations between the percentiles defined by Type IV Pearson distribution and those from Monte Carlo simulation varied from 0.20  min (0.01) to 0.43  min (0.03). Operating room schedulers can rely on the most recent 10 cases with the same combination of surgeon and procedure(s) for distribution parameter estimation to plan lists of cases. Values are mean (SEM). The proposed Type IV Pearson distribution is more accurate than t-distribution to estimate the probabilities of underrun and overrun of lists of cases. However, as not all the individual case durations followed log-normal distributions, there was some deviation from the true duration distribution of the lists.

  4. Inhibition of dipeptidyl-peptidase IV catalyzed peptide truncation by Vildagliptin ((2S)-{[(3-hydroxyadamantan-1-yl)amino]acetyl}-pyrrolidine-2-carbonitrile).

    PubMed

    Brandt, Inger; Joossens, Jurgen; Chen, Xin; Maes, Marie-Berthe; Scharpé, Simon; De Meester, Ingrid; Lambeir, Anne-Marie

    2005-07-01

    Vildagliptin (NVP-LAF237/(2S)-{[(3-hydroxyadamantan-1-yl)amino]acetyl}-pyrrolidine-2-carbonitrile) was described as a potent, selective and orally bio-available dipeptidyl-peptidase IV (DPP IV, EC 3.4.14.5) inhibitor [Villhauer EB, Brinkman JA, Naderi GB, Burkey BF, Dunning BE, Prasad K, et al.1-[[(3-Hydroxy-1-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine: a potent, selective, and orally bioavailable dipeptidyl peptidase IV inhibitor with antihyperglycemic properties. J Med Chem 2003;46:2774-89]. Phase III clinical trials for the use of this compound in the treatment of Type 2 diabetes were started in the first quarter of 2004. In this paper, we report on (1) the kinetics of binding, (2) the type of inhibition, (3) the selectivity with respect to other peptidases, and (4) the inhibitory potency on the DPP IV catalyzed degradation of glucagon-like peptide-1 (GLP-1), glucose-dependent insulinotropic polypeptide (GIP) and substance P. Vildagliptin behaved as a slow-binding DPP IV inhibitor with an association rate constant of 1.4x10(5)M(-1)s(-1) and a K(i) of 17nM. It is a micromolar inhibitor for dipeptidyl-peptidase 8 and does not significantly inhibit dipeptidyl-peptidase II (EC 3.4.11.2), prolyl oligopeptidase (EC 3.4.21.26), aminopeptidase P (EC 3.4.11.9) or aminopeptidase M (EC 3.4.11.2). There was no evidence for substrate specific inhibition of DPP IV by Vildagliptin or for important allosteric factors affecting the inhibition constant in presence of GIP and GLP-1.

  5. Discovery of 2-[4-{{2-(2S,5R)-2-cyano-5-ethynyl-1-pyrrolidinyl]-2-oxoethyl]amino]- 4-methyl-1-piperidinyl]-4-pyridinecarboxylic acid (ABT-279): a very potent, selective, effective, and well-tolerated inhibitor of dipeptidyl peptidase-IV, useful for the treatment of diabetes.

    PubMed

    Madar, David J; Kopecka, Hana; Pireh, Daisy; Yong, Hong; Pei, Zhonghua; Li, Xiaofeng; Wiedeman, Paul E; Djuric, Stevan W; Von Geldern, Thomas W; Fickes, Michael G; Bhagavatula, Lakshmi; McDermott, Todd; Wittenberger, Steven; Richards, Steven J; Longenecker, Kenton L; Stewart, Kent D; Lubben, Thomas H; Ballaron, Stephen J; Stashko, Michael A; Long, Michelle A; Wells, Heidi; Zinker, Bradley A; Mika, Amanda K; Beno, David W A; Kempf-Grote, Anita J; Polakowski, James; Segreti, Jason; Reinhart, Glenn A; Fryer, Ryan M; Sham, Hing L; Trevillyan, James M

    2006-10-19

    Dipeptidyl peptidase-IV (DPP-IV) inhibitors are poised to be the next major drug class for the treatment of type 2 diabetes. Structure-activity studies of substitutions at the C5 position of the 2-cyanopyrrolidide warhead led to the discovery of potent inhibitors of DPP-IV that lack activity against DPP8 and DPP9. Further modification led to an extremely potent (Ki(DPP)(-)(IV) = 1.0 nM) and selective (Ki(DPP8) > 30 microM; Ki(DPP9) > 30 microM) clinical candidate, ABT-279, that is orally available, efficacious, and remarkably safe in preclinical safety studies.

  6. Ultraviolet light sensitivity and prolonged UVR-erythema

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilson, P.D.; Kaidbey, K.H.; Kligman, A.M.

    The erythema and tanning responses in skin type I (n . 15) and skin type IV (n . 17) have been compared in caucasoids following a single exposure to solar simulated radiation. The former sunburn easily and do not tan while the latter do not burn and tan readily. The dose of radiation was 5 times the Minimal Erythema Dose (MED). The test sites were the extensor aspect of the forearm (exposed site) and flexor aspect of the upper arm (nonexposed site). The responses were monitored at 24 and 48 hr and then twice weekly for 8 weeks. The groupmore » of skin type I individuals had a lower MED and a much more prolonged erythema on both the exposed and nonexposed sites than the group of type IV individuals. All differences were highly significant (p less than 0.005). After 4 weeks erythema remained present in all of the type I subjects but had disappeared in 16 of the 17 type IV subjects. Within the groups there was no difference between erythema duration on exposed vs. nonexposed sites, but there was a highly significant difference (p less than 0.005) between the lower MED on the upper arm and higher MED on the forearm. These results contrast with those of other reports in which prolonged erythema could not be correlated with fair complexion, sunburn sensitivity, ethnic background, or skin type but was instead found to be a distinct feature of persons who had developed nonmelanoma skin cancer. Since prolonged erythema is related to skin type it is therefore not solely a feature of patients with skin cancer.« less

  7. Testing for Drug Hypersensitivity Syndromes

    PubMed Central

    Rive, Craig M; Bourke, Jack; Phillips, Elizabeth J

    2013-01-01

    Adverse drug reactions are a common cause of patient morbidity and mortality. Type B drug reactions comprise only 20% of all drug reactions but they tend to be primarily immunologically mediated and less dependent on the drug’s pharmacological action and dose. Common Type B reactions seen in clinical practice are those of the immediate, IgE, Gell-Coombs Type I reactions, and the delayed, T-cell mediated, Type IV reactions. Management of these types of reactions, once they have occurred, requires careful consideration and recognition of the utility of routine diagnostic tests followed by ancillary specialised diagnostic testing. For Type I, IgE mediated reactions this includes prick/intradermal skin testing and oral provocation. For Type IV, T-cell mediated reactions this includes a variety of in vivo (patch testing) and ex vivo tests, many of which are currently mainly used in highly specialised research laboratories. The recent association of many serious delayed (Type IV) hypersensitivity reactions to specific drugs with HLA class I and II alleles has created the opportunity for HLA screening to exclude high risk populations from exposure to the implicated drug and hence prevent clinical reactions. For example, the 100% negative predictive value of HLA-B*5701 for true immunologically mediated abacavir hypersensitivity and the development of feasible, inexpensive DNA-based molecular tests has led to incorporation of HLA-B*5701 screening in routine HIV clinical practice. The mechanism by which drugs specifically interact with HLA has been recently characterised and promises to lead to strategies for pre-clinical screening to inform drug development and design. PMID:23592889

  8. Treatment of Crowe Type-IV Hip Dysplasia Using Cementless Total Hip Arthroplasty and Double Chevron Subtrochanteric Shortening Osteotomy: A 5- to 10-Year Follow-Up Study.

    PubMed

    Li, Xigong; Lu, Yang; Sun, Junying; Lin, Xiangjin; Tang, Tiansi

    2017-02-01

    The purpose of this study was to evaluate the functional and radiographic results of patients with Crowe type-IV hip dysplasia treated by cementless total hip arthroplasty and double chevron subtrochanteric osteotomy. From January 2000 to February 2006, cementless total hip arthroplasty with a double chevron subtrochanteric shortening osteotomy was performed on 18 patients (22 hips) with Crowe type-IV dysplasia. The acetabular cup was placed in the position of the anatomic hip center, and subtrochanteric femoral shortening osteotomy was performed with the use of a double chevron design. The clinical and radiographic outcomes were reviewed with a mean follow-up of 6.5 years (5-10 years). The mean amount of femoral subtrochanteric shortening was 38 mm (25-60 mm). All osteotomy sites were healed by 3-6 months without complications. The mean Harris Hip Score improved significantly from 47 points (35-65 points) preoperatively to 88 points (75-97 points) at the final follow-up. The Trendelenburg sign was corrected from a positive preoperative status to a negative postoperative status in 12 of 22 hips. No acetabular and femoral components have loosened or required revision during the period of follow-up. Cementless total hip arthroplasty using double chevron subtrochanteric osteotomy allowed for restoration of anatomic hip center with safely functional limb lengthening, achieved correction of preoperative limp, and good functional and radiographic outcomes for 22 Crowe type-IV dislocation hips at the time of the 5- to 10-year follow-up. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Influence of polyurethane resin dies on the fit and adaptation of full veneer crowns.

    PubMed

    Lillywhite, Graeme R R; Vohra, Fahim

    2015-01-01

    Polyurethane resin is a possible alternative to type IV dental stone for fabrication of indirect restorations however its dimensional accuracy is questionable. The aim was to investigate the dimensional accuracy of silica filled polyurethane resin die material by evaluating the marginal fit and adaptation of indirect gold castings. Experimental, in vitro study. Totally 40 copper plated replicas of a nickel chrome master die analogous to a veneer gold crown preparation were made and impressions recorded using polyvinylsiloxane material. Twenty impressions were poured in type IV dental stone (control group (Vel-mix, Kerr, UK) and the remaining (n = 20) in silica filled polyurethane die material (test group) (Alpha Die MF, CA, USA). Gold castings were fabricated for each die using standardized techniques. The castings were seated on their respective copper plated dies, embedded in resin and sectioned. The specimens were analyzed by measuring marginal opening and the area beneath the casting at a ×63 magnification and using image analysis software. Data were analyzed using a Student's t-test. No significant difference was observed between the experimental groups (P > 0.05). The mean marginal opening for type IV, dental stone and polyurethane resin, was 57 ± 22.6 μm and 63.47 ± 27.1 μm, respectively. Stone displayed a smaller area beneath the casting (31581 ± 16297 μm 2 ) as compared to polyurethane resin (35003 ± 23039 μm 2 ). The fit and adaptation of indirect gold castings made on polyurethane and type IV dental stone dies were comparable.

  10. [Longitudinal preputial pedicled flap urethroplasty for chordee of Donnahoo type IV].

    PubMed

    Zeng, Li; Shan, Wei; Yuan, Miao; Huang, Guizhen; Huang, Lugang

    2012-11-01

    To investigate the effectiveness of longitudinal preputial pedicled flap urethroplasty for chordee of Donnahoo IV type. Between June 1994 and October 2011, 30 patients with chordee (Donnahoo type IV) underwent longitudinal preputial pedicled flap urethroplasty. The patients' age ranged from 2 to 16 years (mean, 5.8 years). The morphology of the balanus-navicular fossa-external urethral orifice ranged normal; the penis length was 2.5-6.8 cm (mean, 4.3 cm); the penis bending angle was 35-70 degrees (mean, 40.1 degrees). Primary and secondary operation was 27 cases and 3 cases, respectively. The size of flap ranged from 1.5 cm x 1.3 cm to 4.0 cm x 2.0 cm. After correction, the penis length was 3.0-8.5 cm (mean, 6.6 cm); the penis bending angle was 0-10 degrees (mean, 1.2 degrees). All patients were followed up 6 months to 12 years (mean, 33 months). No recurrence, stabbing pain of the balanus, or foreign body sensation occurred during follow-up. Of them, 4 patients (13.33%) had urinary fistular, they had satisfactory results after the second operation; 2 patients (6.67%) had urethral stricture 1 month after operation, they also had satisfactory results after arethral dilatation. The other patients showed no scattering urinary flow and good direction without complication. Six patients had satisfactory sexual function after puberty without erection disorder, pain, or dyspareunia. Longitudinal preputial pedicled flap urethroplasty can achieve maximum utilization of prepuce and aesthetic and functional improvement with less complication, so it is a relatively ideal mean for treating chordee of Donnahoo type IV.

  11. National Estimates of Exposure to Traumatic Events and PTSD Prevalence Using DSM-IV and DSM-5 Criteria

    PubMed Central

    Kilpatrick, Dean G.; Resnick, Heidi S.; Milanak, Melissa E.; Miller, Mark W.; Keyes, Katherine M.; Friedman, Matthew J.

    2014-01-01

    Prevalence of posttraumatic stress disorder (PTSD) defined according to the American Psychiatric Association’s Diagnostic and Statistical Manual fifth edition (DSM-5; 2013) and fourth edition (DSM-IV; 1994) was compared in a national sample of U.S. adults (N = 2,953) recruited from an online panel. Exposure to traumatic events, PTSD symptoms, and functional impairment were assessed online using a highly structured, self-administered survey. Traumatic event exposure using DSM-5 criteria was high (89.7%), and exposure to multiple traumatic event types was the norm. PTSD caseness was determined using Same Event (i.e., all symptom criteria met to the same event type) and Composite Event (i.e., symptom criteria met to a combination of event types) definitions. Lifetime, past-12-month, and past 6-month PTSD prevalence using the Same Event definition for DSM-5 was 8.3%, 4.7%, and 3.8% respectively. All 6 DSM-5 prevalence estimates were slightly lower than their DSM-IV counterparts, although only 2 of these differences were statistically significant. DSM-5 PTSD prevalence was higher among women than among men, and prevalence increased with greater traumatic event exposure. Major reasons individuals met DSM-IV criteria, but not DSM-5 criteria were the exclusion of nonaccidental, nonviolent deaths from Criterion A, and the new requirement of at least 1 active avoidance symptom. PMID:24151000

  12. A retrospective chart review to assess the safety of nonablative fractional laser resurfacing in Fitzpatrick skin types IV to VI.

    PubMed

    Clark, Charlotte M; Silverberg, Jonathan I; Alexis, Andrew F

    2013-04-01

    Laser resurfacing in patients with Fitzpatrick skin phototypes (SPT) IV to VI is associated with a higher risk of pigmentary alteration. There is a paucity of studies evaluating optimum treatment parameters for fractional lasers in darkly pigmented skin types. This is a retrospective review of medical records for patients with SPT IV to VI who were treated with a 1,550 nm erbium-doped fractional nonablative laser (Fraxel Re:Store SR 1550; Solta Medical, Hayword, CA). Data were collected from patient charts and the clinic laser logbook from January 2008 to January 2012. The frequency of treatment-associated postinflammatory hyperpigmentation (PIH) and treatment settings used were evaluated. A total of 115 total laser sessions (45 patients) were included in our analysis. Five of the sessions (4%) were accompanied by PIH, 2 of which occurred in a single patient. Only 1 episode of PIH lasted longer than 1 month (2 months). Two of the 5 cases had only transient PIH (≤7 days), one of which was reported by the patient and not clinically evident on examination. The 1,550 nm erbium-doped fractional laser is well tolerated in SPT IV to VI. Fractional laser resurfacing, with the settings used and pretreatment and posttreatment hydroquinone 4% cream, was associated with a low risk of PIH in darker skin types.

  13. Immunohistochemical distribution of collagens type I, III, IV and VI, of undulin and of tenascin in oral fibrous hyperplasia.

    PubMed

    Becker, J; Schuppan, D; Müller, S

    1993-11-01

    The distribution of collagens type I, IV and VI, of procollagen type III, of undulin and of tenascin was studied in 10 lesions which were clinically and histologically diagnosed as localized oral fibrous hyperplasias. The immunohistochemical distribution of these proteins was similar to that observed for normal oral mucosa. Undulin showed a pattern of parallel fibers throughout. Collagen type VI was pronounced in the subepithelial connective tissue, whereas the collagen fiber bundles were equally reactive for collagens type I and III. Tenascin was observed close to the subepithelial basement membrane and in proximity to collagen fiber bundles in the upper connective tissue. The present findings indicate that oral fibrous hyperplasias that are probably caused by inflammation or chronic irritation show the differentiated and ordered pattern of extracellular matrix proteins characteristic of normal oral mucosa.

  14. Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes.

    PubMed

    Haddad, N M; Ente, D; Chouery, E; Jalkh, N; Mehawej, C; Khoueir, Z; Pingault, V; Mégarbané, A

    2011-01-01

    Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region.

  15. Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes

    PubMed Central

    Haddad, N.M.; Ente, D.; Chouery, E.; Jalkh, N.; Mehawej, C.; Khoueir, Z.; Pingault, V.; Mégarbané, A.

    2011-01-01

    Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region. PMID:21373256

  16. Sunlight exposure and photoprotection behaviour of white Caucasian adolescents in the UK.

    PubMed

    Gould, M; Farrar, M D; Kift, R; Berry, J L; Mughal, M Z; Bundy, C; Vail, A; Webb, A R; Rhodes, L E

    2015-04-01

    Sun exposure has positive and negative effects on health, yet little is known about the sun exposure behaviour of UK adolescents, including those more prone or less prone to sunburn. To examine sun exposure behaviour of UK white Caucasian adolescents including time spent outdoors, holiday behaviour, use of sunscreen and clothing, with assessment for differences between sun-reactive skin type groups. White Caucasian adolescents (12-15 years) attending schools in Greater Manchester completed a two-page questionnaire to assess sun exposure and photoprotective behaviour. A total of 133 adolescents (median age 13.4 years; 39% skin type I/II, 61% skin type III/IV) completed the questionnaire. In summer, adolescents spent significantly longer outdoors at weekends (median 4 h/day, range 0.25-10) than on weekdays (2, 0.25-6; P < 0.0001). When at home in the UK during summer, 44% reported never wearing sunscreen compared to just 1% when on a sunny holiday. Sunscreen use was also greater (frequency/coverage) when on a sunny holiday than at home in the UK summer (P < 0.0001). Adolescents of skin types I/II (easy burning) spent significantly less time outdoors than skin types III/IV (easy tanning) on summer weekends (P < 0.001), summer weekdays (P < 0.05) and on a sunny holiday (P = 0.001). Furthermore, skin types I/II reported greater sunscreen use during summer in the UK and on sunny holiday (both P < 0.01), and wore clothing covering a greater skin area on a sunny holiday (P < 0.01) than skin types III/IV. There was no difference in sun exposure behaviour/protection between males and females. The greater sun-protective measures reported by adolescents of sun-reactive skin type group I/II than III/IV suggest those who burn more easily are aware of the greater need to protect their skin. However, use of sunscreen during the UK summer is low and may need more effective promotion in adolescents. © 2014 European Academy of Dermatology and Venereology.

  17. Effects of enzyme replacement therapy for cardiac-type Fabry patients with a Chinese hotspot late-onset Fabry mutation (IVS4+919G>A)

    PubMed Central

    Lin, Hsiang-Yu; Liu, Hao-Chuan; Huang, Yu-Hsiu; Liao, Hsuan-Chieh; Hsu, Ting-Rong; Shen, Chia-I; Li, Shao-Tzu; Li, Cheng-Fang; Lee, Li-Hong; Lee, Pi-Chang; Huang, Chun-Kai; Chiang, Chuan-Chi; Lin, Ching-Yuang; Lin, Shuan-Pei; Niu, Dau-Ming

    2013-01-01

    Objective Current studies of newborn screening for Fabry disease in Taiwan have revealed a remarkably high prevalence of cardiac-type Fabry disease with a Chinese hotspot late-onset Fabry mutation (IVS4+919G>A). Design Retrospective cohort study. Setting Tertiary medical centre. Participants 21 patients with cardiac-type Fabry disease (15 men and 6 women) as well as 15 patients with classic Fabry disease (4 men and 11 women) treated with biweekly intravenous infusions of agalsidase β (1 mg/kg) or agalsidase α (0.2 mg/kg) for at least 6 months. Outcome measures These data were collected at the time before enzyme replacement therapy (ERT) began and followed up after ERT for at least 6 months, including patient demographics, medical history, parameter changes of cardiac status and renal functions, plasma globotriaosylsphingosine (lyso-Gb3) and Mainz Severity Score Index. Results After 6–39 months of ERT, plasma lyso-Gb3 was found to be reduced in 89% (17/19) and 93% (14/15) of patients with cardiac-type and classic Fabry disease, respectively, which indicated an improvement of disease severity. For patients with cardiac-type Fabry disease, echocardiography revealed the reduction or stabilisation of left ventricular mass index (LVMI), the thicknesses of intraventricular septum (IVS) and left posterior wall (LPW) in 83% (15/18), 83% (15/18) and 67% (12/18) of patients, respectively, as well as 77% (10/13), 73% (11/15) and 60% (9/15) for those with classic type. Most patients showed stable renal function after ERT. There were statistically significant improvements (p<0.05) between the data at baseline and those after ERT for values of plasma lyso-Gb3, LVMI, IVS, LPW and Mainz Severity Score Index. No severe clinical events were reported during the treatment. Conclusions ERT is beneficial and appears to be safe for Taiwanese patients with cardiac-type Fabry disease, as well as for those with the classic type. PMID:23864212

  18. Prospective Computed Tomographic Analysis of Osteochondral Lesions of the Ankle Joint Associated With Ankle Fractures.

    PubMed

    Nosewicz, Tomasz L; Beerekamp, M Suzan H; De Muinck Keizer, Robert-Jan O; Schepers, Tim; Maas, Mario; Niek van Dijk, C; Goslings, J Carel

    2016-08-01

    Osteochondral lesions (OCLs) associated with ankle fracture correlate with unfavorable outcome. The goals of this study were to detect OCLs following ankle fracture, to associate fracture type to OCLs and to investigate whether OCLs affect clinical outcome. 100 ankle fractures requiring operative treatment were prospectively included (46 men, 54 women; mean age 44 ± 14 years, range 20-77). All ankle fractures (conventional radiography; 71 Weber B, 22 Weber C, 1 Weber A, 4 isolated medial malleolus and 2 isolated posterior malleolus fractures) were treated by open reduction and internal fixation. Multidetector computed tomography (CT) was performed postoperatively. For each OCL, the location, size, and Loomer OCL classification (CT modified Berndt and Harty classification) were determined. The subjective Foot and Ankle Outcome Scoring (FAOS) was used for clinical outcome at 1 year. OCLs were found in 10/100 ankle fractures (10.0%). All OCLs were solitary talar lesions. Four OCLs were located posteromedial, 4 posterolateral, 1 anterolateral, and 1 anteromedial. There were 2 type I OCLs (subchondral compression), 6 type II OCLs (partial, nondisplaced fracture) and 2 type IV OCLs (displaced fracture). Mean OCL size (largest diameter) was 4.4 ± 1.7 mm (range, 1.7 mm to 6.2 mm). Chi-square analysis showed no significant association between ankle fracture type and occurrence of OCLs. OCLs did occur only in Lauge-Hansen stage III/IV ankle fractures. There were no significant differences in FAOS outcome between patients with or without OCLs. Ten percent of investigated ankle fractures had associated OCLs on CT. Although no significant association between fracture type and OCL was found, OCLs only occurred in Lauge-Hansen stage III/IV ankle fractures. With the numbers available, OCLs did not significantly affect clinical outcome at 1 year according to FAOS. Level IV, observational study. © The Author(s) 2016.

  19. Effects of bfp Mutations on Biogenesis of Functional Enteropathogenic Escherichia coli Type IV Pili

    PubMed Central

    Anantha, Ravi P.; Stone, Kelly D.; Donnenberg, Michael S.

    2000-01-01

    Enteropathogenic Escherichia coli expresses a type IV fimbria known as the bundle-forming pilus (BFP) that is required for autoaggregation and localized adherence (LA) to host cells. A cluster of 14 genes is sufficient to reconstitute BFP biogenesis in a laboratory strain of E. coli. We have undertaken a systematic mutagenesis of the individual genes to determine the effect of each mutation on BFP biogenesis and LA. Here we report the construction and analysis of nonpolar mutations in six genes of the bfp cluster, bfpG, bfpB, bfpC, bfpD, bfpP, and bfpH, as well as the further analysis of a previously described bfpA mutant strain that is unable to express bundlin, the pilin protein. We found that mutations in bfpB, which encodes an outer membrane protein; bfpD, which encodes a putative nucleotide-binding protein; and bfpG and bfpC, which do not have sequence homologues in other type IV pilus systems, do not affect prebundlin expression or processing but block both BFP biogenesis and LA. The mutation in bfpP, the prepilin peptidase gene, does not affect prebundlin expression but blocks signal sequence cleavage of prebundlin, BFP biogenesis, and LA. The mutation in bfpH, which is predicted to encode a lytic transglycosylase, has no effect on prebundlin expression, prebundlin processing, BFP biogenesis, or LA. For each mutant for which altered phenotypes were detected, complementation with a plasmid containing the corresponding wild-type allele restored the wild-type phenotypes. We also found that association of prebundlin or bundlin with sucrose density flotation gradient fractions containing both inner and outer membrane proteins does not require any accessory proteins. These studies indicate that many bfp gene products are required for biogenesis of functional type IV pili but that mutations in the individual genes do not lead to the identification of new phases of pilus assembly. PMID:10762251

  20. Prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous mutations in GCDH gene.

    PubMed

    Peng, Hsiu-Huei; Shaw, Sheng-Wen; Huang, Kuan-Gen

    2018-02-01

    Glutaric aciduria type 1 is a rare disease, with the estimated prevalence about 1 in 100,000 newborns. GCDH gene mutation can lead to glutaric acid and 3- OH glutaric acid accumulation, with clinical manifestation of neuronal damage, brain atrophy, microencephalic macrocephaly, decreased coordination of swallowing, poor muscle coordination, spasticity, and severe dystonic movement disorder. A 22-year-old female, Gravida 4 Para 2, is pregnancy at 13 weeks of gestational age. Her first child is normal, however, the second child was diagnosed as glutaric aciduria type I after birth. She came to our hospital for prenatal genetic counselling of her fetus at 13 weeks of gestational age. We performed GCDH gene mutation analysis of maternal blood showed IVS 3 + 1 G > A heterozygous mutation, GCDH gene mutation analysis of paternal blood showed c. 1240 G > A heterozygous mutation, and the second child has compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. Later, we performed amniocentesis at 16 weeks of gestational age for chromosome study and GCDH gene mutation analysis for the fetus. The fetal chromosome study showed normal karyotype, however, GCDH gene mutation analysis showed compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. The couple decided to termination of pregnancy thereafter. Glutaric acidemia type 1 is an autosomal recessive disorder because of pathogenic mutations in the GCDH gene. Early diagnosis and therapy of glutaric acidemia type 1 can reduce the risk of neuronal damage and acute dystonia. We report a case of prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous GCDH gene mutation at IVS 3 + 1 G > A and c. 1240 G > A mutations, which provide better genetic counselling for the couples. Copyright © 2018. Published by Elsevier B.V.

  1. The recent emergence in hospitals of multidrug-resistant community-associated sequence type 1 and spa type t127 methicillin-resistant Staphylococcus aureus investigated by whole-genome sequencing: Implications for screening

    PubMed Central

    Earls, Megan R.; Kinnevey, Peter M.; Brennan, Gráinne I.; Lazaris, Alexandros; Skally, Mairead; O’Connell, Brian; Humphreys, Hilary; Shore, Anna C.

    2017-01-01

    Community-associated spa type t127/t922 methicillin-resistant Staphylococcus aureus (MRSA) prevalence increased from 1%-7% in Ireland between 2010–2015. This study tracked the spread of 89 such isolates from June 2013-June 2016. These included 78 healthcare-associated and 11 community associated-MRSA isolates from a prolonged hospital outbreak (H1) (n = 46), 16 other hospitals (n = 28), four other healthcare facilities (n = 4) and community-associated sources (n = 11). Isolates underwent antimicrobial susceptibility testing, DNA microarray profiling and whole-genome sequencing. Minimum spanning trees were generated following core-genome multilocus sequence typing and pairwise single nucleotide variation (SNV) analysis was performed. All isolates were sequence type 1 MRSA staphylococcal cassette chromosome mec type IV (ST1-MRSA-IV) and 76/89 were multidrug-resistant. Fifty isolates, including 40/46 from H1, were high-level mupirocin-resistant, carrying a conjugative 39 kb iles2-encoding plasmid. Two closely related ST1-MRSA-IV strains (I and II) and multiple sporadic strains were identified. Strain I isolates (57/89), including 43/46 H1 and all high-level mupirocin-resistant isolates, exhibited ≤80 SNVs. Two strain I isolates from separate H1 healthcare workers differed from other H1/strain I isolates by 7–47 and 12–53 SNVs, respectively, indicating healthcare worker involvement in this outbreak. Strain II isolates (19/89), including the remaining H1 isolates, exhibited ≤127 SNVs. For each strain, the pairwise SNVs exhibited by healthcare-associated and community-associated isolates indicated recent transmission of ST1-MRSA-IV within and between multiple hospitals, healthcare facilities and communities in Ireland. Given the interchange between healthcare-associated and community-associated isolates in hospitals, the risk factors that inform screening for MRSA require revision. PMID:28399151

  2. Deposition of sedimentary organic matter in black shale facies indicated by the geochemistry and petrography of high-resolution samples, blake nose, western North Atlantic

    USGS Publications Warehouse

    Barker, C.E.; Pawlewicz, M.; Cobabe, E.A.

    2001-01-01

    A transect of three holes drilled across the Blake Nose, western North Atlantic Ocean, retrieved cores of black shale facies related to the Albian Oceanic Anoxic Events (OAE) lb and ld. Sedimentary organic matter (SOM) recovered from Ocean Drilling Program Hole 1049A from the eastern end of the transect showed that before black shale facies deposition organic matter preservation was a Type III-IV SOM. Petrography reveals that this SOM is composed mostly of degraded algal debris, amorphous SOM and a minor component of Type III-IV terrestrial SOM, mostly detroinertinite. When black shale facies deposition commenced, the geochemical character of the SOM changed from a relatively oxygen-rich Type III-IV to relatively hydrogen-rich Type II. Petrography, biomarker and organic carbon isotopic data indicate marine and terrestrial SOM sources that do not appear to change during the transition from light-grey calcareous ooze to the black shale facies. Black shale subfacies layers alternate from laminated to homogeneous. Some of the laminated and the poorly laminated to homogeneous layers are organic carbon and hydrogen rich as well, suggesting that at least two SOM depositional processes are influencing the black shale facies. The laminated beds reflect deposition in a low sedimentation rate (6m Ma-1) environment with SOM derived mostly from gravity settling from the overlying water into sometimes dysoxic bottom water. The source of this high hydrogen content SOM is problematic because before black shale deposition, the marine SOM supplied to the site is geochemically a Type III-IV. A clue to the source of the H-rich SOM may be the interlayering of relatively homogeneous ooze layers that have a widely variable SOM content and quality. These relatively thick, sometimes subtly graded, sediment layers are thought to be deposited from a Type II SOM-enriched sediment suspension generated by turbidities or direct turbidite deposition.

  3. Chronic administration of DSP-7238, a novel, potent, specific and substrate-selective DPP IV inhibitor, improves glycaemic control and beta-cell damage in diabetic mice.

    PubMed

    Furuta, Y; Horiguchi, M; Sugaru, E; Ono-Kishino, M; Otani, M; Sakai, M; Masui, Y; Tsuchida, A; Sato, Y; Takubo, K; Hochigai, H; Kimura, H; Nakahira, H; Nakagawa, T; Taiji, M

    2010-05-01

    The purpose of this study is to assess the in vitro enzyme inhibition profile of DSP-7238, a novel non-cyanopyrrolidine dipeptidyl peptidase (DPP) IV inhibitor and to evaluate the acute and chronic effects of this compound on glucose metabolism in two different mouse models of type 2 diabetes. The in vitro enzyme inhibition profile of DSP-7238 was assessed using plasma and recombinant enzymes including DPP IV, DPP II, DPP8, DPP9 and fibroblast activation protein alpha (FAPalpha) with fluorogenic substrates. The inhibition type was evaluated based on the Lineweaver-Burk plot. Substrate selectivity of DSP-7238 and comparator DPP IV inhibitors (vildagliptin, sitagliptin, saxagliptin and linagliptin) was evaluated by mass spectrometry based on the changes in molecular weight of peptide substrates caused by release of N-terminal dipeptides. In the in vivo experiments, high-fat diet-induced obese (DIO) mice were subjected to oral glucose tolerance test (OGTT) following a single oral administration of DSP-7238. To assess the chronic effects of DSP-7238 on glycaemic control and pancreatic beta-cell damage, DSP-7238 was administered for 11 weeks to mice made diabetic by a combination of high-fat diet (HFD) and a low-dose of streptozotocin (STZ). After the dosing period, HbA1c was measured and pancreatic damage was evaluated by biological and histological analyses. DSP-7238 and sitagliptin both competitively inhibited recombinant human DPP IV (rhDPP IV) with K(i) values of 0.60 and 2.1 nM respectively. Neither vildagliptin nor saxagliptin exhibited competitive inhibition of rhDPP IV. DSP-7238 did not inhibit DPP IV-related enzymes including DPP8, DPP9, DPP II and FAPalpha, whereas vildagliptin and saxagliptin showed inhibition of DPP8 and DPP9. Inhibition of glucagon-like peptide-1 (GLP-1) degradation by DSP-7238 was apparently more potent than its inhibition of chemokine (C-X-C motif) ligand 10 (IP-10) or chemokine (C-X-C motif) ligand 12 (SDF-1alpha) degradation. In contrast, vildagliptin and saxagliptin showed similar degree of inhibition of degradation for all the substrates tested. Compared to treatment with the vehicle, single oral administration of DSP-7238 dose-dependently decreased plasma DPP IV activity and improved glucose tolerance in DIO mice. In addition, DSP-7238 significantly decreased HbA1c and ameliorated pancreatic damage following 11 weeks of chronic treatment in HFD/STZ mice. We have shown in this study that DSP-7238 is a potent DPP IV inhibitor that has high specificity for DPP IV and substrate selectivity against GLP-1. We have also found that chronic treatment with DSP-7238 improves glycaemic control and ameliorates beta-cell damage in a mouse model with impaired insulin sensitivity and secretion. These findings indicate that DSP-7238 may be a new therapeutic agent for the treatment of type 2 diabetes.

  4. Uranium(IV) adsorption by natural organic matter in anoxic sediments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bone, Sharon E.; Dynes, James J.; Cliff, John

    2017-01-09

    Uranium is an important fuel source and a global environmental contaminant. It accumulates in the tetravalent state, U(IV), in anoxic sediments, including ore deposits, marine basins, and contaminated aquifers. However, very little is known about the speciation of U(IV) in low temperature geochemical environments, inhibiting the development of a conceptual model of U behavior. Until recently, U(IV) was assumed to exist predominantly as the sparingly soluble mineral uraninite (UO 2) in anoxic sediments; yet studies now show that UO 2 is not often dominant in these environments. However, a model of U(IV) speciation under environmentally relevant conditions has not yetmore » been developed. Here we show that complexes of U(IV) adsorb on organic carbon and organic carbon-coated clays in an organic-rich natural substrate under field-relevant conditions. Whereas previous research assumed that the U(IV) product depended on the reduction pathway, our results demonstrate that UO 2 formation can be inhibited simply by decreasing the U:solid ratio. Thus, it is the number and type of surface ligands that controls U(IV) speciation subsequent to U(VI) reduction. Projections of U transport and bioavailability, and thus its threat to human and ecosystem health, must consider retention of U(IV) ions within the local sediment environment.« less

  5. Secondary flow structures in the presence of Type-IV stent fractures through a bent tube model for curved arteries: Effect of circulation thresholding

    NASA Astrophysics Data System (ADS)

    Hussain, Shadman; Bulusu, Kartik V.; Plesniak, Michael W.

    2013-11-01

    A common treatment for atherosclerosis is the opening of narrowed arteries resulting from obstructive lesions by angioplasty and stent implantation to restore unrestricted blood flow. ``Type-IV'' stent fractures involve complete transverse, linear fracture of stent struts, along with displacement of the stent fragments. Experimental data pertaining to secondary flows in the presence of stents that underwent ``Type-IV'' fractures in a bent artery model under physiological inflow conditions were obtained through a two-component, two-dimensional (2C-2D) PIV technique. Concomitant stent-induced flow perturbations result in secondary flow structures with complex, multi-scale morphologies and varying size-strength characteristics. Ultimately, these flow structures may have a role to play in restenosis and progression of atherosclerotic plaque. Vortex circulation thresholds were established with the goal of resolving and tracking iso-circulation secondary flow vortical structures and their morphological changes. This allowed for a parametric evaluation and quantitative representation of secondary flow structures undergoing deformation and spatial reorganization. Supported by NSF Grant No. CBET- 0828903 and GW Center for Biomimetics and Bioinspired Engineering.

  6. Assessment of Pathological Traits in DSM-5 Personality Disorders by the DAPP-BQ: How Do These Traits Relate to the Six Personality Disorder Types of the Alternative Model?

    PubMed

    Berghuis, Han; Ingenhoven, Theo J M; van der Heijden, Paul T; Rossi, Gina M P; Schotte, Chris K W

    2017-11-09

    The six personality disorder (PD) types in DSM-5 section III are intended to resemble their DSM-IV/DSM-5 section II PD counterparts, but are now described by the level of personality functioning (criterion A) and an assigned trait profile (criterion B). However, concerns have been raised about the validity of these PD types. The present study examined the continuity between the DSM-IV/DSM-5 section II PDs and the corresponding trait profiles of the six DSM-5 section III PDs in a sample of 350 Dutch psychiatric patients. Facets of the Dimensional Assessment of Personality Pathology-Basic Questionnaire (DAPP-BQ) were presumed as representations (proxies) of the DSM-5 section III traits. Correlational patterns between the DAPP-BQ and the six PDs were consistent with previous research between DAPP-BQ and DSM-IV PDs. Moreover, DAPP-BQ proxies were able to predict the six selected PDs. However, the assigned trait profile for each PD didn't fully match the corresponding PD.

  7. Open angle glaucoma in a case of Type IV Ehler Danlos syndrome: A rarely reported association

    PubMed Central

    Mitra, Arijit; Ramakrishnan, R.; Kader, Mohideen Abdul

    2014-01-01

    A 26-year-old male presented to us with defective vision in the left eye. He had best corrected visual acuity (BCVA) of hand movement (HM) in right eye and 6/9 in left eye. He had ptosis with ectropion in both eyes and relative afferent pupillary defect (RAPD) in right eye. Intraocular pressure (IOP) was 46 and 44 mmHg in right and left eye, respectively. Fundus showed glaucomatous optic atrophy (GOA) in right eye and cup disc ratio (CDR) of 0.75 with bipolar rim thinning in left eye. Systemic examination showed hyperextensible skin and joints, acrogeria, hypodontia, high arched palate, and varicose veins. He gave history of easy bruising and tendency to fall and history of intestinal rupture 5 years ago for which he had undergone surgery. He was diagnosed as a case of Type IV Ehler-Danlos syndrome (EDS) with open angle glaucoma. He underwent trabeculectomy in both eyes. This is a rare case that shows glaucoma in a patient of EDS Type IV. Very few such cases have been reported in literature. PMID:25230966

  8. Open angle glaucoma in a case of Type IV Ehler Danlos syndrome: a rarely reported association.

    PubMed

    Mitra, Arijit; Ramakrishnan, R; Kader, Mohideen Abdul

    2014-08-01

    A 26-year-old male presented to us with defective vision in the left eye. He had best corrected visual acuity (BCVA) of hand movement (HM) in right eye and 6/9 in left eye. He had ptosis with ectropion in both eyes and relative afferent pupillary defect (RAPD) in right eye. Intraocular pressure (IOP) was 46 and 44 mmHg in right and left eye, respectively. Fundus showed glaucomatous optic atrophy (GOA) in right eye and cup disc ratio (CDR) of 0.75 with bipolar rim thinning in left eye. Systemic examination showed hyperextensible skin and joints, acrogeria, hypodontia, high arched palate, and varicose veins. He gave history of easy bruising and tendency to fall and history of intestinal rupture 5 years ago for which he had undergone surgery. He was diagnosed as a case of Type IV Ehler-Danlos syndrome (EDS) with open angle glaucoma. He underwent trabeculectomy in both eyes. This is a rare case that shows glaucoma in a patient of EDS Type IV. Very few such cases have been reported in literature.

  9. (2S,4S)-4-Fluoro-1-{[(2-hydroxy-1,1-dimethylethyl)amino]acetyl}-pyrrolidine-2-carbonitrile monobenzenesulfonate (TS-021) is a selective and reversible dipeptidyl peptidase IV inhibitor.

    PubMed

    Tajima, Atsushi; Yamamoto, Koji; Kozakai, Akinori; Okumura-Kitajima, Lisa; Mita, Yasuo; Kitano, Kiyokazu; Jingu, Shigeji; Nakaike, Shiro

    2011-03-25

    The incretin hormone glucagon-like peptide-1 (GLP-1) has significant roles in the regulation of postprandial glucose metabolism, and the active form of GLP-1 is rapidly degraded by dipeptidyl peptidase (DPP)-IV. Therefore, DPP-IV inhibition is a promising approach for the treatment of type 2 diabetes. In the present study, we investigated the character of a DPP-IV inhibitor, TS-021, (2S, 4S)-4-fluoro-1-{[(2-hydroxy-1,1-dimethylethyl)amino]acetyl}-pyrrolidine-2-carbonitrile monobenzenesulfonate both in vitro and in vivo. TS-021 inhibits DPP-IV activity in human plasma with an IC(50) value of 5.34nM. In kinetics experiments, TS-021 had a relatively higher dissociation rate constant, with a k(off) value of 1.09×10(-3)s, despite exhibiting a potent human plasma DPP-IV inhibition activity with a K(i) value of 4.96nM. TS-021 exhibited significant inhibition selectivity against DPP-8 (>600 fold), DPP-9 (>1200 fold) and other peptidases examined (>15,000 fold). In normal rats, dogs and monkeys, a single oral dose of TS-021 exhibited favorable pharmacokinetic profiles. In Zucker fatty (fa/fa) rats, a rat model of obesity and impaired glucose tolerance, the oral administration of TS-021 resulted in the suppression of plasma DPP-IV activity and an increase in the active form of GLP-1. Furthermore, TS-021 exhibited a significant improvement in glucose tolerance by increasing the plasma insulin level during oral glucose tolerance tests at doses of 0.02-0.5mg/kg. These results suggest that TS-021 is a selective and reversible dipeptidyl peptidase IV inhibitor and has excellent characteristics as an oral anti-diabetic agent for postprandial hyperglycemia in patients with impaired glucose tolerance or type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Functional diversification of maize RNA polymerase IV and V subtypes via alternative catalytic subunits

    DOE PAGES

    Haag, Jeremy R.; Brower-Toland, Brent; Krieger, Elysia K.; ...

    2014-10-02

    Unlike nuclear multisubunit RNA polymerases I, II, and III, whose subunit compositions are conserved throughout eukaryotes, plant RNA polymerases IV and V are nonessential, Pol II-related enzymes whose subunit compositions are still evolving. Whereas Arabidopsis Pols IV and V differ from Pol II in four or five of their 12 subunits, respectively, and differ from one another in three subunits, proteomic analyses show that maize Pols IV and V differ from Pol II in six subunits but differ from each other only in their largest subunits. Use of alternative catalytic second subunits, which are nonredundant for development and paramutation, yieldsmore » at least two sub-types of Pol IV and three subtypes of Pol V in maize. Pol IV/Pol V associations with MOP1, RMR1, AGO121, Zm_DRD1/CHR127, SHH2a, and SHH2b extend parallels between paramutation in maize and the RNA-directed DNA methylation pathway in Arabidopsis.« less

  11. Adipokine Profile in Patients with Type 2 Diabetes Depends on Degree of Obesity

    PubMed Central

    Kocot, Joanna; Dziemidok, Piotr; Kiełczykowska, Małgorzata; Hordyjewska, Anna; Szcześniak, Grzegorz; Musik, Irena

    2017-01-01

    Background The fast pace of life, promoting fast food consumption and low physical activity, has resulted in obesity and/or diabetes as being serious social problems. The aim of the present study was to evaluate concentrations of selected adipokines (leptin, adiponectin, resistin, and visfatin) and to assess the leptin/adiponectin ratio in plasma of type 2 diabetes (T2D) patients in relation to degree of obesity. Material/Methods The study comprised 92 T2D subjects divided into 4 groups according to BMI value – I (normal body weight), II (overweight), III (obesity), and IV (severe obesity) – and 20 healthy volunteers (control group). Each group was divided into male and female subgroups. Plasma concentrations of adipokines were determined by enzyme-linked immunosorbent assay. Results In women, leptin concentration was significantly higher in group IV, whereas in men it was higher in groups III and IV than in the control group and groups I and II. Irrespective of sex, a significant decrease in adiponectin level was observed in group III vs. control. There was no significant difference in resistin levels. In women visfatin was markedly enhanced in group III, whereas in men in groups II, III and IV vs. control. Leptin/adiponectin ratio was increased in groups III and IV vs. control in women, whereas in men vs. both control and group I. Conclusions The obese type 2 diabetic patients presented a disturbed adipokine profile, which seems to be an important link between obesity and T2D. The future studies concerning the question if regulating of adipokines’ concentrations could be a promising approach for managing metabolic disorders seem to be well-grounded. PMID:29049270

  12. Prevention of Contrast-Induced AKI: A Review of Published Trials and the Design of the Prevention of Serious Adverse Events following Angiography (PRESERVE) Trial

    PubMed Central

    Gallagher, Martin; Kaufman, James; Cass, Alan; Parikh, Chirag R.; Chertow, Glenn M.; Shunk, Kendrick A.; McCullough, Peter A.; Fine, Michael J.; Mor, Maria K.; Lew, Robert A.; Huang, Grant D.; Conner, Todd A.; Brophy, Mary T.; Lee, Joanne; Soliva, Susan; Palevsky, Paul M.

    2013-01-01

    Summary Contrast-induced AKI (CI-AKI) is a common condition associated with serious, adverse outcomes. CI-AKI may be preventable because its risk factors are well characterized and the timing of renal insult is commonly known in advance. Intravenous (IV) fluids and N-acetylcysteine (NAC) are two of the most widely studied preventive measures for CI-AKI. Despite a multitude of clinical trials and meta-analyses, the most effective type of IV fluid (sodium bicarbonate versus sodium chloride) and the benefit of NAC remain unclear. Careful review of published trials of these interventions reveals design limitations that contributed to their inconclusive findings. Such design limitations include the enrollment of small numbers of patients, increasing the risk for type I and type II statistical errors; the use of surrogate primary endpoints defined by small increments in serum creatinine, which are associated with, but not necessarily causally related to serious, adverse, patient-centered outcomes; and the inclusion of low-risk patients with intact baseline kidney function, yielding low event rates and reduced generalizability to a higher-risk population. The Prevention of Serious Adverse Events following Angiography (PRESERVE) trial is a randomized, double-blind, multicenter trial that will enroll 8680 high-risk patients undergoing coronary or noncoronary angiography to compare the effectiveness of IV isotonic sodium bicarbonate versus IV isotonic sodium chloride and oral NAC versus oral placebo for the prevention of serious, adverse outcomes associated with CI-AKI. This article discusses key methodological issues of past trials investigating IV fluids and NAC and how they informed the design of the PRESERVE trial. PMID:23660180

  13. 77 FR 56138 - World Trade Center Health Program; Addition of Certain Types of Cancer to the List of WTC-Related...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-12

    ... of Rulemaking on Federal Agencies IV. Methods Used by the Administrator To Determine Whether To Add... [ssquf] Rare cancers The Administrator developed a hierarchy of methods (detailed in Section IV of this... treating 9/11- exposed patients; health and research organizations; the WTC Health Program Survivors...

  14. LEOPARD; SPOTS; sjectrum calculation with depletion. [IBM360; UNIVAC1108; FORTRAN IV(H) (IBM360) and FORTRAN V (UNIVAC1108)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barry, R.F.

    LEOPARD is a unit cell homogenization and spectrum generation (MUFT-SOFOCATE type) program with a fuel depletion option.IBM360;UNIVAC1108; FORTRAN IV(H) (IBM360) and FORTRAN V (UNIVAC1108); OS/360 (IBM360) and EXEC2 (UNIVAC1108); 50K (decimal) memory.

  15. 7 CFR 42.112 - Defects of containers: Tables IV, V, VI, VII, VIII, IX, and X.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ..., and X. 42.112 Section 42.112 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... Stationary Lot Sampling and Inspection § 42.112 Defects of containers: Tables IV, V, VI, VII, VIII, IX, and X... Table X—Unitizing [Plastic or other type of casing/unitizing] Defects Categories Major Minor Not...

  16. Lenalidomide Maintenance Therapy After High Dose BEAM With or Without Rituximab

    ClinicalTrials.gov

    2018-01-13

    Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Nodal Marginal Zone B-cell Lymphoma; Peripheral T-cell Lymphoma; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Grade III Lymphomatoid Granulomatosis; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Splenic Marginal Zone Lymphoma; Stage III Adult Burkitt Lymphoma; Stage III Adult Diffuse Large Cell Lymphoma; Stage III Adult Diffuse Mixed Cell Lymphoma; Stage III Adult Diffuse Small Cleaved Cell Lymphoma; Stage III Adult Immunoblastic Large Cell Lymphoma; Stage III Adult Lymphoblastic Lymphoma; Stage III Cutaneous T-cell Non-Hodgkin Lymphoma; Stage III Grade 1 Follicular Lymphoma; Stage III Grade 2 Follicular Lymphoma; Stage III Grade 3 Follicular Lymphoma; Stage III Mantle Cell Lymphoma; Stage III Marginal Zone Lymphoma; Stage III Mycosis Fungoides/Sezary Syndrome; Stage III Small Lymphocytic Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Cutaneous T-cell Non-Hodgkin Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IV Marginal Zone Lymphoma; Stage IV Mycosis Fungoides/Sezary Syndrome; Stage IV Small Lymphocytic Lymphoma; Waldenström Macroglobulinemia

  17. Fabricate heterojunction diode by using the modified spray pyrolysis method to deposit nickel-lithium oxide on indium tin oxide substrate.

    PubMed

    Wu, Chia-Ching; Yang, Cheng-Fu

    2013-06-12

    P-type lithium-doped nickel oxide (p-LNiO) thin films were deposited on an n-type indium tin oxide (ITO) glass substrate using the modified spray pyrolysis method (SPM), to fabricate a transparent p-n heterojunction diode. The structural, optical, and electrical properties of the p-LNiO and ITO thin films and the p-LNiO/n-ITO heterojunction diode were characterized by field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), UV-visible spectroscopy, Hall effect measurement, and current-voltage (I-V) measurements. The nonlinear and rectifying I-V properties confirmed that a heterojunction diode characteristic was successfully formed in the p-LNiO/n-ITO (p-n) structure. The I-V characteristic was dominated by space-charge-limited current (SCLC), and the Anderson model demonstrated that band alignment existed in the p-LNiO/n-ITO heterojunction diode.

  18. Identification of branched-chain amino acid aminotransferases active towards (R)-(+)-1-phenylethylamine among PLP fold type IV transaminases.

    PubMed

    Bezsudnova, Ekaterina Yu; Dibrova, Daria V; Nikolaeva, Alena Yu; Rakitina, Tatiana V; Popov, Vladimir O

    2018-04-10

    New class IV transaminases with activity towards L-Leu, which is typical of branched-chain amino acid aminotransferases (BCAT), and with activity towards (R)-(+)-1-phenylethylamine ((R)-PEA), which is typical of (R)-selective (R)-amine:pyruvate transaminases, were identified by bioinformatics analysis, obtained in recombinant form, and analyzed. The values of catalytic activities in the reaction with L-Leu and (R)-PEA are comparable to those measured for characteristic transaminases with the corresponding specificity. Earlier, (R)-selective class IV transaminases were found to be active, apart from (R)-PEA, only with some other (R)-primary amines and D-amino acids. Sequences encoding new transaminases with mixed type of activity were found by searching for changes in the conserved motifs of sequences of BCAT by different bioinformatics tools. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Identification of the DotL Coupling Protein Subcomplex of the Legionella Dot/Icm Type IV Secretion System

    PubMed Central

    Vincent, Carr D.; Friedman, Jonathan R.; Jeong, Kwang Cheol; Sutherland, Molly C.; Vogel, Joseph P.

    2012-01-01

    Summary Legionella pneumophila, the causative agent of Legionnaires’ disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella T4SS substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. PMID:22694730

  20. Schottky barrier parameters and low frequency noise characteristics of graphene-germanium Schottky barrier diode

    NASA Astrophysics Data System (ADS)

    Khurelbaatar, Zagarzusem; Kil, Yeon-Ho; Shim, Kyu-Hwan; Cho, Hyunjin; Kim, Myung-Jong; Lee, Sung-Nam; Jeong, Jae-chan; Hong, Hyobong; Choi, Chel-Jong

    2016-03-01

    We investigated the electrical properties of chemical vapor deposition-grown monolayer graphene/n-type germanium (Ge) Schottky barrier diodes (SBD) using current-voltage (I-V) characteristics and low frequency noise measurements. The Schottky barrier parameters of graphene/n-type Ge SBDs, such as Schottky barrier height (VB), ideality factor (n), and series resistance (Rs), were extracted using the forward I-V and Cheung's methods. The VB and n extracted from the forward ln(I)-V plot were found to be 0.63 eV and 1.78, respectively. In contrast, from Cheung method, the VB and n were calculated to be 0.53 eV and 1.76, respectively. Such a discrepancy between the values of VB calculated from the forward I-V and Cheung's methods indicated a deviation from the ideal thermionic emission of graphene/n-type Ge SBD associated with the voltage drop across graphene. The low frequency noise measurements performed at the frequencies in the range of 10 Hz-1 kHz showed that the graphene/n-type Ge SBD had 1/f γ frequency dependence, with γ ranging from 1.09 to 1.12, regardless of applied forward biases. Similar to forward-biased SBDs operating in the thermionic emission mode, the current noise power spectral density of graphene/n-type Ge SBD was linearly proportional to the forward current.

  1. Distribution of Porphyromonas gingivalis fimA genotypes in primary endodontic infections.

    PubMed

    Rôças, Isabela N; Siqueira, José F

    2010-03-01

    Long fimbriae (FimA) are important virulence factors of Porphyromonas gingivalis. Based on the diversity of the fimA gene, this species is classified into 6 genotypes. This study surveyed samples from primary endodontic infections for the presence of these P. gingivalis fimA variants. Genomic DNA isolated from samples taken from 25 root canals of teeth with chronic apical periodontitis and 25 aspirates from acute apical abscess was used as template in polymerase chain reaction (PCR) assays directed toward the detection of the different P. gingivalis fimA genotypes. Porphyromonas gingivalis was detected by a 16S rRNA gene-based PCR in 36% of the total number of cases sampled (44% of chronic apical periodontitis and 28% of abscess aspirates). In cases of chronic apical periodontitis, P. gingivalis variant type IV was the most prevalent (24%), followed by types I (20%), II (16%), and III (8%). In acute abscess samples, variant type II was the most prevalent (12%), followed by types III and IV (8% of each) and type I (4%). Combinations of up to 3 different genotypes were detected in a few cases. No single fimA genotype variant or combination thereof was significantly associated with symptoms. Overall, fimA types IV (16%), II (14%), and I (12%) were the most prevalent. Findings demonstrated that different P. gingivalis fimA genotypes can be present in primary endodontic infections. Copyright 2010 Mosby, Inc. All rights reserved.

  2. Root Canal Anatomy and Morphology of Mandibular First Molars in a Selected Iranian Population: An In Vitro Study

    PubMed Central

    Mohammadzadeh Akhlaghi, Nahid; Khalilak, Zohreh; Vatanpour, Mehdi; Mohammadi, Saman; Pirmoradi, Sakineh; Fazlyab, Mahta; Safavi, Kamran

    2017-01-01

    Introduction: The aim of this study was to evaluate root canal anatomy of mandibular first molars (MFM) in a selected Iranian Population using clearing technique. Methods and Materials: A total of 150 extracted MFMs were cleared. The root canal morphology (including the root numbers and root length) and the anatomy of the root canal system (including is the number and type of canals based on Vertucci’s classification, canal curvature according to Schneider's method and the presence of isthmus) was evaluated using the buccolingual and mesiodistal parallel x-rays and stereomicroscope. The data were analyzed using the chi-square test. Results: Two and three roots were present in 96.7% and 33% of the teeth, respectively (P=0.0001). All the teeth (100%) had two canals in the mesial root, while 61.3% of the samples had one distal root canal (P=0.006). The root canal configuration in the mesial canal included type IV (55.3%) and type II (41.3%) (P=0.0001). In doubled-canalled distal roots, 68.8% and 24.3% were type II and type IV, respectively (P=0.0001). Isthmii were observed in 44.6% of mesial and 27.3% of distal roots (P=0.0001). Conclusion: The notable prevalence of type IV configuration in both roots of mandibular first molars, presence of isthmus and root curvature, necessitates the careful negotiation and cleaning of all accessible canal spaces. PMID:28179932

  3. Mapping General Anesthetic Sites in Heteromeric γ-Aminobutyric Acid Type A Receptors Reveals a Potential For Targeting Receptor Subtypes.

    PubMed

    Forman, Stuart A; Miller, Keith W

    2016-11-01

    IV general anesthetics, including propofol, etomidate, alphaxalone, and barbiturates, produce important actions by enhancing γ-aminobutyric acid type A (GABAA) receptor activation. In this article, we review scientific studies that have located and mapped IV anesthetic sites using photoaffinity labeling and substituted cysteine modification protection. These anesthetics bind in transmembrane pockets between subunits of typical synaptic GABAA receptors, and drugs that display stereoselectivity also show remarkably selective interactions with distinct interfacial sites. These results suggest strategies for developing new drugs that selectively modulate distinct GABAA receptor subtypes.

  4. Successful treatment of direct carotid-cavernous fistula in a patient with Ehlers-Danlos syndrome type IV without arterial puncture: the transvenous triple-overlay embolization (TAILOREd) technique.

    PubMed

    Huynh, Thien J; Morton, Ryan P; Levitt, Michael R; Ghodke, Basavaraj V; Wink, Onno; Hallam, Danial K

    2017-08-18

    We report successful transvenous treatment of direct carotid-cavernous fistula in a patient with Ehlers-Danlos syndrome type IV using a novel triple-overlay embolization (TAILOREd) technique without the need for arterial puncture, which is known to be highly risky in this patient group. The TAILOREd technique allowed for successful treatment using preoperative MR angiography as a three-dimensional overlay roadmap combined with cone beam CT and live fluoroscopy, precluding the need for an arterial puncture. 2017 BMJ Publishing Group Ltd.

  5. [Ehlers Danlos type IV syndrome presenting with simultaneous dissection of both internal carotid and both vertebral arteries].

    PubMed

    Mondon, K; de Toffol, B; Georgesco, G; Cassarini, J-F; Machet, M-C; Cottier, J-P; Arbeille, B; Autret, A

    2004-04-01

    Dissection of cervical arteries is a frequent cause of stroke in young subjects. We report the case of a 34-year-old patient who experienced simultaneous dissection of both internal carotid arteries and both vertebral arteries leading to repeated motor deficit of the right half-body associated with persistent otalgia. Search for an etiology led to the diagnosis of Ehlers-Danlos syndrome type IV. Search for the cause of cervical artery dissection must consider connective tIssue disease, particularly vascular forms of Ehler-Danlos syndrome. Diagnostic, therapeutic as well as prognostic aspects are discussed.

  6. Treatment of melasma with low fluence, large spot size, 1064-nm Q-switched neodymium-doped yttrium aluminum garnet (Nd:YAG) laser for the treatment of melasma in Fitzpatrick skin types II-IV.

    PubMed

    Brown, Alia S; Hussain, Mussarat; Goldberg, David J

    2011-12-01

    Melasma is a common condition affecting over six million American women. Treatment of dermal or combined melasma is difficult and does not respond well to conventional topical therapies. Various light sources have been used recently in the treatment of melasma including fractionated ablative and non-ablative lasers as well as intense pulse light. We report the use of low fluence, large spot size Q-switched, Nd:Yag laser for the treatment of melasma in skin types II-IV.

  7. Steps in the development of a Vibrio cholerae El Tor biofilm

    PubMed Central

    Watnick, Paula I.; Kolter, Roberto

    2010-01-01

    Summary We report that, in a simple, static culture system, wild-type Vibrio cholerae El Tor forms a three-dimensional biofilm with characteristic water channels and pillars of bacteria. Furthermore, we have isolated and characterized transposon insertion mutants of V. cholerae that are defective in biofilm development. The transposons were localized to genes involved in (i) the biosynthesis and secretion of the mannose-sensitive haemagglutinin type IV pilus (MSHA); (ii) the synthesis of exopolysaccharide; and (iii) flagellar motility. The phenotypes of these three groups suggest that the type IV pilus and flagellum accelerate attachment to the abiotic surface, the flagellum mediates spread along the abiotic surface, and exopolysaccharide is involved in the formation of three-dimensional biofilm architecture. PMID:10564499

  8. Stage-Specific Action of Matrix Metalloproteinases Influences Progressive Hereditary Kidney Disease

    PubMed Central

    Zeisberg, Michael; Khurana, Mona; Rao, Velidi H; Cosgrove, Dominic; Rougier, Jean-Philippe; Werner, Michelle C; Shield, Charles F; Werb, Zena; Kalluri, Raghu

    2006-01-01

    Background Glomerular basement membrane (GBM), a key component of the blood-filtration apparatus in the in the kidney, is formed through assembly of type IV collagen with laminins, nidogen, and sulfated proteoglycans. Mutations or deletions involving α3(IV), α4(IV), or α5(IV) chains of type IV collagen in the GBM have been identified as the cause for Alport syndrome in humans, a progressive hereditary kidney disease associated with deafness. The pathological mechanisms by which such mutations lead to eventual kidney failure are not completely understood. Methods and Findings We showed that increased susceptibility of defective human Alport GBM to proteolytic degradation is mediated by three different matrix metalloproteinases (MMPs)—MMP-2, MMP-3, and MMP-9—which influence the progression of renal dysfunction in α3(IV) −/− mice, a model for human Alport syndrome. Genetic ablation of either MMP-2 or MMP-9, or both MMP-2 and MMP-9, led to compensatory up-regulation of other MMPs in the kidney glomerulus. Pharmacological ablation of enzymatic activity associated with multiple GBM-degrading MMPs, before the onset of proteinuria or GBM structural defects in the α3(IV) −/− mice, led to significant attenuation in disease progression associated with delayed proteinuria and marked extension in survival. In contrast, inhibition of MMPs after induction of proteinuria led to acceleration of disease associated with extensive interstitial fibrosis and early death of α3(IV) −/− mice. Conclusions These results suggest that preserving GBM/extracellular matrix integrity before the onset of proteinuria leads to significant disease protection, but if this window of opportunity is lost, MMP-inhibition at the later stages of Alport disease leads to accelerated glomerular and interstitial fibrosis. Our findings identify a crucial dual role for MMPs in the progression of Alport disease in α3(IV) −/− mice, with an early pathogenic function and a later protective action. Hence, we propose possible use of MMP-inhibitors as disease-preventive drugs for patients with Alport syndrome with identified genetic defects, before the onset of proteinuria. PMID:16509766

  9. Pathogenic Natural Antibodies Recognizing Annexin IV Are Required to Develop Intestinal Ischemia-Reperfusion Injury1

    PubMed Central

    Kulik, Liudmila; Fleming, Sherry D.; Moratz, Chantal; Reuter, Jason W.; Novikov, Aleksey; Chen, Kuan; Andrews, Kathy A.; Markaryan, Adam; Quigg, Richard J.; Silverman, Gregg J.; Tsokos, George C.; Holers, V. Michael

    2010-01-01

    Intestinal ischemia-reperfusion (IR)3 injury is initiated when natural IgM antibodies recognize neo-epitopes that are revealed on ischemic cells. The target molecules and mechanisms whereby these neo-epitopes become accessible to recognition are not well understood. Proposing that isolated intestinal epithelial cells (IEC) may carry IR-related neo-epitopes, we used in vitro IEC binding assays to screen hybridomas created from B cells of unmanipulated wild type C57BL/6 mice. We identified a novel IgM monoclonal antibody (mAb B4) that reacted with the surface of IEC by flow cytometric analysis and was alone capable of causing complement activation, neutrophil recruitment and intestinal injury in otherwise IR-resistant Rag1−/− mice. Monoclonal Ab B4 was found to specifically recognize mouse annexin IV. Pre-injection of recombinant annexin IV blocked IR injury in wild type C57BL/6 mice, demonstrating the requirement for recognition of this protein in order to develop IR injury in the context of a complex natural antibody repertoire. Humans were also found to exhibit IgM natural antibodies that recognize annexin IV. These data in toto identify annexin IV as a key ischemia-related target antigen that is recognized by natural Abs in a pathologic process required in vivo to develop intestinal IR injury. PMID:19380783

  10. The very high rotators in the late-B and early-A stars: Shell stars with Si IV and C IV features the case of HD 119921

    NASA Technical Reports Server (NTRS)

    Freireferrero, R.; Bruhweiler, Frederick C.; Grady, C. A.

    1990-01-01

    Study of several stars in the late B and early A spectral types shows that very high rotators are associated with shell characteristics (sometimes not detected at all in the visible spectra) and also with C IV and some Si IV spectral absorption features which can be explained by circumstellar phenomena superimposed over stellar metallic blends. These particularities are evidenced by comparison with other spectra of low and high rotators in the same spectral range. HD 119921, a star with similar characteristics to the other ones of the sample, is given special attention. A possible scenario is suggested to explain the observed superionization features.

  11. Aquatic toxicity of nine aircraft deicer and anti-icer formulations and relative toxicity of additive package ingredients alkylphenol ethoxylates and 4,5-methyl-1H-henzotriazoles.

    PubMed

    Corsi, Steven R; Geis, Steven W; Loyo-Rosales, Jorge E; Rice, Clifford P

    2006-12-01

    Characterization of the effects of aircraft deicer and anti-icer fluid (ADAF) runoff on aquatic organisms in receiving streams is a complex issue because the identities of numerous toxic additives are proprietary and not publicly available. Most potentially toxic and endocrine disrupting effects caused by ADAF are due to the numerous additive package ingredients which vary among manufacturers and types of ADAF formulation. Toxicity investigations of nine ADAF formulations indicate that endpoint concentrations for formulations of different manufacturers are widely variable. Type IV ADAF (anti-icers) are more toxic than Type I (deicers) for the four organisms tested (Vibrio fischeri, Pimephales promelas, Ceriodaphnia dubia, and Selenastrum capricornutum). Acute toxicity endpoint concentrations ranged from 347 to 7700 mg/L as ADAF for Type IV and from 1550 to 45,100 mg/L for Type I formulations. Chronic endpoint concentrations ranged from 70 to 1300 mg/L for Type IV and from 37 to 18,400 mg/L for Type I formulations. Alkylphenol ethoxylates and tolyltriazoles are two known classes of additives. Nonylphenol, nonylphenol ethoxylates, octylphenol, octylphenol ethoxylates, and 4,5-methyl-1H-benzotriazoles were quantified in the nine ADAF formulations, and toxicity tests were conducted with nonylphenol ethoxylates and 4,5-methyl-1H-benzotriazoles. Toxicity units computed for glycol and these additives, with respect to toxicity of the ADAF formulations, indicate that a portion of ADAF toxicity can be explained by the known additives and glycols, but much of the toxicity is due to unidentified additives.

  12. 7 CFR 52.3182 - Varietal types of dried prunes.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT PROCESSED FRUITS AND VEGETABLES, PROCESSED PRODUCTS THEREOF, AND CERTAIN OTHER PROCESSED FOOD PRODUCTS 1 United States Standards for Grades of Dried...; or Sugar; or a mixture of Imperial and Sugar. (d) Type IV. Any other types; or mixtures of any types...

  13. 7 CFR 52.3182 - Varietal types of dried prunes.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT PROCESSED FRUITS AND VEGETABLES, PROCESSED PRODUCTS THEREOF, AND CERTAIN OTHER PROCESSED FOOD PRODUCTS 1 United States Standards for Grades of Dried...; or Sugar; or a mixture of Imperial and Sugar. (d) Type IV. Any other types; or mixtures of any types...

  14. Ultraviolet Observations of M-Type Symbiotic Stars

    NASA Astrophysics Data System (ADS)

    Michalitsianos, Andrew G.

    The significant differences revealed in high dispersion short wavelength spectra of two M-type symbiotic stars RW Hya (gM2 + pec) and RX Pup (M5 + pec) observed previously with IUE emphasizes the need for high resolution observations of a wide range of similar objects. The anomalies observed in high excitation lines in RX Pup of He II, N III], N IV], O III], C III], C IV and Si III] that show split line profiles, multiple component Doppler displaced components, and broadened blue wing emission structure in N III] and N IV] suggest motion in circumstellar material. In contrast, high dispersion UV spectra of RW Hya reveal narrow high excitation emission lines that give no suggestion of macroscopic motions in the circumstellar gas. We wish to extend observations of a selected number of symbiotic stars observed previously but in low resolution, to high dispersion in order to determine if particular M-type symbiotic stars exhibit anomalies in their line profile. As such, symbiotic stars exhibiting velocity structure in emission lines may form a subset of objects that are characterized by mass motions in their circumstellar envelops that create high excitation emission. UV line and continuum emission from other M-type symbiotics may arise from mainly photo-excitation processes that results from the intense radiation field associated with the hot secondary companion.

  15. Main-Sequence O Stars in NGC 6231: Enhanced Winds

    NASA Astrophysics Data System (ADS)

    Morrison, Nancy D.

    Three late O-type main-sequence stars in the open cluster NGC 6231 will be observed with IUE at high dispersion, and their C IV and N V resonance-line profiles will be studied. From low-dispersion IUE observations, 10 members of the cluster have been found to have anomalously strong C IV resonance lines for their spectral types. Massa, Savage, and Cassinelli (1984) observed two of these "UV peculiar" stars (spectral types B0.5 V and B1 V) at high dispersion. They found that the C IV lines have a strong, broad, shortward-shifted absorption component, which suggests a greatly enhanced wind relative to the average for the spectral type. They proposed that the enhancement is due to an overabundance of C. Recently, however, Grigsby, Gordon, Morrison, and Zimba (1992) showed from optical spectra that these stars have normal C abundances. Thus, there is not yet a convincing explanation for these strikingly anomalous stellar winds. By extending the temperature range over which the phenomenon has been studied at high dispersion, however, we expect to gain new physical information. From wind modeling of the line profiles, we will derive mass-loss rates and terminal velocities, and we will test whether these winds are described by radiation-driven wind theory.

  16. Title IV Quality Control Project, Stage II. Management Option II: Delivery System Quality Improvements.

    ERIC Educational Resources Information Center

    Advanced Technology, Inc., Reston, VA.

    Stage Two of the Title IV Quality Control Project is an integrated study of quality in five related Federal financial aid programs for postsecondary students. Section 1 of the paper establishes a framework for defining quality improvements, in order to identify the types of changes that would tend to improve quality across all facets of the…

  17. Focused Screening of ECM-Selective Adhesion Peptides on Cellulose-Bound Peptide Microarrays.

    PubMed

    Kanie, Kei; Kondo, Yuto; Owaki, Junki; Ikeda, Yurika; Narita, Yuji; Kato, Ryuji; Honda, Hiroyuki

    2016-11-19

    The coating of surfaces with bio-functional proteins is a promising strategy for the creation of highly biocompatible medical implants. Bio-functional proteins from the extracellular matrix (ECM) provide effective surface functions for controlling cellular behavior. We have previously screened bio-functional tripeptides for feasibility of mass production with the aim of identifying those that are medically useful, such as cell-selective peptides. In this work, we focused on the screening of tripeptides that selectively accumulate collagen type IV (Col IV), an ECM protein that accelerates the re-endothelialization of medical implants. A SPOT peptide microarray was selected for screening owing to its unique cellulose membrane platform, which can mimic fibrous scaffolds used in regenerative medicine. However, since the library size on the SPOT microarray was limited, physicochemical clustering was used to provide broader variation than that of random peptide selection. Using the custom focused microarray of 500 selected peptides, we assayed the relative binding rates of tripeptides to Col IV, collagen type I (Col I), and albumin. We discovered a cluster of Col IV-selective adhesion peptides that exhibit bio-safety with endothelial cells. The results from this study can be used to improve the screening of regeneration-enhancing peptides.

  18. Focused Screening of ECM-Selective Adhesion Peptides on Cellulose-Bound Peptide Microarrays

    PubMed Central

    Kanie, Kei; Kondo, Yuto; Owaki, Junki; Ikeda, Yurika; Narita, Yuji; Kato, Ryuji; Honda, Hiroyuki

    2016-01-01

    The coating of surfaces with bio-functional proteins is a promising strategy for the creation of highly biocompatible medical implants. Bio-functional proteins from the extracellular matrix (ECM) provide effective surface functions for controlling cellular behavior. We have previously screened bio-functional tripeptides for feasibility of mass production with the aim of identifying those that are medically useful, such as cell-selective peptides. In this work, we focused on the screening of tripeptides that selectively accumulate collagen type IV (Col IV), an ECM protein that accelerates the re-endothelialization of medical implants. A SPOT peptide microarray was selected for screening owing to its unique cellulose membrane platform, which can mimic fibrous scaffolds used in regenerative medicine. However, since the library size on the SPOT microarray was limited, physicochemical clustering was used to provide broader variation than that of random peptide selection. Using the custom focused microarray of 500 selected peptides, we assayed the relative binding rates of tripeptides to Col IV, collagen type I (Col I), and albumin. We discovered a cluster of Col IV-selective adhesion peptides that exhibit bio-safety with endothelial cells. The results from this study can be used to improve the screening of regeneration-enhancing peptides. PMID:28952593

  19. Evaluation of a Hyperlinked Consumer Health Dictionary for reading EHR notes.

    PubMed

    Slaughter, Laura; Oyri, Karl; Fosse, Erik

    2011-01-01

    In this paper, we report on a pilot study conducted to test the usefulness and understandability of definitions in a Consumer Health Dictionary (IVS-CHD). Our two main goals for this study were to evaluate functionality of the dictionary when embedded in electronic health records (EHR) and determine the methodology for our larger-scale project to iteratively develop the IVS-CHD. The hyperlinked IVS-CHD was made available to thoracic surgery patients reading their own EHR. We asked patients to rate definitions on two 5-level Likert items measuring perceived usefulness and understandability. We also captured the terms that patients wanted defined, but that were not included in the IVS-CHD. Preliminary results indicate the types of problems that must be avoided when creating definitions, for example, that patients prefer detailed explanations that include medical outcomes, and that do not use "unfamiliar" terms they must also look up. We also have gained insight into the types of terms that patients want defined from their EHR notes, especially certain abbreviations. Patients further commented on the experience of reading EHR notes directly from the same system used by healthcare personnel and the help strategy of linking the contents to a hyperlinked dictionary.

  20. 49 CFR 538.7 - Petitions for reduction of minimum driving range.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... type treated as an electric dual fueled automobile. (3) Be written in the English language. (4) State... displacement and type, electric storage capacity, transmission type, and average fuel economy when operating on...) Economic practicability; (iv) Technology; (v) Environmental impact; (vi) Safety; (vii) Driveability; and...

  1. Staging of intestinal- and diffuse-type gastric cancers with the OLGA and OLGIM staging systems.

    PubMed

    Cho, S-J; Choi, I J; Kook, M-C; Nam, B-H; Kim, C G; Lee, J Y; Ryu, K W; Kim, Y-W

    2013-11-01

    Operative link on gastritis assessment (OLGA) and Operative link on gastric intestinal metaplasia assessment (OLGIM) staging systems have been proposed for gastric cancer (GC) risk estimation. To validate the OLGA and OLGIM staging systems in a region with high risk of GC. This retrospective study included 474 GC patients and age- and sex-matched health screening control persons in a cancer centre hospital. We classified gastritis patterns according to the OLGA and OLGIM systems using the histological database that a pathologist prospectively evaluated using the updated Sydney system. GC risk according to the OLGA and OLGIM stages was evaluated using logistic regression analysis. More GC patients had OLGA stages III-IV (46.2%) than controls (26.6%, P < 0.001), particularly among patients with intestinal-type GCs (62.2%) compared with diffuse-type GCs (30.9%). OLGA stages III and IV were significantly associated with increased risk of GC [odds ratios (ORs), 2.09; P = 0.008 and 2.04; P = 0.014 respectively] in multivariate analysis. The association was more significant for intestinal-type (ORs, 4.76; P = 0.001 and 4.19; P = 0.002 respectively), but not diffuse-type GC. OLGIM stages from I to IV were significantly associated with increased risk of both intestinal-type (ORs, 3.64, 5.15, 7.89 and 13.20 respectively) and diffuse-type GC (ORs, 1.84, 2.59, 5.08 and 6.32 respectively) with a significantly increasing trend. As high OLGA and OLGIM stages are independent risk factors for gastric cancer, the staging systems may be useful for risk assessment in high-risk regions, especially for intestinal-type gastric cancer. © 2013 John Wiley & Sons Ltd.

  2. Percutaneous intraductal radiofrequency ablation in the management of unresectable Bismuth types III and IV hilar cholangiocarcinoma.

    PubMed

    Wang, Yu; Cui, Wei; Fan, Wenzhe; Zhang, Yingqiang; Yao, Wang; Huang, Kunbo; Li, Jiaping

    2016-08-16

    To assess the feasibility and safety of percutaneous intraductal radiofrequency ablation (RFA) for unresectable Bismuth types III and IV hilar cholangiocarcinoma. Percutaneous intraductal RFA combined with metal stent placement was successful in all patients without any technical problems; the technical success rate was 100%. Chemotherapy was administered to two patients. After treatment, serum direct bilirubin levels were notably decreased. Six patients died during the follow-up period. Median stent patency from the time of the first RFA and survival from the time of diagnosis were 100 days (95% confidence interval (CI), 85-115 days) and 5.3 months (95% CI, 2.5-8.1 months), respectively. No acute pancreatitis, bile duct bleeding and perforation, bile leakage, or other severe complications occurred. Four cases of procedure-related cholangitis, three cases of postoperative abdominal pain, and five cases of asymptomatic transient increase in serum amylase were observed. One patient who presented with stent blockage 252 days' post-procedure underwent repeat ablation. Between September 2013 and May 2015, nine patients with unresectable Bismuth types III and IV hilar cholangiocarcinoma who were treated with percutaneous intraductal RFA combined with metal stent placement after the percutaneous transhepatic cholangial drainage were included in the retrospective analysis. Procedure-related complications, stent patency, and survival after treatment were investigated. Percutaneous intraductal RFA combined with metal stent placement is a technically safe and feasible therapeutic option for the palliative treatment of unresectable Bismuth types III and IV hilar cholangiocarcinoma. Its long-term efficacy and safety is promising, but needs further study via randomized and prospective trials that include a greater number of patients.

  3. Genetic and mechanistic evaluation for the weak A phenotype in Ael blood type with IVS6 + 5G>A ABO gene mutation.

    PubMed

    Chen, D-P; Sun, C-F; Ning, H-C; Peng, C-T; Wang, W-T; Tseng, C-P

    2015-01-01

    Ael is a rare blood type that is characterized by weak agglutination of RBCs when reacts with anti-A antibody in adsorption-elution test. Although IVS6 + 5G→A mutation is known to associate with the Ael blood type, genetic and mechanistic evaluation for the weak agglutination of Ael with IVS6 + 5G→A mutation has not yet been completely addressed. In this study, five cases of confirmed Ael individuals were analysed. The cDNAs for the A(el) alleles were obtained by cloning method for sequence analyses. The erythroleukemia K562 cells were used as the cell study model and were transfected with the A(el) expression construct. Flow cytometry analysis was then performed to determine the levels of surface antigen expression. The results indicated that IVS6 + 5G→A attributes to all cases of Ael . RT-PCR analyses revealed the presence of at least 10 types of aberrant A(el) splicing transcripts. Most of the transcripts caused early termination and produced non-functional protein during translation. Nevertheless, the transcript without exons 5-6 was predicted to generate functional Ael glycosyltransferase lacking 57 amino acids at the N-terminal segment. When the exons 5-6 deletion transcript was stably expressed in the K562 cells, weak agglutination of the cells can be induced by adding anti-A antibody followed by adsorption-elution test. This study demonstrates that aberrant splicing of A transcripts contributes to weak A expression and the weak agglutination of Ael -RBCs, adding to the complexity for the regulatory mechanisms of ABO gene expression. © 2014 International Society of Blood Transfusion.

  4. Effect of heat treatment on mechanical properties of age-hardenable gold alloy at intraoral temperature.

    PubMed

    Watanabe, I; Watanabe, E; Cai, Z; Okabe, T; Atsuta, M

    2001-09-01

    The aim of this study was to investigate the effect of various heat treatments on the mechanical properties of gold alloys capable of age-hardening at intraoral temperature. Dumbbell-shaped patterns (ISO 6871) were cast with three gold alloys (Sofard; NC Type-IV; Aurum Cast, NihombashiTokuriki Co.). The Sofard alloy is age-hardenable at intraoral temperature. The castings underwent various heat treatments [as-cast (AC); solution treatment (ST); high-temperature aging (HA); intraoral aging (IA)]. After these heat treatments, ultimate tensile strength (UTS), 0.2% offset yield strength (YS), and elongation (EL) were measured at a strain rate of 1.7x10(-4)/s. Fracture surfaces of the specimens after tensile testing were observed using SEM. Vickers hardness was also measured after heat treating. After IA, the hardness values of the Sofard alloy increased and reached values similar to the hardness of the Sofard specimens aged at high temperature (HA). The hardness values of the NC Type-IV and Aurum Cast specimens slightly increased after IA, but did not reach the values of the specimens after HA. All the Sofard, NC Type-IV and Aurum Cast specimens showed significantly (P<0.05) greater hardness values after HA, compared with the values after any other heat treatments (AC, ST and IA). The UTS and YS of the specimens indicated a tendency similar to the results obtained for hardness. The Sofard specimens with ST showed the greatest elongation compared to the corresponding NC Type-IV and Aurum Cast specimens. However, the elongation of the Sofard specimens was abruptly reduced after intraoral aging. Intraoral aging significantly improved the mechanical properties and hardness of the Sofard alloy.

  5. Comparative Evaluation of Tensile Strength in Die Stone Incorporated with Sodium and Calcium Hypochlorite as Disinfectants: An in vitro Study.

    PubMed

    Pramodh, N R; Kumar, C N Vijay; Pradeep, M R; Naik, Ravi; Mahesh, C S; Kumari, Manju R

    2017-12-01

    The aim of this study was to evaluate the tensile strength of die stone incorporated with sodium and calcium hypochlorite as disinfectants. Two commercially available type IV die stone (Kalrock: Kalabhai Karson Pvt., Ltd and Pearlstone: Asian Chemicals) and two commercially available disinfectant solutions (sodium hypochlorite and calcium hypochlorite: Beachem Laboratory Chemical Private Limited, Chennai and Leo Chem Private Limited, Bengaluru) were used in this study, and the tensile strength was measured using Lloyd's Universal Testing Machine. The results show that incorporating the disinfecting solutions decreases the tensile strength of both products. The effect of decreasing tensile strength on type IV gypsum product is seen more in calcium hypochlorite when compared with sodium hypochlorite disinfecting solution, and the tensile strength of Kalrock specimens is higher than Pearlstone specimens after disinfecting with sodium hypochlorite and calcium hypochlorite solution. The statistical results also show significant results in all the groups when compared with the control group. The incorporation of sodium and calcium hypochlorite disinfecting solutions is not an encouraging method for both die materials as it reduces the tensile strength of type IV gypsum product. Tensile strength of Kalstone® die material is superior than Pearlstone® die material after mixing with sodium hypochlorite and calcium hypochlorite. According to the recommendations of Americans with Disability Act (ADA) and the Centers for Disease Control and Prevention, disinfecting the whole cast without or minimal changes in physical and mechanical properties was the motto of the study. The tensile strength in type IV gypsum product plays a most important role in retrieval of cast from impression, especially in narrow tooth preparation. This study reveals that incorporating method of disinfecting solutions is not recommended as it reduces the tensile strength.

  6. Correlation Between the Integrity of the Circle of Willis and the Severity of Initial Noncardiac Cerebral Infarction and Clinical Prognosis

    PubMed Central

    Zhou, Houshi; Sun, Jian; Ji, Xiaotan; Lin, Jing; Tang, Shujin; Zeng, Jinsheng; Fan, Yu-hua

    2016-01-01

    Abstract The quality of collateral circulation affects the severity and prognosis of stroke patients. The effect of the circle of Willis, which is the primary collateral circulation, on ischemic stroke has attracted significant attention. This study was designed to investigate the effect of different circles of Willis types on stroke severity and prognosis in patients with noncardiac stroke. A total of 376 patients with noncardiac ischemic stroke, who were treated by the specialty team of cerebrovascular diseases at the First Affiliated Hospital of Sun Yat-sen Hospital, were successively enrolled in this study. The detailed clinical characteristics of the patients were recorded upon admission, including risk factors of vascular disease and National Institutes of Health Stroke Scale (NIHSS) scores. The patients were divided into groups of different circles of Willis types based on magnetic resonance angiography (MRA) that was performed within 3 days of admission—type I: complete circle of Willis; type II: complete anterior half of the circle of Willis and incomplete posterior half of the circle of Willis; type III: incomplete anterior half of the circle of Willis and complete posterior half of the circle of Willis; and type IV: incomplete anterior and posterior halves of the circle of Willis. Patients were re-evaluated for NIHSS scores at discharge and after discharge. The modified Rankin score (mRS) was recorded for 90 days, and stroke recurrence and death after 90 days were also recorded until the end of the study. The 376 patients were divided into 4 groups based on the MRA—type I group: 92 patients (24.5%); type II group: 215 patients (57.2%); type III group: 12 patients (3.2%), and type IV group: 57 patients (15.2%). NIHSS scores at admission and discharge were significantly lower for the type I group compared with those for the type II and type IV groups (P < 0.05). NIHSS scores were higher in the groups with an incomplete circle of Willis compared with the group with a complete circle of Willis. A poor recovery rate was highest for the type IV group, whereas a good recovery rate was highest for the type I group. The logistic regression analysis showed that a complete circle of Willis was one of the predictors of suitable recovery (odds ratio [OR] = 0.708, 95% confidence interval [CI]: 0.554–0.906). Circle of Willis type was associated with stroke severity and patient prognosis, whereas an incomplete circle of Willis was associated with more severe conditions and a higher 90-day poor diagnosis rate. A complete circle of Willis was an independent predictor of good prognosis. PMID:26962785

  7. A comparison of the emission line properties between quasars and type 1 Seyfert galaxies

    NASA Technical Reports Server (NTRS)

    Wu, C. C.; Boggess, A.; Gull, T. R.

    1982-01-01

    For quasars and Seyfert galaxies, the equivalent width of C IV lambda 1550 increases as the continuum luminosity of an object decreases. A reasonable interpretation is that the covering factor increases as luminosity decreases. This is consistent with the fact that the L alpha and C IV equivalent widths for Seyferts are a factor of 2 larger than those for high redshift quasars. The C IV/C III ratio, which is a sensitive indicator of the ionization parameter, is about 5 for many Seyferts while it is about 2 for high redshift quasars.

  8. Sex Differences in DSM-IV Posttraumatic Stress Disorder Symptoms Expression Using Item Response Theory: a Population-based Study

    PubMed Central

    Rivollier, Fabrice; Peyre, Hugo; Hoertel, Nicolas; Blanco, Carlos; Limosin, Frédéric; Delorme, Richard

    2015-01-01

    Background Whether there are systematic sex differences in posttraumatic stress disorder (PTSD) symptom expression remains debated. Using methods based on item response theory (IRT), we aimed at examining differences in the likelihood of reporting DSM-IV symptoms of PTSD between women and men, while stratifying for major trauma type and equating for PTSD severity. Method We compared data from women and men in a large nationally representative adult sample, the National Epidemiologic Survey on Alcohol and Related Conditions. Analyses were conducted in the full population sample of individuals who met the DSM-IV criterion A (n = 23,860) and in subsamples according to trauma types. Results The clinical presentation of the 17 DSM-IV PTSD symptoms in the general population did not substantially differ in women and men in the full population and by trauma type after equating for levels of PTSD severity. The only exception was the symptom “foreshortened future”, which was more likely endorsed by men at equivalent levels of PTSD severity. Limitations The retrospective nature of the assessment of PTSD symptoms could have led to recall bias. Our sample size was too small to draw conclusions among individuals who experienced war-related traumas. Conclusions Our findings suggest that the clinical presentation of PTSD does not differ substantially between women and men. We also provide additional psychometric support to the exclusion of the symptom “foreshortened future” from the diagnostic criteria for PTSD in the DSM-5. PMID:26342916

  9. Sex differences in DSM-IV posttraumatic stress disorder symptoms expression using item response theory: A population-based study.

    PubMed

    Rivollier, Fabrice; Peyre, Hugo; Hoertel, Nicolas; Blanco, Carlos; Limosin, Frédéric; Delorme, Richard

    2015-11-15

    Whether there are systematic sex differences in posttraumatic stress disorder (PTSD) symptom expression remains debated. Using methods based on item response theory (IRT), we aimed at examining differences in the likelihood of reporting DSM-IV symptoms of PTSD between women and men, while stratifying for major trauma type and equating for PTSD severity. We compared data from women and men in a large nationally representative adult sample, the National Epidemiologic Survey on Alcohol and Related Conditions. Analyses were conducted in the full population sample of individuals who met the DSM-IV criterion A (n=23,860) and in subsamples according to trauma types. The clinical presentation of the 17 DSM-IV PTSD symptoms in the general population did not substantially differ in women and men in the full population and by trauma type after equating for levels of PTSD severity. The only exception was the symptom "foreshortened future", which was more likely endorsed by men at equivalent levels of PTSD severity. The retrospective nature of the assessment of PTSD symptoms could have led to recall bias. Our sample size was too small to draw conclusions among individuals who experienced war-related traumas. Our findings suggest that the clinical presentation of PTSD does not differ substantially between women and men. We also provide additional psychometric support to the exclusion of the symptom "foreshortened future" from the diagnostic criteria for PTSD in the DSM-5. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. High sensitivity Schottky junction diode based on monolithically grown aligned polypyrrole nanofibers: Broad range detection of m-dihydroxybenzene.

    PubMed

    Ameen, Sadia; Akhtar, M Shaheer; Seo, Hyung-Kee; Shin, Hyung Shik

    2015-07-30

    Aligned p-type polypyrrole (PPy) nanofibers (NFs) thin film was grown on n-type silicon (100) substrate by an electrochemical technique to fabricate Schottky junction diode for the efficient detection of m-dihydroxybenzene chemical. The highly dense and well aligned PPy NFs with the average diameter (∼150-200 nm) were grown on n-type Si substrate. The formation of aligned PPy NFs was confirmed by elucidating the structural, compositional and the optical properties. The electrochemical behavior of the fabricated Pt/p-aligned PPy NFs/n-silicon Schottky junction diode was evaluated by cyclovoltametry (CV) and current (I)-voltage (V) measurements with the variation of m-dihydroxybenzene concentration in the phosphate buffer solution (PBS). The fabricated Pt/p-aligned PPy NFs/n-silicon Schottky junction diode exhibited the rectifying behavior of I-V curve with the addition of m-dihydroxybenzene chemical, while a weak rectifying I-V behavior was observed without m-dihydroxybenzene chemical. This non-linear I-V behavior suggested the formation of Schottky barrier at the interface of Pt layer and p-aligned PPy NFs/n-silicon thin film layer. By analyzing the I-V characteristics, the fabricated Pt/p-aligned PPy NFs/n-silicon Schottky junction diode displayed reasonably high sensitivity ∼23.67 μAmM(-1)cm(-2), good detection limit of ∼1.51 mM with correlation coefficient (R) of ∼0.9966 and short response time (10 s). Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Laser and Light Treatments for Hair Reduction in Fitzpatrick Skin Types IV-VI: A Comprehensive Review of the Literature.

    PubMed

    Fayne, Rachel A; Perper, Marina; Eber, Ariel E; Aldahan, Adam S; Nouri, Keyvan

    2018-04-01

    Unwanted facial and body hair presents as a common finding in many patients, such as females with hirsutism. With advances in laser and light technology, a clinically significant reduction in hair can be achieved in patients with light skin. However, in patients with darker skin, Fitzpatrick skin types (FST) IV-VI, the higher melanin content of the skin interferes with the proposed mechanism of laser-induced selective photothermolysis, which is to target the melanin in the hair follicle to cause permanent destruction of hair bulge stem cells. Many prospective and retrospective studies have been conducted with laser and light hair-removal devices, but most exclude patients with darkly pigmented skin, considering them a high-risk group for unwanted side effects, including pigmentation changes, blisters, and crust formation. We reviewed the published literature to obtain studies that focused on hair reduction for darker skin types. The existing literature for this patient population identifies longer wavelengths as a key element of the treatment protocol and indicates neodymium-doped yttrium aluminum garnet (Nd:YAG), diode, alexandrite, and ruby lasers as well as certain intense pulsed light sources for safe hair reduction with minimal side effects in patients with FST IV-VI, so long as energy settings and wavelengths are appropriate. Based on the findings in this review, safe and effective hair reduction for patients with FST IV-VI is achievable under proper treatment protocols and energy settings.

  12. Proposal for a new classification of variations in the iliac venous system based on internal iliac veins: a case series and a review of double and left inferior vena cava.

    PubMed

    Hayashi, Shogo; Naito, Munekazu; Hirai, Shuichi; Terayama, Hayato; Miyaki, Takayoshi; Itoh, Masahiro; Fukuzawa, Yoshitaka; Nakano, Takashi

    2013-09-01

    There are many reports on variations in the inferior vena cava (IVC), particularly double IVC (DIVC) and left IVC (LIVC). However, no systematic report has recorded iliac vein (IV) flow patterns in the DIVC and LIVC. In this study, we examined IV flow patterns in both DIVC and LIVC observed during gross anatomy courses conducted for medical students and in previously reported cases. During the gross anatomy courses, three cases of DIVC and one case of LIVC were found in 618 cadavers. The IV flow pattern from these four cases and all other previously reported cases can be classified into one of the following three types according to the vein into which the internal iliac vein drained: the ipsilateral external IV; confluence of the ipsilateral external IV and IVC; and the communicating vein, which connects the IVC and the contralateral IVC or its iliac branch. This classification, which is based on the internal IV course, is considered to be useful because IV variations have the potential to cause clinical problems during related retroperitoneal surgery, venous interventional radiology, and diagnostic procedures for pelvic cancer.

  13. Safety and Efficacy of Once-Daily Intravenous Busulfan in Allogeneic Transplantation: A Matched-Pair Analysis.

    PubMed

    Kako, Shinichi; Fujiwara, Shinichiro; Sato, Miki; Kimura, Shun-Ichi; Nakasone, Hideki; Ohashi, Kazuteru; Kawakita, Toshiro; Maeda, Tetsuo; Morishita, Takanobu; Suzuki, Ritsuro; Fukuda, Takahiro; Ichinohe, Tatsuo; Kurata, Mio; Atsuta, Yoshiko; Kanda, Yoshinobu

    2018-04-19

    Compared with 4-times-daily infusion of intravenous busulfan (ivBU4), the safety and efficacy of once-daily infusion of ivBU (ivBU1) has not been fully clarified. We have been routinely using ivBU1 in a conditioning regimen in adult patients with myeloid malignancy who undergo allogeneic hematopoietic stem cell transplantation. In this study, a total of 91 patients who received ivBU1 for 2 days (n = 18) or 4 days (n = 73) in our institutions were compared with 273 control patients who received ivBU4, who were matched for age, sex, performance status, disease risk, conditioning regimen, and donor type, selected from the database of the Japanese Society for Hematopoietic Cell Transplantation using optimal matching algorithms. One-year overall survival (56.8% versus 57.1%, P = .94), disease-free survival (51.6% versus 50.8%, P = .73), relapse rate (28.5% versus 26.2%, P = .94), nonrelapse mortality (19.9% versus 23.0%, P = .71), and the incidence of graft-versus-host disease were not significantly different between the ivBU1 and ivBU4 groups. In patients who received ivBU1, neutrophil recovery was slower (median days: 22 versus 17, P = .001), and the incidence of veno-occlusive disease was lower (2.6% versus 17.4%, P = .04). In conclusion, ivBU1 can be safely administered with clinical outcomes similar to those with ivBU4. Copyright © 2018 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  14. 46 CFR 177.202 - Plans and information required.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... materials; (iv) Type and size of generators and prime movers; (v) Type and size of generator cables, bus-tie... 7102, Washington, DC 20593-7102. Three copies of all documents are required to be submitted for Marine...

  15. Clinical presentations of Ehlers Danlos syndrome type IV.

    PubMed Central

    Pope, F M; Narcisi, P; Nicholls, A C; Liberman, M; Oorthuys, J W

    1988-01-01

    Ehlers Danlos syndrome type IV is an often lethal disease caused by various mutations of type III collagen genes. It presents in infancy and childhood in several ways, and the symptoms and signs include low birth weight, prematurity, congenital dislocation of the hips, easy inappropriate bruising (sometimes suspected as child battering), and a diagnostic facial phenotype. These features predict a lethal adult disease often complicated by fatal arterial rupture in early or middle adult life. Most affected patients can be diagnosed from radiolabelled collagen protein profiles by polyacrylamide gel electrophoresis. Prenatal diagnosis by specific type III collagen restriction fragment length polymorphisms is possible in some families, and will become increasingly important. Prenatal diagnosis and prevention of the disease in selected families is already possible and will be widely available in the future. Images Fig 1 Fig 2 Fig 3 Fig 4 Fig 5 Fig 6 Fig 7 Fig 8 Fig 9 Fig 10 Fig 11 PMID:3178263

  16. Genome Wide DNA Methylation Profiles Provide Clues to the Origin and Pathogenesis of Germ Cell Tumors

    PubMed Central

    Rijlaarsdam, Martin A.; Tax, David M. J.; Gillis, Ad J. M.; Dorssers, Lambert C. J.; Koestler, Devin C.; de Ridder, Jeroen; Looijenga, Leendert H. J.

    2015-01-01

    The cell of origin of the five subtypes (I-V) of germ cell tumors (GCTs) are assumed to be germ cells from different maturation stages. This is (potentially) reflected in their methylation status as fetal maturing primordial germ cells are globally demethylated during migration from the yolk sac to the gonad. Imprinted regions are erased in the gonad and later become uniparentally imprinted according to fetal sex. Here, 91 GCTs (type I-IV) and four cell lines were profiled (Illumina’s HumanMethylation450BeadChip). Data was pre-processed controlling for cross hybridization, SNPs, detection rate, probe-type bias and batch effects. The annotation was extended, covering snRNAs/microRNAs, repeat elements and imprinted regions. A Hidden Markov Model-based genome segmentation was devised to identify differentially methylated genomic regions. Methylation profiles allowed for separation of clusters of non-seminomas (type II), seminomas/dysgerminomas (type II), spermatocytic seminomas (type III) and teratomas/dermoid cysts (type I/IV). The seminomas, dysgerminomas and spermatocytic seminomas were globally hypomethylated, in line with previous reports and their demethylated precursor. Differential methylation and imprinting status between subtypes reflected their presumed cell of origin. Ovarian type I teratomas and dermoid cysts showed (partial) sex specific uniparental maternal imprinting. The spermatocytic seminomas showed uniparental paternal imprinting while testicular teratomas exhibited partial imprinting erasure. Somatic imprinting in type II GCTs might indicate a cell of origin after global demethylation but before imprinting erasure. This is earlier than previously described, but agrees with the totipotent/embryonic stem cell like potential of type II GCTs and their rare extra-gonadal localization. The results support the common origin of the type I teratomas and show strong similarity between ovarian type I teratomas and dermoid cysts. In conclusion, we identified specific and global methylation differences between GCT subtypes, providing insight into their developmental timing and underlying developmental biology. Data and extended annotation are deposited at GEO (GSE58538 and GPL18809). PMID:25859847

  17. The Legionella IcmSW Complex Directly Interacts with DotL to Mediate Translocation of Adaptor-Dependent Substrates

    PubMed Central

    Sutherland, Molly C.; Nguyen, Thuy Linh; Tseng, Victor; Vogel, Joseph P.

    2012-01-01

    Legionella pneumophila is a Gram-negative bacterium that replicates within human alveolar macrophages by evasion of the host endocytic pathway through the formation of a replicative vacuole. Generation of this vacuole is dependent upon the secretion of over 275 effector proteins into the host cell via the Dot/Icm type IVB secretion system (T4SS). The type IV coupling protein (T4CP) subcomplex, consisting of DotL, DotM, DotN, IcmS and IcmW, was recently defined. DotL is proposed to be the T4CP of the L. pneumophila T4SS based on its homology to known T4CPs, which function as inner-membrane receptors for substrates. As a result, DotL is hypothesized to play an integral role(s) in the L. pneumophila T4SS for the engagement and translocation of substrates. To elucidate this role, a genetic approach was taken to screen for dotL mutants that were unable to survive inside host cells. One mutant, dotLY725Stop, did not interact with the type IV adaptor proteins IcmS/IcmW (IcmSW) leading to the identification of an IcmSW-binding domain on DotL. Interestingly, the dotLY725Stop mutant was competent for export of one class of secreted effectors, the IcmSW-independent substrates, but exhibited a specific defect in secretion of IcmSW-dependent substrates. This differential secretion illustrates that DotL requires a direct interaction with the type IV adaptor proteins for the secretion of a major class of substrates. Thus, by identifying a new target for IcmSW, we have discovered that the type IV adaptors perform an additional role in the export of substrates by the L. pneumophila Dot/Icm T4SS. PMID:23028312

  18. Haploidentical Donor Bone Marrow Transplant in Treating Patients With High-Risk Hematologic Cancer

    ClinicalTrials.gov

    2017-04-10

    Accelerated Phase Chronic Myelogenous Leukemia; Adult Acute Lymphoblastic Leukemia in Remission; Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Acute Lymphoblastic Leukemia in Remission; Childhood Acute Myeloid Leukemia in Remission; Childhood Burkitt Lymphoma; Childhood Chronic Myelogenous Leukemia; Childhood Myelodysplastic Syndromes; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; de Novo Myelodysplastic Syndromes; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hematopoietic/Lymphoid Cancer; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Peripheral T-cell Lymphoma; Post-transplant Lymphoproliferative Disorder; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Grade III Lymphomatoid Granulomatosis; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Grade III Lymphomatoid Granulomatosis; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Chronic Lymphocytic Leukemia; Refractory Multiple Myeloma; Relapsing Chronic Myelogenous Leukemia; Secondary Myelodysplastic Syndromes; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage II Multiple Myeloma; Stage III Adult Burkitt Lymphoma; Stage III Adult Diffuse Large Cell Lymphoma; Stage III Adult Diffuse Mixed Cell Lymphoma; Stage III Adult Diffuse Small Cleaved Cell Lymphoma; Stage III Adult Hodgkin Lymphoma; Stage III Adult Immunoblastic Large Cell Lymphoma; Stage III Adult Lymphoblastic Lymphoma; Stage III Adult T-cell Leukemia/Lymphoma; Stage III Childhood Hodgkin Lymphoma; Stage III Chronic Lymphocytic Leukemia; Stage III Cutaneous T-cell Non-Hodgkin Lymphoma; Stage III Grade 1 Follicular Lymphoma; Stage III Grade 2 Follicular Lymphoma; Stage III Grade 3 Follicular Lymphoma; Stage III Mantle Cell Lymphoma; Stage III Marginal Zone Lymphoma; Stage III Multiple Myeloma; Stage III Mycosis Fungoides/Sezary Syndrome; Stage III Small Lymphocytic Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Chronic Lymphocytic Leukemia; Stage IV Cutaneous T-cell Non-Hodgkin Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IV Marginal Zone Lymphoma; Stage IV Mycosis Fungoides/Sezary Syndrome; Stage IV Small Lymphocytic Lymphoma; Testicular Lymphoma; Waldenström Macroglobulinemia

  19. Structure activity relationship modelling of milk protein-derived peptides with dipeptidyl peptidase IV (DPP-IV) inhibitory activity.

    PubMed

    Nongonierma, Alice B; FitzGerald, Richard J

    2016-05-01

    Quantitative structure activity type models were developed in an attempt to predict the key features of peptide sequences having dipeptidyl peptidase IV (DPP-IV) inhibitory activity. The models were then employed to help predict the potential of peptides, which are currently reported in the literature to be present in the intestinal tract of humans following milk/dairy product ingestion, to act as inhibitors of DPP-IV. Two models (z- and v-scale) for short (2-5 amino acid residues) bovine milk peptides, behaving as competitive inhibitors of DPP-IV, were developed. The z- and the v-scale models (p<0.05, R(2) of 0.829 and 0.815, respectively) were then applied to 56 milk protein-derived peptides previously reported in the literature to be found in the intestinal tract of humans which possessed a structural feature of DPP-IV inhibitory peptides (P at the N2 position). Ten of these peptides were synthetized and tested for their in vitro DPP-IV inhibitory properties. There was no agreement between the predicted and experimentally determined DPP-IV half maximal inhibitory concentrations (IC50) for the competitive peptide inhibitors. However, the ranking for DPP-IV inhibitory potency of the competitive peptide inhibitors was conserved. Furthermore, potent in vitro DPP-IV inhibitory activity was observed with two peptides, LPVPQ (IC50=43.8±8.8μM) and IPM (IC50=69.5±8.7μM). Peptides present within the gastrointestinal tract of human may have promise for the development of natural DPP-IV inhibitors for the management of serum glucose. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. [Differentiation of spa types and staphylococcal cassette chromosome mec (SCCmec) in clinical methicillin-resistant Staphylococcus aureus isolated in medical sites of Gdańsk region].

    PubMed

    Kasprzyk, Joanna; Piechowicz, Lidia; Wiśniewska, Katarzyna; Dziewit, Łukasz; Bronk, Marek; Świeć, Krystyna

    2015-01-01

    Methicillin-resistant Staphylococcus aureus bacteria are one of the key etiological factors of hospital-acquired and community-acquired infections. MRSA strains have an ability of causing a broad spectrum infections: from a relatively mild skin infections to severe life-threatening systemic infections. They are characterized by multi-drug resistance, virulence of a number of factors, may clonally spread within the hospitals and between hospitals. The study embraced a number of 75 isolates of MRSA isolated from patients of 7 medical sites of the Gdansk region within the period of six months (June to December 2013). Strains have derived from various clinical materials, both of hospitalized patients (n=59) and outpatient (n=16). The isolates were tested for the susceptibility to antimicrobial agents accordance with the guidelines EUCAST. To estimate of the variability of occurrence of S. aureus clones used were standard spa gene, consisting in the amplified polymorphic region of the X gene encoding the protein A gene (spa). After receiving the results, a spa types were identified using international database Ridom Spa Server (www.spaserver.ridom.de). To determine the polymorphism cassette carrying the inecA gene from MRSA strains, used typing five major chromosomal cassette SCCmec (I-V) by multiplex PCR. MRSA population genetic analysis carried out on the basis of typing SCCmec cassettes and spa gene has showed a predominance of strains with SCCmec type II casette (46.7%) and SCCmec IV casette (38.7%). Less frequently detected were strains containing SCCmec I cassette (12.0%) and SCCmec III cassette (2.6%). Spa typing revealed the presence of 13 gene types in MRSA. The most frequently observed spa types were: t151 (24.0%), t003 (16.0%) in strains of the SCCmec II cassette and t437 (16.0%) and t008 (14.8%) in the isolates with SCCmec cassette IV, whereas staphylococcus with the type of spa t011 (12.0%) had SCCmec cassette I. In our population most frequent strains cassette SCCmec II (46.7%), in most representing types of spa t151 (51.4%) and t003 (34.3%), generally resistant not only to β-lactam antibiotics, but as erythromycin, clindamycin and norfloxacin (82.8%), the more frequently they were isolated from patients than a hospital outpatient centers. The strains SCCmec IV that represent the majority of outpatient centers (68.8%), the most represented type t437 (41.4%) and often occurred in hospital centers.

  1. Veliparib, Capecitabine, and Temozolomide in Patients With Advanced, Metastatic, and Recurrent Neuroendocrine Tumor

    ClinicalTrials.gov

    2017-09-26

    Functional Pancreatic Neuroendocrine Tumor; Malignant Somatostatinoma; Merkel Cell Carcinoma; Metastatic Adrenal Gland Pheochromocytoma; Metastatic Carcinoid Tumor; Multiple Endocrine Neoplasia Type 1; Multiple Endocrine Neoplasia Type 2A; Multiple Endocrine Neoplasia Type 2B; Neuroendocrine Neoplasm; Non-Functional Pancreatic Neuroendocrine Tumor; Pancreatic Glucagonoma; Pancreatic Insulinoma; Recurrent Adrenal Cortex Carcinoma; Recurrent Adrenal Gland Pheochromocytoma; Recurrent Merkel Cell Carcinoma; Somatostatin-Producing Neuroendocrine Tumor; Stage III Adrenal Cortex Carcinoma; Stage III Thyroid Gland Medullary Carcinoma; Stage IIIA Merkel Cell Carcinoma; Stage IIIB Merkel Cell Carcinoma; Stage IV Adrenal Cortex Carcinoma; Stage IV Merkel Cell Carcinoma; Stage IVA Thyroid Gland Medullary Carcinoma; Stage IVB Thyroid Gland Medullary Carcinoma; Stage IVC Thyroid Gland Medullary Carcinoma; Thymic Carcinoid Tumor; VIP-Producing Neuroendocrine Tumor; Well Differentiated Adrenal Cortex Carcinoma; Zollinger Ellison Syndrome

  2. Design and synthesis of aminocoumarin derivatives as DPP-IV inhibitors and anticancer agents.

    PubMed

    Soni, Rina; Soman, Shubhangi S

    2018-09-01

    DPP-IV "a moonlighting protein" has immerged as promising pathway to control Type 2 diabetes as well as found to play key role in earlier stages of cancer. Here we have reported design, synthesis and applications of aminocoumarin derivatives as DPP-IV inhibitors. Compounds have been synthesized and studied for their DPP-IV inhibition activity. Three compounds have shown moderate inhibition at 100 µM concentration. All compounds were also screened for their anticancer activity against A549 (Lung cancer cell line), MCF-7 (Breast cancer cell line) using MTT assay. One of the compounds has shown very good anticancer activity with IC 50 value 24 ± 0.1 nM against A549 cell line. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. The Fentanyl Patch Boil-Up - A Novel Method of Opioid Abuse.

    PubMed

    Schauer, Cameron K M W; Shand, James A D; Reynolds, Thomas M

    2015-11-01

    Fentanyl is a potent opioid analgesic used in the treatment of pain. Transdermal fentanyl patches are now widely utilized as an acceptable and efficacious method of medication delivery. Unfortunately, the potential for their abuse is well recognized. Previous case reports have documented deaths after intravenous (IV) misuse of fentanyl which had been extracted from Duragesic (liquid reservoir type) patches. We present a case of IV fentanyl abuse after the extraction from a Mylan (matrix type) patch. This method of abuse has not previously been described in the literature. © 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

  4. Cementless total hip arthroplasty with a double chevron subtrochanteric shortening osteotomy in patients with Crowe type-IV hip dysplasia.

    PubMed

    Li, Xigong; Sun, Junying; Lin, Xiangjin; Xu, Sanzhong; Tang, Tiansi

    2013-06-01

    The authors describe a modified double chevron subtrochanteric shortening osteotomy combined with cementless total hip arthroplasty for Crowe type-IV hip dysplasia. Shortening the femur allows to relax the shortened musculature. This operation was performed in 18 patients (22 hips) between January 2000 and February 2006. The mean follow-up period was 5.6 years (range: 3 to 8 years). The mean amount of femoral subtrochanteric shortening was 38 mm (range: 25 to 60 mm). The mean Harris hip score improved from 47 (range: 35 to 65) preoperatively to 88 points (range: 75 to 97) at final follow-up. The Trendelenburg sign was corrected from positive to negative in 12 of 22 hips. No acetabular or femoral components loosened or required revision during the follow-up period. All osteotomy sites healed in 3 to 6 months without complications. Cementless total hip arthroplasty using the modified double chevron subtrochanteric osteotomy provided good short- to midterm results in all 22 Crowe type-IV hip dislocations. Moreover, it restored the anatomic hip center and the limb length, which contributed to correction of the preoperative limp.

  5. Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

    PubMed

    Wang, Yaqiong; Ma, Hong

    2015-09-01

    Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  6. Effect of Sea buckthorn on liver fibrosis: A clinical study

    PubMed Central

    Gao, Ze-Li; Gu, Xiao-Hong; Cheng, Feng-Tao; Jiang, Fo-Hu

    2003-01-01

    AIM: To appraise the effect of sea buckthorn (Hippophae rhamnoides) on cirrhotic patients. METHODS: Fifty cirrhotic patients of Child-Pugh grade A and B were randomly divided into two groups: Group A as the treated group (n = 30), taking orally the sea buckthorn extract, 15 g 3 times a day for 6 mo. Group B as the control group (n = 18), taking vitamin B complex one tablet, 3 times a day for 6 mo. The following tests were performed before and after the treatment in both groups to determine LN, HA, collagens types III and IV, cytokines IL-6 and TNFα, liver serum albumin, total bile acid, ALT, AST and prothrombin time. RESULTS: The serum levels of TNFα, IL-6, laminin and type IV collagen in group A were significantly higher than those in the control group. After a course of sea buckthorn treatment, the serum levels of LN, HA, collagen types III and IV, total bile acid (TBA) decreased significantly as compared with those before and after treatment in the control group. The sea buckthorn notably shortened the duration for normalization of aminotransferases. CONCLUSION: Sea buckthorn may be a hopeful drug for prevention and treatment of liver fibrosis. PMID:12854177

  7. Ultraviolet studies of nova-like variables with the IUE

    NASA Technical Reports Server (NTRS)

    Guinan, E. F.

    1983-01-01

    KQ Mon is a new UX UMa-type nova-like variable. Optical spectra taken in 1978 reveal very shallow Balmer absorption lines and He I (wavelength 4471) absorption. There was no evidence of orbital variations but the appearance of the optical spectrum and the presence of low amplitude flickering suggested a strong similarity to CD-42 degrees 14462 (=V3885 Sgr) and other members of the UX UMa class. KQ Mon was observed at low dispersion with the IUE satellite. Six spectra taken with the short wavelength prime (SWP) camera are dominated by strong broad absorption lines due to N V, O I, Si III, Si IV, C IV, He II, N IV, and A1 III. There is little evidence of orbital phase modulation over the time baseline of the observations. Unlike UV observations of other UX UMa-type objects, KQ Mon exhibits no emission lines or P Cygni-type profiles and the velocity displacements appear to be smaller, suggesting the absence of a hot, high velocity wind characterizing other UX UMa stars. The relationship of KQ Mon to other UX UMa disk stars is discussed and a model is suggested to explain their observed properties and the lack of major outbursts.

  8. The electron-cyclotron maser instability as a source of plasma radiation. [Solar radio bursts

    NASA Technical Reports Server (NTRS)

    Winglee, R. M.; Dulk, G. A.

    1986-01-01

    The generation of continuum bursts from the sun at dm and m wavelengths (in particular, type IV bursts) via the electron-cyclotron-maser instability is examined. The maser instability can be driven by an electron distribution with either a loss-cone anisotropy or a peak at large pitch angles. For omega(p)/Omega(e) much greater than 1, the maser emission is produced by electrons interacting through a harmonic (cyclotron) resonance and is electrostatic, being in the upper hybrid mode at frequencies approximately equal to omega(p). Coalescence processes are required to convert the electrostatic waves into transverse radiation which can escape from the source region. Whether the resultant spectrum is nearly a smooth continuum or has a zebra-stripe pattern (both of which occur in type IV bursts) depends on the form of the electron distribution, inhomogeneities in the density and magnetic field, and whether the maser reaches saturation. For at least the case of some type IV dm bursts with fine structure, comparison with observations seems to indicate that the electrons producing the emission are more likely to have a loss-cone distribution, and that the maser instability is not at saturation.

  9. INTERNAL ROOT MORPHOLOGY IN MANDIBULAR FIRST PERMANENT MOLARS IN A KENYAN POPULATION.

    PubMed

    Muriithi, N J; Maina, S W; Okoth, J; Gathece, L W

    2012-05-01

    To determine the internal root morphology and gender variations in mandibular first permanent molars in a Kenyan population. In vitro descriptive cross sectional study. School of Dental Sciences, University of Nairobi The mesial root of mandibular first molars had two canals in 96.3% of the teeth in both males and females and-type IV canal configuration was most prevalent in the mesial root. The distal root of the mandibular first molar had one canal in 57.7% of the teeth in males and females. There were significant gender variations in the number of canals and canal configurations in the distal root. Two canals were more prevalent in females (53.6%) compared to males (30.4%) and a single canal was more frequent in males (69.6%) compared to females (46.4%) (P=0.001). Canal types 1, 11 and IV were the most frequent in the mandibular distal root. The gender variation in the frequency of canal types I, II and IV in the distal root was statistically significant (P=0.001). Most of the mandibular first molars have three canals (56%). Two canals in the distal root are more frequent among females (53.6%) compared to males (30.4%).

  10. Methods to Improve Osseointegration of Dental Implants in Low Quality (Type-IV) Bone: An Overview.

    PubMed

    Alghamdi, Hamdan S

    2018-01-13

    Nowadays, dental implants have become more common treatment for replacing missing teeth and aim to improve chewing efficiency, physical health, and esthetics. The favorable clinical performance of dental implants has been attributed to their firm osseointegration, as introduced by Brånemark in 1965. Although the survival rate of dental implants over a 10-year observation has been reported to be higher than 90% in totally edentulous jaws, the clinical outcome of implant treatment is challenged in compromised (bone) conditions, as are frequently present in elderly people. The biomechanical characteristics of bone in aged patients do not offer proper stability to implants, being similar to type-IV bone (Lekholm & Zarb classification), in which a decreased clinical fixation of implants has been clearly demonstrated. However, the search for improved osseointegration has continued forward for the new evolution of modern dental implants. This represents a continuum of developments spanning more than 20 years of research on implant related-factors including surgical techniques, implant design, and surface properties. The methods to enhance osseointegration of dental implants in low quality (type-IV) bone are described in a general manner in this review.

  11. Bone tissue ultrastructural defects in a mouse model for osteogenesis imperfecta: a Raman spectroscopy study

    NASA Astrophysics Data System (ADS)

    Chen, Tsoching; Kozloff, Kenneth M.; Goldstein, Steven A.; Morris, Michael D.

    2004-07-01

    Osteogenesis imperfecta (OI) is genetic defect in which the genes that code for the α1(I) or α2(I) chains of type I collagen are defective. The defects often result in substitution of a bulky amino acid for glycine, causing formation of collagen that can not form the normal triple helix. Depending on the details of the defects, the outcomes range from controllable to lethal. This study focuses on OI type IV, a more common and moderately severe form of the disease. People with the disease have a substantial increase in the risk and rate of fracture. We examine the spectroscopic consequences of these defects, using a mouse model (BRTL) that mimics OI type IV. We compare Raman images from tibial cortical tissue of wild-type mice and BRTL mice with single copy of mutation and show that both mineral to matrix ratios and collagen inter-fibril cross-links are different in wild-type and mutant mice.

  12. Effects of extracellular matrix proteins on macrophage differentiation, growth, and function: comparison of liquid and agar culture systems

    NASA Technical Reports Server (NTRS)

    Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Both spaceflight and skeletal unloading suppress the haematopoietic differentiation of macrophages (Sonnenfeld et al., Aviat. Space Environ. Med., 61:648-653, 1990; Armstrong et al., J. Appl. Physiol., 75:2734-2739, 1993). The mechanism behind this reduction in haematopoiesis has yet to be elucidated. However, changes in bone marrow extracellular matrix (ECM) may be involved. To further understand the role of ECM products in macrophage differentiation, we have performed experiments evaluating the effects of fibronectin, laminin, collagen type I, and collagen type IV on macrophage development and function. Bone marrow-derived macrophages cultured on four different ECM substrates in liquid culture medium showed less growth than those cultured on plastic. Significant morphological differences were seen on each of the substrates used. Phenotypically and functionally, as measured by class II major histocompatibility molecule (MHCII) expression, MAC-2 expression, and the secretion of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha), these macrophages were similar. In contrast, bone marrow-derived macrophages cultured in suspension, using agar, showed no difference in growth when exposed to ECM proteins. However, IL-6 and TNF-alpha secretion was affected by fibronectin, laminin, collagen type I, and collagen type IV in a concentration-dependent manner. We conclude that the ECM products fibronectin, laminin, collagen type I, and collagen type IV have profound effects on macrophage development and function. Additionally, we suggest that an ECM-supplemented agar culture system provides an environment more analogous to in vivo bone marrow than does a traditional liquid culture system.

  13. Non-invasive high-intensity focused ultrasound for UV-induced hyperpigmentation in Fitzpatrick skin types III and IV: a prospective, randomized, controlled, evaluator-blinded trial.

    PubMed

    Vachiramon, Vasanop; Jurairattanaporn, Natthachat; Harnchoowong, Sarawin; Chayavichitsilp, Pamela

    2018-02-01

    Skin hyperpigmentation is a frequently encountered problem, particularly in darker skin types. Unfortunately, standard treatments for this condition have shown disappointing results. High-intensity focused ultrasound (HIFU) is commonly indicated for skin laxity, but recently was used to treat UV-induced hyperpigmentation in animal models. This study is aimed to evaluate the efficacy and safety of high-intensity focused ultrasound for UVB-induced hyperpigmentation in human subjects. A randomized, evaluator-blinded pilot study was conducted on 20 subjects. Each subject was induced three hyperpigmentary spots by local broadband UVB. After 2 weeks, each spot was randomly allocated to control, low-energy, and high-energy HIFU. Subjects were instructed to follow up weekly for a duration of 1 month. Lightness index measurements, mean improvement scores, subjects' satisfaction, pain scores, and side effects were evaluated. All 20 subjects completed the study. Fourteen subjects had Fitzpatrick (FPT) skin type III and six subjects had FPT skin type IV. Twelve subjects showed greater improvement at control sites while eight subjects showed greater improvement at HIFU-treated sites. In FPT skin type III, HIFU appeared to be inferior to control in both lightness index and mean improvement scores, but in FPT skin type IV, HIFU had greater lightness index improvement and higher improvement scores than control. Side effects were more frequent in high-energy-treated areas. Focused ultrasound may be offered in some patients with hyperpigmentary conditions. More research is needed to determine proper energy settings for optimal outcome.

  14. 33 CFR Appendix B to Part 155 - Determining and Evaluating Required Response Resources for Vessel Response Plans

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and the geographic area(s) in... type of petroleum oil carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and... Petroleum Oil Cargo Groups Non-persistent oil 72 G: Group I 1.0 Persistent oil: Group II 1.8 Group III 2.0...

  15. 33 CFR Appendix B to Part 155 - Determining and Evaluating Required Response Resources for Vessel Response Plans

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and the geographic area(s) in... type of petroleum oil carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and... Petroleum Oil Cargo Groups Non-persistent oil 72 G: Group I 1.0 Persistent oil: Group II 1.8 Group III 2.0...

  16. 33 CFR Appendix B to Part 155 - Determining and Evaluating Required Response Resources for Vessel Response Plans

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and the geographic area(s) in... type of petroleum oil carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and... Petroleum Oil Cargo Groups Non-persistent oil 72 G: Group I 1.0 Persistent oil: Group II 1.8 Group III 2.0...

  17. Comparing Diagnostic Outcomes of Autism Spectrum Disorder Using "DSM-IV-TR" and "DSM-5" Criteria

    ERIC Educational Resources Information Center

    Harstad, Elizabeth B.; Fogler, Jason; Sideridis, Georgios; Weas, Sarah; Mauras, Carrie; Barbaresi, William J.

    2015-01-01

    Controversy exists regarding the "DSM-5" criteria for ASD. This study tested the psychometric properties of the "DSM-5" model and determined how well it performed across different gender, IQ, and "DSM-IV-TR" sub-type, using clinically collected data on 227 subjects (median age = 3.95 years, majority had IQ > 70).…

  18. Graduate Students' Administration and Scoring Errors on the WISC-IV: Reducing Inaccuracies with Training and Experience

    ERIC Educational Resources Information Center

    Alper, Jaclyn

    2012-01-01

    A total of 52 Wechsler Intelligence Scale for Children, Fourth Edition (WISC-IV) protocols, administered by graduate students were examined to obtain data on the type and frequency of examiner errors, the impact of errors on resultant test scores as well as improvement rate over the course of two years in training. Findings were consistent with…

  19. Sorption of Ferrioxime B to Synthetic and Biogenic layer type Mn Oxides

    NASA Astrophysics Data System (ADS)

    Duckworth, O. W.; Bargar, J. R.; Sposito, G.

    2005-12-01

    Siderophores are biogenic chelating agents produced in terrestrial and marine environments to increase the bioavailablity of ferric iron. Recent work has suggested that both aqueous and solid-phase Mn(III) may affect siderophore-mediated iron transport, but no information appears to be available about the effect of solid-phase Mn(IV). To probe the effect of solid-phase Mn(IV), we studied the sorption reaction of ferrioxamine B [principally the species, Fe(III)HDFOB+, an Fe(III) chelate of the trihydroxamate siderophore, desferrioxamine B (DFOB)] with two synthetic birnessites [layer type Mn(IV) oxides] and a biogenic birnessite produced by Pseudomonas putida MnB1. We found that all of these predominantly Mn(IV) oxides greatly reduced the aqueous concentration of Fe(III)HDFOB+ over the pH range between 5 and 9. After 72 h equilibration time at pH 8, the sorption behavior for the synthetic birnessites could be accurately described by a Langmuir isotherm; for the biogenic oxide, a Freundlich isotherm was best utilized to model the sorption data. To study the molecular nature of the interaction between the Fe(III)HDFOB+ complex and the oxide surface, Fe K-edge extended X-Ray absorption fine structure (EXAFS) spectroscopy was employed. Analysis of the X-ray absorption spectra indicated that Fe(III) associated with the Mn(IV) oxides is not complexed with DFOB, but instead is incorporated into the mineral structure, thus implying that the Mn(IV) oxides displaced Fe(III) from the siderophore complex. These results indicate that manganese oxides, including biominerals, may strongly sequester iron from soluble ferric complexes and thus may play a significant role in the biogeochemical cycling of iron.

  20. Sorption of Ferric Iron from Ferrioxamine B to Synthetic and Biogenic Layer Type Manganese Oxides

    NASA Astrophysics Data System (ADS)

    Duckworth, O.; John, B.; Sposito, G.

    2006-12-01

    Siderophores are biogenic chelating agents produced in terrestrial and marine environments to increase the bioavailablity of ferric iron. Recent work has suggested that both aqueous and solid-phase Mn(III) may affect siderophore-mediated iron transport, but no information appears to be available about the effect of solid-phase Mn(IV). To probe the effects of predominantly Mn(IV) oxides, we studied the sorption reaction of ferrioxamine B [Fe(III)HDFOB+, an Fe(III) chelate of the trihydroxamate siderophore desferrioxamine B (DFOB)] with two synthetic birnessites [layer type Mn(III, IV) oxides] and a biogenic birnessite produced by Pseudomonas putida MnB1. We found that all of these predominantly Mn(IV) oxides greatly reduced the aqueous concentration of Fe(III)HDFOB+ over at pH 8. After 72 hours equilibration time, the sorption behavior for the synthetic birnessites could be accurately described by a Langmuir isotherm; for the biogenic oxide, a Freundlich isotherm was best utilized to model the sorption data. To study the molecular nature of the interaction between the Fe(III)HDFOB+ complex and the oxide surface, Fe K-edge extended X-ray absorption fine structure (EXAFS) spectroscopy was employed. Analysis of the EXAFS spectra indicated that Fe(III) associated with the Mn(IV) oxides is not complexed by DFOB as in solution, but instead Fe(III) is specifically adsorbed to into the mineral structure at multiple sites with no evidence of DFOB complexation, thus indicating that the Mn(IV) oxides displaced Fe(III) from the siderophore complex. These results indicate that manganese oxides, including biominerals, may strongly sequester iron from soluble ferric complexes and thus may play a significant role in the biogeochemical cycling of iron in marine and terrestrial environments.

  1. Closure of tubular patent ductus arteriosus with the Amplatzer Vascular Plug IV: feasibility and safety.

    PubMed

    Baruteau, Alban-Elouen; Lambert, Virginie; Riou, Jean-Yves; Angel, Claude-Yves; Belli, Emre; Petit, Jérôme

    2015-01-01

    Closure of tubular patent ductus arteriosus remains a challenging procedure. Anecdotal use of Amplatzer Vascular Plug IV for tubular ductus closure has been reported but feasibility and safety in a consecutive patients' series remain unknown. We performed a monocenter prospective study at the Marie Lannelongue Hospital in Paris, France. From 2009 to 2014, a total of 47 patients (39 infants, 3 children, and 5 adults) underwent ductus closure with the Plug IV. Ductus morphology was a type E in 34 (72.3%) patients and a type C in 13 (27.7%) patients. Ductus closure occurred in 39 (83.0%) infants at a median age of seven months (range: 3-23 months) and a median weight of 6.9 kg (range: 4.1-17.0 kg). A past history of prematurity and very low birth weight was found in 33 (70.2%) of them. Twelve (25.5%) patients had pulmonary hypertension. Mean Plug IV diameter was 1.9 ± 0.1 mm larger than the mean maximal ductus diameter. Early complete closure of the ductus was obtained in all patients. Early migration of an undersized Plug IV occurred in one (2.1%) patient and was suitable for percutaneous device retrieval. After a mean follow-up of 3.4 ± 1.4 years, all patients are alive and asymptomatic, no late complication occurred. Transcatheter closure of tubular ductus with the Amplatzer Vascular Plug IV can be safe and effective, with a 100% early occlusion rate. This device, suitable for a 4F sheath, is a new alternative for tubular ductus closure in low-body-weight infants. © The Author(s) 2014.

  2. A New Method to Assess Asymmetry in Fingerprints Could Be Used as an Early Indicator of Type 2 Diabetes Mellitus

    PubMed Central

    Morris, Molly R.; Ludwar, Bjoern Ch.; Swingle, Evan; Mamo, Mahelet N.; Shubrook, Jay H.

    2016-01-01

    Background: Inexpensive screening tools are needed to identify individuals predisposed to developing diabetes mellitus (DM). Such early identification coupled with an effective intervention could help many people avoid the substantial health costs of this disease. We investigated the hypothesis that fluctuating asymmetry (FA) in fingerprints is an indicator of type 2 diabetes mellitus (T2DM). Methods: Participants with T2DM, with T1DM, and without any indication or known family history of diabetes were fingerprinted with a Crossmatch Verifier 320 LC scanner. Asymmetry scores for each finger pair were assessed using both pattern analysis (ridge counts), and a wavelet-based analysis. Results: Both methods for scoring asymmetry predicted risk of T2DM for finger pair IV, controlling for gender and age. AUC scores were significantly greater than the null for pattern asymmetry scores (finger IV AUC = 0.74), and wavelet asymmetry scores for finger pair IV (AUC = 0.73) and finger pair V (AUC = 0.73), for predicting T2DM. In addition, wavelet asymmetry scores for finger pair IV (AUC = 0.80) and finger pair V (AUC = 0.85) significantly predicted risk of T1DM. Conclusions: A diagnostic tool based on FA in the fingerprints of finger pair IV, measured using a wavelet analysis could be developed for predicting risk prior to associated health problems for both T2DM and T1DM. In addition, given that that the prints for fingers IV and V develop during the 14-17 weeks of gestation, we predict that interventions during this time period of pregnancy will be most successful. PMID:26830490

  3. A New Method to Assess Asymmetry in Fingerprints Could Be Used as an Early Indicator of Type 2 Diabetes Mellitus.

    PubMed

    Morris, Molly R; Ludwar, Bjoern Ch; Swingle, Evan; Mamo, Mahelet N; Shubrook, Jay H

    2016-07-01

    Inexpensive screening tools are needed to identify individuals predisposed to developing diabetes mellitus (DM). Such early identification coupled with an effective intervention could help many people avoid the substantial health costs of this disease. We investigated the hypothesis that fluctuating asymmetry (FA) in fingerprints is an indicator of type 2 diabetes mellitus (T2DM). Participants with T2DM, with T1DM, and without any indication or known family history of diabetes were fingerprinted with a Crossmatch Verifier 320 LC scanner. Asymmetry scores for each finger pair were assessed using both pattern analysis (ridge counts), and a wavelet-based analysis. Both methods for scoring asymmetry predicted risk of T2DM for finger pair IV, controlling for gender and age. AUC scores were significantly greater than the null for pattern asymmetry scores (finger IV AUC = 0.74), and wavelet asymmetry scores for finger pair IV (AUC = 0.73) and finger pair V (AUC = 0.73), for predicting T2DM. In addition, wavelet asymmetry scores for finger pair IV (AUC = 0.80) and finger pair V (AUC = 0.85) significantly predicted risk of T1DM. A diagnostic tool based on FA in the fingerprints of finger pair IV, measured using a wavelet analysis could be developed for predicting risk prior to associated health problems for both T2DM and T1DM. In addition, given that that the prints for fingers IV and V develop during the 14-17 weeks of gestation, we predict that interventions during this time period of pregnancy will be most successful. © 2016 Diabetes Technology Society.

  4. High resolution observations with Artemis-IV and the NRH. I. Type IV associated narrow-band bursts

    NASA Astrophysics Data System (ADS)

    Bouratzis, C.; Hillaris, A.; Alissandrakis, C. E.; Preka-Papadema, P.; Moussas, X.; Caroubalos, C.; Tsitsipis, P.; Kontogeorgos, A.

    2016-02-01

    Context. Narrow-band bursts appear on dynamic spectra from microwave to decametric frequencies as fine structures with very small duration and bandwidth. They are believed to be manifestations of small scale energy release through magnetic reconnection. Aims: We analyzed 27 metric type IV events with embedded narrow-band bursts, which were observed by the ARTEMIS-IV radio spectrograph from 30 June 1999 to 1 August 2010. We examined the morphological characteristics of isolated narrow-band structures (mostly spikes) and groups or chains of structures. Methods: The events were recorded with the SAO high resolution (10 ms cadence) receiver of ARTEMIS-IV in the 270-450 MHz range. We measured the duration, spectral width, and frequency drift of ~12 000 individual narrow-band bursts, groups, and chains. Spike sources were imaged with the Nançay radioheliograph (NRH) for the event of 21 April 2003. Results: The mean duration of individual bursts at fixed frequency was ~100 ms, while the instantaneous relative bandwidth was ~2%. Some bursts had measurable frequency drift, either positive or negative. Quite often spikes appeared in chains, which were closely spaced in time (column chains) or in frequency (row chains). Column chains had frequency drifts similar to type-IIId bursts, while most of the row chains exhibited negative frequently drifts with a rate close to that of fiber bursts. From the analysis of NRH data, we found that spikes were superimposed on a larger, slowly varying, background component. They were polarized in the same sense as the background source, with a slightly higher degree of polarization of ~65%, and their size was about 60% of their size in total intensity. Conclusions: The duration and bandwidth distributions did not show any clear separation in groups. Some chains tended to assume the form of zebra, lace stripes, fiber bursts, or bursts of the type-III family, suggesting that such bursts might be resolved in spikes when viewed with high resolution. The NRH data indicate that the spikes are not fluctuations of the background, but represent additional emission such as what would be expected from small-scale reconnection.

  5. Assessment of AASHTO M 364 type II and type IV joint sealers.

    DOT National Transportation Integrated Search

    2014-11-01

    To address the issue of water infiltration and debris retention, bituminous crack sealers and fillers have been : developed to help prevent premature pavement distress. If applied appropriately, crack sealers and fillers can : significantly extend th...

  6. Narrow absorption lines complex I: one form of broad absorption line

    NASA Astrophysics Data System (ADS)

    Lu, Wei-Jian; Lin, Ying-Ru

    2018-03-01

    We discover that some of the broad absorption lines (BALs) are actually a complex of narrow absorption lines (NALs). As a pilot study of this type of BAL, we show this discovery through a typical example in this paper. Utilizing the two-epoch observations of J002710.06-094435.3 (hereafter J0027-0944) from the Sloan Digital Sky Survey (SDSS), we find that each of the C IV and Si IV BAL troughs contains at least four NAL doublets. By resolving the Si IV BAL into multiple NALs, we present the following main results and conclusions. First, all these NALs show coordinated variations between the two-epoch SDSS observations, suggesting that they all originate in the quasar outflow, and that their variations are due to global changes in the ionization condition of the absorbing gas. Secondly, a BAL consisting of a number of NAL components indicates that this type of BAL is basically the same as the intrinsic NAL, which tends to support the inclination model rather than the evolution model. Thirdly, although both the C IV and Si IV BALs originate from the same clumpy substructures of the outflow, they show different profile shapes: multiple absorption troughs for the Si IV BAL in a wider velocity range, while P-Cygni for the C IV BAL in a narrower velocity range. This can be interpreted by the substantial differences in fine structure and oscillator strength between the Si IVλλ1393, 1402 and C IVλλ1548, 1551 doublets. Based on the above conclusions, we consider that the decomposition of a BAL into NALs can serve as a way to resolve the clumpy structure for outflows, and it can be used to learn more about characteristics of the clumpy structure and to test the outflow model, when utilizing high-resolution spectra and photoionization model.

  7. On the type Ia supernovae 2007on and 2011iv: evidence for Chandrasekhar-mass explosions at the faint end of the luminosity-width relationship

    NASA Astrophysics Data System (ADS)

    Ashall, C.; Mazzali, P. A.; Stritzinger, M. D.; Hoeflich, P.; Burns, C. R.; Gall, C.; Hsiao, E. Y.; Phillips, M. M.; Morrell, N.; Foley, Ryan J.

    2018-06-01

    Radiative transfer models of two transitional type Ia supernovae (SNe Ia) have been produced using the abundance stratification technique. These two objects - designated SN 2007on and SN 2011iv - both exploded in the same galaxy, NGC 1404, which allows for a direct comparison. SN 2007on synthesized 0.25 M_{⊙} of 56Ni and was less luminous than SN 2011iv, which produced 0.31 M_{⊙} of 56Ni. SN 2007on had a lower central density (ρc) and higher explosion energy (Ekin ˜1.3 ± 0.3 × 1051erg) than SN 2011iv, and it produced less nuclear statistical equilibrium (NSE) elements (0.06 M_{⊙}). Whereas, SN 2011iv had a larger ρc, which increased the electron capture rate in the lowest velocity regions, and produced 0.35 M_{⊙} of stable NSE elements. SN 2011iv had an explosion energy of ˜Ekin ˜0.9 ± 0.2 × 1051erg. Both objects had an ejecta mass consistent with the Chandrasekhar mass (Ch-mass), and their observational properties are well described by predictions from delayed-detonation explosion models. Within this framework, comparison to the sub-luminous SN 1986G indicates SN 2011iv and SN 1986G have different transition densities (ρtr) but similar ρc. Whereas SN 1986G and SN 2007on had a similar ρtr but different ρc. Finally, we examine the colour-stretch parameter sBV versus Lmax relation and determine that the bulk of SNe Ia (including the sub-luminous ones) are consistent with Ch-mass delayed-detonation explosions, where the main parameter driving the diversity is ρtr. We also find ρc to be driving the second-order scatter observed at the faint end of the luminosity-width relationship.

  8. Protective effects of tocotrienols against lipid-induced nephropathy in experimental type-2 diabetic rats by modulation in TGF-β expression.

    PubMed

    Siddiqui, Shabeena; Ahsan, Haseeb; Khan, Mohammad Rashid; Siddiqui, Waseem A

    2013-12-01

    Dyslipidemia is common in patients with diabetes mellitus (DM) and is considered a risk factor for the progression of diabetic nephropathy (DN). Hyperlipidemia and hyperglycemia act synergistically to induce renal injury. The present study was designed to investigate the protective effects of tocotrienols as tocotrienol-rich fraction (TRF) extracted from palm (PO) and rice bran oils (RBO) against lipid induced nephropathy in type-2 diabetic rats and its probable molecular mechanism. Male Wistar rats (175-200 g) were divided into four groups. The first group served as diabetic control, while the second and third groups received PO-TRF and RBO-TRF, respectively by gavage over a period of sixteen weeks post-induction of diabetes. The fourth group comprised of age-matched rats that served as normal control. The effects of TRF on serum lipid profile, oxidative stress markers, expression of TGF-β, fibronectin and collagen type IV were analyzed in the kidney of diabetic rats. Treatment with PO-TRF and RBO-TRF significantly improved glycemic status, serum lipid profile and renal function in type-2 diabetic rats. In addition, TRF supplementation down-regulated the expression of TGF-β, fibronectin and collagen type IV in the kidney of diabetic rats. Transforming growth factor-β (TGF-β) plays a critical role in progression of DN, but its modulation by tocotrienols in DN remains unexplored. TRF ameliorated lipid induced nephropathy in type-2 diabetes by its hypoglycemic, hypolipidemic and antioxidant activities as well as by modulation of TGF-β to prevent increased expression of collagen type IV and fibrinogen. We finally propose a mechanism for the expression of molecular markers that are significant in the events leading to diabetic nephropathy and its modulation by tocotrienols/TRF. © 2013.

  9. A survey of the intravenous sedation status in one provincial dental clinic center for the disabled in Korea

    PubMed Central

    Seok, Ujeong; Ji, Sangeun; Yoo, Seunghoon; Kim, Jongsoo; Kim, Seungoh

    2016-01-01

    Background The objective of the present study was to examine the status of patients who had received dental treatment under intravenous (IV) sedation at Chungnam Dental Clinic for the Disabled in Korea from its inception to the present time, and to review the analysis results. Methods Retrospective analysis was performed on 305 cases of patients who had received dental treatments under IV sedation between January 2011 and May 2016. The analysis examined the patient's sex, age, primary reason for IV sedation, duration of anesthesia and dental treatment, type of dental treatment performed, number of clinical departments involved in the dental treatment and level of multidisciplinary cooperation, and annual trends. Results Most dental treatments using intravenous sedation were performed on medically disabled patients or dentally disabled patients with an extreme gag reflex or dental phobia. The mean duration of IV sedation was 72.5 min, while the mean duration of treatment was 58.0 min. The types of dental treatments included surgical treatment (n = 209), periodontal treatment (n = 28), prosthodontic treatment (n = 28), restorative treatment (n = 23), implant surgery (n = 22), endodontic treatment (n = 9), reduction of temporomandibular joint dislocation (n = 1), and treatment of traumatic injuries (n = 1), with treatments mostly performed on adult patients. Conclusions With increasing demand for minimally painful treatment, cases using IV sedation are on an upward trend and are expected to continue to increase. PMID:28879305

  10. Loss of the smallest subunit of cytochrome c oxidase, COX8A, causes Leigh-like syndrome and epilepsy.

    PubMed

    Hallmann, Kerstin; Kudin, Alexei P; Zsurka, Gábor; Kornblum, Cornelia; Reimann, Jens; Stüve, Burkhard; Waltz, Stephan; Hattingen, Elke; Thiele, Holger; Nürnberg, Peter; Rüb, Cornelia; Voos, Wolfgang; Kopatz, Jens; Neumann, Harald; Kunz, Wolfram S

    2016-02-01

    Isolated cytochrome c oxidase (complex IV) deficiency is one of the most frequent respiratory chain defects in humans and is usually caused by mutations in proteins required for assembly of the complex. Mutations in nuclear-encoded structural subunits are very rare. In a patient with Leigh-like syndrome presenting with leukodystrophy and severe epilepsy, we identified a homozygous splice site mutation in COX8A, which codes for the ubiquitously expressed isoform of subunit VIII, the smallest nuclear-encoded subunit of complex IV. The mutation, affecting the last nucleotide of intron 1, leads to aberrant splicing, a frame-shift in the highly conserved exon 2, and decreased amount of the COX8A transcript. The loss of the wild-type COX8A protein severely impairs the stability of the entire cytochrome c oxidase enzyme complex and manifests in isolated complex IV deficiency in skeletal muscle and fibroblasts, similar to the frequent c.845_846delCT mutation in the assembly factor SURF1 gene. Stability and activity of complex IV could be rescued in the patient's fibroblasts by lentiviral expression of wild-type COX8A. Our findings demonstrate that COX8A is indispensable for function of human complex IV and its mutation causes human disease. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

    PubMed

    Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

    2012-10-01

    The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Guadecitabine and Durvalumab in Treating Patients With Advanced Liver, Pancreatic, Bile Duct, or Gallbladder Cancer

    ClinicalTrials.gov

    2018-04-27

    Extrahepatic Bile Duct Adenocarcinoma, Biliary Type; Gallbladder Adenocarcinoma, Biliary Type; Metastatic Pancreatic Adenocarcinoma; Recurrent Cholangiocarcinoma; Recurrent Gallbladder Carcinoma; Recurrent Hepatocellular Carcinoma; Recurrent Intrahepatic Cholangiocarcinoma; Recurrent Pancreatic Carcinoma; Stage III Gallbladder Cancer AJCC V7; Stage III Hepatocellular Carcinoma AJCC v7; Stage III Intrahepatic Cholangiocarcinoma AJCC v7; Stage III Pancreatic Cancer AJCC v6 and v7; Stage IIIA Gallbladder Cancer AJCC v7; Stage IIIA Hepatocellular Carcinoma AJCC v7; Stage IIIB Gallbladder Cancer AJCC v7; Stage IIIB Hepatocellular Carcinoma AJCC v7; Stage IIIC Hepatocellular Carcinoma AJCC v7; Stage IV Gallbladder Cancer AJCC v7; Stage IV Hepatocellular Carcinoma AJCC v7; Stage IV Pancreatic Cancer AJCC v6 and v7; Stage IVA Gallbladder Cancer AJCC v7; Stage IVA Hepatocellular Carcinoma AJCC v7; Stage IVA Intrahepatic Cholangiocarcinoma AJCC v7; Stage IVB Gallbladder Cancer AJCC v7; Stage IVB Hepatocellular Carcinoma AJCC v7; Stage IVB Intrahepatic Cholangiocarcinoma AJCC v7; Unresectable Gallbladder Carcinoma; Unresectable Pancreatic Carcinoma

  13. Distribution of Flunixin Residues in Muscles of Dairy Cattle Dosed with Lipopolysaccharide or Saline and Treated with Flunixin by Intravenous or Intramuscular Injection.

    PubMed

    Shelver, Weilin L; Schneider, Marilyn J; Smith, David J

    2016-12-28

    Twenty dairy cows received flunixin meglumine at 2.2 mg/kg bw, administered once daily by either the intravenous (IV) or intramuscular (IM) route for three consecutive days with either intravenous normal saline (NS) or lipopolysaccharide (LPS) providing a balanced design with five animals per group. Cows were sacrificed after a 4 day withdrawal period, and 13 muscle types were collected and assayed for flunixin by LC-MS/MS. After elimination of sample outliers, the main effects of route of administration (IV or IM), treatment (NS or LPS), and tissue type significantly (P < 0.05) affected flunixin residues, with no interaction (P > 0.05). Intramuscular (nonlabel) flunixin administration produced greater (P < 0.05) flunixin residues in muscle than the IV (label) administration, whereas LPS resulted in lower flunixin levels. Differences among the tissue levels indicate it is necessary to specify the tissue to be used for any monitoring of drug levels for consumer protection.

  14. Nitrogen plasma-treated multilayer graphene-based field effect transistor fabrication and electronic characteristics

    NASA Astrophysics Data System (ADS)

    Su, Wei-Jhih; Chang, Hsuan-Chen; Honda, Shin-ichi; Lin, Pao-Hung; Huang, Ying-Sheng; Lee, Kuei-Yi

    2017-08-01

    Chemical doping with hetero-atoms is an effective method used to change the characteristics of materials. Nitrogen doping technology plays a critical role in regulating the electronic properties of graphene. Nitrogen plasma treatment was used in this work to dope nitrogen atoms to modulate multilayer graphene electrical properties. The measured I-V multilayer graphene-base field-effect transistor characteristics (GFETs) showed a V-shaped transfer curve with the hole and electron region separated from the measured current-voltage (I-V) minimum. GFETs fabricated with multilayer graphene from chemical vapor deposition (CVD) exhibited p-type behavior because of oxygen adsorption. After using different nitrogen plasma treatment times, the minimum in I-V characteristic shifted into the negative gate voltage region with increased nitrogen concentration and the GFET channel became an n-type semiconductor. GFETs could be easily fabricated using this method with potential for various applications. The GFET transfer characteristics could be tuned precisely by adjusting the nitrogen plasma treatment time.

  15. The Legionella pneumophila IcmS-LvgA protein complex is important for Dot/Icm-dependent intracellular growth.

    PubMed

    Vincent, Carr D; Vogel, Joseph P

    2006-08-01

    Many bacterial pathogens require a functional type IV secretion system (T4SS) for virulence. Legionella pneumophila, the causative agent of Legionnaires' disease, employs the Dot/Icm T4SS to inject a large number of protein substrates into its host, thereby altering phagosome trafficking. The L. pneumophila T4SS substrate SdeA has been shown to require the accessory factor IcmS for its export. IcmS, defined as a type IV adaptor, exists as a heterodimer with IcmW and this complex functions in a manner similar to a type III secretion chaperone. Here we report an interaction between IcmS and the previously identified virulence factor LvgA. Similar to the icmS mutant, the lvgA mutant appears to assemble a fully functional Dot/Icm complex. Both LvgA and IcmS are small, acidic proteins localized to the cytoplasm and are not exported by the Dot/Icm system, suggesting they form a novel type IV adaptor complex. Inactivation of lvgA causes a minimal defect in growth in the human monocytic cell line U937 and the environmental host Acanthamoeba castellanii. However, the lvgA mutant was severely attenuated for intracellular growth of L. pneumophila in mouse macrophages, suggesting LvgA may be a critical factor that confers host specificity.

  16. Identification of capsule, biofilm, lateral flagellum, and type IV pili in Vibrio mimicus strains.

    PubMed

    Tercero-Alburo, J J; González-Márquez, H; Bonilla-González, E; Quiñones-Ramírez, E I; Vázquez-Salinas, C

    2014-11-01

    Vibrio mimicus is a bacterium that causes gastroenteritis; it is closely related to Vibrio cholerae, and can cause acute diarrhea like cholera- or dysentery-type diarrhea. It is distributed worldwide. Factors associated with virulence (such as hemolysins, enterotoxins, proteases, phospholipases, aerobactin, and hemagglutinin) have been identified; however, its pathogenicity mechanism is still unknown. In pathogenic Vibrio species such as V. cholerae, Vibrio. parahaemolyticus and Vibrio vulnificus, capsule, biofilms, lateral flagellum, and type IV pili are structures described as essential for pathogenicity. These structures had not been described in V. mimicus until this work. We used 20 V. mimicus strains isolated from water (6), oyster (9), and fish (5) samples and we were able to identify the capsule, biofilm, lateral flagellum, and type IV pili through phenotypic tests, electron microscopy, PCR, and sequencing. In all tested strains, we observed and identified the presence of capsular exopolysaccharide, biofilm formation in an in vitro model, as well as swarming, multiple flagellation, and pili. In addition, we identified homologous genes to those described in other bacteria of the genus in which these structures have been found. Identification of these structures in V. mimicus is a contribution to the biology of this organism and can help to reveal its pathogenic behavior. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Co-ordinated expression of MMP-2 and its putative activator, MT1-MMP, in human placentation.

    PubMed

    Bjørn, S F; Hastrup, N; Lund, L R; Danø, K; Larsen, J F; Pyke, C

    1997-08-01

    The spatial expression of mRNA for matrix metalloproteinase 2 (MMP-2), its putative activator, the membrane-type 1 matrix metalloproteinase (MT1-MMP), and the MMP-2 substrate type IV collagen was investigated in human placentas of both normal and tubal ectopic pregnancies and in cyclic endometrium using in-situ hybridization. Cytokeratin staining applied to adjacent sections was used to identify epithelial and trophoblast cells. In both normal and tubal pregnancies MT1-MMP, MMP-2 and type IV collagen mRNA were highly expressed and co-localized in the extravillous cytotrophoblasts of anchoring villi, in cytotrophoblasts that had penatrated into the placental bed and in cytotrophoblastic cell islands. In addition, the decidual cells of normal pregnancies in some areas co-expressed MT1-MMP and MMP-2 mRNA, with moderate signals for both components. Fibroblast-like stromal cells in tubal pregnancies were positive for MMP-2 mRNA but generally negative for MT1-MMP mRNA. The consistent co-localization of MT1-MMP with MMP-2 and type IV collagen in the same subset of cytotrophoblasts strongly suggests that all three components co-operate in the tightly regulated fetal invasion process. The co-expression of MT1-MMP and MMP-2 mRNA in some of the decidual cells indicates that these cells are also actively involved in the placentation process.

  18. Anatomical variations of the right hepatic veins and their relevance to surgery.

    PubMed

    Hribernik, Marija; de Cecchis, Lucio; Trotovsek, Blaz; Gadzijev, Eldar M; Ravnik, Dean

    2003-01-01

    In a morphological study of the right hepatic veins anatomical characteristics of surgical importance were looked for. 110 cadaveric human livers were prepared by the corrosion casts method. The confluence patterns of the superior right hepatic vein, the hepatocaval confluence, the accessory right hepatic veins and the anastomoses between hepatic veins in the right hemiliver were examined. Four types of the superior right hepatic vein, based on the length of its trunk and the confluence pattern of its main tributaries were determined and their frequency was calculated. Type I was found in 20%, type II in 40%, type III in 25% and type IV in 15%. Accessory right hepatic veins with a minimal caliber of 0.4 cm, which were always present in type IV, were also found in other types, all together in 27% of the casts. The tributary-free part of the superior right hepatic vein at hepatocaval confluence was longer than 1 cm in 77%. In the right hemiliver 109 anastomoses were found in 29/110 liver casts. Knowing the characteristics of different superior right hepatic vein types and of the accessory right hepatic veins may be useful in segment-oriented liver resections and in right side living donor resections.

  19. 29 CFR 70.40 - Charges assessed for the production of records.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... There are three types of charges assessed in connection with the production of records in response to a... materials are exempt (review costs). (b)(1) There are four types of requesters: (i) Commercial use... media, and (iv) All other requesters. (2) Depending upon the type of requester, as set forth in...

  20. 40 CFR 86.1726-99 - Mileage and service accumulation; emission measurements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... of hybrid electric vehicles shall be conducted with the battery pack at the manufacturer's indicated... Type A hybrid electric vehicle, 75,000 miles for a Type B hybrid electric vehicle, and 100,000 miles for a Type C hybrid electric vehicle. (iv) Alternative durability plans may also be used if the...

  1. Vorinostat in Treating Patients With Metastatic or Unresectable Solid Tumors or Lymphoma and Liver Dysfunction

    ClinicalTrials.gov

    2014-02-21

    Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Primary Central Nervous System Hodgkin Lymphoma; Primary Central Nervous System Non-Hodgkin Lymphoma; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Grade III Lymphomatoid Granulomatosis; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage III Adult Burkitt Lymphoma; Stage III Adult Diffuse Large Cell Lymphoma; Stage III Adult Diffuse Mixed Cell Lymphoma; Stage III Adult Diffuse Small Cleaved Cell Lymphoma; Stage III Adult Hodgkin Lymphoma; Stage III Adult Immunoblastic Large Cell Lymphoma; Stage III Adult Lymphoblastic Lymphoma; Stage III Adult T-cell Leukemia/Lymphoma; Stage III Cutaneous T-cell Non-Hodgkin Lymphoma; Stage III Grade 1 Follicular Lymphoma; Stage III Grade 2 Follicular Lymphoma; Stage III Grade 3 Follicular Lymphoma; Stage III Mantle Cell Lymphoma; Stage III Marginal Zone Lymphoma; Stage III Mycosis Fungoides/Sezary Syndrome; Stage III Small Lymphocytic Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Cutaneous T-cell Non-Hodgkin Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IV Marginal Zone Lymphoma; Stage IV Mycosis Fungoides/Sezary Syndrome; Stage IV Small Lymphocytic Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  2. PXD101 and 17-N-Allylamino-17-Demethoxygeldanamycin in Treating Patients With Metastatic or Unresectable Solid Tumors or Lymphoma

    ClinicalTrials.gov

    2013-05-15

    Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Post-transplant Lymphoproliferative Disorder; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Grade III Lymphomatoid Granulomatosis; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage III Adult Burkitt Lymphoma; Stage III Adult Diffuse Large Cell Lymphoma; Stage III Adult Diffuse Mixed Cell Lymphoma; Stage III Adult Diffuse Small Cleaved Cell Lymphoma; Stage III Adult Hodgkin Lymphoma; Stage III Adult Immunoblastic Large Cell Lymphoma; Stage III Adult Lymphoblastic Lymphoma; Stage III Adult T-cell Leukemia/Lymphoma; Stage III Cutaneous T-cell Non-Hodgkin Lymphoma; Stage III Grade 1 Follicular Lymphoma; Stage III Grade 2 Follicular Lymphoma; Stage III Grade 3 Follicular Lymphoma; Stage III Mantle Cell Lymphoma; Stage III Marginal Zone Lymphoma; Stage III Mycosis Fungoides/Sezary Syndrome; Stage III Small Lymphocytic Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Cutaneous T-cell Non-Hodgkin Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IV Marginal Zone Lymphoma; Stage IV Mycosis Fungoides/Sezary Syndrome; Stage IV Small Lymphocytic Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  3. [Physical work capacity of ischemic heart disease patients with various types of hyperlipoproteinemias].

    PubMed

    Zadionchenko, V S; Kopalova, S M

    1980-08-01

    The results of ergometric examination of 316 patients with chronic coronary insufficiency and various types of hyperlipoproteinemia have shown a clear diminution of physical working capacity in patients with hyperlipidemia as compared to patients with hyperlipidemia as compared to patients in whom the lipid content is within normal values. Working capacity was most diminished in IIa and particularly IIb types of hyperlipoproteinemia; in type IV physical working capacity was not reduced. The effect of hyperlipoproteinemia is most significant in the mildest degree of coronary insufficiency, but reduces or vanishes completely with increasing severity of the disease. An inverse relationship has been established between the value of physical working capacity and the level of cholesterol and beta-lipoproteins and a direct relationship in regard to NEFA concentration. Ergometry in patients with type II hyperlipoproteinemia showed that as compared to patients with normolipemia and type IV hyperlipoproteinemia an equal degree in the severity of the disease, the frequency and marked character of changes on the ECG increase; this evidences a more marked transitory myocardial ischemia.

  4. Blood plasma apolipoproteins A-I and B in different types of hyperlipoproteinaemia: comparative analysis of population groups in Moscow and Prague.

    PubMed

    Metel'skaya, V A; Ceska, R; Perova, N V; Sobra, J

    1988-01-01

    The level of blood plasma apolipoproteins A-I and B was studied in Moscow and Prague residents with different types of hyperlipoproteinaemia (HLP). The analysis proceeded in two directions. On the one hand, lipoprotein (LP) spectra in residents of both cities with the same type of LP disturbance (HLP type IIa, IIb or IV) were compared; in Prague lipid and apolipoprotein content was compared in inhabitants with a normal lipid level and those with HLP types I, III and V. The analysis showed that inhabitants of Prague with types II and IV HLP have a higher concentrations of high density LP cholesterol. At the same time, it was found that the apolipoprotein profile of blood plasma LP in HLP patients was similar to that in patients living elsewhere. The authors regard comparative study of LP system disturbances in residents of different cities and countries differing in their geographical, ethnic and ecological conditions as a promising approach to understanding the mechanisms responsible for the development of HLP.

  5. Neutralization Serotyping of BK Polyomavirus Infection in Kidney Transplant Recipients

    PubMed Central

    Pastrana, Diana V.; Brennan, Daniel C.; Çuburu, Nicolas; Storch, Gregory A.; Viscidi, Raphael P.; Randhawa, Parmjeet S.; Buck, Christopher B.

    2012-01-01

    BK polyomavirus (BKV or BKPyV) associated nephropathy affects up to 10% of kidney transplant recipients (KTRs). BKV isolates are categorized into four genotypes. It is currently unclear whether the four genotypes are also serotypes. To address this issue, we developed high-throughput serological assays based on antibody-mediated neutralization of BKV genotype I and IV reporter vectors (pseudoviruses). Neutralization-based testing of sera from mice immunized with BKV-I or BKV-IV virus-like particles (VLPs) or sera from naturally infected human subjects revealed that BKV-I specific serum antibodies are poorly neutralizing against BKV-IV and vice versa. The fact that BKV-I and BKV-IV are distinct serotypes was less evident in traditional VLP-based ELISAs. BKV-I and BKV-IV neutralization assays were used to examine BKV type-specific neutralizing antibody responses in KTRs at various time points after transplantation. At study entry, sera from 5% and 49% of KTRs showed no detectable neutralizing activity for BKV-I or BKV-IV neutralization, respectively. By one year after transplantation, all KTRs were neutralization seropositive for BKV-I, and 43% of the initially BKV-IV seronegative subjects showed evidence of acute seroconversion for BKV-IV neutralization. The results suggest a model in which BKV-IV-specific seroconversion reflects a de novo BKV-IV infection in KTRs who initially lack protective antibody responses capable of neutralizing genotype IV BKVs. If this model is correct, it suggests that pre-vaccinating prospective KTRs with a multivalent VLP-based vaccine against all BKV serotypes, or administration of BKV-neutralizing antibodies, might offer protection against graft loss or dysfunction due to BKV associated nephropathy. PMID:22511874

  6. Opioid use in knee arthroplasty after receiving intravenous acetaminophen.

    PubMed

    Kelly, Jennifer S; Opsha, Yekaterina; Costello, Jennifer; Schiller, Daryl; Hola, Eric T

    2014-12-01

    Intravenous (IV) acetaminophen may be an effective component of multimodal postoperative pain management. The primary objective of this study was to evaluate the impact of IV acetaminophen on total opioid use in postoperative patients. The secondary objective was to evaluate the effect of IV acetaminophen on hospital length of stay. This retrospective, case-control study evaluated the impact of IV acetaminophen on total opioid use in surgical patients. Patients were included if they received at least one perioperative dose of IV acetaminophen and underwent a surgical knee procedure. Controls were matched and randomly selected based on procedure type, age, and severity of illness. Postoperative opioids were converted into oral morphine equivalents, and overall use was compared between groups. One hundred patients were enrolled, with 25 patients receiving IV acetaminophen and 75 matched controls. A total of 135 mg versus 112.5 mg oral morphine equivalents were used in the IV acetaminophen group and control group, respectively (p=0.987). There were 45 mg/day oral morphine equivalents used in the IV acetaminophen group versus 37.5 mg in the control group (p=0.845). The median hospital length of stay in both groups was 3 days (p=0.799). IV acetaminophen did not significantly decrease postoperative opioid use in patients who underwent surgical knee procedures. In addition, there was a nonsignificant trend toward increased opioid use in the IV acetaminophen group. There was no significant difference in hospital length of stay between the IV acetaminophen group and the control group. These findings require further study in larger patient populations and in other orthopedic procedures that typically require longer hospital stays. © 2014 Pharmacotherapy Publications, Inc.

  7. RNA polymerases IV and V influence the 3' boundaries of Polymerase II transcription units in Arabidopsis.

    PubMed

    McKinlay, Anastasia; Podicheti, Ram; Wendte, Jered M; Cocklin, Ross; Rusch, Douglas B

    2018-02-01

    Nuclear multisubunit RNA polymerases IV and V (Pol IV and Pol V) evolved in plants as specialized forms of Pol II. Their functions are best understood in the context of RNA-directed DNA methylation (RdDM), a process in which Pol IV-dependent 24 nt siRNAs direct the de novo cytosine methylation of regions transcribed by Pol V. Pol V has additional functions, independent of Pol IV and 24 nt siRNA biogenesis, in maintaining the repression of transposons and genomic repeats whose silencing depends on maintenance cytosine methylation. Here we report that Pol IV and Pol V play unexpected roles in defining the 3' boundaries of Pol II transcription units. Nuclear run-on assays reveal that in the absence of Pol IV or Pol V, Pol II occupancy downstream of poly A sites increases for approximately 12% of protein-coding genes. This effect is most pronounced for convergently transcribed gene pairs. Although Pols IV and V are detected near transcript ends of the affected Pol II - transcribed genes, their role in limiting Pol II read-through is independent of siRNA biogenesis or cytosine methylation for the majority of these genes. Interestingly, we observed that splicing was less efficient in pol IV or pol V mutant plants, compared to wild-type plants, suggesting that Pol IV or Pol V might affect pre-mRNA processing. We speculate that Pols IV and V (and/or their associated factors) play roles in Pol II transcription termination and pre-mRNA splicing by influencing polymerase elongation rates and/or release at collision sites for convergent genes.

  8. Double-trap model for hysteretic current-voltage characteristics of a polystyrene/ZnO nanorods stacked layer

    NASA Astrophysics Data System (ADS)

    Wu, You-Lin; Lin, Jing-Jenn; Lin, Shih-Hung; Sung, Yi-Hsing

    2017-11-01

    Hysteretic current-voltage (I-V) characteristics are quite common in metal-insulator-metal (MIM) devices used for resistive switching random access memory (RRAM). Two types of hysteretic I-V curves are usually observed, figure eight and counter figure eight (counter-clockwise and clockwise in the positive voltage sweep direction, respectively). In this work, a clockwise hysteretic I-V curve was found for an MIM device with polystyrene (PS)/ZnO nanorods stack as an insulator layer. Three distinct regions I ∼ V, I ∼ V2, and I ∼ V0.6 are observed in the double logarithmic plot of the I-V curves, which cannot be explained completely with the conventional trap-controlled space-charge-limited-current (SCLC) model. A model based on the energy band with two separate traps plus local energy variation and trap-controlled SCLC has been developed, which can successfully describe the behavior of the clockwise hysteretic I-V characteristics obtained in this work.

  9. Assessment of ASTM D 6690-12 type II and type IV joint sealers.

    DOT National Transportation Integrated Search

    2014-11-01

    To address the issue of water infiltration and debris retention, bi : tuminous crack sealers and fillers have been : developed to help prevent premature pavement distress. If applied appropriately, crack sealers and fillers can : significantly extend...

  10. Organic metamorphism in the California petroleum basins; Chapter A, Rock-Eval and vitrinite reflectance

    USGS Publications Warehouse

    Price, Leigh C.; Pawlewicz, Mark J.; Daws, Ted A.

    1999-01-01

    The results of ROCK-EVAL and vitrinite reflectance analyses of a large sample base from more than 70 wells located in three oil-rich California petroleum basins are reported. The cores from these wells have a wide range of present-day burial temperatures (40 ? to 220 ? C). The rocks in these basins were deposited under highly variable conditions, sometimes resulting in substantially different organic matter (OM) types in rocks tens of meters vertically apart from each other in one well. The kinetic response of these different OM types to equivalent wellknown burial histories is a pivotal point of this study. In the Los Angeles and Ventura Basins, rock organic-richness significantly increased with depth, as did kerogen hydrogen content, and the percentage of fine-grained versus coarsegrained rocks. The shales in these basins are perceived as containing primarily hydrogen-rich amorphous OM. In actuality, the shallowest 2,000 to 3,000 m of rocks in the basins, and at least the upper 6,000 m of rocks in parts of the Los Angeles Basin central syncline, are dominated by type III/IV OM. In the Los Angeles Basin, mainstage hydrocarbon (HC) generation commences in the type III/IV OM at present-day burial temperatures of 85 ? to 110 ? C, most likely around 100 ? C, and is largely complete by 220 ? C. In the Southern San Joaquin Valley Basin, mainstage HC generation commences in type III/IV OM at 150 ? C and is also largely complete by 220 ? C. In the Ventura Basin, mainstage HC generation commences above 140 ? C in type III/IV OM. The apparent lower temperatures for commencement of HC generation in the Los Angeles Basin are attributed to the fact that parts of the basin were cooled from maximal burial temperatures by increased meteoric water flows during the last glaciations. All aspects of organic metamorphism, including mainstage HC generation, are strongly suppressed in rocks with hydrogenrich OM in these basins. For example, ROCK-EVAL data suggest that mainstage HC generation has not commenced in rocks with hydrogen-rich OM at present-day temperatures of 198?C. This observation is attributed to much stronger bonds in hydrogen- rich OM compared to types III and IV OM and, therefore, significantly higher burial temperatures are required to break these bonds. This difference in OM kinetics has profound ramifications for petroleum-geochemical exploration models. Organic-matter characteristics inherited from original depositional conditions were overlaid on, and at times confused interpretation of, characteristics from organic metamorphism in all study areas. In all the basins examined in this study, immature fine-grained rocks occasionally had high to very high carbon-normalized concentrations of pre-generation indigenous bitumen. This unusual characteristic may be due to unique depositional conditions in these basins.

  11. Stellar Laboratories II. New Zn Iv and Zn v Oscillator Strengths and Their Validation in the Hot White Dwarfs G191-B2B and RE0503-289

    NASA Technical Reports Server (NTRS)

    Rauch, T.; Werner, K.; Quinet, P.; Kruk, J. W.

    2014-01-01

    Context. For the spectral analysis of high-resolution and high-signal-to-noise (SN) spectra of hot stars, state-of-the-art non-local thermodynamic equilibrium (NLTE) model atmospheres are mandatory. These are strongly dependent on the reliability of the atomic data that is used for their calculation. In a recent analysis of the ultraviolet (UV) spectrum of the DA-type white dwarf G191B2B,21 Zn iv lines were newly identified. Because of the lack of Zn iv data, transition probabilities of the isoelectronic Ge vi were adapted for a first, coarse determination of the photospheric Zn abundance.Aims. Reliable Zn iv and Zn v oscillator strengths are used to improve the Zn abundance determination and to identify more Zn lines in the spectra of G191B2B and the DO-type white dwarf RE 0503289. Methods. We performed new calculations of Zn iv and Zn v oscillator strengths to consider their radiative and collisional bound-bound transitions in detail in our NLTE stellar-atmosphere models for the analysis of the Zn iv v spectrum exhibited in high-resolution and high-SN UV observations of G191B2B and RE 0503289. Results. In the UV spectrum of G191B2B, we identify 31 Zn iv and 16 Zn v lines. Most of these are identified for the first time in any star. We can reproduce well almost all of them at log Zn 5.52 0.2 (mass fraction, about 1.7 times solar). In particular, the Zn iv Zn v ionization equilibrium, which is a very sensitive Teff indicator, is well reproduced with the previously determined Teff 60 000 2000 K and log g 7.60 0.05. In the spectrum of RE 0503289, we identified 128 Zn v lines for the first time and determined log Zn 3.57 0.2 (155 times solar). Conclusions. Reliable measurements and calculations of atomic data are a pre-requisite for stellar-atmosphere modeling. Observed Zn iv and Zn v line profiles in two white dwarf (G191B2B and RE 0503289) ultraviolet spectra were well reproduced with our newly calculated oscillator strengths. This allowed us to determine the photospheric Zn abundance of these two stars precisely.

  12. Equipoise among recanalization strategies.

    PubMed

    Tomsick, T A; Khatri, P; Jovin, T; Demaerschalk, B; Malisch, T; Demchuk, A; Hill, M D; Jauch, E; Spilker, J; Broderick, J P

    2010-03-30

    Modern acute ischemic stroke therapy is based on the premise that recanalization and subsequent reperfusion are essential for the preservation of brain tissue and favorable clinical outcomes. We outline key issues that we think underlie equipoise regarding the comparative clinical efficacy of IV recombinant tissue-type plasminogen activator (rt-PA) and intra-arterial (IA) reperfusion therapies for acute ischemic stroke. On the one hand, IV rt-PA therapy has the benefit of speed with presumed lower rates of recanalization of large artery occlusions as compared to IA methods. More recent reports of major arterial occlusions treated with IV rt-PA, as measured by transcranial Doppler and magnetic resonance angiography, demonstrate higher rates of recanalization. Conversely, IA therapies report higher recanalization rates, but are hampered by procedural delays and risks, even failing to be applied at all in occasional patients where time to reperfusion remains a critical factor. Higher rates of recanalization in IA trials using clot-removal devices have not translated into improved patient functional outcome as compared to trials of IV therapy. Combined IV-IA therapy promises to offer advantages of both, but perhaps only when applied in the timeliest of fashions, compared to IV therapy alone. Where equipoise exists, randomizing subjects to either IV rt-PA therapy or IV therapy followed by IA intervention, while incorporating new interventions into the study design, is a rational and appropriate research approach.

  13. Preparation of graphene oxide-manganese dioxide for highly efficient adsorption and separation of Th(IV)/U(VI).

    PubMed

    Pan, Ning; Li, Long; Ding, Jie; Li, Shengke; Wang, Ruibing; Jin, Yongdong; Wang, Xiangke; Xia, Chuanqin

    2016-05-15

    Manganese dioxide decorated graphene oxide (GOM) was prepared via fixation of crystallographic MnO2 (α, γ) on the surface of graphene oxide (GO) and was explored as an adsorbent material for simultaneous removal of thorium/uranium ions from aqueous solutions. In single component systems (Th(IV) or U(VI)), the α-GOM2 (the weight ratio of GO/α-MnO2 of 2) exhibited higher maximum adsorption capacities toward both Th(IV) (497.5mg/g) and U(VI) (185.2 mg/g) than those of GO. In the binary component system (Th(IV)/U(VI)), the saturated adsorption capacity of Th(IV) (408.8 mg/g)/U(VI) (66.8 mg/g) on α-GOM2 was also higher than those on GO. Based on the analysis of various data, it was proposed that the adsorption process may involve four types of molecular interactions including coordination, electrostatic interaction, cation-pi interaction, and Lewis acid-base interaction between Th(IV)/U(VI) and α-GOM2. Finally, the Th(IV)/U(VI) ions on α-GOM2 can be separated by a two-stage desorption process with Na2CO3/EDTA. Those results displayed that the α-GOM2 may be utilized as an potential adsorbent for removing and separating Th(IV)/U(VI) ions from aqueous solutions. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Two transitional type Ia supernovae located in the Fornax cluster member NGC 1404: SN 2007on and SN 2011iv

    NASA Astrophysics Data System (ADS)

    Gall, C.; Stritzinger, M. D.; Ashall, C.; Baron, E.; Burns, C. R.; Hoeflich, P.; Hsiao, E. Y.; Mazzali, P. A.; Phillips, M. M.; Filippenko, A. V.; Anderson, J. P.; Benetti, S.; Brown, P. J.; Campillay, A.; Challis, P.; Contreras, C.; Elias de la Rosa, N.; Folatelli, G.; Foley, R. J.; Fraser, M.; Holmbo, S.; Marion, G. H.; Morrell, N.; Pan, Y.-C.; Pignata, G.; Suntzeff, N. B.; Taddia, F.; Robledo, S. Torres; Valenti, S.

    2018-03-01

    We present an analysis of ultraviolet (UV) to near-infrared observations of the fast-declining Type Ia supernovae (SNe Ia) 2007on and 2011iv, hosted by the Fornax cluster member NGC 1404. The B-band light curves of SN 2007on and SN 2011iv are characterised by Δm15 (B) decline-rate values of 1.96 mag and 1.77 mag, respectively. Although they have similar decline rates, their peak B- and H-band magnitudes differ by 0.60 mag and 0.35 mag, respectively. After correcting for the luminosity vs. decline rate and the luminosity vs. colour relations, the peak B-band and H-band light curves provide distances that differ by 14% and 9%, respectively. These findings serve as a cautionary tale for the use of transitional SNe Ia located in early-type hosts in the quest to measure cosmological parameters. Interestingly, even though SN 2011iv is brighter and bluer at early times, by three weeks past maximum and extending over several months, its B - V colour is 0.12 mag redder than that of SN 2007on. To reconcile this unusual behaviour, we turn to guidance from a suite of spherical one-dimensional Chandrasekhar-mass delayed-detonation explosion models. In this context, 56Ni production depends on both the so-called transition density and the central density of the progenitor white dwarf. To first order, the transition density drives the luminosity-width relation, while the central density is an important second-order parameter. Within this context, the differences in the B - V colour evolution along the Lira regime suggest that the progenitor of SN 2011iv had a higher central density than SN 2007on. The photometry tables are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/611/A58

  15. Differences in clinical and molecular characteristics of skin and soft tissue methicillin-resistant Staphylococcus aureus isolates between two hospitals in Northern California.

    PubMed

    Bhattacharya, Debika; Carleton, Heather; Tsai, Chiaojung J; Baron, Ellen Jo; Perdreau-Remington, Françoise

    2007-06-01

    Community-onset methicillin-resistant Staphylococcus aureus (CO-MRSA) skin and soft tissue infections (SSTI) are associated with SCCmec IV and Panton-Valentine leukocidin (PVL) genes. CO-MRSA epidemiologic studies suggest that genotypic variation exists within one geographic region. We compared MRSA genotypes and demographic and clinical characteristics of patients with CO-MRSA SSTI between two regional medical centers. We also examined factors associated with SCCmec IV and PVL carriage. A total of 279 MRSA SSTI isolates from 2000 to 2002 at San Francisco General Hospital (SFGH) and Stanford University Hospital (SUH) were genotyped by pulsed-field gel electrophoresis and PCR for SCCmec and PVL genes. Medical records were reviewed for clinical characteristics. Ninety-three percent and 69% of MRSA SSTI were caused by CO-MRSA at SFGH and SUH, respectively. Patients with CO-MRSA SSTI at SFGH were more likely to be nonwhite, younger, homeless, and have no previous exposure to health care (P < 0.01). SFGH CO-MRSA strains were more likely to carry SCCmec type IV and PVL genes (90% and 55%, respectively) than SUH strains (29% and 16%, respectively). In multivariate analyses, nonwhite ethnicity was associated with both SCCmec type IV and PVL carriage (odds ratio [OR] of 2.65 and 95% confidence interval [CI] of 1.19 to 5.95 and OR of 1.94 and 95% CI of 1.03 to 3.65, respectively). ST8:USA300:IV became the dominant clone at SFGH, but not at SUH, by 2002. Despite geographic proximity, CO-MRSA SSTI exhibited differing SCCmec types, PVL carriage, and clonal dynamics. CO-MRSA SSTI at SUH were more likely to represent feral isolates of nosocomial origin. Clinicians should assess for nosocomial and community risk factors, realizing that different populations with CO-MRSA SSTI may require separate antimicrobial strategies.

  16. An overview of intravenous-related medication administration errors as reported to MEDMARX, a national medication error-reporting program.

    PubMed

    Hicks, Rodney W; Becker, Shawn C

    2006-01-01

    Medication errors can be harmful, especially if they involve the intravenous (IV) route of administration. A mixed-methodology study using a 5-year review of 73,769 IV-related medication errors from a national medication error reporting program indicates that between 3% and 5% of these errors were harmful. The leading type of error was omission, and the leading cause of error involved clinician performance deficit. Using content analysis, three themes-product shortage, calculation errors, and tubing interconnectivity-emerge and appear to predispose patients to harm. Nurses often participate in IV therapy, and these findings have implications for practice and patient safety. Voluntary medication error-reporting programs afford an opportunity to improve patient care and to further understanding about the nature of IV-related medication errors.

  17. Non-aggregated axially disubstituted silicon phthalocyanines bearing electropolymerizable ligands and their aggregation, electropolymerizaton and thermal properties.

    PubMed

    Biyiklioglu, Zekeriya; Bas, Huseyin; Alp, Hakan

    2015-08-21

    A novel series of axially disubstituted silicon(iv) phthalocyanines bearing electropolymerizable ligands were designed and synthesized for the first time. The silicon(iv) phthalocyanines were characterized by various spectroscopic techniques as well as elemental analysis. The aggregation behavior of the SiPcs were examined in different solvents and at different concentrations in chloroform. In all the studied solvents and concentrations, the SiPcs were non-aggregated. The thermal behavior of the silicon(iv) phthalocyanines was also studied. The electropolymerization properties of the silicon(iv) phthalocyanines were investigated by cyclic and square wave voltammetry. This study is the first example of the electropolymerization of axially disubstituted silicon phthalocyanines. The type of axial ligand on the phthalocyanine ring did not show any effect on the absorption and thermal properties but influenced the electropolymerization of the phthalocyanines.

  18. Managing type II and type IV Lauge-Hansen supination external rotation ankle fractures: current orthopaedic practice.

    PubMed

    Kosuge, D D; Mahadevan, D; Chandrasenan, J; Pugh, H

    2010-11-01

    Differentiating supination external rotation (SER) type II and IV ankle injuries is challenging in the absence of a medial malleolar fracture or talar shift on radiographs. The accurate differentiation between a stable SER-II from an unstable SER-IV injury would allow implementation of the appropriate management plan from diagnosis. The aim of this study was to ascertain the practice of orthopaedic surgeons in dealing with these injuries. A postal survey was undertaken on 216 orthopaedic consultants from three regions. In the presence of medial-sided clinical signs (tenderness, swelling, ecchymosis), 22% of consultants would perform surgical fixation. 53% would choose non-operative treatment and the majority would monitor these fractures through serial radiographs. The remaining 25% of consultants would perform an examination under anaesthesia (EUA; 15%), request stress radiographs (9%) or an MRI scan (1%). Without medial-sided signs, 85% would advocate non-operative treatment and, of these, 74% would perform weekly radiographs. Interestingly, 6% would perform immediate surgical fixation. Stress radiographs (6%) and EUAs (2%) were advocated in the remaining group of consultants. Foot and ankle surgeons utilised stress radiographs more frequently and were more likely to proceed to surgical fixation should talar shift be demonstrated. Clinical practice is varied amongst the orthopaedic community. This may lead to unnecessary surgery in SER-II injuries and delay in diagnosis and operative management of SER-IV injuries. We have highlighted the various investigative modalities available that may be used in conjunction with clinical signs to make a more accurate diagnosis.

  19. Effects of the combination of a dipeptidyl peptidase IV inhibitor and an insulin secretagogue on glucose and insulin levels in mice and rats.

    PubMed

    Yamazaki, Kazuto; Yasuda, Nobuyuki; Inoue, Takashi; Yamamoto, Eiichi; Sugaya, Yukiko; Nagakura, Tadashi; Shinoda, Masanobu; Clark, Richard; Saeki, Takao; Tanaka, Isao

    2007-02-01

    Several combination therapies have been tried for treating of type 2 diabetes to control more effectively fasting hyperglycemia and postprandial hyperglycemia. In this study, we have examined the effects of combining a novel, selective, and competitive dipeptidyl peptidase IV (DPP-IV) inhibitor, 3-but-2-ynyl-5-methyl-2-piperazin-1-yl-3,5-dihydro-4H-imidazo[4,5-d]pyridazin-4-one tosylate (E3024), with a representative of one of two types of insulin secretagogues, i.e., either glybenclamide (a sulfonylurea) or nateglinide (a rapid-onset/short-duration insulin secretagogue), on glucose and insulin levels in an oral glucose tolerance test (OGTT) using mice fed a high-fat diet. In addition, we have investigated the effects of these combinations on blood glucose levels in fasting rats. Two-way analysis of variance showed that the combination of E3024 and glybenclamide improved glucose tolerance additively and also caused a synergistic increase in insulin levels in the OGTT in mice fed a high-fat diet. In a similar way, the combination of E3024 and nateglinide ameliorated glucose tolerance additively and raised insulin levels additively. In fasting rats, coadministration of E3024 with glybenclamide or nateglinide treatment did not affect the glucose-lowering effects of the insulin secretagogues. Therefore, a DPP-IV inhibitor in combination with glybenclamide or nateglinide may be a promising option for the treatment of type 2 diabetes, and particularly, for controlling postprandial hyperglycemia in the clinic.

  20. Discovery of ((4R,5S)-5-amino-4-(2,4,5- trifluorophenyl)cyclohex-1-enyl)-(3- (trifluoromethyl)-5,6-dihydro- [1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl)methanone (ABT-341), a highly potent, selective, orally efficacious, and safe dipeptidyl peptidase IV inhibitor for the treatment of type 2 diabetes.

    PubMed

    Pei, Zhonghua; Li, Xiaofeng; von Geldern, Thomas W; Madar, David J; Longenecker, Kenton; Yong, Hong; Lubben, Thomas H; Stewart, Kent D; Zinker, Bradley A; Backes, Bradley J; Judd, Andrew S; Mulhern, Mathew; Ballaron, Stephen J; Stashko, Michael A; Mika, Amanda K; Beno, David W A; Reinhart, Glenn A; Fryer, Ryan M; Preusser, Lee C; Kempf-Grote, Anita J; Sham, Hing L; Trevillyan, James M

    2006-11-02

    Dipeptidyl peptidase IV (DPP4) deactivates glucose-regulating hormones such as GLP-1 and GIP, thus, DPP4 inhibition has become a useful therapy for type 2 diabetes. Optimization of the high-throughput screening lead 6 led to the discovery of 25 (ABT-341), a highly potent, selective, and orally bioavailable DPP4 inhibitor. When dosed orally, 25 dose-dependently reduced glucose excursion in ZDF rats. Amide 25 is safe in a battery of in vitro and in vivo tests and may represent a new therapeutic agent for the treatment of type 2 diabetes.

  1. 49 CFR 224.5 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ..., as where a layer of paint or dense chemical residue blocks all incoming light); this term does not... of American Railroads. Unqualified Retroreflective Sheeting means engineering grade sheeting, super engineering grade sheeting (enclosed lens) or high-intensity type sheeting (ASTM Type I, II, III, or IV...

  2. A plant based protective antigen [PA(dIV)] vaccine expressed in chloroplasts demonstrates protective immunity in mice against anthrax.

    PubMed

    Gorantala, Jyotsna; Grover, Sonam; Goel, Divya; Rahi, Amit; Jayadev Magani, Sri Krishna; Chandra, Subhash; Bhatnagar, Rakesh

    2011-06-15

    The currently available anthrax vaccines are limited by being incompletely characterized, potentially reactogenic and have an expanded dosage schedule. Plant based vaccines offer safe alternative for vaccine production. In the present study, we expressed domain IV of Bacillus anthracis protective antigen gene [PA(dIV)] in planta (by nuclear agrobacterium and chloroplast transformation) and E. coli [rPA(dIV)]. The presence of transgene and the expression of PA(dIV) in planta was confirmed by molecular analysis. Expression levels up to 5.3% of total soluble protein (TSP) were obtained with AT rich (71.8% AT content) PA(dIV) gene in transplastomic plants while 0.8% of TSP was obtained in nuclear transformants. Further, we investigated the protective response of plant and E. coli derived PA(dIV) in mice by intraperitoneal (i.p.) and oral immunizations with or without adjuvant. Antibody titers of >10(4) were induced upon i.p. and oral immunizations with plant derived PA(dIV) and oral immunization with E. coli derived PA(dIV). Intraperitoneal injections with adjuvanted E. coli derived PA(dIV), generated highest antibody titers of >10(5). All the immunized groups demonstrated predominant IgG1 titers over IgG2a indicating a polarized Th2 type response. We also evaluated the mucosal antibody response in orally immunized groups. When fecal extracts were analyzed, low sIgA titer was demonstrated in adjuvanted plant and E. coli derived PA(dIV) groups. Further, PA(dIV) antisera enhanced B. anthracis spore uptake by macrophages in vitro and also demonstrated an anti-germinating effect suggesting a potent role at mucosal surfaces. The antibodies from various groups were efficient in neutralizing the lethal toxin in vitro. When mice were challenged with B. anthracis, mice immunized with adjuvanted plant PA(dIV) imparted 60% and 40% protection while E. coli derived PA(dIV) conferred 100% and 80% protection upon i.p. and oral immunizations. Thus, our study is the first attempt in highlighting the efficacy of plant expressed PA(dIV) by oral immunization in murine model. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. (3,3-Difluoro-pyrrolidin-1-yl)-[(2S,4S)-(4-(4-pyrimidin-2-yl-piperazin-1-yl)-pyrrolidin-2-yl]-methanone: A potent, selective, orally active dipeptidyl peptidase IV inhibitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ammirati, Mark J.; Andrews, Kim M.; Boyer, David D.

    2010-10-01

    A series of 4-substituted proline amides was synthesized and evaluated as inhibitors of dipeptidyl pepdidase IV for the treatment of type 2 diabetes. (3,3-Difluoro-pyrrolidin-1-yl)-[(2S,4S)-(4-(4-pyrimidin-2-yl-piperazin-1-yl)-pyrrolidin-2-yl]-methanone (5) emerged as a potent (IC{sub 50} = 13 nM) and selective compound, with high oral bioavailability in preclinical species and low plasma protein binding. Compound 5, PF-00734200, was selected for development as a potential new treatment for type 2 diabetes.

  4. Translocation of Helicobacter pylori CagA into Gastric Epithelial Cells by Type IV Secretion

    NASA Astrophysics Data System (ADS)

    Odenbreit, Stefan; Püls, Jürgen; Sedlmaier, Bettina; Gerland, Elke; Fischer, Wolfgang; Haas, Rainer

    2000-02-01

    The Gram-negative bacterium Helicobacter pylori is a causative agent of gastritis and peptic ulcer disease in humans. Strains producing the CagA antigen (cagA+) induce strong gastric inflammation and are strongly associated with gastric adenocarcinoma and MALT lymphoma. We show here that such strains translocate the bacterial protein CagA into gastric epithelial cells by a type IV secretion system, encoded by the cag pathogenicity island. CagA is tyrosine-phosphorylated and induces changes in the tyrosine phosphorylation state of distinct cellular proteins. Modulation of host cells by bacterial protein translocation adds a new dimension to the chronic Helicobacter infection with yet unknown consequences.

  5. Evaluation of magnifying colonoscopy in the diagnosis of serrated polyps.

    PubMed

    Ishigooka, Shinya; Nomoto, Masahito; Obinata, Nobuyuki; Oishi, Yoshichika; Sato, Yoshinori; Nakatsu, Satoko; Suzuki, Midori; Ikeda, Yoshiko; Maehata, Tadateru; Kimura, Tomoaki; Watanabe, Yoshiyuki; Nakajima, Takashi; Yamano, Hiro-o; Yasuda, Hiroshi; Itoh, Fumio

    2012-08-28

    To elucidate the colonoscopic features of serrated lesions of the colorectum using magnifying colonoscopy. Broad division of serrated lesions of the colorectum into hyperplastic polyps (HPs), traditional serrated adenomas (TSAs), and sessile serrated adenomas/polyps (SSA/Ps) has been proposed on the basis of recent molecular biological studies. However, few reports have examined the colonoscopic features of these divisions, including magnified colonoscopic findings. This study examined 118 lesions excised in our hospital as suspected serrated lesions after magnified observation between January 2008 and September 2011. Patient characteristics (sex, age), conventional colonoscopic findings (location, size, morphology, color, mucin) and magnified colonoscopic findings (pit pattern diagnosis) were interpreted by five colonoscopists with experience in over 1000 colonoscopies, and were compared with histopathological diagnoses. The pit patterns were categorized according to Kudo's classification, but a more detailed investigation was also performed using the subclassification [type II-Open (type II-O), type II-Long (type II-L), or type IV-Serrated (type IV-S)] proposed by Kimura T and Yamano H. Lesions comprised 23 HPs (23/118: 19.5%), 39 TSAs (39/118: 33.1%: with cancer in one case), 50 SSA/Ps (50/118: 42.4%: complicated with cancer in three cases), and six others (6/118: 5.1%). We excluded six others, including three regular adenomas, one hamartoma, one inflammatory polyp, and one juvenile polyp for further analysis. Conventional colonoscopy showed that SSA/Ps were characterized as larger in diameter than TSAs and HPs (SSA/P vs HP, 13.62 ± 8.62 mm vs 7.74 ± 3.24 mm, P < 0.001; SSA/Ps vs TSA, 13.62 ± 8.62 mm vs 9.89 ± 5.73 mm, P < 0.01); common in the right side of the colon [HPs, 30.4% (7/23): TSAs, 20.5% (8/39): SSA/P, 84.0% (42/50), P < 0.001]; flat-elevated lesion [HPs, 30.4% (7/23): TSAs, 5.1% (2/39): SSA/Ps, 90.0% (45/50), P < 0.001]; normal-colored or pale imucosa [HPs, 34.8% (8/23): TSAs, 10.3% (4/39): SSA/Ps, 80% (40/50), P < 0.001]; and with large amounts of mucin [HPs, 21.7% (5/23): TSAs, 17.9% (7/39): SSA/Ps, 72.0% (36/50), P < 0.001]. In magnified colonoscopic findings, 17 lesions showed either type II pit pattern alone or partial type II pit pattern as the basic architecture, with 14 HPs (14/17, 70.0%) and 3 SSA/Ps. Magnified colonoscopy showed the type II-O pit pattern as characteristic of SSA/Ps [sensitivity 83.7% (41/49), specificity 85.7% (54/63)]. Cancer was also present in three lesions, in all of which a type VI pit pattern was also present within the same lesion. There were four HPs and four TSAs each. The type IV-S pit pattern was characteristic of TSAs [sensitivity 96.7% (30/31), specificity 89.9% (72/81)]. Cancer was present in one lesion, in which a type VI pit pattern was also present within the same lesion. In our study, serrated lesions of the colorectum also possessed the features described in previous reports of conventional colonoscopic findings. The pit pattern diagnosis using magnifying colonoscopy, particularly magnified colonoscopic findings using subclassifications of surface architecture, reflected the pathological characteristics of SSA/Ps and TSAs, and will be useful for colonoscopic diagnosis. We suggest that this system could be a good diagnostic tool for SSA/Ps using magnifying colonoscopy.

  6. [APPLICATION AND EFFECTIVENESS OF BIOLOGICAL TYPE ACETABULAR CUP IN ADULT Crowe TYPE IV DEVELOPMENTAL DYSPLASIA OF THE HIP].

    PubMed

    Xu, Ning; Sun, Junying; Zhao, Xijiang; Wang, Tao

    2016-01-01

    To investigate the application and effectiveness of the biological type acetabular cup(diameter < 44 mm) in adult Crowe type IV developmental dysplasia of the hip (DDH). Between April 2001 andAugust 2013, biological type acetabular cup was used in total hip arthroplasty for the treatment of Crowe type IV DDH in16 cases (20 hips). There were 3 males and 13 females, aged 31-69 years (mean, 49 years). Unilateral hip was involved in 12cases, and bilateral hips in 4 cases. The patients showed pain of the hip joint and inequality of lower limb (shortening ofaffected limb 1.8-6.0 cm in length, 3.5 cm on average). Acetabular deformity, the relationship and the severity of femoralhead dislocation were comfirmed on the X-ray films. The preoperative Harris score was 34.0 ± 6.9. All patientsachieved healing of incision by first intention, with no complication of infection or neurovascular injury. Sixteen caseswere followed up 4-12 years (mean, 7.5 years). At 2 weeks after operation, dislocation occurred in 2 cases, and were fixedwith plaster for 3 weeks after reduction of the hip. Postoperative X-ray films showed complete reduction of femoral head;the average acetabular coverage of the cup of the weight-bearing area was 98.5% (range, 98.2%-99.1%). The cup from theRanawat triangle was 4.6-7.0 mm (mean, 5.8 mm) in medial shifting, and was 4.5-7.9 mm (mean, 6.2 mm) in elevation,it located at cup lateral surface area inside the iliopectineal line and the Kohler line (< 40%); the cup abduction angle was(45 ± 5)degrees, and the anteversion angle was (10 ± 5)degrees. The other patients had no prosthesis loosening except 1 patient havingextensive acetabular prosthesis loosening because of acetabular osteolysis at 12 years after operation. The hip Harris scorewas significantly improved to 85.0 ± 7.5 at 1 year after operation (t = 14.34, P = 0.01). The acetabular grindingprocess to retain enough bone combined with a small cup of-biological prosthesis treating adult Crowe type IV DDH has theadvantages of satisfactory coverage and initial acetabular fixation, so good early and mid-term effectiveness can be obtained.

  7. Liver fibrosis score predicts mortality in heart failure patients with preserved ejection fraction.

    PubMed

    Yoshihisa, Akiomi; Sato, Yu; Yokokawa, Tetsuro; Sato, Takamasa; Suzuki, Satoshi; Oikawa, Masayoshi; Kobayashi, Atsushi; Yamaki, Takayoshi; Kunii, Hiroyuki; Nakazato, Kazuhiko; Saitoh, Shu-Ichi; Takeishi, Yasuchika

    2018-04-01

    Heart failure with preserved ejection fraction (HFpEF) has several pathophysiological aspects, including stiffness and/or congestion of multiple organs. Poor prognosis is expected in heart failure patients with liver stiffness, which has recently been assessed by non-alcoholic fatty liver disease fibrosis score (NFS; based on aspartate aminotransferase to alanine aminotransferase ratio, platelet counts, and albumin). We aimed to investigate the impact of NFS on prognosis of HFpEF patients, with consideration for the peripheral collagen markers such as procollagen type III peptide (PIIIP), type IV collagen 7S, and hyaluronic acid. We performed a prospective observational study. Consecutive 492 hospitalized HFpEF patients were divided into four groups based on their NFS: first-fourth quartiles (n = 123). The fourth quartile group had the highest levels of PIIIP, type IV collagen 7S, hyaluronic acid, and B-type natriuretic peptide (P<0.001 each). In addition, there were significant positive correlations between PIIIP, type IV collagen 7S, hyaluronic acid, B-type natriuretic peptide, and NFS (P < 0.001 each). In the follow-up period (mean 1107 days), 93 deaths occurred. All-cause mortality increased in all four quartiles (8.1%, 12.2%, 23.6%, and 31.7%, P < 0.001). In the multivariable Cox proportional hazard analysis, NFS was an independent predictor of all-cause mortality in the HFpEF patients. NFS, a novel indicator of liver fibrosis, correlates with circulating systemic markers of fibrosis and congestion and is associated with higher all-cause mortality in HFpEF patients. NFS can be calculated simply and may be a useful tool to assess liver stiffness and prognosis in HFpEF patients. © 2017 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of the European Society of Cardiology.

  8. Structural characterization of CFA/III and Longus type IVb pili from enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramaniapillai; Roos, Justin; Yuen, Alex S W; Pierce, Owen M; Craig, Lisa

    2012-05-01

    The type IV pili are helical filaments found on many Gram-negative pathogenic bacteria, with multiple diverse roles in pathogenesis, including microcolony formation, adhesion, and twitching motility. Many pathogenic enterotoxigenic Escherichia coli (ETEC) isolates express one of two type IV pili belonging to the type IVb subclass: CFA/III or Longus. Here we show a direct correlation between CFA/III expression and ETEC aggregation, suggesting that these pili, like the Vibrio cholerae toxin-coregulated pili (TCP), mediate microcolony formation. We report a 1.26-Å resolution crystal structure of CofA, the major pilin subunit from CFA/III. CofA is very similar in structure to V. cholerae TcpA but possesses a 10-amino-acid insertion that replaces part of the α2-helix with an irregular loop containing a 3(10)-helix. Homology modeling suggests a very similar structure for the Longus LngA pilin. A model for the CFA/III pilus filament was generated using the TCP electron microscopy reconstruction as a template. The unique 3(10)-helix insert fits perfectly within the gap between CofA globular domains. This insert, together with differences in surface-exposed residues, produces a filament that is smoother and more negatively charged than TCP. To explore the specificity of the type IV pilus assembly apparatus, CofA was expressed heterologously in V. cholerae by replacing the tcpA gene with that of cofA within the tcp operon. Although CofA was synthesized and processed by V. cholerae, no CFA/III filaments were detected, suggesting that the components of the type IVb pilus assembly system are highly specific to their pilin substrates.

  9. 10 CFR Appendix J to Part 50 - Primary Reactor Containment Leakage Testing for Water-Cooled Power Reactors

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... air test pressure and to assure they will be subjected to the post accident differential pressure... Table of Contents I. Introduction. II. Explanation of terms. III. Leakage test requirements. A. Type A test. B. Type B test. C. Type C test. D. Periodic retest schedule. IV. Special test requirements. A...

  10. 10 CFR Appendix J to Part 50 - Primary Reactor Containment Leakage Testing for Water-Cooled Power Reactors

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... air test pressure and to assure they will be subjected to the post accident differential pressure... Table of Contents I. Introduction. II. Explanation of terms. III. Leakage test requirements. A. Type A test. B. Type B test. C. Type C test. D. Periodic retest schedule. IV. Special test requirements. A...

  11. 10 CFR Appendix J to Part 50 - Primary Reactor Containment Leakage Testing for Water-Cooled Power Reactors

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... air test pressure and to assure they will be subjected to the post accident differential pressure... Table of Contents I. Introduction. II. Explanation of terms. III. Leakage test requirements. A. Type A test. B. Type B test. C. Type C test. D. Periodic retest schedule. IV. Special test requirements. A...

  12. 10 CFR Appendix J to Part 50 - Primary Reactor Containment Leakage Testing for Water-Cooled Power Reactors

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... air test pressure and to assure they will be subjected to the post accident differential pressure... Table of Contents I. Introduction. II. Explanation of terms. III. Leakage test requirements. A. Type A test. B. Type B test. C. Type C test. D. Periodic retest schedule. IV. Special test requirements. A...

  13. Osteogenesis Imperfecta

    PubMed Central

    Sam, Justin Easow; Dharmalingam, Mala

    2017-01-01

    Osteogenesis imperfecta is a common heritable connective tissue disorder. Nearly ninety percent are due to Type I collagen mutations. Type I-IV are autosomal dominant, and Type VI–XIII are autosomal recessive. They are Graded 1-5 based on severity. Genomic testing is done by collagen analysis from fibroblasts. The mainstay of treatment is bisphosphonate therapy. The prognosis is variable. PMID:29285457

  14. North Korea’s Choice of the Types of Provocation Against South Korea

    DTIC Science & Technology

    2013-12-01

    DISTRIBUTION CODE A 13. ABSTRACT (maximum 200 words) This research starts from the question of how North Korea decides upon the types of its provocations...INTENTIONALLY LEFT BLANK iv ABSTRACT This research starts from the question of how North Korea decides upon the types of its provocations...1 A. MAJOR RESEARCH QUESTION................................................................1 B

  15. Contribution of type IV pili to the virulence of Aeromonas salmonicida subsp. salmonicida in Atlantic salmon (Salmo salar L.).

    PubMed

    Boyd, Jessica M; Dacanay, Andrew; Knickle, Leah C; Touhami, Ahmed; Brown, Laura L; Jericho, Manfred H; Johnson, Stewart C; Reith, Michael

    2008-04-01

    Aeromonas salmonicida subsp. salmonicida, a bacterial pathogen of Atlantic salmon, has no visible pili, yet its genome contains genes for three type IV pilus systems. One system, Tap, is similar to the Pseudomonas aeruginosa Pil system, and a second, Flp, resembles the Actinobacillus actinomycetemcomitans Flp pilus, while the third has homology to the mannose-sensitive hemagglutinin pilus of Vibrio cholerae. The latter system is likely nonfunctional since eight genes, including the gene encoding the main pilin subunit, are deleted compared with the orthologous V. cholerae locus. The first two systems were characterized to investigate their expression and role in pathogenesis. The pili of A. salmonicida subsp. salmonicida were imaged using atomic force microscopy and Tap- and Flp-overexpressing strains. The Tap pili appeared to be polar, while the Flp pili appeared to be peritrichous. Strains deficient in tap and/or flp were used in live bacterial challenges of Atlantic salmon, which showed that the Tap pilus made a moderate contribution to virulence, while the Flp pilus made little or no contribution. Delivery of the tap mutant by immersion resulted in reduced cumulative morbidity compared with the cumulative morbidity observed with the wild-type strain; however, delivery by intraperitoneal injection resulted in cumulative morbidity similar to that of the wild type. Unlike the pili of other piliated bacterial pathogens, A. salmonicida subsp. salmonicida type IV pili are not absolutely required for virulence in Atlantic salmon. Significant differences in the behavior of the two mutant strains indicated that the two pilus systems are not redundant.

  16. Gene expression profile of collagen types, osteopontin in the tympanic membrane of patients with tympanosclerosis.

    PubMed

    Sakowicz-Burkiewicz, Monika; Kuczkowski, Jerzy; Przybyła, Tomasz; Grdeń, Marzena; Starzyńska, Anna; Pawełczyk, Tadeusz

    2017-09-01

    Tympanosclerosis is a pathological process involving the middle ear. The hallmark of this disease is the formation of calcium deposits. In the submucosal layer, as well as in the right layer of the tympanic membrane, the calcium deposits result in a significant increase in the activity of fibroblasts and deposition of collagen fibers. The aim of our study was to examine the expression level of genes encoding collagen type I, II, III and IV (COL1A1, COL2A1, COL3A1, COL4A1) and osteopontin (SPP1) in the tympanic membrane of patients with tympanosclerosis. The total RNA was isolated from middle ear tissues with tympanosclerosis, received from 25 patients and from 19 normal tympanic membranes. The gene expression level was determined by real-time RT-PCR. The gene expression levels were correlated with clinical Tos classification of tympanosclerosis. We observed that in the tympanic membrane of patients with tympanosclerosis, the expression of type I collagen is decreased, while the expression of type II and IV collagen and osteopontin is increased. Moreover, mRNA levels of the investigated genes strongly correlated with the clinical stages of tympanosclerosis. The strong correlations between the expression of type I, II, IV collagen and osteopontin and the clinical stage of tympanosclerosis indicate the involvement of these proteins in excessive fibrosis and pathological remodeling of the tympanic membrane. In the future, a treatment aiming to modulate these gene expressions and/or regulation of the degradation of their protein products could be used as a new medical approach for patients with tympanosclerosis.

  17. Type-III and IV interacting Weyl points

    NASA Astrophysics Data System (ADS)

    Nissinen, J.; Volovik, G. E.

    2017-04-01

    3+1-dimensional Weyl fermions in interacting systems are described by effective quasi-relativistic Green's functions parametrized by a 16-element matrix e α μ in an expansion around the Weyl point. The matrix e α μ can be naturally identified as an effective tetrad field for the fermions. The correspondence between the tetrad field and an effective quasi-relativistic metric gμν governing the Weyl fermions allows for the possibility to simulate different classes of metric fields emerging in general relativity in interacting Weyl semimetals. According to this correspondence, there can be four types of Weyl fermions, depending on the signs of the components g 00 and g 00 of the effective metric. In addition to the conventional type-I fermions with a tilted Weyl cone and type-II fermions with an overtilted Weyl cone for g 00 > 0 and, respectively, g 00 > 0 or g 00 < 0, we find additional "type-III" and "type-IV" Weyl fermions with instabilities (complex frequencies) for g 00 < 0 and g 00 > 0 or g 00 < 0, respectively. While the type-I and type-II Weyl points allow us to simulate the black hole event horizon at an interface where g 00 changes sign, the type-III Weyl point leads to effective spacetimes with closed timelike curves.

  18. AR-42 in Treating Patients With Advanced or Relapsed Multiple Myeloma, Chronic Lymphocytic Leukemia, or Lymphoma

    ClinicalTrials.gov

    2017-02-21

    Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Peripheral T-cell Lymphoma; Post-transplant Lymphoproliferative Disorder; Prolymphocytic Leukemia; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Grade III Lymphomatoid Granulomatosis; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Refractory Chronic Lymphocytic Leukemia; Refractory Multiple Myeloma; Stage III Adult Burkitt Lymphoma; Stage III Adult Diffuse Large Cell Lymphoma; Stage III Adult Diffuse Mixed Cell Lymphoma; Stage III Adult Diffuse Small Cleaved Cell Lymphoma; Stage III Adult Hodgkin Lymphoma; Stage III Adult Immunoblastic Large Cell Lymphoma; Stage III Adult Lymphoblastic Lymphoma; Stage III Adult T-cell Leukemia/Lymphoma; Stage III Chronic Lymphocytic Leukemia; Stage III Cutaneous T-cell Non-Hodgkin Lymphoma; Stage III Grade 1 Follicular Lymphoma; Stage III Grade 2 Follicular Lymphoma; Stage III Grade 3 Follicular Lymphoma; Stage III Mantle Cell Lymphoma; Stage III Marginal Zone Lymphoma; Stage III Multiple Myeloma; Stage III Mycosis Fungoides/Sezary Syndrome; Stage III Small Lymphocytic Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Chronic Lymphocytic Leukemia; Stage IV Cutaneous T-cell Non-Hodgkin Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IV Marginal Zone Lymphoma; Stage IV Mycosis Fungoides/Sezary Syndrome; Stage IV Small Lymphocytic Lymphoma; Testicular Lymphoma; Waldenstrom Macroglobulinemia

  19. Visualisation of Rouviere's Sulcus during Laparoscopic Cholecystectomy.

    PubMed

    Thapa, P B; Maharjan, D K; Tamang, T Y; Shrestha, S K

    2015-01-01

    Safe dissection of Calot's Triangle is important during the performance of laparascopic cholucystectomy. The purpose of the study is to determine the frequency of demonstrable Rouviere's sulcus in patients with symptomatic gall stones and its role in safe dissection in Calot's triangle. This is a prospective descriptive study design done in Department of surgery, Kathmandu Medical College Teaching Hospital from Jan 2013 to Jan 2015. Patients who were posted for laparoscopic cholecystectomy were included. During laparoscopy, Rouviere's sulcus was noted in the operative note and classified according to following: Type I: Open type was defined as a cleft in which the right hepatic pedicle was visualized and the sulcus was opened throughout its length. Type II: if the sulcus was open only at its lateral end. Type III If the sulcus was open only at its medial end. Type IV: Fused type was defined as one in which the pedicle was not visualized.  A total of 200 patients underwent laparoscopic cholecystectomy during period of 2 years. Out of which Rouviere's sulcus was visualized in 150 patients (75 %).Type I (open type) was commoner in 54%, type II in 12%, Type III in 9% and type IV (fused type) in 25%. Rouviere's Sulcus is an important extra biliary land mark for safe dissection of Calot's triangle during laparoscopic cholecystectomy.  Rouviere's Sulcus, Laparoscopic cholecystectomy, Bile duct injury.

  20. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

    PubMed

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

    2017-12-30

    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  1. Comparison of the susceptibility of porcine and human dipeptidyl-peptidase IV to inhibition by protein-derived peptides.

    PubMed

    Lacroix, Isabelle M E; Li-Chan, Eunice C Y

    2015-07-01

    The enzyme dipeptidyl-peptidase IV (DPP-IV) is recognized to be a promising target for the management of type 2 diabetes. Over the last decade, numerous synthetic molecules and more recently, peptides from dietary proteins, have been reported to be able to inhibit DPP-IV activity. Most studies that have investigated the in vitro effect of these inhibitors have used porcine or human DPP-IV. Although structurally alike, it is unclear whether these two species display similar inhibition patterns. Therefore, the objective of this study was to compare the effects of protein-derived peptides on the activity of porcine and recombinant human DPP-IV. The two species showed different inhibition susceptibility to 43 of the 62 peptide sequences investigated. While 37 protein-derived peptides were more effective at inhibiting the porcine DPP-IV, only six caused a stronger inhibition of the activity of the human enzyme. Although the peptides WR, IPIQY and WCKDDQNPHS were found to be among the most potent inhibitors of both species, the inhibitory effect was greater on the porcine enzyme than on human DPP-IV (αKi or Ki=11.5, 13.4, 13.3 μM and 31.4, 28.2, 75.0 μM for porcine and human DPP-IV, respectively). Investigation into the mode of action of the most effective inhibitory peptides revealed that both species were inhibited in a similar manner by short fragments (≤5 amino acid residues), but that some of the longer peptides acted differently on the enzymes. This study shows that porcine DPP-IV is generally inhibited with greater potency by protein-derived peptides than is the human enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Dissimilatory Fe(III) reduction by the marine microorganism Desulfuromonas acetoxidans

    USGS Publications Warehouse

    Roden, E.E.; Lovley, D.R.

    1993-01-01

    The ability of the marine microorganism Desulfuromonas acetoxidans to reduce Fe(III) was investigated because of its close phylogenetic relationship with the freshwater dissimilatory Fe(III) reducer Geobacter metallireducens. Washed cell suspensions of the type strain of D. acetoxidans reduced soluble Fe(III)-citrate and Fe(III) complexed with nitriloacetic acid. The c-type cytochrome(s) of D. acetoxidans was oxidized by Fe(III)- citrate and Mn(IV)-oxalate, as well as by two electron acceptors known to support growth, colloidal sulfur and malate. D. acetoxidans grew in defined anoxic, bicarbonate-buffered medium with acetate as the sole electron donor and poorly crystalline Fe(III) or Mn(IV) as the sole electron acceptor. Magnetite (Fe3O4) and siderite (FeCO3) were the major end products of Fe(III) reduction, whereas rhodochrosite (MnCO3) was the end product of Mn(IV) reduction. Ethanol, propanol, pyruvate, and butanol also served as electron donors for Fe(III) reduction. In contrast to D. acetoxidans, G. metallireducens could only grow in freshwater medium and it did not conserve energy to support growth from colloidal S0 reduction. D. acetoxidans is the first marine microorganism shown to conserve energy to support growth by coupling the complete oxidation of organic compounds to the reduction of Fe(III) or Mn(IV). Thus, D. acetoxidans provides a model enzymatic mechanism for Fe(III) or Mn(IV) oxidation of organic compounds in marine and estuarine sediments. These findings demonstrate that 16S rRNA phylogenetic analyses can suggest previously unrecognized metabolic capabilities of microorganisms.

  3. Mouse embryonic stem cells, but not somatic cells, predominantly use homologous recombination to repair double-strand DNA breaks.

    PubMed

    Tichy, Elisia D; Pillai, Resmi; Deng, Li; Liang, Li; Tischfield, Jay; Schwemberger, Sandy J; Babcock, George F; Stambrook, Peter J

    2010-11-01

    Embryonic stem (ES) cells give rise to all cell types of an organism. Since mutations at this embryonic stage would affect all cells and be detrimental to the overall health of an organism, robust mechanisms must exist to ensure that genomic integrity is maintained. To test this proposition, we compared the capacity of murine ES cells to repair DNA double-strand breaks with that of differentiated cells. Of the 2 major pathways that repair double-strand breaks, error-prone nonhomologous end joining (NHEJ) predominated in mouse embryonic fibroblasts, whereas the high fidelity homologous recombinational repair (HRR) predominated in ES cells. Microhomology-mediated end joining, an emerging repair pathway, persisted at low levels in all cell types examined. The levels of proteins involved in HRR and microhomology-mediated end joining were highly elevated in ES cells compared with mouse embryonic fibroblasts, whereas those for NHEJ were quite variable, with DNA Ligase IV expression low in ES cells. The half-life of DNA Ligase IV protein was also low in ES cells. Attempts to increase the abundance of DNA Ligase IV protein by overexpression or inhibition of its degradation, and thereby elevate NHEJ in ES cells, were unsuccessful. When ES cells were induced to differentiate, however, the level of DNA Ligase IV protein increased, as did the capacity to repair by NHEJ. The data suggest that preferential use of HRR rather than NHEJ may lend ES cells an additional layer of genomic protection and that the limited levels of DNA Ligase IV may account for the low level of NHEJ activity.

  4. Identification of Novel Human Dipeptidyl Peptidase-IV Inhibitors of Natural Origin (Part II): In Silico Prediction in Antidiabetic Extracts

    PubMed Central

    Guasch, Laura; Sala, Esther; Ojeda, María José; Valls, Cristina; Bladé, Cinta; Mulero, Miquel; Blay, Mayte; Ardévol, Anna; Garcia-Vallvé, Santiago; Pujadas, Gerard

    2012-01-01

    Background Natural extracts play an important role in traditional medicines for the treatment of diabetes mellitus and are also an essential resource for new drug discovery. Dipeptidyl peptidase IV (DPP-IV) inhibitors are potential candidates for the treatment of type 2 diabetes mellitus, and the effectiveness of certain antidiabetic extracts of natural origin could be, at least partially, explained by the inhibition of DPP-IV. Methodology/Principal Findings Using an initial set of 29,779 natural products that are annotated with their natural source and an experimentally validated virtual screening procedure previously developed in our lab (Guasch et al.; 2012) [1], we have predicted 12 potential DPP-IV inhibitors from 12 different plant extracts that are known to have antidiabetic activity. Seven of these molecules are identical or similar to molecules with described antidiabetic activity (although their role as DPP-IV inhibitors has not been suggested as an explanation for their bioactivity). Therefore, it is plausible that these 12 molecules could be responsible, at least in part, for the antidiabetic activity of these extracts through their inhibitory effect on DPP-IV. In addition, we also identified as potential DPP-IV inhibitors 6 molecules from 6 different plants with no described antidiabetic activity but that share the same genus as plants with known antidiabetic properties. Moreover, none of the 18 molecules that we predicted as DPP-IV inhibitors exhibits chemical similarity with a group of 2,342 known DPP-IV inhibitors. Conclusions/Significance Our study identified 18 potential DPP-IV inhibitors in 18 different plant extracts (12 of these plants have known antidiabetic properties, whereas, for the remaining 6, antidiabetic activity has been reported for other plant species from the same genus). Moreover, none of the 18 molecules exhibits chemical similarity with a large group of known DPP-IV inhibitors. PMID:23028712

  5. Crimp-Imbalanced Protective (CRIMP) Fabrics

    DTIC Science & Technology

    2010-03-31

    ILLUSTRATIONS ii LIST OF TABLES iv LIST OF ABBREVIATIONS, ACRONYMS, AND SYMBOLS iv INTRODUCTION 1 THREAT TYPES AND PROTECTION LEVELS 2 HISTORICAL...velocity 3-D Three-dimensional v (vi blank) CRIMP-IMBALANCED PROTECTIVE (CRIMP) FABRICS INTRODUCTION Lightweight, soft-armor systems have...1200 ft/sec D-4 (qi-uO /(B jaug UIBJJS 3i;sei3 (qi-uO 3* dSd ui uoipnpay > .’/ .7 • ’/ i •’/ !/ / *- IT> *- m y / II

  6. 40 CFR 60.53c - Operator training and qualification requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... following subjects: (i) Environmental concerns, including pathogen destruction and types of emissions; (ii) Basic combustion principles, including products of combustion; (iii) Operation of the type of incinerator to be used by the operator, including proper startup, waste charging, and shutdown procedures; (iv...

  7. 40 CFR 60.53c - Operator training and qualification requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... following subjects: (i) Environmental concerns, including pathogen destruction and types of emissions; (ii) Basic combustion principles, including products of combustion; (iii) Operation of the type of incinerator to be used by the operator, including proper startup, waste charging, and shutdown procedures; (iv...

  8. Gene expression profiling of mucolipidosis type IV fibroblasts reveals deregulation of genes with relevant functions in lysosome physiology.

    PubMed

    Bozzato, Andrea; Barlati, Sergio; Borsani, Giuseppe

    2008-04-01

    Mucolipidosis type IV (MLIV, MIM 252650) is an autosomal recessive lysosomal storage disorder that causes mental and motor retardation as well as visual impairment. The lysosomal storage defect in MLIV is consistent with abnormalities of membrane traffic and organelle dynamics in the late endocytic pathway. MLIV is caused by mutations in the MCOLN1 gene, which codes for mucolipin-1 (MLN1), a member of the large family of transient receptor potential (TRP) cation channels. Although a number of studies have been performed on mucolipin-1, the pathological mechanisms underlying MLIV are not fully understood. To identify genes that characterize pathogenic changes in mucolipidosis type IV, we compared the expression profiles of three MLIV and three normal skin fibroblasts cell lines using oligonucleotide microarrays. Genes that were differentially expressed in patients' cells were identified. 231 genes were up-regulated, and 116 down-regulated. Real-Time RT-PCR performed on selected genes in six independent MLIV fibroblasts cell lines was generally consistent with the microarray findings. This study allowed to evidence the modulation at the transcriptional level of a discrete number of genes relevant in biological processes which are altered in the disease such as endosome/lysosome trafficking, lysosome biogenesis, organelle acidification and lipid metabolism.

  9. Prevalence of ADHD in primary school children in Vinh Long, Vietnam.

    PubMed

    Pham, Hoai Danh; Nguyen, Huu Bao Han; Tran, Diep Tuan

    2015-10-01

    Attention-deficit hyperactivity disorder (ADHD) is the most common behavioral disorder in children. It affects not only the subjects but also their families and society. The purpose of this study was to determine the prevalence of ADHD in primary school children in South Vietnam, especially Vinh Long province. Children were chosen randomly from primary schools in Vinh Long from February to March in 2009 in a cross-sectional study to determine the prevalence of ADHD using the ADHD Rating Scale-IV for parents/caregivers and teachers. ADHD Rating Scale-IV was based on DSM-IV for diagnosis of ADHD. A total of 600 children were chosen and 1200 reports were collected from parents/caregivers and teachers. The prevalence rate of ADHD was 7.7%. The rates of the predominantly inattentive type, predominantly hyperactive type and combined type were 1.7%, 5% and 1%, respectively. The difference in sex was not significant across all subtypes. The prevalence of ADHD in urban children was 2.2-fold that in rural children. The prevalence of ADHD in primary school children in Vinh Long, southern Vietnam, is in the same range as other regions in the world. Therefore, awareness of ADHD needs to be raised, to ensure suitable psychiatric care for children. © 2015 Japan Pediatric Society.

  10. Distinct activities of Bartonella henselae type IV secretion effector proteins modulate capillary-like sprout formation.

    PubMed

    Scheidegger, F; Ellner, Y; Guye, P; Rhomberg, T A; Weber, H; Augustin, H G; Dehio, C

    2009-07-01

    The zoonotic pathogen Bartonella henselae (Bh) can lead to vasoproliferative tumour lesions in the skin and inner organs known as bacillary angiomatosis and bacillary peliosis. The knowledge on the molecular and cellular mechanisms involved in this pathogen-triggered angiogenic process is confined by the lack of a suitable animal model and a physiologically relevant cell culture model of angiogenesis. Here we employed a three-dimensional in vitro angiogenesis assay of collagen gel-embedded endothelial cell (EC) spheroids to study the angiogenic properties of Bh. Spheroids generated from Bh-infected ECs displayed a high capacity to form sprouts, which represent capillary-like projections into the collagen gel. The VirB/VirD4 type IV secretion system and a subset of its translocated Bartonella effector proteins (Beps) were found to profoundly modulate this Bh-induced sprouting activity. BepA, known to protect ECs from apoptosis, strongly promoted sprout formation. In contrast, BepG, triggering cytoskeletal rearrangements, potently inhibited sprouting. Hence, the here established in vitro model of Bartonella- induced angiogenesis revealed distinct and opposing activities of type IV secretion system effector proteins, which together with a VirB/VirD4-independent effect may control the angiogenic activity of Bh during chronic infection of the vasculature.

  11. ESCRT-Dependent Cell Death in a Caenorhabditis elegans Model of the Lysosomal Storage Disorder Mucolipidosis Type IV

    PubMed Central

    Huynh, Julie M.; Dang, Hope; Munoz-Tucker, Isabel A.; O’Ketch, Marvin; Liu, Ian T.; Perno, Savannah; Bhuyan, Natasha; Crain, Allison; Borbon, Ivan; Fares, Hanna

    2016-01-01

    Mutations in MCOLN1, which encodes the cation channel protein TRPML1, result in the neurodegenerative lysosomal storage disorder Mucolipidosis type IV. Mucolipidosis type IV patients show lysosomal dysfunction in many tissues and neuronal cell death. The ortholog of TRPML1 in Caenorhabditis elegans is CUP-5; loss of CUP-5 results in lysosomal dysfunction in many tissues and death of developing intestinal cells that results in embryonic lethality. We previously showed that a null mutation in the ATP-Binding Cassette transporter MRP-4 rescues the lysosomal defect and embryonic lethality of cup-5(null) worms. Here we show that reducing levels of the Endosomal Sorting Complex Required for Transport (ESCRT)-associated proteins DID-2, USP-50, and ALX-1/EGO-2, which mediate the final de-ubiquitination step of integral membrane proteins being sequestered into late endosomes, also almost fully suppresses cup-5(null) mutant lysosomal defects and embryonic lethality. Indeed, we show that MRP-4 protein is hypo-ubiquitinated in the absence of CUP-5 and that reducing levels of ESCRT-associated proteins suppresses this hypo-ubiquitination. Thus, increased ESCRT-associated de-ubiquitinating activity mediates the lysosomal defects and corresponding cell death phenotypes in the absence of CUP-5. PMID:26596346

  12. Fosaprepitant-induced phlebitis: a focus on patients receiving doxorubicin/cyclophosphamide therapy.

    PubMed

    Leal, A D; Kadakia, K C; Looker, S; Hilger, C; Sorgatz, K; Anderson, K; Jacobson, A; Grendahl, D; Seisler, D; Hobday, T; Loprinzi, Charles L

    2014-05-01

    The purpose of this study was to investigate the incidence of fosaprepitant-associated infusion site adverse events (ISAEs) among a cohort of breast cancer patients receiving doxorubicin/cyclophosphamide (AC) chemotherapy. A retrospective review of electronic medical record (EMR) data was performed for all patients who were initiated on AC from January 2011 to April 2012. Data collected included baseline demographics, antiemetic regimen, documentation of ISAEs, and type of intravenous (IV) access. Descriptive statistics (mean and standard deviation or percentages) were summarized overall, by type of IV access and initial antiemetic given. Among the 148 patients included in this analysis, 98 initially received fosaprepitant and 44 received aprepitant. The incidence of ISAEs associated with fosaprepitant administration was 34.7 % (n=34), while the incidence of aprepitant-associated ISAEs was 2.3 % (n=1). All ISAEs were associated with peripheral IV access. The most commonly reported ISAEs were infusion site pain (n=26), erythema (n=22), swelling (n=12), superficial thrombosis (n=8), infusion site hives (n=5), and phlebitis/thrombophlebitis (n=5). Twenty-six patients experienced more than one type of ISAE. The incidence and severity of ISAEs associated with fosaprepitant administration among a group of patients receiving AC chemotherapy are significant and appreciably higher than what has been previously reported.

  13. Fosaprepitant-induced Phlebitis: A Focus on Patients receiving Doxorubicin/Cyclophosphamide therapy

    PubMed Central

    Leal, A. D.; Kadakia, K. C.; Looker, S.; Hilger, C.; Sorgatz, K.; Anderson, K.; Jacobson, A.; Grendahl, D.; Seisler, D.; Hobday, T.; Loprinzi, C. L.

    2014-01-01

    Purpose The purpose of this study was to investigate the incidence of fosaprepitant-associated infusion site adverse events (ISAEs) among a cohort of breast cancer patients receiving doxorubicin/cyclophosphamide (AC) chemotherapy. Methods A retrospective review of electronic medical record (EMR) data was performed for all patients who were initiated on AC from January 2011 to April 2012. Data collected included baseline demographics, antiemetic regimen, documentation of ISAEs and type of intravenous (IV) access. Descriptive statistics (mean and standard deviation or percentages) were summarized overall, by type of IV access and initial antiemetic given. Results Among the 148 patients included in this analysis, 98 initially received fosaprepitant and 44 received aprepitant. The incidence of ISAEs associated with fosaprepitant administration was 34.7% (n=34), while the incidence of aprepitant-associated ISAEs was 2.3% (n=1). All ISAEs were associated with peripheral IV access. The most commonly reported ISAEs were: infusion site pain (n=26), erythema (n=22), swelling (n=12), superficial thrombosis (n=8), infusion site hives (n=5) and phlebitis/thrombophlebitis (n=5). Twenty-six patients experienced more than one type of ISAE. Conclusions The incidence and severity of ISAEs associated with fosaprepitant administration among a group of patients receiving AC chemotherapy is significant and appreciably higher than what has been previously reported. PMID:24402411

  14. Bacterial Translocation Ratchets: Shared Physical Principles with Different Molecular Implementations: How bacterial secretion systems bias Brownian motion for efficient translocation of macromolecules.

    PubMed

    Hepp, Christof; Maier, Berenike

    2017-10-01

    Secretion systems enable bacteria to import and secrete large macromolecules including DNA and proteins. While most components of these systems have been identified, the molecular mechanisms of macromolecular transport remain poorly understood. Recent findings suggest that various bacterial secretion systems make use of the translocation ratchet mechanism for transporting polymers across the cell envelope. Translocation ratchets are powered by chemical potential differences generated by concentration gradients of ions or molecules that are specific to the respective secretion systems. Bacteria employ these potential differences for biasing Brownian motion of the macromolecules within the conduits of the secretion systems. Candidates for this mechanism include DNA import by the type II secretion/type IV pilus system, DNA export by the type IV secretion system, and protein export by the type I secretion system. Here, we propose that these three secretion systems employ different molecular implementations of the translocation ratchet mechanism. © 2017 The Authors. BioEssays Published by WILEY Periodicals, Inc.

  15. Non-robbery-related occupational homicides in the retail industry, 2003-2008.

    PubMed

    Konda, Srinivas; Tiesman, Hope M; Hendricks, Scott; Gurka, Kelly K

    2014-02-01

    The purpose of this study was to examine non-robbery-related occupational homicides in the retail industry from 2003 to 2008. Data were abstracted from the Census of Fatal Occupational Injuries. Motive (robbery- or non-robbery-related) and workplace violence (WPV) typology (Type I-IV) were assigned using narrative text fields. Non-robbery-related homicide rates were calculated and compared among WPV types, demographic characteristics, and occupation. Twenty-eight percent of homicides that occurred in the retail industry were non-robbery-related. The leading event associated with non-robbery-related homicides was Type II (perpetrated by customers) (34%), followed by Type IV (perpetrated by personal relationship) (31%). The majority of homicides were due to arguments (50%). Security guards and workers in drinking establishments had the highest homicide rates per 100,000 workers (14.3 and 6.0, respectively). Non-robbery-related homicides comprised a meaningful proportion of workplace homicides in the retail industry. Research is needed to develop strategies to prevent non-robbery-related homicides specifically. © 2013 Wiley Periodicals, Inc.

  16. Non-Robbery-Related Occupational Homicides in the Retail Industry, 2003–2008

    PubMed Central

    Konda, Srinivas; Tiesman, Hope M.; Hendricks, Scott; Gurka, Kelly K.

    2015-01-01

    Background The purpose of this study was to examine non-robbery-related occupational homicides in the retail industry from 2003 to 2008. Methods Data were abstracted from the Census of Fatal Occupational Injuries. Motive (robbery- or non-robbery-related) and workplace violence (WPV) typology (Type I–IV) were assigned using narrative text fields. Non-robbery-related homicide rates were calculated and compared among WPV types, demographic characteristics, and occupation. Results Twenty-eight percent of homicides that occurred in the retail industry were non-robbery-related. The leading event associated with non-robbery-related homicides was Type II (perpetrated by customers) (34%), followed by Type IV (perpetrated by personal relationship) (31%). The majority of homicides were due to arguments (50%). Security guards and workers in drinking establishments had the highest homicide rates per 100,000 workers (14.3 and 6.0, respectively). Conclusions Non-robbery-related homicides comprised a meaningful proportion of workplace homicides in the retail industry. Research is needed to develop strategies Periodicals, Inc. PMID:24248892

  17. Scoliosis in osteogenesis imperfecta caused by COL1A1/COL1A2 mutations - genotype-phenotype correlations and effect of bisphosphonate treatment.

    PubMed

    Sato, Atsuko; Ouellet, Jean; Muneta, Takeshi; Glorieux, Francis H; Rauch, Frank

    2016-05-01

    Bisphosphonates are widely used to treat children with osteogenesis imperfecta (OI), a bone fragility disorder that is most often caused by mutations in COL1A1 or COL1A2. However, it is unclear whether this treatment decreases the risk of developing scoliosis. We retrospectively evaluated spine radiographs and charts of 437 patients (227 female) with OI caused by mutations in COL1A1 or COL1A2 and compared the relationship between scoliosis, genotype and bisphosphonate treatment history. At the last follow-up (mean age 11.9 [SD: 5.9] years), 242 (55%) patients had scoliosis. The prevalence of scoliosis was highest in OI type III (89%), followed by OI type IV (61%) and OI type I (36%). Moderate to severe scoliosis (Cobb angle ≥25°) was rare in individuals with COL1A1 haploinsufficiency mutations but was present in about two fifth of patients with triple helical glycine substitutions or C-propeptide mutations. During the first 2 to 4years of bisphosphonate therapy, patients with OI type III had lower Cobb angle progression rates than before bisphosphonate treatment, whereas in OI types I and IV bisphosphonate treatment was not associated with a change in Cobb angle progression rates. At skeletal maturity, the prevalence of scoliosis (Cobb angle >10°) was similar in patients who had started bisphosphonate treatment early in life (before 5.0years of age) and in patients who had started therapy later (after the age of 10.0years) or had never received bisphosphonate therapy. Bisphosphonate treatment decreased progression rate of scoliosis in OI type III but there was no evidence of a positive effect on scoliosis in OI types I and IV. The prevalence of scoliosis at maturity was not influenced by the bisphosphonate treatment history in any OI type. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Utilisation of the isobole methodology to study dietary peptide-drug and peptide-peptide interactive effects on dipeptidyl peptidase IV (DPP-IV) inhibition.

    PubMed

    Nongonierma, Alice B; FitzGerald, Richard J

    2015-01-01

    Inhibition of dipeptidyl peptidase-IV (DPP-IV) is used as a means to regulate post-prandial serum glucose in type 2 diabetics. The effect of drug (Sitagliptin®)/peptide and binary peptide mixtures on DPP-IV inhibition was studied using an isobole approach. Five peptides (Ile-Pro-Ile-Gln-Tyr, Trp-Lys, Trp-Pro, Trp-Arg and Trp-Leu), having DPP-IV half maximum inhibitory concentration values (IC₅₀)<60 μM and reported to act through different inhibition mechanisms, were investigated. The dose response relationship of Sitagliptin : peptide (1:0, 0:1, 1:852, 1:426 and 1:1704 on a molar basis) and binary Ile-Pro-Ile-Gln-Tyr : peptide (1:0, 0:1, 1:1, 1:2 and 2:1 on a molar basis) mixtures for DPP-IV inhibition was characterised. Isobolographic analysis showed, in most instances, an additive effect on DPP-IV inhibition. However, a synergistic effect was observed with two Sitagliptin:Ile-Pro-Ile-Gln-Tyr (1:426 and 1:852) mixtures and an antagonistic effect was seen with one Sitagliptin : Trp-Pro (1:852) mixture, and three binary peptide mixtures (Ile-Pro-Ile-Gln-Tyr : Trp-Lys (1:1 and 2:1) and Ile-Pro-Ile-Gln-Tyr:Trp-Leu (1:2)). The results show that Sitagliptin and food protein-derived peptides can interact, thereby enhancing overall DPP-IV inhibition. Combination of Sitagliptin with food protein-derived peptides may help in reducing drug dosage and possible associated side-effects.

  19. New lethal disease involving type I and III collagen defect resembling geroderma osteodysplastica, De Barsy syndrome, and Ehlers-Danlos syndrome IV.

    PubMed

    Jukkola, A; Kauppila, S; Risteli, L; Vuopala, K; Risteli, J; Leisti, J; Pajunen, L

    1998-06-01

    We describe the clinical findings and biochemical features of a male child suffering from a so far undescribed lethal connective tissue disorder characterised by extreme hypermobility of the joints, lax skin, cataracts, severe growth retardation, and insufficient production of type I and type III procollagens. His features are compared with Ehlers-Danlos type IV, De Barsy syndrome, and geroderma osteodysplastica, as these disorders show some symptoms and signs shared with our patient. The child died because of failure of the connective tissue structures joining the skull and the spine, leading to progressive spinal stenosis. The aortic valve was translucent and insufficient. The clinical symptoms and signs, together with histological findings, suggested a collagen defect. Studies on both skin fibroblast cultures and the patient's serum showed reduced synthesis of collagen types I and III at the protein and RNA levels. The sizes of the mRNAs and newly synthesised proteins were normal, excluding gross structural abnormalities. These findings are not in accordance with any other collagen defect characterised so far.

  20. Proteinases secreted by Fasciola hepatica degrade extracellular matrix and basement membrane components.

    PubMed

    Berasaín, P; Goñi, F; McGonigle, S; Dowd, A; Dalton, J P; Frangione, B; Carmona, C

    1997-02-01

    The invasive stages of the parasitic trematode Fasciola hepatica release proteinases into the medium in which they are maintained. In this study, we investigated the interaction of F. hepatica excretory/secretory (E/S) products and 2 cysteine proteinases (CL1 and CL2) purified from these products with extracellular matrix and basement membrane macromolecules. Fasciola hepatica E/S products contained collagenolytic activity on fibrillar types I and III collagen as well as basement membrane type IV collagen. CL1 and CL2 were capable of degrading acid-soluble type III and type IV collagen but not insoluble type I collagen. In contrast, neither the E/S products nor the purified CL1 and CL2 showed elastinolytic activity. Fibronectin and laminin were degraded by E/S products and by CL1 and CL2. Sequence analysis of fibronectin degradation products showed that the fragments obtained corresponded to complete biologically active domains. These results indicate that the cysteine proteinases secreted by F. hepatica may be involved in the process of tissue invasion by the parasite.

Top